Validating Pseudo-dynamic Source Models against Observed Ground Motion Data at the SCEC Broadband Platform, Ver 16.5

NASA Astrophysics Data System (ADS)

Song, S. G.

2016-12-01

Simulation-based ground motion prediction approaches have several benefits over empirical ground motion prediction equations (GMPEs). For instance, full 3-component waveforms can be produced and site-specific hazard analysis is also possible. However, it is important to validate them against observed ground motion data to confirm their efficiency and validity before practical uses. There have been community efforts for these purposes, which are supported by the Broadband Platform (BBP) project at the Southern California Earthquake Center (SCEC). In the simulation-based ground motion prediction approaches, it is a critical element to prepare a possible range of scenario rupture models. I developed a pseudo-dynamic source model for Mw 6.5-7.0 by analyzing a number of dynamic rupture models, based on 1-point and 2-point statistics of earthquake source parameters (Song et al. 2014; Song 2016). In this study, the developed pseudo-dynamic source models were tested against observed ground motion data at the SCEC BBP, Ver 16.5. The validation was performed at two stages. At the first stage, simulated ground motions were validated against observed ground motion data for past events such as the 1992 Landers and 1994 Northridge, California, earthquakes. At the second stage, they were validated against the latest version of empirical GMPEs, i.e., NGA-West2. The validation results show that the simulated ground motions produce ground motion intensities compatible with observed ground motion data at both stages. The compatibility of the pseudo-dynamic source models with the omega-square spectral decay and the standard deviation of the simulated ground motion intensities are also discussed in the study

Comparison of lung tumor motion measured using a model-based 4DCT technique and a commercial protocol.

PubMed

O'Connell, Dylan; Shaverdian, Narek; Kishan, Amar U; Thomas, David H; Dou, Tai H; Lewis, John H; Lamb, James M; Cao, Minsong; Tenn, Stephen; Percy, Lee P; Low, Daniel A

To compare lung tumor motion measured with a model-based technique to commercial 4-dimensional computed tomography (4DCT) scans and describe a workflow for using model-based 4DCT as a clinical simulation protocol. Twenty patients were imaged using a model-based technique and commercial 4DCT. Tumor motion was measured on each commercial 4DCT dataset and was calculated on model-based datasets for 3 breathing amplitude percentile intervals: 5th to 85th, 5th to 95th, and 0th to 100th. Internal target volumes (ITVs) were defined on the 4DCT and 5th to 85th interval datasets and compared using Dice similarity. Images were evaluated for noise and rated by 2 radiation oncologists for artifacts. Mean differences in tumor motion magnitude between commercial and model-based images were 0.47 ± 3.0, 1.63 ± 3.17, and 5.16 ± 4.90 mm for the 5th to 85th, 5th to 95th, and 0th to 100th amplitude intervals, respectively. Dice coefficients between ITVs defined on commercial and 5th to 85th model-based images had a mean value of 0.77 ± 0.09. Single standard deviation image noise was 11.6 ± 9.6 HU in the liver and 6.8 ± 4.7 HU in the aorta for the model-based images compared with 57.7 ± 30 and 33.7 ± 15.4 for commercial 4DCT. Mean model error within the ITV regions was 1.71 ± 0.81 mm. Model-based images exhibited reduced presence of artifacts at the tumor compared with commercial images. Tumor motion measured with the model-based technique using the 5th to 85th percentile breathing amplitude interval corresponded more closely to commercial 4DCT than the 5th to 95th or 0th to 100th intervals, which showed greater motion on average. The model-based technique tended to display increased tumor motion when breathing amplitude intervals wider than 5th to 85th were used because of the influence of unusually deep inhalations. These results suggest that care must be taken in selecting the appropriate interval during image generation when using model-based 4DCT methods. Copyright © 2017 American Society for Radiation Oncology. Published by Elsevier Inc. All rights reserved.

Human motion analysis with detection of subpart deformations

NASA Astrophysics Data System (ADS)

Wang, Juhui; Lorette, Guy; Bouthemy, Patrick

1992-06-01

One essential constraint used in 3-D motion estimation from optical projections is the rigidity assumption. Because of muscle deformations in human motion, this rigidity requirement is often violated for some regions on the human body. Global methods usually fail to bring stable solutions. This paper presents a model-based approach to combating the effect of muscle deformations in human motion analysis. The approach developed is based on two main stages. In the first stage, the human body is partitioned into different areas, where each area is consistent with a general motion model (not necessarily corresponding to a physical existing motion pattern). In the second stage, the regions are eliminated under the hypothesis that they are not induced by a specific human motion pattern. Each hypothesis is generated by making use of specific knowledge about human motion. A global method is used to estimate the 3-D motion parameters in basis of valid segments. Experiments based on a cycling motion sequence are presented.

Motion Recognition and Modifying Motion Generation for Imitation Robot Based on Motion Knowledge Formation

NASA Astrophysics Data System (ADS)

Okuzawa, Yuki; Kato, Shohei; Kanoh, Masayoshi; Itoh, Hidenori

A knowledge-based approach to imitation learning of motion generation for humanoid robots and an imitative motion generation system based on motion knowledge learning and modification are described. The system has three parts: recognizing, learning, and modifying parts. The first part recognizes an instructed motion distinguishing it from the motion knowledge database by the continuous hidden markov model. When the motion is recognized as being unfamiliar, the second part learns it using locally weighted regression and acquires a knowledge of the motion. When a robot recognizes the instructed motion as familiar or judges that its acquired knowledge is applicable to the motion generation, the third part imitates the instructed motion by modifying a learned motion. This paper reports some performance results: the motion imitation of several radio gymnastics motions.

Scene-based nonuniformity correction and enhancement: pixel statistics and subpixel motion.

PubMed

Zhao, Wenyi; Zhang, Chao

2008-07-01

We propose a framework for scene-based nonuniformity correction (NUC) and nonuniformity correction and enhancement (NUCE) that is required for focal-plane array-like sensors to obtain clean and enhanced-quality images. The core of the proposed framework is a novel registration-based nonuniformity correction super-resolution (NUCSR) method that is bootstrapped by statistical scene-based NUC methods. Based on a comprehensive imaging model and an accurate parametric motion estimation, we are able to remove severe/structured nonuniformity and in the presence of subpixel motion to simultaneously improve image resolution. One important feature of our NUCSR method is the adoption of a parametric motion model that allows us to (1) handle many practical scenarios where parametric motions are present and (2) carry out perfect super-resolution in principle by exploring available subpixel motions. Experiments with real data demonstrate the efficiency of the proposed NUCE framework and the effectiveness of the NUCSR method.

Automatic human body modeling for vision-based motion capture system using B-spline parameterization of the silhouette

NASA Astrophysics Data System (ADS)

Jaume-i-Capó, Antoni; Varona, Javier; González-Hidalgo, Manuel; Mas, Ramon; Perales, Francisco J.

2012-02-01

Human motion capture has a wide variety of applications, and in vision-based motion capture systems a major issue is the human body model and its initialization. We present a computer vision algorithm for building a human body model skeleton in an automatic way. The algorithm is based on the analysis of the human shape. We decompose the body into its main parts by computing the curvature of a B-spline parameterization of the human contour. This algorithm has been applied in a context where the user is standing in front of a camera stereo pair. The process is completed after the user assumes a predefined initial posture so as to identify the main joints and construct the human model. Using this model, the initialization problem of a vision-based markerless motion capture system of the human body is solved.

Fourier functional analysis for unsteady aerodynamic modeling

NASA Technical Reports Server (NTRS)

Lan, C. Edward; Chin, Suei

1991-01-01

A method based on Fourier analysis is developed to analyze the force and moment data obtained in large amplitude forced oscillation tests at high angles of attack. The aerodynamic models for normal force, lift, drag, and pitching moment coefficients are built up from a set of aerodynamic responses to harmonic motions at different frequencies. Based on the aerodynamic models of harmonic data, the indicial responses are formed. The final expressions for the models involve time integrals of the indicial type advocated by Tobak and Schiff. Results from linear two- and three-dimensional unsteady aerodynamic theories as well as test data for a 70-degree delta wing are used to verify the models. It is shown that the present modeling method is accurate in producing the aerodynamic responses to harmonic motions and the ramp type motions. The model also produces correct trend for a 70-degree delta wing in harmonic motion with different mean angles-of-attack. However, the current model cannot be used to extrapolate data to higher angles-of-attack than that of the harmonic motions which form the aerodynamic model. For linear ramp motions, a special method is used to calculate the corresponding frequency and phase angle at a given time. The calculated results from modeling show a higher lift peak for linear ramp motion than for harmonic ramp motion. The current model also shows reasonably good results for the lift responses at different angles of attack.

Survey of Motion Tracking Methods Based on Inertial Sensors: A Focus on Upper Limb Human Motion

PubMed Central

Filippeschi, Alessandro; Schmitz, Norbert; Miezal, Markus; Bleser, Gabriele; Ruffaldi, Emanuele; Stricker, Didier

2017-01-01

Motion tracking based on commercial inertial measurements units (IMUs) has been widely studied in the latter years as it is a cost-effective enabling technology for those applications in which motion tracking based on optical technologies is unsuitable. This measurement method has a high impact in human performance assessment and human-robot interaction. IMU motion tracking systems are indeed self-contained and wearable, allowing for long-lasting tracking of the user motion in situated environments. After a survey on IMU-based human tracking, five techniques for motion reconstruction were selected and compared to reconstruct a human arm motion. IMU based estimation was matched against motion tracking based on the Vicon marker-based motion tracking system considered as ground truth. Results show that all but one of the selected models perform similarly (about 35 mm average position estimation error). PMID:28587178

Head Motion Modeling for Human Behavior Analysis in Dyadic Interaction

PubMed Central

Xiao, Bo; Georgiou, Panayiotis; Baucom, Brian; Narayanan, Shrikanth S.

2015-01-01

This paper presents a computational study of head motion in human interaction, notably of its role in conveying interlocutors’ behavioral characteristics. Head motion is physically complex and carries rich information; current modeling approaches based on visual signals, however, are still limited in their ability to adequately capture these important properties. Guided by the methodology of kinesics, we propose a data driven approach to identify typical head motion patterns. The approach follows the steps of first segmenting motion events, then parametrically representing the motion by linear predictive features, and finally generalizing the motion types using Gaussian mixture models. The proposed approach is experimentally validated using video recordings of communication sessions from real couples involved in a couples therapy study. In particular we use the head motion model to classify binarized expert judgments of the interactants’ specific behavioral characteristics where entrainment in head motion is hypothesized to play a role: Acceptance, Blame, Positive, and Negative behavior. We achieve accuracies in the range of 60% to 70% for the various experimental settings and conditions. In addition, we describe a measure of motion similarity between the interaction partners based on the proposed model. We show that the relative change of head motion similarity during the interaction significantly correlates with the expert judgments of the interactants’ behavioral characteristics. These findings demonstrate the effectiveness of the proposed head motion model, and underscore the promise of analyzing human behavioral characteristics through signal processing methods. PMID:26557047

On a PCA-based lung motion model

PubMed Central

Li, Ruijiang; Lewis, John H; Jia, Xun; Zhao, Tianyu; Liu, Weifeng; Wuenschel, Sara; Lamb, James; Yang, Deshan; Low, Daniel A; Jiang, Steve B

2014-01-01

Respiration-induced organ motion is one of the major uncertainties in lung cancer radiotherapy and is crucial to be able to accurately model the lung motion. Most work so far has focused on the study of the motion of a single point (usually the tumor center of mass), and much less work has been done to model the motion of the entire lung. Inspired by the work of Zhang et al (2007 Med. Phys. 34 4772–81), we believe that the spatiotemporal relationship of the entire lung motion can be accurately modeled based on principle component analysis (PCA) and then a sparse subset of the entire lung, such as an implanted marker, can be used to drive the motion of the entire lung (including the tumor). The goal of this work is twofold. First, we aim to understand the underlying reason why PCA is effective for modeling lung motion and find the optimal number of PCA coefficients for accurate lung motion modeling. We attempt to address the above important problems both in a theoretical framework and in the context of real clinical data. Second, we propose a new method to derive the entire lung motion using a single internal marker based on the PCA model. The main results of this work are as follows. We derived an important property which reveals the implicit regularization imposed by the PCA model. We then studied the model using two mathematical respiratory phantoms and 11 clinical 4DCT scans for eight lung cancer patients. For the mathematical phantoms with cosine and an even power (2n) of cosine motion, we proved that 2 and 2n PCA coefficients and eigenvectors will completely represent the lung motion, respectively. Moreover, for the cosine phantom, we derived the equivalence conditions for the PCA motion model and the physiological 5D lung motion model (Low et al 2005 Int. J. Radiat. Oncol. Biol. Phys. 63 921–9). For the clinical 4DCT data, we demonstrated the modeling power and generalization performance of the PCA model. The average 3D modeling error using PCA was within 1 mm (0.7 ± 0.1 mm). When a single artificial internal marker was used to derive the lung motion, the average 3D error was found to be within 2 mm (1.8 ± 0.3 mm) through comprehensive statistical analysis. The optimal number of PCA coefficients needs to be determined on a patient-by-patient basis and two PCA coefficients seem to be sufficient for accurate modeling of the lung motion for most patients. In conclusion, we have presented thorough theoretical analysis and clinical validation of the PCA lung motion model. The feasibility of deriving the entire lung motion using a single marker has also been demonstrated on clinical data using a simulation approach. PMID:21865624

Modeling repetitive motions using structured light.

PubMed

Xu, Yi; Aliaga, Daniel G

2010-01-01

Obtaining models of dynamic 3D objects is an important part of content generation for computer graphics. Numerous methods have been extended from static scenarios to model dynamic scenes. If the states or poses of the dynamic object repeat often during a sequence (but not necessarily periodically), we call such a repetitive motion. There are many objects, such as toys, machines, and humans, undergoing repetitive motions. Our key observation is that when a motion-state repeats, we can sample the scene under the same motion state again but using a different set of parameters; thus, providing more information of each motion state. This enables robustly acquiring dense 3D information difficult for objects with repetitive motions using only simple hardware. After the motion sequence, we group temporally disjoint observations of the same motion state together and produce a smooth space-time reconstruction of the scene. Effectively, the dynamic scene modeling problem is converted to a series of static scene reconstructions, which are easier to tackle. The varying sampling parameters can be, for example, structured-light patterns, illumination directions, and viewpoints resulting in different modeling techniques. Based on this observation, we present an image-based motion-state framework and demonstrate our paradigm using either a synchronized or an unsynchronized structured-light acquisition method.

WE-G-207-06: 3D Fluoroscopic Image Generation From Patient-Specific 4DCBCT-Based Motion Models Derived From Physical Phantom and Clinical Patient Images

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dhou, S; Cai, W; Hurwitz, M

2015-06-15

Purpose: Respiratory-correlated cone-beam CT (4DCBCT) images acquired immediately prior to treatment have the potential to represent patient motion patterns and anatomy during treatment, including both intra- and inter-fractional changes. We develop a method to generate patient-specific motion models based on 4DCBCT images acquired with existing clinical equipment and used to generate time varying volumetric images (3D fluoroscopic images) representing motion during treatment delivery. Methods: Motion models are derived by deformably registering each 4DCBCT phase to a reference phase, and performing principal component analysis (PCA) on the resulting displacement vector fields. 3D fluoroscopic images are estimated by optimizing the resulting PCAmore » coefficients iteratively through comparison of the cone-beam projections simulating kV treatment imaging and digitally reconstructed radiographs generated from the motion model. Patient and physical phantom datasets are used to evaluate the method in terms of tumor localization error compared to manually defined ground truth positions. Results: 4DCBCT-based motion models were derived and used to generate 3D fluoroscopic images at treatment time. For the patient datasets, the average tumor localization error and the 95th percentile were 1.57 and 3.13 respectively in subsets of four patient datasets. For the physical phantom datasets, the average tumor localization error and the 95th percentile were 1.14 and 2.78 respectively in two datasets. 4DCBCT motion models are shown to perform well in the context of generating 3D fluoroscopic images due to their ability to reproduce anatomical changes at treatment time. Conclusion: This study showed the feasibility of deriving 4DCBCT-based motion models and using them to generate 3D fluoroscopic images at treatment time in real clinical settings. 4DCBCT-based motion models were found to account for the 3D non-rigid motion of the patient anatomy during treatment and have the potential to localize tumor and other patient anatomical structures at treatment time even when inter-fractional changes occur. This project was supported, in part, through a Master Research Agreement with Varian Medical Systems, Inc., Palo Alto, CA. The project was also supported, in part, by Award Number R21CA156068 from the National Cancer Institute.« less

Multiscale turbulence models based on convected fluid microstructure

NASA Astrophysics Data System (ADS)

Holm, Darryl D.; Tronci, Cesare

2012-11-01

The Euler-Poincaré approach to complex fluids is used to derive multiscale equations for computationally modeling Euler flows as a basis for modeling turbulence. The model is based on a kinematic sweeping ansatz (KSA) which assumes that the mean fluid flow serves as a Lagrangian frame of motion for the fluctuation dynamics. Thus, we regard the motion of a fluid parcel on the computationally resolvable length scales as a moving Lagrange coordinate for the fluctuating (zero-mean) motion of fluid parcels at the unresolved scales. Even in the simplest two-scale version on which we concentrate here, the contributions of the fluctuating motion under the KSA to the mean motion yields a system of equations that extends known results and appears to be suitable for modeling nonlinear backscatter (energy transfer from smaller to larger scales) in turbulence using multiscale methods.

Statistical prediction of space motion sickness

NASA Technical Reports Server (NTRS)

Reschke, Millard F.

1990-01-01

Studies designed to empirically examine the etiology of motion sickness to develop a foundation for enhancing its prediction are discussed. Topics addressed include early attempts to predict space motion sickness, multiple test data base that uses provocative and vestibular function tests, and data base subjects; reliability of provocative tests of motion sickness susceptibility; prediction of space motion sickness using linear discriminate analysis; and prediction of space motion sickness susceptibility using the logistic model.

Whole-Motion Model of Perception during Forward- and Backward-Facing Centrifuge Runs

PubMed Central

Holly, Jan E.; Vrublevskis, Arturs; Carlson, Lindsay E.

2009-01-01

Illusory perceptions of motion and orientation arise during human centrifuge runs without vision. Asymmetries have been found between acceleration and deceleration, and between forward-facing and backward-facing runs. Perceived roll tilt has been studied extensively during upright fixed-carriage centrifuge runs, and other components have been studied to a lesser extent. Certain, but not all, perceptual asymmetries in acceleration-vs-deceleration and forward-vs-backward motion can be explained by existing analyses. The immediate acceleration-deceleration roll-tilt asymmetry can be explained by the three-dimensional physics of the external stimulus; in addition, longer-term data has been modeled in a standard way using physiological time constants. However, the standard modeling approach is shown in the present research to predict forward-vs-backward-facing symmetry in perceived roll tilt, contradicting experimental data, and to predict perceived sideways motion, rather than forward or backward motion, around a curve. The present work develops a different whole-motion-based model taking into account the three-dimensional form of perceived motion and orientation. This model predicts perceived forward or backward motion around a curve, and predicts additional asymmetries such as the forward-backward difference in roll tilt. This model is based upon many of the same principles as the standard model, but includes an additional concept of familiarity of motions as a whole. PMID:19208962

Representation of Reserves Through a Brownian Motion Model

NASA Astrophysics Data System (ADS)

Andrade, M.; Ferreira, M. A. M.; Filipe, J. A.

2012-11-01

The Brownian Motion is commonly used as an approximation for some Random Walks and also for the Classic Risk Process. As the Random Walks and the Classic Risk Process are used frequently as stochastic models to represent reserves, it is natural to consider the Brownian Motion with the same purpose. In this study a model, based on the Brownian Motion, is presented to represent reserves. The Brownian Motion is used in this study to estimate the ruin probability of a fund. This kind of models is considered often in the study of pensions funds.

Stochastic Earthquake Rupture Modeling Using Nonparametric Co-Regionalization

NASA Astrophysics Data System (ADS)

Lee, Kyungbook; Song, Seok Goo

2017-09-01

Accurate predictions of the intensity and variability of ground motions are essential in simulation-based seismic hazard assessment. Advanced simulation-based ground motion prediction methods have been proposed to complement the empirical approach, which suffers from the lack of observed ground motion data, especially in the near-source region for large events. It is important to quantify the variability of the earthquake rupture process for future events and to produce a number of rupture scenario models to capture the variability in simulation-based ground motion predictions. In this study, we improved the previously developed stochastic earthquake rupture modeling method by applying the nonparametric co-regionalization, which was proposed in geostatistics, to the correlation models estimated from dynamically derived earthquake rupture models. The nonparametric approach adopted in this study is computationally efficient and, therefore, enables us to simulate numerous rupture scenarios, including large events ( M > 7.0). It also gives us an opportunity to check the shape of true input correlation models in stochastic modeling after being deformed for permissibility. We expect that this type of modeling will improve our ability to simulate a wide range of rupture scenario models and thereby predict ground motions and perform seismic hazard assessment more accurately.

Scene-aware joint global and local homographic video coding

NASA Astrophysics Data System (ADS)

Peng, Xiulian; Xu, Jizheng; Sullivan, Gary J.

2016-09-01

Perspective motion is commonly represented in video content that is captured and compressed for various applications including cloud gaming, vehicle and aerial monitoring, etc. Existing approaches based on an eight-parameter homography motion model cannot deal with this efficiently, either due to low prediction accuracy or excessive bit rate overhead. In this paper, we consider the camera motion model and scene structure in such video content and propose a joint global and local homography motion coding approach for video with perspective motion. The camera motion is estimated by a computer vision approach, and camera intrinsic and extrinsic parameters are globally coded at the frame level. The scene is modeled as piece-wise planes, and three plane parameters are coded at the block level. Fast gradient-based approaches are employed to search for the plane parameters for each block region. In this way, improved prediction accuracy and low bit costs are achieved. Experimental results based on the HEVC test model show that up to 9.1% bit rate savings can be achieved (with equal PSNR quality) on test video content with perspective motion. Test sequences for the example applications showed a bit rate savings ranging from 3.7 to 9.1%.

Ground motion simulation for the 23 August 2011, Mineral, Virginia earthquake using physics-based and stochastic broadband methods

USGS Publications Warehouse

Sun, Xiaodan; Hartzell, Stephen; Rezaeian, Sanaz

2015-01-01

Three broadband simulation methods are used to generate synthetic ground motions for the 2011 Mineral, Virginia, earthquake and compare with observed motions. The methods include a physics‐based model by Hartzell et al. (1999, 2005), a stochastic source‐based model by Boore (2009), and a stochastic site‐based model by Rezaeian and Der Kiureghian (2010, 2012). The ground‐motion dataset consists of 40 stations within 600 km of the epicenter. Several metrics are used to validate the simulations: (1) overall bias of response spectra and Fourier spectra (from 0.1 to 10 Hz); (2) spatial distribution of residuals for GMRotI50 peak ground acceleration (PGA), peak ground velocity, and pseudospectral acceleration (PSA) at various periods; (3) comparison with ground‐motion prediction equations (GMPEs) for the eastern United States. Our results show that (1) the physics‐based model provides satisfactory overall bias from 0.1 to 10 Hz and produces more realistic synthetic waveforms; (2) the stochastic site‐based model also yields more realistic synthetic waveforms and performs superiorly for frequencies greater than about 1 Hz; (3) the stochastic source‐based model has larger bias at lower frequencies (<0.5  Hz) and cannot reproduce the varying frequency content in the time domain. The spatial distribution of GMRotI50 residuals shows that there is no obvious pattern with distance in the simulation bias, but there is some azimuthal variability. The comparison between synthetics and GMPEs shows similar fall‐off with distance for all three models, comparable PGA and PSA amplitudes for the physics‐based and stochastic site‐based models, and systematic lower amplitudes for the stochastic source‐based model at lower frequencies (<0.5  Hz).

Computational Motion Phantoms and Statistical Models of Respiratory Motion

NASA Astrophysics Data System (ADS)

Ehrhardt, Jan; Klinder, Tobias; Lorenz, Cristian

Breathing motion is not a robust and 100 % reproducible process, and inter- and intra-fractional motion variations form an important problem in radiotherapy of the thorax and upper abdomen. A widespread consensus nowadays exists that it would be useful to use prior knowledge about respiratory organ motion and its variability to improve radiotherapy planning and treatment delivery. This chapter discusses two different approaches to model the variability of respiratory motion. In the first part, we review computational motion phantoms, i.e. computerized anatomical and physiological models. Computational phantoms are excellent tools to simulate and investigate the effects of organ motion in radiation therapy and to gain insight into methods for motion management. The second part of this chapter discusses statistical modeling techniques to describe the breathing motion and its variability in a population of 4D images. Population-based models can be generated from repeatedly acquired 4D images of the same patient (intra-patient models) and from 4D images of different patients (inter-patient models). The generation of those models is explained and possible applications of those models for motion prediction in radiotherapy are exemplified. Computational models of respiratory motion and motion variability have numerous applications in radiation therapy, e.g. to understand motion effects in simulation studies, to develop and evaluate treatment strategies or to introduce prior knowledge into the patient-specific treatment planning.

Dynamic motion planning of 3D human locomotion using gradient-based optimization.

PubMed

Kim, Hyung Joo; Wang, Qian; Rahmatalla, Salam; Swan, Colby C; Arora, Jasbir S; Abdel-Malek, Karim; Assouline, Jose G

2008-06-01

Since humans can walk with an infinite variety of postures and limb movements, there is no unique solution to the modeling problem to predict human gait motions. Accordingly, we test herein the hypothesis that the redundancy of human walking mechanisms makes solving for human joint profiles and force time histories an indeterminate problem best solved by inverse dynamics and optimization methods. A new optimization-based human-modeling framework is thus described for predicting three-dimensional human gait motions on level and inclined planes. The basic unknowns in the framework are the joint motion time histories of a 25-degree-of-freedom human model and its six global degrees of freedom. The joint motion histories are calculated by minimizing an objective function such as deviation of the trunk from upright posture that relates to the human model's performance. A variety of important constraints are imposed on the optimization problem, including (1) satisfaction of dynamic equilibrium equations by requiring the model's zero moment point (ZMP) to lie within the instantaneous geometrical base of support, (2) foot collision avoidance, (3) limits on ground-foot friction, and (4) vanishing yawing moment. Analytical forms of objective and constraint functions are presented and discussed for the proposed human-modeling framework in which the resulting optimization problems are solved using gradient-based mathematical programming techniques. When the framework is applied to the modeling of bipedal locomotion on level and inclined planes, acyclic human walking motions that are smooth and realistic as opposed to less natural robotic motions are obtained. The aspects of the modeling framework requiring further investigation and refinement, as well as potential applications of the framework in biomechanics, are discussed.

Comparison between collective coordinate models for domain wall motion in PMA nanostrips in the presence of the Dzyaloshinskii-Moriya interaction

NASA Astrophysics Data System (ADS)

Vandermeulen, J.; Nasseri, S. A.; Van de Wiele, B.; Durin, G.; Van Waeyenberge, B.; Dupré, L.

2018-03-01

Lagrangian-based collective coordinate models for magnetic domain wall (DW) motion rely on an ansatz for the DW profile and a Lagrangian approach to describe the DW motion in terms of a set of time-dependent collective coordinates: the DW position, the DW magnetization angle, the DW width and the DW tilting angle. Another approach was recently used to derive similar equations of motion by averaging the Landau-Lifshitz-Gilbert equation without any ansatz, and identifying the relevant collective coordinates afterwards. In this paper, we use an updated version of the semi-analytical equations to compare the Lagrangian-based collective coordinate models with micromagnetic simulations for field- and STT-driven (spin-transfer torque-driven) DW motion in Pt/CoFe/MgO and Pt/Co/AlOx nanostrips. Through this comparison, we assess the accuracy of the different models, and provide insight into the deviations of the models from simulations. It is found that the lack of terms related to DW asymmetry in the Lagrangian-based collective coordinate models significantly contributes to the discrepancy between the predictions of the most accurate Lagrangian-based model and the micromagnetic simulations in the field-driven case. This is in contrast to the STT-driven case where the DW remains symmetric.

A 4D global respiratory motion model of the thorax based on CT images: A proof of concept.

PubMed

Fayad, Hadi; Gilles, Marlene; Pan, Tinsu; Visvikis, Dimitris

2018-05-17

Respiratory motion reduces the sensitivity and specificity of medical images especially in the thoracic and abdominal areas. It may affect applications such as cancer diagnostic imaging and/or radiation therapy (RT). Solutions to this issue include modeling of the respiratory motion in order to optimize both diagnostic and therapeutic protocols. Personalized motion modeling required patient-specific four-dimensional (4D) imaging which in the case of 4D computed tomography (4D CT) acquisition is associated with an increased dose. The goal of this work was to develop a global respiratory motion model capable of relating external patient surface motion to internal structure motion without the need for a patient-specific 4D CT acquisition. The proposed global model is based on principal component analysis and can be adjusted to a given patient anatomy using only one or two static CT images in conjunction with a respiratory synchronized patient external surface motion. It is based on the relation between the internal motion described using deformation fields obtained by registering 4D CT images and patient surface maps obtained either from optical imaging devices or extracted from CT image-based patient skin segmentation. 4D CT images of six patients were used to generate the global motion model which was validated by adapting it on four different patients having skin segmented surfaces and two other patients having time of flight camera acquired surfaces. The reproducibility of the proposed model was also assessed on two patients with two 4D CT series acquired within 2 weeks of each other. Profile comparison shows the efficacy of the global respiratory motion model and an improvement while using two CT images in order to adapt the model. This was confirmed by the correlation coefficient with a mean correlation of 0.9 and 0.95 while using one or two CT images respectively and when comparing acquired to model generated 4D CT images. For the four patients with segmented surfaces, expert validation indicates an error of 2.35 ± 0.26 mm compared to 6.07 ± 0.76 mm when using a simple interpolation between full inspiration (FI) and full expiration (FE) CT only; i.e., without specific modeling of the respiratory motion. For the two patients with acquired surfaces, this error was of 2.48 ± 0.18 mm. In terms of reproducibility, model error changes of 0.12 and 0.17 mm were measured for the two patients concerned. The framework for the derivation of a global respiratory motion model was developed. A single or two static CT images and associated patient surface motion, as a surrogate measure, are only needed to personalize the model. This model accuracy and reproducibility were assessed by comparing acquired vs model generated 4D CT images. Future work will consist of assessing extensively the proposed model for radiotherapy applications. © 2018 American Association of Physicists in Medicine.

Nonlinear-drifted Brownian motion with multiple hidden states for remaining useful life prediction of rechargeable batteries

NASA Astrophysics Data System (ADS)

Wang, Dong; Zhao, Yang; Yang, Fangfang; Tsui, Kwok-Leung

2017-09-01

Brownian motion with adaptive drift has attracted much attention in prognostics because its first hitting time is highly relevant to remaining useful life prediction and it follows the inverse Gaussian distribution. Besides linear degradation modeling, nonlinear-drifted Brownian motion has been developed to model nonlinear degradation. Moreover, the first hitting time distribution of the nonlinear-drifted Brownian motion has been approximated by time-space transformation. In the previous studies, the drift coefficient is the only hidden state used in state space modeling of the nonlinear-drifted Brownian motion. Besides the drift coefficient, parameters of a nonlinear function used in the nonlinear-drifted Brownian motion should be treated as additional hidden states of state space modeling to make the nonlinear-drifted Brownian motion more flexible. In this paper, a prognostic method based on nonlinear-drifted Brownian motion with multiple hidden states is proposed and then it is applied to predict remaining useful life of rechargeable batteries. 26 sets of rechargeable battery degradation samples are analyzed to validate the effectiveness of the proposed prognostic method. Moreover, some comparisons with a standard particle filter based prognostic method, a spherical cubature particle filter based prognostic method and two classic Bayesian prognostic methods are conducted to highlight the superiority of the proposed prognostic method. Results show that the proposed prognostic method has lower average prediction errors than the particle filter based prognostic methods and the classic Bayesian prognostic methods for battery remaining useful life prediction.

Deblurring for spatial and temporal varying motion with optical computing

NASA Astrophysics Data System (ADS)

Xiao, Xiao; Xue, Dongfeng; Hui, Zhao

2016-05-01

A way to estimate and remove spatially and temporally varying motion blur is proposed, which is based on an optical computing system. The translation and rotation motion can be independently estimated from the joint transform correlator (JTC) system without iterative optimization. The inspiration comes from the fact that the JTC system is immune to rotation motion in a Cartesian coordinate system. The work scheme of the JTC system is designed to keep switching between the Cartesian coordinate system and polar coordinate system in different time intervals with the ping-pang handover. In the ping interval, the JTC system works in the Cartesian coordinate system to obtain a translation motion vector with optical computing speed. In the pang interval, the JTC system works in the polar coordinate system. The rotation motion is transformed to the translation motion through coordinate transformation. Then the rotation motion vector can also be obtained from JTC instantaneously. To deal with continuous spatially variant motion blur, submotion vectors based on the projective motion path blur model are proposed. The submotion vectors model is more effective and accurate at modeling spatially variant motion blur than conventional methods. The simulation and real experiment results demonstrate its overall effectiveness.

Source characterization of underground explosions from hydrodynamic-to-elastic coupling simulations

NASA Astrophysics Data System (ADS)

Chiang, A.; Pitarka, A.; Ford, S. R.; Ezzedine, S. M.; Vorobiev, O.

2017-12-01

A major improvement in ground motion simulation capabilities for underground explosion monitoring during the first phase of the Source Physics Experiment (SPE) is the development of a wave propagation solver that can propagate explosion generated non-linear near field ground motions to the far-field. The calculation is done using a hybrid modeling approach with a one-way hydrodynamic-to-elastic coupling in three dimensions where near-field motions are computed using GEODYN-L, a Lagrangian hydrodynamics code, and then passed to WPP, an elastic finite-difference code for seismic waveform modeling. The advancement in ground motion simulation capabilities gives us the opportunity to assess moment tensor inversion of a realistic volumetric source with near-field effects in a controlled setting, where we can evaluate the recovered source properties as a function of modeling parameters (i.e. velocity model) and can provide insights into previous source studies on SPE Phase I chemical shots and other historical nuclear explosions. For example the moment tensor inversion of far-field SPE seismic data demonstrated while vertical motions are well-modeled using existing velocity models large misfits still persist in predicting tangential shear wave motions from explosions. One possible explanation we can explore is errors and uncertainties from the underlying Earth model. Here we investigate the recovered moment tensor solution, particularly on the non-volumetric component, by inverting far-field ground motions simulated from physics-based explosion source models in fractured material, where the physics-based source models are based on the modeling of SPE-4P, SPE-5 and SPE-6 near-field data. The hybrid modeling approach provides new prospects in modeling explosion source and understanding the uncertainties associated with it.

Hand interception of occluded motion in humans: a test of model-based vs. on-line control

PubMed Central

Zago, Myrka; Lacquaniti, Francesco

2015-01-01

Two control schemes have been hypothesized for the manual interception of fast visual targets. In the model-free on-line control, extrapolation of target motion is based on continuous visual information, without resorting to physical models. In the model-based control, instead, a prior model of target motion predicts the future spatiotemporal trajectory. To distinguish between the two hypotheses in the case of projectile motion, we asked participants to hit a ball that rolled down an incline at 0.2 g and then fell in air at 1 g along a parabola. By varying starting position, ball velocity and trajectory differed between trials. Motion on the incline was always visible, whereas parabolic motion was either visible or occluded. We found that participants were equally successful at hitting the falling ball in both visible and occluded conditions. Moreover, in different trials the intersection points were distributed along the parabolic trajectories of the ball, indicating that subjects were able to extrapolate an extended segment of the target trajectory. Remarkably, this trend was observed even at the very first repetition of movements. These results are consistent with the hypothesis of model-based control, but not with on-line control. Indeed, ball path and speed during the occlusion could not be extrapolated solely from the kinematic information obtained during the preceding visible phase. The only way to extrapolate ball motion correctly during the occlusion was to assume that the ball would fall under gravity and air drag when hidden from view. Such an assumption had to be derived from prior experience. PMID:26133803

Mechanism test bed. Flexible body model report

NASA Technical Reports Server (NTRS)

Compton, Jimmy

1991-01-01

The Space Station Mechanism Test Bed is a six degree-of-freedom motion simulation facility used to evaluate docking and berthing hardware mechanisms. A generalized rigid body math model was developed which allowed the computation of vehicle relative motion in six DOF due to forces and moments from mechanism contact, attitude control systems, and gravity. No vehicle size limitations were imposed in the model. The equations of motion were based on Hill's equations for translational motion with respect to a nominal circular earth orbit and Newton-Euler equations for rotational motion. This rigid body model and supporting software were being refined.

Fractional Brownian motion and long term clinical trial recruitment

PubMed Central

Zhang, Qiang; Lai, Dejian

2015-01-01

Prediction of recruitment in clinical trials has been a challenging task. Many methods have been studied, including models based on Poisson process and its large sample approximation by Brownian motion (BM), however, when the independent incremental structure is violated for BM model, we could use fractional Brownian motion to model and approximate the underlying Poisson processes with random rates. In this paper, fractional Brownian motion (FBM) is considered for such conditions and compared to BM model with illustrated examples from different trials and simulations. PMID:26347306

Fractional Brownian motion and long term clinical trial recruitment.

PubMed

Zhang, Qiang; Lai, Dejian

2011-05-01

Prediction of recruitment in clinical trials has been a challenging task. Many methods have been studied, including models based on Poisson process and its large sample approximation by Brownian motion (BM), however, when the independent incremental structure is violated for BM model, we could use fractional Brownian motion to model and approximate the underlying Poisson processes with random rates. In this paper, fractional Brownian motion (FBM) is considered for such conditions and compared to BM model with illustrated examples from different trials and simulations.

Crosswind stability of FSAE race car considering the location of the pressure center

NASA Astrophysics Data System (ADS)

Zhao, Lijun; He, Huimin; Wang, Jianfeng; Li, Yaou; Yang, Na; Liu, Yiqun

2017-09-01

An 8-DOF vehicle dynamic model of FSAE race car was established, including the lateral motion, pitch motion, roll motion, yaw motion and four tires rotation. The model of aerodynamic lateral force and pressure center model were set up based on the vehicle speed and crosswind parameters. The simulation model was built by Simulink, to analyse the crosswind stability for straight-line condition. Results showed that crosswind influences the yawing velocity and sideslip angle seriously.

Spectrum Analysis of Inertial and Subinertial Motions Based on Analyzed Winds and Wind-Driven Currents from a Primitive Equation General Ocean Circulation Model.

DTIC Science & Technology

1982-12-01

1Muter.Te Motions Based on Ana lyzed Winds and wind-driven December 1982 Currents from. a Primitive Squat ion General a.OW -love"*..* Oean Circulation...mew se"$ (comeS.... do oISN..u am ae~ 00do OWaor NUN Fourier and Rotary Spc , Analysis Modeled Inertial and Subinrtial Motion 4 Primitive Equation

SU-E-J-163: A Biomechanical Lung Model for Respiratory Motion Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, X; Belcher, AH; Grelewicz, Z

2015-06-15

Purpose: This work presents a biomechanical model to investigate the complex respiratory motion for the lung tumor tracking in radiosurgery by computer simulation. Methods: The models include networked massspring-dampers to describe the tumor motion, different types of surrogate signals, and the force generated by the diaphragm. Each mass-springdamper has the same mechanical structure and each model can have different numbers of mass-spring-dampers. Both linear and nonlinear stiffness parameters were considered, and the damping ratio was tuned in a range so that the tumor motion was over-damped (no natural tumor oscillation occurs without force from the diaphragm). The simulation was runmore » by using ODE45 (ordinary differential equations by Runge-Kutta method) in MATLAB, and all time courses of motions and inputs (force) were generated and compared. Results: The curvature of the motion time courses around their peaks was sensitive to the damping ratio. Therefore, the damping ratio can be determined based on the clinical data of a high sampling rate. The peak values of different signals and the time the peaks occurred were compared, and it was found that the diaphragm force had a time lead over the tumor motion, and the lead time (0.1–0.4 seconds) depended on the distance between the tumor and the diaphragm. Conclusion: We reported a model based analysis approach for the spatial and temporal relation between the motion of the lung tumor and the surrogate signals. Due to the phase lead of the diaphragm in comparing with the lung tumor motion, the measurement of diaphragm motion (or its electromyography signal) can be used as a beam gating signal in radiosurgery, and it can also be an additional surrogate signal for better tumor motion tracking. The research is funded by the American Cancer Society (ACS) grant. The grant name is: Frameless SRS Based on Robotic Head Motion Cancellation. The grant number is: RSG-13-313-01-CCE.« less

4D cone-beam CT reconstruction using multi-organ meshes for sliding motion modeling

NASA Astrophysics Data System (ADS)

Zhong, Zichun; Gu, Xuejun; Mao, Weihua; Wang, Jing

2016-02-01

A simultaneous motion estimation and image reconstruction (SMEIR) strategy was proposed for 4D cone-beam CT (4D-CBCT) reconstruction and showed excellent results in both phantom and lung cancer patient studies. In the original SMEIR algorithm, the deformation vector field (DVF) was defined on voxel grid and estimated by enforcing a global smoothness regularization term on the motion fields. The objective of this work is to improve the computation efficiency and motion estimation accuracy of SMEIR for 4D-CBCT through developing a multi-organ meshing model. Feature-based adaptive meshes were generated to reduce the number of unknowns in the DVF estimation and accurately capture the organ shapes and motion. Additionally, the discontinuity in the motion fields between different organs during respiration was explicitly considered in the multi-organ mesh model. This will help with the accurate visualization and motion estimation of the tumor on the organ boundaries in 4D-CBCT. To further improve the computational efficiency, a GPU-based parallel implementation was designed. The performance of the proposed algorithm was evaluated on a synthetic sliding motion phantom, a 4D NCAT phantom, and four lung cancer patients. The proposed multi-organ mesh based strategy outperformed the conventional Feldkamp-Davis-Kress, iterative total variation minimization, original SMEIR and single meshing method based on both qualitative and quantitative evaluations.

4D cone-beam CT reconstruction using multi-organ meshes for sliding motion modeling.

PubMed

Zhong, Zichun; Gu, Xuejun; Mao, Weihua; Wang, Jing

2016-02-07

A simultaneous motion estimation and image reconstruction (SMEIR) strategy was proposed for 4D cone-beam CT (4D-CBCT) reconstruction and showed excellent results in both phantom and lung cancer patient studies. In the original SMEIR algorithm, the deformation vector field (DVF) was defined on voxel grid and estimated by enforcing a global smoothness regularization term on the motion fields. The objective of this work is to improve the computation efficiency and motion estimation accuracy of SMEIR for 4D-CBCT through developing a multi-organ meshing model. Feature-based adaptive meshes were generated to reduce the number of unknowns in the DVF estimation and accurately capture the organ shapes and motion. Additionally, the discontinuity in the motion fields between different organs during respiration was explicitly considered in the multi-organ mesh model. This will help with the accurate visualization and motion estimation of the tumor on the organ boundaries in 4D-CBCT. To further improve the computational efficiency, a GPU-based parallel implementation was designed. The performance of the proposed algorithm was evaluated on a synthetic sliding motion phantom, a 4D NCAT phantom, and four lung cancer patients. The proposed multi-organ mesh based strategy outperformed the conventional Feldkamp-Davis-Kress, iterative total variation minimization, original SMEIR and single meshing method based on both qualitative and quantitative evaluations.

4D cone-beam CT reconstruction using multi-organ meshes for sliding motion modeling

PubMed Central

Zhong, Zichun; Gu, Xuejun; Mao, Weihua; Wang, Jing

2016-01-01

A simultaneous motion estimation and image reconstruction (SMEIR) strategy was proposed for 4D cone-beam CT (4D-CBCT) reconstruction and showed excellent results in both phantom and lung cancer patient studies. In the original SMEIR algorithm, the deformation vector field (DVF) was defined on voxel grid and estimated by enforcing a global smoothness regularization term on the motion fields. The objective of this work is to improve the computation efficiency and motion estimation accuracy of SMEIR for 4D-CBCT through developing a multi-organ meshing model. Feature-based adaptive meshes were generated to reduce the number of unknowns in the DVF estimation and accurately capture the organ shapes and motion. Additionally, the discontinuity in the motion fields between different organs during respiration was explicitly considered in the multi-organ mesh model. This will help with the accurate visualization and motion estimation of the tumor on the organ boundaries in 4D-CBCT. To further improve the computational efficiency, a GPU-based parallel implementation was designed. The performance of the proposed algorithm was evaluated on a synthetic sliding motion phantom, a 4D NCAT phantom, and four lung cancer patients. The proposed multi-organ mesh based strategy outperformed the conventional Feldkamp–Davis–Kress, iterative total variation minimization, original SMEIR and single meshing method based on both qualitative and quantitative evaluations. PMID:26758496

Mathematical Modeling and Evaluation of Human Motions in Physical Therapy Using Mixture Density Neural Networks

PubMed Central

Vakanski, A; Ferguson, JM; Lee, S

2016-01-01

Objective The objective of the proposed research is to develop a methodology for modeling and evaluation of human motions, which will potentially benefit patients undertaking a physical rehabilitation therapy (e.g., following a stroke or due to other medical conditions). The ultimate aim is to allow patients to perform home-based rehabilitation exercises using a sensory system for capturing the motions, where an algorithm will retrieve the trajectories of a patient’s exercises, will perform data analysis by comparing the performed motions to a reference model of prescribed motions, and will send the analysis results to the patient’s physician with recommendations for improvement. Methods The modeling approach employs an artificial neural network, consisting of layers of recurrent neuron units and layers of neuron units for estimating a mixture density function over the spatio-temporal dependencies within the human motion sequences. Input data are sequences of motions related to a prescribed exercise by a physiotherapist to a patient, and recorded with a motion capture system. An autoencoder subnet is employed for reducing the dimensionality of captured sequences of human motions, complemented with a mixture density subnet for probabilistic modeling of the motion data using a mixture of Gaussian distributions. Results The proposed neural network architecture produced a model for sets of human motions represented with a mixture of Gaussian density functions. The mean log-likelihood of observed sequences was employed as a performance metric in evaluating the consistency of a subject’s performance relative to the reference dataset of motions. A publically available dataset of human motions captured with Microsoft Kinect was used for validation of the proposed method. Conclusion The article presents a novel approach for modeling and evaluation of human motions with a potential application in home-based physical therapy and rehabilitation. The described approach employs the recent progress in the field of machine learning and neural networks in developing a parametric model of human motions, by exploiting the representational power of these algorithms to encode nonlinear input-output dependencies over long temporal horizons. PMID:28111643

Mathematical Modeling and Evaluation of Human Motions in Physical Therapy Using Mixture Density Neural Networks.

PubMed

Vakanski, A; Ferguson, J M; Lee, S

2016-12-01

The objective of the proposed research is to develop a methodology for modeling and evaluation of human motions, which will potentially benefit patients undertaking a physical rehabilitation therapy (e.g., following a stroke or due to other medical conditions). The ultimate aim is to allow patients to perform home-based rehabilitation exercises using a sensory system for capturing the motions, where an algorithm will retrieve the trajectories of a patient's exercises, will perform data analysis by comparing the performed motions to a reference model of prescribed motions, and will send the analysis results to the patient's physician with recommendations for improvement. The modeling approach employs an artificial neural network, consisting of layers of recurrent neuron units and layers of neuron units for estimating a mixture density function over the spatio-temporal dependencies within the human motion sequences. Input data are sequences of motions related to a prescribed exercise by a physiotherapist to a patient, and recorded with a motion capture system. An autoencoder subnet is employed for reducing the dimensionality of captured sequences of human motions, complemented with a mixture density subnet for probabilistic modeling of the motion data using a mixture of Gaussian distributions. The proposed neural network architecture produced a model for sets of human motions represented with a mixture of Gaussian density functions. The mean log-likelihood of observed sequences was employed as a performance metric in evaluating the consistency of a subject's performance relative to the reference dataset of motions. A publically available dataset of human motions captured with Microsoft Kinect was used for validation of the proposed method. The article presents a novel approach for modeling and evaluation of human motions with a potential application in home-based physical therapy and rehabilitation. The described approach employs the recent progress in the field of machine learning and neural networks in developing a parametric model of human motions, by exploiting the representational power of these algorithms to encode nonlinear input-output dependencies over long temporal horizons.

Application of nonlinear adaptive motion washout to transport ground-handling simulation

NASA Technical Reports Server (NTRS)

Parrish, R. V.; Martin, D. J., Jr.

1983-01-01

The application of a nonlinear coordinated adaptive motion washout to the transport ground-handling environment is documented. Additions to both the aircraft math model and the motion washout system are discussed. The additions to the simulated-aircraft math model provided improved modeling fidelity for braking and reverse-thrust application, and the additions to the motion-base washout system allowed transition from the desired flight parameters to the less restrictive ground parameters of the washout.

Applying Model Analysis to a Resource-Based Analysis of the Force and Motion Conceptual Evaluation

ERIC Educational Resources Information Center

Smith, Trevor I.; Wittmann, Michael C.; Carter, Tom

2014-01-01

Previously, we analyzed the Force and Motion Conceptual Evaluation in terms of a resources-based model that allows for clustering of questions so as to provide useful information on how students correctly or incorrectly reason about physics. In this paper, we apply model analysis to show that the associated model plots provide more information…

A 3D Human-Machine Integrated Design and Analysis Framework for Squat Exercises with a Smith Machine.

PubMed

Lee, Haerin; Jung, Moonki; Lee, Ki-Kwang; Lee, Sang Hun

2017-02-06

In this paper, we propose a three-dimensional design and evaluation framework and process based on a probabilistic-based motion synthesis algorithm and biomechanical analysis system for the design of the Smith machine and squat training programs. Moreover, we implemented a prototype system to validate the proposed framework. The framework consists of an integrated human-machine-environment model as well as a squat motion synthesis system and biomechanical analysis system. In the design and evaluation process, we created an integrated model in which interactions between a human body and machine or the ground are modeled as joints with constraints at contact points. Next, we generated Smith squat motion using the motion synthesis program based on a Gaussian process regression algorithm with a set of given values for independent variables. Then, using the biomechanical analysis system, we simulated joint moments and muscle activities from the input of the integrated model and squat motion. We validated the model and algorithm through physical experiments measuring the electromyography (EMG) signals, ground forces, and squat motions as well as through a biomechanical simulation of muscle forces. The proposed approach enables the incorporation of biomechanics in the design process and reduces the need for physical experiments and prototypes in the development of training programs and new Smith machines.

A 3D Human-Machine Integrated Design and Analysis Framework for Squat Exercises with a Smith Machine

PubMed Central

Lee, Haerin; Jung, Moonki; Lee, Ki-Kwang; Lee, Sang Hun

2017-01-01

In this paper, we propose a three-dimensional design and evaluation framework and process based on a probabilistic-based motion synthesis algorithm and biomechanical analysis system for the design of the Smith machine and squat training programs. Moreover, we implemented a prototype system to validate the proposed framework. The framework consists of an integrated human–machine–environment model as well as a squat motion synthesis system and biomechanical analysis system. In the design and evaluation process, we created an integrated model in which interactions between a human body and machine or the ground are modeled as joints with constraints at contact points. Next, we generated Smith squat motion using the motion synthesis program based on a Gaussian process regression algorithm with a set of given values for independent variables. Then, using the biomechanical analysis system, we simulated joint moments and muscle activities from the input of the integrated model and squat motion. We validated the model and algorithm through physical experiments measuring the electromyography (EMG) signals, ground forces, and squat motions as well as through a biomechanical simulation of muscle forces. The proposed approach enables the incorporation of biomechanics in the design process and reduces the need for physical experiments and prototypes in the development of training programs and new Smith machines. PMID:28178184

Metrics for Performance Evaluation of Patient Exercises during Physical Therapy.

PubMed

Vakanski, Aleksandar; Ferguson, Jake M; Lee, Stephen

2017-06-01

The article proposes a set of metrics for evaluation of patient performance in physical therapy exercises. Taxonomy is employed that classifies the metrics into quantitative and qualitative categories, based on the level of abstraction of the captured motion sequences. Further, the quantitative metrics are classified into model-less and model-based metrics, in reference to whether the evaluation employs the raw measurements of patient performed motions, or whether the evaluation is based on a mathematical model of the motions. The reviewed metrics include root-mean square distance, Kullback Leibler divergence, log-likelihood, heuristic consistency, Fugl-Meyer Assessment, and similar. The metrics are evaluated for a set of five human motions captured with a Kinect sensor. The metrics can potentially be integrated into a system that employs machine learning for modelling and assessment of the consistency of patient performance in home-based therapy setting. Automated performance evaluation can overcome the inherent subjectivity in human performed therapy assessment, and it can increase the adherence to prescribed therapy plans, and reduce healthcare costs.

Hand interception of occluded motion in humans: a test of model-based vs. on-line control.

PubMed

La Scaleia, Barbara; Zago, Myrka; Lacquaniti, Francesco

2015-09-01

Two control schemes have been hypothesized for the manual interception of fast visual targets. In the model-free on-line control, extrapolation of target motion is based on continuous visual information, without resorting to physical models. In the model-based control, instead, a prior model of target motion predicts the future spatiotemporal trajectory. To distinguish between the two hypotheses in the case of projectile motion, we asked participants to hit a ball that rolled down an incline at 0.2 g and then fell in air at 1 g along a parabola. By varying starting position, ball velocity and trajectory differed between trials. Motion on the incline was always visible, whereas parabolic motion was either visible or occluded. We found that participants were equally successful at hitting the falling ball in both visible and occluded conditions. Moreover, in different trials the intersection points were distributed along the parabolic trajectories of the ball, indicating that subjects were able to extrapolate an extended segment of the target trajectory. Remarkably, this trend was observed even at the very first repetition of movements. These results are consistent with the hypothesis of model-based control, but not with on-line control. Indeed, ball path and speed during the occlusion could not be extrapolated solely from the kinematic information obtained during the preceding visible phase. The only way to extrapolate ball motion correctly during the occlusion was to assume that the ball would fall under gravity and air drag when hidden from view. Such an assumption had to be derived from prior experience. Copyright © 2015 the American Physiological Society.

Unifying model of carpal mechanics based on computationally derived isometric constraints and rules-based motion - the stable central column theory.

PubMed

Sandow, M J; Fisher, T J; Howard, C Q; Papas, S

2014-05-01

This study was part of a larger project to develop a (kinetic) theory of carpal motion based on computationally derived isometric constraints. Three-dimensional models were created from computed tomography scans of the wrists of ten normal subjects and carpal spatial relationships at physiological motion extremes were assessed. Specific points on the surface of the various carpal bones and the radius that remained isometric through range of movement were identified. Analysis of the isometric constraints and intercarpal motion suggests that the carpus functions as a stable central column (lunate-capitate-hamate-trapezoid-trapezium) with a supporting lateral column (scaphoid), which behaves as a 'two gear four bar linkage'. The triquetrum functions as an ulnar translation restraint, as well as controlling lunate flexion. The 'trapezoid'-shaped trapezoid places the trapezium anterior to the transverse plane of the radius and ulna, and thus rotates the principal axis of the central column to correspond to that used in the 'dart thrower's motion'. This study presents a forward kinematic analysis of the carpus that provides the basis for the development of a unifying kinetic theory of wrist motion based on isometric constraints and rules-based motion.

Trouble with diffusion: Reassessing hillslope erosion laws with a particle-based model

NASA Astrophysics Data System (ADS)

Tucker, Gregory E.; Bradley, D. Nathan

2010-03-01

Many geomorphic systems involve a broad distribution of grain motion length scales, ranging from a few particle diameters to the length of an entire hillslope or stream. Studies of analogous physical systems have revealed that such broad motion distributions can have a significant impact on macroscale dynamics and can violate the assumptions behind standard, local gradient flux laws. Here, a simple particle-based model of sediment transport on a hillslope is used to study the relationship between grain motion statistics and macroscopic landform evolution. Surface grains are dislodged by random disturbance events with probabilities and distances that depend on local microtopography. Despite its simplicity, the particle model reproduces a surprisingly broad range of slope forms, including asymmetric degrading scarps and cinder cone profiles. At low slope angles the dynamics are diffusion like, with a short-range, thin-tailed hop length distribution, a parabolic, convex upward equilibrium slope form, and a linear relationship between transport rate and gradient. As slope angle steepens, the characteristic grain motion length scale begins to approach the length of the slope, leading to planar equilibrium forms that show a strongly nonlinear correlation between transport rate and gradient. These high-probability, long-distance motions violate the locality assumption embedded in many common gradient-based geomorphic transport laws. The example of a degrading scarp illustrates the potential for grain motion dynamics to vary in space and time as topography evolves. This characteristic renders models based on independent, stationary statistics inapplicable. An accompanying analytical framework based on treating grain motion as a survival process is briefly outlined.

Live Speech Driven Head-and-Eye Motion Generators.

PubMed

Le, Binh H; Ma, Xiaohan; Deng, Zhigang

2012-11-01

This paper describes a fully automated framework to generate realistic head motion, eye gaze, and eyelid motion simultaneously based on live (or recorded) speech input. Its central idea is to learn separate yet interrelated statistical models for each component (head motion, gaze, or eyelid motion) from a prerecorded facial motion data set: 1) Gaussian Mixture Models and gradient descent optimization algorithm are employed to generate head motion from speech features; 2) Nonlinear Dynamic Canonical Correlation Analysis model is used to synthesize eye gaze from head motion and speech features, and 3) nonnegative linear regression is used to model voluntary eye lid motion and log-normal distribution is used to describe involuntary eye blinks. Several user studies are conducted to evaluate the effectiveness of the proposed speech-driven head and eye motion generator using the well-established paired comparison methodology. Our evaluation results clearly show that this approach can significantly outperform the state-of-the-art head and eye motion generation algorithms. In addition, a novel mocap+video hybrid data acquisition technique is introduced to record high-fidelity head movement, eye gaze, and eyelid motion simultaneously.

Tsunami simulation using submarine displacement calculated from simulation of ground motion due to seismic source model

NASA Astrophysics Data System (ADS)

Akiyama, S.; Kawaji, K.; Fujihara, S.

2013-12-01

Since fault fracturing due to an earthquake can simultaneously cause ground motion and tsunami, it is appropriate to evaluate the ground motion and the tsunami by single fault model. However, several source models are used independently in the ground motion simulation or the tsunami simulation, because of difficulty in evaluating both phenomena simultaneously. Many source models for the 2011 off the Pacific coast of Tohoku Earthquake are proposed from the inversion analyses of seismic observations or from those of tsunami observations. Most of these models show the similar features, which large amount of slip is located at the shallower part of fault area near the Japan Trench. This indicates that the ground motion and the tsunami can be evaluated by the single source model. Therefore, we examine the possibility of the tsunami prediction, using the fault model estimated from seismic observation records. In this study, we try to carry out the tsunami simulation using the displacement field of oceanic crustal movements, which is calculated from the ground motion simulation of the 2011 off the Pacific coast of Tohoku Earthquake. We use two fault models by Yoshida et al. (2011), which are based on both the teleseismic body wave and on the strong ground motion records. Although there is the common feature in those fault models, the amount of slip near the Japan trench is lager in the fault model from the strong ground motion records than in that from the teleseismic body wave. First, the large-scale ground motion simulations applying those fault models used by the voxel type finite element method are performed for the whole eastern Japan. The synthetic waveforms computed from the simulations are generally consistent with the observation records of K-NET (Kinoshita (1998)) and KiK-net stations (Aoi et al. (2000)), deployed by the National Research Institute for Earth Science and Disaster Prevention (NIED). Next, the tsunami simulations are performed by the finite difference calculation based on the shallow water theory. The initial wave height for tsunami generation is estimated from the vertical displacement of ocean bottom due to the crustal movements, which is obtained from the ground motion simulation mentioned above. The results of tsunami simulations are compared with the observations of the GPS wave gauges to evaluate the validity for the tsunami prediction using the fault model based on the seismic observation records.

A variational reconstruction method for undersampled dynamic x-ray tomography based on physical motion models

NASA Astrophysics Data System (ADS)

Burger, Martin; Dirks, Hendrik; Frerking, Lena; Hauptmann, Andreas; Helin, Tapio; Siltanen, Samuli

2017-12-01

In this paper we study the reconstruction of moving object densities from undersampled dynamic x-ray tomography in two dimensions. A particular motivation of this study is to use realistic measurement protocols for practical applications, i.e. we do not assume to have a full Radon transform in each time step, but only projections in few angular directions. This restriction enforces a space-time reconstruction, which we perform by incorporating physical motion models and regularization of motion vectors in a variational framework. The methodology of optical flow, which is one of the most common methods to estimate motion between two images, is utilized to formulate a joint variational model for reconstruction and motion estimation. We provide a basic mathematical analysis of the forward model and the variational model for the image reconstruction. Moreover, we discuss the efficient numerical minimization based on alternating minimizations between images and motion vectors. A variety of results are presented for simulated and real measurement data with different sampling strategy. A key observation is that random sampling combined with our model allows reconstructions of similar amount of measurements and quality as a single static reconstruction.

Biomechanical effects of hybrid stabilization on the risk of proximal adjacent-segment degeneration following lumbar spinal fusion using an interspinous device or a pedicle screw-based dynamic fixator.

PubMed

Lee, Chang-Hyun; Kim, Young Eun; Lee, Hak Joong; Kim, Dong Gyu; Kim, Chi Heon

2017-12-01

OBJECTIVE Pedicle screw-rod-based hybrid stabilization (PH) and interspinous device-based hybrid stabilization (IH) have been proposed to prevent adjacent-segment degeneration (ASD) and their effectiveness has been reported. However, a comparative study based on sound biomechanical proof has not yet been reported. The aim of this study was to compare the biomechanical effects of IH and PH on the transition and adjacent segments. METHODS A validated finite element model of the normal lumbosacral spine was used. Based on the normal model, a rigid fusion model was immobilized at the L4-5 level by a rigid fixator. The DIAM or NFlex model was added on the L3-4 segment of the fusion model to construct the IH and PH models, respectively. The developed models simulated 4 different loading directions using the hybrid loading protocol. RESULTS Compared with the intact case, fusion on L4-5 produced 18.8%, 9.3%, 11.7%, and 13.7% increments in motion at L3-4 under flexion, extension, lateral bending, and axial rotation, respectively. Additional instrumentation at L3-4 (transition segment) in hybrid models reduced motion changes at this level. The IH model showed 8.4%, -33.9%, 6.9%, and 2.0% change in motion at the segment, whereas the PH model showed -30.4%, -26.7%, -23.0%, and 12.9%. At L2-3 (adjacent segment), the PH model showed 14.3%, 3.4%, 15.0%, and 0.8% of motion increment compared with the motion in the IH model. Both hybrid models showed decreased intradiscal pressure (IDP) at the transition segment compared with the fusion model, but the pressure at L2-3 (adjacent segment) increased in all loading directions except under extension. CONCLUSIONS Both IH and PH models limited excessive motion and IDP at the transition segment compared with the fusion model. At the segment adjacent to the transition level, PH induced higher stress than IH model. Such differences may eventually influence the likelihood of ASD.

The Importance of Lower Mantle Structure to Plate Stresses and Plate Motions

NASA Astrophysics Data System (ADS)

Holt, W. E.; Wang, X.; Ghosh, A.

2016-12-01

Plate motions and plate stresses are widely assumed as the surface expression of mantle convection. The generation of plate tectonics from mantle convection has been studied for many years. Lithospheric thickening (or ridge push) and slab pull forces are commonly accepted as the major driving forces for the plate motions. However, the importance of the lower mantle to plate stresses and plate motions remains less clear. Here, we use the joint modeling of lithosphere and mantle dynamics approach of Wang et al. (2015) to compute the tractions originating from deeper mantle convection and follow the method of Ghosh et al. (2013) to calculate gravitational potential energy per unit area (GPE) based on Crust 1.0 (Laske et al., 2013). Absolute values of deviatoric stresses are determined by the body force distributions (GPE gradients and traction magnitudes applied at the base of the lithosphere). We use the same relative viscosity model that Ghosh et al. (2013) used, and we solve for one single adjustable scaling factor that multiplies the entire relative viscosity field to provide absolute values of viscosity throughout the lithosphere. This distribution of absolute values of lithosphere viscosities defines the magnitudes of surface motions. In this procedure, the dynamic model first satisfies the internal constraint of no-net-rotation of motions. The model viscosity field is then scaled by the single factor until we achieve a root mean square (RMS) minimum between computed surface motions and the kinematic no-net-rotation (NNR) model of Kreemer et al. (2006). We compute plate stresses and plate motions from recently published global tomography models (over 70 based on Wang et al., 2015). We find that RMS misfits are significantly reduced when details of lower mantle structure from the latest tomography models are added to models that contain only upper and mid-mantle density distributions. One of the key reasons is that active upwelling from the Large Low Shear Velocity Provinces (LLSVPs) in the lower mantle in Pacific (Frost and Rost, 2014) provides important components of mantle flow affecting plate stresses and motions. We demonstrate in this paper how lower mantle density heterogeneity has a marked influence on plate stresses and plate motions.

Modeling respiratory mechanics in the MCAT and spline-based MCAT phantoms

NASA Astrophysics Data System (ADS)

Segars, W. P.; Lalush, D. S.; Tsui, B. M. W.

2001-02-01

Respiratory motion can cause artifacts in myocardial SPECT and computed tomography (CT). The authors incorporate models of respiratory mechanics into the current 4D MCAT and into the next generation spline-based MCAT phantoms. In order to simulate respiratory motion in the current MCAT phantom, the geometric solids for the diaphragm, heart, ribs, and lungs were altered through manipulation of parameters defining them. Affine transformations were applied to the control points defining the same respiratory structures in the spline-based MCAT phantom to simulate respiratory motion. The Non-Uniform Rational B-Spline (NURBS) surfaces for the lungs and body outline were constructed in such a way as to be linked to the surrounding ribs. Expansion and contraction of the thoracic cage then coincided with expansion and contraction of the lungs and body. The changes both phantoms underwent were spline-interpolated over time to create time continuous 4D respiratory models. The authors then used the geometry-based and spline-based MCAT phantoms in an initial simulation study of the effects of respiratory motion on myocardial SPECT. The simulated reconstructed images demonstrated distinct artifacts in the inferior region of the myocardium. It is concluded that both respiratory models can be effective tools for researching effects of respiratory motion.

Clustering Of Left Ventricular Wall Motion Patterns

NASA Astrophysics Data System (ADS)

Bjelogrlic, Z.; Jakopin, J.; Gyergyek, L.

1982-11-01

A method for detection of wall regions with similar motion was presented. A model based on local direction information was used to measure the left ventricular wall motion from cineangiographic sequence. Three time functions were used to define segmental motion patterns: distance of a ventricular contour segment from the mean contour, the velocity of a segment and its acceleration. Motion patterns were clustered by the UPGMA algorithm and by an algorithm based on K-nearest neighboor classification rule.

Object Segmentation from Motion Discontinuities and Temporal Occlusions–A Biologically Inspired Model

PubMed Central

Beck, Cornelia; Ognibeni, Thilo; Neumann, Heiko

2008-01-01

Background Optic flow is an important cue for object detection. Humans are able to perceive objects in a scene using only kinetic boundaries, and can perform the task even when other shape cues are not provided. These kinetic boundaries are characterized by the presence of motion discontinuities in a local neighbourhood. In addition, temporal occlusions appear along the boundaries as the object in front covers the background and the objects that are spatially behind it. Methodology/Principal Findings From a technical point of view, the detection of motion boundaries for segmentation based on optic flow is a difficult task. This is due to the problem that flow detected along such boundaries is generally not reliable. We propose a model derived from mechanisms found in visual areas V1, MT, and MSTl of human and primate cortex that achieves robust detection along motion boundaries. It includes two separate mechanisms for both the detection of motion discontinuities and of occlusion regions based on how neurons respond to spatial and temporal contrast, respectively. The mechanisms are embedded in a biologically inspired architecture that integrates information of different model components of the visual processing due to feedback connections. In particular, mutual interactions between the detection of motion discontinuities and temporal occlusions allow a considerable improvement of the kinetic boundary detection. Conclusions/Significance A new model is proposed that uses optic flow cues to detect motion discontinuities and object occlusion. We suggest that by combining these results for motion discontinuities and object occlusion, object segmentation within the model can be improved. This idea could also be applied in other models for object segmentation. In addition, we discuss how this model is related to neurophysiological findings. The model was successfully tested both with artificial and real sequences including self and object motion. PMID:19043613

Inter-fraction variations in respiratory motion models

NASA Astrophysics Data System (ADS)

McClelland, J. R.; Hughes, S.; Modat, M.; Qureshi, A.; Ahmad, S.; Landau, D. B.; Ourselin, S.; Hawkes, D. J.

2011-01-01

Respiratory motion can vary dramatically between the planning stage and the different fractions of radiotherapy treatment. Motion predictions used when constructing the radiotherapy plan may be unsuitable for later fractions of treatment. This paper presents a methodology for constructing patient-specific respiratory motion models and uses these models to evaluate and analyse the inter-fraction variations in the respiratory motion. The internal respiratory motion is determined from the deformable registration of Cine CT data and related to a respiratory surrogate signal derived from 3D skin surface data. Three different models for relating the internal motion to the surrogate signal have been investigated in this work. Data were acquired from six lung cancer patients. Two full datasets were acquired for each patient, one before the course of radiotherapy treatment and one at the end (approximately 6 weeks later). Separate models were built for each dataset. All models could accurately predict the respiratory motion in the same dataset, but had large errors when predicting the motion in the other dataset. Analysis of the inter-fraction variations revealed that most variations were spatially varying base-line shifts, but changes to the anatomy and the motion trajectories were also observed.

Knowledge-Based Motion Control of AN Intelligent Mobile Autonomous System

NASA Astrophysics Data System (ADS)

Isik, Can

An Intelligent Mobile Autonomous System (IMAS), which is equipped with vision and low level sensors to cope with unknown obstacles, is modeled as a hierarchy of path planning and motion control. This dissertation concentrates on the lower level of this hierarchy (Pilot) with a knowledge-based controller. The basis of a theory of knowledge-based controllers is established, using the example of the Pilot level motion control of IMAS. In this context, the knowledge-based controller with a linguistic world concept is shown to be adequate for the minimum time control of an autonomous mobile robot motion. The Pilot level motion control of IMAS is approached in the framework of production systems. The three major components of the knowledge-based control that are included here are the hierarchies of the database, the rule base and the rule evaluator. The database, which is the representation of the state of the world, is organized as a semantic network, using a concept of minimal admissible vocabulary. The hierarchy of rule base is derived from the analytical formulation of minimum-time control of IMAS motion. The procedure introduced for rule derivation, which is called analytical model verbalization, utilizes the concept of causalities to describe the system behavior. A realistic analytical system model is developed and the minimum-time motion control in an obstacle strewn environment is decomposed to a hierarchy of motion planning and control. The conditions for the validity of the hierarchical problem decomposition are established, and the consistency of operation is maintained by detecting the long term conflicting decisions of the levels of the hierarchy. The imprecision in the world description is modeled using the theory of fuzzy sets. The method developed for the choice of the rule that prescribes the minimum-time motion control among the redundant set of applicable rules is explained and the usage of fuzzy set operators is justified. Also included in the dissertation are the description of the computer simulation of Pilot within the hierarchy of IMAS control and the simulated experiments that demonstrate the theoretical work.

Feature-based respiratory motion tracking in native fluoroscopic sequences for dynamic roadmaps during minimally invasive procedures in the thorax and abdomen

NASA Astrophysics Data System (ADS)

Wagner, Martin G.; Laeseke, Paul F.; Schubert, Tilman; Slagowski, Jordan M.; Speidel, Michael A.; Mistretta, Charles A.

2017-03-01

Fluoroscopic image guidance for minimally invasive procedures in the thorax and abdomen suffers from respiratory and cardiac motion, which can cause severe subtraction artifacts and inaccurate image guidance. This work proposes novel techniques for respiratory motion tracking in native fluoroscopic images as well as a model based estimation of vessel deformation. This would allow compensation for respiratory motion during the procedure and therefore simplify the workflow for minimally invasive procedures such as liver embolization. The method first establishes dynamic motion models for both the contrast-enhanced vasculature and curvilinear background features based on a native (non-contrast) and a contrast-enhanced image sequence acquired prior to device manipulation, under free breathing conditions. The model of vascular motion is generated by applying the diffeomorphic demons algorithm to an automatic segmentation of the subtraction sequence. The model of curvilinear background features is based on feature tracking in the native sequence. The two models establish the relationship between the respiratory state, which is inferred from curvilinear background features, and the vascular morphology during that same respiratory state. During subsequent fluoroscopy, curvilinear feature detection is applied to determine the appropriate vessel mask to display. The result is a dynamic motioncompensated vessel mask superimposed on the fluoroscopic image. Quantitative evaluation of the proposed methods was performed using a digital 4D CT-phantom (XCAT), which provides realistic human anatomy including sophisticated respiratory and cardiac motion models. Four groups of datasets were generated, where different parameters (cycle length, maximum diaphragm motion and maximum chest expansion) were modified within each image sequence. Each group contains 4 datasets consisting of the initial native and contrast enhanced sequences as well as a sequence, where the respiratory motion is tracked. The respiratory motion tracking error was between 1.00 % and 1.09 %. The estimated dynamic vessel masks yielded a Sørensen-Dice coefficient between 0.94 and 0.96. Finally, the accuracy of the vessel contours was measured in terms of the 99th percentile of the error, which ranged between 0.64 and 0.96 mm. The presented results show that the approach is feasible for respiratory motion tracking and compensation and could therefore considerably improve the workflow of minimally invasive procedures in the thorax and abdomen

Nonlinear dynamic modeling of a simple flexible rotor system subjected to time-variable base motions

NASA Astrophysics Data System (ADS)

Chen, Liqiang; Wang, Jianjun; Han, Qinkai; Chu, Fulei

2017-09-01

Rotor systems carried in transportation system or under seismic excitations are considered to have a moving base. To study the dynamic behavior of flexible rotor systems subjected to time-variable base motions, a general model is developed based on finite element method and Lagrange's equation. Two groups of Euler angles are defined to describe the rotation of the rotor with respect to the base and that of the base with respect to the ground. It is found that the base rotations would cause nonlinearities in the model. To verify the proposed model, a novel test rig which could simulate the base angular-movement is designed. Dynamic experiments on a flexible rotor-bearing system with base angular motions are carried out. Based upon these, numerical simulations are conducted to further study the dynamic response of the flexible rotor under harmonic angular base motions. The effects of base angular amplitude, rotating speed and base frequency on response behaviors are discussed by means of FFT, waterfall, frequency response curve and orbits of the rotor. The FFT and waterfall plots of the disk horizontal and vertical vibrations are marked with multiplications of the base frequency and sum and difference tones of the rotating frequency and the base frequency. Their amplitudes will increase remarkably when they meet the whirling frequencies of the rotor system.

Enhanced simulation software for rocket turbopump, turbulent, annular liquid seals

NASA Technical Reports Server (NTRS)

Padavala, Satya; Palazzolo, Alan

1994-01-01

One of the main objectives of this work is to develop a new dynamic analysis for liquid annular seals with arbitrary profile and to analyze a general distorted interstage seal of the space shuttle main engine high pressure oxygen turbopump (SSME-ATD-HPOTP). The dynamic analysis developed is based on a method originally proposed by Nelson and Nguyen. A simpler scheme based on cubic splines is found to be computationally more efficient and has better convergence properties at higher eccentricities. The first order solution of the original analysis is modified by including a more exact solution that takes into account the variation of perturbed variables along the circumference. A new set of equations for dynamic analysis are derived based on this more general model. A unified solution procedure that is valid for both Moody's and Hirs' friction models is presented. Dynamic analysis is developed for three different models: constant properties, variable properties, and thermal effects with variable properties. Arbitrarily varying seal profiles in both axial and circumferential directions are considered. An example case of an elliptical seal with varying degrees of axial curvature is analyzed in detail. A case study based on predicted clearances of an interstage seal of the SSME-ATD-HPOTP is presented. Dynamic coefficients based on external specified load are introduced to analyze seals that support a preload. The other objective of this work is to study the effect of large rotor displacements of SSME-ATD-HPOTP on the dynamics of the annular seal and the resulting transient motion. One task is to identify the magnitude of motion of the rotor about the centered position and establish limits of effectiveness of using current linear models. This task is accomplished by solving the bulk flow model seal governing equations directly for transient seal forces for any given type of motion, including motion with large eccentricities. Based on the above study, an equivalence is established between linearized coefficients based transient motion and the same motion as predicted by the original governing equations. An innovative method is developed to model nonlinearities in an annular seal based on dynamic coefficients computed at various static eccentricities. This method is thoroughly tested for various types of transient motion using bulk flow model results as a benchmark.

Research on modeling and motion simulation of a spherical space robot with telescopic manipulator based on virtual prototype technology

NASA Astrophysics Data System (ADS)

Shi, Chengkun; Sun, Hanxu; Jia, Qingxuan; Zhao, Kailiang

2009-05-01

For realizing omni-directional movement and operating task of spherical space robot system, this paper describes an innovated prototype and analyzes dynamic characteristics of a spherical rolling robot with telescopic manipulator. Based on the Newton-Euler equations, the kinematics and dynamic equations of the spherical robot's motion are instructed detailedly. Then the motion simulations of the robot in different environments are developed with ADAMS. The simulation results validate the mathematics model of the system. And the dynamic model establishes theoretical basis for the latter job.

Identification of aerodynamic models for maneuvering aircraft

NASA Technical Reports Server (NTRS)

Lan, C. Edward; Hu, C. C.

1992-01-01

A Fourier analysis method was developed to analyze harmonic forced-oscillation data at high angles of attack as functions of the angle of attack and its time rate of change. The resulting aerodynamic responses at different frequencies are used to build up the aerodynamic models involving time integrals of the indicial type. An efficient numerical method was also developed to evaluate these time integrals for arbitrary motions based on a concept of equivalent harmonic motion. The method was verified by first using results from two-dimensional and three-dimensional linear theories. The developed models for C sub L, C sub D, and C sub M based on high-alpha data for a 70 deg delta wing in harmonic motions showed accurate results in reproducing hysteresis. The aerodynamic models are further verified by comparing with test data using ramp-type motions.

Simulation of range imaging-based estimation of respiratory lung motion. Influence of noise, signal dimensionality and sampling patterns.

PubMed

Wilms, M; Werner, R; Blendowski, M; Ortmüller, J; Handels, H

2014-01-01

A major problem associated with the irradiation of thoracic and abdominal tumors is respiratory motion. In clinical practice, motion compensation approaches are frequently steered by low-dimensional breathing signals (e.g., spirometry) and patient-specific correspondence models, which are used to estimate the sought internal motion given a signal measurement. Recently, the use of multidimensional signals derived from range images of the moving skin surface has been proposed to better account for complex motion patterns. In this work, a simulation study is carried out to investigate the motion estimation accuracy of such multidimensional signals and the influence of noise, the signal dimensionality, and different sampling patterns (points, lines, regions). A diffeomorphic correspondence modeling framework is employed to relate multidimensional breathing signals derived from simulated range images to internal motion patterns represented by diffeomorphic non-linear transformations. Furthermore, an automatic approach for the selection of optimal signal combinations/patterns within this framework is presented. This simulation study focuses on lung motion estimation and is based on 28 4D CT data sets. The results show that the use of multidimensional signals instead of one-dimensional signals significantly improves the motion estimation accuracy, which is, however, highly affected by noise. Only small differences exist between different multidimensional sampling patterns (lines and regions). Automatically determined optimal combinations of points and lines do not lead to accuracy improvements compared to results obtained by using all points or lines. Our results show the potential of multidimensional breathing signals derived from range images for the model-based estimation of respiratory motion in radiation therapy.

Fast super-resolution with affine motion using an adaptive Wiener filter and its application to airborne imaging.

PubMed

Hardie, Russell C; Barnard, Kenneth J; Ordonez, Raul

2011-12-19

Fast nonuniform interpolation based super-resolution (SR) has traditionally been limited to applications with translational interframe motion. This is in part because such methods are based on an underlying assumption that the warping and blurring components in the observation model commute. For translational motion this is the case, but it is not true in general. This presents a problem for applications such as airborne imaging where translation may be insufficient. Here we present a new Fourier domain analysis to show that, for many image systems, an affine warping model with limited zoom and shear approximately commutes with the point spread function when diffraction effects are modeled. Based on this important result, we present a new fast adaptive Wiener filter (AWF) SR algorithm for non-translational motion and study its performance with affine motion. The fast AWF SR method employs a new smart observation window that allows us to precompute all the needed filter weights for any type of motion without sacrificing much of the full performance of the AWF. We evaluate the proposed algorithm using simulated data and real infrared airborne imagery that contains a thermal resolution target allowing for objective resolution analysis.

A novel approach to locomotion learning: Actor-Critic architecture using central pattern generators and dynamic motor primitives.

PubMed

Li, Cai; Lowe, Robert; Ziemke, Tom

2014-01-01

In this article, we propose an architecture of a bio-inspired controller that addresses the problem of learning different locomotion gaits for different robot morphologies. The modeling objective is split into two: baseline motion modeling and dynamics adaptation. Baseline motion modeling aims to achieve fundamental functions of a certain type of locomotion and dynamics adaptation provides a "reshaping" function for adapting the baseline motion to desired motion. Based on this assumption, a three-layer architecture is developed using central pattern generators (CPGs, a bio-inspired locomotor center for the baseline motion) and dynamic motor primitives (DMPs, a model with universal "reshaping" functions). In this article, we use this architecture with the actor-critic algorithms for finding a good "reshaping" function. In order to demonstrate the learning power of the actor-critic based architecture, we tested it on two experiments: (1) learning to crawl on a humanoid and, (2) learning to gallop on a puppy robot. Two types of actor-critic algorithms (policy search and policy gradient) are compared in order to evaluate the advantages and disadvantages of different actor-critic based learning algorithms for different morphologies. Finally, based on the analysis of the experimental results, a generic view/architecture for locomotion learning is discussed in the conclusion.

A novel approach to locomotion learning: Actor-Critic architecture using central pattern generators and dynamic motor primitives

PubMed Central

Li, Cai; Lowe, Robert; Ziemke, Tom

2014-01-01

In this article, we propose an architecture of a bio-inspired controller that addresses the problem of learning different locomotion gaits for different robot morphologies. The modeling objective is split into two: baseline motion modeling and dynamics adaptation. Baseline motion modeling aims to achieve fundamental functions of a certain type of locomotion and dynamics adaptation provides a “reshaping” function for adapting the baseline motion to desired motion. Based on this assumption, a three-layer architecture is developed using central pattern generators (CPGs, a bio-inspired locomotor center for the baseline motion) and dynamic motor primitives (DMPs, a model with universal “reshaping” functions). In this article, we use this architecture with the actor-critic algorithms for finding a good “reshaping” function. In order to demonstrate the learning power of the actor-critic based architecture, we tested it on two experiments: (1) learning to crawl on a humanoid and, (2) learning to gallop on a puppy robot. Two types of actor-critic algorithms (policy search and policy gradient) are compared in order to evaluate the advantages and disadvantages of different actor-critic based learning algorithms for different morphologies. Finally, based on the analysis of the experimental results, a generic view/architecture for locomotion learning is discussed in the conclusion. PMID:25324773

Nonlinear flight dynamics and stability of hovering model insects

PubMed Central

Liang, Bin; Sun, Mao

2013-01-01

Current analyses on insect dynamic flight stability are based on linear theory and limited to small disturbance motions. However, insects' aerial environment is filled with swirling eddies and wind gusts, and large disturbances are common. Here, we numerically solve the equations of motion coupled with the Navier–Stokes equations to simulate the large disturbance motions and analyse the nonlinear flight dynamics of hovering model insects. We consider two representative model insects, a model hawkmoth (large size, low wingbeat frequency) and a model dronefly (small size, high wingbeat frequency). For small and large initial disturbances, the disturbance motion grows with time, and the insects tumble and never return to the equilibrium state; the hovering flight is inherently (passively) unstable. The instability is caused by a pitch moment produced by forward/backward motion and/or a roll moment produced by side motion of the insect. PMID:23697714

Estimation of slipping organ motion by registration with direction-dependent regularization.

PubMed

Schmidt-Richberg, Alexander; Werner, René; Handels, Heinz; Ehrhardt, Jan

2012-01-01

Accurate estimation of respiratory motion is essential for many applications in medical 4D imaging, for example for radiotherapy of thoracic and abdominal tumors. It is usually done by non-linear registration of image scans at different states of the breathing cycle but without further modeling of specific physiological motion properties. In this context, the accurate computation of respiration-driven lung motion is especially challenging because this organ is sliding along the surrounding tissue during the breathing cycle, leading to discontinuities in the motion field. Without considering this property in the registration model, common intensity-based algorithms cause incorrect estimation along the object boundaries. In this paper, we present a model for incorporating slipping motion in image registration. Extending the common diffusion registration by distinguishing between normal- and tangential-directed motion, we are able to estimate slipping motion at the organ boundaries while preventing gaps and ensuring smooth motion fields inside and outside. We further present an algorithm for a fully automatic detection of discontinuities in the motion field, which does not rely on a prior segmentation of the organ. We evaluate the approach for the estimation of lung motion based on 23 inspiration/expiration pairs of thoracic CT images. The results show a visually more plausible motion estimation. Moreover, the target registration error is quantified using manually defined landmarks and a significant improvement over the standard diffusion regularization is shown. Copyright © 2011 Elsevier B.V. All rights reserved.

Human Pose Estimation from Monocular Images: A Comprehensive Survey

PubMed Central

Gong, Wenjuan; Zhang, Xuena; Gonzàlez, Jordi; Sobral, Andrews; Bouwmans, Thierry; Tu, Changhe; Zahzah, El-hadi

2016-01-01

Human pose estimation refers to the estimation of the location of body parts and how they are connected in an image. Human pose estimation from monocular images has wide applications (e.g., image indexing). Several surveys on human pose estimation can be found in the literature, but they focus on a certain category; for example, model-based approaches or human motion analysis, etc. As far as we know, an overall review of this problem domain has yet to be provided. Furthermore, recent advancements based on deep learning have brought novel algorithms for this problem. In this paper, a comprehensive survey of human pose estimation from monocular images is carried out including milestone works and recent advancements. Based on one standard pipeline for the solution of computer vision problems, this survey splits the problem into several modules: feature extraction and description, human body models, and modeling methods. Problem modeling methods are approached based on two means of categorization in this survey. One way to categorize includes top-down and bottom-up methods, and another way includes generative and discriminative methods. Considering the fact that one direct application of human pose estimation is to provide initialization for automatic video surveillance, there are additional sections for motion-related methods in all modules: motion features, motion models, and motion-based methods. Finally, the paper also collects 26 publicly available data sets for validation and provides error measurement methods that are frequently used. PMID:27898003

Evaluation of respiratory and cardiac motion correction schemes in dual gated PET/CT cardiac imaging.

PubMed

Lamare, F; Le Maitre, A; Dawood, M; Schäfers, K P; Fernandez, P; Rimoldi, O E; Visvikis, D

2014-07-01

Cardiac imaging suffers from both respiratory and cardiac motion. One of the proposed solutions involves double gated acquisitions. Although such an approach may lead to both respiratory and cardiac motion compensation there are issues associated with (a) the combination of data from cardiac and respiratory motion bins, and (b) poor statistical quality images as a result of using only part of the acquired data. The main objective of this work was to evaluate different schemes of combining binned data in order to identify the best strategy to reconstruct motion free cardiac images from dual gated positron emission tomography (PET) acquisitions. A digital phantom study as well as seven human studies were used in this evaluation. PET data were acquired in list mode (LM). A real-time position management system and an electrocardiogram device were used to provide the respiratory and cardiac motion triggers registered within the LM file. Acquired data were subsequently binned considering four and six cardiac gates, or the diastole only in combination with eight respiratory amplitude gates. PET images were corrected for attenuation, but no randoms nor scatter corrections were included. Reconstructed images from each of the bins considered above were subsequently used in combination with an affine or an elastic registration algorithm to derive transformation parameters allowing the combination of all acquired data in a particular position in the cardiac and respiratory cycles. Images were assessed in terms of signal-to-noise ratio (SNR), contrast, image profile, coefficient-of-variation (COV), and relative difference of the recovered activity concentration. Regardless of the considered motion compensation strategy, the nonrigid motion model performed better than the affine model, leading to higher SNR and contrast combined with a lower COV. Nevertheless, when compensating for respiration only, no statistically significant differences were observed in the performance of the two motion models considered. Superior image SNR and contrast were seen using the affine respiratory motion model in combination with the diastole cardiac bin in comparison to the use of the whole cardiac cycle. In contrast, when simultaneously correcting for cardiac beating and respiration, the elastic respiratory motion model outperformed the affine model. In this context, four cardiac bins associated with eight respiratory amplitude bins seemed to be adequate. Considering the compensation of respiratory motion effects only, both affine and elastic based approaches led to an accurate resizing and positioning of the myocardium. The use of the diastolic phase combined with an affine model based respiratory motion correction may therefore be a simple approach leading to significant quality improvements in cardiac PET imaging. However, the best performance was obtained with the combined correction for both cardiac and respiratory movements considering all the dual-gated bins independently through the use of an elastic model based motion compensation.

Musculoskeletal Simulation Model Generation from MRI Data Sets and Motion Capture Data

NASA Astrophysics Data System (ADS)

Schmid, Jérôme; Sandholm, Anders; Chung, François; Thalmann, Daniel; Delingette, Hervé; Magnenat-Thalmann, Nadia

Today computer models and computer simulations of the musculoskeletal system are widely used to study the mechanisms behind human gait and its disorders. The common way of creating musculoskeletal models is to use a generic musculoskeletal model based on data derived from anatomical and biomechanical studies of cadaverous specimens. To adapt this generic model to a specific subject, the usual approach is to scale it. This scaling has been reported to introduce several errors because it does not always account for subject-specific anatomical differences. As a result, a novel semi-automatic workflow is proposed that creates subject-specific musculoskeletal models from magnetic resonance imaging (MRI) data sets and motion capture data. Based on subject-specific medical data and a model-based automatic segmentation approach, an accurate modeling of the anatomy can be produced while avoiding the scaling operation. This anatomical model coupled with motion capture data, joint kinematics information, and muscle-tendon actuators is finally used to create a subject-specific musculoskeletal model.

Representation of planar motion of complex joints by means of rolling pairs. Application to neck motion.

PubMed

Page, Alvaro; de Rosario, Helios; Gálvez, José A; Mata, Vicente

2011-02-24

We propose to model planar movements between two human segments by means of rolling-without-slipping kinematic pairs. We compute the path traced by the instantaneous center of rotation (ICR) as seen from the proximal and distal segments, thus obtaining the fixed and moving centrodes, respectively. The joint motion is then represented by the rolling-without-slipping of one centrode on the other. The resulting joint kinematic model is based on the real movement and accounts for nonfixed axes of rotation; therefore it could improve current models based on revolute pairs in those cases where joint movement implies displacement of the ICR. Previous authors have used the ICR to characterize human joint motion, but they only considered the fixed centrode. Such an approach is not adequate for reproducing motion because the fixed centrode by itself does not convey information about body position. The combination of the fixed and moving centrodes gathers the kinematic information needed to reproduce the position and velocities of moving bodies. To illustrate our method, we applied it to the flexion-extension movement of the head relative to the thorax. The model provides a good estimation of motion both for position variables (mean R(pos)=0.995) and for velocities (mean R(vel)=0.958). This approach is more realistic than other models of neck motion based on revolute pairs, such as the dual-pivot model. The geometry of the centrodes can provide some information about the nature of the movement. For instance, the ascending and descending curves of the fixed centrode suggest a sequential movement of the cervical vertebrae. Copyright © 2010 Elsevier Ltd. All rights reserved.

Human joint motion estimation for electromyography (EMG)-based dynamic motion control.

PubMed

Zhang, Qin; Hosoda, Ryo; Venture, Gentiane

2013-01-01

This study aims to investigate a joint motion estimation method from Electromyography (EMG) signals during dynamic movement. In most EMG-based humanoid or prosthetics control systems, EMG features were directly or indirectly used to trigger intended motions. However, both physiological and nonphysiological factors can influence EMG characteristics during dynamic movements, resulting in subject-specific, non-stationary and crosstalk problems. Particularly, when motion velocity and/or joint torque are not constrained, joint motion estimation from EMG signals are more challenging. In this paper, we propose a joint motion estimation method based on muscle activation recorded from a pair of agonist and antagonist muscles of the joint. A linear state-space model with multi input single output is proposed to map the muscle activity to joint motion. An adaptive estimation method is proposed to train the model. The estimation performance is evaluated in performing a single elbow flexion-extension movement in two subjects. All the results in two subjects at two load levels indicate the feasibility and suitability of the proposed method in joint motion estimation. The estimation root-mean-square error is within 8.3% ∼ 10.6%, which is lower than that being reported in several previous studies. Moreover, this method is able to overcome subject-specific problem and compensate non-stationary EMG properties.

Stochastic point-source modeling of ground motions in the Cascadia region

USGS Publications Warehouse

Atkinson, G.M.; Boore, D.M.

1997-01-01

A stochastic model is used to develop preliminary ground motion relations for the Cascadia region for rock sites. The model parameters are derived from empirical analyses of seismographic data from the Cascadia region. The model is based on a Brune point-source characterized by a stress parameter of 50 bars. The model predictions are compared to ground-motion data from the Cascadia region and to data from large earthquakes in other subduction zones. The point-source simulations match the observations from moderate events (M 100 km). The discrepancy at large magnitudes suggests further work on modeling finite-fault effects and regional attenuation is warranted. In the meantime, the preliminary equations are satisfactory for predicting motions from events of M < 7 and provide conservative estimates of motions from larger events at distances less than 100 km.

Richardson-Lucy deblurring for the star scene under a thinning motion path

NASA Astrophysics Data System (ADS)

Su, Laili; Shao, Xiaopeng; Wang, Lin; Wang, Haixin; Huang, Yining

2015-05-01

This paper puts emphasis on how to model and correct image blur that arises from a camera's ego motion while observing a distant star scene. Concerning the significance of accurate estimation of point spread function (PSF), a new method is employed to obtain blur kernel by thinning star motion path. In particular, how the blurred star image can be corrected to reconstruct the clear scene with a thinning motion blur model which describes the camera's path is presented. This thinning motion path to build blur kernel model is more effective at modeling the spatially motion blur introduced by camera's ego motion than conventional blind estimation of kernel-based PSF parameterization. To gain the reconstructed image, firstly, an improved thinning algorithm is used to obtain the star point trajectory, so as to extract the blur kernel of the motion-blurred star image. Then how motion blur model can be incorporated into the Richardson-Lucy (RL) deblurring algorithm, which reveals its overall effectiveness, is detailed. In addition, compared with the conventional estimated blur kernel, experimental results show that the proposed method of using thinning algorithm to get the motion blur kernel is of less complexity, higher efficiency and better accuracy, which contributes to better restoration of the motion-blurred star images.

Real-time intra-fraction-motion tracking using the treatment couch: a feasibility study

NASA Astrophysics Data System (ADS)

D'Souza, Warren D.; Naqvi, Shahid A.; Yu, Cedric X.

2005-09-01

Significant differences between planned and delivered treatments may occur due to respiration-induced tumour motion, leading to underdosing of parts of the tumour and overdosing of parts of the surrounding critical structures. Existing methods proposed to counter tumour motion include breath-holds, gating and MLC-based tracking. Breath-holds and gating techniques increase treatment time considerably, whereas MLC-based tracking is limited to two dimensions. We present an alternative solution in which a robotic couch moves in real time in response to organ motion. To demonstrate proof-of-principle, we constructed a miniature adaptive couch model consisting of two movable platforms that simulate tumour motion and couch motion, respectively. These platforms were connected via an electronic feedback loop so that the bottom platform responded to the motion of the top platform. We tested our model with a seven-field step-and-shoot delivery case in which we performed three film-based experiments: (1) static geometry, (2) phantom-only motion and (3) phantom motion with simulated couch motion. Our measurements demonstrate that the miniature couch was able to compensate for phantom motion to the extent that the dose distributions were practically indistinguishable from those in static geometry. Motivated by this initial success, we investigated a real-time couch compensation system consisting of a stereoscopic infra-red camera system interfaced to a robotic couch known as the Hexapod™, which responds in real time to any change in position detected by the cameras. Optical reflectors placed on a solid water phantom were used as surrogates for motion. We tested the effectiveness of couch-based motion compensation for fixed fields and a dynamic arc delivery cases. Due to hardware limitations, we performed film-based experiments (1), (2) and (3), with the robotic couch at a phantom motion period and dose rate of 16 s and 100 MU min-1, respectively. Analysis of film measurements showed near-equivalent dose distributions (<=2 mm agreement of corresponding isodose lines) for static geometry and motion-synchronized real-time robotic couch tracking-based radiation delivery.

Combining Feature Selection and Integration—A Neural Model for MT Motion Selectivity

PubMed Central

Beck, Cornelia; Neumann, Heiko

2011-01-01

Background The computation of pattern motion in visual area MT based on motion input from area V1 has been investigated in many experiments and models attempting to replicate the main mechanisms. Two different core conceptual approaches were developed to explain the findings. In integrationist models the key mechanism to achieve pattern selectivity is the nonlinear integration of V1 motion activity. In contrast, selectionist models focus on the motion computation at positions with 2D features. Methodology/Principal Findings Recent experiments revealed that neither of the two concepts alone is sufficient to explain all experimental data and that most of the existing models cannot account for the complex behaviour found. MT pattern selectivity changes over time for stimuli like type II plaids from vector average to the direction computed with an intersection of constraint rule or by feature tracking. Also, the spatial arrangement of the stimulus within the receptive field of a MT cell plays a crucial role. We propose a recurrent neural model showing how feature integration and selection can be combined into one common architecture to explain these findings. The key features of the model are the computation of 1D and 2D motion in model area V1 subpopulations that are integrated in model MT cells using feedforward and feedback processing. Our results are also in line with findings concerning the solution of the aperture problem. Conclusions/Significance We propose a new neural model for MT pattern computation and motion disambiguation that is based on a combination of feature selection and integration. The model can explain a range of recent neurophysiological findings including temporally dynamic behaviour. PMID:21814543

High speed, precision motion strategies for lightweight structures

NASA Technical Reports Server (NTRS)

Book, Wayne J.

1987-01-01

Abstracts of published papers and dissertations generated during the reporting period are compiled. Work on fine motion control was completed. Specifically, real time control of flexible manipulator vibrations were experimentally investigated. A linear model based on the application of Lagrangian dynamics to a rigid body mode and a series of separable flexible modes was examined with respect to model order requirements, and modal candidate selection. State feedback control laws were implemented based upon linear quadratic regulator design. Specification of the closed loop poles in the regulator design process was obtained by inclusion of a prescribed degree of stability in the manipulator model. Work on gross motion planning and control is also summarized. A systematic method to symbolically derive the full nonlinear dynamic equations of motion of multi-link flexible manipulators was developed.

Integration of visual and motion cues for simulator requirements and ride quality investigation

NASA Technical Reports Server (NTRS)

Young, L. R.

1976-01-01

Practical tools which can extend the state of the art of moving base flight simulation for research and training are developed. Main approaches to this research effort include: (1) application of the vestibular model for perception of orientation based on motion cues: optimum simulator motion controls; and (2) visual cues in landing.

Video quality assessment based on correlation between spatiotemporal motion energies

NASA Astrophysics Data System (ADS)

Yan, Peng; Mou, Xuanqin

2016-09-01

Video quality assessment (VQA) has been a hot research topic because of rapid increase of huge demand of video communications. From the earliest PSNR metric to advanced models that are perceptual aware, researchers have made great progress in this field by introducing properties of human vision system (HVS) into VQA model design. Among various algorithms that model the property of HVS perceiving motion, the spatiotemporal energy model has been validated to be high consistent with psychophysical experiments. In this paper, we take the spatiotemporal energy model into VQA model design by the following steps. 1) According to the pristine spatiotemporal energy model proposed by Adelson et al, we apply the linear filters, which are oriented in space-time and tuned in spatial frequency, to filter the reference and test videos respectively. The outputs of quadrature pairs of above filters are then squared and summed to give two measures of motion energy, which are named rightward and leftward energy responses, respectively. 2) Based on the pristine model, we calculate summation of the rightward and leftward energy responses as spatiotemporal features to represent perceptual quality information for videos, named total spatiotemporal motion energy maps. 3) The proposed FR-VQA model, named STME, is calculated with statistics based on the pixel-wise correlation between the total spatiotemporal motion energy maps of the reference and distorted videos. The STME model was validated on the LIVE VQA Database by comparing with existing FR-VQA models. Experimental results show that STME performs with excellent prediction accuracy and stays in state-of-the-art VQA models.

Non-model-based correction of respiratory motion using beat-to-beat 3D spiral fat-selective imaging.

PubMed

Keegan, Jennifer; Gatehouse, Peter D; Yang, Guang-Zhong; Firmin, David N

2007-09-01

To demonstrate the feasibility of retrospective beat-to-beat correction of respiratory motion, without the need for a respiratory motion model. A high-resolution three-dimensional (3D) spiral black-blood scan of the right coronary artery (RCA) of six healthy volunteers was acquired over 160 cardiac cycles without respiratory gating. One spiral interleaf was acquired per cardiac cycle, prior to each of which a complete low-resolution fat-selective 3D spiral dataset was acquired. The respiratory motion (3D translation) on each cardiac cycle was determined by cross-correlating a region of interest (ROI) in the fat around the artery in the low-resolution datasets with that on a reference end-expiratory dataset. The measured translations were used to correct the raw data of the high-resolution spiral interleaves. Beat-to-beat correction provided consistently good results, with the image quality being better than that obtained with a fixed superior-inferior tracking factor of 0.6 and better than (N = 5) or equal to (N = 1) that achieved using a subject-specific retrospective 3D translation motion model. Non-model-based correction of respiratory motion using 3D spiral fat-selective imaging is feasible, and in this small group of volunteers produced better-quality images than a subject-specific retrospective 3D translation motion model. (c) 2007 Wiley-Liss, Inc.

A Five-Dimensional Mathematical Model for Regional and Global Changes in Cardiac Uptake and Motion

NASA Astrophysics Data System (ADS)

Pretorius, P. H.; King, M. A.; Gifford, H. C.

2004-10-01

The objective of this work was to simultaneously introduce known regional changes in contraction pattern and perfusion to the existing gated Mathematical Cardiac Torso (MCAT) phantom heart model. We derived a simple integral to calculate the fraction of the ellipsoidal volume that makes up the left ventricle (LV), taking into account the stationary apex and the moving base. After calculating the LV myocardium volume of the existing beating heart model, we employed the property of conservation of mass to manipulate the LV ejection fraction to values ranging between 13.5% and 68.9%. Multiple dynamic heart models that differ in degree of LV wall thickening, base-to-apex motion, and ejection fraction, are thus available for use with the existing MCAT methodology. To introduce more complex regional LV contraction and perfusion patterns, we used composites of dynamic heart models to create a central region with little or no motion or perfusion, surrounded by a region in which the motion and perfusion gradually reverts to normal. To illustrate this methodology, the following gated cardiac acquisitions for different clinical situations were simulated analytically: 1) reduced regional motion and perfusion; 2) same perfusion as in (1) without motion intervention; and 3) washout from the normal and diseased myocardial regions. Both motion and perfusion can change dynamically during a single rotation or multiple rotations of a simulated single-photon emission computed tomography acquisition system.

Effect of motion inputs on the wear prediction of artificial hip joints

PubMed Central

Liu, Feng; Fisher, John; Jin, Zhongmin

2013-01-01

Hip joint simulators have been largely used to assess the wear performance of joint implants. Due to the complexity of joint movement, the motion mechanism adopted in simulators varies. The motion condition is particularly important for ultra-high molecular weight polyethylene (UHMWPE) since polyethylene wear can be substantially increased by the bearing cross-shear motion. Computational wear modelling has been improved recently for the conventional UHMWPE used in total hip joint replacements. A new polyethylene wear law is an explicit function of the contact area of the bearing and the sliding distance, and the effect of multidirectional motion on wear has been quantified by a factor, cross-shear ratio. In this study, the full simulated walking cycle condition based on a walking measurement and two simplified motions, including the ISO standard motion and a simplified ProSim hip simulator motion, were considered as the inputs for wear modelling based on the improved wear model. Both the full simulation and simplified motions generated the comparable multidirectional motion required to reproduce the physiological wear of the bearing in vivo. The predicted volumetric wear of the ProSim simulator motion and the ISO motion conditions for the walking cycle were 13% and 4% lower, respectively, than that of the measured walking condition. The maximum linear wear depths were almost the same, and the areas of the wear depth distribution were 13% and 7% lower for the ProSim simulator and the ISO condition, respectively, compared with that of the measured walking cycle motion condition. PMID:25540472

Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

Neural network-based motion control of an underactuated wheeled inverted pendulum model.

PubMed

Yang, Chenguang; Li, Zhijun; Cui, Rongxin; Xu, Bugong

2014-11-01

In this paper, automatic motion control is investigated for one of wheeled inverted pendulum (WIP) models, which have been widely applied for modeling of a large range of two wheeled modern vehicles. First, the underactuated WIP model is decomposed into a fully actuated second order subsystem Σa consisting of planar movement of vehicle forward and yaw angular motions, and a nonactuated first order subsystem Σb of pendulum motion. Due to the unknown dynamics of subsystem Σa and the universal approximation ability of neural network (NN), an adaptive NN scheme has been employed for motion control of subsystem Σa . The model reference approach has been used whereas the reference model is optimized by the finite time linear quadratic regulation technique. The pendulum motion in the passive subsystem Σb is indirectly controlled using the dynamic coupling with planar forward motion of subsystem Σa , such that satisfactory tracking of a set pendulum tilt angle can be guaranteed. Rigours theoretic analysis has been established, and simulation studies have been performed to demonstrate the developed method.

Development of a parametric kinematic model of the human hand and a novel robotic exoskeleton.

PubMed

Burton, T M W; Vaidyanathan, R; Burgess, S C; Turton, A J; Melhuish, C

2011-01-01

This paper reports the integration of a kinematic model of the human hand during cylindrical grasping, with specific focus on the accurate mapping of thumb movement during grasping motions, and a novel, multi-degree-of-freedom assistive exoskeleton mechanism based on this model. The model includes thumb maximum hyper-extension for grasping large objects (~> 50 mm). The exoskeleton includes a novel four-bar mechanism designed to reproduce natural thumb opposition and a novel synchro-motion pulley mechanism for coordinated finger motion. A computer aided design environment is used to allow the exoskeleton to be rapidly customized to the hand dimensions of a specific patient. Trials comparing the kinematic model to observed data of hand movement show the model to be capable of mapping thumb and finger joint flexion angles during grasping motions. Simulations show the exoskeleton to be capable of reproducing the complex motion of the thumb to oppose the fingers during cylindrical and pinch grip motions. © 2011 IEEE

A simple model for studying rotation errors of gimbal mount axes in laser tracking system based on spherical mirror as a reflection unit

NASA Astrophysics Data System (ADS)

Song, Huixu; Shi, Zhaoyao; Chen, Hongfang; Sun, Yanqiang

2018-01-01

This paper presents a novel experimental approach and a simple model for verifying that spherical mirror of laser tracking system could lessen the effect of rotation errors of gimbal mount axes based on relative motion thinking. Enough material and evidence are provided to support that this simple model could replace complex optical system in laser tracking system. This experimental approach and model interchange the kinematic relationship between spherical mirror and gimbal mount axes in laser tracking system. Being fixed stably, gimbal mount axes' rotation error motions are replaced by spatial micro-displacements of spherical mirror. These motions are simulated by driving spherical mirror along the optical axis and vertical direction with the use of precision positioning platform. The effect on the laser ranging measurement accuracy of displacement caused by the rotation errors of gimbal mount axes could be recorded according to the outcome of laser interferometer. The experimental results show that laser ranging measurement error caused by the rotation errors is less than 0.1 μm if radial error motion and axial error motion are under 10 μm. The method based on relative motion thinking not only simplifies the experimental procedure but also achieves that spherical mirror owns the ability to reduce the effect of rotation errors of gimbal mount axes in laser tracking system.

A priori motion models for four-dimensional reconstruction in gated cardiac SPECT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lalush, D.S.; Tsui, B.M.W.; Cui, Lin

1996-12-31

We investigate the benefit of incorporating a priori assumptions about cardiac motion in a fully four-dimensional (4D) reconstruction algorithm for gated cardiac SPECT. Previous work has shown that non-motion-specific 4D Gibbs priors enforcing smoothing in time and space can control noise while preserving resolution. In this paper, we evaluate methods for incorporating known heart motion in the Gibbs prior model. The new model is derived by assigning motion vectors to each 4D voxel, defining the movement of that volume of activity into the neighboring time frames. Weights for the Gibbs cliques are computed based on these {open_quotes}most likely{close_quotes} motion vectors.more » To evaluate, we employ the mathematical cardiac-torso (MCAT) phantom with a new dynamic heart model that simulates the beating and twisting motion of the heart. Sixteen realistically-simulated gated datasets were generated, with noise simulated to emulate a real Tl-201 gated SPECT study. Reconstructions were performed using several different reconstruction algorithms, all modeling nonuniform attenuation and three-dimensional detector response. These include ML-EM with 4D filtering, 4D MAP-EM without prior motion assumption, and 4D MAP-EM with prior motion assumptions. The prior motion assumptions included both the correct motion model and incorrect models. Results show that reconstructions using the 4D prior model can smooth noise and preserve time-domain resolution more effectively than 4D linear filters. We conclude that modeling of motion in 4D reconstruction algorithms can be a powerful tool for smoothing noise and preserving temporal resolution in gated cardiac studies.« less

Moving from spatially segregated to transparent motion: a modelling approach

PubMed Central

Durant, Szonya; Donoso-Barrera, Alejandra; Tan, Sovira; Johnston, Alan

2005-01-01

Motion transparency, in which patterns of moving elements group together to give the impression of lacy overlapping surfaces, provides an important challenge to models of motion perception. It has been suggested that we perceive transparent motion when the shape of the velocity histogram of the stimulus is bimodal. To investigate this further, random-dot kinematogram motion sequences were created to simulate segregated (perceptually spatially separated) and transparent (perceptually overlapping) motion. The motion sequences were analysed using the multi-channel gradient model (McGM) to obtain the speed and direction at every pixel of each frame of the motion sequences. The velocity histograms obtained were found to be quantitatively similar and all were bimodal. However, the spatial and temporal properties of the velocity field differed between segregated and transparent stimuli. Transparent stimuli produced patches of rightward and leftward motion that varied in location over time. This demonstrates that we can successfully differentiate between these two types of motion on the basis of the time varying local velocity field. However, the percept of motion transparency cannot be based simply on the presence of a bimodal velocity histogram. PMID:17148338

Smart Sensor-Based Motion Detection System for Hand Movement Training in Open Surgery.

PubMed

Sun, Xinyao; Byrns, Simon; Cheng, Irene; Zheng, Bin; Basu, Anup

2017-02-01

We introduce a smart sensor-based motion detection technique for objective measurement and assessment of surgical dexterity among users at different experience levels. The goal is to allow trainees to evaluate their performance based on a reference model shared through communication technology, e.g., the Internet, without the physical presence of an evaluating surgeon. While in the current implementation we used a Leap Motion Controller to obtain motion data for analysis, our technique can be applied to motion data captured by other smart sensors, e.g., OptiTrack. To differentiate motions captured from different participants, measurement and assessment in our approach are achieved using two strategies: (1) low level descriptive statistical analysis, and (2) Hidden Markov Model (HMM) classification. Based on our surgical knot tying task experiment, we can conclude that finger motions generated from users with different surgical dexterity, e.g., expert and novice performers, display differences in path length, number of movements and task completion time. In order to validate the discriminatory ability of HMM for classifying different movement patterns, a non-surgical task was included in our analysis. Experimental results demonstrate that our approach had 100 % accuracy in discriminating between expert and novice performances. Our proposed motion analysis technique applied to open surgical procedures is a promising step towards the development of objective computer-assisted assessment and training systems.

The use of the logistic model in space motion sickness prediction

NASA Technical Reports Server (NTRS)

Lin, Karl K.; Reschke, Millard F.

1987-01-01

The one-equation and the two-equation logistic models were used to predict subjects' susceptibility to motion sickness in KC-135 parabolic flights using data from other ground-based motion sickness tests. The results show that the logistic models correctly predicted substantially more cases (an average of 13 percent) in the data subset used for model building. Overall, the logistic models ranged from 53 to 65 percent predictions of the three endpoint parameters, whereas the Bayes linear discriminant procedure ranged from 48 to 65 percent correct for the cross validation sample.

On-Line Detection and Segmentation of Sports Motions Using a Wearable Sensor.

PubMed

Kim, Woosuk; Kim, Myunggyu

2018-03-19

In sports motion analysis, observation is a prerequisite for understanding the quality of motions. This paper introduces a novel approach to detect and segment sports motions using a wearable sensor for supporting systematic observation. The main goal is, for convenient analysis, to automatically provide motion data, which are temporally classified according to the phase definition. For explicit segmentation, a motion model is defined as a sequence of sub-motions with boundary states. A sequence classifier based on deep neural networks is designed to detect sports motions from continuous sensor inputs. The evaluation on two types of motions (soccer kicking and two-handed ball throwing) verifies that the proposed method is successful for the accurate detection and segmentation of sports motions. By developing a sports motion analysis system using the motion model and the sequence classifier, we show that the proposed method is useful for observation of sports motions by automatically providing relevant motion data for analysis.

A Bio-Inspired, Motion-Based Analysis of Crowd Behavior Attributes Relevance to Motion Transparency, Velocity Gradients, and Motion Patterns

PubMed Central

Raudies, Florian; Neumann, Heiko

2012-01-01

The analysis of motion crowds is concerned with the detection of potential hazards for individuals of the crowd. Existing methods analyze the statistics of pixel motion to classify non-dangerous or dangerous behavior, to detect outlier motions, or to estimate the mean throughput of people for an image region. We suggest a biologically inspired model for the analysis of motion crowds that extracts motion features indicative for potential dangers in crowd behavior. Our model consists of stages for motion detection, integration, and pattern detection that model functions of the primate primary visual cortex area (V1), the middle temporal area (MT), and the medial superior temporal area (MST), respectively. This model allows for the processing of motion transparency, the appearance of multiple motions in the same visual region, in addition to processing opaque motion. We suggest that motion transparency helps to identify “danger zones” in motion crowds. For instance, motion transparency occurs in small exit passages during evacuation. However, motion transparency occurs also for non-dangerous crowd behavior when people move in opposite directions organized into separate lanes. Our analysis suggests: The combination of motion transparency and a slow motion speed can be used for labeling of candidate regions that contain dangerous behavior. In addition, locally detected decelerations or negative speed gradients of motions are a precursor of danger in crowd behavior as are globally detected motion patterns that show a contraction toward a single point. In sum, motion transparency, image speeds, motion patterns, and speed gradients extracted from visual motion in videos are important features to describe the behavioral state of a motion crowd. PMID:23300930

Optical Flow Estimation for Flame Detection in Videos

PubMed Central

Mueller, Martin; Karasev, Peter; Kolesov, Ivan; Tannenbaum, Allen

2014-01-01

Computational vision-based flame detection has drawn significant attention in the past decade with camera surveillance systems becoming ubiquitous. Whereas many discriminating features, such as color, shape, texture, etc., have been employed in the literature, this paper proposes a set of motion features based on motion estimators. The key idea consists of exploiting the difference between the turbulent, fast, fire motion, and the structured, rigid motion of other objects. Since classical optical flow methods do not model the characteristics of fire motion (e.g., non-smoothness of motion, non-constancy of intensity), two optical flow methods are specifically designed for the fire detection task: optimal mass transport models fire with dynamic texture, while a data-driven optical flow scheme models saturated flames. Then, characteristic features related to the flow magnitudes and directions are computed from the flow fields to discriminate between fire and non-fire motion. The proposed features are tested on a large video database to demonstrate their practical usefulness. Moreover, a novel evaluation method is proposed by fire simulations that allow for a controlled environment to analyze parameter influences, such as flame saturation, spatial resolution, frame rate, and random noise. PMID:23613042

Dynamical simulation priors for human motion tracking.

PubMed

Vondrak, Marek; Sigal, Leonid; Jenkins, Odest Chadwicke

2013-01-01

We propose a simulation-based dynamical motion prior for tracking human motion from video in presence of physical ground-person interactions. Most tracking approaches to date have focused on efficient inference algorithms and/or learning of prior kinematic motion models; however, few can explicitly account for the physical plausibility of recovered motion. Here, we aim to recover physically plausible motion of a single articulated human subject. Toward this end, we propose a full-body 3D physical simulation-based prior that explicitly incorporates a model of human dynamics into the Bayesian filtering framework. We consider the motion of the subject to be generated by a feedback “control loop” in which Newtonian physics approximates the rigid-body motion dynamics of the human and the environment through the application and integration of interaction forces, motor forces, and gravity. Interaction forces prevent physically impossible hypotheses, enable more appropriate reactions to the environment (e.g., ground contacts), and are produced from detected human-environment collisions. Motor forces actuate the body, ensure that proposed pose transitions are physically feasible, and are generated using a motion controller. For efficient inference in the resulting high-dimensional state space, we utilize an exemplar-based control strategy that reduces the effective search space of motor forces. As a result, we are able to recover physically plausible motion of human subjects from monocular and multiview video. We show, both quantitatively and qualitatively, that our approach performs favorably with respect to Bayesian filtering methods with standard motion priors.

Motion analysis study on sensitivity of finite element model of the cervical spine to geometry.

PubMed

Zafarparandeh, Iman; Erbulut, Deniz U; Ozer, Ali F

2016-07-01

Numerous finite element models of the cervical spine have been proposed, with exact geometry or with symmetric approximation in the geometry. However, few researches have investigated the sensitivity of predicted motion responses to the geometry of the cervical spine. The goal of this study was to evaluate the effect of symmetric assumption on the predicted motion by finite element model of the cervical spine. We developed two finite element models of the cervical spine C2-C7. One model was based on the exact geometry of the cervical spine (asymmetric model), whereas the other was symmetric (symmetric model) about the mid-sagittal plane. The predicted range of motion of both models-main and coupled motions-was compared with published experimental data for all motion planes under a full range of loads. The maximum differences between the asymmetric model and symmetric model predictions for the principal motion were 31%, 78%, and 126% for flexion-extension, right-left lateral bending, and right-left axial rotation, respectively. For flexion-extension and lateral bending, the minimum difference was 0%, whereas it was 2% for axial rotation. The maximum coupled motions predicted by the symmetric model were 1.5° axial rotation and 3.6° lateral bending, under applied lateral bending and axial rotation, respectively. Those coupled motions predicted by the asymmetric model were 1.6° axial rotation and 4° lateral bending, under applied lateral bending and axial rotation, respectively. In general, the predicted motion response of the cervical spine by the symmetric model was in the acceptable range and nonlinearity of the moment-rotation curve for the cervical spine was properly predicted. © IMechE 2016.

An Ultrasound Image-Based Dynamic Fusion Modeling Method for Predicting the Quantitative Impact of In Vivo Liver Motion on Intraoperative HIFU Therapies: Investigations in a Porcine Model

PubMed Central

N'Djin, W. Apoutou; Chapelon, Jean-Yves; Melodelima, David

2015-01-01

Organ motion is a key component in the treatment of abdominal tumors by High Intensity Focused Ultrasound (HIFU), since it may influence the safety, efficacy and treatment time. Here we report the development in a porcine model of an Ultrasound (US) image-based dynamic fusion modeling method for predicting the effect of in vivo motion on intraoperative HIFU treatments performed in the liver in conjunction with surgery. A speckle tracking method was used on US images to quantify in vivo liver motions occurring intraoperatively during breathing and apnea. A fusion modeling of HIFU treatments was implemented by merging dynamic in vivo motion data in a numerical modeling of HIFU treatments. Two HIFU strategies were studied: a spherical focusing delivering 49 juxtapositions of 5-second HIFU exposures and a toroidal focusing using 1 single 40-second HIFU exposure. Liver motions during breathing were spatially homogenous and could be approximated to a rigid motion mainly encountered in the cranial-caudal direction (f = 0.20Hz, magnitude >13mm). Elastic liver motions due to cardiovascular activity, although negligible, were detectable near millimeter-wide sus-hepatic veins (f = 0.96Hz, magnitude <1mm). The fusion modeling quantified the deleterious effects of respiratory motions on the size and homogeneity of a standard “cigar-shaped” millimetric lesion usually predicted after a 5-second single spherical HIFU exposure in stationary tissues (Dice Similarity Coefficient: DSC<45%). This method assessed the ability to enlarge HIFU ablations during respiration, either by juxtaposing “cigar-shaped” lesions with spherical HIFU exposures, or by generating one large single lesion with toroidal HIFU exposures (DSC>75%). Fusion modeling predictions were preliminarily validated in vivo and showed the potential of using a long-duration toroidal HIFU exposure to accelerate the ablation process during breathing (from 0.5 to 6 cm3·min-1). To improve HIFU treatment control, dynamic fusion modeling may be interesting for assessing numerically focusing strategies and motion compensation techniques in more realistic conditions. PMID:26398366

A 4DCT imaging-based breathing lung model with relative hysteresis

PubMed Central

Miyawaki, Shinjiro; Choi, Sanghun; Hoffman, Eric A.; Lin, Ching-Long

2016-01-01

To reproduce realistic airway motion and airflow, the authors developed a deforming lung computational fluid dynamics (CFD) model based on four-dimensional (4D, space and time) dynamic computed tomography (CT) images. A total of 13 time points within controlled tidal volume respiration were used to account for realistic and irregular lung motion in human volunteers. Because of the irregular motion of 4DCT-based airways, we identified an optimal interpolation method for airway surface deformation during respiration, and implemented a computational solid mechanics-based moving mesh algorithm to produce smooth deforming airway mesh. In addition, we developed physiologically realistic airflow boundary conditions for both models based on multiple images and a single image. Furthermore, we examined simplified models based on one or two dynamic or static images. By comparing these simplified models with the model based on 13 dynamic images, we investigated the effects of relative hysteresis of lung structure with respect to lung volume, lung deformation, and imaging methods, i.e., dynamic vs. static scans, on CFD-predicted pressure drop. The effect of imaging method on pressure drop was 24 percentage points due to the differences in airflow distribution and airway geometry. PMID:28260811

A 4DCT imaging-based breathing lung model with relative hysteresis

NASA Astrophysics Data System (ADS)

Miyawaki, Shinjiro; Choi, Sanghun; Hoffman, Eric A.; Lin, Ching-Long

2016-12-01

To reproduce realistic airway motion and airflow, the authors developed a deforming lung computational fluid dynamics (CFD) model based on four-dimensional (4D, space and time) dynamic computed tomography (CT) images. A total of 13 time points within controlled tidal volume respiration were used to account for realistic and irregular lung motion in human volunteers. Because of the irregular motion of 4DCT-based airways, we identified an optimal interpolation method for airway surface deformation during respiration, and implemented a computational solid mechanics-based moving mesh algorithm to produce smooth deforming airway mesh. In addition, we developed physiologically realistic airflow boundary conditions for both models based on multiple images and a single image. Furthermore, we examined simplified models based on one or two dynamic or static images. By comparing these simplified models with the model based on 13 dynamic images, we investigated the effects of relative hysteresis of lung structure with respect to lung volume, lung deformation, and imaging methods, i.e., dynamic vs. static scans, on CFD-predicted pressure drop. The effect of imaging method on pressure drop was 24 percentage points due to the differences in airflow distribution and airway geometry.

Modeling respiratory motion for reducing motion artifacts in 4D CT images.

PubMed

Zhang, Yongbin; Yang, Jinzhong; Zhang, Lifei; Court, Laurence E; Balter, Peter A; Dong, Lei

2013-04-01

Four-dimensional computed tomography (4D CT) images have been recently adopted in radiation treatment planning for thoracic and abdominal cancers to explicitly define respiratory motion and anatomy deformation. However, significant image distortions (artifacts) exist in 4D CT images that may affect accurate tumor delineation and the shape representation of normal anatomy. In this study, the authors present a patient-specific respiratory motion model, based on principal component analysis (PCA) of motion vectors obtained from deformable image registration, with the main goal of reducing image artifacts caused by irregular motion during 4D CT acquisition. For a 4D CT image set of a specific patient, the authors calculated displacement vector fields relative to a reference phase, using an in-house deformable image registration method. The authors then used PCA to decompose each of the displacement vector fields into linear combinations of principal motion bases. The authors have demonstrated that the regular respiratory motion of a patient can be accurately represented by a subspace spanned by three principal motion bases and their projections. These projections were parameterized using a spline model to allow the reconstruction of the displacement vector fields at any given phase in a respiratory cycle. Finally, the displacement vector fields were used to deform the reference CT image to synthesize CT images at the selected phase with much reduced image artifacts. The authors evaluated the performance of the in-house deformable image registration method using benchmark datasets consisting of ten 4D CT sets annotated with 300 landmark pairs that were approved by physicians. The initial large discrepancies across the landmark pairs were significantly reduced after deformable registration, and the accuracy was similar to or better than that reported by state-of-the-art methods. The proposed motion model was quantitatively validated on 4D CT images of a phantom and a lung cancer patient by comparing the synthesized images and the original images at different phases. The synthesized images matched well with the original images. The motion model was used to reduce irregular motion artifacts in the 4D CT images of three lung cancer patients. Visual assessment indicated that the proposed approach could reduce severe image artifacts. The shape distortions around the diaphragm and tumor regions were mitigated in the synthesized 4D CT images. The authors have derived a mathematical model to represent the regular respiratory motion from a patient-specific 4D CT set and have demonstrated its application in reducing irregular motion artifacts in 4D CT images. The authors' approach can mitigate shape distortions of anatomy caused by irregular breathing motion during 4D CT acquisition.

High-Frequency Replanning Under Uncertainty Using Parallel Sampling-Based Motion Planning

PubMed Central

Sun, Wen; Patil, Sachin; Alterovitz, Ron

2015-01-01

As sampling-based motion planners become faster, they can be re-executed more frequently by a robot during task execution to react to uncertainty in robot motion, obstacle motion, sensing noise, and uncertainty in the robot’s kinematic model. We investigate and analyze high-frequency replanning (HFR), where, during each period, fast sampling-based motion planners are executed in parallel as the robot simultaneously executes the first action of the best motion plan from the previous period. We consider discrete-time systems with stochastic nonlinear (but linearizable) dynamics and observation models with noise drawn from zero mean Gaussian distributions. The objective is to maximize the probability of success (i.e., avoid collision with obstacles and reach the goal) or to minimize path length subject to a lower bound on the probability of success. We show that, as parallel computation power increases, HFR offers asymptotic optimality for these objectives during each period for goal-oriented problems. We then demonstrate the effectiveness of HFR for holonomic and nonholonomic robots including car-like vehicles and steerable medical needles. PMID:26279645

A learning scheme for reach to grasp movements: on EMG-based interfaces using task specific motion decoding models.

PubMed

Liarokapis, Minas V; Artemiadis, Panagiotis K; Kyriakopoulos, Kostas J; Manolakos, Elias S

2013-09-01

A learning scheme based on random forests is used to discriminate between different reach to grasp movements in 3-D space, based on the myoelectric activity of human muscles of the upper-arm and the forearm. Task specificity for motion decoding is introduced in two different levels: Subspace to move toward and object to be grasped. The discrimination between the different reach to grasp strategies is accomplished with machine learning techniques for classification. The classification decision is then used in order to trigger an EMG-based task-specific motion decoding model. Task specific models manage to outperform "general" models providing better estimation accuracy. Thus, the proposed scheme takes advantage of a framework incorporating both a classifier and a regressor that cooperate advantageously in order to split the task space. The proposed learning scheme can be easily used to a series of EMG-based interfaces that must operate in real time, providing data-driven capabilities for multiclass problems, that occur in everyday life complex environments.

Active contour-based visual tracking by integrating colors, shapes, and motions.

PubMed

Hu, Weiming; Zhou, Xue; Li, Wei; Luo, Wenhan; Zhang, Xiaoqin; Maybank, Stephen

2013-05-01

In this paper, we present a framework for active contour-based visual tracking using level sets. The main components of our framework include contour-based tracking initialization, color-based contour evolution, adaptive shape-based contour evolution for non-periodic motions, dynamic shape-based contour evolution for periodic motions, and the handling of abrupt motions. For the initialization of contour-based tracking, we develop an optical flow-based algorithm for automatically initializing contours at the first frame. For the color-based contour evolution, Markov random field theory is used to measure correlations between values of neighboring pixels for posterior probability estimation. For adaptive shape-based contour evolution, the global shape information and the local color information are combined to hierarchically evolve the contour, and a flexible shape updating model is constructed. For the dynamic shape-based contour evolution, a shape mode transition matrix is learnt to characterize the temporal correlations of object shapes. For the handling of abrupt motions, particle swarm optimization is adopted to capture the global motion which is applied to the contour in the current frame to produce an initial contour in the next frame.

Direct Visuo-Haptic 4D Volume Rendering Using Respiratory Motion Models.

PubMed

Fortmeier, Dirk; Wilms, Matthias; Mastmeyer, Andre; Handels, Heinz

2015-01-01

This article presents methods for direct visuo-haptic 4D volume rendering of virtual patient models under respiratory motion. Breathing models are computed based on patient-specific 4D CT image data sequences. Virtual patient models are visualized in real-time by ray casting based rendering of a reference CT image warped by a time-variant displacement field, which is computed using the motion models at run-time. Furthermore, haptic interaction with the animated virtual patient models is provided by using the displacements computed at high rendering rates to translate the position of the haptic device into the space of the reference CT image. This concept is applied to virtual palpation and the haptic simulation of insertion of a virtual bendable needle. To this aim, different motion models that are applicable in real-time are presented and the methods are integrated into a needle puncture training simulation framework, which can be used for simulated biopsy or vessel puncture in the liver. To confirm real-time applicability, a performance analysis of the resulting framework is given. It is shown that the presented methods achieve mean update rates around 2,000 Hz for haptic simulation and interactive frame rates for volume rendering and thus are well suited for visuo-haptic rendering of virtual patients under respiratory motion.

Evaluation of respiratory and cardiac motion correction schemes in dual gated PET/CT cardiac imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lamare, F., E-mail: frederic.lamare@chu-bordeaux.fr; Fernandez, P.; CNRS, INCIA, UMR 5287, F-33400 Talence

Purpose: Cardiac imaging suffers from both respiratory and cardiac motion. One of the proposed solutions involves double gated acquisitions. Although such an approach may lead to both respiratory and cardiac motion compensation there are issues associated with (a) the combination of data from cardiac and respiratory motion bins, and (b) poor statistical quality images as a result of using only part of the acquired data. The main objective of this work was to evaluate different schemes of combining binned data in order to identify the best strategy to reconstruct motion free cardiac images from dual gated positron emission tomography (PET)more » acquisitions. Methods: A digital phantom study as well as seven human studies were used in this evaluation. PET data were acquired in list mode (LM). A real-time position management system and an electrocardiogram device were used to provide the respiratory and cardiac motion triggers registered within the LM file. Acquired data were subsequently binned considering four and six cardiac gates, or the diastole only in combination with eight respiratory amplitude gates. PET images were corrected for attenuation, but no randoms nor scatter corrections were included. Reconstructed images from each of the bins considered above were subsequently used in combination with an affine or an elastic registration algorithm to derive transformation parameters allowing the combination of all acquired data in a particular position in the cardiac and respiratory cycles. Images were assessed in terms of signal-to-noise ratio (SNR), contrast, image profile, coefficient-of-variation (COV), and relative difference of the recovered activity concentration. Results: Regardless of the considered motion compensation strategy, the nonrigid motion model performed better than the affine model, leading to higher SNR and contrast combined with a lower COV. Nevertheless, when compensating for respiration only, no statistically significant differences were observed in the performance of the two motion models considered. Superior image SNR and contrast were seen using the affine respiratory motion model in combination with the diastole cardiac bin in comparison to the use of the whole cardiac cycle. In contrast, when simultaneously correcting for cardiac beating and respiration, the elastic respiratory motion model outperformed the affine model. In this context, four cardiac bins associated with eight respiratory amplitude bins seemed to be adequate. Conclusions: Considering the compensation of respiratory motion effects only, both affine and elastic based approaches led to an accurate resizing and positioning of the myocardium. The use of the diastolic phase combined with an affine model based respiratory motion correction may therefore be a simple approach leading to significant quality improvements in cardiac PET imaging. However, the best performance was obtained with the combined correction for both cardiac and respiratory movements considering all the dual-gated bins independently through the use of an elastic model based motion compensation.« less

A hybrid patient-specific biomechanical model based image registration method for the motion estimation of lungs.

PubMed

Han, Lianghao; Dong, Hua; McClelland, Jamie R; Han, Liangxiu; Hawkes, David J; Barratt, Dean C

2017-07-01

This paper presents a new hybrid biomechanical model-based non-rigid image registration method for lung motion estimation. In the proposed method, a patient-specific biomechanical modelling process captures major physically realistic deformations with explicit physical modelling of sliding motion, whilst a subsequent non-rigid image registration process compensates for small residuals. The proposed algorithm was evaluated with 10 4D CT datasets of lung cancer patients. The target registration error (TRE), defined as the Euclidean distance of landmark pairs, was significantly lower with the proposed method (TRE = 1.37 mm) than with biomechanical modelling (TRE = 3.81 mm) and intensity-based image registration without specific considerations for sliding motion (TRE = 4.57 mm). The proposed method achieved a comparable accuracy as several recently developed intensity-based registration algorithms with sliding handling on the same datasets. A detailed comparison on the distributions of TREs with three non-rigid intensity-based algorithms showed that the proposed method performed especially well on estimating the displacement field of lung surface regions (mean TRE = 1.33 mm, maximum TRE = 5.3 mm). The effects of biomechanical model parameters (such as Poisson's ratio, friction and tissue heterogeneity) on displacement estimation were investigated. The potential of the algorithm in optimising biomechanical models of lungs through analysing the pattern of displacement compensation from the image registration process has also been demonstrated. Copyright © 2017 Elsevier B.V. All rights reserved.

Discomfort Evaluation of Truck Ingress/Egress Motions Based on Biomechanical Analysis

PubMed Central

Choi, Nam-Chul; Lee, Sang Hun

2015-01-01

This paper presents a quantitative discomfort evaluation method based on biomechanical analysis results for human body movement, as well as its application to an assessment of the discomfort for truck ingress and egress. In this study, the motions of a human subject entering and exiting truck cabins with different types, numbers, and heights of footsteps were first measured using an optical motion capture system and load sensors. Next, the maximum voluntary contraction (MVC) ratios of the muscles were calculated through a biomechanical analysis of the musculoskeletal human model for the captured motion. Finally, the objective discomfort was evaluated using the proposed discomfort model based on the MVC ratios. To validate this new discomfort assessment method, human subject experiments were performed to investigate the subjective discomfort levels through a questionnaire for comparison with the objective discomfort levels. The validation results showed that the correlation between the objective and subjective discomforts was significant and could be described by a linear regression model. PMID:26067194

Certification of a hybrid parameter model of the fully flexible Shuttle Remote Manipulator System

NASA Technical Reports Server (NTRS)

Barhorst, Alan A.

1995-01-01

The development of high fidelity models of mechanical systems with flexible components is in flux. Many working models of these devices assume the elastic motion is small and can be superimposed on the overall rigid body motion. A drawback associated with this type of modeling technique is that it is required to regenerate the linear modal model of the device if the elastic motion is sufficiently far from the base rigid motion. An advantage to this type of modeling is that it uses NASTRAN modal data which is the NASA standard means of modal information exchange. A disadvantage to the linear modeling is that it fails to accurately represent large motion of the system, unless constant modal updates are performed. In this study, which is a continuation of a project started last year, the drawback of the currently used modal snapshot modeling technique is addressed in a rigorous fashion by novel and easily applied means.

A unified probabilistic framework for spontaneous facial action modeling and understanding.

PubMed

Tong, Yan; Chen, Jixu; Ji, Qiang

2010-02-01

Facial expression is a natural and powerful means of human communication. Recognizing spontaneous facial actions, however, is very challenging due to subtle facial deformation, frequent head movements, and ambiguous and uncertain facial motion measurements. Because of these challenges, current research in facial expression recognition is limited to posed expressions and often in frontal view. A spontaneous facial expression is characterized by rigid head movements and nonrigid facial muscular movements. More importantly, it is the coherent and consistent spatiotemporal interactions among rigid and nonrigid facial motions that produce a meaningful facial expression. Recognizing this fact, we introduce a unified probabilistic facial action model based on the Dynamic Bayesian network (DBN) to simultaneously and coherently represent rigid and nonrigid facial motions, their spatiotemporal dependencies, and their image measurements. Advanced machine learning methods are introduced to learn the model based on both training data and subjective prior knowledge. Given the model and the measurements of facial motions, facial action recognition is accomplished through probabilistic inference by systematically integrating visual measurements with the facial action model. Experiments show that compared to the state-of-the-art techniques, the proposed system yields significant improvements in recognizing both rigid and nonrigid facial motions, especially for spontaneous facial expressions.

Multilayer Joint Gait-Pose Manifolds for Human Gait Motion Modeling.

PubMed

Ding, Meng; Fan, Guolian

2015-11-01

We present new multilayer joint gait-pose manifolds (multilayer JGPMs) for complex human gait motion modeling, where three latent variables are defined jointly in a low-dimensional manifold to represent a variety of body configurations. Specifically, the pose variable (along the pose manifold) denotes a specific stage in a walking cycle; the gait variable (along the gait manifold) represents different walking styles; and the linear scale variable characterizes the maximum stride in a walking cycle. We discuss two kinds of topological priors for coupling the pose and gait manifolds, i.e., cylindrical and toroidal, to examine their effectiveness and suitability for motion modeling. We resort to a topologically-constrained Gaussian process (GP) latent variable model to learn the multilayer JGPMs where two new techniques are introduced to facilitate model learning under limited training data. First is training data diversification that creates a set of simulated motion data with different strides. Second is the topology-aware local learning to speed up model learning by taking advantage of the local topological structure. The experimental results on the Carnegie Mellon University motion capture data demonstrate the advantages of our proposed multilayer models over several existing GP-based motion models in terms of the overall performance of human gait motion modeling.

Reconstructing 3-D skin surface motion for the DIET breast cancer screening system.

PubMed

Botterill, Tom; Lotz, Thomas; Kashif, Amer; Chase, J Geoffrey

2014-05-01

Digital image-based elasto-tomography (DIET) is a prototype system for breast cancer screening. A breast is imaged while being vibrated, and the observed surface motion is used to infer the internal stiffness of the breast, hence identifying tumors. This paper describes a computer vision system for accurately measuring 3-D surface motion. A model-based segmentation is used to identify the profile of the breast in each image, and the 3-D surface is reconstructed by fitting a model to the profiles. The surface motion is measured using a modern optical flow implementation customized to the application, then trajectories of points on the 3-D surface are given by fusing the optical flow with the reconstructed surfaces. On data from human trials, the system is shown to exceed the performance of an earlier marker-based system at tracking skin surface motion. We demonstrate that the system can detect a 10 mm tumor in a silicone phantom breast.

Bayesian approach to MSD-based analysis of particle motion in live cells.

PubMed

Monnier, Nilah; Guo, Syuan-Ming; Mori, Masashi; He, Jun; Lénárt, Péter; Bathe, Mark

2012-08-08

Quantitative tracking of particle motion using live-cell imaging is a powerful approach to understanding the mechanism of transport of biological molecules, organelles, and cells. However, inferring complex stochastic motion models from single-particle trajectories in an objective manner is nontrivial due to noise from sampling limitations and biological heterogeneity. Here, we present a systematic Bayesian approach to multiple-hypothesis testing of a general set of competing motion models based on particle mean-square displacements that automatically classifies particle motion, properly accounting for sampling limitations and correlated noise while appropriately penalizing model complexity according to Occam's Razor to avoid over-fitting. We test the procedure rigorously using simulated trajectories for which the underlying physical process is known, demonstrating that it chooses the simplest physical model that explains the observed data. Further, we show that computed model probabilities provide a reliability test for the downstream biological interpretation of associated parameter values. We subsequently illustrate the broad utility of the approach by applying it to disparate biological systems including experimental particle trajectories from chromosomes, kinetochores, and membrane receptors undergoing a variety of complex motions. This automated and objective Bayesian framework easily scales to large numbers of particle trajectories, making it ideal for classifying the complex motion of large numbers of single molecules and cells from high-throughput screens, as well as single-cell-, tissue-, and organism-level studies. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Comparison of different models of motion in a crowded environment: a Monte Carlo study.

PubMed

Polanowski, P; Sikorski, A

2017-02-22

In this paper we investigate the motion of molecules in crowded environments for two dramatically different types of molecular transport. The first type is realized by the dynamic lattice liquid model, which is based on a cooperative movement concept and thus, the motion of molecules is highly correlated. The second one corresponds to a so-called motion of a single agent where the motion of molecules is considered as a random walk without any correlation with other moving elements. The crowded environments are modeled as a two-dimensional triangular lattice with fixed impenetrable obstacles. Our simulation results indicate that the type of transport has an impact on the dynamics of the system, the percolation threshold, critical exponents, and on molecules' trajectories.

Simulating the dynamic interaction of a robotic arm and the Space Shuttle remote manipulator system. M.S. Thesis - George Washington Univ., Dec. 1994

NASA Technical Reports Server (NTRS)

Garrahan, Steven L.; Tolson, Robert H.; Williams, Robert L., II

1995-01-01

Industrial robots are usually attached to a rigid base. Placing the robot on a compliant base introduces dynamic coupling between the two systems. The Vehicle Emulation System (VES) is a six DOF platform that is capable of modeling this interaction. The VES employs a force-torque sensor as the interface between robot and base. A computer simulation of the VES is presented. Each of the hardware and software components is described and Simulink is used as the programming environment. The simulation performance is compared with experimental results to validate accuracy. A second simulation which models the dynamic interaction of a robot and a flexible base acts as a comparison to the simulated motion of the VES. Results are presented that compare the simulated VES motion with the motion of the VES hardware using the same admittance model. The two computer simulations are compared to determine how well the VES is expected to emulate the desired motion. Simulation results are given for robots mounted to the end effector of the Space Shuttle Remote Manipulator System (SRMS). It is shown that for fast motions of the two robots studied, the SRMS experiences disturbances on the order of centimeters. Larger disturbances are possible if different manipulators are used.

Physics-Based Hazard Assessment for Critical Structures Near Large Earthquake Sources

NASA Astrophysics Data System (ADS)

Hutchings, L.; Mert, A.; Fahjan, Y.; Novikova, T.; Golara, A.; Miah, M.; Fergany, E.; Foxall, W.

2017-09-01

We argue that for critical structures near large earthquake sources: (1) the ergodic assumption, recent history, and simplified descriptions of the hazard are not appropriate to rely on for earthquake ground motion prediction and can lead to a mis-estimation of the hazard and risk to structures; (2) a physics-based approach can address these issues; (3) a physics-based source model must be provided to generate realistic phasing effects from finite rupture and model near-source ground motion correctly; (4) wave propagations and site response should be site specific; (5) a much wider search of possible sources of ground motion can be achieved computationally with a physics-based approach; (6) unless one utilizes a physics-based approach, the hazard and risk to structures has unknown uncertainties; (7) uncertainties can be reduced with a physics-based approach, but not with an ergodic approach; (8) computational power and computer codes have advanced to the point that risk to structures can be calculated directly from source and site-specific ground motions. Spanning the variability of potential ground motion in a predictive situation is especially difficult for near-source areas, but that is the distance at which the hazard is the greatest. The basis of a "physical-based" approach is ground-motion syntheses derived from physics and an understanding of the earthquake process. This is an overview paper and results from previous studies are used to make the case for these conclusions. Our premise is that 50 years of strong motion records is insufficient to capture all possible ranges of site and propagation path conditions, rupture processes, and spatial geometric relationships between source and site. Predicting future earthquake scenarios is necessary; models that have little or no physical basis but have been tested and adjusted to fit available observations can only "predict" what happened in the past, which should be considered description as opposed to prediction. We have developed a methodology for synthesizing physics-based broadband ground motion that incorporates the effects of realistic earthquake rupture along specific faults and the actual geology between the source and site.

Hamiltonian modelling of relative motion.

PubMed

Kasdin, N Jeremy; Gurfil, Pini

2004-05-01

This paper presents a Hamiltonian approach to modelling relative spacecraft motion based on derivation of canonical coordinates for the relative state-space dynamics. The Hamiltonian formulation facilitates the modelling of high-order terms and orbital perturbations while allowing us to obtain closed-form solutions to the relative motion problem. First, the Hamiltonian is partitioned into a linear term and a high-order term. The Hamilton-Jacobi equations are solved for the linear part by separation, and new constants for the relative motions are obtained, they are called epicyclic elements. The influence of higher order terms and perturbations, such as the oblateness of the Earth, are incorporated into the analysis by a variation of parameters procedure. Closed-form solutions for J(2-) and J(4-)invariant orbits and for periodic high-order unperturbed relative motion, in terms of the relative motion elements only, are obtained.

Analyzing locomotion synthesis with feature-based motion graphs.

PubMed

Mahmudi, Mentar; Kallmann, Marcelo

2013-05-01

We propose feature-based motion graphs for realistic locomotion synthesis among obstacles. Among several advantages, feature-based motion graphs achieve improved results in search queries, eliminate the need of postprocessing for foot skating removal, and reduce the computational requirements in comparison to traditional motion graphs. Our contributions are threefold. First, we show that choosing transitions based on relevant features significantly reduces graph construction time and leads to improved search performances. Second, we employ a fast channel search method that confines the motion graph search to a free channel with guaranteed clearance among obstacles, achieving faster and improved results that avoid expensive collision checking. Lastly, we present a motion deformation model based on Inverse Kinematics applied over the transitions of a solution branch. Each transition is assigned a continuous deformation range that does not exceed the original transition cost threshold specified by the user for the graph construction. The obtained deformation improves the reachability of the feature-based motion graph and in turn also reduces the time spent during search. The results obtained by the proposed methods are evaluated and quantified, and they demonstrate significant improvements in comparison to traditional motion graph techniques.

Quantification of the uncertainty in coronary CTA plaque measurements using dynamic cardiac phantom and 3D-printed plaque models

NASA Astrophysics Data System (ADS)

Richards, Taylor; Sturgeon, Gregory M.; Ramirez-Giraldo, Juan Carlos; Rubin, Geoffrey; Segars, Paul; Samei, Ehsan

2017-03-01

The purpose of this study was to quantify the accuracy of coronary computed tomography angiography (CTA) stenosis measurements using newly developed physical coronary plaque models attached to a base dynamic cardiac phantom (Shelley Medical DHP-01). Coronary plaque models (5 mm diameter, 50% stenosis, and 32 mm long) were designed and 3D-printed with tissue equivalent materials (calcified plaque with iodine enhanced lumen). Realistic cardiac motion was achieved by fitting known cardiac motion vectors to left ventricle volume-time curves to create synchronized heart motion profiles executed by the base cardiac phantom. Realistic coronary CTA acquisition was accomplished by synthesizing corresponding ECG waveforms for gating and reconstruction purposes. All scans were acquired using a retrospective gating technique on a dual-source CT system (Siemens SOMATOM FLASH) with 75ms temporal resolution. Multi-planar reformatted images were reconstructed along vessel centerlines and the enhanced lumens were manually segmented by 5 independent operators. On average, the stenosis measurement accuracy was 0.9% positive bias for the motion free condition (0 bpm). The measurement accuracy monotonically decreased to 18.5% negative bias at 90 bpm. Contrast-tonoise (CNR), vessel circularity, and segmentation conformity also decreased monotonically with increasing heart rate. These results demonstrate successful implementation of the base cardiac phantom with 3D-printed coronary plaque models, adjustable motion profiles, and coordinated ECG waveforms. They further show the utility of the model to ascertain metrics of coronary CT accuracy and image quality under a variety of plaque, motion, and acquisition conditions.

Analysis of Ground Motion from An Underground Chemical Explosion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pitarka, Arben; Mellors, Robert J.; Walter, William R.

Here in this paper we investigate the excitation and propagation of far-field seismic waves from the 905 kg trinitrotoluene equivalent underground chemical explosion SPE-3 recorded during the Source Physics Experiment (SPE) at the Nevada National Security Site. The recorded far-field ground motion at short and long distances is characterized by substantial shear-wave energy, and large azimuthal variations in P-and S-wave amplitudes. The shear waves observed on the transverse component of sensors at epicentral distances <50 m suggests they were generated at or very near the source. The relative amplitude of the shear waves grows as the waves propagate away frommore » the source. We analyze and model the shear-wave excitation during the explosion in the 0.01–10 Hz frequency range, at epicentral distances of up to 1 km. We used two simulation techniques. One is based on the empirical isotropic Mueller–Murphy (MM) (Mueller and Murphy, 1971) nuclear explosion source model, and 3D anelastic wave propagation modeling. The second uses a physics-based approach that couples hydrodynamic modeling of the chemical explosion source with anelastic wave propagation modeling. Comparisons with recorded data show the MM source model overestimates the SPE-3 far-field ground motion by an average factor of 4. The observations show that shear waves with substantial high-frequency energy were generated at the source. However, to match the observations additional shear waves from scattering, including surface topography, and heterogeneous shallow structure contributed to the amplification of far-field shear motion. Comparisons between empirically based isotropic and physics-based anisotropic source models suggest that both wave-scattering effects and near-field nonlinear effects are needed to explain the amplitude and irregular radiation pattern of shear motion observed during the SPE-3 explosion.« less

Analysis of Ground Motion from An Underground Chemical Explosion

DOE PAGES

Pitarka, Arben; Mellors, Robert J.; Walter, William R.; ...

2015-09-08

Here in this paper we investigate the excitation and propagation of far-field seismic waves from the 905 kg trinitrotoluene equivalent underground chemical explosion SPE-3 recorded during the Source Physics Experiment (SPE) at the Nevada National Security Site. The recorded far-field ground motion at short and long distances is characterized by substantial shear-wave energy, and large azimuthal variations in P-and S-wave amplitudes. The shear waves observed on the transverse component of sensors at epicentral distances <50 m suggests they were generated at or very near the source. The relative amplitude of the shear waves grows as the waves propagate away frommore » the source. We analyze and model the shear-wave excitation during the explosion in the 0.01–10 Hz frequency range, at epicentral distances of up to 1 km. We used two simulation techniques. One is based on the empirical isotropic Mueller–Murphy (MM) (Mueller and Murphy, 1971) nuclear explosion source model, and 3D anelastic wave propagation modeling. The second uses a physics-based approach that couples hydrodynamic modeling of the chemical explosion source with anelastic wave propagation modeling. Comparisons with recorded data show the MM source model overestimates the SPE-3 far-field ground motion by an average factor of 4. The observations show that shear waves with substantial high-frequency energy were generated at the source. However, to match the observations additional shear waves from scattering, including surface topography, and heterogeneous shallow structure contributed to the amplification of far-field shear motion. Comparisons between empirically based isotropic and physics-based anisotropic source models suggest that both wave-scattering effects and near-field nonlinear effects are needed to explain the amplitude and irregular radiation pattern of shear motion observed during the SPE-3 explosion.« less

On-chip visual perception of motion: a bio-inspired connectionist model on FPGA.

PubMed

Torres-Huitzil, César; Girau, Bernard; Castellanos-Sánchez, Claudio

2005-01-01

Visual motion provides useful information to understand the dynamics of a scene to allow intelligent systems interact with their environment. Motion computation is usually restricted by real time requirements that need the design and implementation of specific hardware architectures. In this paper, the design of hardware architecture for a bio-inspired neural model for motion estimation is presented. The motion estimation is based on a strongly localized bio-inspired connectionist model with a particular adaptation of spatio-temporal Gabor-like filtering. The architecture is constituted by three main modules that perform spatial, temporal, and excitatory-inhibitory connectionist processing. The biomimetic architecture is modeled, simulated and validated in VHDL. The synthesis results on a Field Programmable Gate Array (FPGA) device show the potential achievement of real-time performance at an affordable silicon area.

Experimental validation of flexible robot arm modeling and control

NASA Technical Reports Server (NTRS)

Ulsoy, A. Galip

1989-01-01

Flexibility is important for high speed, high precision operation of lightweight manipulators. Accurate dynamic modeling of flexible robot arms is needed. Previous work has mostly been based on linear elasticity with prescribed rigid body motions (i.e., no effect of flexible motion on rigid body motion). Little or no experimental validation of dynamic models for flexible arms is available. Experimental results are also limited for flexible arm control. Researchers include the effects of prismatic as well as revolute joints. They investigate the effect of full coupling between the rigid and flexible motions, and of axial shortening, and consider the control of flexible arms using only additional sensors.

Magnetic Resonance-based Motion Correction for Quantitative PET in Simultaneous PET-MR Imaging.

PubMed

Rakvongthai, Yothin; El Fakhri, Georges

2017-07-01

Motion degrades image quality and quantitation of PET images, and is an obstacle to quantitative PET imaging. Simultaneous PET-MR offers a tool that can be used for correcting the motion in PET images by using anatomic information from MR imaging acquired concurrently. Motion correction can be performed by transforming a set of reconstructed PET images into the same frame or by incorporating the transformation into the system model and reconstructing the motion-corrected image. Several phantom and patient studies have validated that MR-based motion correction strategies have great promise for quantitative PET imaging in simultaneous PET-MR. Copyright © 2017 Elsevier Inc. All rights reserved.

A System for Video Surveillance and Monitoring CMU VSAM Final Report

DTIC Science & Technology

1999-11-30

motion-based skeletonization, neural network , spatio-temporal salience Patterns inside image chips, spurious motion rejection, model -based... network of sensors with respect to the model coordinate system, computation of 3D geolocation estimates, and graphical display of object hypotheses...rithms have been developed. The first uses view dependent visual properties to train a neural network classifier to recognize four classes: single

A vision-based system for measuring the displacements of large structures: Simultaneous adaptive calibration and full motion estimation

NASA Astrophysics Data System (ADS)

Santos, C. Almeida; Costa, C. Oliveira; Batista, J.

2016-05-01

The paper describes a kinematic model-based solution to estimate simultaneously the calibration parameters of the vision system and the full-motion (6-DOF) of large civil engineering structures, namely of long deck suspension bridges, from a sequence of stereo images captured by digital cameras. Using an arbitrary number of images and assuming a smooth structure motion, an Iterated Extended Kalman Filter is used to recursively estimate the projection matrices of the cameras and the structure full-motion (displacement and rotation) over time, helping to meet the structure health monitoring fulfilment. Results related to the performance evaluation, obtained by numerical simulation and with real experiments, are reported. The real experiments were carried out in indoor and outdoor environment using a reduced structure model to impose controlled motions. In both cases, the results obtained with a minimum setup comprising only two cameras and four non-coplanar tracking points, showed a high accuracy results for on-line camera calibration and structure full motion estimation.

Spontaneous emergence of milling (vortex state) in a Vicsek-like model

NASA Astrophysics Data System (ADS)

Costanzo, A.; Hemelrijk, C. K.

2018-04-01

Collective motion is of interest to laymen and scientists in different fields. In groups of animals, many patterns of collective motion arise such as polarized schools and mills (i.e. circular motion). Collective motion can be generated in computational models of different degrees of complexity. In these models, moving individuals coordinate with others nearby. In the more complex models, individuals attract each other, aligning their headings, and avoiding collisions. Simpler models may include only one or two of these types of interactions. The collective pattern that interests us here is milling, which is observed in many animal species. It has been reproduced in the more complex models, but not in simpler models that are based only on alignment, such as the well-known Vicsek model. Our aim is to provide insight in the minimal conditions required for milling by making minimal modifications to the Vicsek model. Our results show that milling occurs when both the field of view and the maximal angular velocity are decreased. Remarkably, apart from milling, our minimal model also exhibits many of the other patterns of collective motion observed in animal groups.

Comparison of hydrological signal in polar motion excitation with those based on the FGOALS-g2 climate model

NASA Astrophysics Data System (ADS)

Wińska, Małgorzata; Nastula, Jolanta; Salstein, David

2016-04-01

Our investigations are focused on the influence of different land hydrosphere surface parameters (precipitation, evaporation, total runoff, soil moisture, accumulated snow) on polar motion excitation functions at seasonal and nonseasonal timescales. Here these different variables are obtained from the Flexible Global Ocean-Atmosphere-Land System Model, Grid point Version 2 (FGOALS-g2), which is a climate model from the fifth phase of the Coupled Model Intercomparison Project (CMIP5); with CMIP5 being composed of separate component models of the atmosphere, ocean, sea ice, and land surface. In this study Terrestrial Water Storage TWS changes were determined as: differences between the precipitation, evaporation and total surface runoff content, and as the total soil moisture content being a sum of soil moisture and snowfall flux changes. We compare the model-based data with those from estimates of the Equivalent Water Thickness determined by GRACE satellite observations from the Center for Space Research (CSR). The transfer of angular momentum from global geophysical fluids to the solid Earth is described by the equatorial components χ1 and χ2 of the polar motion excitation functions. Observationally, these so-called geodetic excitation functions of polar motion can be determined on the basis of the equations of motion by using observed x, y components of the pole. The second-degree, first-order coefficients of the Earth gravity field are proportional to variations of the equatorial component χ1, χ2 of the series of the gravimetric excitation function of polar motion. This gravimetric function can be compared with the mass term of geodetic excitation of polar motion. Our analysis comprises (1) determinations and comparisons of regional patterns of hydrological excitation functions of polar motion, and (2) comparison of the global hydrological function determined from the FGOALS-g2 and GRACE data with a hydrological signal in the geodetic excitation function of polar motion, determined as a residual geodetic and atmospheric plus oceanic excitations.

Engineering uses of physics-based ground motion simulations

USGS Publications Warehouse

Baker, Jack W.; Luco, Nicolas; Abrahamson, Norman A.; Graves, Robert W.; Maechling, Phillip J.; Olsen, Kim B.

2014-01-01

This paper summarizes validation methodologies focused on enabling ground motion simulations to be used with confidence in engineering applications such as seismic hazard analysis and dynmaic analysis of structural and geotechnical systems. Numberical simullation of ground motion from large erthquakes, utilizing physics-based models of earthquake rupture and wave propagation, is an area of active research in the earth science community. Refinement and validatoin of these models require collaboration between earthquake scientists and engineering users, and testing/rating methodolgies for simulated ground motions to be used with confidence in engineering applications. This paper provides an introduction to this field and an overview of current research activities being coordinated by the Souther California Earthquake Center (SCEC). These activities are related both to advancing the science and computational infrastructure needed to produce ground motion simulations, as well as to engineering validation procedures. Current research areas and anticipated future achievements are also discussed.

A true polar wander model for Neoproterozoic plate motions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ripperdan, R.L.

1992-01-01

Recent paleogeographic reconstructions for the interval 750--500 Ma (Neoproterozoic to Late Cambrian) require rapid rates of plate motion and/or rotation around an equatorial Euler pole to accommodate reconstructions for the Early Paleozoic. Motions of this magnitude appear to be very uncommon during the Phanerozoic. A model for plate motions based on the hypothesis that discrete intervals of rapid true polar wander (RTPW) occurred during the Neoproterozoic can account for the paleogeographic changes with minimum amounts of plate motion. The model uses the paleogeographic reconstructions of Hoffman (1991). The following constraints were applied during derivation of the model: (1) relative motionsmore » between major continental units were restricted to be combinations of great circle or small circle translations with Euler poles of rotation = spin axis; (2) maximum rates of relative translational plate motion were 0.2 m/yr. Based on these constraints, two separate sets of synthetic plate motion trajectories were determined. The sequence of events in both can be summarized as: (1) A rapid true polar wander event of ca 90[degree] rafting a supercontinent to the spin axis; (2) breakup of the polar supercontinent into two fragments, one with the Congo, West Africa, Amazonia, and Baltica cratons, the other with the Laurentia, East Gondwana, and Kalahari cratons; (3) great circle motion of the blocks towards the equator; (4) small circle motion leading to amalgamation of Gondwana and separation of Laurentia and Baltica. In alternative 1, rifting initiates between East Antarctica and Laurentia and one episode of RTPW is required. Alternative 2 requires two episodes of RTPW; and that rifting occurred first along the eastern margin and later along the western margin of Laurentia. Synthetic plate motion trajectories are compared to existing paleomagnetic and geological data, and implications of the model for paleoclimatic changes during the Neoproterozoic are discussed.« less

Dynamic modeling and motion simulation for a winged hybrid-driven underwater glider

NASA Astrophysics Data System (ADS)

Wang, Shu-Xin; Sun, Xiu-Jun; Wang, Yan-Hui; Wu, Jian-Guo; Wang, Xiao-Ming

2011-03-01

PETREL, a winged hybrid-driven underwater glider is a novel and practical marine survey platform which combines the features of legacy underwater glider and conventional AUV (autonomous underwater vehicle). It can be treated as a multi-rigid-body system with a floating base and a particular hydrodynamic profile. In this paper, theorems on linear and angular momentum are used to establish the dynamic equations of motion of each rigid body and the effect of translational and rotational motion of internal masses on the attitude control are taken into consideration. In addition, due to the unique external shape with fixed wings and deflectable rudders and the dual-drive operation in thrust and glide modes, the approaches of building dynamic model of conventional AUV and hydrodynamic model of submarine are introduced, and the tailored dynamic equations of the hybrid glider are formulated. Moreover, the behaviors of motion in glide and thrust operation are analyzed based on the simulation and the feasibility of the dynamic model is validated by data from lake field trials.

Seeing blur: 'motion sharpening' without motion.

PubMed Central

Georgeson, Mark A; Hammett, Stephen T

2002-01-01

It is widely supposed that things tend to look blurred when they are moving fast. Previous work has shown that this is true for sharp edges but, paradoxically, blurred edges look sharper when they are moving than when stationary. This is 'motion sharpening'. We show that blurred edges also look up to 50% sharper when they are presented briefly (8-24 ms) than at longer durations (100-500 ms) without motion. This argues strongly against high-level models of sharpening based specifically on compensation for motion blur. It also argues against a recent, low-level, linear filter model that requires motion to produce sharpening. No linear filter model can explain our finding that sharpening was similar for sinusoidal and non-sinusoidal gratings, since linear filters can never distort sine waves. We also conclude that the idea of a 'default' assumption of sharpness is not supported by experimental evidence. A possible source of sharpening is a nonlinearity in the contrast response of early visual mechanisms to fast or transient temporal changes, perhaps based on the magnocellular (M-cell) pathway. Our finding that sharpening is not diminished at low contrast sets strong constraints on the nature of the nonlinearity. PMID:12137571

Exploring the effect of East Antarctic ice mass loss on GIA-induced horizontal bedrock motions

NASA Astrophysics Data System (ADS)

Konfal, S. A.; Whitehouse, P. L.; Hermans, T.; van der Wal, W.; Wilson, T. J.; Bevis, M. G.; Kendrick, E. C.; Dalziel, I.; Smalley, R., Jr.

2017-12-01

Ice history inputs used in Antarctic models of GIA include major centers of ice mass loss in West Antarctica. In the Transantarctic Mountains (TAM) region spanning the boundary between East and West Antarctica, horizontal crustal motions derived from GPS observations from the Antarctic Network (ANET) component of the Polar Earth Observing Network (POLENET) are towards these West Antarctic ice mass centers, opposite to the pattern of radial crustal motion expected in an unloading scenario. We investigate alternative ice history and earth structure inputs to GIA models in an attempt to reproduce observed crustal motions in the region. The W12 ice history model is altered to create scenarios including ice unloading in the Wilkes Subglacial Basin based on available glaciological records. These altered ice history models, along with the unmodified W12 ice history model, are coupled with 60 radially varying (1D) earth model combinations, including approximations of optimal earth profiles identified in published GIA models. The resulting model-predicted motions utilizing both the modified and unmodified ice history models fit ANET GPS-derived crustal motions in the northern TAM region for a suite of earth model combinations. Further south, where the influence of simulated Wilkes unloading is weakest and West Antarctic unloading is strongest, observed and predicted motions do not agree. The influence of simulated Wilkes ice unloading coupled with laterally heterogeneous earth models is also investigated. The resulting model-predicted motions do not differ significantly between the original W12 and W12 with simulated Wilkes unloading ice histories.

Analytical evaluation of two motion washout techniques

NASA Technical Reports Server (NTRS)

Young, L. R.

1977-01-01

Practical tools were developed which extend the state of the art of moving base flight simulation for research and training purposes. The use of visual and vestibular cues to minimize the actual motion of the simulator itself was a primary consideration. The investigation consisted of optimum programming of motion cues based on a physiological model of the vestibular system to yield 'ideal washout logic' for any given simulator constraints.

The application of mean field theory to image motion estimation.

PubMed

Zhang, J; Hanauer, G G

1995-01-01

Previously, Markov random field (MRF) model-based techniques have been proposed for image motion estimation. Since motion estimation is usually an ill-posed problem, various constraints are needed to obtain a unique and stable solution. The main advantage of the MRF approach is its capacity to incorporate such constraints, for instance, motion continuity within an object and motion discontinuity at the boundaries between objects. In the MRF approach, motion estimation is often formulated as an optimization problem, and two frequently used optimization methods are simulated annealing (SA) and iterative-conditional mode (ICM). Although the SA is theoretically optimal in the sense of finding the global optimum, it usually takes many iterations to converge. The ICM, on the other hand, converges quickly, but its results are often unsatisfactory due to its "hard decision" nature. Previously, the authors have applied the mean field theory to image segmentation and image restoration problems. It provides results nearly as good as SA but with much faster convergence. The present paper shows how the mean field theory can be applied to MRF model-based motion estimation. This approach is demonstrated on both synthetic and real-world images, where it produced good motion estimates.

Ground Motion in Central Mexico: A Comprehensive Analysis

NASA Astrophysics Data System (ADS)

Ramirez-Guzman, L.; Juarez, A.; Rábade, S.; Aguirre, J.; Bielak, J.

2015-12-01

This study presents a detailed analysis of the ground motion in Central Mexico based on numerical simulations, as well as broadband and strong ground motion records. We describe and evaluate a velocity model for Central Mexico derived from noise and regional earthquake cross-correlations, which is used throughout this research to estimate the ground motion in the region. The 3D crustal model includes a geotechnical structure of the Valley of Mexico (VM), subduction zone geometry, and 3D velocity distributions. The latter are based on more than 200 low magnitude (Mw < 4.5) earthquakes and two years of noise recordings. We emphasize the analysis on the ground motion in the Valley of Mexico originating from intra-slab deep events and temblors located along the Pacific coast. Also, we quantify the effects Trans-Mexican Volcanic Belt (TMVB) and the low-velocity deposits on the ground motion. The 3D octree-based finite element wave propagation computations, valid up to 1 Hz, reveal that the inclusion of a basin with a structure as complex as the Valley of Mexico dramatically enhances the regional effects induced by the TMVB. Moreover, the basin not only produces ground motion amplification and anomalous duration, but it also favors the energy focusing into zones of Mexico City where structures typically undergo high levels of damage.

Structured Kernel Subspace Learning for Autonomous Robot Navigation.

PubMed

Kim, Eunwoo; Choi, Sungjoon; Oh, Songhwai

2018-02-14

This paper considers two important problems for autonomous robot navigation in a dynamic environment, where the goal is to predict pedestrian motion and control a robot with the prediction for safe navigation. While there are several methods for predicting the motion of a pedestrian and controlling a robot to avoid incoming pedestrians, it is still difficult to safely navigate in a dynamic environment due to challenges, such as the varying quality and complexity of training data with unwanted noises. This paper addresses these challenges simultaneously by proposing a robust kernel subspace learning algorithm based on the recent advances in nuclear-norm and l 1 -norm minimization. We model the motion of a pedestrian and the robot controller using Gaussian processes. The proposed method efficiently approximates a kernel matrix used in Gaussian process regression by learning low-rank structured matrix (with symmetric positive semi-definiteness) to find an orthogonal basis, which eliminates the effects of erroneous and inconsistent data. Based on structured kernel subspace learning, we propose a robust motion model and motion controller for safe navigation in dynamic environments. We evaluate the proposed robust kernel learning in various tasks, including regression, motion prediction, and motion control problems, and demonstrate that the proposed learning-based systems are robust against outliers and outperform existing regression and navigation methods.

Orthogonal-blendshape-based editing system for facial motion capture data.

PubMed

Li, Qing; Deng, Zhigang

2008-01-01

The authors present a novel data-driven 3D facial motion capture data editing system using automated construction of an orthogonal blendshape face model and constrained weight propagation, aiming to bridge the popular facial motion capture technique and blendshape approach. In this work, a 3D facial-motion-capture-editing problem is transformed to a blendshape-animation-editing problem. Given a collected facial motion capture data set, we construct a truncated PCA space spanned by the greatest retained eigenvectors and a corresponding blendshape face model for each anatomical region of the human face. As such, modifying blendshape weights (PCA coefficients) is equivalent to editing their corresponding motion capture sequence. In addition, a constrained weight propagation technique allows animators to balance automation and flexible controls.

A 4DCT imaging-based breathing lung model with relative hysteresis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyawaki, Shinjiro; Choi, Sanghun; Hoffman, Eric A.

To reproduce realistic airway motion and airflow, the authors developed a deforming lung computational fluid dynamics (CFD) model based on four-dimensional (4D, space and time) dynamic computed tomography (CT) images. A total of 13 time points within controlled tidal volume respiration were used to account for realistic and irregular lung motion in human volunteers. Because of the irregular motion of 4DCT-based airways, we identified an optimal interpolation method for airway surface deformation during respiration, and implemented a computational solid mechanics-based moving mesh algorithm to produce smooth deforming airway mesh. In addition, we developed physiologically realistic airflow boundary conditions for bothmore » models based on multiple images and a single image. Furthermore, we examined simplified models based on one or two dynamic or static images. By comparing these simplified models with the model based on 13 dynamic images, we investigated the effects of relative hysteresis of lung structure with respect to lung volume, lung deformation, and imaging methods, i.e., dynamic vs. static scans, on CFD-predicted pressure drop. The effect of imaging method on pressure drop was 24 percentage points due to the differences in airflow distribution and airway geometry. - Highlights: • We developed a breathing human lung CFD model based on 4D-dynamic CT images. • The 4DCT-based breathing lung model is able to capture lung relative hysteresis. • A new boundary condition for lung model based on one static CT image was proposed. • The difference between lung models based on 4D and static CT images was quantified.« less

Seismic response evaluation of base-isolated reinforced concrete buildings under bidirectional excitation

NASA Astrophysics Data System (ADS)

Bhagat, Satish; Wijeyewickrema, Anil C.

2017-04-01

This paper reports on an investigation of the seismic response of base-isolated reinforced concrete buildings, which considers various isolation system parameters under bidirectional near-fault and far-fault motions. Three-dimensional models of 4-, 8-, and 12-story base-isolated buildings with nonlinear effects in the isolation system and the superstructure are investigated, and nonlinear response history analysis is carried out. The bounding values of isolation system properties that incorporate the aging effect of isolators are also taken into account, as is the current state of practice in the design and analysis of base-isolated buildings. The response indicators of the buildings are studied for near-fault and far-fault motions weight-scaled to represent the design earthquake (DE) level and the risk-targeted maximum considered earthquake (MCER) level. Results of the nonlinear response history analyses indicate no structural damage under DE-level motions for near-fault and far-fault motions and for MCER-level far-fault motions, whereas minor structural damage is observed under MCER-level near-fault motions. Results of the base-isolated buildings are compared with their fixed-base counterparts. Significant reduction of the superstructure response of the 12-story base-isolated building compared to the fixed-base condition indicates that base isolation can be effectively used in taller buildings to enhance performance. Additionally, the applicability of a rigid superstructure to predict the isolator displacement demand is also investigated. It is found that the isolator displacements can be estimated accurately using a rigid body model for the superstructure for the buildings considered.

Motion-based prediction is sufficient to solve the aperture problem

PubMed Central

Perrinet, Laurent U; Masson, Guillaume S

2012-01-01

In low-level sensory systems, it is still unclear how the noisy information collected locally by neurons may give rise to a coherent global percept. This is well demonstrated for the detection of motion in the aperture problem: as luminance of an elongated line is symmetrical along its axis, tangential velocity is ambiguous when measured locally. Here, we develop the hypothesis that motion-based predictive coding is sufficient to infer global motion. Our implementation is based on a context-dependent diffusion of a probabilistic representation of motion. We observe in simulations a progressive solution to the aperture problem similar to physiology and behavior. We demonstrate that this solution is the result of two underlying mechanisms. First, we demonstrate the formation of a tracking behavior favoring temporally coherent features independently of their texture. Second, we observe that incoherent features are explained away while coherent information diffuses progressively to the global scale. Most previous models included ad-hoc mechanisms such as end-stopped cells or a selection layer to track specific luminance-based features as necessary conditions to solve the aperture problem. Here, we have proved that motion-based predictive coding, as it is implemented in this functional model, is sufficient to solve the aperture problem. This solution may give insights in the role of prediction underlying a large class of sensory computations. PMID:22734489

Global plate motion frames: Toward a unified model

NASA Astrophysics Data System (ADS)

Torsvik, Trond H.; Müller, R. Dietmar; van der Voo, Rob; Steinberger, Bernhard; Gaina, Carmen

2008-09-01

Plate tectonics constitutes our primary framework for understanding how the Earth works over geological timescales. High-resolution mapping of relative plate motions based on marine geophysical data has followed the discovery of geomagnetic reversals, mid-ocean ridges, transform faults, and seafloor spreading, cementing the plate tectonic paradigm. However, so-called "absolute plate motions," describing how the fragments of the outer shell of the Earth have moved relative to a reference system such as the Earth's mantle, are still poorly understood. Accurate absolute plate motion models are essential surface boundary conditions for mantle convection models as well as for understanding past ocean circulation and climate as continent-ocean distributions change with time. A fundamental problem with deciphering absolute plate motions is that the Earth's rotation axis and the averaged magnetic dipole axis are not necessarily fixed to the mantle reference system. Absolute plate motion models based on volcanic hot spot tracks are largely confined to the last 130 Ma and ideally would require knowledge about the motions within the convecting mantle. In contrast, models based on paleomagnetic data reflect plate motion relative to the magnetic dipole axis for most of Earth's history but cannot provide paleolongitudes because of the axial symmetry of the Earth's magnetic dipole field. We analyze four different reference frames (paleomagnetic, African fixed hot spot, African moving hot spot, and global moving hot spot), discuss their uncertainties, and develop a unifying approach for connecting a hot spot track system and a paleomagnetic absolute plate reference system into a "hybrid" model for the time period from the assembly of Pangea (˜320 Ma) to the present. For the last 100 Ma we use a moving hot spot reference frame that takes mantle convection into account, and we connect this to a pre-100 Ma global paleomagnetic frame adjusted 5° in longitude to smooth the reference frame transition. Using plate driving force arguments and the mapping of reconstructed large igneous provinces to core-mantle boundary topography, we argue that continental paleolongitudes can be constrained with reasonable confidence.

Example-Based Automatic Music-Driven Conventional Dance Motion Synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Songhua; Fan, Rukun; Geng, Weidong

We introduce a novel method for synthesizing dance motions that follow the emotions and contents of a piece of music. Our method employs a learning-based approach to model the music to motion mapping relationship embodied in example dance motions along with those motions' accompanying background music. A key step in our method is to train a music to motion matching quality rating function through learning the music to motion mapping relationship exhibited in synchronized music and dance motion data, which were captured from professional human dance performance. To generate an optimal sequence of dance motion segments to match with amore » piece of music, we introduce a constraint-based dynamic programming procedure. This procedure considers both music to motion matching quality and visual smoothness of a resultant dance motion sequence. We also introduce a two-way evaluation strategy, coupled with a GPU-based implementation, through which we can execute the dynamic programming process in parallel, resulting in significant speedup. To evaluate the effectiveness of our method, we quantitatively compare the dance motions synthesized by our method with motion synthesis results by several peer methods using the motions captured from professional human dancers' performance as the gold standard. We also conducted several medium-scale user studies to explore how perceptually our dance motion synthesis method can outperform existing methods in synthesizing dance motions to match with a piece of music. These user studies produced very positive results on our music-driven dance motion synthesis experiments for several Asian dance genres, confirming the advantages of our method.« less

Correspondence model-based 4D VMAT dose simulation for analysis of local metastasis recurrence after extracranial SBRT

NASA Astrophysics Data System (ADS)

Sothmann, T.; Gauer, T.; Wilms, M.; Werner, R.

2017-12-01

The purpose of this study is to introduce a novel approach to incorporate patient-specific breathing variability information into 4D dose simulation of volumetric arc therapy (VMAT)-based stereotactic body radiotherapy (SBRT) of extracranial metastases. Feasibility of the approach is illustrated by application to treatment planning and motion data of lung and liver metastasis patients. The novel 4D dose simulation approach makes use of a regression-based correspondence model that allows representing patient motion variability by breathing signal-steered interpolation and extrapolation of deformable image registration motion fields. To predict the internal patient motion during treatment with only external breathing signal measurements being available, the patients’ internal motion information and external breathing signals acquired during 4D CT imaging were correlated. Combining the correspondence model, patient-specific breathing signal measurements during treatment and time-resolved information about dose delivery, reconstruction of a motion variability-affected dose becomes possible. As a proof of concept, the proposed approach is illustrated by a retrospective 4D simulation of VMAT-based SBRT treatment of ten patients with 15 treated lung and liver metastases and known clinical endpoints for the individual metastases (local metastasis recurrence yes/no). Resulting 4D-simulated dose distributions were compared to motion-affected dose distributions estimated by standard 4D CT-only dose accumulation and the originally (i.e. statically) planned dose distributions by means of GTV D98 indices (dose to 98% of the GTV volume). A potential linkage of metastasis-specific endpoints to differences between GTV D98 indices of planned and 4D-simulated dose distributions was analyzed.

An MR-based Model for Cardio-Respiratory Motion Compensation of Overlays in X-Ray Fluoroscopy

PubMed Central

Fischer, Peter; Faranesh, Anthony; Pohl, Thomas; Maier, Andreas; Rogers, Toby; Ratnayaka, Kanishka; Lederman, Robert; Hornegger, Joachim

2017-01-01

In X-ray fluoroscopy, static overlays are used to visualize soft tissue. We propose a system for cardiac and respiratory motion compensation of these overlays. It consists of a 3-D motion model created from real-time MR imaging. Multiple sagittal slices are acquired and retrospectively stacked to consistent 3-D volumes. Slice stacking considers cardiac information derived from the ECG and respiratory information extracted from the images. Additionally, temporal smoothness of the stacking is enhanced. Motion is estimated from the MR volumes using deformable 3-D/3-D registration. The motion model itself is a linear direct correspondence model using the same surrogate signals as slice stacking. In X-ray fluoroscopy, only the surrogate signals need to be extracted to apply the motion model and animate the overlay in real time. For evaluation, points are manually annotated in oblique MR slices and in contrast-enhanced X-ray images. The 2-D Euclidean distance of these points is reduced from 3.85 mm to 2.75 mm in MR and from 3.0 mm to 1.8 mm in X-ray compared to the static baseline. Furthermore, the motion-compensated overlays are shown qualitatively as images and videos. PMID:28692969

Comparison of hydrological and GRACE-based excitation functions of polar motion in the seasonal spectral band

NASA Astrophysics Data System (ADS)

Nastula, J.; Kolaczek, B.; Salstein, D. A.

2008-04-01

Understanding changes in the global balance of the Earths angular momentum due to the mass redistribution of geophysical fluids is needed to explain the observed polar motion. The impact of continental hydrologic signals, from land water, snow, and ice, on polar motion excitation (hydrological angular momentum-HAM), is still inadequately known. Although estimates of HAM have been made from several models of global hydrology based upon the observed distribution of surface water, snow, and soil moisture, the relatively sparse observation network and the presence of errors in the data and the geophysical fluid models preclude a full understanding of the HAM influence on polar motion variations. Recently the GRACE mission monitoring Earths time variable gravity field has allowed us to determine the mass term of polar motion excitation functions and compare them with the mass term derivable as a residual from the geodetic excitation functions and geophysical fluid motion terms on seasonal time scales. Differences between these mass terms in the years 2004 - 2005.5 are still on the order of 20 mas. Besides the overall mass excitation of polar motion comparisons with GRACE (RL04-release), we also intercompare the non-atmospheric, non-oceanic signals in the mass term of geodetic polar motion excitation with hydrological excitation of polar motion.

Biogeography-based combinatorial strategy for efficient autonomous underwater vehicle motion planning and task-time management

NASA Astrophysics Data System (ADS)

Zadeh, S. M.; Powers, D. M. W.; Sammut, K.; Yazdani, A. M.

2016-12-01

Autonomous Underwater Vehicles (AUVs) are capable of spending long periods of time for carrying out various underwater missions and marine tasks. In this paper, a novel conflict-free motion planning framework is introduced to enhance underwater vehicle's mission performance by completing maximum number of highest priority tasks in a limited time through a large scale waypoint cluttered operating field, and ensuring safe deployment during the mission. The proposed combinatorial route-path planner model takes the advantages of the Biogeography-Based Optimization (BBO) algorithm toward satisfying objectives of both higher-lower level motion planners and guarantees maximization of the mission productivity for a single vehicle operation. The performance of the model is investigated under different scenarios including the particular cost constraints in time-varying operating fields. To show the reliability of the proposed model, performance of each motion planner assessed separately and then statistical analysis is undertaken to evaluate the total performance of the entire model. The simulation results indicate the stability of the contributed model and its feasible application for real experiments.

Hand-writing motion tracking with vision-inertial sensor fusion: calibration and error correction.

PubMed

Zhou, Shengli; Fei, Fei; Zhang, Guanglie; Liu, Yunhui; Li, Wen J

2014-08-25

The purpose of this study was to improve the accuracy of real-time ego-motion tracking through inertial sensor and vision sensor fusion. Due to low sampling rates supported by web-based vision sensor and accumulation of errors in inertial sensors, ego-motion tracking with vision sensors is commonly afflicted by slow updating rates, while motion tracking with inertial sensor suffers from rapid deterioration in accuracy with time. This paper starts with a discussion of developed algorithms for calibrating two relative rotations of the system using only one reference image. Next, stochastic noises associated with the inertial sensor are identified using Allan Variance analysis, and modeled according to their characteristics. Finally, the proposed models are incorporated into an extended Kalman filter for inertial sensor and vision sensor fusion. Compared with results from conventional sensor fusion models, we have shown that ego-motion tracking can be greatly enhanced using the proposed error correction model.

Motion-based prediction explains the role of tracking in motion extrapolation.

PubMed

Khoei, Mina A; Masson, Guillaume S; Perrinet, Laurent U

2013-11-01

During normal viewing, the continuous stream of visual input is regularly interrupted, for instance by blinks of the eye. Despite these frequents blanks (that is the transient absence of a raw sensory source), the visual system is most often able to maintain a continuous representation of motion. For instance, it maintains the movement of the eye such as to stabilize the image of an object. This ability suggests the existence of a generic neural mechanism of motion extrapolation to deal with fragmented inputs. In this paper, we have modeled how the visual system may extrapolate the trajectory of an object during a blank using motion-based prediction. This implies that using a prior on the coherency of motion, the system may integrate previous motion information even in the absence of a stimulus. In order to compare with experimental results, we simulated tracking velocity responses. We found that the response of the motion integration process to a blanked trajectory pauses at the onset of the blank, but that it quickly recovers the information on the trajectory after reappearance. This is compatible with behavioral and neural observations on motion extrapolation. To understand these mechanisms, we have recorded the response of the model to a noisy stimulus. Crucially, we found that motion-based prediction acted at the global level as a gain control mechanism and that we could switch from a smooth regime to a binary tracking behavior where the dot is tracked or lost. Our results imply that a local prior implementing motion-based prediction is sufficient to explain a large range of neural and behavioral results at a more global level. We show that the tracking behavior deteriorates for sensory noise levels higher than a certain value, where motion coherency and predictability fail to hold longer. In particular, we found that motion-based prediction leads to the emergence of a tracking behavior only when enough information from the trajectory has been accumulated. Then, during tracking, trajectory estimation is robust to blanks even in the presence of relatively high levels of noise. Moreover, we found that tracking is necessary for motion extrapolation, this calls for further experimental work exploring the role of noise in motion extrapolation. Copyright © 2013 Elsevier Ltd. All rights reserved.

A method of depth image based human action recognition

NASA Astrophysics Data System (ADS)

Li, Pei; Cheng, Wanli

2017-05-01

In this paper, we propose an action recognition algorithm framework based on human skeleton joint information. In order to extract the feature of human motion, we use the information of body posture, speed and acceleration of movement to construct spatial motion feature that can describe and reflect the joint. On the other hand, we use the classical temporal pyramid matching algorithm to construct temporal feature and describe the motion sequence variation from different time scales. Then, we use bag of words to represent these actions, which is to present every action in the histogram by clustering these extracted feature. Finally, we employ Hidden Markov Model to train and test the extracted motion features. In the experimental part, the correctness and effectiveness of the proposed model are comprehensively verified on two well-known datasets.

Models for the Effects of G-seat Cuing on Roll-axis Tracking Performance

NASA Technical Reports Server (NTRS)

Levison, W. H.; Mcmillan, G. R.; Martin, E. A.

1984-01-01

Including whole-body motion in a flight simulator improves performance for a variety of tasks requiring a pilot to compensate for the effects of unexpected disturbances. A possible mechanism for this improvement is that whole-body motion provides high derivative vehicle state information whic allows the pilot to generate more lead in responding to the external disturbances. During development of motion simulating algorithms for an advanced g-cuing system it was discovered that an algorithm based on aircraft roll acceleration producted little or no performance improvement. On the other hand, algorithms based on roll position or roll velocity produced performance equivalent to whole-body motion. The analysis and modeling conducted at both the sensory system and manual control performance levels to explain the above results are described.

Motion-adapted catheter navigation with real-time instantiation and improved visualisation

PubMed Central

Kwok, Ka-Wai; Wang, Lichao; Riga, Celia; Bicknell, Colin; Cheshire, Nicholas; Yang, Guang-Zhong

2014-01-01

The improvements to catheter manipulation by the use of robot-assisted catheter navigation for endovascular procedures include increased precision, stability of motion and operator comfort. However, navigation through the vasculature under fluoroscopic guidance is still challenging, mostly due to physiological motion and when tortuous vessels are involved. In this paper, we propose a motion-adaptive catheter navigation scheme based on shape modelling to compensate for these dynamic effects, permitting predictive and dynamic navigations. This allows for timed manipulations synchronised with the vascular motion. The technical contribution of the paper includes the following two aspects. Firstly, a dynamic shape modelling and real-time instantiation scheme based on sparse data obtained intra-operatively is proposed for improved visualisation of the 3D vasculature during endovascular intervention. Secondly, a reconstructed frontal view from the catheter tip using the derived dynamic model is used as an interventional aid to user guidance. To demonstrate the practical value of the proposed framework, a simulated aortic branch cannulation procedure is used with detailed user validation to demonstrate the improvement in navigation quality and efficiency. PMID:24744817

Motion-adaptive model-assisted compatible coding with spatiotemporal scalability

NASA Astrophysics Data System (ADS)

Lee, JaeBeom; Eleftheriadis, Alexandros

1997-01-01

We introduce the concept of motion adaptive spatio-temporal model-assisted compatible (MA-STMAC) coding, a technique to selectively encode areas of different importance to the human eye in terms of space and time in moving images with the consideration of object motion. PRevious STMAC was proposed base don the fact that human 'eye contact' and 'lip synchronization' are very important in person-to-person communication. Several areas including the eyes and lips need different types of quality, since different areas have different perceptual significance to human observers. The approach provides a better rate-distortion tradeoff than conventional image coding techniques base don MPEG-1, MPEG- 2, H.261, as well as H.263. STMAC coding is applied on top of an encoder, taking full advantage of its core design. Model motion tracking in our previous STMAC approach was not automatic. The proposed MA-STMAC coding considers the motion of the human face within the STMAC concept using automatic area detection. Experimental results are given using ITU-T H.263, addressing very low bit-rate compression.

Color-gradient lattice Boltzmann model for simulating droplet motion with contact-angle hysteresis.

PubMed

Ba, Yan; Liu, Haihu; Sun, Jinju; Zheng, Rongye

2013-10-01

Lattice Boltzmann method (LBM) is an effective tool for simulating the contact-line motion due to the nature of its microscopic dynamics. In contact-line motion, contact-angle hysteresis is an inherent phenomenon, but it is neglected in most existing color-gradient based LBMs. In this paper, a color-gradient based multiphase LBM is developed to simulate the contact-line motion, particularly with the hysteresis of contact angle involved. In this model, the perturbation operator based on the continuum surface force concept is introduced to model the interfacial tension, and the recoloring operator proposed by Latva-Kokko and Rothman is used to produce phase segregation and resolve the lattice pinning problem. At the solid surface, the color-conserving wetting boundary condition [Hollis et al., IMA J. Appl. Math. 76, 726 (2011)] is applied to improve the accuracy of simulations and suppress spurious currents at the contact line. In particular, we present a numerical algorithm to allow for the effect of the contact-angle hysteresis, in which an iterative procedure is used to determine the dynamic contact angle. Numerical simulations are conducted to verify the developed model, including the droplet partial wetting process and droplet dynamical behavior in a simple shear flow. The obtained results are compared with theoretical solutions and experimental data, indicating that the model is able to predict the equilibrium droplet shape as well as the dynamic process of partial wetting and thus permits accurate prediction of contact-line motion with the consideration of contact-angle hysteresis.

Model-based extended quaternion Kalman filter to inertial orientation tracking of arbitrary kinematic chains.

PubMed

Szczęsna, Agnieszka; Pruszowski, Przemysław

2016-01-01

Inertial orientation tracking is still an area of active research, especially in the context of out-door, real-time, human motion capture. Existing systems either propose loosely coupled tracking approaches where each segment is considered independently, taking the resulting drawbacks into account, or tightly coupled solutions that are limited to a fixed chain with few segments. Such solutions have no flexibility to change the skeleton structure, are dedicated to a specific set of joints, and have high computational complexity. This paper describes the proposal of a new model-based extended quaternion Kalman filter that allows for estimation of orientation based on outputs from the inertial measurements unit sensors. The filter considers interdependencies resulting from the construction of the kinematic chain so that the orientation estimation is more accurate. The proposed solution is a universal filter that does not predetermine the degree of freedom at the connections between segments of the model. To validation the motion of 3-segments single link pendulum captured by optical motion capture system is used. The next step in the research will be to use this method for inertial motion capture with a human skeleton model.

Error-compensation model for simultaneous measurement of five degrees of freedom motion errors of a rotary axis

NASA Astrophysics Data System (ADS)

Bao, Chuanchen; Li, Jiakun; Feng, Qibo; Zhang, Bin

2018-07-01

This paper introduces an error-compensation model for our measurement method to measure five motion errors of a rotary axis based on fibre laser collimation. The error-compensation model is established in a matrix form using the homogeneous coordinate transformation theory. The influences of the installation errors, error crosstalk, and manufacturing errors are analysed. The model is verified by both ZEMAX simulation and measurement experiments. The repeatability values of the radial and axial motion errors are significantly suppressed by more than 50% after compensation. The repeatability experiments of five degrees of freedom motion errors and the comparison experiments of two degrees of freedom motion errors of an indexing table were performed by our measuring device and a standard instrument. The results show that the repeatability values of the angular positioning error ε z and tilt motion error around the Y axis ε y are 1.2″ and 4.4″, and the comparison deviations of the two motion errors are 4.0″ and 4.4″, respectively. The repeatability values of the radial and axial motion errors, δ y and δ z , are 1.3 and 0.6 µm, respectively. The repeatability value of the tilt motion error around the X axis ε x is 3.8″.

Stock price prediction using geometric Brownian motion

NASA Astrophysics Data System (ADS)

Farida Agustini, W.; Restu Affianti, Ika; Putri, Endah RM

2018-03-01

Geometric Brownian motion is a mathematical model for predicting the future price of stock. The phase that done before stock price prediction is determine stock expected price formulation and determine the confidence level of 95%. On stock price prediction using geometric Brownian Motion model, the algorithm starts from calculating the value of return, followed by estimating value of volatility and drift, obtain the stock price forecast, calculating the forecast MAPE, calculating the stock expected price and calculating the confidence level of 95%. Based on the research, the output analysis shows that geometric Brownian motion model is the prediction technique with high rate of accuracy. It is proven with forecast MAPE value ≤ 20%.

Perceived health from biological motion predicts voting behaviour.

PubMed

Kramer, Robin S S; Arend, Isabel; Ward, Robert

2010-04-01

Body motion signals socially relevant traits like the sex, age, and even the genetic quality of actors and may therefore facilitate various social judgements. By examining ratings and voting decisions based solely on body motion of political candidates, we considered how the candidates' motion affected people's judgements and voting behaviour. In two experiments, participants viewed stick figure motion displays made from videos of politicians in public debate. Participants rated the motion displays for a variety of social traits and then indicated their vote preference. In both experiments, perceived physical health was the single best predictor of vote choice, and no two-factor model produced significant improvement. Notably, although attractiveness and leadership correlated with voting behaviour, neither provided additional explanatory power to a single-factor model of health alone. Our results demonstrate for the first time that motion can produce systematic vote preferences.

Image-driven, model-based 3D abdominal motion estimation for MR-guided radiotherapy

NASA Astrophysics Data System (ADS)

Stemkens, Bjorn; Tijssen, Rob H. N.; de Senneville, Baudouin Denis; Lagendijk, Jan J. W.; van den Berg, Cornelis A. T.

2016-07-01

Respiratory motion introduces substantial uncertainties in abdominal radiotherapy for which traditionally large margins are used. The MR-Linac will open up the opportunity to acquire high resolution MR images just prior to radiation and during treatment. However, volumetric MRI time series are not able to characterize 3D tumor and organ-at-risk motion with sufficient temporal resolution. In this study we propose a method to estimate 3D deformation vector fields (DVFs) with high spatial and temporal resolution based on fast 2D imaging and a subject-specific motion model based on respiratory correlated MRI. In a pre-beam phase, a retrospectively sorted 4D-MRI is acquired, from which the motion is parameterized using a principal component analysis. This motion model is used in combination with fast 2D cine-MR images, which are acquired during radiation, to generate full field-of-view 3D DVFs with a temporal resolution of 476 ms. The geometrical accuracies of the input data (4D-MRI and 2D multi-slice acquisitions) and the fitting procedure were determined using an MR-compatible motion phantom and found to be 1.0-1.5 mm on average. The framework was tested on seven healthy volunteers for both the pancreas and the kidney. The calculated motion was independently validated using one of the 2D slices, with an average error of 1.45 mm. The calculated 3D DVFs can be used retrospectively for treatment simulations, plan evaluations, or to determine the accumulated dose for both the tumor and organs-at-risk on a subject-specific basis in MR-guided radiotherapy.

Regional-specific Stochastic Simulation of Spatially-distributed Ground-motion Time Histories using Wavelet Packet Analysis

NASA Astrophysics Data System (ADS)

Huang, D.; Wang, G.

2014-12-01

Stochastic simulation of spatially distributed ground-motion time histories is important for performance-based earthquake design of geographically distributed systems. In this study, we develop a novel technique to stochastically simulate regionalized ground-motion time histories using wavelet packet analysis. First, a transient acceleration time history is characterized by wavelet-packet parameters proposed by Yamamoto and Baker (2013). The wavelet-packet parameters fully characterize ground-motion time histories in terms of energy content, time- frequency-domain characteristics and time-frequency nonstationarity. This study further investigates the spatial cross-correlations of wavelet-packet parameters based on geostatistical analysis of 1500 regionalized ground motion data from eight well-recorded earthquakes in California, Mexico, Japan and Taiwan. The linear model of coregionalization (LMC) is used to develop a permissible spatial cross-correlation model for each parameter group. The geostatistical analysis of ground-motion data from different regions reveals significant dependence of the LMC structure on regional site conditions, which can be characterized by the correlation range of Vs30 in each region. In general, the spatial correlation and cross-correlation of wavelet-packet parameters are stronger if the site condition is more homogeneous. Using the regional-specific spatial cross-correlation model and cokriging technique, wavelet packet parameters at unmeasured locations can be best estimated, and regionalized ground-motion time histories can be synthesized. Case studies and blind tests demonstrated that the simulated ground motions generally agree well with the actual recorded data, if the influence of regional-site conditions is considered. The developed method has great potential to be used in computational-based seismic analysis and loss estimation in a regional scale.

Image-driven, model-based 3D abdominal motion estimation for MR-guided radiotherapy.

PubMed

Stemkens, Bjorn; Tijssen, Rob H N; de Senneville, Baudouin Denis; Lagendijk, Jan J W; van den Berg, Cornelis A T

2016-07-21

Respiratory motion introduces substantial uncertainties in abdominal radiotherapy for which traditionally large margins are used. The MR-Linac will open up the opportunity to acquire high resolution MR images just prior to radiation and during treatment. However, volumetric MRI time series are not able to characterize 3D tumor and organ-at-risk motion with sufficient temporal resolution. In this study we propose a method to estimate 3D deformation vector fields (DVFs) with high spatial and temporal resolution based on fast 2D imaging and a subject-specific motion model based on respiratory correlated MRI. In a pre-beam phase, a retrospectively sorted 4D-MRI is acquired, from which the motion is parameterized using a principal component analysis. This motion model is used in combination with fast 2D cine-MR images, which are acquired during radiation, to generate full field-of-view 3D DVFs with a temporal resolution of 476 ms. The geometrical accuracies of the input data (4D-MRI and 2D multi-slice acquisitions) and the fitting procedure were determined using an MR-compatible motion phantom and found to be 1.0-1.5 mm on average. The framework was tested on seven healthy volunteers for both the pancreas and the kidney. The calculated motion was independently validated using one of the 2D slices, with an average error of 1.45 mm. The calculated 3D DVFs can be used retrospectively for treatment simulations, plan evaluations, or to determine the accumulated dose for both the tumor and organs-at-risk on a subject-specific basis in MR-guided radiotherapy.

Statistics and Machine Learning based Outlier Detection Techniques for Exoplanets

NASA Astrophysics Data System (ADS)

Goel, Amit; Montgomery, Michele

2015-08-01

Architectures of planetary systems are observable snapshots in time that can indicate formation and dynamic evolution of planets. The observable key parameters that we consider are planetary mass and orbital period. If planet masses are significantly less than their host star masses, then Keplerian Motion is defined as P^2 = a^3 where P is the orbital period in units of years and a is the orbital period in units of Astronomical Units (AU). Keplerian motion works on small scales such as the size of the Solar System but not on large scales such as the size of the Milky Way Galaxy. In this work, for confirmed exoplanets of known stellar mass, planetary mass, orbital period, and stellar age, we analyze Keplerian motion of systems based on stellar age to seek if Keplerian motion has an age dependency and to identify outliers. For detecting outliers, we apply several techniques based on statistical and machine learning methods such as probabilistic, linear, and proximity based models. In probabilistic and statistical models of outliers, the parameters of a closed form probability distributions are learned in order to detect the outliers. Linear models use regression analysis based techniques for detecting outliers. Proximity based models use distance based algorithms such as k-nearest neighbour, clustering algorithms such as k-means, or density based algorithms such as kernel density estimation. In this work, we will use unsupervised learning algorithms with only the proximity based models. In addition, we explore the relative strengths and weaknesses of the various techniques by validating the outliers. The validation criteria for the outliers is if the ratio of planetary mass to stellar mass is less than 0.001. In this work, we present our statistical analysis of the outliers thus detected.

A synthetic GMPE based on deterministic simulated ground motion data obtained from dynamic rupture models

NASA Astrophysics Data System (ADS)

Dalguer, L. A.; Baumann, C.; Cauzzi, C.

2013-12-01

Empirical ground motion prediction in the very near-field and for large magnitudes is often based on extrapolation of ground motion prediction equations (GMPEs) outside the range where they are well constrained by recorded data. With empirical GMPEs it is also difficult to capture source-dominated ground motion patterns, such as the effects of velocity pulses induced by subshear and supershear rupture directivity, buried and surface-rupturing, hanging-wall and foot-wall, weak shallow layers, complex geometry faults and stress drop. A way to cope at least in part with these shortcomings is to augment the calibration datasets with synthetic ground motions. To this aim, physics-based dynamic rupture models - where the physical bases involved in the fault rupture are explicitly considered - appear to be a suitable approach to produce synthetic ground motions. In this contribution, we first perform an assessment of a database of synthetic ground motions generated by a suite of dynamic rupture simulations to verify compatibility of the peak ground amplitudes with current GMPEs. The synthetic data-set is composed by 360 earthquake scenarios with moment magnitudes in the range of 5.5-7, for three mechanisms of faulting (reverse, normal and strike-slip) and for both buried faults and surface rupturing faults. Second, we parameterise the synthetic dataset through a GMPE. For this purpose, we identify the basic functional forms by analyzing the variation of the synthetic peak ground motions and spectral ordinates as a function of different explanatory variables related to the earthquake source characteristics, in order to account for some of the source effects listed above. We argue that this study provides basic guidelines for the developments of future GMPEs including data from physics-based numerical simulations.

Maintaining tumor targeting accuracy in real-time motion compensation systems for respiration-induced tumor motion.

PubMed

Malinowski, Kathleen; McAvoy, Thomas J; George, Rohini; Dieterich, Sonja; D'Souza, Warren D

2013-07-01

To determine how best to time respiratory surrogate-based tumor motion model updates by comparing a novel technique based on external measurements alone to three direct measurement methods. Concurrently measured tumor and respiratory surrogate positions from 166 treatment fractions for lung or pancreas lesions were analyzed. Partial-least-squares regression models of tumor position from marker motion were created from the first six measurements in each dataset. Successive tumor localizations were obtained at a rate of once per minute on average. Model updates were timed according to four methods: never, respiratory surrogate-based (when metrics based on respiratory surrogate measurements exceeded confidence limits), error-based (when localization error ≥ 3 mm), and always (approximately once per minute). Radial tumor displacement prediction errors (mean ± standard deviation) for the four schema described above were 2.4 ± 1.2, 1.9 ± 0.9, 1.9 ± 0.8, and 1.7 ± 0.8 mm, respectively. The never-update error was significantly larger than errors of the other methods. Mean update counts over 20 min were 0, 4, 9, and 24, respectively. The same improvement in tumor localization accuracy could be achieved through any of the three update methods, but significantly fewer updates were required when the respiratory surrogate method was utilized. This study establishes the feasibility of timing image acquisitions for updating respiratory surrogate models without direct tumor localization.

Human Activity Modeling and Simulation with High Biofidelity

DTIC Science & Technology

2013-01-01

Human activity Modeling and Simulation (M&S) plays an important role in simulation-based training and Virtual Reality (VR). However, human activity M...kinematics and motion mapping/creation; and (e) creation and replication of human activity in 3-D space with true shape and motion. A brief review is

Satellite attitude motion models for capture and retrieval investigations

NASA Technical Reports Server (NTRS)

Cochran, John E., Jr.; Lahr, Brian S.

1986-01-01

The primary purpose of this research is to provide mathematical models which may be used in the investigation of various aspects of the remote capture and retrieval of uncontrolled satellites. Emphasis has been placed on analytical models; however, to verify analytical solutions, numerical integration must be used. Also, for satellites of certain types, numerical integration may be the only practical or perhaps the only possible method of solution. First, to provide a basis for analytical and numerical work, uncontrolled satellites were categorized using criteria based on: (1) orbital motions, (2) external angular momenta, (3) internal angular momenta, (4) physical characteristics, and (5) the stability of their equilibrium states. Several analytical solutions for the attitude motions of satellite models were compiled, checked, corrected in some minor respects and their short-term prediction capabilities were investigated. Single-rigid-body, dual-spin and multi-rotor configurations are treated. To verify the analytical models and to see how the true motion of a satellite which is acted upon by environmental torques differs from its corresponding torque-free motion, a numerical simulation code was developed. This code contains a relatively general satellite model and models for gravity-gradient and aerodynamic torques. The spacecraft physical model for the code and the equations of motion are given. The two environmental torque models are described.

Transient tidal eddy motion in the western Gulf of Maine, part 1: Primary structure

NASA Astrophysics Data System (ADS)

Brown, W. S.; Marques, G. M.

2013-07-01

High frequency radar-derived surface current maps of the Great South Channel (GSC) in the western Gulf of Maine in 2005 revealed clockwise (CW) and anticlockwise (ACW) eddy motion associated with the strong regional tidal currents. To better elucidate the kinematics and dynamics of these transient tidal eddy motions, an observational and modeling study was conducted during the weakly stratified conditions of winter 2008-2009. Our moored bottom pressure and ADCP current measurements in 13m depth were augmented by historical current measurements in about 30m in documenting the dominance of highly polarized M2 semidiurnal currents in our nearshore study region. The high-resolution finite element coastal ocean model (QUODDY) - forced by the five principal tidal constituents - produced maps depicting the formation and evolution of the CW and ACW eddy motions that regularly follow maximum ebb and flood flows, respectively. Observation versus model current comparison required that the model bottom current drag coefficient be set to at an unusually high Cd=0.01 - suggesting the importance of form drag in the study region. The observations and model results were consistent in diagnosing CW or ACW eddy motions that (a) form nearshore in the coastal boundary layer (CBL) for about 3h after the respective tidal current maxima and then (b) translate southeastward across the GSC along curved 50m isobath at speeds of about 25m/s. Observation-based and model-based momentum budget estimates were consistent in showing a first order forced semidiurnal standing tidal wave dynamics (like the adjacent Gulf of Maine) which was modulated by adverse pressure gradient/bottom stress forcing to generate the eddy motions. Observation-based estimates of terms in the transport vorticity budget showed that in the shallower Inner Zone subregion (average depth=23m) that the diffusion of nearshore vorticity was dominant in feeding the growth of eddy motion vorticity; while in the somewhat deeper Outer Zone subregion (33m) bottom current lateral shear and water column stretching/squashing was significant in modulating the eddy motion. We conclude that the transient eddy motions in the GSC region are phase eddies that accompany the change of tide across the GSC and are (1) generated by bottom stress gradients in the shallower nearshore - an issue which needs to be better understood for improved future forecasting.

Source parameters of the 2013 Lushan, Sichuan, Ms7.0 earthquake and estimation of the near-fault strong ground motion

NASA Astrophysics Data System (ADS)

Meng, L.; Zhou, L.; Liu, J.

2013-12-01

Abstract: The April 20, 2013 Ms 7.0 earthquake in Lushan city, Sichuan province of China occurred as the result of east-west oriented reverse-type motion on a north-south striking fault. The source location suggests the event occurred on the Southern part of Longmenshan fault at a depth of 13km. The Lushan earthquake caused a great of loss of property and 196 deaths. The maximum intensity is up to VIII to IX at Boxing and Lushan city, which are located in the meizoseismal area. In this study, we analyzed the dynamic source process and calculated source spectral parameters, estimated the strong ground motion in the near-fault field based on the Brune's circle model at first. A dynamical composite source model (DCSM) has been developed further to simulate the near-fault strong ground motion with associated fault rupture properties at Boxing and Lushan city, respectively. The results indicate that the frictional undershoot behavior in the dynamic source process of Lushan earthquake, which is actually different from the overshoot activity of the Wenchuan earthquake. Based on the simulated results of the near-fault strong ground motion, described the intensity distribution of the Lushan earthquake field. The simulated intensity indicated that, the maximum intensity value is IX, and region with and above VII almost 16,000km2, which is consistence with observation intensity published online by China Earthquake Administration (CEA) on April 25. Moreover, the numerical modeling developed in this study has great application in the strong ground motion prediction and intensity estimation for the earthquake rescue purpose. In fact, the estimation methods based on the empirical relationship and numerical modeling developed in this study has great application in the strong ground motion prediction for the earthquake source process understand purpose. Keywords: Lushan, Ms7.0 earthquake; near-fault strong ground motion; DCSM; simulated intensity

Safe motion planning for mobile agents: A model of reactive planning for multiple mobile agents

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujimura, Kikuo.

1990-01-01

The problem of motion planning for multiple mobile agents is studied. Each planning agent independently plans its own action based on its map which contains a limited information about the environment. In an environment where more than one mobile agent interacts, the motions of the robots are uncertain and dynamic. A model for reactive agents is described and simulation results are presented to show their behavior patterns. 18 refs., 2 figs.

Assessing Motion Induced Interruptions Using a Motion Platform

DTIC Science & Technology

2013-09-01

same way that cars have shock absorbers to decrease jolt from potholes and bumps in the road, ships may have the potential to be designed to better...Integration (HSI) seeks to assure human performance to reduce operating costs. This thesis seeks to develop a model for ship design in relation to Motion...Induced Interruptions (MII). The model is based on the premise that MIIs affect specific domains of HSI in an adverse way. Future ship design

Modeling stick-slip-separation dynamics in a bimodal standing wave ultrasonic motor

NASA Astrophysics Data System (ADS)

Li, Xiang; Yao, Zhiyuan; Lv, Qibao; Liu, Zhen

2016-11-01

Ultrasonic motor (USM) is an electromechanical coupling system with ultrasonic vibration, which is driven by the frictional contact force between the stator (vibrating body) and the rotor/slider (driven body). Stick-slip motion can occur at the contact interface when USM is operating, which may affect the performance of the motor. This paper develops a physically-based model to investigate the complex stick-slip-separation dynamics in a bimodal standing wave ultrasonic motor. The model includes both friction nonlinearity and intermittent separation nonlinearity of the system. Utilizing Hamilton's principle and assumed mode method, the dynamic equations of the stator are deduced. Based on the dynamics of the stator and the slider, sticking force during the stick phase is derived, which is used to examine the stick-to-slip transition. Furthermore, the stick-slip-separation kinematics is analyzed by establishing analytical criteria that predict the transition between stick, slip and separation of the interface. Stick-slip-separation motion is observed in the resulting model, and numerical simulations are performed to study the influence of parameters on the range of possible motions. Results show that stick-slip motion can occur with greater preload and smaller voltage amplitude. Furthermore, a dimensionless parameter is proposed to predict the occurrence of stick-slip versus slip-separation motions, and its role in designing ultrasonic motors is discussed. It is shown that slip-separation motion is favorable for the slider velocity.

The effect of inertial coupling in the dynamics and control of flexible robotic manipulators

NASA Technical Reports Server (NTRS)

Tesar, Delbert; Curran, Carol Cockrell; Graves, Philip Lee

1988-01-01

A general model of the dynamics of flexible robotic manipulators is presented, including the gross motion of the links, the vibrations of the links and joints, and the dynamic coupling between the gross motions and vibrations. The vibrations in the links may be modeled using lumped parameters, truncated modal summation, a component mode synthesis method, or a mixture of these methods. The local link inertia matrix is derived to obtain the coupling terms between the gross motion of the link and the vibrations of the link. Coupling between the motions of the links results from the kinematic model, which utilizes the method of kinematic influence. The model is used to simulate the dynamics of a flexible space-based robotic manipulator which is attached to a spacecraft, and is free to move with respect to the inertial reference frame. This model may be used to study the dynamic response of the manipulator to the motions of its joints, or to externally applied disturbances.

Real-time prediction of respiratory motion based on a local dynamic model in an augmented space

NASA Astrophysics Data System (ADS)

Hong, S.-M.; Jung, B.-H.; Ruan, D.

2011-03-01

Motion-adaptive radiotherapy aims to deliver ablative radiation dose to the tumor target with minimal normal tissue exposure, by accounting for real-time target movement. In practice, prediction is usually necessary to compensate for system latency induced by measurement, communication and control. This work focuses on predicting respiratory motion, which is most dominant for thoracic and abdominal tumors. We develop and investigate the use of a local dynamic model in an augmented space, motivated by the observation that respiratory movement exhibits a locally circular pattern in a plane augmented with a delayed axis. By including the angular velocity as part of the system state, the proposed dynamic model effectively captures the natural evolution of respiratory motion. The first-order extended Kalman filter is used to propagate and update the state estimate. The target location is predicted by evaluating the local dynamic model equations at the required prediction length. This method is complementary to existing work in that (1) the local circular motion model characterizes 'turning', overcoming the limitation of linear motion models; (2) it uses a natural state representation including the local angular velocity and updates the state estimate systematically, offering explicit physical interpretations; (3) it relies on a parametric model and is much less data-satiate than the typical adaptive semiparametric or nonparametric method. We tested the performance of the proposed method with ten RPM traces, using the normalized root mean squared difference between the predicted value and the retrospective observation as the error metric. Its performance was compared with predictors based on the linear model, the interacting multiple linear models and the kernel density estimator for various combinations of prediction lengths and observation rates. The local dynamic model based approach provides the best performance for short to medium prediction lengths under relatively low observation rate. Sensitivity analysis indicates its robustness toward the choice of parameters. Its simplicity, robustness and low computation cost makes the proposed local dynamic model an attractive tool for real-time prediction with system latencies below 0.4 s.

Real-time prediction of respiratory motion based on a local dynamic model in an augmented space.

PubMed

Hong, S-M; Jung, B-H; Ruan, D

2011-03-21

Motion-adaptive radiotherapy aims to deliver ablative radiation dose to the tumor target with minimal normal tissue exposure, by accounting for real-time target movement. In practice, prediction is usually necessary to compensate for system latency induced by measurement, communication and control. This work focuses on predicting respiratory motion, which is most dominant for thoracic and abdominal tumors. We develop and investigate the use of a local dynamic model in an augmented space, motivated by the observation that respiratory movement exhibits a locally circular pattern in a plane augmented with a delayed axis. By including the angular velocity as part of the system state, the proposed dynamic model effectively captures the natural evolution of respiratory motion. The first-order extended Kalman filter is used to propagate and update the state estimate. The target location is predicted by evaluating the local dynamic model equations at the required prediction length. This method is complementary to existing work in that (1) the local circular motion model characterizes 'turning', overcoming the limitation of linear motion models; (2) it uses a natural state representation including the local angular velocity and updates the state estimate systematically, offering explicit physical interpretations; (3) it relies on a parametric model and is much less data-satiate than the typical adaptive semiparametric or nonparametric method. We tested the performance of the proposed method with ten RPM traces, using the normalized root mean squared difference between the predicted value and the retrospective observation as the error metric. Its performance was compared with predictors based on the linear model, the interacting multiple linear models and the kernel density estimator for various combinations of prediction lengths and observation rates. The local dynamic model based approach provides the best performance for short to medium prediction lengths under relatively low observation rate. Sensitivity analysis indicates its robustness toward the choice of parameters. Its simplicity, robustness and low computation cost makes the proposed local dynamic model an attractive tool for real-time prediction with system latencies below 0.4 s.

Fish tracking by combining motion based segmentation and particle filtering

NASA Astrophysics Data System (ADS)

Bichot, E.; Mascarilla, L.; Courtellemont, P.

2006-01-01

In this paper, we suggest a new importance sampling scheme to improve a particle filtering based tracking process. This scheme relies on exploitation of motion segmentation. More precisely, we propagate hypotheses from particle filtering to blobs of similar motion to target. Hence, search is driven toward regions of interest in the state space and prediction is more accurate. We also propose to exploit segmentation to update target model. Once the moving target has been identified, a representative model is learnt from its spatial support. We refer to this model in the correction step of the tracking process. The importance sampling scheme and the strategy to update target model improve the performance of particle filtering in complex situations of occlusions compared to a simple Bootstrap approach as shown by our experiments on real fish tank sequences.

Direction-dependent regularization for improved estimation of liver and lung motion in 4D image data

NASA Astrophysics Data System (ADS)

Schmidt-Richberg, Alexander; Ehrhardt, Jan; Werner, René; Handels, Heinz

2010-03-01

The estimation of respiratory motion is a fundamental requisite for many applications in the field of 4D medical imaging, for example for radiotherapy of thoracic and abdominal tumors. It is usually done using non-linear registration of time frames of the sequence without further modelling of physiological motion properties. In this context, the accurate calculation of liver und lung motion is especially challenging because the organs are slipping along the surrounding tissue (i.e. the rib cage) during the respiratory cycle, which leads to discontinuities in the motion field. Without incorporating this specific physiological characteristic, common smoothing mechanisms cause an incorrect estimation along the object borders. In this paper, we present an extended diffusion-based model for incorporating physiological knowledge in image registration. By decoupling normal- and tangential-directed smoothing, we are able to estimate slipping motion at the organ borders while preventing gaps and ensuring smooth motion fields inside. We evaluate our model for the estimation of lung and liver motion on the basis of publicly accessible 4D CT and 4D MRI data. The results show a considerable increase of registration accuracy with respect to the target registration error and a more plausible motion estimation.

Evaluation of a computational model to predict elbow range of motion

PubMed Central

Nishiwaki, Masao; Johnson, James A.; King, Graham J. W.; Athwal, George S.

2014-01-01

Computer models capable of predicting elbow flexion and extension range of motion (ROM) limits would be useful for assisting surgeons in improving the outcomes of surgical treatment of patients with elbow contractures. A simple and robust computer-based model was developed that predicts elbow joint ROM using bone geometries calculated from computed tomography image data. The model assumes a hinge-like flexion-extension axis, and that elbow passive ROM limits can be based on terminal bony impingement. The model was validated against experimental results with a cadaveric specimen, and was able to predict the flexion and extension limits of the intact joint to 0° and 3°, respectively. The model was also able to predict the flexion and extension limits to 1° and 2°, respectively, when simulated osteophytes were inserted into the joint. Future studies based on this approach will be used for the prediction of elbow flexion-extension ROM in patients with primary osteoarthritis to help identify motion-limiting hypertrophic osteophytes, and will eventually permit real-time computer-assisted navigated excisions. PMID:24841799

Flight simulator requirements for airline transport pilot training - An evaluation of motion system design alternatives

NASA Technical Reports Server (NTRS)

Lee, A. T.; Bussolari, S. R.

1986-01-01

The effect of motion platform systems on pilot behavior is considered with emphasis placed on civil aviation applications. A dynamic model for human spatial orientation based on the physiological structure and function of the human vestibular system is presented. Motion platform alternatives were evaluated on the basis of the following motion platform conditions: motion with six degrees-of-freedom required for Phase II simulators and two limited motion conditions. Consideration was given to engine flameout, airwork, and approach and landing scenarios.

Development of esMOCA Biomechanic, Motion Capture Instrumentation for Biomechanics Analysis

NASA Astrophysics Data System (ADS)

Arendra, A.; Akhmad, S.

2018-01-01

This study aims to build motion capture instruments using inertial measurement unit sensors to assist in the analysis of biomechanics. Sensors used are accelerometer and gyroscope. Estimation of orientation sensors is done by digital motion processing in each sensor nodes. There are nine sensor nodes attached to the upper limbs. This sensor is connected to the pc via a wireless sensor network. The development of kinematics and inverse dynamamic models of the upper limb is done in simulink simmechanic. The kinematic model receives streaming data of sensor nodes mounted on the limbs. The output of the kinematic model is the pose of each limbs and visualized on display. The dynamic inverse model outputs the reaction force and reaction moment of each joint based on the limb motion input. Model validation in simulink with mathematical model of mechanical analysis showed results that did not differ significantly

Simulation of earthquake ground motions in the eastern United States using deterministic physics‐based and site‐based stochastic approaches

USGS Publications Warehouse

Rezaeian, Sanaz; Hartzell, Stephen; Sun, Xiaodan; Mendoza, Carlos

2017-01-01

Earthquake ground‐motion recordings are scarce in the central and eastern United States (CEUS) for large‐magnitude events and at close distances. We use two different simulation approaches, a deterministic physics‐based method and a site‐based stochastic method, to simulate ground motions over a wide range of magnitudes. Drawing on previous results for the modeling of recordings from the 2011 Mw 5.8 Mineral, Virginia, earthquake and using the 2001 Mw 7.6 Bhuj, India, earthquake as a tectonic analog for a large magnitude CEUS event, we are able to calibrate the two simulation methods over this magnitude range. Both models show a good fit to the Mineral and Bhuj observations from 0.1 to 10 Hz. Model parameters are then adjusted to obtain simulations for Mw 6.5, 7.0, and 7.6 events in the CEUS. Our simulations are compared with the 2014 U.S. Geological Survey weighted combination of existing ground‐motion prediction equations in the CEUS. The physics‐based simulations show comparable response spectral amplitudes and a fairly similar attenuation with distance. The site‐based stochastic simulations suggest a slightly faster attenuation of the response spectral amplitudes with distance for larger magnitude events and, as a result, slightly lower amplitudes at distances greater than 200 km. Both models are plausible alternatives and, given the few available data points in the CEUS, can be used to represent the epistemic uncertainty in modeling of postulated CEUS large‐magnitude events.

A prototype of the procedure of strong ground motion prediction for intraslab earthquake based on characterized source model

NASA Astrophysics Data System (ADS)

Iwata, T.; Asano, K.; Sekiguchi, H.

2011-12-01

We propose a prototype of the procedure to construct source models for strong motion prediction during intraslab earthquakes based on the characterized source model (Irikura and Miyake, 2011). The key is the characterized source model which is based on the empirical scaling relationships for intraslab earthquakes and involve the correspondence between the SMGA (strong motion generation area, Miyake et al., 2003) and the asperity (large slip area). Iwata and Asano (2011) obtained the empirical relationships of the rupture area (S) and the total asperity area (Sa) to the seismic moment (Mo) as follows, with assuming power of 2/3 dependency of S and Sa on M0, S (km**2) = 6.57×10**(-11)×Mo**(2/3) (Nm) (1) Sa (km**2) = 1.04 ×10**(-11)×Mo**(2/3) (Nm) (2). Iwata and Asano (2011) also pointed out that the position and the size of SMGA approximately corresponds to the asperity area for several intraslab events. Based on the empirical relationships, we gave a procedure for constructing source models of intraslab earthquakes for strong motion prediction. [1] Give the seismic moment, Mo. [2] Obtain the total rupture area and the total asperity area according to the empirical scaling relationships between S, Sa, and Mo given by Iwata and Asano (2011). [3] Square rupture area and asperities are assumed. [4] The source mechanism is assumed to be the same as that of small events in the source region. [5] Plural scenarios including variety of the number of asperities and rupture starting points are prepared. We apply this procedure by simulating strong ground motions for several observed events for confirming the methodology.

Calculation of broadband time histories of ground motion, Part II: Kinematic and dynamic modeling using theoretical Green's functions and comparison with the 1994 northridge earthquake

USGS Publications Warehouse

Hartzell, S.; Guatteri, Mariagiovanna; Mai, P.M.; Liu, P.-C.; Fisk, M. R.

2005-01-01

In the evolution of methods for calculating synthetic time histories of ground motion for postulated earthquakes, kinematic source models have dominated to date because of their ease of application. Dynamic models, however, which incorporate a physical relationship between important faulting parameters of stress drop, slip, rupture velocity, and rise time, are becoming more accessible. This article compares a class of kinematic models based on the summation of a fractal distribution of subevent sizes with a dynamic model based on the slip-weakening friction law. Kinematic modeling is done for the frequency band 0.2 to 10.0. Hz, dynamic models are calculated from 0.2 to 2.0. Hz. The strong motion data set for the 1994 Northridge earthquake is used to evaluate and compare the synthetic time histories. Source models are propagated to the far field by convolution with 1D and 3D theoretical Green’s functions. In addition, the kinematic model is used to evaluate the importance of propagation path effects: velocity structure, scattering, and nonlinearity. At present, the kinematic model gives a better broadband fit to the Northridge ground motion than the simple slip-weakening dynamic model. In general, the dynamic model overpredicts rise times and produces insufficient shorter-period energy. Within the context of the slip-weakening model, the Northridge ground motion requires a short slip-weakening distance, on the order of 0.15 m or less. A more complex dynamic model including rate weakening or one that allows shorter rise times near the hypocenter may fit the data better.

Study of the Navigation Method for a Snake Robot Based on the Kinematics Model with MEMS IMU.

PubMed

Zhao, Xu; Dou, Lihua; Su, Zhong; Liu, Ning

2018-03-16

A snake robot is a type of highly redundant mobile robot that significantly differs from a tracked robot, wheeled robot and legged robot. To address the issue of a snake robot performing self-localization in the application environment without assistant orientation, an autonomous navigation method is proposed based on the snake robot's motion characteristic constraints. The method realized the autonomous navigation of the snake robot with non-nodes and an external assistant using its own Micro-Electromechanical-Systems (MEMS) Inertial-Measurement-Unit (IMU). First, it studies the snake robot's motion characteristics, builds the kinematics model, and then analyses the motion constraint characteristics and motion error propagation properties. Second, it explores the snake robot's navigation layout, proposes a constraint criterion and the fixed relationship, and makes zero-state constraints based on the motion features and control modes of a snake robot. Finally, it realizes autonomous navigation positioning based on the Extended-Kalman-Filter (EKF) position estimation method under the constraints of its motion characteristics. With the self-developed snake robot, the test verifies the proposed method, and the position error is less than 5% of Total-Traveled-Distance (TDD). In a short-distance environment, this method is able to meet the requirements of a snake robot in order to perform autonomous navigation and positioning in traditional applications and can be extended to other familiar multi-link robots.

A Motion Detection Algorithm Using Local Phase Information

PubMed Central

Lazar, Aurel A.; Ukani, Nikul H.; Zhou, Yiyin

2016-01-01

Previous research demonstrated that global phase alone can be used to faithfully represent visual scenes. Here we provide a reconstruction algorithm by using only local phase information. We also demonstrate that local phase alone can be effectively used to detect local motion. The local phase-based motion detector is akin to models employed to detect motion in biological vision, for example, the Reichardt detector. The local phase-based motion detection algorithm introduced here consists of two building blocks. The first building block measures/evaluates the temporal change of the local phase. The temporal derivative of the local phase is shown to exhibit the structure of a second order Volterra kernel with two normalized inputs. We provide an efficient, FFT-based algorithm for implementing the change of the local phase. The second processing building block implements the detector; it compares the maximum of the Radon transform of the local phase derivative with a chosen threshold. We demonstrate examples of applying the local phase-based motion detection algorithm on several video sequences. We also show how the locally detected motion can be used for segmenting moving objects in video scenes and compare our local phase-based algorithm to segmentation achieved with a widely used optic flow algorithm. PMID:26880882

On Inertial Body Tracking in the Presence of Model Calibration Errors

PubMed Central

Miezal, Markus; Taetz, Bertram; Bleser, Gabriele

2016-01-01

In inertial body tracking, the human body is commonly represented as a biomechanical model consisting of rigid segments with known lengths and connecting joints. The model state is then estimated via sensor fusion methods based on data from attached inertial measurement units (IMUs). This requires the relative poses of the IMUs w.r.t. the segments—the IMU-to-segment calibrations, subsequently called I2S calibrations—to be known. Since calibration methods based on static poses, movements and manual measurements are still the most widely used, potentially large human-induced calibration errors have to be expected. This work compares three newly developed/adapted extended Kalman filter (EKF) and optimization-based sensor fusion methods with an existing EKF-based method w.r.t. their segment orientation estimation accuracy in the presence of model calibration errors with and without using magnetometer information. While the existing EKF-based method uses a segment-centered kinematic chain biomechanical model and a constant angular acceleration motion model, the newly developed/adapted methods are all based on a free segments model, where each segment is represented with six degrees of freedom in the global frame. Moreover, these methods differ in the assumed motion model (constant angular acceleration, constant angular velocity, inertial data as control input), the state representation (segment-centered, IMU-centered) and the estimation method (EKF, sliding window optimization). In addition to the free segments representation, the optimization-based method also represents each IMU with six degrees of freedom in the global frame. In the evaluation on simulated and real data from a three segment model (an arm), the optimization-based method showed the smallest mean errors, standard deviations and maximum errors throughout all tests. It also showed the lowest dependency on magnetometer information and motion agility. Moreover, it was insensitive w.r.t. I2S position and segment length errors in the tested ranges. Errors in the I2S orientations were, however, linearly propagated into the estimated segment orientations. In the absence of magnetic disturbances, severe model calibration errors and fast motion changes, the newly developed IMU centered EKF-based method yielded comparable results with lower computational complexity. PMID:27455266

Funnel Libraries for Real-Time Robust Feedback Motion Planning

DTIC Science & Technology

2016-07-21

motion plans for a robot that are guaranteed to suc- ceed despite uncertainty in the environment, parametric model uncertainty, and disturbances...resulting funnel library is then used to sequentially compose motion plans at runtime while ensuring the safety of the robot . A major advantage of...the work presented here is that by explicitly taking into account the effect of uncertainty, the robot can evaluate motion plans based on how vulnerable

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dasari, Paul K. R.; Shazeeb, Mohammed Salman; Könik, Arda

Purpose: Binning list-mode acquisitions as a function of a surrogate signal related to respiration has been employed to reduce the impact of respiratory motion on image quality in cardiac emission tomography (SPECT and PET). Inherent in amplitude binning is the assumption that there is a monotonic relationship between the amplitude of the surrogate signal and respiratory motion of the heart. This assumption is not valid in the presence of hysteresis when heart motion exhibits a different relationship with the surrogate during inspiration and expiration. The purpose of this study was to investigate the novel approach of using the Bouc–Wen (BW)more » model to provide a signal accounting for hysteresis when binning list-mode data with the goal of thereby improving motion correction. The study is based on the authors’ previous observations that hysteresis between chest and abdomen markers was indicative of hysteresis between abdomen markers and the internal motion of the heart. Methods: In 19 healthy volunteers, they determined the internal motion of the heart and diaphragm in the superior–inferior direction during free breathing using MRI navigators. A visual tracking system (VTS) synchronized with MRI acquisition tracked the anterior–posterior motions of external markers placed on the chest and abdomen. These data were employed to develop and test the Bouc–Wen model by inputting the VTS derived chest and abdomen motions into it and using the resulting output signals as surrogates for cardiac motion. The data of the volunteers were divided into training and testing sets. The training set was used to obtain initial values for the model parameters for all of the volunteers in the set, and for set members based on whether they were or were not classified as exhibiting hysteresis using a metric derived from the markers. These initial parameters were then employed with the testing set to estimate output signals. Pearson’s linear correlation coefficient between the abdomen, chest, average of chest and abdomen markers, and Bouc–Wen derived signals versus the true internal motion of the heart from MRI was used to judge the signals match to the heart motion. Results: The results show that the Bouc–Wen model generated signals demonstrated strong correlation with the heart motion. This correlation was slightly larger on average than that of the external surrogate signals derived from the abdomen marker, and average of the abdomen and chest markers, but was not statistically significantly different from them. Conclusions: The results suggest that the proposed model has the potential to be a unified framework for modeling hysteresis in respiratory motion in cardiac perfusion studies and beyond.« less

Long-period Ground Motion Simulation in the Osaka Basin during the 2011 Great Tohoku Earthquake

NASA Astrophysics Data System (ADS)

Iwata, T.; Kubo, H.; Asano, K.; Sato, K.; Aoi, S.

2014-12-01

Large amplitude long-period ground motions (1-10s) with long duration were observed in the Osaka sedimentary basin during the 2011 Tohoku earthquake (Mw9.0) and its aftershock (Ibaraki-Oki, Mw7.7), which is about 600 km away from the source regions. Sato et al. (2013) analyzed strong ground motion records from the source region to the Osaka basin and showed the following characteristics. (1) In the period range of 1 to 10s, the amplitude of horizontal components of the ground motion at the site-specific period is amplified in the Osaka basin sites. The predominant period is about 7s in the bay area where the largest pSv were observed. (2) The velocity Fourier amplitude spectra with their predominant period of around 7s are observed at the bedrock sites surrounding the Osaka basin. Those characteristics were observed during both of the mainshock and the largest aftershock. Therefore, large long-period ground motions in the Osaka basin are generated by the combination of propagation-path and basin effects. They simulated ground motions due to the largest aftershock as a simple point source model using three-dimensional FDM (GMS; Aoi and Fujiwara, 1999). They used a three-dimensional velocity structure based on the Japan Integrated Velocity Structure Model (JIVSM, Koketsu et al., 2012), with the minimum effective period of the computation of 3s. Their simulation result reproduced the observation characteristics well and it validates the applicability of the JIVSM for the long period ground motion simulation. In this study, we try to simulate long-period ground motions during the mainshock. The source model we used for the simulation is based on the SMGA model obtained by Asano and Iwata (2012). We succeed to simulate long-period ground motion propagation from Kanto area to the Osaka basin fairly well. The long-period ground motion simulations with the several Osaka basin velocity structure models are done for improving the model applicability. We used strong motion data recorded by K-NET, KiK-net and F-net of NIED, CEORKA, BRI, JMA, Osaka city waterworks bureau, and Osaka prefecture. GMS provided by NIED is used for the computation.

Efficient low-bit-rate adaptive mesh-based motion compensation technique

NASA Astrophysics Data System (ADS)

Mahmoud, Hanan A.; Bayoumi, Magdy A.

2001-08-01

This paper proposes a two-stage global motion estimation method using a novel quadtree block-based motion estimation technique and an active mesh model. In the first stage, motion parameters are estimated by fitting block-based motion vectors computed using a new efficient quadtree technique, that divides a frame into equilateral triangle blocks using the quad-tree structure. Arbitrary partition shapes are achieved by allowing 4-to-1, 3-to-1 and 2-1 merge/combine of sibling blocks having the same motion vector . In the second stage, the mesh is constructed using an adaptive triangulation procedure that places more triangles over areas with high motion content, these areas are estimated during the first stage. finally the motion compensation is achieved by using a novel algorithm that is carried by both the encoder and the decoder to determine the optimal triangulation of the resultant partitions followed by affine mapping at the encoder. Computer simulation results show that the proposed method gives better performance that the conventional ones in terms of the peak signal-to-noise ration (PSNR) and the compression ratio (CR).

Fire flame detection based on GICA and target tracking

NASA Astrophysics Data System (ADS)

Rong, Jianzhong; Zhou, Dechuang; Yao, Wei; Gao, Wei; Chen, Juan; Wang, Jian

2013-04-01

To improve the video fire detection rate, a robust fire detection algorithm based on the color, motion and pattern characteristics of fire targets was proposed, which proved a satisfactory fire detection rate for different fire scenes. In this fire detection algorithm: (a) a rule-based generic color model was developed based on analysis on a large quantity of flame pixels; (b) from the traditional GICA (Geometrical Independent Component Analysis) model, a Cumulative Geometrical Independent Component Analysis (C-GICA) model was developed for motion detection without static background and (c) a BP neural network fire recognition model based on multi-features of the fire pattern was developed. Fire detection tests on benchmark fire video clips of different scenes have shown the robustness, accuracy and fast-response of the algorithm.

The prediction of acoustical particle motion using an efficient polynomial curve fit procedure

NASA Technical Reports Server (NTRS)

Marshall, S. E.; Bernhard, R.

1984-01-01

A procedure is examined whereby the acoustic model parameters, natural frequencies and mode shapes, in the cavities of transportation vehicles are determined experimentally. The acoustic model shapes are described in terms of the particle motion. The acoustic modal analysis procedure is tailored to existing minicomputer based spectral analysis systems.

Accounting for Variability in Student Responses to Motion Questions

ERIC Educational Resources Information Center

Frank, Brian W.; Kanim, Stephen E.; Gomez, Luanna S.

2008-01-01

We describe the results of an experiment conducted to test predictions about student responses to questions about motion based on an explicit model of student thinking in terms of the cuing of a variety of different physical intuitions or conceptual resources. This particular model allows us to account for observed variations in patterns of…

Predicting Mercury's precession using simple relativistic Newtonian dynamics

NASA Astrophysics Data System (ADS)

Friedman, Y.; Steiner, J. M.

2016-03-01

We present a new simple relativistic model for planetary motion describing accurately the anomalous precession of the perihelion of Mercury and its origin. The model is based on transforming Newton's classical equation for planetary motion from absolute to real spacetime influenced by the gravitational potential and introducing the concept of influenced direction.

Domain Motion Enhanced (DoME) Model for Efficient Conformational Sampling of Multidomain Proteins.

PubMed

Kobayashi, Chigusa; Matsunaga, Yasuhiro; Koike, Ryotaro; Ota, Motonori; Sugita, Yuji

2015-11-19

Large conformational changes of multidomain proteins are difficult to simulate using all-atom molecular dynamics (MD) due to the slow time scale. We show that a simple modification of the structure-based coarse-grained (CG) model enables a stable and efficient MD simulation of those proteins. "Motion Tree", a tree diagram that describes conformational changes between two structures in a protein, provides information on rigid structural units (domains) and the magnitudes of domain motions. In our new CG model, which we call the DoME (domain motion enhanced) model, interdomain interactions are defined as being inversely proportional to the magnitude of the domain motions in the diagram, whereas intradomain interactions are kept constant. We applied the DoME model in combination with the Go model to simulations of adenylate kinase (AdK). The results of the DoME-Go simulation are consistent with an all-atom MD simulation for 10 μs as well as known experimental data. Unlike the conventional Go model, the DoME-Go model yields stable simulation trajectories against temperature changes and conformational transitions are easily sampled despite domain rigidity. Evidently, identification of domains and their interfaces is useful approach for CG modeling of multidomain proteins.

A Novel Model-Based Driving Behavior Recognition System Using Motion Sensors.

PubMed

Wu, Minglin; Zhang, Sheng; Dong, Yuhan

2016-10-20

In this article, a novel driving behavior recognition system based on a specific physical model and motion sensory data is developed to promote traffic safety. Based on the theory of rigid body kinematics, we build a specific physical model to reveal the data change rule during the vehicle moving process. In this work, we adopt a nine-axis motion sensor including a three-axis accelerometer, a three-axis gyroscope and a three-axis magnetometer, and apply a Kalman filter for noise elimination and an adaptive time window for data extraction. Based on the feature extraction guided by the built physical model, various classifiers are accomplished to recognize different driving behaviors. Leveraging the system, normal driving behaviors (such as accelerating, braking, lane changing and turning with caution) and aggressive driving behaviors (such as accelerating, braking, lane changing and turning with a sudden) can be classified with a high accuracy of 93.25%. Compared with traditional driving behavior recognition methods using machine learning only, the proposed system possesses a solid theoretical basis, performs better and has good prospects.

A Novel Model-Based Driving Behavior Recognition System Using Motion Sensors

PubMed Central

Wu, Minglin; Zhang, Sheng; Dong, Yuhan

2016-01-01

In this article, a novel driving behavior recognition system based on a specific physical model and motion sensory data is developed to promote traffic safety. Based on the theory of rigid body kinematics, we build a specific physical model to reveal the data change rule during the vehicle moving process. In this work, we adopt a nine-axis motion sensor including a three-axis accelerometer, a three-axis gyroscope and a three-axis magnetometer, and apply a Kalman filter for noise elimination and an adaptive time window for data extraction. Based on the feature extraction guided by the built physical model, various classifiers are accomplished to recognize different driving behaviors. Leveraging the system, normal driving behaviors (such as accelerating, braking, lane changing and turning with caution) and aggressive driving behaviors (such as accelerating, braking, lane changing and turning with a sudden) can be classified with a high accuracy of 93.25%. Compared with traditional driving behavior recognition methods using machine learning only, the proposed system possesses a solid theoretical basis, performs better and has good prospects. PMID:27775625

Revisions to some parameters used in stochastic-method simulations of ground motion

USGS Publications Warehouse

Boore, David; Thompson, Eric M.

2015-01-01

The stochastic method of ground‐motion simulation specifies the amplitude spectrum as a function of magnitude (M) and distance (R). The manner in which the amplitude spectrum varies with M and R depends on physical‐based parameters that are often constrained by recorded motions for a particular region (e.g., stress parameter, geometrical spreading, quality factor, and crustal amplifications), which we refer to as the seismological model. The remaining ingredient for the stochastic method is the ground‐motion duration. Although the duration obviously affects the character of the ground motion in the time domain, it also significantly affects the response of a single‐degree‐of‐freedom oscillator. Recently published updates to the stochastic method include a new generalized double‐corner‐frequency source model, a new finite‐fault correction, a new parameterization of duration, and a new duration model for active crustal regions. In this article, we augment these updates with a new crustal amplification model and a new duration model for stable continental regions. Random‐vibration theory (RVT) provides a computationally efficient method to compute the peak oscillator response directly from the ground‐motion amplitude spectrum and duration. Because the correction factor used to account for the nonstationarity of the ground motion depends on the ground‐motion amplitude spectrum and duration, we also present new RVT correction factors for both active and stable regions.

Image and Video Quality Assessment Using LCD: Comparisons with CRT Conditions

NASA Astrophysics Data System (ADS)

Tourancheau, Sylvain; Callet, Patrick Le; Barba, Dominique

In this paper, the impact of display on quality assessment is addressed. Subjective quality assessment experiments have been performed on both LCD and CRT displays. Two sets of still images and two sets of moving pictures have been assessed using either an ACR or a SAMVIQ protocol. Altogether, eight experiments have been led. Results are presented and discussed, some differences are pointed out. Concerning moving pictures, these differences seem to be mainly due to LCD moving artefacts such as motion blur. LCD motion blur has been measured objectively and with psycho-physics experiments. A motion-blur metric based on the temporal characteristics of LCD can be defined. A prediction model have been then designed which predict the differences of perceived quality between CRT and LCD. This motion-blur-based model enables the estimation of perceived quality on LCD with respect to the perceived quality on CRT. Technical solutions to LCD motion blur can thus be evaluated on natural contents by this mean.

Quantitative Analysis of Transnasal Anterior Skull Base Approach: Report of Technology for Intraoperative Assessment of Instrument Motion.

PubMed

Berens, Angelique M; Harbison, Richard Alex; Li, Yangming; Bly, Randall A; Aghdasi, Nava; Ferreira, Manuel; Hannaford, Blake; Moe, Kris S

2017-08-01

To develop a method to measure intraoperative surgical instrument motion. This model will be applicable to the study of surgical instrument kinematics including surgical training, skill verification, and the development of surgical warning systems that detect aberrant instrument motion that may result in patient injury. We developed an algorithm to automate derivation of surgical instrument kinematics in an endoscopic endonasal skull base surgery model. Surgical instrument motion was recorded during a cadaveric endoscopic transnasal approach to the pituitary using a navigation system modified to record intraoperative time-stamped Euclidian coordinates and Euler angles. Microdebrider tip coordinates and angles were referenced to the cadaver's preoperative computed tomography scan allowing us to assess surgical instrument kinematics over time. A representative cadaveric endoscopic endonasal approach to the pituitary was performed to demonstrate feasibility of our algorithm for deriving surgical instrument kinematics. Technical feasibility of automatically measuring intraoperative surgical instrument motion and deriving kinematics measurements was demonstrated using standard navigation equipment.

Real-time stylistic prediction for whole-body human motions.

PubMed

Matsubara, Takamitsu; Hyon, Sang-Ho; Morimoto, Jun

2012-01-01

The ability to predict human motion is crucial in several contexts such as human tracking by computer vision and the synthesis of human-like computer graphics. Previous work has focused on off-line processes with well-segmented data; however, many applications such as robotics require real-time control with efficient computation. In this paper, we propose a novel approach called real-time stylistic prediction for whole-body human motions to satisfy these requirements. This approach uses a novel generative model to represent a whole-body human motion including rhythmic motion (e.g., walking) and discrete motion (e.g., jumping). The generative model is composed of a low-dimensional state (phase) dynamics and a two-factor observation model, allowing it to capture the diversity of motion styles in humans. A real-time adaptation algorithm was derived to estimate both state variables and style parameter of the model from non-stationary unlabeled sequential observations. Moreover, with a simple modification, the algorithm allows real-time adaptation even from incomplete (partial) observations. Based on the estimated state and style, a future motion sequence can be accurately predicted. In our implementation, it takes less than 15 ms for both adaptation and prediction at each observation. Our real-time stylistic prediction was evaluated for human walking, running, and jumping behaviors. Copyright © 2011 Elsevier Ltd. All rights reserved.

Real-Time External Respiratory Motion Measuring Technique Using an RGB-D Camera and Principal Component Analysis †

PubMed Central

Wijenayake, Udaya; Park, Soon-Yong

2017-01-01

Accurate tracking and modeling of internal and external respiratory motion in the thoracic and abdominal regions of a human body is a highly discussed topic in external beam radiotherapy treatment. Errors in target/normal tissue delineation and dose calculation and the increment of the healthy tissues being exposed to high radiation doses are some of the unsolicited problems caused due to inaccurate tracking of the respiratory motion. Many related works have been introduced for respiratory motion modeling, but a majority of them highly depend on radiography/fluoroscopy imaging, wearable markers or surgical node implanting techniques. We, in this article, propose a new respiratory motion tracking approach by exploiting the advantages of an RGB-D camera. First, we create a patient-specific respiratory motion model using principal component analysis (PCA) removing the spatial and temporal noise of the input depth data. Then, this model is utilized for real-time external respiratory motion measurement with high accuracy. Additionally, we introduce a marker-based depth frame registration technique to limit the measuring area into an anatomically consistent region that helps to handle the patient movements during the treatment. We achieved a 0.97 correlation comparing to a spirometer and 0.53 mm average error considering a laser line scanning result as the ground truth. As future work, we will use this accurate measurement of external respiratory motion to generate a correlated motion model that describes the movements of internal tumors. PMID:28792468

Modeling of earthquake ground motion in the frequency domain

NASA Astrophysics Data System (ADS)

Thrainsson, Hjortur

In recent years, the utilization of time histories of earthquake ground motion has grown considerably in the design and analysis of civil structures. It is very unlikely, however, that recordings of earthquake ground motion will be available for all sites and conditions of interest. Hence, there is a need for efficient methods for the simulation and spatial interpolation of earthquake ground motion. In addition to providing estimates of the ground motion at a site using data from adjacent recording stations, spatially interpolated ground motions can also be used in design and analysis of long-span structures, such as bridges and pipelines, where differential movement is important. The objective of this research is to develop a methodology for rapid generation of horizontal earthquake ground motion at any site for a given region, based on readily available source, path and site characteristics, or (sparse) recordings. The research includes two main topics: (i) the simulation of earthquake ground motion at a given site, and (ii) the spatial interpolation of earthquake ground motion. In topic (i), models are developed to simulate acceleration time histories using the inverse discrete Fourier transform. The Fourier phase differences, defined as the difference in phase angle between adjacent frequency components, are simulated conditional on the Fourier amplitude. Uniformly processed recordings from recent California earthquakes are used to validate the simulation models, as well as to develop prediction formulas for the model parameters. The models developed in this research provide rapid simulation of earthquake ground motion over a wide range of magnitudes and distances, but they are not intended to replace more robust geophysical models. In topic (ii), a model is developed in which Fourier amplitudes and Fourier phase angles are interpolated separately. A simple dispersion relationship is included in the phase angle interpolation. The accuracy of the interpolation model is assessed using data from the SMART-1 array in Taiwan. The interpolation model provides an effective method to estimate ground motion at a site using recordings from stations located up to several kilometers away. Reliable estimates of differential ground motion are restricted to relatively limited ranges of frequencies and inter-station spacings.

In vivo retinal imaging for fixational eye motion detection using a high-speed digital micromirror device (DMD)-based ophthalmoscope.

PubMed

Vienola, Kari V; Damodaran, Mathi; Braaf, Boy; Vermeer, Koenraad A; de Boer, Johannes F

2018-02-01

Retinal motion detection with an accuracy of 0.77 arcmin corresponding to 3.7 µm on the retina is demonstrated with a novel digital micromirror device based ophthalmoscope. By generating a confocal image as a reference, eye motion could be measured from consecutively measured subsampled frames. The subsampled frames provide 7.7 millisecond snapshots of the retina without motion artifacts between the image points of the subsampled frame, distributed over the full field of view. An ophthalmoscope pattern projection speed of 130 Hz enabled a motion detection bandwidth of 65 Hz. A model eye with a scanning mirror was built to test the performance of the motion detection algorithm. Furthermore, an in vivo motion trace was obtained from a healthy volunteer. The obtained eye motion trace clearly shows the three main types of fixational eye movements. Lastly, the obtained eye motion trace was used to correct for the eye motion in consecutively obtained subsampled frames to produce an averaged confocal image correct for motion artefacts.

In vivo retinal imaging for fixational eye motion detection using a high-speed digital micromirror device (DMD)-based ophthalmoscope

PubMed Central

Vienola, Kari V.; Damodaran, Mathi; Braaf, Boy; Vermeer, Koenraad A.; de Boer, Johannes F.

2018-01-01

Retinal motion detection with an accuracy of 0.77 arcmin corresponding to 3.7 µm on the retina is demonstrated with a novel digital micromirror device based ophthalmoscope. By generating a confocal image as a reference, eye motion could be measured from consecutively measured subsampled frames. The subsampled frames provide 7.7 millisecond snapshots of the retina without motion artifacts between the image points of the subsampled frame, distributed over the full field of view. An ophthalmoscope pattern projection speed of 130 Hz enabled a motion detection bandwidth of 65 Hz. A model eye with a scanning mirror was built to test the performance of the motion detection algorithm. Furthermore, an in vivo motion trace was obtained from a healthy volunteer. The obtained eye motion trace clearly shows the three main types of fixational eye movements. Lastly, the obtained eye motion trace was used to correct for the eye motion in consecutively obtained subsampled frames to produce an averaged confocal image correct for motion artefacts. PMID:29552396

Annual Geocenter Motion from Space Geodesy and Models

NASA Astrophysics Data System (ADS)

Ries, J. C.

2013-12-01

Ideally, the origin of the terrestrial reference frame and the center of mass of the Earth are always coincident. By construction, the origin of the reference frame is coincident with the mean Earth center of mass, averaged over the time span of the satellite laser ranging (SLR) observations used in the reference frame solution, within some level of uncertainty. At shorter time scales, tidal and non-tidal mass variations result in an offset between the origin and geocenter, called geocenter motion. Currently, there is a conventional model for the tidally-coherent diurnal and semi-diurnal geocenter motion, but there is no model for the non-tidal annual variation. This annual motion reflects the largest-scale mass redistribution in the Earth system, so it essential to observe it for a complete description of the total mass transport. Failing to model it can also cause false signals in geodetic products such as sea height observations from satellite altimeters. In this paper, a variety of estimates for the annual geocenter motion are presented based on several different geodetic techniques and models, and a ';consensus' model from SLR is suggested.

Crustal block motion model and interplate coupling along Ecuador-Colombia trench based on GNSS observation network

NASA Astrophysics Data System (ADS)

Ito, T.; Mora-Páez, H.; Peláez-Gaviria, J. R.; Kimura, H.; Sagiya, T.

2017-12-01

IntroductionEcuador-Colombia trench is located at the boundary between South-America plate, Nazca Plate and Caribrian plate. This region is very complexes such as subducting Caribrian plate and Nazca plate, and collision between Panama and northern part of the Andes mountains. The previous large earthquakes occurred along the subducting boundary of Nazca plate, such as 1906 (M8.8) and 1979 (M8.2). And also, earthquakes occurred inland, too. So, it is important to evaluate earthquake potentials for preparing huge damage due to large earthquake in near future. GNSS observation In the last decade, the GNSS observation was established in Columbia. The GNSS observation is called by GEORED, which is operated by servicing Geologico Colomiano. The purpose of GEORED is research of crustal deformation. The number of GNSS site of GEORED is consist of 60 continuous GNSS observation site at 2017 (Mora et al., 2017). The sampling interval of almost GNSS site is 30 seconds. These GNSS data were processed by PPP processing using GIPSY-OASYS II software. GEORED can obtain the detailed crustal deformation map in whole Colombia. In addition, we use 100 GNSS data at Ecuador-Peru region (Nocquet et al. 2014). Method We developed a crustal block movements model based on crustal deformation derived from GNSS observation. Our model considers to the block motion with pole location and angular velocity and the interplate coupling between each block boundaries, including subduction between the South-American plate and the Nazca plate. And also, our approach of estimation of crustal block motion and coefficient of interplate coupling are based on MCMC method. The estimated each parameter is obtained probably density function (PDF). Result We tested 11 crustal block models based on geological data, such as active fault trace at surface. The optimal number of crustal blocks is 11 for based on geological and geodetic data using AIC. We use optimal block motion model. And also, we estimate interplate coupling along the plate interface and rigid block motion. We can evaluate to contribution of elastic deformation and rigid motion. In result, weak plate coupling was found northern part of 3 degree in latitude. Almost crustal deformation are explained by rigid block motion.

Inferential modeling and predictive feedback control in real-time motion compensation using the treatment couch during radiotherapy

NASA Astrophysics Data System (ADS)

Qiu, Peng; D'Souza, Warren D.; McAvoy, Thomas J.; Liu, K. J. Ray

2007-09-01

Tumor motion induced by respiration presents a challenge to the reliable delivery of conformal radiation treatments. Real-time motion compensation represents the technologically most challenging clinical solution but has the potential to overcome the limitations of existing methods. The performance of a real-time couch-based motion compensation system is mainly dependent on two aspects: the ability to infer the internal anatomical position and the performance of the feedback control system. In this paper, we propose two novel methods for the two aspects respectively, and then combine the proposed methods into one system. To accurately estimate the internal tumor position, we present partial-least squares (PLS) regression to predict the position of the diaphragm using skin-based motion surrogates. Four radio-opaque markers were placed on the abdomen of patients who underwent fluoroscopic imaging of the diaphragm. The coordinates of the markers served as input variables and the position of the diaphragm served as the output variable. PLS resulted in lower prediction errors compared with standard multiple linear regression (MLR). The performance of the feedback control system depends on the system dynamics and dead time (delay between the initiation and execution of the control action). While the dynamics of the system can be inverted in a feedback control system, the dead time cannot be inverted. To overcome the dead time of the system, we propose a predictive feedback control system by incorporating forward prediction using least-mean-square (LMS) and recursive least square (RLS) filtering into the couch-based control system. Motion data were obtained using a skin-based marker. The proposed predictive feedback control system was benchmarked against pure feedback control (no forward prediction) and resulted in a significant performance gain. Finally, we combined the PLS inference model and the predictive feedback control to evaluate the overall performance of the feedback control system. Our results show that, with the tumor motion unknown but inferred by skin-based markers through the PLS model, the predictive feedback control system was able to effectively compensate intra-fraction motion.

In Situ Observational Constraints on GIA in Antarctica

NASA Astrophysics Data System (ADS)

Wilson, T. J.; Bevis, M. G.; Kendrick, E. C.; Konfal, S.; Dalziel, I. W.; Smalley, R.; Willis, M. J.; Wiens, D. A.; Heeszel, D. S.

2012-12-01

Geodetic and seismologic data sets have been acquired across a significant portion of Antarctica through deployment of autonomous, remote instrumentation by the Antarctic Network (ANET) project of the Polar Earth Observing Network (POLENET). Continuous GPS measurements of bedrock crustal motions are yielding a synoptic picture of vertical and horizontal crustal motion patterns from the Transantarctic Mountains to the Ellsworth-Whitmore Mountains and Marie Byrd Land regions. Vertical motion patterns are broadly compatible with predictions from current GIA models, but the magnitudes of the vertical motions are substantially lower than predicted. Slower rates of uplift due to GIA can be attributed to factors including errors in ice history, a superposed solid earth response to modern ice mass change, and/or the influence of laterally varying earth properties on the GIA response. Patterns of horizontal motions measured by ANET show that the role of laterally varying earth rheology is extremely important in Antarctica. Crustal motion vectors are closely aligned and document motion from East toward West Antarctica, in contradiction to ice sheet reconstructions placing maximum LGM ice mass loss in West Antarctica and GIA models that predict motions in the opposite direction. When compared to earth structure mapped by seismology, the horizontal crustal motions are consistently near-perpendicular to the very strong gradient in crust and mantle properties, perhaps the first confirmation of predictions from modeling studies that horizontal motions can be deflected or even reversed where such a lateral earth property exists. Accurate GIA models for Antarctica clearly require a laterally-varying earth model and tuning based on these new GPS and seismological constraints.

Model-Based Reinforcement of Kinect Depth Data for Human Motion Capture Applications

PubMed Central

Calderita, Luis Vicente; Bandera, Juan Pedro; Bustos, Pablo; Skiadopoulos, Andreas

2013-01-01

Motion capture systems have recently experienced a strong evolution. New cheap depth sensors and open source frameworks, such as OpenNI, allow for perceiving human motion on-line without using invasive systems. However, these proposals do not evaluate the validity of the obtained poses. This paper addresses this issue using a model-based pose generator to complement the OpenNI human tracker. The proposed system enforces kinematics constraints, eliminates odd poses and filters sensor noise, while learning the real dimensions of the performer's body. The system is composed by a PrimeSense sensor, an OpenNI tracker and a kinematics-based filter and has been extensively tested. Experiments show that the proposed system improves pure OpenNI results at a very low computational cost. PMID:23845933

Accumulation of microswimmers near a surface mediated by collision and rotational Brownian motion.

PubMed

Li, Guanglai; Tang, Jay X

2009-08-14

In this Letter we propose a kinematic model to explain how collisions with a surface and rotational Brownian motion give rise to accumulation of microswimmers near a surface. In this model, an elongated microswimmer invariably travels parallel to the surface after hitting it from an oblique angle. It then swims away from the surface, facilitated by rotational Brownian motion. Simulations based on this model reproduce the density distributions measured for the small bacteria E. coli and Caulobacter crescentus, as well as for the much larger bull spermatozoa swimming between two walls.

Nonlinear friction model for servo press simulation

NASA Astrophysics Data System (ADS)

Ma, Ninshu; Sugitomo, Nobuhiko; Kyuno, Takunori; Tamura, Shintaro; Naka, Tetsuo

2013-12-01

The friction coefficient was measured under an idealized condition for a pulse servo motion. The measured friction coefficient and its changing with both sliding distance and a pulse motion showed that the friction resistance can be reduced due to the re-lubrication during unloading process of the pulse servo motion. Based on the measured friction coefficient and its changes with sliding distance and re-lubrication of oil, a nonlinear friction model was developed. Using the newly developed the nonlinear friction model, a deep draw simulation was performed and the formability was evaluated. The results were compared with experimental ones and the effectiveness was verified.

WE-D-303-02: Applications of Volumetric Images Generated with a Respiratory Motion Model Based On An External Surrogate Signal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hurwitz, M; Williams, C; Dhou, S

Purpose: Respiratory motion can vary significantly over the course of simulation and treatment. Our goal is to use volumetric images generated with a respiratory motion model to improve the definition of the internal target volume (ITV) and the estimate of delivered dose. Methods: Ten irregular patient breathing patterns spanning 35 seconds each were incorporated into a digital phantom. Ten images over the first five seconds of breathing were used to emulate a 4DCT scan, build the ITV, and generate a patient-specific respiratory motion model which correlated the measured trajectories of markers placed on the patients’ chests with the motion ofmore » the internal anatomy. This model was used to generate volumetric images over the subsequent thirty seconds of breathing. The increase in the ITV taking into account the full 35 seconds of breathing was assessed with ground-truth and model-generated images. For one patient, a treatment plan based on the initial ITV was created and the delivered dose was estimated using images from the first five seconds as well as ground-truth and model-generated images from the next 30 seconds. Results: The increase in the ITV ranged from 0.2 cc to 6.9 cc for the ten patients based on ground-truth information. The model predicted this increase in the ITV with an average error of 0.8 cc. The delivered dose to the tumor (D95) changed significantly from 57 Gy to 41 Gy when estimated using 5 seconds and 30 seconds, respectively. The model captured this effect, giving an estimated D95 of 44 Gy. Conclusion: A respiratory motion model generating volumetric images of the internal patient anatomy could be useful in estimating the increase in the ITV due to irregular breathing during simulation and in assessing delivered dose during treatment. This project was supported, in part, through a Master Research Agreement with Varian Medical Systems, Inc. and Radiological Society of North America Research Scholar Grant #RSCH1206.« less

Modeling moving systems with RELAP5-3D

DOE PAGES

Mesina, G. L.; Aumiller, David L.; Buschman, Francis X.; ...

2015-12-04

RELAP5-3D is typically used to model stationary, land-based reactors. However, it can also model reactors in other inertial and accelerating frames of reference. By changing the magnitude of the gravitational vector through user input, RELAP5-3D can model reactors on a space station or the moon. The field equations have also been modified to model reactors in a non-inertial frame, such as occur in land-based reactors during earthquakes or onboard spacecraft. Transient body forces affect fluid flow in thermal-fluid machinery aboard accelerating crafts during rotational and translational accelerations. It is useful to express the equations of fluid motion in the acceleratingmore » frame of reference attached to the moving craft. However, careful treatment of the rotational and translational kinematics is required to accurately capture the physics of the fluid motion. Correlations for flow at angles between horizontal and vertical are generated via interpolation where no experimental studies or data exist. The equations for three-dimensional fluid motion in a non-inertial frame of reference are developed. As a result, two different systems for describing rotational motion are presented, user input is discussed, and an example is given.« less

A stochastic model for eye movements during fixation on a stationary target.

NASA Technical Reports Server (NTRS)

Vasudevan, R.; Phatak, A. V.; Smith, J. D.

1971-01-01

A stochastic model describing small eye movements occurring during steady fixation on a stationary target is presented. Based on eye movement data for steady gaze, the model has a hierarchical structure; the principal level represents the random motion of the image point within a local area of fixation, while the higher level mimics the jump processes involved in transitions from one local area to another. Target image motion within a local area is described by a Langevin-like stochastic differential equation taking into consideration the microsaccadic jumps pictured as being due to point processes and the high frequency muscle tremor, represented as a white noise. The transform of the probability density function for local area motion is obtained, leading to explicit expressions for their means and moments. Evaluation of these moments based on the model is comparable with experimental results.

Nuclear quadrupole resonance lineshape analysis for different motional models: Stochastic Liouville approach

NASA Astrophysics Data System (ADS)

Kruk, D.; Earle, K. A.; Mielczarek, A.; Kubica, A.; Milewska, A.; Moscicki, J.

2011-12-01

A general theory of lineshapes in nuclear quadrupole resonance (NQR), based on the stochastic Liouville equation, is presented. The description is valid for arbitrary motional conditions (particularly beyond the valid range of perturbation approaches) and interaction strengths. It can be applied to the computation of NQR spectra for any spin quantum number and for any applied magnetic field. The treatment presented here is an adaptation of the "Swedish slow motion theory," [T. Nilsson and J. Kowalewski, J. Magn. Reson. 146, 345 (2000), 10.1006/jmre.2000.2125] originally formulated for paramagnetic systems, to NQR spectral analysis. The description is formulated for simple (Brownian) diffusion, free diffusion, and jump diffusion models. The two latter models account for molecular cooperativity effects in dense systems (such as liquids of high viscosity or molecular glasses). The sensitivity of NQR slow motion spectra to the mechanism of the motional processes modulating the nuclear quadrupole interaction is discussed.

Maintaining tumor targeting accuracy in real-time motion compensation systems for respiration-induced tumor motion

PubMed Central

Malinowski, Kathleen; McAvoy, Thomas J.; George, Rohini; Dieterich, Sonja; D’Souza, Warren D.

2013-01-01

Purpose: To determine how best to time respiratory surrogate-based tumor motion model updates by comparing a novel technique based on external measurements alone to three direct measurement methods. Methods: Concurrently measured tumor and respiratory surrogate positions from 166 treatment fractions for lung or pancreas lesions were analyzed. Partial-least-squares regression models of tumor position from marker motion were created from the first six measurements in each dataset. Successive tumor localizations were obtained at a rate of once per minute on average. Model updates were timed according to four methods: never, respiratory surrogate-based (when metrics based on respiratory surrogate measurements exceeded confidence limits), error-based (when localization error ≥3 mm), and always (approximately once per minute). Results: Radial tumor displacement prediction errors (mean ± standard deviation) for the four schema described above were 2.4 ± 1.2, 1.9 ± 0.9, 1.9 ± 0.8, and 1.7 ± 0.8 mm, respectively. The never-update error was significantly larger than errors of the other methods. Mean update counts over 20 min were 0, 4, 9, and 24, respectively. Conclusions: The same improvement in tumor localization accuracy could be achieved through any of the three update methods, but significantly fewer updates were required when the respiratory surrogate method was utilized. This study establishes the feasibility of timing image acquisitions for updating respiratory surrogate models without direct tumor localization. PMID:23822413

On the Integration of Medium Wave Infrared Cameras for Vision-Based Navigation

DTIC Science & Technology

2015-03-01

SWIR Short Wave Infrared VisualSFM Visual Structure from Motion WPAFB Wright Patterson Air Force Base xi ON THE INTEGRATION OF MEDIUM WAVE INFRARED...Structure from Motion Visual Structure from Motion ( VisualSFM ) is an application that performs incremental SfM using images fed into it of a scene [20...too drastically in between frames. When this happens, VisualSFM will begin creating a new model with images that do not fit to the old one. These new

Ride quality evaluation. IV - Models of subjective reaction to aircraft motion

NASA Technical Reports Server (NTRS)

Jacobson, I. D.; Richards, L. G.

1978-01-01

The paper examines models of human reaction to the motions typically experienced on short-haul aircraft flights. Data are taken on the regularly scheduled flights of four commercial airlines - three airplanes and one helicopter. The data base consists of: (1) a series of motion recordings distributed over each flight, each including all six degrees of freedom of motion; temperature, pressure, and noise are also recorded; (2) ratings of perceived comfort and satisfaction from the passengers on each flight; (3) moment-by-moment comfort ratings from a test subject assigned to each airplane; and (4) overall comfort ratings for each flight from the test subjects. Regression models are obtained for prediction of rated comfort from rms values for six degrees of freedom of motion. It is shown that the model C = 2.1 + 17.1 T + 17.2 V (T = transverse acceleration, V = vertical acceleration) gives a good fit to the airplane data but is less acceptable for the helicopter data.

Hand-Writing Motion Tracking with Vision-Inertial Sensor Fusion: Calibration and Error Correction

PubMed Central

Zhou, Shengli; Fei, Fei; Zhang, Guanglie; Liu, Yunhui; Li, Wen J.

2014-01-01

The purpose of this study was to improve the accuracy of real-time ego-motion tracking through inertial sensor and vision sensor fusion. Due to low sampling rates supported by web-based vision sensor and accumulation of errors in inertial sensors, ego-motion tracking with vision sensors is commonly afflicted by slow updating rates, while motion tracking with inertial sensor suffers from rapid deterioration in accuracy with time. This paper starts with a discussion of developed algorithms for calibrating two relative rotations of the system using only one reference image. Next, stochastic noises associated with the inertial sensor are identified using Allan Variance analysis, and modeled according to their characteristics. Finally, the proposed models are incorporated into an extended Kalman filter for inertial sensor and vision sensor fusion. Compared with results from conventional sensor fusion models, we have shown that ego-motion tracking can be greatly enhanced using the proposed error correction model. PMID:25157546

TH-CD-207A-03: A Surface Deformation Driven Respiratory Model for Organ Motion Tracking in Lung Cancer Radiotherapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, H; Zhen, X; Zhou, L

Purpose: To propose and validate a novel real-time surface-mesh-based internal organ-external surface motion and deformation tracking method for lung cancer radiotherapy. Methods: Deformation vector fields (DVFs) which characterizes the internal and external motion are obtained by registering the internal organ and tumor contours and external surface meshes to a reference phase in the 4D CT images using a recent developed local topology preserved non-rigid point matching algorithm (TOP). A composite matrix is constructed by combing the estimated internal and external DVFs. Principle component analysis (PCA) is then applied on the composite matrix to extract principal motion characteristics and finally yieldmore » the respiratory motion model parameters which correlates the internal and external motion and deformation. The accuracy of the respiratory motion model is evaluated using a 4D NURBS-based cardiac-torso (NCAT) synthetic phantom and three lung cancer cases. The center of mass (COM) difference is used to measure the tumor motion tracking accuracy, and the Dice’s coefficient (DC), percent error (PE) and Housdourf’s distance (HD) are used to measure the agreement between the predicted and ground truth tumor shape. Results: The mean COM is 0.84±0.49mm and 0.50±0.47mm for the phantom and patient data respectively. The mean DC, PE and HD are 0.93±0.01, 0.13±0.03 and 1.24±0.34 voxels for the phantom, and 0.91±0.04, 0.17±0.07 and 3.93±2.12 voxels for the three lung cancer patients, respectively. Conclusions: We have proposed and validate a real-time surface-mesh-based organ motion and deformation tracking method with an internal-external motion modeling. The preliminary results conducted on a synthetic 4D NCAT phantom and 4D CT images from three lung cancer cases show that the proposed method is reliable and accurate in tracking both the tumor motion trajectory and deformation, which can serve as a potential tool for real-time organ motion and deformation monitoring in lung cancer radiotherapy. This work is supported in part by grant from VARIAN MEDICAL SYSTEMS INC, the National Natural Science Foundation of China (no 81428019 and no 81301940), the Guangdong Natural Science Foundation (2015A030313302)and the 2015 Pearl River S&T Nova Program of Guangzhou (201506010096).« less

Motion transparency: making models of motion perception transparent.

PubMed

Snowden; Verstraten

1999-10-01

In daily life our visual system is bombarded with motion information. We see cars driving by, flocks of birds flying in the sky, clouds passing behind trees that are dancing in the wind. Vision science has a good understanding of the first stage of visual motion processing, that is, the mechanism underlying the detection of local motions. Currently, research is focused on the processes that occur beyond the first stage. At this level, local motions have to be integrated to form objects, define the boundaries between them, construct surfaces and so on. An interesting, if complicated case is known as motion transparency: the situation in which two overlapping surfaces move transparently over each other. In that case two motions have to be assigned to the same retinal location. Several researchers have tried to solve this problem from a computational point of view, using physiological and psychophysical results as a guideline. We will discuss two models: one uses the traditional idea known as 'filter selection' and the other a relatively new approach based on Bayesian inference. Predictions from these models are compared with our own visual behaviour and that of the neural substrates that are presumed to underlie these perceptions.

Motion-mode energy method for vehicle dynamics analysis and control

NASA Astrophysics Data System (ADS)

Zhang, Nong; Wang, Lifu; Du, Haiping

2014-01-01

Vehicle motion and vibration control is a fundamental motivation for the development of advanced vehicle suspension systems. In a vehicle-fixed coordinate system, the relative motions of the vehicle between body and wheel can be classified into several dynamic stages based on energy intensity, and can be decomposed into sets of uncoupled motion-modes according to modal parameters. Vehicle motions are coupled, but motion-modes are orthogonal. By detecting and controlling the predominating vehicle motion-mode, the system cost and energy consumption of active suspensions could be reduced. A motion-mode energy method (MEM) is presented in this paper to quantify the energy contribution of each motion-mode to vehicle dynamics in real time. The control of motion-modes is prioritised according to the level of motion-mode energy. Simulation results on a 10 degree-of-freedom nonlinear full-car model with the magic-formula tyre model illustrate the effectiveness of the proposed MEM. The contribution of each motion-mode to the vehicle's dynamic behaviour is analysed under different excitation inputs from road irregularities, directional manoeuvres and braking. With the identified dominant motion-mode, novel cost-effective suspension systems, such as active reconfigurable hydraulically interconnected suspension, can possibly be used to control full-car motions with reduced energy consumption. Finally, discussion, conclusions and suggestions for future work are provided.

4D motion modeling of the coronary arteries from CT images for robotic assisted minimally invasive surgery

NASA Astrophysics Data System (ADS)

Zhang, Dong Ping; Edwards, Eddie; Mei, Lin; Rueckert, Daniel

2009-02-01

In this paper, we present a novel approach for coronary artery motion modeling from cardiac Computed Tomography( CT) images. The aim of this work is to develop a 4D motion model of the coronaries for image guidance in robotic-assisted totally endoscopic coronary artery bypass (TECAB) surgery. To utilize the pre-operative cardiac images to guide the minimally invasive surgery, it is essential to have a 4D cardiac motion model to be registered with the stereo endoscopic images acquired intraoperatively using the da Vinci robotic system. In this paper, we are investigating the extraction of the coronary arteries and the modelling of their motion from a dynamic sequence of cardiac CT. We use a multi-scale vesselness filter to enhance vessels in the cardiac CT images. The centerlines of the arteries are extracted using a ridge traversal algorithm. Using this method the coronaries can be extracted in near real-time as only local information is used in vessel tracking. To compute the deformation of the coronaries due to cardiac motion, the motion is extracted from a dynamic sequence of cardiac CT. Each timeframe in this sequence is registered to the end-diastole timeframe of the sequence using a non-rigid registration algorithm based on free-form deformations. Once the images have been registered a dynamic motion model of the coronaries can be obtained by applying the computed free-form deformations to the extracted coronary arteries. To validate the accuracy of the motion model we compare the actual position of the coronaries in each time frame with the predicted position of the coronaries as estimated from the non-rigid registration. We expect that this motion model of coronaries can facilitate the planning of TECAB surgery, and through the registration with real-time endoscopic video images it can reduce the conversion rate from TECAB to conventional procedures.

Evaluation of Drogue Parachute Damping Effects Utilizing the Apollo Legacy Parachute Model

NASA Technical Reports Server (NTRS)

Currin, Kelly M.; Gamble, Joe D.; Matz, Daniel A.; Bretz, David R.

2011-01-01

Drogue parachute damping is required to dampen the Orion Multi Purpose Crew Vehicle (MPCV) crew module (CM) oscillations prior to deployment of the main parachutes. During the Apollo program, drogue parachute damping was modeled on the premise that the drogue parachute force vector aligns with the resultant velocity of the parachute attach point on the CM. Equivalent Cm(sub q) and Cm(sub alpha) equations for drogue parachute damping resulting from the Apollo legacy parachute damping model premise have recently been developed. The MPCV computer simulations ANTARES and Osiris have implemented high fidelity two-body parachute damping models. However, high-fidelity model-based damping motion predictions do not match the damping observed during wind tunnel and full-scale free-flight oscillatory motion. This paper will present the methodology for comparing and contrasting the Apollo legacy parachute damping model with full-scale free-flight oscillatory motion. The analysis shows an agreement between the Apollo legacy parachute damping model and full-scale free-flight oscillatory motion.

Prediction of muscle activation for an eye movement with finite element modeling.

PubMed

Karami, Abbas; Eghtesad, Mohammad; Haghpanah, Seyyed Arash

2017-10-01

In this paper, a 3D finite element (FE) modeling is employed in order to predict extraocular muscles' activation and investigate force coordination in various motions of the eye orbit. A continuum constitutive hyperelastic model is employed for material description in dynamic modeling of the extraocular muscles (EOMs). Two significant features of this model are accurate mass modeling with FE method and stimulating EOMs for motion through muscle activation parameter. In order to validate the eye model, a forward dynamics simulation of the eye motion is carried out by variation of the muscle activation. Furthermore, to realize muscle activation prediction in various eye motions, two different tracking-based inverse controllers are proposed. The performance of these two inverse controllers is investigated according to their resulted muscle force magnitude and muscle force coordination. The simulation results are compared with the available experimental data and the well-known existing neurological laws. The comparison authenticates both the validation and the prediction results. Copyright © 2017 Elsevier Ltd. All rights reserved.

Accurate visible speech synthesis based on concatenating variable length motion capture data.

PubMed

Ma, Jiyong; Cole, Ron; Pellom, Bryan; Ward, Wayne; Wise, Barbara

2006-01-01

We present a novel approach to synthesizing accurate visible speech based on searching and concatenating optimal variable-length units in a large corpus of motion capture data. Based on a set of visual prototypes selected on a source face and a corresponding set designated for a target face, we propose a machine learning technique to automatically map the facial motions observed on the source face to the target face. In order to model the long distance coarticulation effects in visible speech, a large-scale corpus that covers the most common syllables in English was collected, annotated and analyzed. For any input text, a search algorithm to locate the optimal sequences of concatenated units for synthesis is desrcribed. A new algorithm to adapt lip motions from a generic 3D face model to a specific 3D face model is also proposed. A complete, end-to-end visible speech animation system is implemented based on the approach. This system is currently used in more than 60 kindergarten through third grade classrooms to teach students to read using a lifelike conversational animated agent. To evaluate the quality of the visible speech produced by the animation system, both subjective evaluation and objective evaluation are conducted. The evaluation results show that the proposed approach is accurate and powerful for visible speech synthesis.

Geometric Brownian Motion with Tempered Stable Waiting Times

NASA Astrophysics Data System (ADS)

Gajda, Janusz; Wyłomańska, Agnieszka

2012-08-01

One of the earliest system that was used to asset prices description is Black-Scholes model. It is based on geometric Brownian motion and was used as a tool for pricing various financial instruments. However, when it comes to data description, geometric Brownian motion is not capable to capture many properties of present financial markets. One can name here for instance periods of constant values. Therefore we propose an alternative approach based on subordinated tempered stable geometric Brownian motion which is a combination of the popular geometric Brownian motion and inverse tempered stable subordinator. In this paper we introduce the mentioned process and present its main properties. We propose also the estimation procedure and calibrate the analyzed system to real data.

Effects of motion base and g-seat cueing of simulator pilot performance

NASA Technical Reports Server (NTRS)

Ashworth, B. R.; Mckissick, B. T.; Parrish, R. V.

1984-01-01

In order to measure and analyze the effects of a motion plus g-seat cueing system, a manned-flight-simulation experiment was conducted utilizing a pursuit tracking task and an F-16 simulation model in the NASA Langley visual/motion simulator. This experiment provided the information necessary to determine whether motion and g-seat cues have an additive effect on the performance of this task. With respect to the lateral tracking error and roll-control stick force, the answer is affirmative. It is shown that presenting the two cues simultaneously caused significant reductions in lateral tracking error and that using the g-seat and motion base separately provided essentially equal reductions in the pilot's lateral tracking error.

Respiratory motion estimation in x-ray angiography for improved guidance during coronary interventions

NASA Astrophysics Data System (ADS)

Baka, N.; Lelieveldt, B. P. F.; Schultz, C.; Niessen, W.; van Walsum, T.

2015-05-01

During percutaneous coronary interventions (PCI) catheters and arteries are visualized by x-ray angiography (XA) sequences, using brief contrast injections to show the coronary arteries. If we could continue visualizing the coronary arteries after the contrast agent passed (thus in non-contrast XA frames), we could potentially lower contrast use, which is advantageous due to the toxicity of the contrast agent. This paper explores the possibility of such visualization in mono-plane XA acquisitions with a special focus on respiratory based coronary artery motion estimation. We use the patient specific coronary artery centerlines from pre-interventional 3D CTA images to project on the XA sequence for artery visualization. To achieve this, a framework for registering the 3D centerlines with the mono-plane 2D + time XA sequences is presented. During the registration the patient specific cardiac and respiratory motion is learned. We investigate several respiratory motion estimation strategies with respect to accuracy, plausibility and ease of use for motion prediction in XA frames with and without contrast. The investigated strategies include diaphragm motion based prediction, and respiratory motion extraction from the guiding catheter tip motion. We furthermore compare translational and rigid respiratory based heart motion. We validated the accuracy of the 2D/3D registration and the respiratory and cardiac motion estimations on XA sequences of 12 interventions. The diaphragm based motion model and the catheter tip derived motion achieved 1.58 mm and 1.83 mm median 2D accuracy, respectively. On a subset of four interventions we evaluated the artery visualization accuracy for non-contrast cases. Both diaphragm, and catheter tip based prediction performed similarly, with about half of the cases providing satisfactory accuracy (median error < 2 mm).

Data Fusion Based on Optical Technology for Observation of Human Manipulation

NASA Astrophysics Data System (ADS)

Falco, Pietro; De Maria, Giuseppe; Natale, Ciro; Pirozzi, Salvatore

2012-01-01

The adoption of human observation is becoming more and more frequent within imitation learning and programming by demonstration approaches (PbD) to robot programming. For robotic systems equipped with anthropomorphic hands, the observation phase is very challenging and no ultimate solution exists. This work proposes a novel mechatronic approach to the observation of human hand motion during manipulation tasks. The strategy is based on the combined use of an optical motion capture system and a low-cost data glove equipped with novel joint angle sensors, based on optoelectronic technology. The combination of the two information sources is obtained through a sensor fusion algorithm based on the extended Kalman filter (EKF) suitably modified to tackle the problem of marker occlusions, typical of optical motion capture systems. This approach requires a kinematic model of the human hand. Another key contribution of this work is a new method to calibrate this model.

Resolved motion rate and resolved acceleration servo-control of wheeled mobile robots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muir, P.F.; Neuman, C.P.; Carnegie-Mellon Univ., Pittsburgh, PA

1989-01-01

Accurate motion control of wheeled mobile robots (WMRs) is required for their application to autonomous, semi-autonomous and teleoperated tasks. The similarities between WMRs and stationary manipulators suggest that current, successful, model-based manipulator control algorithms may be applied to WMRs. Special characteristics of WMRs including higher-pairs, closed-chains, friction and unactuated and unsensed joints require innovative modeling methodologies. The WMR modeling challenge has been recently overcome, thus enabling the application of manipulator control algorithms to WMRs. This realization lays the foundation for significant technology transfer from manipulator control to WMR control. We apply two Cartesian-space manipulator control algorithms: resolved motion rate (kinematics-based)more » and resolved acceleration (dynamics-based) control to WMR servo-control. We evaluate simulation studies of two exemplary WMRs: Uranus (a three degree-of-freedom WMR constructed at Carnegie Mellon University), and Bicsun-Bicas (a two degree-of-freedom WMR being constructed at Sandia National Laboratories) under the control of these algorithms. Although resolved motion rate servo-control is adequate for the control of Uranus, resolved acceleration servo-control is required for the control of the mechanically simpler Bicsun-Bicas because it exhibits more dynamic coupling and nonlinearities. Successful accurate motion control of these WMRs in simulation is driving current experimental research studies. 18 refs., 7 figs., 5 tabs.« less

Correlation between external and internal respiratory motion: a validation study.

PubMed

Ernst, Floris; Bruder, Ralf; Schlaefer, Alexander; Schweikard, Achim

2012-05-01

In motion-compensated image-guided radiotherapy, accurate tracking of the target region is required. This tracking process includes building a correlation model between external surrogate motion and the motion of the target region. A novel correlation method is presented and compared with the commonly used polynomial model. The CyberKnife system (Accuray, Inc., Sunnyvale/CA) uses a polynomial correlation model to relate externally measured surrogate data (optical fibres on the patient's chest emitting red light) to infrequently acquired internal measurements (X-ray data). A new correlation algorithm based on ɛ -Support Vector Regression (SVR) was developed. Validation and comparison testing were done with human volunteers using live 3D ultrasound and externally measured infrared light-emitting diodes (IR LEDs). Seven data sets (5:03-6:27 min long) were recorded from six volunteers. Polynomial correlation algorithms were compared to the SVR-based algorithm demonstrating an average increase in root mean square (RMS) accuracy of 21.3% (0.4 mm). For three signals, the increase was more than 29% and for one signal as much as 45.6% (corresponding to more than 1.5 mm RMS). Further analysis showed the improvement to be statistically significant. The new SVR-based correlation method outperforms traditional polynomial correlation methods for motion tracking. This method is suitable for clinical implementation and may improve the overall accuracy of targeted radiotherapy.

Biomechanical Analysis of Lateral Lumbar Interbody Fusion Constructs with Various Fixation Options: Based on a Validated Finite Element Model.

PubMed

Zhang, Zhenjun; Fogel, Guy R; Liao, Zhenhua; Sun, Yitao; Liu, Weiqiang

2018-06-01

Lateral lumbar interbody fusion using cage supplemented with fixation has been used widely in the treatment of lumbar disease. A combined fixation (CF) of lateral plate and spinous process plate may provide multiplanar stability similar to that of bilateral pedicle screws (BPS) and may reduce morbidity. The biomechanical influence of the CF on cage subsidence and facet joint stress has not been well described. The aim of this study was to compare biomechanics of various fixation options and to verify biomechanical effects of the CF. The surgical finite element models with various fixation options were constructed based on computed tomography images. The lateral plate and posterior spinous process plate were applied (CF). The 6 motion modes were simulated. Range of motion (ROM), cage stress, endplate stress, and facet joint stress were compared. For the CF model, ROM, cage stress, and endplate stress were the minimum in almost all motion modes. Compared with BPS, the CF reduced ROM, cage stress, and endplate stress in all motion modes. The ROM was reduced by more than 10% in all motion modes except for flexion; cage stress and endplate stress were reduced more than 10% in all motion modes except for rotation-left. After interbody fusion, facet joint stress was reduced substantially compared with the intact conditions in all motion modes except for flexion. The combined plate fixation may offer an alternative to BPS fixation in lateral lumbar interbody fusion. Copyright © 2018 Elsevier Inc. All rights reserved.

Population-based respiratory 4D motion atlas construction and its application for VR simulations of liver punctures

NASA Astrophysics Data System (ADS)

Mastmeyer, Andre; Wilms, Matthias; Handels, Heinz

2018-03-01

Virtual reality (VR) training simulators of liver needle insertion in the hepatic area of breathing virtual patients often need 4D image data acquisitions as a prerequisite. Here, first a population-based breathing virtual patient 4D atlas is built and second the requirement of a dose-relevant or expensive acquisition of a 4D CT or MRI data set for a new patient can be mitigated by warping the mean atlas motion. The breakthrough contribution of this work is the construction and reuse of population-based, learned 4D motion models.

Processing of angular motion and gravity information through an internal model.

PubMed

Laurens, Jean; Straumann, Dominik; Hess, Bernhard J M

2010-09-01

The vestibular organs in the base of the skull provide important information about head orientation and motion in space. Previous studies have suggested that both angular velocity information from the semicircular canals and information about head orientation and translation from the otolith organs are centrally processed in an internal model of head motion, using the principles of optimal estimation. This concept has been successfully applied to model behavioral responses to classical vestibular motion paradigms. This study measured the dynamic of the vestibuloocular reflex during postrotatory tilt, tilt during the optokinetic afternystagmus, and off-vertical axis rotation. The influence of otolith signal on the VOR was systematically varied by using a series of tilt angles. We found that the time constants of responses varied almost identically as a function of gravity in these paradigms. We show that Bayesian modeling could predict the experimental results in an accurate and consistent manner. In contrast to other approaches, the Bayesian model also provides a plausible explanation of why these vestibulooculo motor responses occur as a consequence of an internal process of optimal motion estimation.

WE-G-BRD-01: A Data-Driven 4D-MRI Motion Model to Estimate Full Field-Of-View Abdominal Motion From 2D Image Navigators During MR-Linac Treatment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stemkens, B; Tijssen, RHN; Denis de Senneville, B Denis

2015-06-15

Purpose: To estimate full field-of-view abdominal respiratory motion from fast 2D image navigators using a 4D-MRI based motion model. This will allow for radiation dose accumulation mapping during MR-Linac treatment. Methods: Experiments were conducted on a Philips Ingenia 1.5T MRI. First, a retrospectively ordered 4D-MRI was constructed using 3D transient-bSSFP with radial in-plane sampling. Motion fields were calculated through 3D non-rigid registration. From these motion fields a PCA-based abdominal motion model was constructed and used to warp a 3D reference volume to fast 2D cine-MR image navigators that can be used for real-time tracking. To test this procedure, a time-seriesmore » consisting of two interleaved orthogonal slices (sagittal and coronal), positioned on the pancreas or kidneys, were acquired for 1m38s (dynamic scan-time=0.196ms), during normal, shallow, or deep breathing. The coronal slices were used to update the optimal weights for the first two PCA components, in order to warp the 3D reference image and construct a dynamic 4D-MRI time-series. The interleaved sagittal slices served as an independent measure to test the model’s accuracy and fit. Spatial maps of the root-mean-squared error (RMSE) and histograms of the motion differences within the pancreas and kidneys were used to evaluate the method. Results: Cranio-caudal motion was accurately calculated within the pancreas using the model for normal and shallow breathing with an RMSE of 1.6mm and 1.5mm and a histogram median and standard deviation below 0.2 and 1.7mm, respectively. For deep-breathing an underestimation of the inhale amplitude was observed (RMSE=4.1mm). Respiratory-induced antero-posterior and lateral motion were correctly mapped (RMSE=0.6/0.5mm). Kidney motion demonstrated good motion estimation with RMSE-values of 0.95 and 2.4mm for the right and left kidney, respectively. Conclusion: We have demonstrated a method that can calculate dynamic 3D abdominal motion in a large volume, while acquiring real-time cine-MR images for MR-guided radiotherapy.« less

Losses to single-family housing from ground motions in the 1994 Northridge, California, earthquake

USGS Publications Warehouse

Wesson, R.L.; Perkins, D.M.; Leyendecker, E.V.; Roth, R.J.; Petersen, M.D.

2004-01-01

The distributions of insured losses to single-family housing following the 1994 Northridge, California, earthquake for 234 ZIP codes can be satisfactorily modeled with gamma distributions. Regressions of the parameters in the gamma distribution on estimates of ground motion, derived from ShakeMap estimates or from interpolated observations, provide a basis for developing curves of conditional probability of loss given a ground motion. Comparison of the resulting estimates of aggregate loss with the actual aggregate loss gives satisfactory agreement for several different ground-motion parameters. Estimates of loss based on a deterministic spatial model of the earthquake ground motion, using standard attenuation relationships and NEHRP soil factors, give satisfactory results for some ground-motion parameters if the input ground motions are increased about one and one-half standard deviations above the median, reflecting the fact that the ground motions for the Northridge earthquake tended to be higher than the median ground motion for other earthquakes with similar magnitude. The results give promise for making estimates of insured losses to a similar building stock under future earthquake loading. ?? 2004, Earthquake Engineering Research Institute.

Effect of a Near Fault on the Seismic Response of a Base-Isolated Structure with a Soft Storey

NASA Astrophysics Data System (ADS)

Athamnia, B.; Ounis, A.; Abdeddaim, M.

2017-12-01

This study focuses on the soft-storey behavior of RC structures with lead core rubber bearing (LRB) isolation systems under near and far-fault motions. Under near-fault ground motions, seismic isolation devices might perform poorly because of large isolator displacements caused by large velocity and displacement pulses associated with such strong motions. In this study, four different structural models have been designed to study the effect of soft-storey behavior under near-fault and far-fault motions. The seismic analysis for isolated reinforced concrete buildings is carried out using a nonlinear time history analysis method. Inter-story drifts, absolute acceleration, displacement, base shear forces, hysteretic loops and the distribution of plastic hinges are examined as a result of the analysis. These results show that the performance of a base isolated RC structure is more affected by increasing the height of a story under nearfault motion than under far-fault motion.

Robust Models for Optic Flow Coding in Natural Scenes Inspired by Insect Biology

PubMed Central

Brinkworth, Russell S. A.; O'Carroll, David C.

2009-01-01

The extraction of accurate self-motion information from the visual world is a difficult problem that has been solved very efficiently by biological organisms utilizing non-linear processing. Previous bio-inspired models for motion detection based on a correlation mechanism have been dogged by issues that arise from their sensitivity to undesired properties of the image, such as contrast, which vary widely between images. Here we present a model with multiple levels of non-linear dynamic adaptive components based directly on the known or suspected responses of neurons within the visual motion pathway of the fly brain. By testing the model under realistic high-dynamic range conditions we show that the addition of these elements makes the motion detection model robust across a large variety of images, velocities and accelerations. Furthermore the performance of the entire system is more than the incremental improvements offered by the individual components, indicating beneficial non-linear interactions between processing stages. The algorithms underlying the model can be implemented in either digital or analog hardware, including neuromorphic analog VLSI, but defy an analytical solution due to their dynamic non-linear operation. The successful application of this algorithm has applications in the development of miniature autonomous systems in defense and civilian roles, including robotics, miniature unmanned aerial vehicles and collision avoidance sensors. PMID:19893631

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pitarka, A.

In this project we developed GEN_SRF4 a computer program for generating kinematic rupture models, compatible with the SRF format, using Irikura and Miyake (2011) asperity-­based earthquake rupture model (IM2011, hereafter). IM2011, also known as Irkura’s recipe, has been widely used to model and simulate ground motion from earthquakes in Japan. An essential part of the method is its kinematic rupture generation technique, which is based on a deterministic rupture asperity modeling approach. The source model simplicity and efficiency of IM2011 at reproducing ground motion from earthquakes recorded in Japan makes it attractive to developers and users of the Southern Californiamore » Earthquake Center Broadband Platform (SCEC BB platform). Besides writing the code the objective of our study was to test the transportability of IM2011 to broadband simulation methods used by the SCEC BB platform. Here we test it using the Graves and Pitarka (2010) method, implemented in the platform. We performed broadband (0.1- -10 Hz) ground motion simulations for a M6.7 scenario earthquake using rupture models produced with both GEN_SRF4 and rupture generator of Graves and Pitarka (2016), (GP2016 hereafter). In the simulations we used the same Green’s functions, and same high frequency approach for calculating the low-­frequency and high-­frequency parts of ground motion, respectively.« less

Motion sickness: a negative reinforcement model.

PubMed

Bowins, Brad

2010-01-15

Theories pertaining to the "why" of motion sickness are in short supply relative to those detailing the "how." Considering the profoundly disturbing and dysfunctional symptoms of motion sickness, it is difficult to conceive of why this condition is so strongly biologically based in humans and most other mammalian and primate species. It is posited that motion sickness evolved as a potent negative reinforcement system designed to terminate motion involving sensory conflict or postural instability. During our evolution and that of many other species, motion of this type would have impaired evolutionary fitness via injury and/or signaling weakness and vulnerability to predators. The symptoms of motion sickness strongly motivate the individual to terminate the offending motion by early avoidance, cessation of movement, or removal of oneself from the source. The motion sickness negative reinforcement mechanism functions much like pain to strongly motivate evolutionary fitness preserving behavior. Alternative why theories focusing on the elimination of neurotoxins and the discouragement of motion programs yielding vestibular conflict suffer from several problems, foremost that neither can account for the rarity of motion sickness in infants and toddlers. The negative reinforcement model proposed here readily accounts for the absence of motion sickness in infants and toddlers, in that providing strong motivation to terminate aberrant motion does not make sense until a child is old enough to act on this motivation.

SENSITIVITY OF STRUCTURAL RESPONSE TO GROUND MOTION SOURCE AND SITE PARAMETERS.

USGS Publications Warehouse

Safak, Erdal; Brebbia, C.A.; Cakmak, A.S.; Abdel Ghaffar, A.M.

1985-01-01

Designing structures to withstand earthquakes requires an accurate estimation of the expected ground motion. While engineers use the peak ground acceleration (PGA) to model the strong ground motion, seismologists use physical characteristics of the source and the rupture mechanism, such as fault length, stress drop, shear wave velocity, seismic moment, distance, and attenuation. This study presents a method for calculating response spectra from seismological models using random vibration theory. It then investigates the effect of various source and site parameters on peak response. Calculations are based on a nonstationary stochastic ground motion model, which can incorporate all the parameters both in frequency and time domains. The estimation of the peak response accounts for the effects of the non-stationarity, bandwidth and peak correlations of the response.

Real-time tumor motion estimation using respiratory surrogate via memory-based learning

NASA Astrophysics Data System (ADS)

Li, Ruijiang; Lewis, John H.; Berbeco, Ross I.; Xing, Lei

2012-08-01

Respiratory tumor motion is a major challenge in radiation therapy for thoracic and abdominal cancers. Effective motion management requires an accurate knowledge of the real-time tumor motion. External respiration monitoring devices (optical, etc) provide a noninvasive, non-ionizing, low-cost and practical approach to obtain the respiratory signal. Due to the highly complex and nonlinear relations between tumor and surrogate motion, its ultimate success hinges on the ability to accurately infer the tumor motion from respiratory surrogates. Given their widespread use in the clinic, such a method is critically needed. We propose to use a powerful memory-based learning method to find the complex relations between tumor motion and respiratory surrogates. The method first stores the training data in memory and then finds relevant data to answer a particular query. Nearby data points are assigned high relevance (or weights) and conversely distant data are assigned low relevance. By fitting relatively simple models to local patches instead of fitting one single global model, it is able to capture highly nonlinear and complex relations between the internal tumor motion and external surrogates accurately. Due to the local nature of weighting functions, the method is inherently robust to outliers in the training data. Moreover, both training and adapting to new data are performed almost instantaneously with memory-based learning, making it suitable for dynamically following variable internal/external relations. We evaluated the method using respiratory motion data from 11 patients. The data set consists of simultaneous measurement of 3D tumor motion and 1D abdominal surface (used as the surrogate signal in this study). There are a total of 171 respiratory traces, with an average peak-to-peak amplitude of ∼15 mm and average duration of ∼115 s per trace. Given only 5 s (roughly one breath) pretreatment training data, the method achieved an average 3D error of 1.5 mm and 95th percentile error of 3.4 mm on unseen test data. The average 3D error was further reduced to 1.4 mm when the model was tuned to its optimal setting for each respiratory trace. In one trace where a few outliers are present in the training data, the proposed method achieved an error reduction of as much as ∼50% compared with the best linear model (1.0 mm versus 2.1 mm). The memory-based learning technique is able to accurately capture the highly complex and nonlinear relations between tumor and surrogate motion in an efficient manner (a few milliseconds per estimate). Furthermore, the algorithm is particularly suitable to handle situations where the training data are contaminated by large errors or outliers. These desirable properties make it an ideal candidate for accurate and robust tumor gating/tracking using respiratory surrogates.

Study of the Navigation Method for a Snake Robot Based on the Kinematics Model with MEMS IMU

PubMed Central

Dou, Lihua; Su, Zhong; Liu, Ning

2018-01-01

A snake robot is a type of highly redundant mobile robot that significantly differs from a tracked robot, wheeled robot and legged robot. To address the issue of a snake robot performing self-localization in the application environment without assistant orientation, an autonomous navigation method is proposed based on the snake robot’s motion characteristic constraints. The method realized the autonomous navigation of the snake robot with non-nodes and an external assistant using its own Micro-Electromechanical-Systems (MEMS) Inertial-Measurement-Unit (IMU). First, it studies the snake robot’s motion characteristics, builds the kinematics model, and then analyses the motion constraint characteristics and motion error propagation properties. Second, it explores the snake robot’s navigation layout, proposes a constraint criterion and the fixed relationship, and makes zero-state constraints based on the motion features and control modes of a snake robot. Finally, it realizes autonomous navigation positioning based on the Extended-Kalman-Filter (EKF) position estimation method under the constraints of its motion characteristics. With the self-developed snake robot, the test verifies the proposed method, and the position error is less than 5% of Total-Traveled-Distance (TDD). In a short-distance environment, this method is able to meet the requirements of a snake robot in order to perform autonomous navigation and positioning in traditional applications and can be extended to other familiar multi-link robots. PMID:29547515

Multichannel techniques for motion artifacts removal from electrocardiographic signals.

PubMed

Milanesi, M; Martini, N; Vanello, N; Positano, V; Santarelli, M F; Paradiso, R; De Rossi, D; Landini, L

2006-01-01

Electrocardiographic (ECG) signals are affected by several kinds of artifacts, that may hide vital signs of interest. Motion artifacts, due to the motion of the electrodes in relation to patient skin, are particularly frequent in bioelectrical signals acquired by wearable systems. In this paper we propose different approaches in order to get rid of motion confounds. The first approach we follow starts from measuring electrode motion provided by an accelerometer placed on the electrode and use this measurement in an adaptive filtering system to remove the noise present in the ECG. The second approach is based on independent component analysis methods applied to multichannel ECG recordings; we propose to use both instantaneous model and a frequency domain implementation of the convolutive model that accounts for different paths of the source signals to the electrodes.

Identification of Piecewise Linear Uniform Motion Blur

NASA Astrophysics Data System (ADS)

Patanukhom, Karn; Nishihara, Akinori

A motion blur identification scheme is proposed for nonlinear uniform motion blurs approximated by piecewise linear models which consist of more than one linear motion component. The proposed scheme includes three modules that are a motion direction estimator, a motion length estimator and a motion combination selector. In order to identify the motion directions, the proposed scheme is based on a trial restoration by using directional forward ramp motion blurs along different directions and an analysis of directional information via frequency domain by using a Radon transform. Autocorrelation functions of image derivatives along several directions are employed for estimation of the motion lengths. A proper motion combination is identified by analyzing local autocorrelation functions of non-flat component of trial restored results. Experimental examples of simulated and real world blurred images are given to demonstrate a promising performance of the proposed scheme.

Data-Driven Based Asynchronous Motor Control for Printing Servo Systems

NASA Astrophysics Data System (ADS)

Bian, Min; Guo, Qingyun

Modern digital printing equipment aims to the environmental-friendly industry with high dynamic performances and control precision and low vibration and abrasion. High performance motion control system of printing servo systems was required. Control system of asynchronous motor based on data acquisition was proposed. Iterative learning control (ILC) algorithm was studied. PID control was widely used in the motion control. However, it was sensitive to the disturbances and model parameters variation. The ILC applied the history error data and present control signals to approximate the control signal directly in order to fully track the expect trajectory without the system models and structures. The motor control algorithm based on the ILC and PID was constructed and simulation results were given. The results show that data-driven control method is effective dealing with bounded disturbances for the motion control of printing servo systems.

Deductive Reasoning to Teach Newton's Law of Motion

ERIC Educational Resources Information Center

Lee, Han Su; Park, Jongwon

2013-01-01

Finding out about and then understanding the forces acting on a moving object, based on a description of the change in motion of this object, is an important part of the conceptual understanding of Newton's law of motion. Using Hempel's deductive-normative model for scientific explanation, we developed a deductive explanation task (DET),…

Segmenting Continuous Motions with Hidden Semi-markov Models and Gaussian Processes

PubMed Central

Nakamura, Tomoaki; Nagai, Takayuki; Mochihashi, Daichi; Kobayashi, Ichiro; Asoh, Hideki; Kaneko, Masahide

2017-01-01

Humans divide perceived continuous information into segments to facilitate recognition. For example, humans can segment speech waves into recognizable morphemes. Analogously, continuous motions are segmented into recognizable unit actions. People can divide continuous information into segments without using explicit segment points. This capacity for unsupervised segmentation is also useful for robots, because it enables them to flexibly learn languages, gestures, and actions. In this paper, we propose a Gaussian process-hidden semi-Markov model (GP-HSMM) that can divide continuous time series data into segments in an unsupervised manner. Our proposed method consists of a generative model based on the hidden semi-Markov model (HSMM), the emission distributions of which are Gaussian processes (GPs). Continuous time series data is generated by connecting segments generated by the GP. Segmentation can be achieved by using forward filtering-backward sampling to estimate the model's parameters, including the lengths and classes of the segments. In an experiment using the CMU motion capture dataset, we tested GP-HSMM with motion capture data containing simple exercise motions; the results of this experiment showed that the proposed GP-HSMM was comparable with other methods. We also conducted an experiment using karate motion capture data, which is more complex than exercise motion capture data; in this experiment, the segmentation accuracy of GP-HSMM was 0.92, which outperformed other methods. PMID:29311889

Best Practices in Physics-Based Fault Rupture Models for Seismic Hazard Assessment of Nuclear Installations

NASA Astrophysics Data System (ADS)

Dalguer, Luis A.; Fukushima, Yoshimitsu; Irikura, Kojiro; Wu, Changjiang

2017-09-01

Inspired by the first workshop on Best Practices in Physics-Based Fault Rupture Models for Seismic Hazard Assessment of Nuclear Installations (BestPSHANI) conducted by the International Atomic Energy Agency (IAEA) on 18-20 November, 2015 in Vienna (http://www-pub.iaea.org/iaeameetings/50896/BestPSHANI), this PAGEOPH topical volume collects several extended articles from this workshop as well as several new contributions. A total of 17 papers have been selected on topics ranging from the seismological aspects of earthquake cycle simulations for source-scaling evaluation, seismic source characterization, source inversion and ground motion modeling (based on finite fault rupture using dynamic, kinematic, stochastic and empirical Green's functions approaches) to the engineering application of simulated ground motion for the analysis of seismic response of structures. These contributions include applications to real earthquakes and description of current practice to assess seismic hazard in terms of nuclear safety in low seismicity areas, as well as proposals for physics-based hazard assessment for critical structures near large earthquakes. Collectively, the papers of this volume highlight the usefulness of physics-based models to evaluate and understand the physical causes of observed and empirical data, as well as to predict ground motion beyond the range of recorded data. Relevant importance is given on the validation and verification of the models by comparing synthetic results with observed data and empirical models.

Ultrasound thermography: A new temperature reconstruction model and in vivo results

NASA Astrophysics Data System (ADS)

Bayat, Mahdi; Ballard, John R.; Ebbini, Emad S.

2017-03-01

The recursive echo strain filter (RESF) model is presented as a new echo shift-based ultrasound temperature estimation model. The model is shown to have an infinite impulse response (IIR) filter realization of a differentitor-integrator operator. This model is then used for tracking sub-therapeutic temperature changes due to high intensity focused ultrasound (HIFU) shots in the hind limb of the Copenhagen rats in vivo. In addition to the reconstruction filter, a motion compensation method is presented which takes advantage of the deformation field outside the region of interest to correct the motion errors during temperature tracking. The combination of the RESF model and motion compensation algorithm is shown to greatly enhance the accuracy of the in vivo temperature estimation using ultrasound echo shifts.

Using an external surrogate for predictor model training in real-time motion management of lung tumors.

PubMed

Rottmann, Joerg; Berbeco, Ross

2014-12-01

Precise prediction of respiratory motion is a prerequisite for real-time motion compensation techniques such as beam, dynamic couch, or dynamic multileaf collimator tracking. Collection of tumor motion data to train the prediction model is required for most algorithms. To avoid exposure of patients to additional dose from imaging during this procedure, the feasibility of training a linear respiratory motion prediction model with an external surrogate signal is investigated and its performance benchmarked against training the model with tumor positions directly. The authors implement a lung tumor motion prediction algorithm based on linear ridge regression that is suitable to overcome system latencies up to about 300 ms. Its performance is investigated on a data set of 91 patient breathing trajectories recorded from fiducial marker tracking during radiotherapy delivery to the lung of ten patients. The expected 3D geometric error is quantified as a function of predictor lookahead time, signal sampling frequency and history vector length. Additionally, adaptive model retraining is evaluated, i.e., repeatedly updating the prediction model after initial training. Training length for this is gradually increased with incoming (internal) data availability. To assess practical feasibility model calculation times as well as various minimum data lengths for retraining are evaluated. Relative performance of model training with external surrogate motion data versus tumor motion data is evaluated. However, an internal-external motion correlation model is not utilized, i.e., prediction is solely driven by internal motion in both cases. Similar prediction performance was achieved for training the model with external surrogate data versus internal (tumor motion) data. Adaptive model retraining can substantially boost performance in the case of external surrogate training while it has little impact for training with internal motion data. A minimum adaptive retraining data length of 8 s and history vector length of 3 s achieve maximal performance. Sampling frequency appears to have little impact on performance confirming previously published work. By using the linear predictor, a relative geometric 3D error reduction of about 50% was achieved (using adaptive retraining, a history vector length of 3 s and with results averaged over all investigated lookahead times and signal sampling frequencies). The absolute mean error could be reduced from (2.0 ± 1.6) mm when using no prediction at all to (0.9 ± 0.8) mm and (1.0 ± 0.9) mm when using the predictor trained with internal tumor motion training data and external surrogate motion training data, respectively (for a typical lookahead time of 250 ms and sampling frequency of 15 Hz). A linear prediction model can reduce latency induced tracking errors by an average of about 50% in real-time image guided radiotherapy systems with system latencies of up to 300 ms. Training a linear model for lung tumor motion prediction with an external surrogate signal alone is feasible and results in similar performance as training with (internal) tumor motion. Particularly for scenarios where motion data are extracted from fluoroscopic imaging with ionizing radiation, this may alleviate the need for additional imaging dose during the collection of model training data.

Hierarchical HMM based learning of navigation primitives for cooperative robotic endovascular catheterization.

PubMed

Rafii-Tari, Hedyeh; Liu, Jindong; Payne, Christopher J; Bicknell, Colin; Yang, Guang-Zhong

2014-01-01

Despite increased use of remote-controlled steerable catheter navigation systems for endovascular intervention, most current designs are based on master configurations which tend to alter natural operator tool interactions. This introduces problems to both ergonomics and shared human-robot control. This paper proposes a novel cooperative robotic catheterization system based on learning-from-demonstration. By encoding the higher-level structure of a catheterization task as a sequence of primitive motions, we demonstrate how to achieve prospective learning for complex tasks whilst incorporating subject-specific variations. A hierarchical Hidden Markov Model is used to model each movement primitive as well as their sequential relationship. This model is applied to generation of motion sequences, recognition of operator input, and prediction of future movements for the robot. The framework is validated by comparing catheter tip motions against the manual approach, showing significant improvements in the quality of catheterization. The results motivate the design of collaborative robotic systems that are intuitive to use, while reducing the cognitive workload of the operator.

BEM-based simulation of lung respiratory deformation for CT-guided biopsy.

PubMed

Chen, Dong; Chen, Weisheng; Huang, Lipeng; Feng, Xuegang; Peters, Terry; Gu, Lixu

2017-09-01

Accurate and real-time prediction of the lung and lung tumor deformation during respiration are important considerations when performing a peripheral biopsy procedure. However, most existing work focused on offline whole lung simulation using 4D image data, which is not applicable in real-time image-guided biopsy with limited image resources. In this paper, we propose a patient-specific biomechanical model based on the boundary element method (BEM) computed from CT images to estimate the respiration motion of local target lesion region, vessel tree and lung surface for the real-time biopsy guidance. This approach applies pre-computation of various BEM parameters to facilitate the requirement for real-time lung motion simulation. The resulting boundary condition at end inspiratory phase is obtained using a nonparametric discrete registration with convex optimization, and the simulation of the internal tissue is achieved by applying a tetrahedron-based interpolation method depend on expert-determined feature points on the vessel tree model. A reference needle is tracked to update the simulated lung motion during biopsy guidance. We evaluate the model by applying it for respiratory motion estimations of ten patients. The average symmetric surface distance (ASSD) and the mean target registration error (TRE) are employed to evaluate the proposed model. Results reveal that it is possible to predict the lung motion with ASSD of [Formula: see text] mm and a mean TRE of [Formula: see text] mm at largest over the entire respiratory cycle. In the CT-/electromagnetic-guided biopsy experiment, the whole process was assisted by our BEM model and final puncture errors in two studies were 3.1 and 2.0 mm, respectively. The experiment results reveal that both the accuracy of simulation and real-time performance meet the demands of clinical biopsy guidance.

Wavelet-Based Motion Artifact Removal for Electrodermal Activity

PubMed Central

Chen, Weixuan; Jaques, Natasha; Taylor, Sara; Sano, Akane; Fedor, Szymon; Picard, Rosalind W.

2017-01-01

Electrodermal activity (EDA) recording is a powerful, widely used tool for monitoring psychological or physiological arousal. However, analysis of EDA is hampered by its sensitivity to motion artifacts. We propose a method for removing motion artifacts from EDA, measured as skin conductance (SC), using a stationary wavelet transform (SWT). We modeled the wavelet coefficients as a Gaussian mixture distribution corresponding to the underlying skin conductance level (SCL) and skin conductance responses (SCRs). The goodness-of-fit of the model was validated on ambulatory SC data. We evaluated the proposed method in comparison with three previous approaches. Our method achieved a greater reduction of artifacts while retaining motion-artifact-free data. PMID:26737714

Fast instantaneous center of rotation estimation algorithm for a skied-steered robot

NASA Astrophysics Data System (ADS)

Kniaz, V. V.

2015-05-01

Skid-steered robots are widely used as mobile platforms for machine vision systems. However it is hard to achieve a stable motion of such robots along desired trajectory due to an unpredictable wheel slip. It is possible to compensate the unpredictable wheel slip and stabilize the motion of the robot using visual odometry. This paper presents a fast optical flow based algorithm for estimation of instantaneous center of rotation, angular and longitudinal speed of the robot. The proposed algorithm is based on Horn-Schunck variational optical flow estimation method. The instantaneous center of rotation and motion of the robot is estimated by back projection of optical flow field to the ground surface. The developed algorithm was tested using skid-steered mobile robot. The robot is based on a mobile platform that includes two pairs of differential driven motors and a motor controller. Monocular visual odometry system consisting of a singleboard computer and a low cost webcam is mounted on the mobile platform. A state-space model of the robot was derived using standard black-box system identification. The input (commands) and the output (motion) were recorded using a dedicated external motion capture system. The obtained model was used to control the robot without visual odometry data. The paper is concluded with the algorithm quality estimation by comparison of the trajectories estimated by the algorithm with the data from motion capture system.

Illusory Motion Reproduced by Deep Neural Networks Trained for Prediction

PubMed Central

Watanabe, Eiji; Kitaoka, Akiyoshi; Sakamoto, Kiwako; Yasugi, Masaki; Tanaka, Kenta

2018-01-01

The cerebral cortex predicts visual motion to adapt human behavior to surrounding objects moving in real time. Although the underlying mechanisms are still unknown, predictive coding is one of the leading theories. Predictive coding assumes that the brain's internal models (which are acquired through learning) predict the visual world at all times and that errors between the prediction and the actual sensory input further refine the internal models. In the past year, deep neural networks based on predictive coding were reported for a video prediction machine called PredNet. If the theory substantially reproduces the visual information processing of the cerebral cortex, then PredNet can be expected to represent the human visual perception of motion. In this study, PredNet was trained with natural scene videos of the self-motion of the viewer, and the motion prediction ability of the obtained computer model was verified using unlearned videos. We found that the computer model accurately predicted the magnitude and direction of motion of a rotating propeller in unlearned videos. Surprisingly, it also represented the rotational motion for illusion images that were not moving physically, much like human visual perception. While the trained network accurately reproduced the direction of illusory rotation, it did not detect motion components in negative control pictures wherein people do not perceive illusory motion. This research supports the exciting idea that the mechanism assumed by the predictive coding theory is one of basis of motion illusion generation. Using sensory illusions as indicators of human perception, deep neural networks are expected to contribute significantly to the development of brain research. PMID:29599739

Illusory Motion Reproduced by Deep Neural Networks Trained for Prediction.

PubMed

Watanabe, Eiji; Kitaoka, Akiyoshi; Sakamoto, Kiwako; Yasugi, Masaki; Tanaka, Kenta

2018-01-01

The cerebral cortex predicts visual motion to adapt human behavior to surrounding objects moving in real time. Although the underlying mechanisms are still unknown, predictive coding is one of the leading theories. Predictive coding assumes that the brain's internal models (which are acquired through learning) predict the visual world at all times and that errors between the prediction and the actual sensory input further refine the internal models. In the past year, deep neural networks based on predictive coding were reported for a video prediction machine called PredNet. If the theory substantially reproduces the visual information processing of the cerebral cortex, then PredNet can be expected to represent the human visual perception of motion. In this study, PredNet was trained with natural scene videos of the self-motion of the viewer, and the motion prediction ability of the obtained computer model was verified using unlearned videos. We found that the computer model accurately predicted the magnitude and direction of motion of a rotating propeller in unlearned videos. Surprisingly, it also represented the rotational motion for illusion images that were not moving physically, much like human visual perception. While the trained network accurately reproduced the direction of illusory rotation, it did not detect motion components in negative control pictures wherein people do not perceive illusory motion. This research supports the exciting idea that the mechanism assumed by the predictive coding theory is one of basis of motion illusion generation. Using sensory illusions as indicators of human perception, deep neural networks are expected to contribute significantly to the development of brain research.

Sensitivity of tumor motion simulation accuracy to lung biomechanical modeling approaches and parameters.

PubMed

Tehrani, Joubin Nasehi; Yang, Yin; Werner, Rene; Lu, Wei; Low, Daniel; Guo, Xiaohu; Wang, Jing

2015-11-21

Finite element analysis (FEA)-based biomechanical modeling can be used to predict lung respiratory motion. In this technique, elastic models and biomechanical parameters are two important factors that determine modeling accuracy. We systematically evaluated the effects of lung and lung tumor biomechanical modeling approaches and related parameters to improve the accuracy of motion simulation of lung tumor center of mass (TCM) displacements. Experiments were conducted with four-dimensional computed tomography (4D-CT). A Quasi-Newton FEA was performed to simulate lung and related tumor displacements between end-expiration (phase 50%) and other respiration phases (0%, 10%, 20%, 30%, and 40%). Both linear isotropic and non-linear hyperelastic materials, including the neo-Hookean compressible and uncoupled Mooney-Rivlin models, were used to create a finite element model (FEM) of lung and tumors. Lung surface displacement vector fields (SDVFs) were obtained by registering the 50% phase CT to other respiration phases, using the non-rigid demons registration algorithm. The obtained SDVFs were used as lung surface displacement boundary conditions in FEM. The sensitivity of TCM displacement to lung and tumor biomechanical parameters was assessed in eight patients for all three models. Patient-specific optimal parameters were estimated by minimizing the TCM motion simulation errors between phase 50% and phase 0%. The uncoupled Mooney-Rivlin material model showed the highest TCM motion simulation accuracy. The average TCM motion simulation absolute errors for the Mooney-Rivlin material model along left-right, anterior-posterior, and superior-inferior directions were 0.80 mm, 0.86 mm, and 1.51 mm, respectively. The proposed strategy provides a reliable method to estimate patient-specific biomechanical parameters in FEM for lung tumor motion simulation.

Sensitivity of Tumor Motion Simulation Accuracy to Lung Biomechanical Modeling Approaches and Parameters

PubMed Central

Tehrani, Joubin Nasehi; Yang, Yin; Werner, Rene; Lu, Wei; Low, Daniel; Guo, Xiaohu

2015-01-01

Finite element analysis (FEA)-based biomechanical modeling can be used to predict lung respiratory motion. In this technique, elastic models and biomechanical parameters are two important factors that determine modeling accuracy. We systematically evaluated the effects of lung and lung tumor biomechanical modeling approaches and related parameters to improve the accuracy of motion simulation of lung tumor center of mass (TCM) displacements. Experiments were conducted with four-dimensional computed tomography (4D-CT). A Quasi-Newton FEA was performed to simulate lung and related tumor displacements between end-expiration (phase 50%) and other respiration phases (0%, 10%, 20%, 30%, and 40%). Both linear isotropic and non-linear hyperelastic materials, including the Neo-Hookean compressible and uncoupled Mooney-Rivlin models, were used to create a finite element model (FEM) of lung and tumors. Lung surface displacement vector fields (SDVFs) were obtained by registering the 50% phase CT to other respiration phases, using the non-rigid demons registration algorithm. The obtained SDVFs were used as lung surface displacement boundary conditions in FEM. The sensitivity of TCM displacement to lung and tumor biomechanical parameters was assessed in eight patients for all three models. Patient-specific optimal parameters were estimated by minimizing the TCM motion simulation errors between phase 50% and phase 0%. The uncoupled Mooney-Rivlin material model showed the highest TCM motion simulation accuracy. The average TCM motion simulation absolute errors for the Mooney-Rivlin material model along left-right (LR), anterior-posterior (AP), and superior-inferior (SI) directions were 0.80 mm, 0.86 mm, and 1.51 mm, respectively. The proposed strategy provides a reliable method to estimate patient-specific biomechanical parameters in FEM for lung tumor motion simulation. PMID:26531324

Crab Pulsar Astrometry and Spin-Velocity Alignment

NASA Astrophysics Data System (ADS)

Romani, Roger W.; Ng, C.-Y.

2009-01-01

The proper motion of the Crab pulsar and its orientation with respect to the PWN symmetry axis is interesting for testing models of neutron star birth kicks. A number of authors have measured the Crab's motion using archival HST images. The most detailed study by Kaplan et al. (2008) compares a wide range of WFPC and ACS images to obtain an accurate proper motion measurement. However, they concluded that a kick comparison is fundamentally limited by the uncertainty in the progenitor's motion. Here we report on new HST images matched to 1994 and 1995 data frames, providing independent proper motion measurement with over 13 year time base and minimal systematic errors. The new observations also allow us to estimate the systematic errors due to CCD saturation. Our preliminary result indicates a proper motion consistent with Kaplan et al.'s finding. We discuss a model for the progenitor's motion, suggesting that the pulsar spin is much closer to alignment than previously suspected.

Effect of tumor amplitude and frequency on 4D modeling of Vero4DRT system.

PubMed

Miura, Hideharu; Ozawa, Shuichi; Hayata, Masahiro; Tsuda, Shintaro; Yamada, Kiyoshi; Nagata, Yasushi

2017-01-01

An important issue in indirect dynamic tumor tracking with the Vero4DRT system is the accuracy of the model predictions of the internal target position based on surrogate infrared (IR) marker measurement. We investigated the predictive uncertainty of 4D modeling using an external IR marker, focusing on the effect of the target and surrogate amplitudes and periods. A programmable respiratory motion table was used to simulate breathing induced organ motion. Sinusoidal motion sequences were produced by a dynamic phantom with different amplitudes and periods. To investigate the 4D modeling error, the following amplitudes (peak-to-peak: 10-40 mm) and periods (2-8 s) were considered. The 95th percentile 4D modeling error (4D- E 95% ) between the detected and predicted target position ( μ  + 2SD) was calculated to investigate the 4D modeling error. 4D- E 95% was linearly related to the target motion amplitude with a coefficient of determination R 2  = 0.99 and ranged from 0.21 to 0.88 mm. The 4D modeling error ranged from 1.49 to 0.14 mm and gradually decreased with increasing target motion period. We analyzed the predictive error in 4D modeling and the error due to the amplitude and period of target. 4D modeling error substantially increased with increasing amplitude and decreasing period of the target motion.

Blind multirigid retrospective motion correction of MR images.

PubMed

Loktyushin, Alexander; Nickisch, Hannes; Pohmann, Rolf; Schölkopf, Bernhard

2015-04-01

Physiological nonrigid motion is inevitable when imaging, e.g., abdominal viscera, and can lead to serious deterioration of the image quality. Prospective techniques for motion correction can handle only special types of nonrigid motion, as they only allow global correction. Retrospective methods developed so far need guidance from navigator sequences or external sensors. We propose a fully retrospective nonrigid motion correction scheme that only needs raw data as an input. Our method is based on a forward model that describes the effects of nonrigid motion by partitioning the image into patches with locally rigid motion. Using this forward model, we construct an objective function that we can optimize with respect to both unknown motion parameters per patch and the underlying sharp image. We evaluate our method on both synthetic and real data in 2D and 3D. In vivo data was acquired using standard imaging sequences. The correction algorithm significantly improves the image quality. Our compute unified device architecture (CUDA)-enabled graphic processing unit implementation ensures feasible computation times. The presented technique is the first computationally feasible retrospective method that uses the raw data of standard imaging sequences, and allows to correct for nonrigid motion without guidance from external motion sensors. © 2014 Wiley Periodicals, Inc.

A state-based probabilistic model for tumor respiratory motion prediction

NASA Astrophysics Data System (ADS)

Kalet, Alan; Sandison, George; Wu, Huanmei; Schmitz, Ruth

2010-12-01

This work proposes a new probabilistic mathematical model for predicting tumor motion and position based on a finite state representation using the natural breathing states of exhale, inhale and end of exhale. Tumor motion was broken down into linear breathing states and sequences of states. Breathing state sequences and the observables representing those sequences were analyzed using a hidden Markov model (HMM) to predict the future sequences and new observables. Velocities and other parameters were clustered using a k-means clustering algorithm to associate each state with a set of observables such that a prediction of state also enables a prediction of tumor velocity. A time average model with predictions based on average past state lengths was also computed. State sequences which are known a priori to fit the data were fed into the HMM algorithm to set a theoretical limit of the predictive power of the model. The effectiveness of the presented probabilistic model has been evaluated for gated radiation therapy based on previously tracked tumor motion in four lung cancer patients. Positional prediction accuracy is compared with actual position in terms of the overall RMS errors. Various system delays, ranging from 33 to 1000 ms, were tested. Previous studies have shown duty cycles for latencies of 33 and 200 ms at around 90% and 80%, respectively, for linear, no prediction, Kalman filter and ANN methods as averaged over multiple patients. At 1000 ms, the previously reported duty cycles range from approximately 62% (ANN) down to 34% (no prediction). Average duty cycle for the HMM method was found to be 100% and 91 ± 3% for 33 and 200 ms latency and around 40% for 1000 ms latency in three out of four breathing motion traces. RMS errors were found to be lower than linear and no prediction methods at latencies of 1000 ms. The results show that for system latencies longer than 400 ms, the time average HMM prediction outperforms linear, no prediction, and the more general HMM-type predictive models. RMS errors for the time average model approach the theoretical limit of the HMM, and predicted state sequences are well correlated with sequences known to fit the data.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sterndorff, M.J.; O`Brien, P.

ROLF (Retrievable Offshore Loading Facility) has been proposed as an alternative offshore oil export tanker loading system for the North Sea. The system consists of a flexible riser ascending from the seabed in a lazy wave configuration to the bow of a dynamically positioned tanker. In order to supplant and support the numerical analyses performed to design the system, an extensive model test program was carried out in a 3D offshore basin at scale 1:50. A model riser with properties equivalent to the properties of the oil filled prototype riser installed in seawater was tested in several combinations of wavesmore » and current. During the tests the forces at the bow of the tanker and at the pipeline end manifold were measured together with the motions of the tanker and the riser. The riser motions were measured by means of a video based 3D motion monitoring system. Of special importance was accurate determination of the minimum bending radius for the riser. This was derived based on the measured riser motions. The results of the model tests were compared to numerical analyses by an MCS proprietary riser analysis program.« less

Bio-inspired motion detection in an FPGA-based smart camera module.

PubMed

Köhler, T; Röchter, F; Lindemann, J P; Möller, R

2009-03-01

Flying insects, despite their relatively coarse vision and tiny nervous system, are capable of carrying out elegant and fast aerial manoeuvres. Studies of the fly visual system have shown that this is accomplished by the integration of signals from a large number of elementary motion detectors (EMDs) in just a few global flow detector cells. We developed an FPGA-based smart camera module with more than 10,000 single EMDs, which is closely modelled after insect motion-detection circuits with respect to overall architecture, resolution and inter-receptor spacing. Input to the EMD array is provided by a CMOS camera with a high frame rate. Designed as an adaptable solution for different engineering applications and as a testbed for biological models, the EMD detector type and parameters such as the EMD time constants, the motion-detection directions and the angle between correlated receptors are reconfigurable online. This allows a flexible and simultaneous detection of complex motion fields such as translation, rotation and looming, such that various tasks, e.g., obstacle avoidance, height/distance control or speed regulation can be performed by the same compact device.

Synthesis of image sequences for Korean sign language using 3D shape model

NASA Astrophysics Data System (ADS)

Hong, Mun-Ho; Choi, Chang-Seok; Kim, Chang-Seok; Jeon, Joon-Hyeon

1995-05-01

This paper proposes a method for offering information and realizing communication to the deaf-mute. The deaf-mute communicates with another person by means of sign language, but most people are unfamiliar with it. This method enables to convert text data into the corresponding image sequences for Korean sign language (KSL). Using a general 3D shape model of the upper body leads to generating the 3D motions of KSL. It is necessary to construct the general 3D shape model considering the anatomical structure of the human body. To obtain a personal 3D shape model, this general model is to adjust to the personal base images. Image synthesis for KSL consists of deforming a personal 3D shape model and texture-mapping the personal images onto the deformed model. The 3D motions for KSL have the facial expressions and the 3D movements of the head, trunk, arms and hands and are parameterized for easily deforming the model. These motion parameters of the upper body are extracted from a skilled signer's motion for each KSL and are stored to the database. Editing the parameters according to the inputs of text data yields to generate the image sequences of 3D motions.

A computational model for reference-frame synthesis with applications to motion perception.

PubMed

Clarke, Aaron M; Öğmen, Haluk; Herzog, Michael H

2016-09-01

As discovered by the Gestaltists, in particular by Duncker, we often perceive motion to be within a non-retinotopic reference frame. For example, the motion of a reflector on a bicycle appears to be circular, whereas, it traces out a cycloidal path with respect to external world coordinates. The reflector motion appears to be circular because the human brain subtracts the horizontal motion of the bicycle from the reflector motion. The bicycle serves as a reference frame for the reflector motion. Here, we present a general mathematical framework, based on vector fields, to explain non-retinotopic motion processing. Using four types of non-retinotopic motion paradigms, we show how the theory works in detail. For example, we show how non-retinotopic motion in the Ternus-Pikler display can be computed. Copyright © 2015 Elsevier Ltd. All rights reserved.

3D pose estimation and motion analysis of the articulated human hand-forearm limb in an industrial production environment

NASA Astrophysics Data System (ADS)

Hahn, Markus; Barrois, Björn; Krüger, Lars; Wöhler, Christian; Sagerer, Gerhard; Kummert, Franz

2010-09-01

This study introduces an approach to model-based 3D pose estimation and instantaneous motion analysis of the human hand-forearm limb in the application context of safe human-robot interaction. 3D pose estimation is performed using two approaches: The Multiocular Contracting Curve Density (MOCCD) algorithm is a top-down technique based on pixel statistics around a contour model projected into the images from several cameras. The Iterative Closest Point (ICP) algorithm is a bottom-up approach which uses a motion-attributed 3D point cloud to estimate the object pose. Due to their orthogonal properties, a fusion of these algorithms is shown to be favorable. The fusion is performed by a weighted combination of the extracted pose parameters in an iterative manner. The analysis of object motion is based on the pose estimation result and the motion-attributed 3D points belonging to the hand-forearm limb using an extended constraint-line approach which does not rely on any temporal filtering. A further refinement is obtained using the Shape Flow algorithm, a temporal extension of the MOCCD approach, which estimates the temporal pose derivative based on the current and the two preceding images, corresponding to temporal filtering with a short response time of two or at most three frames. Combining the results of the two motion estimation stages provides information about the instantaneous motion properties of the object. Experimental investigations are performed on real-world image sequences displaying several test persons performing different working actions typically occurring in an industrial production scenario. In all example scenes, the background is cluttered, and the test persons wear various kinds of clothes. For evaluation, independently obtained ground truth data are used. [Figure not available: see fulltext.

An approach to high speed ship ride quality simulation

NASA Technical Reports Server (NTRS)

Malone, W. L.; Vickery, J. M.

1975-01-01

The high speeds attained by certain advanced surface ships result in a spectrum of motion which is higher in frequency than that of conventional ships. This fact along with the inclusion of advanced ride control features in the design of these ships resulted in an increased awareness of the need for ride criteria. Such criteria can be developed using data from actual ship operations in varied sea states or from clinical laboratory experiments. A third approach is to simulate ship conditions using measured or calculated ship motion data. Recent simulations have used data derived from a math model of Surface Effect Ship (SES) motion. The model in turn is based on equations of motion which have been refined with data from scale models and SES of up to 101 600-kg (100-ton) displacement. Employment of broad band motion emphasizes the use of the simulators as a design tool to evaluate a given ship configuration in several operational situations and also serves to provide data as to the overall effect of a given motion on crew performance and physiological status.

SPH-DEM approach to numerically simulate the deformation of three-dimensional RBCs in non-uniform capillaries.

PubMed

Polwaththe-Gallage, Hasitha-Nayanajith; Saha, Suvash C; Sauret, Emilie; Flower, Robert; Senadeera, Wijitha; Gu, YuanTong

2016-12-28

Blood continuously flows through the blood vessels in the human body. When blood flows through the smallest blood vessels, red blood cells (RBCs) in the blood exhibit various types of motion and deformed shapes. Computational modelling techniques can be used to successfully predict the behaviour of the RBCs in capillaries. In this study, we report the application of a meshfree particle approach to model and predict the motion and deformation of three-dimensional RBCs in capillaries. An elastic spring network based on the discrete element method (DEM) is employed to model the three-dimensional RBC membrane. The haemoglobin in the RBC and the plasma in the blood are modelled as smoothed particle hydrodynamics (SPH) particles. For validation purposes, the behaviour of a single RBC in a simple shear flow is examined and compared against experimental results. Then simulations are carried out to predict the behaviour of RBCs in a capillary; (i) the motion of five identical RBCs in a uniform capillary, (ii) the motion of five identical RBCs with different bending stiffness (K b ) values in a stenosed capillary, (iii) the motion of three RBCs in a narrow capillary. Finally five identical RBCs are employed to determine the critical diameter of a stenosed capillary. Validation results showed a good agreement with less than 10% difference. From the above simulations, the following results are obtained; (i) RBCs exhibit different deformation behaviours due to the hydrodynamic interaction between them. (ii) Asymmetrical deformation behaviours of the RBCs are clearly observed when the bending stiffness (K b ) of the RBCs is changed. (iii) The model predicts the ability of the RBCs to squeeze through smaller blood vessels. Finally, from the simulations, the critical diameter of the stenosed section to stop the motion of blood flow is predicted. A three-dimensional spring network model based on DEM in combination with the SPH method is successfully used to model the motion and deformation of RBCs in capillaries. Simulation results reveal that the condition of blood flow stopping depends on the pressure gradient of the capillary and the severity of stenosis of the capillary. In addition, this model is capable of predicting the critical diameter which prevents motion of RBCs for different blood pressures.

Graphs and Tracks Revisited

NASA Astrophysics Data System (ADS)

Christian, Wolfgang; Belloni, Mario

2013-04-01

We have recently developed a Graphs and Tracks model based on an earlier program by David Trowbridge, as shown in Fig. 1. Our model can show position, velocity, acceleration, and energy graphs and can be used for motion-to-graphs exercises. Users set the heights of the track segments, and the model displays the motion of the ball on the track together with position, velocity, and acceleration graphs. This ready-to-run model is available in the ComPADRE OSP Collection at www.compadre.org/osp/items/detail.cfm?ID=12023.

Fiducial marker-based correction for involuntary motion in weight-bearing C-arm CT scanning of knees. Part I. Numerical model-based optimization

PubMed Central

Choi, Jang-Hwan; Fahrig, Rebecca; Keil, Andreas; Besier, Thor F.; Pal, Saikat; McWalter, Emily J.; Beaupré, Gary S.; Maier, Andreas

2013-01-01

Purpose: Human subjects in standing positions are apt to show much more involuntary motion than in supine positions. The authors aimed to simulate a complicated realistic lower body movement using the four-dimensional (4D) digital extended cardiac-torso (XCAT) phantom. The authors also investigated fiducial marker-based motion compensation methods in two-dimensional (2D) and three-dimensional (3D) space. The level of involuntary movement-induced artifacts and image quality improvement were investigated after applying each method. Methods: An optical tracking system with eight cameras and seven retroreflective markers enabled us to track involuntary motion of the lower body of nine healthy subjects holding a squat position at 60° of flexion. The XCAT-based knee model was developed using the 4D XCAT phantom and the optical tracking data acquired at 120 Hz. The authors divided the lower body in the XCAT into six parts and applied unique affine transforms to each so that the motion (6 degrees of freedom) could be synchronized with the optical markers’ location at each time frame. The control points of the XCAT were tessellated into triangles and 248 projection images were created based on intersections of each ray and monochromatic absorption. The tracking data sets with the largest motion (Subject 2) and the smallest motion (Subject 5) among the nine data sets were used to animate the XCAT knee model. The authors defined eight skin control points well distributed around the knees as pseudo-fiducial markers which functioned as a reference in motion correction. Motion compensation was done in the following ways: (1) simple projection shifting in 2D, (2) deformable projection warping in 2D, and (3) rigid body warping in 3D. Graphics hardware accelerated filtered backprojection was implemented and combined with the three correction methods in order to speed up the simulation process. Correction fidelity was evaluated as a function of number of markers used (4–12) and marker distribution in three scenarios. Results: Average optical-based translational motion for the nine subjects was 2.14 mm (±0.69 mm) and 2.29 mm (±0.63 mm) for the right and left knee, respectively. In the representative central slices of Subject 2, the authors observed 20.30%, 18.30%, and 22.02% improvements in the structural similarity (SSIM) index with 2D shifting, 2D warping, and 3D warping, respectively. The performance of 2D warping improved as the number of markers increased up to 12 while 2D shifting and 3D warping were insensitive to the number of markers used. The minimum required number of markers for 2D shifting, 2D warping, and 3D warping was 4–6, 12, and 8, respectively. An even distribution of markers over the entire field of view provided robust performance for all three correction methods. Conclusions: The authors were able to simulate subject-specific realistic knee movement in weight-bearing positions. This study indicates that involuntary motion can seriously degrade the image quality. The proposed three methods were evaluated with the numerical knee model; 3D warping was shown to outperform the 2D methods. The methods are shown to significantly reduce motion artifacts if an appropriate marker setup is chosen. PMID:24007156

Fiducial marker-based correction for involuntary motion in weight-bearing C-arm CT scanning of knees. Part I. Numerical model-based optimization.

PubMed

Choi, Jang-Hwan; Fahrig, Rebecca; Keil, Andreas; Besier, Thor F; Pal, Saikat; McWalter, Emily J; Beaupré, Gary S; Maier, Andreas

2013-09-01

Human subjects in standing positions are apt to show much more involuntary motion than in supine positions. The authors aimed to simulate a complicated realistic lower body movement using the four-dimensional (4D) digital extended cardiac-torso (XCAT) phantom. The authors also investigated fiducial marker-based motion compensation methods in two-dimensional (2D) and three-dimensional (3D) space. The level of involuntary movement-induced artifacts and image quality improvement were investigated after applying each method. An optical tracking system with eight cameras and seven retroreflective markers enabled us to track involuntary motion of the lower body of nine healthy subjects holding a squat position at 60° of flexion. The XCAT-based knee model was developed using the 4D XCAT phantom and the optical tracking data acquired at 120 Hz. The authors divided the lower body in the XCAT into six parts and applied unique affine transforms to each so that the motion (6 degrees of freedom) could be synchronized with the optical markers' location at each time frame. The control points of the XCAT were tessellated into triangles and 248 projection images were created based on intersections of each ray and monochromatic absorption. The tracking data sets with the largest motion (Subject 2) and the smallest motion (Subject 5) among the nine data sets were used to animate the XCAT knee model. The authors defined eight skin control points well distributed around the knees as pseudo-fiducial markers which functioned as a reference in motion correction. Motion compensation was done in the following ways: (1) simple projection shifting in 2D, (2) deformable projection warping in 2D, and (3) rigid body warping in 3D. Graphics hardware accelerated filtered backprojection was implemented and combined with the three correction methods in order to speed up the simulation process. Correction fidelity was evaluated as a function of number of markers used (4-12) and marker distribution in three scenarios. Average optical-based translational motion for the nine subjects was 2.14 mm (± 0.69 mm) and 2.29 mm (± 0.63 mm) for the right and left knee, respectively. In the representative central slices of Subject 2, the authors observed 20.30%, 18.30%, and 22.02% improvements in the structural similarity (SSIM) index with 2D shifting, 2D warping, and 3D warping, respectively. The performance of 2D warping improved as the number of markers increased up to 12 while 2D shifting and 3D warping were insensitive to the number of markers used. The minimum required number of markers for 2D shifting, 2D warping, and 3D warping was 4-6, 12, and 8, respectively. An even distribution of markers over the entire field of view provided robust performance for all three correction methods. The authors were able to simulate subject-specific realistic knee movement in weight-bearing positions. This study indicates that involuntary motion can seriously degrade the image quality. The proposed three methods were evaluated with the numerical knee model; 3D warping was shown to outperform the 2D methods. The methods are shown to significantly reduce motion artifacts if an appropriate marker setup is chosen.

Traffic and Driving Simulator Based on Architecture of Interactive Motion.

PubMed

Paz, Alexander; Veeramisti, Naveen; Khaddar, Romesh; de la Fuente-Mella, Hanns; Modorcea, Luiza

2015-01-01

This study proposes an architecture for an interactive motion-based traffic simulation environment. In order to enhance modeling realism involving actual human beings, the proposed architecture integrates multiple types of simulation, including: (i) motion-based driving simulation, (ii) pedestrian simulation, (iii) motorcycling and bicycling simulation, and (iv) traffic flow simulation. The architecture has been designed to enable the simulation of the entire network; as a result, the actual driver, pedestrian, and bike rider can navigate anywhere in the system. In addition, the background traffic interacts with the actual human beings. This is accomplished by using a hybrid mesomicroscopic traffic flow simulation modeling approach. The mesoscopic traffic flow simulation model loads the results of a user equilibrium traffic assignment solution and propagates the corresponding traffic through the entire system. The microscopic traffic flow simulation model provides background traffic around the vicinities where actual human beings are navigating the system. The two traffic flow simulation models interact continuously to update system conditions based on the interactions between actual humans and the fully simulated entities. Implementation efforts are currently in progress and some preliminary tests of individual components have been conducted. The implementation of the proposed architecture faces significant challenges ranging from multiplatform and multilanguage integration to multievent communication and coordination.

Traffic and Driving Simulator Based on Architecture of Interactive Motion

PubMed Central

Paz, Alexander; Veeramisti, Naveen; Khaddar, Romesh; de la Fuente-Mella, Hanns; Modorcea, Luiza

2015-01-01

This study proposes an architecture for an interactive motion-based traffic simulation environment. In order to enhance modeling realism involving actual human beings, the proposed architecture integrates multiple types of simulation, including: (i) motion-based driving simulation, (ii) pedestrian simulation, (iii) motorcycling and bicycling simulation, and (iv) traffic flow simulation. The architecture has been designed to enable the simulation of the entire network; as a result, the actual driver, pedestrian, and bike rider can navigate anywhere in the system. In addition, the background traffic interacts with the actual human beings. This is accomplished by using a hybrid mesomicroscopic traffic flow simulation modeling approach. The mesoscopic traffic flow simulation model loads the results of a user equilibrium traffic assignment solution and propagates the corresponding traffic through the entire system. The microscopic traffic flow simulation model provides background traffic around the vicinities where actual human beings are navigating the system. The two traffic flow simulation models interact continuously to update system conditions based on the interactions between actual humans and the fully simulated entities. Implementation efforts are currently in progress and some preliminary tests of individual components have been conducted. The implementation of the proposed architecture faces significant challenges ranging from multiplatform and multilanguage integration to multievent communication and coordination. PMID:26491711

Hydrological signal in polar motion excitation from a combination of geophysical and gravimetric series

NASA Astrophysics Data System (ADS)

Nastula, Jolanta; Winska, Malgorzata; Salstein, David A.

2015-08-01

One can estimate the hydrological signal in polar motion excitation as a residual, namely the difference between observed geodetic excitation functions (Geodetic Angular Momentum, GAM) and the sum of Atmospheric Angular Momentum (AAM) and Oceanic Angular Momentum (OAM).The aim of this study is to find the optimal model and results for hydrological excitation functions in terms of their agreement with the computed difference between GAM and atmospheric and oceanic signals.The atmospheric and oceanic model-based data that we use in this study are the geophysical excitation functions of AAM, OAM available from the Special Bureaus for the Atmosphere and Oceans of the Geophysical Global Fluids Center (GGFC) of the International Earth Rotation and Reference Systems Service (IERS). For the atmosphere and ocean, these functions are based on the mass and motion fields of the fluids.Global models of land hydrology are used to estimate hydrological excitation functions of polar motion (Hydrological Angular Momentum - HAM). These HAM series are the mass of water substance determined from the various types of land-based hydrological reservoirs. In addition the HAM are estimated from spherical harmonic coefficients of the Earth’s gravity field. We use several sets of degree-2, order-1 harmonics of the Earth’s gravity field, derived from the Gravity Recovery and Climate Experiment (GRACE), Satellite Laser Ranging (SLR), and Global Navigation Satellite Systems (GNSS) data.Finally, these several different HAM series are used to determine the best model of hydrological excitation of polar motion. The model is found by looking for the combination of these series that fits the geodetic residuals using the least-square method.In addition, we will access model results from the Coupled Model Intercomparison Project, fifth experiment (CMIP-5) to examine atmospheric excitations from the twentieth century and estimates for the twenty-first century to see the possible signals and trends of these excitation series to help understand the potential range in the derived of hydrological excitation results.

Regionally Adaptable Ground Motion Prediction Equation (GMPE) from Empirical Models of Fourier and Duration of Ground Motion

NASA Astrophysics Data System (ADS)

Bora, Sanjay; Scherbaum, Frank; Kuehn, Nicolas; Stafford, Peter; Edwards, Benjamin

2016-04-01

The current practice of deriving empirical ground motion prediction equations (GMPEs) involves using ground motions recorded at multiple sites. However, in applications like site-specific (e.g., critical facility) hazard ground motions obtained from the GMPEs are need to be adjusted/corrected to a particular site/site-condition under investigation. This study presents a complete framework for developing a response spectral GMPE, within which the issue of adjustment of ground motions is addressed in a manner consistent with the linear system framework. The present approach is a two-step process in which the first step consists of deriving two separate empirical models, one for Fourier amplitude spectra (FAS) and the other for a random vibration theory (RVT) optimized duration (Drvto) of ground motion. In the second step the two models are combined within the RVT framework to obtain full response spectral amplitudes. Additionally, the framework also involves a stochastic model based extrapolation of individual Fourier spectra to extend the useable frequency limit of the empirically derived FAS model. The stochastic model parameters were determined by inverting the Fourier spectral data using an approach similar to the one as described in Edwards and Faeh (2013). Comparison of median predicted response spectra from present approach with those from other regional GMPEs indicates that the present approach can also be used as a stand-alone model. The dataset used for the presented analysis is a subset of the recently compiled database RESORCE-2012 across Europe, the Middle East and the Mediterranean region.

Dance-the-Music: an educational platform for the modeling, recognition and audiovisual monitoring of dance steps using spatiotemporal motion templates

NASA Astrophysics Data System (ADS)

Maes, Pieter-Jan; Amelynck, Denis; Leman, Marc

2012-12-01

In this article, a computational platform is presented, entitled "Dance-the-Music", that can be used in a dance educational context to explore and learn the basics of dance steps. By introducing a method based on spatiotemporal motion templates, the platform facilitates to train basic step models from sequentially repeated dance figures performed by a dance teacher. Movements are captured with an optical motion capture system. The teachers' models can be visualized from a first-person perspective to instruct students how to perform the specific dance steps in the correct manner. Moreover, recognition algorithms-based on a template matching method-can determine the quality of a student's performance in real time by means of multimodal monitoring techniques. The results of an evaluation study suggest that the Dance-the-Music is effective in helping dance students to master the basics of dance figures.

Multiple-basin energy landscapes for large-amplitude conformational motions of proteins: Structure-based molecular dynamics simulations

PubMed Central

Okazaki, Kei-ichi; Koga, Nobuyasu; Takada, Shoji; Onuchic, Jose N.; Wolynes, Peter G.

2006-01-01

Biomolecules often undergo large-amplitude motions when they bind or release other molecules. Unlike macroscopic machines, these biomolecular machines can partially disassemble (unfold) and then reassemble (fold) during such transitions. Here we put forward a minimal structure-based model, the “multiple-basin model,” that can directly be used for molecular dynamics simulation of even very large biomolecular systems so long as the endpoints of the conformational change are known. We investigate the model by simulating large-scale motions of four proteins: glutamine-binding protein, S100A6, dihydrofolate reductase, and HIV-1 protease. The mechanisms of conformational transition depend on the protein basin topologies and change with temperature near the folding transition. The conformational transition rate varies linearly with driving force over a fairly large range. This linearity appears to be a consequence of partial unfolding during the conformational transition. PMID:16877541

Emittance preservation in plasma-based accelerators with ion motion

DOE PAGES

Benedetti, C.; Schroeder, C. B.; Esarey, E.; ...

2017-11-01

In a plasma-accelerator-based linear collider, the density of matched, low-emittance, high-energy particle bunches required for collider applications can be orders of magnitude above the background ion density, leading to ion motion, perturbation of the focusing fields, and, hence, to beam emittance growth. By analyzing the response of the background ions to an ultrahigh density beam, analytical expressions, valid for nonrelativistic ion motion, are derived for the transverse wakefield and for the final (i.e., after saturation) bunch emittance. Analytical results are validated against numerical modeling. Initial beam distributions are derived that are equilibrium solutions, which require head-to-tail bunch shaping, enabling emittancemore » preservation with ion motion.« less

Beating Heart Motion Accurate Prediction Method Based on Interactive Multiple Model: An Information Fusion Approach

PubMed Central

Xie, Weihong; Yu, Yang

2017-01-01

Robot-assisted motion compensated beating heart surgery has the advantage over the conventional Coronary Artery Bypass Graft (CABG) in terms of reduced trauma to the surrounding structures that leads to shortened recovery time. The severe nonlinear and diverse nature of irregular heart rhythm causes enormous difficulty for the robot to realize the clinic requirements, especially under arrhythmias. In this paper, we propose a fusion prediction framework based on Interactive Multiple Model (IMM) estimator, allowing each model to cover a distinguishing feature of the heart motion in underlying dynamics. We find that, at normal state, the nonlinearity of the heart motion with slow time-variant changing dominates the beating process. When an arrhythmia occurs, the irregularity mode, the fast uncertainties with random patterns become the leading factor of the heart motion. We deal with prediction problem in the case of arrhythmias by estimating the state with two behavior modes which can adaptively “switch” from one to the other. Also, we employed the signal quality index to adaptively determine the switch transition probability in the framework of IMM. We conduct comparative experiments to evaluate the proposed approach with four distinguished datasets. The test results indicate that the new proposed approach reduces prediction errors significantly. PMID:29124062

Beating Heart Motion Accurate Prediction Method Based on Interactive Multiple Model: An Information Fusion Approach.

PubMed

Liang, Fan; Xie, Weihong; Yu, Yang

2017-01-01

Robot-assisted motion compensated beating heart surgery has the advantage over the conventional Coronary Artery Bypass Graft (CABG) in terms of reduced trauma to the surrounding structures that leads to shortened recovery time. The severe nonlinear and diverse nature of irregular heart rhythm causes enormous difficulty for the robot to realize the clinic requirements, especially under arrhythmias. In this paper, we propose a fusion prediction framework based on Interactive Multiple Model (IMM) estimator, allowing each model to cover a distinguishing feature of the heart motion in underlying dynamics. We find that, at normal state, the nonlinearity of the heart motion with slow time-variant changing dominates the beating process. When an arrhythmia occurs, the irregularity mode, the fast uncertainties with random patterns become the leading factor of the heart motion. We deal with prediction problem in the case of arrhythmias by estimating the state with two behavior modes which can adaptively "switch" from one to the other. Also, we employed the signal quality index to adaptively determine the switch transition probability in the framework of IMM. We conduct comparative experiments to evaluate the proposed approach with four distinguished datasets. The test results indicate that the new proposed approach reduces prediction errors significantly.

Advanced Respiratory Motion Compensation for Coronary MR Angiography

PubMed Central

Henningsson, Markus; Botnar, Rene M.

2013-01-01

Despite technical advances, respiratory motion remains a major impediment in a substantial amount of patients undergoing coronary magnetic resonance angiography (CMRA). Traditionally, respiratory motion compensation has been performed with a one-dimensional respiratory navigator positioned on the right hemi-diaphragm, using a motion model to estimate and correct for the bulk respiratory motion of the heart. Recent technical advancements has allowed for direct respiratory motion estimation of the heart, with improved motion compensation performance. Some of these new methods, particularly using image-based navigators or respiratory binning, allow for more advanced motion correction which enables CMRA data acquisition throughout most or all of the respiratory cycle, thereby significantly reducing scan time. This review describes the three components typically involved in most motion compensation strategies for CMRA, including respiratory motion estimation, gating and correction, and how these processes can be utilized to perform advanced respiratory motion compensation. PMID:23708271

Modeling Nonlinear Site Response Uncertainty in Broadband Ground Motion Simulations for the Los Angeles Basin

NASA Astrophysics Data System (ADS)

Assimaki, D.; Li, W.; Steidl, J. M.; Schmedes, J.

2007-12-01

The assessment of strong motion site response is of great significance, both for mitigating seismic hazard and for performing detailed analyses of earthquake source characteristics. There currently exists, however, large degree of uncertainty concerning the mathematical model to be employed for the computationally efficient evaluation of local site effects, and the site investigation program necessary to evaluate the nonlinear input model parameters and ensure cost-effective predictions; and while site response observations may provide critical constraints on interpretation methods, the lack of a statistically significant number of in-situ strong motion records prohibits statistical analyses to be conducted and uncertainties to be quantified based entirely on field data. In this paper, we combine downhole observations and broadband ground motion synthetics for characteristic site conditions the Los Angeles Basin, and investigate the variability in ground motion estimation introduced by the site response assessment methodology. In particular, site-specific regional velocity and attenuation structures are initially compiled using near-surface geotechnical data collected at downhole geotechnical arrays, inverse low-strain velocity and attenuation profiles at these sites obtained by inversion of weak motion records and the crustal velocity structure at the corresponding locations obtained from the Southern California Earthquake Centre Community Velocity Model. Successively, broadband ground motions are simulated by means of a hybrid low/high-frequency finite source model with correlated random parameters for rupture scenaria of weak, medium and large magnitude events (M =3.5-7.5). Observed estimates of site response at the stations of interest are first compared to the ensemble of approximate and incremental nonlinear site response models. Parametric studies are next conducted for each fixed magnitude (fault geometry) scenario by varying the source-to-site distance and source parameters for the ensemble of site conditions. Elastic, equivalent linear and nonlinear simulations are implemented for the deterministic description of the base-model velocity and attenuation structures and nonlinear soil properties, to examine the variability in ground motion predictions as a function of ground motion amplitude and frequency content, and nonlinear site response methodology. The modeling site response uncertainty introduced in the broadband ground motion predictions is reported by means of the COV of site amplification, defined as the ratio of the predicted peak ground acceleration (PGA) and spectral acceleration (SA) at short and long periods to the corresponding intensity measure on the ground surface of a typical NEHRP BC boundary profile (Vs30=760m/s), for the ensemble of approximate and incremental nonlinear models implemented. A frequency index is developed to describe the frequency content of incident ground motion. In conjunction with the rock-outcrop acceleration level, this index is used to identify the site and ground motion conditions where incremental nonlinear analyses should be employed in lieu of approximate methodologies. Finally, the effects of modeling uncertainty in ground response analysis is evaluated in the estimation of site amplification factors, which are successively compared to recently published factors of the New Generation Attenuation Relations (NGA) and the currently employed Seismic Code Provisions (NEHRP).

Comparison of the hydrological excitation functions HAM of polar motion for the period 1980.0-2007.0

NASA Astrophysics Data System (ADS)

Nastula, J.; Pasnicka, M.; Kolaczek, B.

2011-10-01

In this study we compared contributions of polar motion excitation determined from hydrological models and harmonic coefficients of the Earth gravity field obtained from Gravity Recovery and Climate Experiment (GRACE). Hydrological excitation function (hydrological angular momentum - HAM) has been estimated from models of global hydrology, based on the observed distribution of surface water, snow, ice and soil moisture. All of them were compared with observed Geodetic Angular Momentum (GAM), excitations of polar motion. The spectra of these excitation functions of polar motion and residual geodetic excitation function G-A-O obtained from GAM by elimination of atmospheric and oceanic excitation functions were computed too. Phasor diagrams of the seasonal components of the polar motion excitation functions of all HAM excitation functions as well as of two GRACE solutions: CSR, CNES were determined and discussed.

Cryo-tomography Tilt-series Alignment with Consideration of the Beam-induced Sample Motion

PubMed Central

Fernandez, Jose-Jesus; Li, Sam; Bharat, Tanmay A. M.; Agard, David A.

2018-01-01

Recent evidence suggests that the beam-induced motion of the sample during tilt-series acquisition is a major resolution-limiting factor in electron cryo-tomography (cryoET). It causes suboptimal tilt-series alignment and thus deterioration of the reconstruction quality. Here we present a novel approach to tilt-series alignment and tomographic reconstruction that considers the beam-induced sample motion through the tilt-series. It extends the standard fiducial-based alignment approach in cryoET by introducing quadratic polynomials to model the sample motion. The model can be used during reconstruction to yield a motion-compensated tomogram. We evaluated our method on various datasets with different sample sizes. The results demonstrate that our method could be a useful tool to improve the quality of tomograms and the resolution in cryoET. PMID:29410148

Simulation of Molecular Transport in Systems Containing Mobile Obstacles.

PubMed

Polanowski, Piotr; Sikorski, Andrzej

2016-08-04

In this paper, we investigate the movement of molecules in crowded environments with obstacles undergoing Brownian motion by means of extensive Monte Carlo simulations. Our investigations were performed using the dynamic lattice liquid model, which was based on the cooperative movement concept and allowed to mimic systems at high densities where the motion of all elements (obstacles as well as moving particles) were highly correlated. The crowded environments are modeled on a two-dimensional triangular lattice containing obstacles (particles whose mobility was significantly reduced) moving by a Brownian motion. The subdiffusive motion of both elements in the system was analyzed. It was shown that the percolation transition does not exist in such systems in spite of the cooperative character of the particles' motion. The reduction of the obstacle mobility leads to the longer caging of liquid particles by mobile obstacles.

Wave models for turbulent free shear flows

NASA Technical Reports Server (NTRS)

Liou, W. W.; Morris, P. J.

1991-01-01

New predictive closure models for turbulent free shear flows are presented. They are based on an instability wave description of the dominant large scale structures in these flows using a quasi-linear theory. Three model were developed to study the structural dynamics of turbulent motions of different scales in free shear flows. The local characteristics of the large scale motions are described using linear theory. Their amplitude is determined from an energy integral analysis. The models were applied to the study of an incompressible free mixing layer. In all cases, predictions are made for the development of the mean flow field. In the last model, predictions of the time dependent motion of the large scale structure of the mixing region are made. The predictions show good agreement with experimental observations.

Classical Dynamics of Fullerenes

NASA Astrophysics Data System (ADS)

Sławianowski, Jan J.; Kotowski, Romuald K.

2017-06-01

The classical mechanics of large molecules and fullerenes is studied. The approach is based on the model of collective motion of these objects. The mixed Lagrangian (material) and Eulerian (space) description of motion is used. In particular, the Green and Cauchy deformation tensors are geometrically defined. The important issue is the group-theoretical approach to describing the affine deformations of the body. The Hamiltonian description of motion based on the Poisson brackets methodology is used. The Lagrange and Hamilton approaches allow us to formulate the mechanics in the canonical form. The method of discretization in analytical continuum theory and in classical dynamics of large molecules and fullerenes enable us to formulate their dynamics in terms of the polynomial expansions of configurations. Another approach is based on the theory of analytical functions and on their approximations by finite-order polynomials. We concentrate on the extremely simplified model of affine deformations or on their higher-order polynomial perturbations.

Coupled orbit-attitude dynamics and relative state estimation of spacecraft near small Solar System bodies

NASA Astrophysics Data System (ADS)

Misra, Gaurav; Izadi, Maziar; Sanyal, Amit; Scheeres, Daniel

2016-04-01

The effects of dynamical coupling between the rotational (attitude) and translational (orbital) motion of spacecraft near small Solar System bodies is investigated. This coupling arises due to the weak gravity of these bodies, as well as solar radiation pressure. The traditional approach assumes a point-mass spacecraft model to describe the translational motion of the spacecraft, while the attitude motion is considered to be completely decoupled from the translational motion. The model used here to describe the rigid-body spacecraft dynamics includes the non-uniform rotating gravity field of the small body up to second degree and order along with the attitude dependent terms, solar tide, and solar radiation pressure. This model shows that the second degree and order gravity terms due to the small body affect the dynamics of the spacecraft to the same extent as the orbit-attitude coupling due to the primary gravity (zeroth order) term. Variational integrators are used to simulate the dynamics of both the rigid spacecraft and the point mass. The small bodies considered here are modeled after Near-Earth Objects (NEO) 101955 Bennu, and 25143 Itokawa, and are assumed to be triaxial ellipsoids with uniform density. Differences in the numerically obtained trajectories of a rigid spacecraft and a point mass are then compared, to illustrate the impact of the orbit-attitude coupling on spacecraft dynamics in proximity of small bodies. Possible implications on the performance of model-based spacecraft control and on the station-keeping budget, if the orbit-attitude coupling is not accounted for in the model of the dynamics, are also discussed. An almost globally asymptotically stable motion estimation scheme based solely on visual/optical feedback that estimates the relative motion of the asteroid with respect to the spacecraft is also obtained. This estimation scheme does not require a model of the dynamics of the asteroid, which makes it perfectly suited for asteroids whose properties are not well known.

A Novel Method to Compute Breathing Volumes via Motion Capture Systems: Design and Experimental Trials.

PubMed

Massaroni, Carlo; Cassetta, Eugenio; Silvestri, Sergio

2017-10-01

Respiratory assessment can be carried out by using motion capture systems. A geometrical model is mandatory in order to compute the breathing volume as a function of time from the markers' trajectories. This study describes a novel model to compute volume changes and calculate respiratory parameters by using a motion capture system. The novel method, ie, prism-based method, computes the volume enclosed within the chest by defining 82 prisms from the 89 markers attached to the subject chest. Volumes computed with this method are compared to spirometry volumes and to volumes computed by a conventional method based on the tetrahedron's decomposition of the chest wall and integrated in a commercial motion capture system. Eight healthy volunteers were enrolled and 30 seconds of quiet breathing data collected from each of them. Results show a better agreement between volumes computed by the prism-based method and the spirometry (discrepancy of 2.23%, R 2  = .94) compared to the agreement between volumes computed by the conventional method and the spirometry (discrepancy of 3.56%, R 2  = .92). The proposed method also showed better performances in the calculation of respiratory parameters. Our findings open up prospects for the further use of the new method in the breathing assessment via motion capture systems.

An improved multi-paths optimization method for video stabilization

NASA Astrophysics Data System (ADS)

Qin, Tao; Zhong, Sheng

2018-03-01

For video stabilization, the difference between original camera motion path and the optimized one is proportional to the cropping ratio and warping ratio. A good optimized path should preserve the moving tendency of the original one meanwhile the cropping ratio and warping ratio of each frame should be kept in a proper range. In this paper we use an improved warping-based motion representation model, and propose a gauss-based multi-paths optimization method to get a smoothing path and obtain a stabilized video. The proposed video stabilization method consists of two parts: camera motion path estimation and path smoothing. We estimate the perspective transform of adjacent frames according to warping-based motion representation model. It works well on some challenging videos where most previous 2D methods or 3D methods fail for lacking of long features trajectories. The multi-paths optimization method can deal well with parallax, as we calculate the space-time correlation of the adjacent grid, and then a kernel of gauss is used to weigh the motion of adjacent grid. Then the multi-paths are smoothed while minimize the crop ratio and the distortion. We test our method on a large variety of consumer videos, which have casual jitter and parallax, and achieve good results.

A GPU-based framework for modeling real-time 3D lung tumor conformal dosimetry with subject-specific lung tumor motion.

PubMed

Min, Yugang; Santhanam, Anand; Neelakkantan, Harini; Ruddy, Bari H; Meeks, Sanford L; Kupelian, Patrick A

2010-09-07

In this paper, we present a graphics processing unit (GPU)-based simulation framework to calculate the delivered dose to a 3D moving lung tumor and its surrounding normal tissues, which are undergoing subject-specific lung deformations. The GPU-based simulation framework models the motion of the 3D volumetric lung tumor and its surrounding tissues, simulates the dose delivery using the dose extracted from a treatment plan using Pinnacle Treatment Planning System, Phillips, for one of the 3DCTs of the 4DCT and predicts the amount and location of radiation doses deposited inside the lung. The 4DCT lung datasets were registered with each other using a modified optical flow algorithm. The motion of the tumor and the motion of the surrounding tissues were simulated by measuring the changes in lung volume during the radiotherapy treatment using spirometry. The real-time dose delivered to the tumor for each beam is generated by summing the dose delivered to the target volume at each increase in lung volume during the beam delivery time period. The simulation results showed the real-time capability of the framework at 20 discrete tumor motion steps per breath, which is higher than the number of 4DCT steps (approximately 12) reconstructed during multiple breathing cycles.

A ferrofluid based energy harvester: Computational modeling, analysis, and experimental validation

NASA Astrophysics Data System (ADS)

Liu, Qi; Alazemi, Saad F.; Daqaq, Mohammed F.; Li, Gang

2018-03-01

A computational model is described and implemented in this work to analyze the performance of a ferrofluid based electromagnetic energy harvester. The energy harvester converts ambient vibratory energy into an electromotive force through a sloshing motion of a ferrofluid. The computational model solves the coupled Maxwell's equations and Navier-Stokes equations for the dynamic behavior of the magnetic field and fluid motion. The model is validated against experimental results for eight different configurations of the system. The validated model is then employed to study the underlying mechanisms that determine the electromotive force of the energy harvester. Furthermore, computational analysis is performed to test the effect of several modeling aspects, such as three-dimensional effect, surface tension, and type of the ferrofluid-magnetic field coupling on the accuracy of the model prediction.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rottmann, Joerg; Berbeco, Ross

Purpose: Precise prediction of respiratory motion is a prerequisite for real-time motion compensation techniques such as beam, dynamic couch, or dynamic multileaf collimator tracking. Collection of tumor motion data to train the prediction model is required for most algorithms. To avoid exposure of patients to additional dose from imaging during this procedure, the feasibility of training a linear respiratory motion prediction model with an external surrogate signal is investigated and its performance benchmarked against training the model with tumor positions directly. Methods: The authors implement a lung tumor motion prediction algorithm based on linear ridge regression that is suitable tomore » overcome system latencies up to about 300 ms. Its performance is investigated on a data set of 91 patient breathing trajectories recorded from fiducial marker tracking during radiotherapy delivery to the lung of ten patients. The expected 3D geometric error is quantified as a function of predictor lookahead time, signal sampling frequency and history vector length. Additionally, adaptive model retraining is evaluated, i.e., repeatedly updating the prediction model after initial training. Training length for this is gradually increased with incoming (internal) data availability. To assess practical feasibility model calculation times as well as various minimum data lengths for retraining are evaluated. Relative performance of model training with external surrogate motion data versus tumor motion data is evaluated. However, an internal–external motion correlation model is not utilized, i.e., prediction is solely driven by internal motion in both cases. Results: Similar prediction performance was achieved for training the model with external surrogate data versus internal (tumor motion) data. Adaptive model retraining can substantially boost performance in the case of external surrogate training while it has little impact for training with internal motion data. A minimum adaptive retraining data length of 8 s and history vector length of 3 s achieve maximal performance. Sampling frequency appears to have little impact on performance confirming previously published work. By using the linear predictor, a relative geometric 3D error reduction of about 50% was achieved (using adaptive retraining, a history vector length of 3 s and with results averaged over all investigated lookahead times and signal sampling frequencies). The absolute mean error could be reduced from (2.0 ± 1.6) mm when using no prediction at all to (0.9 ± 0.8) mm and (1.0 ± 0.9) mm when using the predictor trained with internal tumor motion training data and external surrogate motion training data, respectively (for a typical lookahead time of 250 ms and sampling frequency of 15 Hz). Conclusions: A linear prediction model can reduce latency induced tracking errors by an average of about 50% in real-time image guided radiotherapy systems with system latencies of up to 300 ms. Training a linear model for lung tumor motion prediction with an external surrogate signal alone is feasible and results in similar performance as training with (internal) tumor motion. Particularly for scenarios where motion data are extracted from fluoroscopic imaging with ionizing radiation, this may alleviate the need for additional imaging dose during the collection of model training data.« less

ARMA models for earthquake ground motions. Seismic safety margins research program

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, M. K.; Kwiatkowski, J. W.; Nau, R. F.

1981-02-01

Four major California earthquake records were analyzed by use of a class of discrete linear time-domain processes commonly referred to as ARMA (Autoregressive/Moving-Average) models. It was possible to analyze these different earthquakes, identify the order of the appropriate ARMA model(s), estimate parameters, and test the residuals generated by these models. It was also possible to show the connections, similarities, and differences between the traditional continuous models (with parameter estimates based on spectral analyses) and the discrete models with parameters estimated by various maximum-likelihood techniques applied to digitized acceleration data in the time domain. The methodology proposed is suitable for simulatingmore » earthquake ground motions in the time domain, and appears to be easily adapted to serve as inputs for nonlinear discrete time models of structural motions. 60 references, 19 figures, 9 tables.« less

Simultaneous motion estimation and image reconstruction (SMEIR) for 4D cone-beam CT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Jing; Gu, Xuejun

2013-10-15

Purpose: Image reconstruction and motion model estimation in four-dimensional cone-beam CT (4D-CBCT) are conventionally handled as two sequential steps. Due to the limited number of projections at each phase, the image quality of 4D-CBCT is degraded by view aliasing artifacts, and the accuracy of subsequent motion modeling is decreased by the inferior 4D-CBCT. The objective of this work is to enhance both the image quality of 4D-CBCT and the accuracy of motion model estimation with a novel strategy enabling simultaneous motion estimation and image reconstruction (SMEIR).Methods: The proposed SMEIR algorithm consists of two alternating steps: (1) model-based iterative image reconstructionmore » to obtain a motion-compensated primary CBCT (m-pCBCT) and (2) motion model estimation to obtain an optimal set of deformation vector fields (DVFs) between the m-pCBCT and other 4D-CBCT phases. The motion-compensated image reconstruction is based on the simultaneous algebraic reconstruction technique (SART) coupled with total variation minimization. During the forward- and backprojection of SART, measured projections from an entire set of 4D-CBCT are used for reconstruction of the m-pCBCT by utilizing the updated DVF. The DVF is estimated by matching the forward projection of the deformed m-pCBCT and measured projections of other phases of 4D-CBCT. The performance of the SMEIR algorithm is quantitatively evaluated on a 4D NCAT phantom. The quality of reconstructed 4D images and the accuracy of tumor motion trajectory are assessed by comparing with those resulting from conventional sequential 4D-CBCT reconstructions (FDK and total variation minimization) and motion estimation (demons algorithm). The performance of the SMEIR algorithm is further evaluated by reconstructing a lung cancer patient 4D-CBCT.Results: Image quality of 4D-CBCT is greatly improved by the SMEIR algorithm in both phantom and patient studies. When all projections are used to reconstruct a 3D-CBCT by FDK, motion-blurring artifacts are present, leading to a 24.4% relative reconstruction error in the NACT phantom. View aliasing artifacts are present in 4D-CBCT reconstructed by FDK from 20 projections, with a relative error of 32.1%. When total variation minimization is used to reconstruct 4D-CBCT, the relative error is 18.9%. Image quality of 4D-CBCT is substantially improved by using the SMEIR algorithm and relative error is reduced to 7.6%. The maximum error (MaxE) of tumor motion determined from the DVF obtained by demons registration on a FDK-reconstructed 4D-CBCT is 3.0, 2.3, and 7.1 mm along left–right (L-R), anterior–posterior (A-P), and superior–inferior (S-I) directions, respectively. From the DVF obtained by demons registration on 4D-CBCT reconstructed by total variation minimization, the MaxE of tumor motion is reduced to 1.5, 0.5, and 5.5 mm along L-R, A-P, and S-I directions. From the DVF estimated by SMEIR algorithm, the MaxE of tumor motion is further reduced to 0.8, 0.4, and 1.5 mm along L-R, A-P, and S-I directions, respectively.Conclusions: The proposed SMEIR algorithm is able to estimate a motion model and reconstruct motion-compensated 4D-CBCT. The SMEIR algorithm improves image reconstruction accuracy of 4D-CBCT and tumor motion trajectory estimation accuracy as compared to conventional sequential 4D-CBCT reconstruction and motion estimation.« less

A new fundamental model of moving particle for reinterpreting Schroedinger equation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Umar, Muhamad Darwis

2012-06-20

The study of Schroedinger equation based on a hypothesis that every particle must move randomly in a quantum-sized volume has been done. In addition to random motion, every particle can do relative motion through the movement of its quantum-sized volume. On the other way these motions can coincide. In this proposed model, the random motion is one kind of intrinsic properties of the particle. The every change of both speed of randomly intrinsic motion and or the velocity of translational motion of a quantum-sized volume will represent a transition between two states, and the change of speed of randomly intrinsicmore » motion will generate diffusion process or Brownian motion perspectives. Diffusion process can take place in backward and forward processes and will represent a dissipative system. To derive Schroedinger equation from our hypothesis we use time operator introduced by Nelson. From a fundamental analysis, we find out that, naturally, we should view the means of Newton's Law F(vector sign) = ma(vector sign) as no an external force, but it is just to describe both the presence of intrinsic random motion and the change of the particle energy.« less

Joint image and motion reconstruction for PET using a B-spline motion model.

PubMed

Blume, Moritz; Navab, Nassir; Rafecas, Magdalena

2012-12-21

We present a novel joint image and motion reconstruction method for PET. The method is based on gated data and reconstructs an image together with a motion function. The motion function can be used to transform the reconstructed image to any of the input gates. All available events (from all gates) are used in the reconstruction. The presented method uses a B-spline motion model, together with a novel motion regularization procedure that does not need a regularization parameter (which is usually extremely difficult to adjust). Several image and motion grid levels are used in order to reduce the reconstruction time. In a simulation study, the presented method is compared to a recently proposed joint reconstruction method. While the presented method provides comparable reconstruction quality, it is much easier to use since no regularization parameter has to be chosen. Furthermore, since the B-spline discretization of the motion function depends on fewer parameters than a displacement field, the presented method is considerably faster and consumes less memory than its counterpart. The method is also applied to clinical data, for which a novel purely data-driven gating approach is presented.

A high and low noise model for strong motion accelerometers

NASA Astrophysics Data System (ADS)

Clinton, J. F.; Cauzzi, C.; Olivieri, M.

2010-12-01

We present reference noise models for high-quality strong motion accelerometer installations. We use continuous accelerometer data acquired by the Swiss Seismological Service (SED) since 2006 and other international high-quality accelerometer network data to derive very broadband (50Hz-100s) high and low noise models. The proposed noise models are compared to the Peterson (1993) low and high noise models designed for broadband seismometers; the datalogger self-noise; background noise levels at existing Swiss strong motion stations; and typical earthquake signals recorded in Switzerland and worldwide. The standard strong motion station operated by the SED consists of a Kinemetrics Episensor (2g clip level; flat acceleration response from 200 Hz to DC; <155dB dynamic range) coupled with a 24-bit Nanometrics Taurus datalogger. The proposed noise models are based on power spectral density (PSD) noise levels for each strong motion station computed via PQLX (McNamara and Buland, 2004) from several years of continuous recording. The 'Accelerometer Low Noise Model', ALNM, is dominated by instrument noise from the sensor and datalogger. The 'Accelerometer High Noise Model', AHNM, reflects 1) at high frequencies the acceptable site noise in urban areas, 2) at mid-periods the peak microseismal energy, as determined by the Peterson High Noise Model and 3) at long periods the maximum noise observed from well insulated sensor / datalogger systems placed in vault quality sites. At all frequencies, there is at least one order of magnitude between the ALNM and the AHNM; at high frequencies (> 1Hz) this extends to 2 orders of magnitude. This study provides remarkable confirmation of the capability of modern strong motion accelerometers to record low-amplitude ground motions with seismic observation quality. In particular, an accelerometric station operating at the ALNM is capable of recording the full spectrum of near source earthquakes, out to 100 km, down to M2. Of particular interest for the SED, this study provides acceptable noise limits for candidate sites for the on-going Strong Motion Network modernisation.

Hazard assessment of long-period ground motions for the Nankai Trough earthquakes

NASA Astrophysics Data System (ADS)

Maeda, T.; Morikawa, N.; Aoi, S.; Fujiwara, H.

2013-12-01

We evaluate a seismic hazard for long-period ground motions associated with the Nankai Trough earthquakes (M8~9) in southwest Japan. Large interplate earthquakes occurring around the Nankai Trough have caused serious damages due to strong ground motions and tsunami; most recent events were in 1944 and 1946. Such large interplate earthquake potentially causes damages to high-rise and large-scale structures due to long-period ground motions (e.g., 1985 Michoacan earthquake in Mexico, 2003 Tokachi-oki earthquake in Japan). The long-period ground motions are amplified particularly on basins. Because major cities along the Nankai Trough have developed on alluvial plains, it is therefore important to evaluate long-period ground motions as well as strong motions and tsunami for the anticipated Nankai Trough earthquakes. The long-period ground motions are evaluated by the finite difference method (FDM) using 'characterized source models' and the 3-D underground structure model. The 'characterized source model' refers to a source model including the source parameters necessary for reproducing the strong ground motions. The parameters are determined based on a 'recipe' for predicting strong ground motion (Earthquake Research Committee (ERC), 2009). We construct various source models (~100 scenarios) giving the various case of source parameters such as source region, asperity configuration, and hypocenter location. Each source region is determined by 'the long-term evaluation of earthquakes in the Nankai Trough' published by ERC. The asperity configuration and hypocenter location control the rupture directivity effects. These parameters are important because our preliminary simulations are strongly affected by the rupture directivity. We apply the system called GMS (Ground Motion Simulator) for simulating the seismic wave propagation based on 3-D FDM scheme using discontinuous grids (Aoi and Fujiwara, 1999) to our study. The grid spacing for the shallow region is 200 m and 100 m in horizontal and vertical, respectively. The grid spacing for the deep region is three times coarser. The total number of grid points is about three billion. The 3-D underground structure model used in the FD simulation is the Japan integrated velocity structure model (ERC, 2012). Our simulation is valid for period more than two seconds due to the lowest S-wave velocity and grid spacing. However, because the characterized source model may not sufficiently support short period components, we should be interpreted the reliable period of this simulation with caution. Therefore, we consider the period more than five seconds instead of two seconds for further analysis. We evaluate the long-period ground motions using the velocity response spectra for the period range between five and 20 second. The preliminary simulation shows a large variation of response spectra at a site. This large variation implies that the ground motion is very sensitive to different scenarios. And it requires studying the large variation to understand the seismic hazard. Our further study will obtain the hazard curves for the Nankai Trough earthquake (M 8~9) by applying the probabilistic seismic hazard analysis to the simulation results.

Ground Motion Prediction Models for Caucasus Region

NASA Astrophysics Data System (ADS)

Jorjiashvili, Nato; Godoladze, Tea; Tvaradze, Nino; Tumanova, Nino

2016-04-01

Ground motion prediction models (GMPMs) relate ground motion intensity measures to variables describing earthquake source, path, and site effects. Estimation of expected ground motion is a fundamental earthquake hazard assessment. The most commonly used parameter for attenuation relation is peak ground acceleration or spectral acceleration because this parameter gives useful information for Seismic Hazard Assessment. Since 2003 development of Georgian Digital Seismic Network has started. In this study new GMP models are obtained based on new data from Georgian seismic network and also from neighboring countries. Estimation of models is obtained by classical, statistical way, regression analysis. In this study site ground conditions are additionally considered because the same earthquake recorded at the same distance may cause different damage according to ground conditions. Empirical ground-motion prediction models (GMPMs) require adjustment to make them appropriate for site-specific scenarios. However, the process of making such adjustments remains a challenge. This work presents a holistic framework for the development of a peak ground acceleration (PGA) or spectral acceleration (SA) GMPE that is easily adjustable to different seismological conditions and does not suffer from the practical problems associated with adjustments in the response spectral domain.

Motion and force control of multiple robotic manipulators

NASA Technical Reports Server (NTRS)

Wen, John T.; Kreutz-Delgado, Kenneth

1992-01-01

This paper addresses the motion and force control problem of multiple robot arms manipulating a cooperatively held object. A general control paradigm is introduced which decouples the motion and force control problems. For motion control, different control strategies are constructed based on the variables used as the control input in the controller design. There are three natural choices; acceleration of a generalized coordinate, arm tip force vectors, and the joint torques. The first two choices require full model information but produce simple models for the control design problem. The last choice results in a class of relatively model independent control laws by exploiting the Hamiltonian structure of the open loop system. The motion control only determines the joint torque to within a manifold, due to the multiple-arm kinematic constraint. To resolve the nonuniqueness of the joint torques, two methods are introduced. If the arm and object models are available, an optimization can be performed to best allocate the desired and effector control force to the joint actuators. The other possibility is to control the internal force about some set point. It is shown that effective force regulation can be achieved even if little model information is available.

Master of Puppets: An Animation-by-Demonstration Computer Puppetry Authoring Framework

NASA Astrophysics Data System (ADS)

Cui, Yaoyuan; Mousas, Christos

2018-03-01

This paper presents Master of Puppets (MOP), an animation-by-demonstration framework that allows users to control the motion of virtual characters (puppets) in real time. In the first step, the user is asked to perform the necessary actions that correspond to the character's motions. The user's actions are recorded, and a hidden Markov model is used to learn the temporal profile of the actions. During the runtime of the framework, the user controls the motions of the virtual character based on the specified activities. The advantage of the MOP framework is that it recognizes and follows the progress of the user's actions in real time. Based on the forward algorithm, the method predicts the evolution of the user's actions, which corresponds to the evolution of the character's motion. This method treats characters as puppets that can perform only one motion at a time. This means that combinations of motion segments (motion synthesis), as well as the interpolation of individual motion sequences, are not provided as functionalities. By implementing the framework and presenting several computer puppetry scenarios, its efficiency and flexibility in animating virtual characters is demonstrated.

In-vehicle group activity modeling and simulation in sensor-based virtual environment

NASA Astrophysics Data System (ADS)

Shirkhodaie, Amir; Telagamsetti, Durga; Poshtyar, Azin; Chan, Alex; Hu, Shuowen

2016-05-01

Human group activity recognition is a very complex and challenging task, especially for Partially Observable Group Activities (POGA) that occur in confined spaces with limited visual observability and often under severe occultation. In this paper, we present IRIS Virtual Environment Simulation Model (VESM) for the modeling and simulation of dynamic POGA. More specifically, we address sensor-based modeling and simulation of a specific category of POGA, called In-Vehicle Group Activities (IVGA). In VESM, human-alike animated characters, called humanoids, are employed to simulate complex in-vehicle group activities within the confined space of a modeled vehicle. Each articulated humanoid is kinematically modeled with comparable physical attributes and appearances that are linkable to its human counterpart. Each humanoid exhibits harmonious full-body motion - simulating human-like gestures and postures, facial impressions, and hands motions for coordinated dexterity. VESM facilitates the creation of interactive scenarios consisting of multiple humanoids with different personalities and intentions, which are capable of performing complicated human activities within the confined space inside a typical vehicle. In this paper, we demonstrate the efficiency and effectiveness of VESM in terms of its capabilities to seamlessly generate time-synchronized, multi-source, and correlated imagery datasets of IVGA, which are useful for the training and testing of multi-source full-motion video processing and annotation. Furthermore, we demonstrate full-motion video processing of such simulated scenarios under different operational contextual constraints.

Automatic online and real-time tumour motion monitoring during stereotactic liver treatments on a conventional linac by combined optical and sparse monoscopic imaging with kilovoltage x-rays (COSMIK)

NASA Astrophysics Data System (ADS)

Bertholet, Jenny; Toftegaard, Jakob; Hansen, Rune; Worm, Esben S.; Wan, Hanlin; Parikh, Parag J.; Weber, Britta; Høyer, Morten; Poulsen, Per R.

2018-03-01

The purpose of this study was to develop, validate and clinically demonstrate fully automatic tumour motion monitoring on a conventional linear accelerator by combined optical and sparse monoscopic imaging with kilovoltage x-rays (COSMIK). COSMIK combines auto-segmentation of implanted fiducial markers in cone-beam computed tomography (CBCT) projections and intra-treatment kV images with simultaneous streaming of an external motion signal. A pre-treatment CBCT is acquired with simultaneous recording of the motion of an external marker block on the abdomen. The 3-dimensional (3D) marker motion during the CBCT is estimated from the auto-segmented positions in the projections and used to optimize an external correlation model (ECM) of internal motion as a function of external motion. During treatment, the ECM estimates the internal motion from the external motion at 20 Hz. KV images are acquired every 3 s, auto-segmented, and used to update the ECM for baseline shifts between internal and external motion. The COSMIK method was validated using Calypso-recorded internal tumour motion with simultaneous camera-recorded external motion for 15 liver stereotactic body radiotherapy (SBRT) patients. The validation included phantom experiments and simulations hereof for 12 fractions and further simulations for 42 fractions. The simulations compared the accuracy of COSMIK with ECM-based monitoring without model updates and with model updates based on stereoscopic imaging as well as continuous kilovoltage intrafraction monitoring (KIM) at 10 Hz without an external signal. Clinical real-time tumour motion monitoring with COSMIK was performed offline for 14 liver SBRT patients (41 fractions) and online for one patient (two fractions). The mean 3D root-mean-square error for the four monitoring methods was 1.61 mm (COSMIK), 2.31 mm (ECM without updates), 1.49 mm (ECM with stereoscopic updates) and 0.75 mm (KIM). COSMIK is the first combined kV/optical real-time motion monitoring method used clinically online on a conventional accelerator. COSMIK gives less imaging dose than KIM and is in addition applicable when the kV imager cannot be deployed such as during non-coplanar fields.

Brownian motion of arbitrarily shaped particles in two dimensions.

PubMed

Chakrabarty, Ayan; Konya, Andrew; Wang, Feng; Selinger, Jonathan V; Sun, Kai; Wei, Qi-Huo

2014-11-25

We implement microfabricated boomerang particles with unequal arm lengths as a model for nonsymmetric particles and study their Brownian motion in a quasi-two-dimensional geometry by using high-precision single-particle motion tracking. We show that because of the coupling between translation and rotation, the mean squared displacements of a single asymmetric boomerang particle exhibit a nonlinear crossover from short-time faster to long-time slower diffusion, and the mean displacements for fixed initial orientation are nonzero and saturate out at long times. The measured anisotropic diffusion coefficients versus the tracking point position indicate that there exists one unique point, i.e., the center of hydrodynamic stress (CoH), at which all coupled diffusion coefficients vanish. This implies that in contrast to motion in three dimensions where the CoH exists only for high-symmetry particles, the CoH always exists for Brownian motion in two dimensions. We develop an analytical model based on Langevin theory to explain the experimental results and show that among the six anisotropic diffusion coefficients only five are independent because the translation-translation coupling originates from the translation-rotation coupling. Finally, we classify the behavior of two-dimensional Brownian motion of arbitrarily shaped particles into four groups based on the particle shape symmetry group and discussed potential applications of the CoH in simplifying understanding of the circular motions of microswimmers.

Source Model of the MJMA 6.5 Plate-Boundary Earthquake at the Nankai Trough, Southwest Japan, on April 1, 2016, Based on Strong Motion Waveform Modeling

NASA Astrophysics Data System (ADS)

Asano, K.

2017-12-01

An MJMA 6.5 earthquake occurred offshore the Kii peninsula, southwest Japan on April 1, 2016. This event was interpreted as a thrust-event on the plate-boundary along the Nankai trough where (Wallace et al., 2016). This event is the largest plate-boundary earthquake in the source region of the 1944 Tonankai earthquake (MW 8.0) after that event. The significant point of this event regarding to seismic observation is that this event occurred beneath an ocean-bottom seismic network called DONET1, which is jointly operated by NIED and JAMSTEC. Since moderate-to-large earthquake of this focal type is very rare in this region in the last half century, it is a good opportunity to investigate the source characteristics relating to strong motion generation of subduction-zone plate-boundary earthquakes along the Nankai trough. Knowledge obtained from the study of this earthquake would contribute to ground motion prediction and seismic hazard assessment for future megathrust earthquakes expected in the Nankai trough. In this study, the source model of the 2016 offshore the Kii peninsula earthquake was estimated by broadband strong motion waveform modeling using the empirical Green's function method (Irikura, 1986). The source model is characterized by strong motion generation area (SMGA) (Miyake et al., 2003), which is defined as a rectangular area with high-stress drop or high slip-velocity. SMGA source model based on the empirical Green's function method has great potential to reproduce ground motion time history in broadband frequency range. We used strong motion data from offshore stations (DONET1 and LTBMS) and onshore stations (NIED F-net and DPRI). The records of an MJMA 3.2 aftershock at 13:04 on April 1, 2016 were selected for the empirical Green's functions. The source parameters of SMGA are optimized by the waveform modeling in the frequency range 0.4-10 Hz. The best estimate of SMGA size is 19.4 km2, and SMGA of this event does not follow the source scaling relationship for past plate-boundary earthquakes along the Japan trench, northeast Japan. This finding implies that the source characteristics of plate-boundary events in the Nankai trough are different from those in the Japan Trench, and it could be important information to consider regional variation in ground motion prediction.

Shear Wave Generation and Modeling Ground Motion From a Source Physics Experiment (SPE) Underground Explosion

NASA Astrophysics Data System (ADS)

Pitarka, Arben; Mellors, Robert; Rodgers, Arthur; Vorobiev, Oleg; Ezzedine, Souheil; Matzel, Eric; Ford, Sean; Walter, Bill; Antoun, Tarabay; Wagoner, Jeffery; Pasyanos, Mike; Petersson, Anders; Sjogreen, Bjorn

2014-05-01

We investigate the excitation and propagation of far-field (epicentral distance larger than 20 m) seismic waves by analyzing and modeling ground motion from an underground chemical explosion recorded during the Source Physics Experiment (SPE), Nevada. The far-field recorded ground motion is characterized by complex features, such as large azimuthal variations in P- and S-wave amplitudes, as well as substantial energy on the tangential component of motion. Shear wave energy is also observed on the tangential component of the near-field motion (epicentral distance smaller than 20 m) suggesting that shear waves were generated at or very near the source. These features become more pronounced as the waves propagate away from the source. We address the shear wave generation during the explosion by modeling ground motion waveforms recorded in the frequency range 0.01-20 Hz, at distances of up to 1 km. We used a physics based approach that combines hydrodynamic modeling of the source with anelastic modeling of wave propagation in order to separate the contributions from the source and near-source wave scattering on shear motion generation. We found that wave propagation scattering caused by the near-source geological environment, including surface topography, contributes to enhancement of shear waves generated from the explosion source. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-06NA25946/ NST11-NCNS-TM-EXP-PD15.

Adaptive identification of vessel's added moments of inertia with program motion

NASA Astrophysics Data System (ADS)

Alyshev, A. S.; Melnikov, V. G.

2018-05-01

In this paper, we propose a new experimental method for determining the moments of inertia of the ship model. The paper gives a brief review of existing methods, a description of the proposed method and experimental stand, test procedures and calculation formulas and experimental results. The proposed method is based on the energy approach with special program motions. The ship model is fixed in a special rack consisting of a torsion element and a set of additional servo drives with flywheels (reactive wheels), which correct the motion. The servo drives with an adaptive controller provide the symmetry of the motion, which is necessary for the proposed identification procedure. The effectiveness of the proposed approach is confirmed by experimental results.

A New Seismic Hazard Model for Mainland China

NASA Astrophysics Data System (ADS)

Rong, Y.; Xu, X.; Chen, G.; Cheng, J.; Magistrale, H.; Shen, Z. K.

2017-12-01

We are developing a new seismic hazard model for Mainland China by integrating historical earthquake catalogs, geological faults, geodetic GPS data, and geology maps. To build the model, we construct an Mw-based homogeneous historical earthquake catalog spanning from 780 B.C. to present, create fault models from active fault data, and derive a strain rate model based on the most complete GPS measurements and a new strain derivation algorithm. We divide China and the surrounding regions into about 20 large seismic source zones. For each zone, a tapered Gutenberg-Richter (TGR) magnitude-frequency distribution is used to model the seismic activity rates. The a- and b-values of the TGR distribution are calculated using observed earthquake data, while the corner magnitude is constrained independently using the seismic moment rate inferred from the geodetically-based strain rate model. Small and medium sized earthquakes are distributed within the source zones following the location and magnitude patterns of historical earthquakes. Some of the larger earthquakes are distributed onto active faults, based on their geological characteristics such as slip rate, fault length, down-dip width, and various paleoseismic data. The remaining larger earthquakes are then placed into the background. A new set of magnitude-rupture scaling relationships is developed based on earthquake data from China and vicinity. We evaluate and select appropriate ground motion prediction equations by comparing them with observed ground motion data and performing residual analysis. To implement the modeling workflow, we develop a tool that builds upon the functionalities of GEM's Hazard Modeler's Toolkit. The GEM OpenQuake software is used to calculate seismic hazard at various ground motion periods and various return periods. To account for site amplification, we construct a site condition map based on geology. The resulting new seismic hazard maps can be used for seismic risk analysis and management.

Quantifying Astronaut Tasks: Robotic Technology and Future Space Suit Design

NASA Technical Reports Server (NTRS)

Newman, Dava

2003-01-01

The primary aim of this research effort was to advance the current understanding of astronauts' capabilities and limitations in space-suited EVA by developing models of the constitutive and compatibility relations of a space suit, based on experimental data gained from human test subjects as well as a 12 degree-of-freedom human-sized robot, and utilizing these fundamental relations to estimate a human factors performance metric for space suited EVA work. The three specific objectives are to: 1) Compile a detailed database of torques required to bend the joints of a space suit, using realistic, multi- joint human motions. 2) Develop a mathematical model of the constitutive relations between space suit joint torques and joint angular positions, based on experimental data and compare other investigators' physics-based models to experimental data. 3) Estimate the work envelope of a space suited astronaut, using the constitutive and compatibility relations of the space suit. The body of work that makes up this report includes experimentation, empirical and physics-based modeling, and model applications. A detailed space suit joint torque-angle database was compiled with a novel experimental approach that used space-suited human test subjects to generate realistic, multi-joint motions and an instrumented robot to measure the torques required to accomplish these motions in a space suit. Based on the experimental data, a mathematical model is developed to predict joint torque from the joint angle history. Two physics-based models of pressurized fabric cylinder bending are compared to experimental data, yielding design insights. The mathematical model is applied to EVA operations in an inverse kinematic analysis coupled to the space suit model to calculate the volume in which space-suited astronauts can work with their hands, demonstrating that operational human factors metrics can be predicted from fundamental space suit information.

Finite element analysis of moment-rotation relationships for human cervical spine.

PubMed

Zhang, Qing Hang; Teo, Ee Chon; Ng, Hong Wan; Lee, Vee Sin

2006-01-01

A comprehensive, geometrically accurate, nonlinear C0-C7 FE model of head and cervical spine based on the actual geometry of a human cadaver specimen was developed. The motions of each cervical vertebral level under pure moment loading of 1.0 Nm applied incrementally on the skull to simulate the movements of the head and cervical spine under flexion, tension, axial rotation and lateral bending with the inferior surface of the C7 vertebral body fully constrained were analysed. The predicted range of motion (ROM) for each motion segment were computed and compared with published experimental data. The model predicted the nonlinear moment-rotation relationship of human cervical spine. Under the same loading magnitude, the model predicted the largest rotation in extension, followed by flexion and axial rotation, and least ROM in lateral bending. The upper cervical spines are more flexible than the lower cervical levels. The motions of the two uppermost motion segments account for half (or even higher) of the whole cervical spine motion under rotational loadings. The differences in the ROMs among the lower cervical spines (C3-C7) were relatively small. The FE predicted segmental motions effectively reflect the behavior of human cervical spine and were in agreement with the experimental data. The C0-C7 FE model offers potentials for biomedical and injury studies.

Effect of spine motion on mobility in quadruped running

NASA Astrophysics Data System (ADS)

Chen, Dongliang; Liu, Qi; Dong, Litao; Wang, Hong; Zhang, Qun

2014-11-01

Most of current running quadruped robots have similar construction: a stiff body and four compliant legs. Many researches have indicated that the stiff body without spine motion is a main factor in limitation of robots' mobility. Therefore, investigating spine motion is very important to build robots with better mobility. A planar quadruped robot is designed based on cheetahs' morphology. There is a spinal driving joint in the body of the robot. When the spinal driving joint acts, the robot has spine motion; otherwise, the robot has not spine motion. Six group prototype experiments with the robot are carried out to study the effect of spine motion on mobility. In each group, there are two comparative experiments: the spinal driving joint acts in one experiment but does not in the other experiment. The results of the prototype experiments indicate that the average speeds of the robot with spine motion are 8.7%-15.9% larger than those of the robot without spine motion. Furthermore, a simplified sagittal plane model of quadruped mammals is introduced. The simplified model also has a spinal driving joint. Using a similar process as the prototype experiments, six group simulation experiments with the simplified model are conducted. The results of the simulation experiments show that the maximum rear leg horizontal thrusts of the simplified mode with spine motion are 68.2%-71.3% larger than those of the simplified mode without spine motion. Hence, it is found that spine motion can increase the average running speed and the intrinsic reason of speed increase is the improvement of the maximum rear leg horizontal thrust.

Ground Motion Simulation for a Large Active Fault System using Empirical Green's Function Method and the Strong Motion Prediction Recipe - a Case Study of the Noubi Fault Zone -

NASA Astrophysics Data System (ADS)

Kuriyama, M.; Kumamoto, T.; Fujita, M.

2005-12-01

The 1995 Hyogo-ken Nambu Earthquake (1995) near Kobe, Japan, spurred research on strong motion prediction. To mitigate damage caused by large earthquakes, a highly precise method of predicting future strong motion waveforms is required. In this study, we applied empirical Green's function method to forward modeling in order to simulate strong ground motion in the Noubi Fault zone and examine issues related to strong motion prediction for large faults. Source models for the scenario earthquakes were constructed using the recipe of strong motion prediction (Irikura and Miyake, 2001; Irikura et al., 2003). To calculate the asperity area ratio of a large fault zone, the results of a scaling model, a scaling model with 22% asperity by area, and a cascade model were compared, and several rupture points and segmentation parameters were examined for certain cases. A small earthquake (Mw: 4.6) that occurred in northern Fukui Prefecture in 2004 were examined as empirical Green's function, and the source spectrum of this small event was found to agree with the omega-square scaling law. The Nukumi, Neodani, and Umehara segments of the 1891 Noubi Earthquake were targeted in the present study. The positions of the asperity area and rupture starting points were based on the horizontal displacement distributions reported by Matsuda (1974) and the fault branching pattern and rupture direction model proposed by Nakata and Goto (1998). Asymmetry in the damage maps for the Noubi Earthquake was then examined. We compared the maximum horizontal velocities for each case that had a different rupture starting point. In the case, rupture started at the center of the Nukumi Fault, while in another case, rupture started on the southeastern edge of the Umehara Fault; the scaling model showed an approximately 2.1-fold difference between these cases at observation point FKI005 of K-Net. This difference is considered to relate to the directivity effect associated with the direction of rupture propagation. Moreover, it was clarified that the horizontal velocities by assuming the cascade model was underestimated more than one standard deviation of empirical relation by Si and Midorikawa (1999). The scaling and cascade models showed an approximately 6.4-fold difference for the case, in which the rupture started along the southeastern edge of the Umehara Fault at observation point GIF020. This difference is significantly large in comparison with the effect of different rupture starting points, and shows that it is important to base scenario earthquake assumptions on active fault datasets before establishing the source characterization model. The distribution map of seismic intensity for the 1891 Noubi Earthquake also suggests that the synthetic waveforms in the southeastern Noubi Fault zone may be underestimated. Our results indicate that outer fault parameters (e.g., earthquake moment) related to the construction of scenario earthquakes influence strong motion prediction, rather than inner fault parameters such as the rupture starting point. Based on these methods, we will predict strong motion for approximately 140 to 150 km of the Itoigawa-Shizuoka Tectonic Line.

Numerical and experimental studies of hydrodynamics of flapping foils

NASA Astrophysics Data System (ADS)

Zhou, Kai; Liu, Jun-kao; Chen, Wei-shan

2018-04-01

The flapping foil based on bionics is a sort of simplified models which imitate the motion of wings or fins of fish or birds. In this paper, a universal kinematic model with three degrees of freedom is adopted and the motion parallel to the flow direction is considered. The force coefficients, the torque coefficient, and the flow field characteristics are extracted and analyzed. Then the propulsive efficiency is calculated. The influence of the motion parameters on the hydrodynamic performance of the bionic foil is studied. The results show that the motion parameters play important roles in the hydrodynamic performance of the flapping foil. To validate the reliability of the numerical method used in this paper, an experiment platform is designed and verification experiments are carried out. Through the comparison, it is found that the numerical results compare well with the experimental results, to show that the adopted numerical method is reliable. The results of this paper provide a theoretical reference for the design of underwater vehicles based on the flapping propulsion.

Flow Mapping Based on the Motion-Integration Errors of Autonomous Underwater Vehicles

NASA Astrophysics Data System (ADS)

Chang, D.; Edwards, C. R.; Zhang, F.

2016-02-01

Knowledge of a flow field is crucial in the navigation of autonomous underwater vehicles (AUVs) since the motion of AUVs is affected by ambient flow. Due to the imperfect knowledge of the flow field, it is typical to observe a difference between the actual and predicted trajectories of an AUV, which is referred to as a motion-integration error (also known as a dead-reckoning error if an AUV navigates via dead-reckoning). The motion-integration error has been essential for an underwater glider to compute its flow estimate from the travel information of the last leg and to improve navigation performance by using the estimate for the next leg. However, the estimate by nature exhibits a phase difference compared to ambient flow experienced by gliders, prohibiting its application in a flow field with strong temporal and spatial gradients. In our study, to mitigate the phase problem, we have developed a local ocean model by combining the flow estimate based on the motion-integration error with flow predictions from a tidal ocean model. Our model has been used to create desired trajectories of gliders for guidance. Our method is validated by Long Bay experiments in 2012 and 2013 in which we deployed multiple gliders on the shelf of South Atlantic Bight and near the edge of Gulf Stream. In our recent study, the application of the motion-integration error is further extended to create a spatial flow map. Considering that the motion-integration errors of AUVs accumulate along their trajectories, the motion-integration error is formulated as a line integral of ambient flow which is then reformulated into algebraic equations. By solving an inverse problem for these algebraic equations, we obtain the knowledge of such flow in near real time, allowing more effective and precise guidance of AUVs in a dynamic environment. This method is referred to as motion tomography. We provide the results of non-parametric and parametric flow mapping from both simulated and experimental data.

Marker-based method to measure movement between the residual limb and a transtibial prosthetic socket.

PubMed

Childers, Walter Lee; Siebert, Steven

2016-12-01

Limb movement between the residuum and socket continues to be an underlying factor in limb health, prosthetic comfort, and gait performance yet techniques to measure this have been underdeveloped. Develop a method to measure motion between the residual limb and a transtibial prosthetic socket. Single subject, repeated measures with mathematical modeling. The gait of a participant with transtibial amputation was recorded using a motion capture system using a marker set that included arrays on the anterior distal tibia and the lateral epicondyle of the femur. The proximal or distal translation, anterior or posterior translation, and angular movements were quantified. A random Monte Carlo simulation based on the precision of the motion capture system and a model of the bone moving under the skin explored the technique's accuracy. Residual limb tissue stiffness was modeled as a linear spring based on data from Papaioannou et al. Residuum movement relative to the socket went through ~30 mm, 18 mm, and 15° range of motion. Root mean squared errors were 5.47 mm, 1.86 mm, and 0.75° when considering the modeled bone-skin movement in the proximal or distal, anterior or posterior, and angular directions, respectively. The measured movement was greater than the root mean squared error, indicating that this method can measure motion between the residuum and socket. The ability to quantify movement between the residual limb and the prosthetic socket will improve prosthetic treatment through the evaluation of different prosthetic suspensions, socket designs, and motor control of the prosthetic interface. © The International Society for Prosthetics and Orthotics 2015.

Dosimetric evaluation of intrafractional tumor motion by means of a robot driven phantom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richter, Anne; Wilbert, Juergen; Flentje, Michael

2011-10-15

Purpose: The aim of the work was to investigate the influence of intrafractional tumor motion to the accumulated (absorbed) dose. The accumulated dose was determined by means of calculations and measurements with a robot driven motion phantom. Methods: Different motion scenarios and compensation techniques were realized in a phantom study to investigate the influence of motion on image acquisition, dose calculation, and dose measurement. The influence of motion on the accumulated dose was calculated by employing two methods (a model based and a voxel based method). Results: Tumor motion resulted in a blurring of steep dose gradients and a reductionmore » of dose at the periphery of the target. A systematic variation of motion parameters allowed the determination of the main influence parameters on the accumulated dose. The key parameters with the greatest influence on dose were the mean amplitude and the pattern of motion. Investigations on necessary safety margins to compensate for dose reduction have shown that smaller safety margins are sufficient, if the developed concept with optimized margins (OPT concept) was used instead of the standard internal target volume (ITV) concept. Both calculation methods were a reasonable approximation of the measured dose with the voxel based method being in better agreement with the measurements. Conclusions: Further evaluation of available systems and algorithms for dose accumulation are needed to create guidelines for the verification of the accumulated dose.« less

Development of biomechanical models for human factors evaluations

NASA Technical Reports Server (NTRS)

Woolford, Barbara; Pandya, Abhilash; Maida, James

1991-01-01

Previewing human capabilities in a computer-aided engineering mode has assisted greatly in planning well-designed systems without the cost and time involved in mockups and engineering models. To date, the computer models have focused on such variables as field of view, accessibility and fit, and reach envelopes. Program outputs have matured from simple static pictures to animations viewable from any eyepoint. However, while kinematics models are available, there are few biomechanical models available for estimating strength and motion patterns. Those, such as Crew Chief, that are available are based on strength measurements taken in specific positions. Johnson Space Center is pursuing a biomechanical model which will use strength data collected on single joints at two or three velocities to attempt to predict compound motions of several joint simultaneously and the resulting force at the end effector. Two lines of research are coming together to produce this result. One is an attempt to use optimal control theory to predict joint motion in complex motions, and another is the development of graphical representation of human capabilities. The progress to date in this research is described.

In Silico Neuro-Oncology: Brownian Motion-Based Mathematical Treatment as a Potential Platform for Modeling the Infiltration of Glioma Cells into Normal Brain Tissue.

PubMed

Antonopoulos, Markos; Stamatakos, Georgios

2015-01-01

Intensive glioma tumor infiltration into the surrounding normal brain tissues is one of the most critical causes of glioma treatment failure. To quantitatively understand and mathematically simulate this phenomenon, several diffusion-based mathematical models have appeared in the literature. The majority of them ignore the anisotropic character of diffusion of glioma cells since availability of pertinent truly exploitable tomographic imaging data is limited. Aiming at enriching the anisotropy-enhanced glioma model weaponry so as to increase the potential of exploiting available tomographic imaging data, we propose a Brownian motion-based mathematical analysis that could serve as the basis for a simulation model estimating the infiltration of glioblastoma cells into the surrounding brain tissue. The analysis is based on clinical observations and exploits diffusion tensor imaging (DTI) data. Numerical simulations and suggestions for further elaboration are provided.

Automated detection of videotaped neonatal seizures of epileptic origin.

PubMed

Karayiannis, Nicolaos B; Xiong, Yaohua; Tao, Guozhi; Frost, James D; Wise, Merrill S; Hrachovy, Richard A; Mizrahi, Eli M

2006-06-01

This study aimed at the development of a seizure-detection system by training neural networks with quantitative motion information extracted from short video segments of neonatal seizures of the myoclonic and focal clonic types and random infant movements. The motion of the infants' body parts was quantified by temporal motion-strength signals extracted from video segments by motion-segmentation methods based on optical flow computation. The area of each frame occupied by the infants' moving body parts was segmented by clustering the motion parameters obtained by fitting an affine model to the pixel velocities. The motion of the infants' body parts also was quantified by temporal motion-trajectory signals extracted from video recordings by robust motion trackers based on block-motion models. These motion trackers were developed to adjust autonomously to illumination and contrast changes that may occur during the video-frame sequence. Video segments were represented by quantitative features obtained by analyzing motion-strength and motion-trajectory signals in both the time and frequency domains. Seizure recognition was performed by conventional feed-forward neural networks, quantum neural networks, and cosine radial basis function neural networks, which were trained to detect neonatal seizures of the myoclonic and focal clonic types and to distinguish them from random infant movements. The computational tools and procedures developed for automated seizure detection were evaluated on a set of 240 video segments of 54 patients exhibiting myoclonic seizures (80 segments), focal clonic seizures (80 segments), and random infant movements (80 segments). Regardless of the decision scheme used for interpreting the responses of the trained neural networks, all the neural network models exhibited sensitivity and specificity>90%. For one of the decision schemes proposed for interpreting the responses of the trained neural networks, the majority of the trained neural-network models exhibited sensitivity>90% and specificity>95%. In particular, cosine radial basis function neural networks achieved the performance targets of this phase of the project (i.e., sensitivity>95% and specificity>95%). The best among the motion segmentation and tracking methods developed in this study produced quantitative features that constitute a reliable basis for detecting neonatal seizures. The performance targets of this phase of the project were achieved by combining the quantitative features obtained by analyzing motion-strength signals with those produced by analyzing motion-trajectory signals. The computational procedures and tools developed in this study to perform off-line analysis of short video segments will be used in the next phase of this project, which involves the integration of these procedures and tools into a system that can process and analyze long video recordings of infants monitored for seizures in real time.

From behavioural analyses to models of collective motion in fish schools

PubMed Central

Lopez, Ugo; Gautrais, Jacques; Couzin, Iain D.; Theraulaz, Guy

2012-01-01

Fish schooling is a phenomenon of long-lasting interest in ethology and ecology, widely spread across taxa and ecological contexts, and has attracted much interest from statistical physics and theoretical biology as a case of self-organized behaviour. One topic of intense interest is the search of specific behavioural mechanisms at stake at the individual level and from which the school properties emerges. This is fundamental for understanding how selective pressure acting at the individual level promotes adaptive properties of schools and in trying to disambiguate functional properties from non-adaptive epiphenomena. Decades of studies on collective motion by means of individual-based modelling have allowed a qualitative understanding of the self-organization processes leading to collective properties at school level, and provided an insight into the behavioural mechanisms that result in coordinated motion. Here, we emphasize a set of paradigmatic modelling assumptions whose validity remains unclear, both from a behavioural point of view and in terms of quantitative agreement between model outcome and empirical data. We advocate for a specific and biologically oriented re-examination of these assumptions through experimental-based behavioural analysis and modelling. PMID:24312723

Modelling the effect of race surface and racehorse limb parameters on in silico fetlock motion and propensity for injury.

PubMed

Symons, J E; Hawkins, D A; Fyhrie, D P; Upadhyaya, S K; Stover, S M

2017-09-01

The metacarpophalangeal joint (fetlock) is the most commonly affected site of racehorse injury, with multiple observed pathologies consistent with extreme fetlock dorsiflexion. Race surface mechanics affect musculoskeletal structure loading and injury risk because surface forces applied to the hoof affect limb motions. Race surface mechanics are a function of controllable factors. Thus, race surface design has the potential to reduce the incidence of musculoskeletal injury through modulation of limb motions. However, the relationship between race surface mechanics and racehorse limb motions is unknown. To determine the effect of changing race surface and racehorse limb model parameters on distal limb motions. Sensitivity analysis of in silico fetlock motion to changes in race surface and racehorse limb parameters using a validated, integrated racehorse and race surface computational model. Fetlock motions were determined during gallop stance from simulations on virtual surfaces with differing average vertical stiffness, upper layer (e.g. cushion) depth and linear stiffness, horizontal friction, tendon and ligament mechanics, as well as fetlock position at heel strike. Upper layer depth produced the greatest change in fetlock motion, with lesser depths yielding greater fetlock dorsiflexion. Lesser fetlock changes were observed for changes in lower layer (e.g. base or pad) mechanics (nonlinear), as well as palmar ligament and tendon stiffness. Horizontal friction and fetlock position contributed less than 1° change in fetlock motion. Simulated fetlock motions are specific to one horse's anatomy reflected in the computational model. Anatomical differences among horses may affect the magnitude of limb flexion, but will likely have similar limb motion responses to varied surface mechanics. Race surface parameters affected by maintenance produced greater changes in fetlock motion than other parameters studied. Simulations can provide evidence to inform race surface design and management to reduce the incidence of injury. © 2017 EVJ Ltd.

Seismic hazard in the Nation's breadbasket

USGS Publications Warehouse

Boyd, Oliver; Haller, Kathleen; Luco, Nicolas; Moschetti, Morgan P.; Mueller, Charles; Petersen, Mark D.; Rezaeian, Sanaz; Rubinstein, Justin L.

2015-01-01

The USGS National Seismic Hazard Maps were updated in 2014 and included several important changes for the central United States (CUS). Background seismicity sources were improved using a new moment-magnitude-based catalog; a new adaptive, nearest-neighbor smoothing kernel was implemented; and maximum magnitudes for background sources were updated. Areal source zones developed by the Central and Eastern United States Seismic Source Characterization for Nuclear Facilities project were simplified and adopted. The weighting scheme for ground motion models was updated, giving more weight to models with a faster attenuation with distance compared to the previous maps. Overall, hazard changes (2% probability of exceedance in 50 years, across a range of ground-motion frequencies) were smaller than 10% in most of the CUS relative to the 2008 USGS maps despite new ground motion models and their assigned logic tree weights that reduced the probabilistic ground motions by 5–20%.

Nonclassical point of view of the Brownian motion generation via fractional deterministic model

NASA Astrophysics Data System (ADS)

Gilardi-Velázquez, H. E.; Campos-Cantón, E.

In this paper, we present a dynamical system based on the Langevin equation without stochastic term and using fractional derivatives that exhibit properties of Brownian motion, i.e. a deterministic model to generate Brownian motion is proposed. The stochastic process is replaced by considering an additional degree of freedom in the second-order Langevin equation. Thus, it is transformed into a system of three first-order linear differential equations, additionally α-fractional derivative are considered which allow us to obtain better statistical properties. Switching surfaces are established as a part of fluctuating acceleration. The final system of three α-order linear differential equations does not contain a stochastic term, so the system generates motion in a deterministic way. Nevertheless, from the time series analysis, we found that the behavior of the system exhibits statistics properties of Brownian motion, such as, a linear growth in time of mean square displacement, a Gaussian distribution. Furthermore, we use the detrended fluctuation analysis to prove the Brownian character of this motion.

Numerical simulation of temperature at drilling micro-hole on moving CO2 laser irradiated sticking plaster

NASA Astrophysics Data System (ADS)

Rao, Zhiming; He, Zhifang; Du, Jianqiang; Zhang, Xinyou; Ai, Guoping; Zhang, Chunqiang; Wu, Tao

2012-03-01

This paper applied numerical simulation of temperature by using finite element analysis software Ansys to study a model of drilling on sticking plaster. The continuous CO2 laser doing uniform linear motion and doing uniform circular motion irradiated sticking plaster to vaporize. The sticking plaster material was chosen as the thermal conductivity, the heat capacity and the density. For temperatures above 450 °C, sticking plaster would be vaporized. Based on the mathematical model of heat transfer, the process of drilling sticking plaster by laser beams could be simulated by Ansys. The simulation results showed the distribution of the temperature at the surface of the sticking plaster with the time of vaporizing at CO2 laser to do uniform linear motion and to do uniform circular motion. The temperature of sticking plaster CO2 laser to do uniform linear motion was higher than CO2 laser to do uniform circular motion in the same condition.

The transformation of regular circular motion into straight motion according to Nasir al din al-Tusi - a genious model for the conscious preservation of a defect of Ptolemy's lunar theory (German Title: Die Umwandlung gleichförmiger Kreisbewegung in geradlinige Bewegung nach Nasir al din al-Tusi - Ein geniales Modell zur bewußten Beibehaltung eines Mangels der Ptolemäischen Mondtheorie)

NASA Astrophysics Data System (ADS)

Hein, Olaf; Mader, Rolf

Nasir al din al-Tusi (1201-1274) was one of the most important universal scholars of Islam. As a convinced Aristotelian, he rejected Ptolemy's modifications of the Aristotelian dogma of uniform circular motion. He created a theory of lunar motion which is only based on uniform circular motion, and which results in the same representation of lunar motion as conceived by Ptolemy. He successfully attempted to consciously preserve, and not to correct, an error of Ptolemy's theory (the doubling of the earth-moon distance in the syzygies as compared to the quadratures). We explain the Tusi mechanism and point out its philosophical consequences (the unwanted dissolution of the difference between the extra- and intralunar world).

Robotics-based synthesis of human motion.

PubMed

Khatib, O; Demircan, E; De Sapio, V; Sentis, L; Besier, T; Delp, S

2009-01-01

The synthesis of human motion is a complex procedure that involves accurate reconstruction of movement sequences, modeling of musculoskeletal kinematics, dynamics and actuation, and characterization of reliable performance criteria. Many of these processes have much in common with the problems found in robotics research. Task-based methods used in robotics may be leveraged to provide novel musculoskeletal modeling methods and physiologically accurate performance predictions. In this paper, we present (i) a new method for the real-time reconstruction of human motion trajectories using direct marker tracking, (ii) a task-driven muscular effort minimization criterion and (iii) new human performance metrics for dynamic characterization of athletic skills. Dynamic motion reconstruction is achieved through the control of a simulated human model to follow the captured marker trajectories in real-time. The operational space control and real-time simulation provide human dynamics at any configuration of the performance. A new criteria of muscular effort minimization has been introduced to analyze human static postures. Extensive motion capture experiments were conducted to validate the new minimization criterion. Finally, new human performance metrics were introduced to study in details an athletic skill. These metrics include the effort expenditure and the feasible set of operational space accelerations during the performance of the skill. The dynamic characterization takes into account skeletal kinematics as well as muscle routing kinematics and force generating capacities. The developments draw upon an advanced musculoskeletal modeling platform and a task-oriented framework for the effective integration of biomechanics and robotics methods.

The decay of motor adaptation to novel movement dynamics reveals an asymmetry in the stability of motion state-dependent learning

PubMed Central

Hosseini, Eghbal A.; Nguyen, Katrina P.; Joiner, Wilsaan M.

2017-01-01

Motor adaptation paradigms provide a quantitative method to study short-term modification of motor commands. Despite the growing understanding of the role motion states (e.g., velocity) play in this form of motor learning, there is little information on the relative stability of memories based on these movement characteristics, especially in comparison to the initial adaptation. Here, we trained subjects to make reaching movements perturbed by force patterns dependent upon either limb position or velocity. Following training, subjects were exposed to a series of error-clamp trials to measure the temporal characteristics of the feedforward motor output during the decay of learning. The compensatory force patterns were largely based on the perturbation kinematic (e.g., velocity), but also showed a small contribution from the other motion kinematic (e.g., position). However, the velocity contribution in response to the position-based perturbation decayed at a slower rate than the position contribution to velocity-based training, suggesting a difference in stability. Next, we modified a previous model of motor adaptation to reflect this difference and simulated the behavior for different learning goals. We were interested in the stability of learning when the perturbations were based on different combinations of limb position or velocity that subsequently resulted in biased amounts of motion-based learning. We trained additional subjects on these combined motion-state perturbations and confirmed the predictions of the model. Specifically, we show that (1) there is a significant separation between the observed gain-space trajectories for the learning and decay of adaptation and (2) for combined motion-state perturbations, the gain associated to changes in limb position decayed at a faster rate than the velocity-dependent gain, even when the position-dependent gain at the end of training was significantly greater. Collectively, these results suggest that the state-dependent adaptation associated with movement velocity is relatively more stable than that based on position. PMID:28481891

Ultrasound fusion image error correction using subject-specific liver motion model and automatic image registration.

PubMed

Yang, Minglei; Ding, Hui; Zhu, Lei; Wang, Guangzhi

2016-12-01

Ultrasound fusion imaging is an emerging tool and benefits a variety of clinical applications, such as image-guided diagnosis and treatment of hepatocellular carcinoma and unresectable liver metastases. However, respiratory liver motion-induced misalignment of multimodal images (i.e., fusion error) compromises the effectiveness and practicability of this method. The purpose of this paper is to develop a subject-specific liver motion model and automatic registration-based method to correct the fusion error. An online-built subject-specific motion model and automatic image registration method for 2D ultrasound-3D magnetic resonance (MR) images were combined to compensate for the respiratory liver motion. The key steps included: 1) Build a subject-specific liver motion model for current subject online and perform the initial registration of pre-acquired 3D MR and intra-operative ultrasound images; 2) During fusion imaging, compensate for liver motion first using the motion model, and then using an automatic registration method to further correct the respiratory fusion error. Evaluation experiments were conducted on liver phantom and five subjects. In the phantom study, the fusion error (superior-inferior axis) was reduced from 13.90±2.38mm to 4.26±0.78mm by using the motion model only. The fusion error further decreased to 0.63±0.53mm by using the registration method. The registration method also decreased the rotation error from 7.06±0.21° to 1.18±0.66°. In the clinical study, the fusion error was reduced from 12.90±9.58mm to 6.12±2.90mm by using the motion model alone. Moreover, the fusion error decreased to 1.96±0.33mm by using the registration method. The proposed method can effectively correct the respiration-induced fusion error to improve the fusion image quality. This method can also reduce the error correction dependency on the initial registration of ultrasound and MR images. Overall, the proposed method can improve the clinical practicability of ultrasound fusion imaging. Copyright © 2016 Elsevier Ltd. All rights reserved.

Equations of motion of a space station with emphasis on the effects of the gravity gradient

NASA Technical Reports Server (NTRS)

Tuell, L. P.

1987-01-01

The derivation of the equations of motion is based upon the principle of virtual work. As developed, these equations apply only to a space vehicle whose physical model consists of a rigid central carrier supporting several flexible appendages (not interconnected), smaller rigid bodies, and point masses. Clearly evident in the equations is the respect paid to the influence of the Earth's gravity field, considerably more than has been the custom in simulating vehicle motion. The effect of unpredictable crew motion is ignored.

Nucleic acid binding drugs. Part XIII. Molecular motion in a drug-nucleic acid model system: thermal motion analysis of a proflavine-dinucleoside crystal structure.

PubMed Central

Aggarwal, A K; Neidle, S

1985-01-01

The high-resolution crystal structure of the intercalation complex between proflavine and cytidylyl-3',5'-guanosine (CpG) has been studied by thermalmotion analysis. This has provided information on the translational and librational motions of individual groups in the complex. Many of these motions are similar to, though of larger magnitude than in uncomplexed dinucleosides. Pronounced librational effects were observed along the base pairs and in the plane of the drug chromophore. PMID:4034394

The average motion of a charged particle in a dipole field

NASA Technical Reports Server (NTRS)

Chen, A. J.; Stern, D. P.

1974-01-01

The numerical representation of the average motion of a charged particle trapped in a geomagnetic field is developed. An assumption is made of the conservation of the first two adiabatic invariants where integration is along a field line between mirror points. The averaged motion also involved the parameters defining the magnetic field line to which the particle is attached. Methods involved in obtaining the motion in the equatorial plane of model magnetospheres are based on Hamiltonian functions. The restrictions imposed by the special nature of the dipole field are defined.

Individualistic weight perception from motion on a slope

PubMed Central

Zintus-art, K.; Shin, D.; Kambara, H.; Yoshimura, N.; Koike, Y.

2016-01-01

Perception of an object’s weight is linked to its form and motion. Studies have shown the relationship between weight perception and motion in horizontal and vertical environments to be universally identical across subjects during passive observation. Here we show a contradicting finding in that not all humans share the same motion-weight pairing. A virtual environment where participants control the steepness of a slope was used to investigate the relationship between sliding motion and weight perception. Our findings showed that distinct, albeit subjective, motion-weight relationships in perception could be identified for slope environments. These individualistic perceptions were found when changes in environmental parameters governing motion were introduced, specifically inclination and surface texture. Differences in environmental parameters, combined with individual factors such as experience, affected participants’ weight perception. This phenomenon may offer evidence of the central nervous system’s ability to choose and combine internal models based on information from the sensory system. The results also point toward the possibility of controlling human perception by presenting strong sensory cues to manipulate the mechanisms managing internal models. PMID:27174036

A Possible Role for End-Stopped V1 Neurons in the Perception of Motion: A Computational Model

PubMed Central

Zarei Eskikand, Parvin; Kameneva, Tatiana; Ibbotson, Michael R.; Burkitt, Anthony N.; Grayden, David B.

2016-01-01

We present a model of the early stages of processing in the visual cortex, in particular V1 and MT, to investigate the potential role of end-stopped V1 neurons in solving the aperture problem. A hierarchical network is used in which the incoming motion signals provided by complex V1 neurons and end-stopped V1 neurons proceed to MT neurons at the next stage. MT neurons are categorized into two types based on their function: integration and segmentation. The role of integration neurons is to propagate unambiguous motion signals arriving from those V1 neurons that emphasize object terminators (e.g. corners). Segmentation neurons detect the discontinuities in the input stimulus to control the activity of integration neurons. Although the activity of the complex V1 neurons at the terminators of the object accurately represents the direction of the motion, their level of activity is less than the activity of the neurons along the edges. Therefore, a model incorporating end-stopped neurons is essential to suppress ambiguous motion signals along the edges of the stimulus. It is shown that the unambiguous motion signals at terminators propagate over the rest of the object to achieve an accurate representation of motion. PMID:27741307

Methodology for estimating human perception to tremors in high-rise buildings

NASA Astrophysics Data System (ADS)

Du, Wenqi; Goh, Key Seng; Pan, Tso-Chien

2017-07-01

Human perception to tremors during earthquakes in high-rise buildings is usually associated with psychological discomfort such as fear and anxiety. This paper presents a methodology for estimating the level of perception to tremors for occupants living in high-rise buildings subjected to ground motion excitations. Unlike other approaches based on empirical or historical data, the proposed methodology performs a regression analysis using the analytical results of two generic models of 15 and 30 stories. The recorded ground motions in Singapore are collected and modified for structural response analyses. Simple predictive models are then developed to estimate the perception level to tremors based on a proposed ground motion intensity parameter—the average response spectrum intensity in the period range between 0.1 and 2.0 s. These models can be used to predict the percentage of occupants in high-rise buildings who may perceive the tremors at a given ground motion intensity. Furthermore, the models are validated with two recent tremor events reportedly felt in Singapore. It is found that the estimated results match reasonably well with the reports in the local newspapers and from the authorities. The proposed methodology is applicable to urban regions where people living in high-rise buildings might feel tremors during earthquakes.

Anthropometry-corrected exposure modeling as a method to improve trunk posture assessment with a single inclinometer.

PubMed

Van Driel, Robin; Trask, Catherine; Johnson, Peter W; Callaghan, Jack P; Koehoorn, Mieke; Teschke, Kay

2013-01-01

Measuring trunk posture in the workplace commonly involves subjective observation or self-report methods or the use of costly and time-consuming motion analysis systems (current gold standard). This work compared trunk inclination measurements using a simple data-logging inclinometer with trunk flexion measurements using a motion analysis system, and evaluated adding measures of subject anthropometry to exposure prediction models to improve the agreement between the two methods. Simulated lifting tasks (n=36) were performed by eight participants, and trunk postures were simultaneously measured with each method. There were significant differences between the two methods, with the inclinometer initially explaining 47% of the variance in the motion analysis measurements. However, adding one key anthropometric parameter (lower arm length) to the inclinometer-based trunk flexion prediction model reduced the differences between the two systems and accounted for 79% of the motion analysis method's variance. Although caution must be applied when generalizing lower-arm length as a correction factor, the overall strategy of anthropometric modeling is a novel contribution. In this lifting-based study, by accounting for subject anthropometry, a single, simple data-logging inclinometer shows promise for trunk posture measurement and may have utility in larger-scale field studies where similar types of tasks are performed.

Sustained High Basal Motion of the Greenland Ice Sheet Revealed by Borehole Deformation

NASA Technical Reports Server (NTRS)

Ryser, Claudia; Luthi, Martin P.; Andrews, Lauren C.; Hoffman, Matthew, J.; Catania, Ginny A.; Hawley, Robert L.; Neumann, Thomas A.; Kristensen, Steen S.

2014-01-01

Ice deformation and basal motion characterize the dynamical behavior of the Greenland ice sheet (GrIS). We evaluate the contribution of basal motion from ice deformation measurements in boreholes drilled to the bed at two sites in the western marginal zone of the GrIS. We find a sustained high amount of basal motion contribution to surface velocity of 44-73 percent in winter, and up to 90 percent in summer. Measured ice deformation rates show an unexpected variation with depth that can be explained with the help of an ice-flow model as a consequence of stress transfer from slippery to sticky areas. This effect necessitates the use of high-order ice-flow models, not only in regions of fast-flowing ice streams but in all temperate-based areas of the GrIS. The agreement between modeled and measured deformation rates confirms that the recommended values of the temperature-dependent flow rate factor A are a good choice for ice-sheet models.

An Integrated, Optimization-Based Approach to the Design and Control of Large Space Structures.

DTIC Science & Technology

1984-05-01

investigator.s shall use a nonlinear beam model for the large motions, and they shall use a linear beam model to describe the small displacements as a... use a nonlinear beam model for the large motions, and we shall use a linear beam model to describe the small displacements as a perturbation around the...of the angular velocity, wt as follows 0 = 0 - 0 (2. ) -01 G,𔃼 - f- 0. The use of a quaternion avoids singularities which are often encountered in

Modeling the Benchmark Active Control Technology Wind-Tunnel Model for Active Control Design Applications

NASA Technical Reports Server (NTRS)

Waszak, Martin R.

1998-01-01

This report describes the formulation of a model of the dynamic behavior of the Benchmark Active Controls Technology (BACT) wind tunnel model for active control design and analysis applications. The model is formed by combining the equations of motion for the BACT wind tunnel model with actuator models and a model of wind tunnel turbulence. The primary focus of this report is the development of the equations of motion from first principles by using Lagrange's equations and the principle of virtual work. A numerical form of the model is generated by making use of parameters obtained from both experiment and analysis. Comparisons between experimental and analytical data obtained from the numerical model show excellent agreement and suggest that simple coefficient-based aerodynamics are sufficient to accurately characterize the aeroelastic response of the BACT wind tunnel model. The equations of motion developed herein have been used to aid in the design and analysis of a number of flutter suppression controllers that have been successfully implemented.

Modelling vortex-induced fluid-structure interaction.

PubMed

Benaroya, Haym; Gabbai, Rene D

2008-04-13

The principal goal of this research is developing physics-based, reduced-order, analytical models of nonlinear fluid-structure interactions associated with offshore structures. Our primary focus is to generalize the Hamilton's variational framework so that systems of flow-oscillator equations can be derived from first principles. This is an extension of earlier work that led to a single energy equation describing the fluid-structure interaction. It is demonstrated here that flow-oscillator models are a subclass of the general, physical-based framework. A flow-oscillator model is a reduced-order mechanical model, generally comprising two mechanical oscillators, one modelling the structural oscillation and the other a nonlinear oscillator representing the fluid behaviour coupled to the structural motion.Reduced-order analytical model development continues to be carried out using a Hamilton's principle-based variational approach. This provides flexibility in the long run for generalizing the modelling paradigm to complex, three-dimensional problems with multiple degrees of freedom, although such extension is very difficult. As both experimental and analytical capabilities advance, the critical research path to developing and implementing fluid-structure interaction models entails-formulating generalized equations of motion, as a superset of the flow-oscillator models; and-developing experimentally derived, semi-analytical functions to describe key terms in the governing equations of motion. The developed variational approach yields a system of governing equations. This will allow modelling of multiple d.f. systems. The extensions derived generalize the Hamilton's variational formulation for such problems. The Navier-Stokes equations are derived and coupled to the structural oscillator. This general model has been shown to be a superset of the flow-oscillator model. Based on different assumptions, one can derive a variety of flow-oscillator models.

Real-Time Tracking by Double Templates Matching Based on Timed Motion History Image with HSV Feature

PubMed Central

Li, Zhiyong; Li, Pengfei; Yu, Xiaoping; Hashem, Mervat

2014-01-01

It is a challenge to represent the target appearance model for moving object tracking under complex environment. This study presents a novel method with appearance model described by double templates based on timed motion history image with HSV color histogram feature (tMHI-HSV). The main components include offline template and online template initialization, tMHI-HSV-based candidate patches feature histograms calculation, double templates matching (DTM) for object location, and templates updating. Firstly, we initialize the target object region and calculate its HSV color histogram feature as offline template and online template. Secondly, the tMHI-HSV is used to segment the motion region and calculate these candidate object patches' color histograms to represent their appearance models. Finally, we utilize the DTM method to trace the target and update the offline template and online template real-timely. The experimental results show that the proposed method can efficiently handle the scale variation and pose change of the rigid and nonrigid objects, even in illumination change and occlusion visual environment. PMID:24592185

The Application of Leap Motion in Astronaut Virtual Training

NASA Astrophysics Data System (ADS)

Qingchao, Xie; Jiangang, Chao

2017-03-01

With the development of computer vision, virtual reality has been applied in astronaut virtual training. As an advanced optic equipment to track hand, Leap Motion can provide precise and fluid tracking of hands. Leap Motion is suitable to be used as gesture input device in astronaut virtual training. This paper built an astronaut virtual training based Leap Motion, and established the mathematics model of hands occlusion. At last the ability of Leap Motion to handle occlusion was analysed. A virtual assembly simulation platform was developed for astronaut training, and occlusion gesture would influence the recognition process. The experimental result can guide astronaut virtual training.

Robust estimation of carotid artery wall motion using the elasticity-based state-space approach.

PubMed

Gao, Zhifan; Xiong, Huahua; Liu, Xin; Zhang, Heye; Ghista, Dhanjoo; Wu, Wanqing; Li, Shuo

2017-04-01

The dynamics of the carotid artery wall has been recognized as a valuable indicator to evaluate the status of atherosclerotic disease in the preclinical stage. However, it is still a challenge to accurately measure this dynamics from ultrasound images. This paper aims at developing an elasticity-based state-space approach for accurately measuring the two-dimensional motion of the carotid artery wall from the ultrasound imaging sequences. In our approach, we have employed a linear elasticity model of the carotid artery wall, and converted it into the state space equation. Then, the two-dimensional motion of carotid artery wall is computed by solving this state-space approach using the H ∞ filter and the block matching method. In addition, a parameter training strategy is proposed in this study for dealing with the parameter initialization problem. In our experiment, we have also developed an evaluation function to measure the tracking accuracy of the motion of the carotid artery wall by considering the influence of the sizes of the two blocks (acquired by our approach and the manual tracing) containing the same carotid wall tissue and their overlapping degree. Then, we have compared the performance of our approach with the manual traced results drawn by three medical physicians on 37 healthy subjects and 103 unhealthy subjects. The results have showed that our approach was highly correlated (Pearson's correlation coefficient equals 0.9897 for the radial motion and 0.9536 for the longitudinal motion), and agreed well (width the 95% confidence interval is 89.62 µm for the radial motion and 387.26 µm for the longitudinal motion) with the manual tracing method. We also compared our approach to the three kinds of previous methods, including conventional block matching methods, Kalman-based block matching methods and the optical flow. Altogether, we have been able to successfully demonstrate the efficacy of our elasticity-model based state-space approach (EBS) for more accurate tracking of the 2-dimensional motion of the carotid artery wall, towards more effective assessment of the status of atherosclerotic disease in the preclinical stage. Copyright © 2017 Elsevier B.V. All rights reserved.

A Hybrid Ground-Motion Prediction Equation for Earthquakes in Western Alberta

NASA Astrophysics Data System (ADS)

Spriggs, N.; Yenier, E.; Law, A.; Moores, A. O.

2015-12-01

Estimation of ground-motion amplitudes that may be produced by future earthquakes constitutes the foundation of seismic hazard assessment and earthquake-resistant structural design. This is typically done by using a prediction equation that quantifies amplitudes as a function of key seismological variables such as magnitude, distance and site condition. In this study, we develop a hybrid empirical prediction equation for earthquakes in western Alberta, where evaluation of seismic hazard associated with induced seismicity is of particular interest. We use peak ground motions and response spectra from recorded seismic events to model the regional source and attenuation attributes. The available empirical data is limited in the magnitude range of engineering interest (M>4). Therefore, we combine empirical data with a simulation-based model in order to obtain seismologically informed predictions for moderate-to-large magnitude events. The methodology is two-fold. First, we investigate the shape of geometrical spreading in Alberta. We supplement the seismic data with ground motions obtained from mining/quarry blasts, in order to gain insights into the regional attenuation over a wide distance range. A comparison of ground-motion amplitudes for earthquakes and mining/quarry blasts show that both event types decay at similar rates with distance and demonstrate a significant Moho-bounce effect. In the second stage, we calibrate the source and attenuation parameters of a simulation-based prediction equation to match the available amplitude data from seismic events. We model the geometrical spreading using a trilinear function with attenuation rates obtained from the first stage, and calculate coefficients of anelastic attenuation and site amplification via regression analysis. This provides a hybrid ground-motion prediction equation that is calibrated for observed motions in western Alberta and is applicable to moderate-to-large magnitude events.

Individual Pause-and-Go Motion Is Instrumental to the Formation and Maintenance of Swarms of Marching Locust Nymphs

PubMed Central

Ariel, Gil; Ophir, Yotam; Levi, Sagi; Ben-Jacob, Eshel; Ayali, Amir

2014-01-01

The principal interactions leading to the emergence of order in swarms of marching locust nymphs was studied both experimentally, using small groups of marching locusts in the lab, and using computer simulations. We utilized a custom tracking algorithm to reveal fundamental animal-animal interactions leading to collective motion. Uncovering this behavior introduced a new agent-based modeling approach in which pause-and-go motion is pivotal. The behavioral and modeling findings are largely based on motion-related visual sensory inputs obtained by the individual locust. Results suggest a generic principle, in which intermittent animal motion can be considered as a sequence of individual decisions as animals repeatedly reassess their situation and decide whether or not to swarm. This interpretation implies, among other things, some generic characteristics regarding the build-up and emergence of collective order in swarms: in particular, that order and disorder are generic meta-stable states of the system, suggesting that the emergence of order is kinetic and does not necessarily require external environmental changes. This work calls for further experimental as well as theoretical investigation of the neural mechanisms underlying locust coordinative behavior. PMID:24988464

Expressive facial animation synthesis by learning speech coarticulation and expression spaces.

PubMed

Deng, Zhigang; Neumann, Ulrich; Lewis, J P; Kim, Tae-Yong; Bulut, Murtaza; Narayanan, Shrikanth

2006-01-01

Synthesizing expressive facial animation is a very challenging topic within the graphics community. In this paper, we present an expressive facial animation synthesis system enabled by automated learning from facial motion capture data. Accurate 3D motions of the markers on the face of a human subject are captured while he/she recites a predesigned corpus, with specific spoken and visual expressions. We present a novel motion capture mining technique that "learns" speech coarticulation models for diphones and triphones from the recorded data. A Phoneme-Independent Expression Eigenspace (PIEES) that encloses the dynamic expression signals is constructed by motion signal processing (phoneme-based time-warping and subtraction) and Principal Component Analysis (PCA) reduction. New expressive facial animations are synthesized as follows: First, the learned coarticulation models are concatenated to synthesize neutral visual speech according to novel speech input, then a texture-synthesis-based approach is used to generate a novel dynamic expression signal from the PIEES model, and finally the synthesized expression signal is blended with the synthesized neutral visual speech to create the final expressive facial animation. Our experiments demonstrate that the system can effectively synthesize realistic expressive facial animation.

Al-Bitrūjī's theory of the motions of the fixed stars

NASA Astrophysics Data System (ADS)

Mancha, J. L.

2004-01-01

The problem which this paper deals with is the following: were the homocentric models of Eudoxus alluded to by Aristotle (Metaphysics, xii.8) preserved in al-Bitrūjī's Kitab fi'l-hay'a, as argued by Kennedy in his reviews of Carmody's edition of Scot's Latin version and Goldstein's English translation based on the Arabic and Hebrew versions of the work - or, as asserted by Goldstein, was the essence of al-Bitrūjī's reform to place Ptolemaic models on the surface of a sphere, influenced by the tradition of the trepidation theory and especially by Ibn al-Zarqallu's contributions, without knowledge whatever of Eudoxus? To answer this question, this paper presents an analysis and new translation of the second chapter of al-Bitrūjī's work, devoted to the motion of the stars, based on the two extant Latin versions. From them it follows that the model described in this chapter is indeed a Eudoxan couple, whose hippopede accounts for the motions of the stars: in al-Bitrūjī's words, a true motion in declination and another, merely apparent, in accession and recession.

A GPU-accelerated cortical neural network model for visually guided robot navigation.

PubMed

Beyeler, Michael; Oros, Nicolas; Dutt, Nikil; Krichmar, Jeffrey L

2015-12-01

Humans and other terrestrial animals use vision to traverse novel cluttered environments with apparent ease. On one hand, although much is known about the behavioral dynamics of steering in humans, it remains unclear how relevant perceptual variables might be represented in the brain. On the other hand, although a wealth of data exists about the neural circuitry that is concerned with the perception of self-motion variables such as the current direction of travel, little research has been devoted to investigating how this neural circuitry may relate to active steering control. Here we present a cortical neural network model for visually guided navigation that has been embodied on a physical robot exploring a real-world environment. The model includes a rate based motion energy model for area V1, and a spiking neural network model for cortical area MT. The model generates a cortical representation of optic flow, determines the position of objects based on motion discontinuities, and combines these signals with the representation of a goal location to produce motor commands that successfully steer the robot around obstacles toward the goal. The model produces robot trajectories that closely match human behavioral data. This study demonstrates how neural signals in a model of cortical area MT might provide sufficient motion information to steer a physical robot on human-like paths around obstacles in a real-world environment, and exemplifies the importance of embodiment, as behavior is deeply coupled not only with the underlying model of brain function, but also with the anatomical constraints of the physical body it controls. Copyright © 2015 Elsevier Ltd. All rights reserved.

The model for Fundamentals of Endovascular Surgery (FEVS) successfully defines the competent endovascular surgeon.

PubMed

Duran, Cassidy; Estrada, Sean; O'Malley, Marcia; Sheahan, Malachi G; Shames, Murray L; Lee, Jason T; Bismuth, Jean

2015-12-01

Fundamental skills testing is now required for certification in general surgery. No model for assessing fundamental endovascular skills exists. Our objective was to develop a model that tests the fundamental endovascular skills and differentiates competent from noncompetent performance. The Fundamentals of Endovascular Surgery model was developed in silicon and virtual-reality versions. Twenty individuals (with a range of experience) performed four tasks on each model in three separate sessions. Tasks on the silicon model were performed under fluoroscopic guidance, and electromagnetic tracking captured motion metrics for catheter tip position. Image processing captured tool tip position and motion on the virtual model. Performance was evaluated using a global rating scale, blinded video assessment of error metrics, and catheter tip movement and position. Motion analysis was based on derivations of speed and position that define proficiency of movement (spectral arc length, duration of submovement, and number of submovements). Performance was significantly different between competent and noncompetent interventionalists for the three performance measures of motion metrics, error metrics, and global rating scale. The mean error metric score was 6.83 for noncompetent individuals and 2.51 for the competent group (P < .0001). Median global rating scores were 2.25 for the noncompetent group and 4.75 for the competent users (P < .0001). The Fundamentals of Endovascular Surgery model successfully differentiates competent and noncompetent performance of fundamental endovascular skills based on a series of objective performance measures. This model could serve as a platform for skills testing for all trainees. Copyright © 2015 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

Real-time prediction and gating of respiratory motion using an extended Kalman filter and Gaussian process regression

NASA Astrophysics Data System (ADS)

Bukhari, W.; Hong, S.-M.

2015-01-01

Motion-adaptive radiotherapy aims to deliver a conformal dose to the target tumour with minimal normal tissue exposure by compensating for tumour motion in real time. The prediction as well as the gating of respiratory motion have received much attention over the last two decades for reducing the targeting error of the treatment beam due to respiratory motion. In this article, we present a real-time algorithm for predicting and gating respiratory motion that utilizes a model-based and a model-free Bayesian framework by combining them in a cascade structure. The algorithm, named EKF-GPR+, implements a gating function without pre-specifying a particular region of the patient’s breathing cycle. The algorithm first employs an extended Kalman filter (LCM-EKF) to predict the respiratory motion and then uses a model-free Gaussian process regression (GPR) to correct the error of the LCM-EKF prediction. The GPR is a non-parametric Bayesian algorithm that yields predictive variance under Gaussian assumptions. The EKF-GPR+ algorithm utilizes the predictive variance from the GPR component to capture the uncertainty in the LCM-EKF prediction error and systematically identify breathing points with a higher probability of large prediction error in advance. This identification allows us to pause the treatment beam over such instances. EKF-GPR+ implements the gating function by using simple calculations based on the predictive variance with no additional detection mechanism. A sparse approximation of the GPR algorithm is employed to realize EKF-GPR+ in real time. Extensive numerical experiments are performed based on a large database of 304 respiratory motion traces to evaluate EKF-GPR+. The experimental results show that the EKF-GPR+ algorithm effectively reduces the prediction error in a root-mean-square (RMS) sense by employing the gating function, albeit at the cost of a reduced duty cycle. As an example, EKF-GPR+ reduces the patient-wise RMS error to 37%, 39% and 42% in percent ratios relative to no prediction for a duty cycle of 80% at lookahead lengths of 192 ms, 384 ms and 576 ms, respectively. The experiments also confirm that EKF-GPR+ controls the duty cycle with reasonable accuracy.

Synthesis of High-Frequency Ground Motion Using Information Extracted from Low-Frequency Ground Motion

NASA Astrophysics Data System (ADS)

Iwaki, A.; Fujiwara, H.

2012-12-01

Broadband ground motion computations of scenario earthquakes are often based on hybrid methods that are the combinations of deterministic approach in lower frequency band and stochastic approach in higher frequency band. Typical computation methods for low-frequency and high-frequency (LF and HF, respectively) ground motions are the numerical simulations, such as finite-difference and finite-element methods based on three-dimensional velocity structure model, and the stochastic Green's function method, respectively. In such hybrid methods, LF and HF wave fields are generated through two different methods that are completely independent of each other, and are combined at the matching frequency. However, LF and HF wave fields are essentially not independent as long as they are from the same event. In this study, we focus on the relation among acceleration envelopes at different frequency bands, and attempt to synthesize HF ground motion using the information extracted from LF ground motion, aiming to propose a new method for broad-band strong motion prediction. Our study area is Kanto area, Japan. We use the K-NET and KiK-net surface acceleration data and compute RMS envelope at four frequency bands: 0.5-1.0 Hz, 1.0-2.0 Hz, 2.0-4.0 Hz, .0-8.0 Hz, and 8.0-16.0 Hz. Taking the ratio of the envelopes of adjacent bands, we find that the envelope ratios have stable shapes at each site. The empirical envelope-ratio characteristics are combined with low-frequency envelope of the target earthquake to synthesize HF ground motion. We have applied the method to M5-class earthquakes and a M7 target earthquake that occurred in the vicinity of Kanto area, and successfully reproduced the observed HF ground motion of the target earthquake. The method can be applied to a broad band ground motion simulation for a scenario earthquake by combining numerically-computed low-frequency (~1 Hz) ground motion with the empirical envelope ratio characteristics to generate broadband ground motion. The strengths of the proposed method are that: 1) it is based on observed ground motion characteristics, 2) it takes full advantage of precise velocity structure model, and 3) it is simple and easy to apply.

Development of an empirically based dynamic biomechanical strength model

NASA Technical Reports Server (NTRS)

Pandya, A.; Maida, J.; Aldridge, A.; Hasson, S.; Woolford, B.

1992-01-01

The focus here is on the development of a dynamic strength model for humans. Our model is based on empirical data. The shoulder, elbow, and wrist joints are characterized in terms of maximum isolated torque, position, and velocity in all rotational planes. This information is reduced by a least squares regression technique into a table of single variable second degree polynomial equations determining the torque as a function of position and velocity. The isolated joint torque equations are then used to compute forces resulting from a composite motion, which in this case is a ratchet wrench push and pull operation. What is presented here is a comparison of the computed or predicted results of the model with the actual measured values for the composite motion.

Evaluation of motion-correction methods for dual-gated cardiac positron emission tomography/computed tomography imaging.

PubMed

Klén, Riku; Noponen, Tommi; Koikkalainen, Juha; Lötjönen, Jyrki; Thielemans, Kris; Hoppela, Erika; Sipilä, Hannu; Teräs, Mika; Knuuti, Juhani

2016-09-01

Dual gating is a method of dividing the data of a cardiac PET scan into smaller bins according to the respiratory motion and the ECG of the patient. It reduces the undesirable motion artefacts in images, but produces several images for interpretation and decreases the quality of single images. By using motion-correction techniques, the motion artefacts in the dual-gated images can be corrected and the images can be combined into a single motion-free image with good statistics. The aim of the present study is to develop and evaluate motion-correction methods for cardiac PET studies. We have developed and compared two different methods: computed tomography (CT)/PET-based and CT-only methods. The methods were implemented and tested with a cardiac phantom and three patient datasets. In both methods, anatomical information of CT images is used to create models for the cardiac motion. In the patient study, the CT-only method reduced motion (measured as the centre of mass of the myocardium) on average 43%, increased the contrast-to-noise ratio on average 6.0% and reduced the target size on average 10%. Slightly better figures (51, 6.9 and 28%) were obtained with the CT/PET-based method. Even better results were obtained in the phantom study for both the CT-only method (57, 68 and 43%) and the CT/PET-based method (61, 74 and 52%). We conclude that using anatomical information of CT for motion correction of cardiac PET images, both respiratory and pulsatile motions can be corrected with good accuracy.

Energy-harvesting shock absorber with a mechanical motion rectifier

NASA Astrophysics Data System (ADS)

Li, Zhongjie; Zuo, Lei; Kuang, Jian; Luhrs, George

2013-02-01

Energy-harvesting shock absorbers are able to recover the energy otherwise dissipated in the suspension vibration while simultaneously suppressing the vibration induced by road roughness. They can work as a controllable damper as well as an energy generator. An innovative design of regenerative shock absorbers is proposed in this paper, with the advantage of significantly improving the energy harvesting efficiency and reducing the impact forces caused by oscillation. The key component is a unique motion mechanism, which we called ‘mechanical motion rectifier (MMR)’, to convert the oscillatory vibration into unidirectional rotation of the generator. An implementation of a MMR-based harvester with high compactness is introduced and prototyped. A dynamic model is created to analyze the general properties of the motion rectifier by making an analogy between mechanical systems and electrical circuits. The model is capable of analyzing electrical and mechanical components at the same time. Both simulation and experiments are carried out to verify the modeling and the advantages. The prototype achieved over 60% efficiency at high frequency, much better than conventional regenerative shock absorbers in oscillatory motion. Furthermore, road tests are done to demonstrate the feasibility of the MMR shock absorber, in which more than 15 Watts of electricity is harvested while driving at 15 mph on a smooth paved road. The MMR-based design can also be used for other applications of vibration energy harvesting, such as from tall buildings or long bridges.

Motion sickness in cats - A symptom rating scale used in laboratory and flight tests

NASA Technical Reports Server (NTRS)

Suri, K. B.; Daunton, N. G.; Crampton, G. H.

1979-01-01

The cat is proposed as a model for the study of motion and space sickness. Development of a scale for rating the motion sickness severity in the cat is described. The scale is used to evaluate an antimotion sickness drug, d-amphetamine plus scopolamine, and to determine whether it is possible to predict sickness susceptibility during parabolic flight, including zero-G maneuvers, from scores obtained during ground based trials.

Refraction-compensated motion tracking of unrestrained small animals in positron emission tomography.

PubMed

Kyme, Andre; Meikle, Steven; Baldock, Clive; Fulton, Roger

2012-08-01

Motion-compensated radiotracer imaging of fully conscious rodents represents an important paradigm shift for preclinical investigations. In such studies, if motion tracking is performed through a transparent enclosure containing the awake animal, light refraction at the interface will introduce errors in stereo pose estimation. We have performed a thorough investigation of how this impacts the accuracy of pose estimates and the resulting motion correction, and developed an efficient method to predict and correct for refraction-based error. The refraction model underlying this study was validated using a state-of-the-art motion tracking system. Refraction-based error was shown to be dependent on tracking marker size, working distance, and interface thickness and tilt. Correcting for refraction error improved the spatial resolution and quantitative accuracy of motion-corrected positron emission tomography images. Since the methods are general, they may also be useful in other contexts where data are corrupted by refraction effects. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

The lucky image-motion prediction for simple scene observation based soft-sensor technology

NASA Astrophysics Data System (ADS)

Li, Yan; Su, Yun; Hu, Bin

2015-08-01

High resolution is important to earth remote sensors, while the vibration of the platforms of the remote sensors is a major factor restricting high resolution imaging. The image-motion prediction and real-time compensation are key technologies to solve this problem. For the reason that the traditional autocorrelation image algorithm cannot meet the demand for the simple scene image stabilization, this paper proposes to utilize soft-sensor technology in image-motion prediction, and focus on the research of algorithm optimization in imaging image-motion prediction. Simulations results indicate that the improving lucky image-motion stabilization algorithm combining the Back Propagation Network (BP NN) and support vector machine (SVM) is the most suitable for the simple scene image stabilization. The relative error of the image-motion prediction based the soft-sensor technology is below 5%, the training computing speed of the mathematical predication model is as fast as the real-time image stabilization in aerial photography.

A neural model of the temporal dynamics of figure-ground segregation in motion perception.

PubMed

Raudies, Florian; Neumann, Heiko

2010-03-01

How does the visual system manage to segment a visual scene into surfaces and objects and manage to attend to a target object? Based on psychological and physiological investigations, it has been proposed that the perceptual organization and segmentation of a scene is achieved by the processing at different levels of the visual cortical hierarchy. According to this, motion onset detection, motion-defined shape segregation, and target selection are accomplished by processes which bind together simple features into fragments of increasingly complex configurations at different levels in the processing hierarchy. As an alternative to this hierarchical processing hypothesis, it has been proposed that the processing stages for feature detection and segregation are reflected in different temporal episodes in the response patterns of individual neurons. Such temporal epochs have been observed in the activation pattern of neurons as low as in area V1. Here, we present a neural network model of motion detection, figure-ground segregation and attentive selection which explains these response patterns in an unifying framework. Based on known principles of functional architecture of the visual cortex, we propose that initial motion and motion boundaries are detected at different and hierarchically organized stages in the dorsal pathway. Visual shapes that are defined by boundaries, which were generated from juxtaposed opponent motions, are represented at different stages in the ventral pathway. Model areas in the different pathways interact through feedforward and modulating feedback, while mutual interactions enable the communication between motion and form representations. Selective attention is devoted to shape representations by sending modulating feedback signals from higher levels (working memory) to intermediate levels to enhance their responses. Areas in the motion and form pathway are coupled through top-down feedback with V1 cells at the bottom end of the hierarchy. We propose that the different temporal episodes in the response pattern of V1 cells, as recorded in recent experiments, reflect the strength of modulating feedback signals. This feedback results from the consolidated shape representations from coherent motion patterns and the attentive modulation of responses along the cortical hierarchy. The model makes testable predictions concerning the duration and delay of the temporal episodes of V1 cell responses as well as their response variations that were caused by modulating feedback signals. Copyright 2009 Elsevier Ltd. All rights reserved.

A singularity free analytical solution of artificial satellite motion with drag

NASA Technical Reports Server (NTRS)

Mueller, A.

1978-01-01

An analytical satellite theory based on the regular, canonical Poincare-Similar (PS phi) elements is described along with an accurate density model which can be implemented into the drag theory. A computationally efficient manner in which to expand the equations of motion into a fourier series is discussed.

Dimensionality of Motion and Binding Valency Govern Receptor-Ligand Kinetics As Revealed by Agent-Based Modeling.

PubMed

Lehnert, Teresa; Figge, Marc Thilo

2017-01-01

Mathematical modeling and computer simulations have become an integral part of modern biological research. The strength of theoretical approaches is in the simplification of complex biological systems. We here consider the general problem of receptor-ligand binding in the context of antibody-antigen binding. On the one hand, we establish a quantitative mapping between macroscopic binding rates of a deterministic differential equation model and their microscopic equivalents as obtained from simulating the spatiotemporal binding kinetics by stochastic agent-based models. On the other hand, we investigate the impact of various properties of B cell-derived receptors-such as their dimensionality of motion, morphology, and binding valency-on the receptor-ligand binding kinetics. To this end, we implemented an algorithm that simulates antigen binding by B cell-derived receptors with a Y-shaped morphology that can move in different dimensionalities, i.e., either as membrane-anchored receptors or as soluble receptors. The mapping of the macroscopic and microscopic binding rates allowed us to quantitatively compare different agent-based model variants for the different types of B cell-derived receptors. Our results indicate that the dimensionality of motion governs the binding kinetics and that this predominant impact is quantitatively compensated by the bivalency of these receptors.

Simulating patient-specific heart shape and motion using SPECT perfusion images with the MCAT phantom

NASA Astrophysics Data System (ADS)

Faber, Tracy L.; Garcia, Ernest V.; Lalush, David S.; Segars, W. Paul; Tsui, Benjamin M.

2001-05-01

The spline-based Mathematical Cardiac Torso (MCAT) phantom is a realistic software simulation designed to simulate single photon emission computed tomographic (SPECT) data. It incorporates a heart model of known size and shape; thus, it is invaluable for measuring accuracy of acquisition, reconstruction, and post-processing routines. New functionality has been added by replacing the standard heart model with left ventricular (LV) epicaridal and endocardial surface points detected from actual patient SPECT perfusion studies. LV surfaces detected from standard post-processing quantitation programs are converted through interpolation in space and time into new B-spline models. Perfusion abnormalities are added to the model based on results of standard perfusion quantification. The new LV is translated and rotated to fit within existing atria and right ventricular models, which are scaled based on the size of the LV. Simulations were created for five different patients with myocardial infractions who had undergone SPECT perfusion imaging. Shape, size, and motion of the resulting activity map were compared visually to the original SPECT images. In all cases, size, shape and motion of simulated LVs matched well with the original images. Thus, realistic simulations with known physiologic and functional parameters can be created for evaluating efficacy of processing algorithms.

Dimensionality of Motion and Binding Valency Govern Receptor–Ligand Kinetics As Revealed by Agent-Based Modeling

PubMed Central

Lehnert, Teresa; Figge, Marc Thilo

2017-01-01

Mathematical modeling and computer simulations have become an integral part of modern biological research. The strength of theoretical approaches is in the simplification of complex biological systems. We here consider the general problem of receptor–ligand binding in the context of antibody–antigen binding. On the one hand, we establish a quantitative mapping between macroscopic binding rates of a deterministic differential equation model and their microscopic equivalents as obtained from simulating the spatiotemporal binding kinetics by stochastic agent-based models. On the other hand, we investigate the impact of various properties of B cell-derived receptors—such as their dimensionality of motion, morphology, and binding valency—on the receptor–ligand binding kinetics. To this end, we implemented an algorithm that simulates antigen binding by B cell-derived receptors with a Y-shaped morphology that can move in different dimensionalities, i.e., either as membrane-anchored receptors or as soluble receptors. The mapping of the macroscopic and microscopic binding rates allowed us to quantitatively compare different agent-based model variants for the different types of B cell-derived receptors. Our results indicate that the dimensionality of motion governs the binding kinetics and that this predominant impact is quantitatively compensated by the bivalency of these receptors. PMID:29250071

Four-Dimensional Dose Reconstruction for Scanned Proton Therapy Using Liver 4DCT-MRI

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bernatowicz, Kinga, E-mail: kinga.bernatowicz@psi.ch; Proton Therapy Center, Paul Scherrer Institute, PSI Villigen; Peroni, Marta

Purpose: Four-dimensional computed tomography-magnetic resonance imaging (4DCT-MRI) is an image-processing technique for simulating many 4DCT data sets from a static reference CT and motions extracted from 4DMRI studies performed using either volunteers or patients. In this work, different motion extraction approaches were tested using 6 liver cases, and a detailed comparison between 4DCT-MRI and 4DCT was performed. Methods and Materials: 4DCT-MRI has been generated using 2 approaches. The first approach used motion extracted from 4DMRI as being “most similar” to that of 4DCT from the same patient (subject-specific), and the second approach used the most similar motion obtained from amore » motion library derived from 4DMRI liver studies of 13 healthy volunteers (population-based). The resulting 4DCT-MRI and 4DCTs were compared using scanned proton 4D dose calculations (4DDC). Results: Dosimetric analysis showed that 93% ± 8% of points inside the clinical target volume (CTV) agreed between 4DCT and subject-specific 4DCT-MRI (gamma analysis: 3%/3 mm). The population-based approach however showed lower dosimetric agreement with only 79% ± 14% points in the CTV reaching the 3%/3 mm criteria. Conclusions: 4D CT-MRI extends the capabilities of motion modeling for dose calculations by accounting for realistic and variable motion patterns, which can be directly employed in clinical research studies. We have found that the subject-specific liver modeling appears more accurate than the population-based approach. The former is particularly interesting for clinical applications, such as improved target delineation and 4D dose reconstruction for patient-specific QA to allow for inter- and/or intra-fractional plan corrections.« less

Generation of fluoroscopic 3D images with a respiratory motion model based on an external surrogate signal

NASA Astrophysics Data System (ADS)

Hurwitz, Martina; Williams, Christopher L.; Mishra, Pankaj; Rottmann, Joerg; Dhou, Salam; Wagar, Matthew; Mannarino, Edward G.; Mak, Raymond H.; Lewis, John H.

2015-01-01

Respiratory motion during radiotherapy can cause uncertainties in definition of the target volume and in estimation of the dose delivered to the target and healthy tissue. In this paper, we generate volumetric images of the internal patient anatomy during treatment using only the motion of a surrogate signal. Pre-treatment four-dimensional CT imaging is used to create a patient-specific model correlating internal respiratory motion with the trajectory of an external surrogate placed on the chest. The performance of this model is assessed with digital and physical phantoms reproducing measured irregular patient breathing patterns. Ten patient breathing patterns are incorporated in a digital phantom. For each patient breathing pattern, the model is used to generate images over the course of thirty seconds. The tumor position predicted by the model is compared to ground truth information from the digital phantom. Over the ten patient breathing patterns, the average absolute error in the tumor centroid position predicted by the motion model is 1.4 mm. The corresponding error for one patient breathing pattern implemented in an anthropomorphic physical phantom was 0.6 mm. The global voxel intensity error was used to compare the full image to the ground truth and demonstrates good agreement between predicted and true images. The model also generates accurate predictions for breathing patterns with irregular phases or amplitudes.

Modeling and simulation of dynamics of a planar-motion rigid body with friction and surface contact

NASA Astrophysics Data System (ADS)

Wang, Xiaojun; Lv, Jing

2017-07-01

The modeling and numerical method for the dynamics of a planar-motion rigid body with frictional contact between plane surfaces were presented based on the theory of contact mechanics and the algorithm of linear complementarity problem (LCP). The Coulomb’s dry friction model is adopted as the friction law, and the normal contact forces are expressed as functions of the local deformations and their speeds in contact bodies. The dynamic equations of the rigid body are obtained by the Lagrange equation. The transition problem of stick-slip motions between contact surfaces is formulated and solved as LCP through establishing the complementary conditions of the friction law. Finally, a numerical example is presented as an example to show the application.

Numerical simulation of artificial hip joint motion based on human age factor

NASA Astrophysics Data System (ADS)

Ramdhani, Safarudin; Saputra, Eko; Jamari, J.

2018-05-01

Artificial hip joint is a prosthesis (synthetic body part) which usually consists of two or more components. Replacement of the hip joint due to the occurrence of arthritis, ordinarily patients aged or older. Numerical simulation models are used to observe the range of motion in the artificial hip joint, the range of motion of joints used as the basis of human age. Finite- element analysis (FEA) is used to calculate stress von mises in motion and observes a probability of prosthetic impingement. FEA uses a three-dimensional nonlinear model and considers the position variation of acetabular liner cups. The result of numerical simulation shows that FEA method can be used to analyze the performance calculation of the artificial hip joint at this time more accurate than conventional method.

An orbital emulator for pursuit-evasion game theoretic sensor management

NASA Astrophysics Data System (ADS)

Shen, Dan; Wang, Tao; Wang, Gang; Jia, Bin; Wang, Zhonghai; Chen, Genshe; Blasch, Erik; Pham, Khanh

2017-05-01

This paper develops and evaluates an orbital emulator (OE) for space situational awareness (SSA). The OE can produce 3D satellite movements using capabilities generated from omni-wheeled robot and robotic arm motion methods. The 3D motion of a satellite is partitioned into the movements in the equatorial plane and the up-down motions in the vertical plane. The 3D actions are emulated by omni-wheeled robot models while the up-down motions are performed by a stepped-motor-controlled-ball along a rod (robotic arm), which is attached to the robot. For multiple satellites, a fast map-merging algorithm is integrated into the robot operating system (ROS) and simultaneous localization and mapping (SLAM) routines to locate the multiple robots in the scene. The OE is used to demonstrate a pursuit-evasion (PE) game theoretic sensor management algorithm, which models conflicts between a space-based-visible (SBV) satellite (as pursuer) and a geosynchronous (GEO) satellite (as evader). The cost function of the PE game is based on the informational entropy of the SBV-tracking-GEO scenario. GEO can maneuver using a continuous and low thruster. The hard-in-loop space emulator visually illustrates the SSA problem solution based PE game.

Constrained motion model of mobile robots and its applications.

PubMed

Zhang, Fei; Xi, Yugeng; Lin, Zongli; Chen, Weidong

2009-06-01

Target detecting and dynamic coverage are fundamental tasks in mobile robotics and represent two important features of mobile robots: mobility and perceptivity. This paper establishes the constrained motion model and sensor model of a mobile robot to represent these two features and defines the k -step reachable region to describe the states that the robot may reach. We show that the calculation of the k-step reachable region can be reduced from that of 2(k) reachable regions with the fixed motion styles to k + 1 such regions and provide an algorithm for its calculation. Based on the constrained motion model and the k -step reachable region, the problems associated with target detecting and dynamic coverage are formulated and solved. For target detecting, the k-step detectable region is used to describe the area that the robot may detect, and an algorithm for detecting a target and planning the optimal path is proposed. For dynamic coverage, the k-step detected region is used to represent the area that the robot has detected during its motion, and the dynamic-coverage strategy and algorithm are proposed. Simulation results demonstrate the efficiency of the coverage algorithm in both convex and concave environments.

Magnetic Resonance Imaging–Guided versus Surrogate-Based Motion Tracking in Liver Radiation Therapy: A Prospective Comparative Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paganelli, Chiara, E-mail: chiara.paganelli@polimi.it; Seregni, Matteo; Fattori, Giovanni

Purpose: This study applied automatic feature detection on cine–magnetic resonance imaging (MRI) liver images in order to provide a prospective comparison between MRI-guided and surrogate-based tracking methods for motion-compensated liver radiation therapy. Methods and Materials: In a population of 30 subjects (5 volunteers plus 25 patients), 2 oblique sagittal slices were acquired across the liver at high temporal resolution. An algorithm based on scale invariant feature transform (SIFT) was used to extract and track multiple features throughout the image sequence. The position of abdominal markers was also measured directly from the image series, and the internal motion of each featuremore » was quantified through multiparametric analysis. Surrogate-based tumor tracking with a state-of-the-art external/internal correlation model was simulated. The geometrical tracking error was measured, and its correlation with external motion parameters was also investigated. Finally, the potential gain in tracking accuracy relying on MRI guidance was quantified as a function of the maximum allowed tracking error. Results: An average of 45 features was extracted for each subject across the whole liver. The multi-parametric motion analysis reported relevant inter- and intrasubject variability, highlighting the value of patient-specific and spatially-distributed measurements. Surrogate-based tracking errors (relative to the motion amplitude) were were in the range 7% to 23% (1.02-3.57mm) and were significantly influenced by external motion parameters. The gain of MRI guidance compared to surrogate-based motion tracking was larger than 30% in 50% of the subjects when considering a 1.5-mm tracking error tolerance. Conclusions: Automatic feature detection applied to cine-MRI allows detailed liver motion description to be obtained. Such information was used to quantify the performance of surrogate-based tracking methods and to provide a prospective comparison with respect to MRI-guided radiation therapy, which could support the definition of patient-specific optimal treatment strategies.« less

3-D model-based vehicle tracking.

PubMed

Lou, Jianguang; Tan, Tieniu; Hu, Weiming; Yang, Hao; Maybank, Steven J

2005-10-01

This paper aims at tracking vehicles from monocular intensity image sequences and presents an efficient and robust approach to three-dimensional (3-D) model-based vehicle tracking. Under the weak perspective assumption and the ground-plane constraint, the movements of model projection in the two-dimensional image plane can be decomposed into two motions: translation and rotation. They are the results of the corresponding movements of 3-D translation on the ground plane (GP) and rotation around the normal of the GP, which can be determined separately. A new metric based on point-to-line segment distance is proposed to evaluate the similarity between an image region and an instantiation of a 3-D vehicle model under a given pose. Based on this, we provide an efficient pose refinement method to refine the vehicle's pose parameters. An improved EKF is also proposed to track and to predict vehicle motion with a precise kinematics model. Experimental results with both indoor and outdoor data show that the algorithm obtains desirable performance even under severe occlusion and clutter.

The validation of a human force model to predict dynamic forces resulting from multi-joint motions

NASA Technical Reports Server (NTRS)

Pandya, Abhilash K.; Maida, James C.; Aldridge, Ann M.; Hasson, Scott M.; Woolford, Barbara J.

1992-01-01

The development and validation is examined of a dynamic strength model for humans. This model is based on empirical data. The shoulder, elbow, and wrist joints were characterized in terms of maximum isolated torque, or position and velocity, in all rotational planes. This data was reduced by a least squares regression technique into a table of single variable second degree polynomial equations determining torque as a function of position and velocity. The isolated joint torque equations were then used to compute forces resulting from a composite motion, in this case, a ratchet wrench push and pull operation. A comparison of the predicted results of the model with the actual measured values for the composite motion indicates that forces derived from a composite motion of joints (ratcheting) can be predicted from isolated joint measures. Calculated T values comparing model versus measured values for 14 subjects were well within the statistically acceptable limits and regression analysis revealed coefficient of variation between actual and measured to be within 0.72 and 0.80.

Automatic 3D motion estimation of left ventricle from C-arm rotational angiocardiography using a prior motion model and learning based boundary detector.

PubMed

Chen, Mingqing; Zheng, Yefeng; Wang, Yang; Mueller, Kerstin; Lauritsch, Guenter

2013-01-01

Compared to pre-operative imaging modalities, it is more convenient to estimate the current cardiac physiological status from C-arm angiocardiography since C-arm is a widely used intra-operative imaging modality to guide many cardiac interventions. The 3D shape and motion of the left ventricle (LV) estimated from rotational angiocardiography provide important cardiac function measurements, e.g., ejection fraction and myocardium motion dyssynchrony. However, automatic estimation of the 3D LV motion is difficult since all anatomical structures overlap on the 2D X-ray projections and the nearby confounding strong image boundaries (e.g., pericardium) often cause ambiguities to LV endocardium boundary detection. In this paper, a new framework is proposed to overcome the aforementioned difficulties: (1) A new learning-based boundary detector is developed by training a boosting boundary classifier combined with the principal component analysis of a local image patch; (2) The prior LV motion model is learned from a set of dynamic cardiac computed tomography (CT) sequences to provide a good initial estimate of the 3D LV shape of different cardiac phases; (3) The 3D motion trajectory is learned for each mesh point; (4) All these components are integrated into a multi-surface graph optimization method to extract the globally coherent motion. The method is tested on seven patient scans, showing significant improvement on the ambiguous boundary cases with a detection accuracy of 2.87 +/- 1.00 mm on LV endocardium boundary delineation in the 2D projections.

An Operational Model for the Prediction of Jet Blast

DOT National Transportation Integrated Search

2012-01-09

This paper presents an operational model for the prediction of jet blast. The model was : developed based upon three modules including a jet exhaust model, jet centerline decay : model and aircraft motion model. The final analysis was compared with d...

Internal Motion Estimation by Internal-external Motion Modeling for Lung Cancer Radiotherapy.

PubMed

Chen, Haibin; Zhong, Zichun; Yang, Yiwei; Chen, Jiawei; Zhou, Linghong; Zhen, Xin; Gu, Xuejun

2018-02-27

The aim of this study is to develop an internal-external correlation model for internal motion estimation for lung cancer radiotherapy. Deformation vector fields that characterize the internal-external motion are obtained by respectively registering the internal organ meshes and external surface meshes from the 4DCT images via a recently developed local topology preserved non-rigid point matching algorithm. A composite matrix is constructed by combing the estimated internal phasic DVFs with external phasic and directional DVFs. Principle component analysis is then applied to the composite matrix to extract principal motion characteristics, and generate model parameters to correlate the internal-external motion. The proposed model is evaluated on a 4D NURBS-based cardiac-torso (NCAT) synthetic phantom and 4DCT images from five lung cancer patients. For tumor tracking, the center of mass errors of the tracked tumor are 0.8(±0.5)mm/0.8(±0.4)mm for synthetic data, and 1.3(±1.0)mm/1.2(±1.2)mm for patient data in the intra-fraction/inter-fraction tracking, respectively. For lung tracking, the percent errors of the tracked contours are 0.06(±0.02)/0.07(±0.03) for synthetic data, and 0.06(±0.02)/0.06(±0.02) for patient data in the intra-fraction/inter-fraction tracking, respectively. The extensive validations have demonstrated the effectiveness and reliability of the proposed model in motion tracking for both the tumor and the lung in lung cancer radiotherapy.

Moving vehicles segmentation based on Gaussian motion model

NASA Astrophysics Data System (ADS)

Zhang, Wei; Fang, Xiang Z.; Lin, Wei Y.

2005-07-01

Moving objects segmentation is a challenge in computer vision. This paper focuses on the segmentation of moving vehicles in dynamic scene. We analyses the psychology of human vision and present a framework for segmenting moving vehicles in the highway. The proposed framework consists of two parts. Firstly, we propose an adaptive background update method in which the background is updated according to the change of illumination conditions and thus can adapt to the change of illumination sensitively. Secondly, we construct a Gaussian motion model to segment moving vehicles, in which the motion vectors of the moving pixels are modeled as a Gaussian model and an on-line EM algorithm is used to update the model. The Gaussian distribution of the adaptive model is elevated to determine which moving vectors result from moving vehicles and which from other moving objects such as waving trees. Finally, the pixels with motion vector result from the moving vehicles are segmented. Experimental results of several typical scenes show that the proposed model can detect the moving vehicles correctly and is immune from influence of the moving objects caused by the waving trees and the vibration of camera.

Numerical simulation of fluid flow through simplified blade cascade with prescribed harmonic motion using discontinuous Galerkin method

NASA Astrophysics Data System (ADS)

Vimmr, Jan; Bublík, Ondřej; Prausová, Helena; Hála, Jindřich; Pešek, Luděk

2018-06-01

This paper deals with a numerical simulation of compressible viscous fluid flow around three flat plates with prescribed harmonic motion. This arrangement presents a simplified blade cascade with forward wave motion. The aim of this simulation is to determine the aerodynamic forces acting on the flat plates. The mathematical model describing this problem is formed by Favre-averaged system of Navier-Stokes equations in arbitrary Lagrangian-Eulerian (ALE) formulation completed by one-equation Spalart-Allmaras turbulence model. The simulation was performed using the developed in-house CFD software based on discontinuous Galerkin method, which offers high order of accuracy.

Stolen Base Physics

ERIC Educational Resources Information Center

Kagan, David

2013-01-01

Few plays in baseball are as consistently close and exciting as the stolen base. While there are several studies of sprinting, the art of base stealing is much more nuanced. This article describes the motion of the base-stealing runner using a very basic kinematic model. The model will be compared to some data from a Major League game. The…

Space robots with flexible appendages: Dynamic modeling, coupling measurement, and vibration suppression

NASA Astrophysics Data System (ADS)

Meng, Deshan; Wang, Xueqian; Xu, Wenfu; Liang, Bin

2017-05-01

For a space robot with flexible appendages, vibrations of flexible structure can be easily excited during both orbit and/or attitude maneuvers of the base and the operation of the manipulators. Hence, the pose (position and attitude) of the manipulator's end-effector will greatly deviate from the desired values, and furthermore, the motion of the manipulator will trigger and exacerbate vibrations of flexible appendages. Given lack of the atmospheric damping in orbit, the vibrations will last for quite a while and cause the on-orbital tasks to fail. We derived the rigid-flexible coupling dynamics of a space robot system with flexible appendages and established a coupling model between the flexible base and the space manipulator. A specific index was defined to measure the coupling degree between the flexible motion of the appendages and the rigid motion of the end-effector. Then, we analyzed the dynamic coupling for different conditions, such as modal displacements, joint angles (manipulator configuration), and mass properties. Moreover, the coupling map was adopted and drawn to represent the coupling motion. Based on this map, a trajectory planning method was addressed to suppress structure vibration. Finally, simulation studies of typical cases were performed, which verified the proposed models and method. This work provides a theoretic basis for the system design, performance evaluation, trajectory planning, and control of such space robots.

Estimating non-circular motions in barred galaxies using numerical N-body simulations

NASA Astrophysics Data System (ADS)

Randriamampandry, T. H.; Combes, F.; Carignan, C.; Deg, N.

2015-12-01

The observed velocities of the gas in barred galaxies are a combination of the azimuthally averaged circular velocity and non-circular motions, primarily caused by gas streaming along the bar. These non-circular flows must be accounted for before the observed velocities can be used in mass modelling. In this work, we examine the performance of the tilted-ring method and the DISKFIT algorithm for transforming velocity maps of barred spiral galaxies into rotation curves (RCs) using simulated data. We find that the tilted-ring method, which does not account for streaming motions, under-/overestimates the circular motions when the bar is parallel/perpendicular to the projected major axis. DISKFIT, which does include streaming motions, is limited to orientations where the bar is not aligned with either the major or minor axis of the image. Therefore, we propose a method of correcting RCs based on numerical simulations of galaxies. We correct the RC derived from the tilted-ring method based on a numerical simulation of a galaxy with similar properties and projections as the observed galaxy. Using observations of NGC 3319, which has a bar aligned with the major axis, as a test case, we show that the inferred mass models from the uncorrected and corrected RCs are significantly different. These results show the importance of correcting for the non-circular motions and demonstrate that new methods of accounting for these motions are necessary as current methods fail for specific bar alignments.

A statistical motion model based on biomechanical simulations for data fusion during image-guided prostate interventions.

PubMed

Hu, Yipeng; Morgan, Dominic; Ahmed, Hashim Uddin; Pendsé, Doug; Sahu, Mahua; Allen, Clare; Emberton, Mark; Hawkes, David; Barratt, Dean

2008-01-01

A method is described for generating a patient-specific, statistical motion model (SMM) of the prostate gland. Finite element analysis (FEA) is used to simulate the motion of the gland using an ultrasound-based 3D FE model over a range of plausible boundary conditions and soft-tissue properties. By applying principal component analysis to the displacements of the FE mesh node points inside the gland, the simulated deformations are then used as training data to construct the SMM. The SMM is used to both predict the displacement field over the whole gland and constrain a deformable surface registration algorithm, given only a small number of target points on the surface of the deformed gland. Using 3D transrectal ultrasound images of the prostates of five patients, acquired before and after imposing a physical deformation, to evaluate the accuracy of predicted landmark displacements, the mean target registration error was found to be less than 1.9 mm.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Local respiratory motion correction for PET/CT imaging: Application to lung cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lamare, F., E-mail: frederic.lamare@chu-bordeaux.fr; Fernandez, P.; Fayad, H.

Purpose: Despite multiple methodologies already proposed to correct respiratory motion in the whole PET imaging field of view (FOV), such approaches have not found wide acceptance in clinical routine. An alternative can be the local respiratory motion correction (LRMC) of data corresponding to a given volume of interest (VOI: organ or tumor). Advantages of LRMC include the use of a simple motion model, faster execution times, and organ specific motion correction. The purpose of this study was to evaluate the performance of LMRC using various motion models for oncology (lung lesion) applications. Methods: Both simulated (NURBS based 4D cardiac-torso phantom)more » and clinical studies (six patients) were used in the evaluation of the proposed LRMC approach. PET data were acquired in list-mode and synchronized with respiration. The implemented approach consists first in defining a VOI on the reconstructed motion average image. Gated PET images of the VOI are subsequently reconstructed using only lines of response passing through the selected VOI and are used in combination with a center of gravity or an affine/elastic registration algorithm to derive the transformation maps corresponding to the respiration effects. Those are finally integrated in the reconstruction process to produce a motion free image over the lesion regions. Results: Although the center of gravity or affine algorithm achieved similar performance for individual lesion motion correction, the elastic model, applied either locally or to the whole FOV, led to an overall superior performance. The spatial tumor location was altered by 89% and 81% for the elastic model applied locally or to the whole FOV, respectively (compared to 44% and 39% for the center of gravity and affine models, respectively). This resulted in similar associated overall tumor volume changes of 84% and 80%, respectively (compared to 75% and 71% for the center of gravity and affine models, respectively). The application of the nonrigid deformation model in LRMC led to over an order of magnitude gain in computational efficiency of the correction relative to the application of the deformable model to the whole FOV. Conclusions: The results of this study support the use of LMRC as a flexible and efficient correction approach for respiratory motion effects for single lesions in the thoracic area.« less

Model-based registration of multi-rigid-body for augmented reality

NASA Astrophysics Data System (ADS)

Ikeda, Sei; Hori, Hajime; Imura, Masataka; Manabe, Yoshitsugu; Chihara, Kunihiro

2009-02-01

Geometric registration between a virtual object and the real space is the most basic problem in augmented reality. Model-based tracking methods allow us to estimate three-dimensional (3-D) position and orientation of a real object by using a textured 3-D model instead of visual marker. However, it is difficult to apply existing model-based tracking methods to the objects that have movable parts such as a display of a mobile phone, because these methods suppose a single, rigid-body model. In this research, we propose a novel model-based registration method for multi rigid-body objects. For each frame, the 3-D models of each rigid part of the object are first rendered according to estimated motion and transformation from the previous frame. Second, control points are determined by detecting the edges of the rendered image and sampling pixels on these edges. Motion and transformation are then simultaneously calculated from distances between the edges and the control points. The validity of the proposed method is demonstrated through experiments using synthetic videos.

Development of a Multiple Input Integrated Pole-to-Pole Global CMORPH

NASA Astrophysics Data System (ADS)

Joyce, R.; Xie, P.

2013-12-01

A test system is being developed at NOAA Climate Prediction Center (CPC) to produce a passive microwave (PMW), IR-based, and model integrated high-resolution precipitation estimation on a 0.05olat/lon grid covering the entire globe from pole to pole. Experiments have been conducted for a summer Test Bed period using data for July and August of 2009. The pole-to-pole global CMORPH system is built upon the Kalman Filter based CMORPH algorithm of Joyce and Xie (2011). First, retrievals of instantaneous precipitation rates from PMW observations aboard nine low earth orbit (LEO) satellites are decoded and pole-to-pole mapped onto a 0.05olat/lon grid over the globe. Also precipitation estimates from LEO AVHRR retrievals are derived using a PDF matching of LEO IR with calibrated microwave combined (MWCOMB) precipitation retrievals. The motion vectors for the precipitating cloud systems are defined using information from both satellite IR observations and precipitation fields generated by the NCEP Climate Forecast System Reanalysis (CFSR). To this end, motion vectors are first computed for the CFSR hourly precipitation fields through cross-correlation analysis of consecutive hourly precipitation fields on the global T382 (~35 km) grid. In a similar manner, separate processing is also performed on satellite IR-based precipitation estimates to derive motion vectors from observations. A blended analysis of precipitating cloud motion vectors is then constructed through the combination of CFSR and satellite-derived vectors utilizing a two-dimensional optimal interpolation (2D-OI) method, in which CFSR-derived motion vectors are used as the first guess and subsequently satellite derived vectors modify the first guess. Weights used to generate the combinations are defined under the OI framework as a function of error statistics for the CFSR and satellite IR based motion vectors. The screened and calibrated PMW and AVHRR derived precipitation estimates are then separately spatially propagated forward and backward in time, using precipitating cloud motion vectors, from their observation time to the next PMW observation. The PMW estimates propagated in both the forward and backward directions are then combined with propagated IR-based precipitation estimates under the Kalman Filter framework, with weights defined based on previously determined error statistics dependent on latitude, season, surface type, and temporal distance from observation time. Performance of the pole-to-pole global CMORPH and its key components, including combined PMW (MWCOMB), IR-based, and model precipitation, as well as model-derived, IR-based, and blended precipitation motion vectors, will be examined against NSSL Q2 radar observed precipitation estimates over CONUS, Finland FMI radar precipitation, and a daily gauge-based analysis including daily Canadian surface reports over global land. Also an initial investigation will be performed over a January - February 2010 winter Test Bed period. Detailed results will be reported at the Fall 2013 AGU Meeting.

Development of 4D mathematical observer models for the task-based evaluation of gated myocardial perfusion SPECT

NASA Astrophysics Data System (ADS)

Lee, Taek-Soo; Frey, Eric C.; Tsui, Benjamin M. W.

2015-04-01

This paper presents two 4D mathematical observer models for the detection of motion defects in 4D gated medical images. Their performance was compared with results from human observers in detecting a regional motion abnormality in simulated 4D gated myocardial perfusion (MP) SPECT images. The first 4D mathematical observer model extends the conventional channelized Hotelling observer (CHO) based on a set of 2D spatial channels and the second is a proposed model that uses a set of 4D space-time channels. Simulated projection data were generated using the 4D NURBS-based cardiac-torso (NCAT) phantom with 16 gates/cardiac cycle. The activity distribution modelled uptake of 99mTc MIBI with normal perfusion and a regional wall motion defect. An analytical projector was used in the simulation and the filtered backprojection (FBP) algorithm was used in image reconstruction followed by spatial and temporal low-pass filtering with various cut-off frequencies. Then, we extracted 2D image slices from each time frame and reorganized them into a set of cine images. For the first model, we applied 2D spatial channels to the cine images and generated a set of feature vectors that were stacked for the images from different slices of the heart. The process was repeated for each of the 1,024 noise realizations, and CHO and receiver operating characteristics (ROC) analysis methodologies were applied to the ensemble of the feature vectors to compute areas under the ROC curves (AUCs). For the second model, a set of 4D space-time channels was developed and applied to the sets of cine images to produce space-time feature vectors to which the CHO methodology was applied. The AUC values of the second model showed better agreement (Spearman’s rank correlation (SRC) coefficient = 0.8) to human observer results than those from the first model (SRC coefficient = 0.4). The agreement with human observers indicates the proposed 4D mathematical observer model provides a good predictor of the performance of human observers in detecting regional motion defects in 4D gated MP SPECT images. The result supports the use of the observer model in the optimization and evaluation of 4D image reconstruction and compensation methods for improving the detection of motion abnormalities in 4D gated MP SPECT images.

New ShakeMaps for Georgia Resulting from Collaboration with EMME

NASA Astrophysics Data System (ADS)

Kvavadze, N.; Tsereteli, N. S.; Varazanashvili, O.; Alania, V.

2015-12-01

Correct assessment of probabilistic seismic hazard and risks maps are first step for advance planning and action to reduce seismic risk. Seismic hazard maps for Georgia were calculated based on modern approach that was developed in the frame of EMME (Earthquake Modl for Middle east region) project. EMME was one of GEM's successful endeavors at regional level. With EMME and GEM assistance, regional models were analyzed to identify the information and additional work needed for the preparation national hazard models. Probabilistic seismic hazard map (PSH) provides the critical bases for improved building code and construction. The most serious deficiency in PSH assessment for the territory of Georgia is the lack of high-quality ground motion data. Due to this an initial hybrid empirical ground motion model is developed for PGA and SA at selected periods. An application of these coefficients for ground motion models have been used in probabilistic seismic hazard assessment. Obtained results of seismic hazard maps show evidence that there were gaps in seismic hazard assessment and the present normative seismic hazard map needed a careful recalculation.

Investigation and Development of Control Laws for the NASA Langley Research Center Cockpit Motion Facility

NASA Technical Reports Server (NTRS)

Coon, Craig R.; Cardullo, Frank M.; Zaychik, Kirill B.

2014-01-01

The ability to develop highly advanced simulators is a critical need that has the ability to significantly impact the aerospace industry. The aerospace industry is advancing at an ever increasing pace and flight simulators must match this development with ever increasing urgency. In order to address both current problems and potential advancements with flight simulator techniques, several aspects of current control law technology of the National Aeronautics and Space Administration (NASA) Langley Research Center's Cockpit Motion Facility (CMF) motion base simulator were examined. Preliminary investigation of linear models based upon hardware data were examined to ensure that the most accurate models are used. This research identified both system improvements in the bandwidth and more reliable linear models. Advancements in the compensator design were developed and verified through multiple techniques. The position error rate feedback, the acceleration feedback and the force feedback were all analyzed in the heave direction using the nonlinear model of the hardware. Improvements were made using the position error rate feedback technique. The acceleration feedback compensator also provided noteworthy improvement, while attempts at implementing a force feedback compensator proved unsuccessful.

Motion Driven by Strain Gradient Fields

PubMed Central

Wang, Chao; Chen, Shaohua

2015-01-01

A new driving mechanism for direction-controlled motion of nano-scale objects is proposed, based on a model of stretching a graphene strip linked to a rigid base with linear springs of identical stiffness. We find that the potential energy difference induced by the strain gradient field in the graphene strip substrate can generate sufficient force to overcome the static and kinetic friction forces between the nano-flake and the strip substrate, resulting in the nanoscale flake motion in the direction of gradient reduction. The dynamics of the nano-flake can be manipulated by tuning the stiffness of linear springs, stretching velocity and the flake size. This fundamental law of directional motion induced by strain gradient could be very useful for promising designs of nanoscale manipulation, transportation and smart surfaces. PMID:26323603

Mode extraction on wind turbine blades via phase-based video motion estimation

NASA Astrophysics Data System (ADS)

Sarrafi, Aral; Poozesh, Peyman; Niezrecki, Christopher; Mao, Zhu

2017-04-01

In recent years, image processing techniques are being applied more often for structural dynamics identification, characterization, and structural health monitoring. Although as a non-contact and full-field measurement method, image processing still has a long way to go to outperform other conventional sensing instruments (i.e. accelerometers, strain gauges, laser vibrometers, etc.,). However, the technologies associated with image processing are developing rapidly and gaining more attention in a variety of engineering applications including structural dynamics identification and modal analysis. Among numerous motion estimation and image-processing methods, phase-based video motion estimation is considered as one of the most efficient methods regarding computation consumption and noise robustness. In this paper, phase-based video motion estimation is adopted for structural dynamics characterization on a 2.3-meter long Skystream wind turbine blade, and the modal parameters (natural frequencies, operating deflection shapes) are extracted. Phase-based video processing adopted in this paper provides reliable full-field 2-D motion information, which is beneficial for manufacturing certification and model updating at the design stage. The phase-based video motion estimation approach is demonstrated through processing data on a full-scale commercial structure (i.e. a wind turbine blade) with complex geometry and properties, and the results obtained have a good correlation with the modal parameters extracted from accelerometer measurements, especially for the first four bending modes, which have significant importance in blade characterization.

Estimating unknown input parameters when implementing the NGA ground-motion prediction equations in engineering practice

USGS Publications Warehouse

Kaklamanos, James; Baise, Laurie G.; Boore, David M.

2011-01-01

The ground-motion prediction equations (GMPEs) developed as part of the Next Generation Attenuation of Ground Motions (NGA-West) project in 2008 are becoming widely used in seismic hazard analyses. However, these new models are considerably more complicated than previous GMPEs, and they require several more input parameters. When employing the NGA models, users routinely face situations in which some of the required input parameters are unknown. In this paper, we present a framework for estimating the unknown source, path, and site parameters when implementing the NGA models in engineering practice, and we derive geometrically-based equations relating the three distance measures found in the NGA models. Our intent is for the content of this paper not only to make the NGA models more accessible, but also to help with the implementation of other present or future GMPEs.

Double-Windows-Based Motion Recognition in Multi-Floor Buildings Assisted by a Built-In Barometer.

PubMed

Liu, Maolin; Li, Huaiyu; Wang, Yuan; Li, Fei; Chen, Xiuwan

2018-04-01

Accelerometers, gyroscopes and magnetometers in smartphones are often used to recognize human motions. Since it is difficult to distinguish between vertical motions and horizontal motions in the data provided by these built-in sensors, the vertical motion recognition accuracy is relatively low. The emergence of a built-in barometer in smartphones improves the accuracy of motion recognition in the vertical direction. However, there is a lack of quantitative analysis and modelling of the barometer signals, which is the basis of barometer's application to motion recognition, and a problem of imbalanced data also exists. This work focuses on using the barometers inside smartphones for vertical motion recognition in multi-floor buildings through modelling and feature extraction of pressure signals. A novel double-windows pressure feature extraction method, which adopts two sliding time windows of different length, is proposed to balance recognition accuracy and response time. Then, a random forest classifier correlation rule is further designed to weaken the impact of imbalanced data on recognition accuracy. The results demonstrate that the recognition accuracy can reach 95.05% when pressure features and the improved random forest classifier are adopted. Specifically, the recognition accuracy of the stair and elevator motions is significantly improved with enhanced response time. The proposed approach proves effective and accurate, providing a robust strategy for increasing accuracy of vertical motions.

A Bayesian model of stereopsis depth and motion direction discrimination.

PubMed

Read, J C A

2002-02-01

The extraction of stereoscopic depth from retinal disparity, and motion direction from two-frame kinematograms, requires the solution of a correspondence problem. In previous psychophysical work [Read and Eagle (2000) Vision Res 40: 3345-3358], we compared the performance of the human stereopsis and motion systems with correlated and anti-correlated stimuli. We found that, although the two systems performed similarly for narrow-band stimuli, broadband anti-correlated kinematograms produced a strong perception of reversed motion, whereas the stereograms appeared merely rivalrous. I now model these psychophysical data with a computational model of the correspondence problem based on the known properties of visual cortical cells. Noisy retinal images are filtered through a set of Fourier channels tuned to different spatial frequencies and orientations. Within each channel, a Bayesian analysis incorporating a prior preference for small disparities is used to assess the probability of each possible match. Finally, information from the different channels is combined to arrive at a judgement of stimulus disparity. Each model system--stereopsis and motion--has two free parameters: the amount of noise they are subject to, and the strength of their preference for small disparities. By adjusting these parameters independently for each system, qualitative matches are produced to psychophysical data, for both correlated and anti-correlated stimuli, across a range of spatial frequency and orientation bandwidths. The motion model is found to require much higher noise levels and a weaker preference for small disparities. This makes the motion model more tolerant of poor-quality reverse-direction false matches encountered with anti-correlated stimuli, matching the strong perception of reversed motion that humans experience with these stimuli. In contrast, the lower noise level and tighter prior preference used with the stereopsis model means that it performs close to chance with anti-correlated stimuli, in accordance with human psychophysics. Thus, the key features of the experimental data can be reproduced assuming that the motion system experiences more effective noise than the stereoscopy system and imposes a less stringent preference for small disparities.

Running and rotating: modelling the dynamics of migrating cell clusters

NASA Astrophysics Data System (ADS)

Copenhagen, Katherine; Gov, Nir; Gopinathan, Ajay

Collective motion of cells is a common occurrence in many biological systems, including tissue development and repair, and tumor formation. Recent experiments have shown cells form clusters in a chemical gradient, which display three different phases of motion: translational, rotational, and random. We present a model for cell clusters based loosely on other models seen in the literature that involves a Vicsek-like alignment as well as physical collisions and adhesions between cells. With this model we show that a mechanism for driving rotational motion in this kind of system is an increased motility of rim cells. Further, we examine the details of the relationship between rim and core cells, and find that the phases of the cluster as a whole are correlated with the creation and annihilation of topological defects in the tangential component of the velocity field.

Digital anthropomorphic phantoms of non-rigid human respiratory and voluntary body motion for investigating motion correction in emission imaging

NASA Astrophysics Data System (ADS)

Könik, Arda; Connolly, Caitlin M.; Johnson, Karen L.; Dasari, Paul; Segars, Paul W.; Pretorius, P. H.; Lindsay, Clifford; Dey, Joyoni; King, Michael A.

2014-07-01

The development of methods for correcting patient motion in emission tomography has been receiving increased attention. Often the performance of these methods is evaluated through simulations using digital anthropomorphic phantoms, such as the commonly used extended cardiac torso (XCAT) phantom, which models both respiratory and cardiac motion based on human studies. However, non-rigid body motion, which is frequently seen in clinical studies, is not present in the standard XCAT phantom. In addition, respiratory motion in the standard phantom is limited to a single generic trend. In this work, to obtain a more realistic representation of motion, we developed a series of individual-specific XCAT phantoms, modeling non-rigid respiratory and non-rigid body motions derived from the magnetic resonance imaging (MRI) acquisitions of volunteers. Acquisitions were performed in the sagittal orientation using the Navigator methodology. Baseline (no motion) acquisitions at end-expiration were obtained at the beginning of each imaging session for each volunteer. For the body motion studies, MRI was again acquired only at end-expiration for five body motion poses (shoulder stretch, shoulder twist, lateral bend, side roll, and axial slide). For the respiratory motion studies, an MRI was acquired during free/regular breathing. The magnetic resonance slices were then retrospectively sorted into 14 amplitude-binned respiratory states, end-expiration, end-inspiration, six intermediary states during inspiration, and six during expiration using the recorded Navigator signal. XCAT phantoms were then generated based on these MRI data by interactive alignment of the organ contours of the XCAT with the MRI slices using a graphical user interface. Thus far we have created five body motion and five respiratory motion XCAT phantoms from the MRI acquisitions of six healthy volunteers (three males and three females). Non-rigid motion exhibited by the volunteers was reflected in both respiratory and body motion phantoms with a varying extent and character for each individual. In addition to these phantoms, we recorded the position of markers placed on the chest of the volunteers for the body motion studies, which could be used as external motion measurement. Using these phantoms and external motion data, investigators will be able to test their motion correction approaches for realistic motion obtained from different individuals. The non-uniform rational B-spline data and the parameter files for these phantoms are freely available for downloading and can be used with the XCAT license.

A research on the postural stability of a person wearing the lower limb exoskeletal robot by the HAT model.

PubMed

Chang, Minsu; Kim, Yeongmin; Lee, Yoseph; Jeon, Doyoung

2017-07-01

This paper proposes a method of detecting the postural stability of a person wearing the lower limb exoskeletal robot with the HAT(Head-Arm-Trunk) model. Previous studies have shown that the human posture is stable when the CoM(Center of Mass) of the human body is placed on the BoS(Base of Support). In the case of the lower limb exoskeletal robot, the motion data, which are used for the CoM estimation, are acquired by sensors in the robot. The upper body, however, does not have sensors in each segment so that it may cause the error of the CoM estimation. In this paper, the HAT(Head-Arm-Trunk) model which combines head, arms, and torso into a single segment is considered because the motion of head and arms are unknown due to the lack of sensors. To verify the feasibility of HAT model, the reflecting markers are attached to each segment of the whole human body and the exact motion data are acquired by the VICON to compare the COM of the full body model and HAT model. The difference between the CoM with full body and that with HAT model is within 20mm for the various motions of head and arms. Based on the HAT model, the XCoM(Extrapolated Center of Mass) which includes the velocity of the CoM is used for prediction of the postural stability. The experiment of making unstable posture shows that the XCoM of the whole body based on the HAT model is feasible to detect the instance of postural instability earlier than the CoM by 20-250 msec. This result may be used for the lower limb exoskeletal robot to prepare for any action to prevent the falling down.

Stolen Base Physics

NASA Astrophysics Data System (ADS)

Kagan, David

2013-05-01

Few plays in baseball are as consistently close and exciting as the stolen base. While there are several studies of sprinting,2-4 the art of base stealing is much more nuanced. This article describes the motion of the base-stealing runner using a very basic kinematic model. The model will be compared to some data from a Major League game. The predictions of the model show consistency with the skills needed for effective base stealing.

A system for learning statistical motion patterns.

PubMed

Hu, Weiming; Xiao, Xuejuan; Fu, Zhouyu; Xie, Dan; Tan, Tieniu; Maybank, Steve

2006-09-01

Analysis of motion patterns is an effective approach for anomaly detection and behavior prediction. Current approaches for the analysis of motion patterns depend on known scenes, where objects move in predefined ways. It is highly desirable to automatically construct object motion patterns which reflect the knowledge of the scene. In this paper, we present a system for automatically learning motion patterns for anomaly detection and behavior prediction based on a proposed algorithm for robustly tracking multiple objects. In the tracking algorithm, foreground pixels are clustered using a fast accurate fuzzy K-means algorithm. Growing and prediction of the cluster centroids of foreground pixels ensure that each cluster centroid is associated with a moving object in the scene. In the algorithm for learning motion patterns, trajectories are clustered hierarchically using spatial and temporal information and then each motion pattern is represented with a chain of Gaussian distributions. Based on the learned statistical motion patterns, statistical methods are used to detect anomalies and predict behaviors. Our system is tested using image sequences acquired, respectively, from a crowded real traffic scene and a model traffic scene. Experimental results show the robustness of the tracking algorithm, the efficiency of the algorithm for learning motion patterns, and the encouraging performance of algorithms for anomaly detection and behavior prediction.

Reference equations of motion for automatic rendezvous and capture

NASA Technical Reports Server (NTRS)

Henderson, David M.

1992-01-01

The analysis presented in this paper defines the reference coordinate frames, equations of motion, and control parameters necessary to model the relative motion and attitude of spacecraft in close proximity with another space system during the Automatic Rendezvous and Capture phase of an on-orbit operation. The relative docking port target position vector and the attitude control matrix are defined based upon an arbitrary spacecraft design. These translation and rotation control parameters could be used to drive the error signal input to the vehicle flight control system. Measurements for these control parameters would become the bases for an autopilot or feedback control system (FCS) design for a specific spacecraft.

Brownian motion of boomerang colloidal particles.

PubMed

Chakrabarty, Ayan; Konya, Andrew; Wang, Feng; Selinger, Jonathan V; Sun, Kai; Wei, Qi-Huo

2013-10-18

We investigate the Brownian motion of boomerang colloidal particles confined between two glass plates. Our experimental observations show that the mean displacements are biased towards the center of hydrodynamic stress (CoH), and that the mean-square displacements exhibit a crossover from short-time faster to long-time slower diffusion with the short-time diffusion coefficients dependent on the points used for tracking. A model based on Langevin theory elucidates that these behaviors are ascribed to the superposition of two diffusive modes: the ellipsoidal motion of the CoH and the rotational motion of the tracking point with respect to the CoH.

Brownian Motion of Boomerang Colloidal Particles

NASA Astrophysics Data System (ADS)

Chakrabarty, Ayan; Konya, Andrew; Wang, Feng; Selinger, Jonathan V.; Sun, Kai; Wei, Qi-Huo

2013-10-01

We investigate the Brownian motion of boomerang colloidal particles confined between two glass plates. Our experimental observations show that the mean displacements are biased towards the center of hydrodynamic stress (CoH), and that the mean-square displacements exhibit a crossover from short-time faster to long-time slower diffusion with the short-time diffusion coefficients dependent on the points used for tracking. A model based on Langevin theory elucidates that these behaviors are ascribed to the superposition of two diffusive modes: the ellipsoidal motion of the CoH and the rotational motion of the tracking point with respect to the CoH.

Reports on crustal movements and deformations

NASA Technical Reports Server (NTRS)

Cohen, S. C.; Peck, T.

1981-01-01

Studies of tectonic plate motions, regional crustal deformations, strain accumulation and release, deformations associated with earthquakes and fault motion, and micro-plate motion, were collected and are summarized. To a limited extent, papers dealing with global models of current plate motions and crustal stress are included. The data base is restricted to articles appearing in reveiwed technical journals during the years 1970-1980. The major journals searched include: Journal of Geophysical Research (solid earth), Tectonophysics, Bulletin of the Seismological Society of America, Geological Society of America Bulletin, Geophysical Journal of the Royal Astronomical Society, and the Journal of Geology.

Qualitative and quantitative descriptions of glenohumeral motion.

PubMed

Hill, A M; Bull, A M J; Wallace, A L; Johnson, G R

2008-02-01

Joint modelling plays an important role in qualitative and quantitative descriptions of both normal and abnormal joints, as well as predicting outcomes of alterations to joints in orthopaedic practice and research. Contemporary efforts in modelling have focussed upon the major articulations of the lower limb. Well-constrained arthrokinematics can form the basis of manageable kinetic and dynamic mathematical predictions. In order to contain computation of shoulder complex modelling, glenohumeral joint representations in both limited and complete shoulder girdle models have undergone a generic simplification. As such, glenohumeral joint models are often based upon kinematic descriptions of inadequate degrees of freedom (DOF) for clinical purposes and applications. Qualitative descriptions of glenohumeral motion range from the parody of a hinge joint to the complex realism of a spatial joint. In developing a model, a clear idea of intention is required in order to achieve a required application. Clinical applicability of a model requires both descriptive and predictive output potentials, and as such, a high level of validation is required. Without sufficient appreciation of the clinical intention of the arthrokinematic foundation to a model, error is all too easily introduced. Mathematical description of joint motion serves to quantify all relevant clinical parameters. Commonly, both the Euler angle and helical (screw) axis methods have been applied to the glenohumeral joint, although concordance between these methods and classical anatomical appreciation of joint motion is limited, resulting in miscommunication between clinician and engineer. Compounding these inconsistencies in motion quantification is gimbal lock and sequence dependency.

Lateral motion stability of high-temperature superconducting maglev systems derived from a nonlinear guidance force hysteretic model

NASA Astrophysics Data System (ADS)

Li, Haitao; Deng, Zigang; Jin, Li’an; Li, Jipeng; Li, Yanxing; Zheng, Jun

2018-07-01

High-temperature superconducting (HTS) maglev, owning to the capability of passive stabilization, is potentially promising for high-speed transportation. The guidance force of bulk HTS materials above a permanent magnetic guideway has a nonlinear response due to the hysteresis effect. As a kind of rail transit, when the vehicle runs along the track, the curve and other disturbances will cause vibrations to the vehicle system. These physical factors will pose dynamic loads on the components, reducing structural reliability as well as affecting the ride comfort. The lateral motion, as an important part of the vehicle system dynamics, needs to be studied in the pursuit of HTS maglev realization. In this paper, we first measured the guidance forces of HTS bulks under different motion conditions, and analyzed the relationship between the lateral displacement, the movement velocity and the guidance force. Then, a mathematical model was built based on these experimental data. The key feature of this mathematical model is that it can describe the hysteresis characteristic of the guidance force. Based on this model, we investigated the lateral motion stability of the HTS levitation system, and found three singular points, one stable focus point, and two unstable saddle points. Lastly, a phase portrait was proposed to indicate the safe working region of the HTS maglev vehicle where the vehicle can automatically return to its equilibrium position. These experimental and simulation results are important to clarify the lateral motion stability under external disturbance or shock, and provide a reference basis for the design of levitation systems.

Motion-base simulator results of advanced supersonic transport handling qualities with active controls

NASA Technical Reports Server (NTRS)

Feather, J. B.; Joshi, D. S.

1981-01-01

Handling qualities of the unaugmented advanced supersonic transport (AST) are deficient in the low-speed, landing approach regime. Consequently, improvement in handling with active control augmentation systems has been achieved using implicit model-following techniques. Extensive fixed-based simulator evaluations were used to validate these systems prior to tests with full motion and visual capabilities on a six-axis motion-base simulator (MBS). These tests compared the handling qualities of the unaugmented AST with several augmented configurations to ascertain the effectiveness of these systems. Cooper-Harper ratings, tracking errors, and control activity data from the MBS tests have been analyzed statistically. The results show the fully augmented AST handling qualities have been improved to an acceptable level.

A Soft Sensor-Based Three-Dimensional (3-D) Finger Motion Measurement System

PubMed Central

Park, Wookeun; Ro, Kyongkwan; Kim, Suin; Bae, Joonbum

2017-01-01

In this study, a soft sensor-based three-dimensional (3-D) finger motion measurement system is proposed. The sensors, made of the soft material Ecoflex, comprise embedded microchannels filled with a conductive liquid metal (EGaln). The superior elasticity, light weight, and sensitivity of soft sensors allows them to be embedded in environments in which conventional sensors cannot. Complicated finger joints, such as the carpometacarpal (CMC) joint of the thumb are modeled to specify the location of the sensors. Algorithms to decouple the signals from soft sensors are proposed to extract the pure flexion, extension, abduction, and adduction joint angles. The performance of the proposed system and algorithms are verified by comparison with a camera-based motion capture system. PMID:28241414

Vision-Based UAV Flight Control and Obstacle Avoidance

DTIC Science & Technology

2006-01-01

denoted it by Vb = (Vb1, Vb2 , Vb3). Fig. 2 shows the block diagram of the proposed vision-based motion analysis and obstacle avoidance system. We denote...structure analysis often involve computation- intensive computer vision tasks, such as feature extraction and geometric modeling. Computation-intensive...First, we extract a set of features from each block. 2) Second, we compute the distance between these two sets of features. In conventional motion

A review of flight simulation techniques

NASA Astrophysics Data System (ADS)

Baarspul, Max

After a brief historical review of the evolution of flight simulation techniques, this paper first deals with the main areas of flight simulator applications. Next, it describes the main components of a piloted flight simulator. Because of the presence of the pilot-in-the-loop, the digital computer driving the simulator must solve the aircraft equations of motion in ‘real-time’. Solutions to meet the high required computer power of todays modern flight simulator are elaborated. The physical similarity between aircraft and simulator in cockpit layout, flight instruments, flying controls etc., is discussed, based on the equipment and environmental cue fidelity required for training and research simulators. Visual systems play an increasingly important role in piloted flight simulation. The visual systems now available and most widely used are described, where image generators and display devices will be distinguished. The characteristics of out-of-the-window visual simulation systems pertaining to the perceptual capabilities of human vision are discussed. Faithful reproduction of aircraft motion requires large travel, velocity and acceleration capabilities of the motion system. Different types and applications of motion systems in e.g. airline training and research are described. The principles of motion cue generation, based on the characteristics of the non-visual human motion sensors, are described. The complete motion system, consisting of the hardware and the motion drive software, is discussed. The principles of mathematical modelling of the aerodynamic, flight control, propulsion, landing gear and environmental characteristics of the aircraft are reviewed. An example of the identification of an aircraft mathematical model, based on flight and taxi tests, is presented. Finally, the paper deals with the hardware and software integration of the flight simulator components and the testing and acceptance of the complete flight simulator. Examples of the so-called ‘Computer Generated Checkout’ and ‘Proof of Match’ are presented. The concluding remarks briefly summarize the status of flight simulator technology and consider possibilities for future research.

Different motion cues are used to estimate time-to-arrival for frontoparallel and looming trajectories

PubMed Central

Calabro, Finnegan J.; Beardsley, Scott A.; Vaina, Lucia M.

2012-01-01

Estimation of time-to-arrival for moving objects is critical to obstacle interception and avoidance, as well as to timing actions such as reaching and grasping moving objects. The source of motion information that conveys arrival time varies with the trajectory of the object raising the question of whether multiple context-dependent mechanisms are involved in this computation. To address this question we conducted a series of psychophysical studies to measure observers’ performance on time-to-arrival estimation when object trajectory was specified by angular motion (“gap closure” trajectories in the frontoparallel plane), looming (colliding trajectories, TTC) or both (passage courses, TTP). We measured performance of time-to-arrival judgments in the presence of irrelevant motion, in which a perpendicular motion vector was added to the object trajectory. Data were compared to models of expected performance based on the use of different components of optical information. Our results demonstrate that for gap closure, performance depended only on the angular motion, whereas for TTC and TTP, both angular and looming motion affected performance. This dissociation of inputs suggests that gap closures are mediated by a separate mechanism than that used for the detection of time-to-collision and time-to-passage. We show that existing models of TTC and TTP estimation make systematic errors in predicting subject performance, and suggest that a model which weights motion cues by their relative time-to-arrival provides a better account of performance. PMID:22056519

Climate-driven seasonal geocenter motion during the GRACE period

NASA Astrophysics Data System (ADS)

Zhang, Hongyue; Sun, Yu

2018-03-01

Annual cycles in the geocenter motion time series are primarily driven by mass changes in the Earth's hydrologic system, which includes land hydrology, atmosphere, and oceans. Seasonal variations of the geocenter motion have been reliably determined according to Sun et al. (J Geophys Res Solid Earth 121(11):8352-8370, 2016) by combining the Gravity Recovery And Climate Experiment (GRACE) data with an ocean model output. In this study, we reconstructed the observed seasonal geocenter motion with geophysical model predictions of mass variations in the polar ice sheets, continental glaciers, terrestrial water storage (TWS), and atmosphere and dynamic ocean (AO). The reconstructed geocenter motion time series is shown to be in close agreement with the solution based on GRACE data supporting with an ocean bottom pressure model. Over 85% of the observed geocenter motion time series, variance can be explained by the reconstructed solution, which allows a further investigation of the driving mechanisms. We then demonstrated that AO component accounts for 54, 62, and 25% of the observed geocenter motion variances in the X, Y, and Z directions, respectively. The TWS component alone explains 42, 32, and 39% of the observed variances. The net mass changes over oceans together with self-attraction and loading effects also contribute significantly (about 30%) to the seasonal geocenter motion in the X and Z directions. Other contributing sources, on the other hand, have marginal (less than 10%) impact on the seasonal variations but introduce a linear trend in the time series.

Motion coherence affects human perception and pursuit similarly.

PubMed

Beutter, B R; Stone, L S

2000-01-01

Pursuit and perception both require accurate information about the motion of objects. Recovering the motion of objects by integrating the motion of their components is a difficult visual task. Successful integration produces coherent global object motion, while a failure to integrate leaves the incoherent local motions of the components unlinked. We compared the ability of perception and pursuit to perform motion integration by measuring direction judgments and the concomitant eye-movement responses to line-figure parallelograms moving behind stationary rectangular apertures. The apertures were constructed such that only the line segments corresponding to the parallelogram's sides were visible; thus, recovering global motion required the integration of the local segment motion. We investigated several potential motion-integration rules by using stimuli with different object, vector-average, and line-segment terminator-motion directions. We used an oculometric decision rule to directly compare direction discrimination for pursuit and perception. For visible apertures, the percept was a coherent object, and both the pursuit and perceptual performance were close to the object-motion prediction. For invisible apertures, the percept was incoherently moving segments, and both the pursuit and perceptual performance were close to the terminator-motion prediction. Furthermore, both psychometric and oculometric direction thresholds were much higher for invisible apertures than for visible apertures. We constructed a model in which both perception and pursuit are driven by a shared motion-processing stage, with perception having an additional input from an independent static-processing stage. Model simulations were consistent with our perceptual and oculomotor data. Based on these results, we propose the use of pursuit as an objective and continuous measure of perceptual coherence. Our results support the view that pursuit and perception share a common motion-integration stage, perhaps within areas MT or MST.

Motion coherence affects human perception and pursuit similarly

NASA Technical Reports Server (NTRS)

Beutter, B. R.; Stone, L. S.

2000-01-01

Pursuit and perception both require accurate information about the motion of objects. Recovering the motion of objects by integrating the motion of their components is a difficult visual task. Successful integration produces coherent global object motion, while a failure to integrate leaves the incoherent local motions of the components unlinked. We compared the ability of perception and pursuit to perform motion integration by measuring direction judgments and the concomitant eye-movement responses to line-figure parallelograms moving behind stationary rectangular apertures. The apertures were constructed such that only the line segments corresponding to the parallelogram's sides were visible; thus, recovering global motion required the integration of the local segment motion. We investigated several potential motion-integration rules by using stimuli with different object, vector-average, and line-segment terminator-motion directions. We used an oculometric decision rule to directly compare direction discrimination for pursuit and perception. For visible apertures, the percept was a coherent object, and both the pursuit and perceptual performance were close to the object-motion prediction. For invisible apertures, the percept was incoherently moving segments, and both the pursuit and perceptual performance were close to the terminator-motion prediction. Furthermore, both psychometric and oculometric direction thresholds were much higher for invisible apertures than for visible apertures. We constructed a model in which both perception and pursuit are driven by a shared motion-processing stage, with perception having an additional input from an independent static-processing stage. Model simulations were consistent with our perceptual and oculomotor data. Based on these results, we propose the use of pursuit as an objective and continuous measure of perceptual coherence. Our results support the view that pursuit and perception share a common motion-integration stage, perhaps within areas MT or MST.

Physiology of motion sickness symptoms

NASA Technical Reports Server (NTRS)

Harm, Deborah L.

1990-01-01

Motion sickness research is reviewed with the emphasis placed on theories developed to explain its symptomatology. A general review of central nervous system, autonomic nervous system, and neuroendocrine system involvement in the syndrome. Particular attention is given to signs, symptoms, and physiological correlates, methodological issues, and directions for future research based on a dynamic interactive systems model.

Gravity Compensation Method for Combined Accelerometer and Gyro Sensors Used in Cardiac Motion Measurements.

PubMed

Krogh, Magnus Reinsfelt; Nghiem, Giang M; Halvorsen, Per Steinar; Elle, Ole Jakob; Grymyr, Ole-Johannes; Hoff, Lars; Remme, Espen W

2017-05-01

A miniaturized accelerometer fixed to the heart can be used for monitoring of cardiac function. However, an accelerometer cannot differentiate between acceleration caused by motion and acceleration due to gravity. The accuracy of motion measurements is therefore dependent on how well the gravity component can be estimated and filtered from the measured signal. In this study we propose a new method for estimating the gravity, based on strapdown inertial navigation, using a combined accelerometer and gyro. The gyro was used to estimate the orientation of the gravity field and thereby remove it. We compared this method with two previously proposed gravity filtering methods in three experimental models using: (1) in silico computer simulated heart motion; (2) robot mimicked heart motion; and (3) in vivo measured motion on the heart in an animal model. The new method correlated excellently with the reference (r 2  > 0.93) and had a deviation from reference peak systolic displacement (6.3 ± 3.9 mm) below 0.2 ± 0.5 mm for the robot experiment model. The new method performed significantly better than the two previously proposed methods (p < 0.001). The results show that the proposed method using gyro can measure cardiac motion with high accuracy and performs better than existing methods for filtering the gravity component from the accelerometer signal.

Feature-Based Attention in Early Vision for the Modulation of Figure–Ground Segregation

PubMed Central

Wagatsuma, Nobuhiko; Oki, Megumi; Sakai, Ko

2013-01-01

We investigated psychophysically whether feature-based attention modulates the perception of figure–ground (F–G) segregation and, based on the results, we investigated computationally the neural mechanisms underlying attention modulation. In the psychophysical experiments, the attention of participants was drawn to a specific motion direction and they were then asked to judge the side of figure in an ambiguous figure with surfaces consisting of distinct motion directions. The results of these experiments showed that the surface consisting of the attended direction of motion was more frequently observed as figure, with a degree comparable to that of spatial attention (Wagatsuma et al., 2008). These experiments also showed that perception was dependent on the distribution of feature contrast, specifically the motion direction differences. These results led us to hypothesize that feature-based attention functions in a framework similar to that of spatial attention. We proposed a V1–V2 model in which feature-based attention modulates the contrast of low-level feature in V1, and this modulation of contrast changes directly the surround modulation of border-ownership-selective cells in V2; thus, perception of F–G is biased. The model exhibited good agreement with human perception in the magnitude of attention modulation and its invariance among stimuli. These results indicate that early-level features that are modified by feature-based attention alter subsequent processing along afferent pathway, and that such modification could even change the perception of object. PMID:23515841

Feature-based attention in early vision for the modulation of figure-ground segregation.

PubMed

Wagatsuma, Nobuhiko; Oki, Megumi; Sakai, Ko

2013-01-01

We investigated psychophysically whether feature-based attention modulates the perception of figure-ground (F-G) segregation and, based on the results, we investigated computationally the neural mechanisms underlying attention modulation. In the psychophysical experiments, the attention of participants was drawn to a specific motion direction and they were then asked to judge the side of figure in an ambiguous figure with surfaces consisting of distinct motion directions. The results of these experiments showed that the surface consisting of the attended direction of motion was more frequently observed as figure, with a degree comparable to that of spatial attention (Wagatsuma et al., 2008). These experiments also showed that perception was dependent on the distribution of feature contrast, specifically the motion direction differences. These results led us to hypothesize that feature-based attention functions in a framework similar to that of spatial attention. We proposed a V1-V2 model in which feature-based attention modulates the contrast of low-level feature in V1, and this modulation of contrast changes directly the surround modulation of border-ownership-selective cells in V2; thus, perception of F-G is biased. The model exhibited good agreement with human perception in the magnitude of attention modulation and its invariance among stimuli. These results indicate that early-level features that are modified by feature-based attention alter subsequent processing along afferent pathway, and that such modification could even change the perception of object.

A simple inertial model for Neptune's zonal circulation

NASA Technical Reports Server (NTRS)

Allison, Michael; Lumetta, James T.

1990-01-01

Voyager imaging observations of zonal cloud-tracked winds on Neptune revealed a strongly subrotational equatorial jet with a speed approaching 500 m/s and generally decreasing retrograde motion toward the poles. The wind data are interpreted with a speculative but revealingly simple model based on steady gradient flow balance and an assumed global homogenization of potential vorticity for shallow layer motion. The prescribed model flow profile relates the equatorial velocity to the mid-latitude shear, in reasonable agreement with the available data, and implies a global horizontal deformation scale L(D) of about 3000 km.

Combined Feature Based and Shape Based Visual Tracker for Robot Navigation

NASA Technical Reports Server (NTRS)

Deans, J.; Kunz, C.; Sargent, R.; Park, E.; Pedersen, L.

2005-01-01

We have developed a combined feature based and shape based visual tracking system designed to enable a planetary rover to visually track and servo to specific points chosen by a user with centimeter precision. The feature based tracker uses invariant feature detection and matching across a stereo pair, as well as matching pairs before and after robot movement in order to compute an incremental 6-DOF motion at each tracker update. This tracking method is subject to drift over time, which can be compensated by the shape based method. The shape based tracking method consists of 3D model registration, which recovers 6-DOF motion given sufficient shape and proper initialization. By integrating complementary algorithms, the combined tracker leverages the efficiency and robustness of feature based methods with the precision and accuracy of model registration. In this paper, we present the algorithms and their integration into a combined visual tracking system.

The Vestibular System and Human Dynamic Space Orientation

NASA Technical Reports Server (NTRS)

Meiry, J. L.

1966-01-01

The motion sensors of the vestibular system are studied to determine their role in human dynamic space orientation and manual vehicle control. The investigation yielded control models for the sensors, descriptions of the subsystems for eye stabilization, and demonstrations of the effects of motion cues on closed loop manual control. Experiments on the abilities of subjects to perceive a variety of linear motions provided data on the dynamic characteristics of the otoliths, the linear motion sensors. Angular acceleration threshold measurements supplemented knowledge of the semicircular canals, the angular motion sensors. Mathematical models are presented to describe the known control characteristics of the vestibular sensors, relating subjective perception of motion to objective motion of a vehicle. The vestibular system, the neck rotation proprioceptors and the visual system form part of the control system which maintains the eye stationary relative to a target or a reference. The contribution of each of these systems was identified through experiments involving head and body rotations about a vertical axis. Compensatory eye movements in response to neck rotation were demonstrated and their dynamic characteristics described by a lag-lead model. The eye motions attributable to neck rotations and vestibular stimulation obey superposition when both systems are active. Human operator compensatory tracking is investigated in simple vehicle orientation control system with stable and unstable controlled elements. Control of vehicle orientation to a reference is simulated in three modes: visual, motion and combined. Motion cues sensed by the vestibular system through tactile sensation enable the operator to generate more lead compensation than in fixed base simulation with only visual input. The tracking performance of the human in an unstable control system near the limits of controllability is shown to depend heavily upon the rate information provided by the vestibular sensors.

Theoretical framework for analyzing structural compliance properties of proteins.

PubMed

Arikawa, Keisuke

2018-01-01

We propose methods for directly analyzing structural compliance (SC) properties of elastic network models of proteins, and we also propose methods for extracting information about motion properties from the SC properties. The analysis of SC properties involves describing the relationships between the applied forces and the deformations. When decomposing the motion according to the magnitude of SC (SC mode decomposition), we can obtain information about the motion properties under the assumption that the lower SC mode motions or the softer motions occur easily. For practical applications, the methods are formulated in a general form. The parts where forces are applied and those where deformations are evaluated are separated from each other for enabling the analyses of allosteric interactions between the specified parts. The parts are specified not only by the points but also by the groups of points (the groups are treated as flexible bodies). In addition, we propose methods for quantitatively evaluating the properties based on the screw theory and the considerations of the algebraic structures of the basic equations expressing the SC properties. These methods enable quantitative discussions about the relationships between the SC mode motions and the motions estimated from two different conformations; they also help identify the key parts that play important roles for the motions by comparing the SC properties with those of partially constrained models. As application examples, lactoferrin and ATCase are analyzed. The results show that we can understand their motion properties through their lower SC mode motions or the softer motions.

Theoretical framework for analyzing structural compliance properties of proteins

PubMed Central

2018-01-01

We propose methods for directly analyzing structural compliance (SC) properties of elastic network models of proteins, and we also propose methods for extracting information about motion properties from the SC properties. The analysis of SC properties involves describing the relationships between the applied forces and the deformations. When decomposing the motion according to the magnitude of SC (SC mode decomposition), we can obtain information about the motion properties under the assumption that the lower SC mode motions or the softer motions occur easily. For practical applications, the methods are formulated in a general form. The parts where forces are applied and those where deformations are evaluated are separated from each other for enabling the analyses of allosteric interactions between the specified parts. The parts are specified not only by the points but also by the groups of points (the groups are treated as flexible bodies). In addition, we propose methods for quantitatively evaluating the properties based on the screw theory and the considerations of the algebraic structures of the basic equations expressing the SC properties. These methods enable quantitative discussions about the relationships between the SC mode motions and the motions estimated from two different conformations; they also help identify the key parts that play important roles for the motions by comparing the SC properties with those of partially constrained models. As application examples, lactoferrin and ATCase are analyzed. The results show that we can understand their motion properties through their lower SC mode motions or the softer motions. PMID:29607281

Depth information in natural environments derived from optic flow by insect motion detection system: a model analysis

PubMed Central

Schwegmann, Alexander; Lindemann, Jens P.; Egelhaaf, Martin

2014-01-01

Knowing the depth structure of the environment is crucial for moving animals in many behavioral contexts, such as collision avoidance, targeting objects, or spatial navigation. An important source of depth information is motion parallax. This powerful cue is generated on the eyes during translatory self-motion with the retinal images of nearby objects moving faster than those of distant ones. To investigate how the visual motion pathway represents motion-based depth information we analyzed its responses to image sequences recorded in natural cluttered environments with a wide range of depth structures. The analysis was done on the basis of an experimentally validated model of the visual motion pathway of insects, with its core elements being correlation-type elementary motion detectors (EMDs). It is the key result of our analysis that the absolute EMD responses, i.e., the motion energy profile, represent the contrast-weighted nearness of environmental structures during translatory self-motion at a roughly constant velocity. In other words, the output of the EMD array highlights contours of nearby objects. This conclusion is largely independent of the scale over which EMDs are spatially pooled and was corroborated by scrutinizing the motion energy profile after eliminating the depth structure from the natural image sequences. Hence, the well-established dependence of correlation-type EMDs on both velocity and textural properties of motion stimuli appears to be advantageous for representing behaviorally relevant information about the environment in a computationally parsimonious way. PMID:25136314

An integrated model-based software for FUS in moving abdominal organs.

PubMed

Schwenke, Michael; Strehlow, Jan; Haase, Sabrina; Jenne, Juergen; Tanner, Christine; Langø, Thomas; Loeve, Arjo J; Karakitsios, Ioannis; Xiao, Xu; Levy, Yoav; Sat, Giora; Bezzi, Mario; Braunewell, Stefan; Guenther, Matthias; Melzer, Andreas; Preusser, Tobias

2015-05-01

Focused ultrasound surgery (FUS) is a non-invasive method for tissue ablation that has the potential for complete and controlled local tumour destruction with minimal side effects. The treatment of abdominal organs such as the liver, however, requires particular technological support in order to enable a safe, efficient and effective treatment. As FUS is applied from outside the patient's body, suitable imaging methods, such as magnetic resonance imaging or diagnostic ultrasound, are needed to guide and track the procedure. To facilitate an efficient FUS procedure in the liver, the organ motion during breathing and the partial occlusion by the rib cage need to be taken into account in real time, demanding a continuous patient-specific adaptation of the treatment configuration. Modelling the patient's respiratory motion and combining this with tracking data improves the accuracy of motion predictions. Modelling and simulation of the FUS effects within the body allows the use of treatment planning and has the potential to be used within therapy to increase knowledge about the patient status. This article describes integrated model-based software for patient-specific modelling and prediction for FUS treatments of moving abdominal organs.

Non-linear motions in reprocessed GPS station position time series

NASA Astrophysics Data System (ADS)

Rudenko, Sergei; Gendt, Gerd

2010-05-01

Global Positioning System (GPS) data of about 400 globally distributed stations obtained at time span from 1998 till 2007 were reprocessed using GFZ Potsdam EPOS (Earth Parameter and Orbit System) software within International GNSS Service (IGS) Tide Gauge Benchmark Monitoring (TIGA) Pilot Project and IGS Data Reprocessing Campaign with the purpose to determine weekly precise coordinates of GPS stations located at or near tide gauges. Vertical motions of these stations are used to correct the vertical motions of tide gauges for local motions and to tie tide gauge measurements to the geocentric reference frame. Other estimated parameters include daily values of the Earth rotation parameters and their rates, as well as satellite antenna offsets. The solution GT1 derived is based on using absolute phase center variation model, ITRF2005 as a priori reference frame, and other new models. The solution contributed also to ITRF2008. The time series of station positions are analyzed to identify non-linear motions caused by different effects. The paper presents the time series of GPS station coordinates and investigates apparent non-linear motions and their influence on GPS station height rates.

Generation of Shear Motion from an Isotropic Explosion Source by Scattering in Heterogeneous Media

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirakawa, Evan; Pitarka, Arben; Mellors, Robert

One challenging task in explosion seismology is the development of physical models for explaining the generation of S waves during underground explosions. Recent analysis of ground motion from chemical explosions during the Source Physics Experiment (Pitarka et al., 2015) suggests that, although a large component of shear motion was generated directly at the source, additional scattering from heterogeneous velocity structure and topography is necessary to better match the recorded data. In our paper, we used a stochastic representation of small-scale velocity variability to produce high-frequency scattering and to analyze its implication on shear-motion generation during underground explosions. In our stochasticmore » velocity model, the key parameters that affect scattering are the correlation length and the relative amplitude of velocity perturbations. Finally, based on finite-difference simulations of elastic wave propagation from an isotropic explosion source, we find that higher velocity perturbations result in larger shear motion, whereas the correlation length, which controls the scatterers size, affects the frequency range at which relative transverse motion is larger.« less

Generation of Shear Motion from an Isotropic Explosion Source by Scattering in Heterogeneous Media

DOE PAGES

Hirakawa, Evan; Pitarka, Arben; Mellors, Robert

2016-07-19

One challenging task in explosion seismology is the development of physical models for explaining the generation of S waves during underground explosions. Recent analysis of ground motion from chemical explosions during the Source Physics Experiment (Pitarka et al., 2015) suggests that, although a large component of shear motion was generated directly at the source, additional scattering from heterogeneous velocity structure and topography is necessary to better match the recorded data. In our paper, we used a stochastic representation of small-scale velocity variability to produce high-frequency scattering and to analyze its implication on shear-motion generation during underground explosions. In our stochasticmore » velocity model, the key parameters that affect scattering are the correlation length and the relative amplitude of velocity perturbations. Finally, based on finite-difference simulations of elastic wave propagation from an isotropic explosion source, we find that higher velocity perturbations result in larger shear motion, whereas the correlation length, which controls the scatterers size, affects the frequency range at which relative transverse motion is larger.« less

Stylistic gait synthesis based on hidden Markov models

NASA Astrophysics Data System (ADS)

Tilmanne, Joëlle; Moinet, Alexis; Dutoit, Thierry

2012-12-01

In this work we present an expressive gait synthesis system based on hidden Markov models (HMMs), following and modifying a procedure originally developed for speaking style adaptation, in speech synthesis. A large database of neutral motion capture walk sequences was used to train an HMM of average walk. The model was then used for automatic adaptation to a particular style of walk using only a small amount of training data from the target style. The open source toolkit that we adapted for motion modeling also enabled us to take into account the dynamics of the data and to model accurately the duration of each HMM state. We also address the assessment issue and propose a procedure for qualitative user evaluation of the synthesized sequences. Our tests show that the style of these sequences can easily be recognized and look natural to the evaluators.

Automatic techniques for 3D reconstruction of critical workplace body postures from range imaging data

NASA Astrophysics Data System (ADS)

Westfeld, Patrick; Maas, Hans-Gerd; Bringmann, Oliver; Gröllich, Daniel; Schmauder, Martin

2013-11-01

The paper shows techniques for the determination of structured motion parameters from range camera image sequences. The core contribution of the work presented here is the development of an integrated least squares 3D tracking approach based on amplitude and range image sequences to calculate dense 3D motion vector fields. Geometric primitives of a human body model are fitted to time series of range camera point clouds using these vector fields as additional information. Body poses and motion information for individual body parts are derived from the model fit. On the basis of these pose and motion parameters, critical body postures are detected. The primary aim of the study is to automate ergonomic studies for risk assessments regulated by law, identifying harmful movements and awkward body postures in a workplace.

Analysis of Timing Control Mechanism of Utterance and Body Motion Using Dialogue between Human and Communication Robot

NASA Astrophysics Data System (ADS)

Takasugi, Shoji; Yamamoto, Tomohito; Muto, Yumiko; Abe, Hiroyuki; Miyake, Yoshihiro

The purpose of this study is to clarify the effects of timing control of utterance and body motion in human-robot interaction. Our previous study has already revealed the correlation of timing of utterance and body motion in human-human communication. Here we proposed a timing control model based on our previous research and estimated its influence to realize human-like communication using a questionnaire method. The results showed that the difference of effectiveness between the communication with the timing control model and that without it was observed. In addition, elderly people evaluated the communication with timing control much higher than younger people. These results show not only the importance of timing control of utterance and body motion in human communication but also its effectiveness for realizing human-like human-robot interaction.

Orbital motions of astronomical bodies and their centre of mass from different reference frames: a conceptual step between the geocentric and heliocentric models

NASA Astrophysics Data System (ADS)

Guerra, André G. C.; Simeão Carvalho, Paulo

2016-09-01

The motion of astronomical bodies and the centre of mass of the system is not always well perceived by students. One of the struggles is the conceptual change of reference frame, which is the same that held back the acceptance of the Heliocentric model over the Geocentric one. To address the question, the notion of centre of mass, motion equations (and their numerical solution for a system of multiple bodies), and change of frame of reference is introduced. The discussion is done based on conceptual and real world examples, using the solar system. Consequently, through the use of simple ‘do it yourself’ methods and basic equations, students can debate complex motions, and have a wider and potentially effective understanding of physics.

3D force control for robotic-assisted beating heart surgery based on viscoelastic tissue model.

PubMed

Liu, Chao; Moreira, Pedro; Zemiti, Nabil; Poignet, Philippe

2011-01-01

Current cardiac surgery faces the challenging problem of heart beating motion even with the help of mechanical stabilizer which makes delicate operation on the heart surface difficult. Motion compensation methods for robotic-assisted beating heart surgery have been proposed recently in literature, but research on force control for such kind of surgery has hardly been reported. Moreover, the viscoelasticity property of the interaction between organ tissue and robotic instrument further complicates the force control design which is much easier in other applications by assuming the interaction model to be elastic (industry, stiff object manipulation, etc.). In this work, we present a three-dimensional force control method for robotic-assisted beating heart surgery taking into consideration of the viscoelastic interaction property. Performance studies based on our D2M2 robot and 3D heart beating motion information obtained through Da Vinci™ system are provided.

Exploring the Argumentation Pattern in Modeling-Based Learning about Apparent Motion of Mars

ERIC Educational Resources Information Center

Park, Su-Kyeong

2016-01-01

This study proposed an analytic framework for coding students' dialogic argumentation and investigated the characteristics of the small-group argumentation pattern observed in modeling-based learning. The participants were 122 second grade high school students in South Korea divided into an experimental and a comparison group. Modeling-based…

The importance of correct specification of tribological parameters in dynamical systems modelling

NASA Astrophysics Data System (ADS)

Alaci, S.; Ciornei, F. C.; Romanu, I. C.; Ciornei, M. C.

2018-01-01

When modelling the behaviour of dynamical systems, the friction phenomenon cannot be neglected. Dry and fluid friction may occur, but dry friction has more severe effects upon the behaviour of the systems, based on the fact that the introduced discontinuities are more important. In the modelling of dynamical systems, dry friction is the main cause of occurrence of the bifurcation phenomenon. These aspects become more complex if, in the case of dry friction, static and dynamic frictions are put forward. The behaviour of a simple dynamical system is studied, consisting in a prismatic body linked to the ground by a spring, placed on a conveyor belt. The theoretical model is described by a nonlinear differential equation which after numerical integration leads to the conclusion that the steady motion of the prism is an un-damped oscillatory motion. The system was qualitatively modelled using specialised software for dynamical analysis. It was impractical to obtain a steady uniform translational motion of a rigid, therefore the conveyor belt was replaced by a metallic disc in uniform rotation motion. The attempts to compare the CAD model to the theoretical model were unsuccessful because the efforts of selecting the tribological parameters directed to the conclusion that the motion of the prism is a damped oscillation. To decide which of the methods depicts reality, a test-rig was assembled and it indicated a sustained oscillation. The conclusion is that the model employed by the dynamical analysis software cannot describe the actual model and a more complex model is required in the description of the friction phenomenon.

Meshless Modeling of Deformable Shapes and their Motion

PubMed Central

Adams, Bart; Ovsjanikov, Maks; Wand, Michael; Seidel, Hans-Peter; Guibas, Leonidas J.

2010-01-01

We present a new framework for interactive shape deformation modeling and key frame interpolation based on a meshless finite element formulation. Starting from a coarse nodal sampling of an object’s volume, we formulate rigidity and volume preservation constraints that are enforced to yield realistic shape deformations at interactive frame rates. Additionally, by specifying key frame poses of the deforming shape and optimizing the nodal displacements while targeting smooth interpolated motion, our algorithm extends to a motion planning framework for deformable objects. This allows reconstructing smooth and plausible deformable shape trajectories in the presence of possibly moving obstacles. The presented results illustrate that our framework can handle complex shapes at interactive rates and hence is a valuable tool for animators to realistically and efficiently model and interpolate deforming 3D shapes. PMID:24839614

Initial clinical evaluation of PET-based ion beam therapy monitoring under consideration of organ motion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurz, Christopher, E-mail: christopher.kurz@physik.uni-muenchen.de; Bauer, Julia; Unholtz, Daniel

2016-02-15

Purpose: Intrafractional organ motion imposes considerable challenges to scanned ion beam therapy and demands for a thorough verification of the applied treatment. At the Heidelberg Ion-Beam Therapy Center (HIT), the scanned ion beam delivery is verified by means of postirradiation positron-emission-tomography (PET) imaging. This work presents a first clinical evaluation of PET-based treatment monitoring in ion beam therapy under consideration of target motion. Methods: Three patients with mobile liver lesions underwent scanned carbon ion irradiation at HIT and postirradiation PET/CT (x-ray-computed-tomography) imaging with a commercial scanner. Respiratory motion was recorded during irradiation and subsequent image acquisition. This enabled a time-resolvedmore » (4D) calculation of the expected irradiation-induced activity pattern and, for one patient where an additional 4D CT was acquired at the PET/CT scanner after treatment, a motion-compensated PET image reconstruction. For the other patients, PET data were reconstructed statically. To verify the treatment, calculated prediction and reconstructed measurement were compared with a focus on the ion beam range. Results: Results in the current three patients suggest that for motion amplitudes in the order of 2 mm there is no benefit from incorporating respiratory motion information into PET-based treatment monitoring. For a target motion in the order of 10 mm, motion-related effects become more severe and a time-resolved modeling of the expected activity distribution can lead to an improved data interpretation if a sufficient number of true coincidences is detected. Benefits from motion-compensated PET image reconstruction could not be shown conclusively at the current stage. Conclusions: The feasibility of clinical PET-based treatment verification under consideration of organ motion has been shown for the first time. Improvements in noise-robust 4D PET image reconstruction are deemed necessary to enhance the clinical potential.« less

Development of a diaphragmatic motion-based elastography framework for assessment of liver stiffness

NASA Astrophysics Data System (ADS)

Weis, Jared A.; Johnsen, Allison M.; Wile, Geoffrey E.; Yankeelov, Thomas E.; Abramson, Richard G.; Miga, Michael I.

2015-03-01

Evaluation of mechanical stiffness imaging biomarkers, through magnetic resonance elastography (MRE), has shown considerable promise for non-invasive assessment of liver stiffness to monitor hepatic fibrosis. MRE typically requires specialized externally-applied vibratory excitation and scanner-specific motion-sensitive pulse sequences. In this work, we have developed an elasticity imaging approach that utilizes natural diaphragmatic respiratory motion to induce deformation and eliminates the need for external deformation excitation hardware and specialized pulse sequences. Our approach uses clinically-available standard of care volumetric imaging acquisitions, combined with offline model-based post-processing to generate volumetric estimates of stiffness within the liver and surrounding tissue structures. We have previously developed a novel methodology for non-invasive elasticity imaging which utilizes a model-based elasticity reconstruction algorithm and MR image volumes acquired under different states of deformation. In prior work, deformation was external applied through inflation of an air bladder placed within the MR radiofrequency coil. In this work, we extend the methodology with the goal of determining the feasibility of assessing liver mechanical stiffness using diaphragmatic respiratory motion between end-inspiration and end-expiration breath-holds as a source of deformation. We present initial investigations towards applying this methodology to assess liver stiffness in healthy volunteers and cirrhotic patients. Our preliminary results suggest that this method is capable of non-invasive image-based assessment of liver stiffness using natural diaphragmatic respiratory motion and provides considerable enthusiasm for extension of our approach towards monitoring liver stiffness in cirrhotic patients with limited impact to standard-of-care clinical imaging acquisition workflow.

Intercepting a moving target: On-line or model-based control?

PubMed

Zhao, Huaiyong; Warren, William H

2017-05-01

When walking to intercept a moving target, people take an interception path that appears to anticipate the target's trajectory. According to the constant bearing strategy, the observer holds the bearing direction of the target constant based on current visual information, consistent with on-line control. Alternatively, the interception path might be based on an internal model of the target's motion, known as model-based control. To investigate these two accounts, participants walked to intercept a moving target in a virtual environment. We degraded the target's visibility by blurring the target to varying degrees in the midst of a trial, in order to influence its perceived speed and position. Reduced levels of visibility progressively impaired interception accuracy and precision; total occlusion impaired performance most and yielded nonadaptive heading adjustments. Thus, performance strongly depended on current visual information and deteriorated qualitatively when it was withdrawn. The results imply that locomotor interception is normally guided by current information rather than an internal model of target motion, consistent with on-line control.

Modeling the Benchmark Active Control Technology Wind-Tunnel Model for Application to Flutter Suppression

NASA Technical Reports Server (NTRS)

Waszak, Martin R.

1996-01-01

This paper describes the formulation of a model of the dynamic behavior of the Benchmark Active Controls Technology (BACT) wind-tunnel model for application to design and analysis of flutter suppression controllers. The model is formed by combining the equations of motion for the BACT wind-tunnel model with actuator models and a model of wind-tunnel turbulence. The primary focus of this paper is the development of the equations of motion from first principles using Lagrange's equations and the principle of virtual work. A numerical form of the model is generated using values for parameters obtained from both experiment and analysis. A unique aspect of the BACT wind-tunnel model is that it has upper- and lower-surface spoilers for active control. Comparisons with experimental frequency responses and other data show excellent agreement and suggest that simple coefficient-based aerodynamics are sufficient to accurately characterize the aeroelastic response of the BACT wind-tunnel model. The equations of motion developed herein have been used to assist the design and analysis of a number of flutter suppression controllers that have been successfully implemented.

Mathematical Model of Bubble Sloshing Dynamics for Cryogenic Liquid Helium in Orbital Spacecraft Dewar Container

NASA Technical Reports Server (NTRS)

Hung, R. J.; Pan, H. L.

1995-01-01

A generalized mathematical model is investigated of sloshing dynamics for dewar containers, partially filled with a liquid of cryogenic superfluid helium 2, driven by both gravity gradient and jitter accelerations applicable to two types of scientific spacecrafts, which are eligible to carry out spinning motion and/or slew motion to perform scientific observations during normal spacecraft operation. Two examples are given for the Gravity Probe-B (GP-B) with spinning motion, and the Advanced X-Ray Astrophysics Facility-Spectroscopy (AXAF-S) with slew motion, which are responsible for the sloshing dynamics. Explicit mathematical expressions for the modelling of sloshing dynamics to cover these forces acting on the spacecraft fluid systems are derived. The numerical computation of sloshing dynamics will be based on the noninertial frame spacecraft bound coordinate, and we will solve the time-dependent three-dimensional formulations of partial differential equations subject to initial and boundary conditions. Explicit mathematical expressions of boundary conditions lo cover capillary force effects on the liquid-vapor interface in microgravity environments are also derived. Results of the simulations of the mathematical model are illustrated.

Development of a numerical model for vehicle-bridge interaction analysis of railway bridges

NASA Astrophysics Data System (ADS)

Kim, Hee Ju; Cho, Eun Sang; Ham, Jun Su; Park, Ki Tae; Kim, Tae Heon

2016-04-01

In the field of civil engineering, analyzing dynamic response was main concern for a long time. These analysis methods can be divided into moving load analysis method and moving mass analysis method, and formulating each an equation of motion has recently been studied after dividing vehicles and bridges. In this study, the numerical method is presented, which can consider the various train types and can solve the equations of motion for a vehicle-bridge interaction analysis by non-iteration procedure through formulating the coupled equations for motion. Also, 3 dimensional accurate numerical models was developed by KTX-vehicle in order to analyze dynamic response characteristics. The equations of motion for the conventional trains are derived, and the numerical models of the conventional trains are idealized by a set of linear springs and dashpots with 18 degrees of freedom. The bridge models are simplified by the 3 dimensional space frame element which is based on the Euler-Bernoulli theory. The rail irregularities of vertical and lateral directions are generated by PSD functions of the Federal Railroad Administration (FRA).

Structure-Preserving Variational Multiscale Modeling of Turbulent Incompressible Flow with Subgrid Vortices

NASA Astrophysics Data System (ADS)

Evans, John; Coley, Christopher; Aronson, Ryan; Nelson, Corey

2017-11-01

In this talk, a large eddy simulation methodology for turbulent incompressible flow will be presented which combines the best features of divergence-conforming discretizations and the residual-based variational multiscale approach to large eddy simulation. In this method, the resolved motion is represented using a divergence-conforming discretization, that is, a discretization that preserves the incompressibility constraint in a pointwise manner, and the unresolved fluid motion is explicitly modeled by subgrid vortices that lie within individual grid cells. The evolution of the subgrid vortices is governed by dynamical model equations driven by the residual of the resolved motion. Consequently, the subgrid vortices appropriately vanish for laminar flow and fully resolved turbulent flow. As the resolved velocity field and subgrid vortices are both divergence-free, the methodology conserves mass in a pointwise sense and admits discrete balance laws for energy, enstrophy, and helicity. Numerical results demonstrate the methodology yields improved results versus state-of-the-art eddy viscosity models in the context of transitional, wall-bounded, and rotational flow when a divergence-conforming B-spline discretization is utilized to represent the resolved motion.

Ground Motion Characteristics of Induced Earthquakes in Central North America

NASA Astrophysics Data System (ADS)

Atkinson, G. M.; Assatourians, K.; Novakovic, M.

2017-12-01

The ground motion characteristics of induced earthquakes in central North America are investigated based on empirical analysis of a compiled database of 4,000,000 digital ground-motion records from events in induced-seismicity regions (especially Oklahoma). Ground-motion amplitudes are characterized non-parametrically by computing median amplitudes and their variability in magnitude-distance bins. We also use inversion techniques to solve for regional source, attenuation and site response effects. Ground motion models are used to interpret the observations and compare the source and attenuation attributes of induced earthquakes to those of their natural counterparts. Significant conclusions are that the stress parameter that controls the strength of high-frequency radiation is similar for induced earthquakes (depth of h 5 km) and shallow (h 5 km) natural earthquakes. By contrast, deeper natural earthquakes (h 10 km) have stronger high-frequency ground motions. At distances close to the epicenter, a greater focal depth (which increases distance from the hypocenter) counterbalances the effects of a larger stress parameter, resulting in motions of similar strength close to the epicenter, regardless of event depth. The felt effects of induced versus natural earthquakes are also investigated using USGS "Did You Feel It?" reports; 400,000 reports from natural events and 100,000 reports from induced events are considered. The felt reports confirm the trends that we expect based on ground-motion modeling, considering the offsetting effects of the stress parameter versus focal depth in controlling the strength of motions near the epicenter. Specifically, felt intensity for a given magnitude is similar near the epicenter, on average, for all event types and depths. At distances more than 10 km from the epicenter, deeper events are felt more strongly than shallow events. These ground-motion attributes imply that the induced-seismicity hazard is most critical for facilities in close proximity (<10 km) to oil and gas operations.

Absolute plate motions relative to deep mantle plumes

NASA Astrophysics Data System (ADS)

Wang, Shimin; Yu, Hongzheng; Zhang, Qiong; Zhao, Yonghong

2018-05-01

Advances in whole waveform seismic tomography have revealed the presence of broad mantle plumes rooted at the base of the Earth's mantle beneath major hotspots. Hotspot tracks associated with these deep mantle plumes provide ideal constraints for inverting absolute plate motions as well as testing the fixed hotspot hypothesis. In this paper, 27 observed hotspot trends associated with 24 deep mantle plumes are used together with the MORVEL model for relative plate motions to determine an absolute plate motion model, in terms of a maximum likelihood optimization for angular data fitting, combined with an outlier data detection procedure based on statistical tests. The obtained T25M model fits 25 observed trends of globally distributed hotspot tracks to the statistically required level, while the other two hotspot trend data (Comores on Somalia and Iceland on Eurasia) are identified as outliers, which are significantly incompatible with other data. For most hotspots with rate data available, T25M predicts plate velocities significantly lower than the observed rates of hotspot volcanic migration, which cannot be fully explained by biased errors in observed rate data. Instead, the apparent hotspot motions derived by subtracting the observed hotspot migration velocities from the T25M plate velocities exhibit a combined pattern of being opposite to plate velocities and moving towards mid-ocean ridges. The newly estimated net rotation of the lithosphere is statistically compatible with three recent estimates, but differs significantly from 30 of 33 prior estimates.

Effect of relativistic motion on witnessing nonclassicality of quantum states

NASA Astrophysics Data System (ADS)

Checińska, Agata; Lorek, Krzysztof; Dragan, Andrzej

2017-01-01

We show that the operational definition of nonclassicality of a quantum state depends on the motion of the observer. We use the relativistic Unruh-DeWitt detector model to witness nonclassicality of the probed field state. It turns out that the witness based on the properties of the P representation of the quantum state depends on the trajectory of the detector. Inertial and noninertial motion of the device have qualitatively different impact on the performance of the witness.

A Modified LS+AR Model to Improve the Accuracy of the Short-term Polar Motion Prediction

NASA Astrophysics Data System (ADS)

Wang, Z. W.; Wang, Q. X.; Ding, Y. Q.; Zhang, J. J.; Liu, S. S.

2017-03-01

There are two problems of the LS (Least Squares)+AR (AutoRegressive) model in polar motion forecast: the inner residual value of LS fitting is reasonable, but the residual value of LS extrapolation is poor; and the LS fitting residual sequence is non-linear. It is unsuitable to establish an AR model for the residual sequence to be forecasted, based on the residual sequence before forecast epoch. In this paper, we make solution to those two problems with two steps. First, restrictions are added to the two endpoints of LS fitting data to fix them on the LS fitting curve. Therefore, the fitting values next to the two endpoints are very close to the observation values. Secondly, we select the interpolation residual sequence of an inward LS fitting curve, which has a similar variation trend as the LS extrapolation residual sequence, as the modeling object of AR for the residual forecast. Calculation examples show that this solution can effectively improve the short-term polar motion prediction accuracy by the LS+AR model. In addition, the comparison results of the forecast models of RLS (Robustified Least Squares)+AR, RLS+ARIMA (AutoRegressive Integrated Moving Average), and LS+ANN (Artificial Neural Network) confirm the feasibility and effectiveness of the solution for the polar motion forecast. The results, especially for the polar motion forecast in the 1-10 days, show that the forecast accuracy of the proposed model can reach the world level.

Floquet stability analysis of the longitudinal dynamics of two hovering model insects

PubMed Central

Wu, Jiang Hao; Sun, Mao

2012-01-01

Because of the periodically varying aerodynamic and inertial forces of the flapping wings, a hovering or constant-speed flying insect is a cyclically forcing system, and, generally, the flight is not in a fixed-point equilibrium, but in a cyclic-motion equilibrium. Current stability theory of insect flight is based on the averaged model and treats the flight as a fixed-point equilibrium. In the present study, we treated the flight as a cyclic-motion equilibrium and used the Floquet theory to analyse the longitudinal stability of insect flight. Two hovering model insects were considered—a dronefly and a hawkmoth. The former had relatively high wingbeat frequency and small wing-mass to body-mass ratio, and hence very small amplitude of body oscillation; while the latter had relatively low wingbeat frequency and large wing-mass to body-mass ratio, and hence relatively large amplitude of body oscillation. For comparison, analysis using the averaged-model theory (fixed-point stability analysis) was also made. Results of both the cyclic-motion stability analysis and the fixed-point stability analysis were tested by numerical simulation using complete equations of motion coupled with the Navier–Stokes equations. The Floquet theory (cyclic-motion stability analysis) agreed well with the simulation for both the model dronefly and the model hawkmoth; but the averaged-model theory gave good results only for the dronefly. Thus, for an insect with relatively large body oscillation at wingbeat frequency, cyclic-motion stability analysis is required, and for their control analysis, the existing well-developed control theories for systems of fixed-point equilibrium are no longer applicable and new methods that take the cyclic variation of the flight dynamics into account are needed. PMID:22491980

Quantitative Analysis of Intracellular Motility Based on Optical Flow Model

PubMed Central

Li, Heng

2017-01-01

Analysis of cell mobility is a key issue for abnormality identification and classification in cell biology research. However, since cell deformation induced by various biological processes is random and cell protrusion is irregular, it is difficult to measure cell morphology and motility in microscopic images. To address this dilemma, we propose an improved variation optical flow model for quantitative analysis of intracellular motility, which not only extracts intracellular motion fields effectively but also deals with optical flow computation problem at the border by taking advantages of the formulation based on L1 and L2 norm, respectively. In the energy functional of our proposed optical flow model, the data term is in the form of L2 norm; the smoothness of the data changes with regional features through an adaptive parameter, using L1 norm near the edge of the cell and L2 norm away from the edge. We further extract histograms of oriented optical flow (HOOF) after optical flow field of intracellular motion is computed. Then distances of different HOOFs are calculated as the intracellular motion features to grade the intracellular motion. Experimental results show that the features extracted from HOOFs provide new insights into the relationship between the cell motility and the special pathological conditions. PMID:29065574

Dynamic PET image reconstruction integrating temporal regularization associated with respiratory motion correction for applications in oncology

NASA Astrophysics Data System (ADS)

Merlin, Thibaut; Visvikis, Dimitris; Fernandez, Philippe; Lamare, Frédéric

2018-02-01

Respiratory motion reduces both the qualitative and quantitative accuracy of PET images in oncology. This impact is more significant for quantitative applications based on kinetic modeling, where dynamic acquisitions are associated with limited statistics due to the necessity of enhanced temporal resolution. The aim of this study is to address these drawbacks, by combining a respiratory motion correction approach with temporal regularization in a unique reconstruction algorithm for dynamic PET imaging. Elastic transformation parameters for the motion correction are estimated from the non-attenuation-corrected PET images. The derived displacement matrices are subsequently used in a list-mode based OSEM reconstruction algorithm integrating a temporal regularization between the 3D dynamic PET frames, based on temporal basis functions. These functions are simultaneously estimated at each iteration, along with their relative coefficients for each image voxel. Quantitative evaluation has been performed using dynamic FDG PET/CT acquisitions of lung cancer patients acquired on a GE DRX system. The performance of the proposed method is compared with that of a standard multi-frame OSEM reconstruction algorithm. The proposed method achieved substantial improvements in terms of noise reduction while accounting for loss of contrast due to respiratory motion. Results on simulated data showed that the proposed 4D algorithms led to bias reduction values up to 40% in both tumor and blood regions for similar standard deviation levels, in comparison with a standard 3D reconstruction. Patlak parameter estimations on reconstructed images with the proposed reconstruction methods resulted in 30% and 40% bias reduction in the tumor and lung region respectively for the Patlak slope, and a 30% bias reduction for the intercept in the tumor region (a similar Patlak intercept was achieved in the lung area). Incorporation of the respiratory motion correction using an elastic model along with a temporal regularization in the reconstruction process of the PET dynamic series led to substantial quantitative improvements and motion artifact reduction. Future work will include the integration of a linear FDG kinetic model, in order to directly reconstruct parametric images.

Dynamic PET image reconstruction integrating temporal regularization associated with respiratory motion correction for applications in oncology.

PubMed

Merlin, Thibaut; Visvikis, Dimitris; Fernandez, Philippe; Lamare, Frédéric

2018-02-13

Respiratory motion reduces both the qualitative and quantitative accuracy of PET images in oncology. This impact is more significant for quantitative applications based on kinetic modeling, where dynamic acquisitions are associated with limited statistics due to the necessity of enhanced temporal resolution. The aim of this study is to address these drawbacks, by combining a respiratory motion correction approach with temporal regularization in a unique reconstruction algorithm for dynamic PET imaging. Elastic transformation parameters for the motion correction are estimated from the non-attenuation-corrected PET images. The derived displacement matrices are subsequently used in a list-mode based OSEM reconstruction algorithm integrating a temporal regularization between the 3D dynamic PET frames, based on temporal basis functions. These functions are simultaneously estimated at each iteration, along with their relative coefficients for each image voxel. Quantitative evaluation has been performed using dynamic FDG PET/CT acquisitions of lung cancer patients acquired on a GE DRX system. The performance of the proposed method is compared with that of a standard multi-frame OSEM reconstruction algorithm. The proposed method achieved substantial improvements in terms of noise reduction while accounting for loss of contrast due to respiratory motion. Results on simulated data showed that the proposed 4D algorithms led to bias reduction values up to 40% in both tumor and blood regions for similar standard deviation levels, in comparison with a standard 3D reconstruction. Patlak parameter estimations on reconstructed images with the proposed reconstruction methods resulted in 30% and 40% bias reduction in the tumor and lung region respectively for the Patlak slope, and a 30% bias reduction for the intercept in the tumor region (a similar Patlak intercept was achieved in the lung area). Incorporation of the respiratory motion correction using an elastic model along with a temporal regularization in the reconstruction process of the PET dynamic series led to substantial quantitative improvements and motion artifact reduction. Future work will include the integration of a linear FDG kinetic model, in order to directly reconstruct parametric images.

Estimation of Static Coulomb Stress Change and Strong Motion Simulation for Jiuzhaigou 7.0 Earthquake Base on SENTINEL-1 Insar Data Inversion

NASA Astrophysics Data System (ADS)

Shen, W. H.; Luo, Y.; Jiao, Q. S.

2018-04-01

On August 8, 2017, an earthquake of M 7.0 occurred at Jiuzhaigou. Based on the Sentinel-1 satellite InSAR data, we obtained coseismic deformation field and inverted the source slip model. Results show that this event is dominated by strike slip, and the total released seismic moment is 8.06 × 1018 Nm, equivalent to an earthquake of Mw 6.57. We calculated static stress changes along strike and dip direction, and the static stress analysis show that the average stress drop are at low level, which may be responsible for the low level of ground motion during Jiuzhaigou earthquake. The coseismic Coulomb stress changes are calculated base on the inverted slip model, which revealed that 82.59 % of aftershocks are located in the Coulomb stress increasing area, 78.42 % of total aftershocks may be triggered by the mainshock aftershock, indicating that the mainshock has a significant triggering effect on the subsequent aftershocks. Based on stochastic finite fault model, we simulated regional peak ground acceleration (PGA), peak ground velocity (PGV) and the intensity, and results could capture basic features associated with the ground motion patterns. Moreover, the simulated results reflect the obvious rupture directivity effect.

Building and using a statistical 3D motion atlas for analyzing myocardial contraction in MRI

NASA Astrophysics Data System (ADS)

Rougon, Nicolas F.; Petitjean, Caroline; Preteux, Francoise J.

2004-05-01

We address the issue of modeling and quantifying myocardial contraction from 4D MR sequences, and present an unsupervised approach for building and using a statistical 3D motion atlas for the normal heart. This approach relies on a state-of-the-art variational non rigid registration (NRR) technique using generalized information measures, which allows for robust intra-subject motion estimation and inter-subject anatomical alignment. The atlas is built from a collection of jointly acquired tagged and cine MR exams in short- and long-axis views. Subject-specific non parametric motion estimates are first obtained by incremental NRR of tagged images onto the end-diastolic (ED) frame. Individual motion data are then transformed into the coordinate system of a reference subject using subject-to-reference mappings derived by NRR of cine ED images. Finally, principal component analysis of aligned motion data is performed for each cardiac phase, yielding a mean model and a set of eigenfields encoding kinematic ariability. The latter define an organ-dedicated hierarchical motion basis which enables parametric motion measurement from arbitrary tagged MR exams. To this end, the atlas is transformed into subject coordinates by reference-to-subject NRR of ED cine frames. Atlas-based motion estimation is then achieved by parametric NRR of tagged images onto the ED frame, yielding a compact description of myocardial contraction during diastole.

Observed and simulated ground motions in the San Bernardino basin region for the Hector Mine, California, earthquake

USGS Publications Warehouse

Graves, R.W.; Wald, D.J.

2004-01-01

During the MW 7.1 Hector Mine earthquake, peak ground velocities recorded at sites in the central San Bernardino basin region were up to 2 times larger and had significantly longer durations of strong shaking than sites just outside the basin. To better understand the effects of 3D structure on the long-period ground-motion response in this region, we have performed finite-difference simulations for this earthquake. The simulations are numerically accurate for periods of 2 sec and longer and incorporate the detailed spatial and temporal heterogeneity of source rupture, as well as complex 3D basin structure. Here, we analyze three models of the San Bernardino basin: model A (with structural constraints from gravity and seismic reflection data), model F (water well and seismic refraction data), and the Southern California Earthquake Center version 3 model (hydrologic and seismic refraction data). Models A and F are characterized by a gradual increase in sediment thickness toward the south with an abrupt step-up in the basement surface across the San Jacinto fault. The basin structure in the SCEC version 3 model has a nearly uniform sediment thickness of 1 km with little basement topography along the San Jacinto fault. In models A and F, we impose a layered velocity structure within the sediments based on the seismic refraction data and an assumed depth-dependent Vp/Vs ratio. Sediment velocities within the SCEC version 3 model are given by a smoothly varying rule-based function that is calibrated to the seismic refraction measurements. Due to computational limitations, the minimum shear-wave velocity is fixed at 600 m/sec in all of the models. Ground-motion simulations for both models A and F provide a reasonably good match to the amplitude and waveform characteristics of the recorded motions. In these models, surface waves are generated as energy enters the basin through the gradually sloping northern margin. Due to the basement step along the San Jacinto fault, the surface wave energy is confined to the region north of this structure, consistent with the observations. The SCEC version 3 model, lacking the basin geometry complexity present in the other two models, fails to provide a satisfactory match to the characteristics of the observed motions. Our study demonstrates the importance of using detailed and accurate basin geometry for predicting ground motions and also highlights the utility of integrating geological, geophysical, and seismological observations in the development and validation of 3D velocity models.

Global continental and ocean basin reconstructions since 200 Ma

NASA Astrophysics Data System (ADS)

Seton, M.; Müller, R. D.; Zahirovic, S.; Gaina, C.; Torsvik, T.; Shephard, G.; Talsma, A.; Gurnis, M.; Turner, M.; Maus, S.; Chandler, M.

2012-07-01

Global plate motion models provide a spatial and temporal framework for geological data and have been effective tools for exploring processes occurring at the earth's surface. However, published models either have insufficient temporal coverage or fail to treat tectonic plates in a self-consistent manner. They usually consider the motions of selected features attached to tectonic plates, such as continents, but generally do not explicitly account for the continuous evolution of plate boundaries through time. In order to explore the coupling between the surface and mantle, plate models are required that extend over at least a few hundred million years and treat plates as dynamic features with dynamically evolving plate boundaries. We have constructed a new type of global plate motion model consisting of a set of continuously-closing topological plate polygons with associated plate boundaries and plate velocities since the break-up of the supercontinent Pangea. Our model is underpinned by plate motions derived from reconstructing the seafloor-spreading history of the ocean basins and motions of the continents and utilizes a hybrid absolute reference frame, based on a moving hotspot model for the last 100 Ma, and a true-polar wander corrected paleomagnetic model for 200 to 100 Ma. Detailed regional geological and geophysical observations constrain plate boundary inception or cessation, and time-dependent geometry. Although our plate model is primarily designed as a reference model for a new generation of geodynamic studies by providing the surface boundary conditions for the deep earth, it is also useful for studies in disparate fields when a framework is needed for analyzing and interpreting spatio-temporal data.

Multi- and monofractal indices of short-term heart rate variability.

PubMed

Fischer, R; Akay, M; Castiglioni, P; Di Rienzo, M

2003-09-01

Indices of heart rate variability (HRV) based on fractal signal models have recently been shown to possess value as predictors of mortality in specific patient populations. To develop more powerful clinical indices of HRV based on a fractal signal model, the study investigated two HRV indices based on a monofractal signal model called fractional Brownian motion and an index based on a multifractal signal model called multifractional Brownian motion. The performance of the indices was compared with an HRV index in common clinical use. To compare the indices, 18 normal subjects were subjected to postural changes, and the indices were compared on their ability to respond to the resulting autonomic events in HRV recordings. The magnitude of the response to postural change (normalised by the measurement variability) was assessed by analysis of variance and multiple comparison testing. Four HRV indices were investigated for this study: the standard deviation of all normal R-R intervals; an HRV index commonly used in the clinic; detrended fluctuation analysis, an HRV index found to be the most powerful predictor of mortality in a study of patients with depressed left ventricular function; an HRV index developed using the maximum likelihood estimation (MLE) technique for a monofractal signal model; and an HRV index developed for the analysis of multifractional Brownian motion signals. The HRV index based on the MLE technique was found to respond most strongly to the induced postural changes (95% CI). The magnitude of its response (normalised by the measurement variability) was at least 25% greater than any of the other indices tested.

Integration of time as a factor in ergonomic simulation.

PubMed

Walther, Mario; Muñoz, Begoña Toledo

2012-01-01

The paper describes the application of a simulation based ergonomic evaluation. Within a pilot project, the algorithms of the screening method of the European Assembly Worksheet were transferred into an existing digital human model. Movement data was recorded with an especially developed hybrid Motion Capturing system. A prototype of the system was built and is currently being tested at the Volkswagen Group. First results showed the feasibility of the simulation based ergonomic evaluation with Motion Capturing.

Wave motion on the surface of the human tympanic membrane: Holographic measurement and modeling analysis

PubMed Central

Cheng, Jeffrey Tao; Hamade, Mohamad; Merchant, Saumil N.; Rosowski, John J.; Harrington, Ellery; Furlong, Cosme

2013-01-01

Sound-induced motions of the surface of the tympanic membrane (TM) were measured using stroboscopic holography in cadaveric human temporal bones at frequencies between 0.2 and 18 kHz. The results are consistent with the combination of standing-wave-like modal motions and traveling-wave-like motions on the TM surface. The holographic techniques also quantified sound-induced displacements of the umbo of the malleus, as well as volume velocity of the TM. These measurements were combined with sound-pressure measurements near the TM to compute middle-ear input impedance and power reflectance at the TM. The results are generally consistent with other published data. A phenomenological model that behaved qualitatively like the data was used to quantify the relative magnitude and spatial frequencies of the modal and traveling-wave-like displacement components on the TM surface. This model suggests the modal magnitudes are generally larger than those of the putative traveling waves, and the computed wave speeds are much slower than wave speeds predicted by estimates of middle-ear delay. While the data are inconsistent with simple modal displacements of the TM, an alternate model based on the combination of modal motions in a lossy membrane can also explain these measurements without invoking traveling waves. PMID:23363110

Empirical Ground Motion Characterization of Induced Seismicity in Alberta and Oklahoma

NASA Astrophysics Data System (ADS)

Novakovic, M.; Atkinson, G. M.; Assatourians, K.

2017-12-01

We develop empirical ground-motion prediction equations (GMPEs) for ground motions from induced earthquakes in Alberta and Oklahoma following the stochastic-model-based method of Atkinson et al. (2015 BSSA). The Oklahoma ground-motion database is compiled from over 13,000 small to moderate seismic events (M 1 to 5.8) recorded at 1600 seismic stations, at distances from 1 to 750 km. The Alberta database is compiled from over 200 small to moderate seismic events (M 1 to 4.2) recorded at 50 regional stations, at distances from 30 to 500 km. A generalized inversion is used to solve for regional source, attenuation and site parameters. The obtained parameters describe the regional attenuation, stress parameter and site amplification. Resolving these parameters allows for the derivation of regionally-calibrated GMPEs that can be used to compare ground motion observations between waste water injection (Oklahoma) and hydraulic fracture induced events (Alberta), and further compare induced observations with ground motions resulting from natural sources (California, NGAWest2). The derived GMPEs have applications for the evaluation of hazards from induced seismicity and can be used to track amplitudes across the regions in real time, which is useful for ground-motion-based alerting systems and traffic light protocols.

Hand motion modeling for psychology analysis in job interview using optical flow-history motion image: OF-HMI

NASA Astrophysics Data System (ADS)

Khalifa, Intissar; Ejbali, Ridha; Zaied, Mourad

2018-04-01

To survive the competition, companies always think about having the best employees. The selection is depended on the answers to the questions of the interviewer and the behavior of the candidate during the interview session. The study of this behavior is always based on a psychological analysis of the movements accompanying the answers and discussions. Few techniques are proposed until today to analyze automatically candidate's non verbal behavior. This paper is a part of a work psychology recognition system; it concentrates in spontaneous hand gesture which is very significant in interviews according to psychologists. We propose motion history representation of hand based on an hybrid approach that merges optical flow and history motion images. The optical flow technique is used firstly to detect hand motions in each frame of a video sequence. Secondly, we use the history motion images (HMI) to accumulate the output of the optical flow in order to have finally a good representation of the hand`s local movement in a global temporal template.

Development of Response Spectral Ground Motion Prediction Equations from Empirical Models for Fourier Spectra and Duration of Ground Motion

NASA Astrophysics Data System (ADS)

Bora, S. S.; Scherbaum, F.; Kuehn, N. M.; Stafford, P.; Edwards, B.

2014-12-01

In a probabilistic seismic hazard assessment (PSHA) framework, it still remains a challenge to adjust ground motion prediction equations (GMPEs) for application in different seismological environments. In this context, this study presents a complete framework for the development of a response spectral GMPE easily adjustable to different seismological conditions; and which does not suffer from the technical problems associated with the adjustment in response spectral domain. Essentially, the approach consists of an empirical FAS (Fourier Amplitude Spectrum) model and a duration model for ground motion which are combined within the random vibration theory (RVT) framework to obtain the full response spectral ordinates. Additionally, FAS corresponding to individual acceleration records are extrapolated beyond the frequency range defined by the data using the stochastic FAS model, obtained by inversion as described in Edwards & Faeh, (2013). To that end, an empirical model for a duration, which is tuned to optimize the fit between RVT based and observed response spectral ordinate, at each oscillator frequency is derived. Although, the main motive of the presented approach was to address the adjustability issues of response spectral GMPEs; comparison, of median predicted response spectra with the other regional models indicate that presented approach can also be used as a stand-alone model. Besides that, a significantly lower aleatory variability (σ<0.5 in log units) in comparison to other regional models, at shorter periods brands it to a potentially viable alternative to the classical regression (on response spectral ordinates) based GMPEs for seismic hazard studies in the near future. The dataset used for the presented analysis is a subset of the recently compiled database RESORCE-2012 across Europe, Middle East and the Mediterranean region.

Understanding the magnitude dependence of PGA and PGV in NGA-West 2 data

USGS Publications Warehouse

Baltay, Annemarie S.; Hanks, Thomas C.

2014-01-01

The Next Generation Attenuation‐West 2 (NGA‐West 2) 2014 ground‐motion prediction equations (GMPEs) model ground motions as a function of magnitude and distance, using empirically derived coefficients (e.g., Bozorgniaet al., 2014); as such, these GMPEs do not clearly employ earthquake source parameters beyond moment magnitude (M) and focal mechanism. To better understand the magnitude‐dependent trends in the GMPEs, we build a comprehensive earthquake source‐based model to explain the magnitude dependence of peak ground acceleration and peak ground velocity in the NGA‐West 2 ground‐motion databases and GMPEs. Our model employs existing models (Hanks and McGuire, 1981; Boore, 1983, 1986; Anderson and Hough, 1984) that incorporate a point‐source Brune model, including a constant stress drop and the high‐frequency attenuation parameter κ0, random vibration theory, and a finite‐fault assumption at the large magnitudes to describe the data from magnitudes 3 to 8. We partition this range into four different magnitude regions, each of which has different functional dependences on M. Use of the four magnitude partitions separately allows greater understanding of what happens in any one subrange, as well as the limiting conditions between the subranges. This model provides a remarkably good fit to the NGA data for magnitudes from 3

SMSIM--Fortran programs for simulating ground motions from earthquakes: Version 2.0.--a revision of OFR 96-80-A

USGS Publications Warehouse

Boore, David M.

2000-01-01

A simple and powerful method for simulating ground motions is based on the assumption that the amplitude of ground motion at a site can be specified in a deterministic way, with a random phase spectrum modified such that the motion is distributed over a duration related to the earthquake magnitude and to distance from the source. This method of simulating ground motions often goes by the name "the stochastic method." It is particularly useful for simulating the higher-frequency ground motions of most interest to engineers, and it is widely used to predict ground motions for regions of the world in which recordings of motion from damaging earthquakes are not available. This simple method has been successful in matching a variety of ground-motion measures for earthquakes with seismic moments spanning more than 12 orders of magnitude. One of the essential characteristics of the method is that it distills what is known about the various factors affecting ground motions (source, path, and site) into simple functional forms that can be used to predict ground motions. SMSIM is a set of programs for simulating ground motions based on the stochastic method. This Open-File Report is a revision of an earlier report (Boore, 1996) describing a set of programs for simulating ground motions from earthquakes. The programs are based on modifications I have made to the stochastic method first introduced by Hanks and McGuire (1981). The report contains source codes, written in Fortran, and executables that can be used on a PC. Programs are included both for time-domain and for random vibration simulations. In addition, programs are included to produce Fourier amplitude spectra for the models used in the simulations and to convert shear velocity vs. depth into frequency-dependent amplification. The revision to the previous report is needed because the input and output files have changed significantly, and a number of new programs have been included in the set.

Near-Fault Broadband Ground Motion Simulations Using Empirical Green's Functions: Application to the Upper Rhine Graben (France-Germany) Case Study

NASA Astrophysics Data System (ADS)

Del Gaudio, Sergio; Hok, Sebastien; Festa, Gaetano; Causse, Mathieu; Lancieri, Maria

2017-09-01

Seismic hazard estimation relies classically on data-based ground motion prediction equations (GMPEs) giving the expected motion level as a function of several parameters characterizing the source and the sites of interest. However, records of moderate to large earthquakes at short distances from the faults are still rare. For this reason, it is difficult to obtain a reliable ground motion prediction for such a class of events and distances where also the largest amount of damage is usually observed. A possible strategy to fill this lack of information is to generate synthetic accelerograms based on an accurate modeling of both extended fault rupture and wave propagation process. The development of such modeling strategies is essential for estimating seismic hazard close to faults in moderate seismic activity zones, where data are even scarcer. For that reason, we selected a target site in Upper Rhine Graben (URG), at the French-German border. URG is a region where faults producing micro-seismic activity are very close to the sites of interest (e.g., critical infrastructures like supply lines, nuclear power plants, etc.) needing a careful investigation of seismic hazard. In this work, we demonstrate the feasibility of performing near-fault broadband ground motion numerical simulations in a moderate seismic activity region such as URG and discuss some of the challenges related to such an application. The modeling strategy is to couple the multi-empirical Green's function technique (multi-EGFt) with a k -2 kinematic source model. One of the advantages of the multi-EGFt is that it does not require a detailed knowledge of the propagation medium since the records of small events are used as the medium transfer function, if, at the target site, records of small earthquakes located on the target fault are available. The selection of suitable events to be used as multi-EGF is detailed and discussed in our specific situation where less number of events are available. We then showed the impact that each source parameter characterizing the k-2 model has on ground motion amplitude. Finally we performed ground motion simulations showing results for different probable earthquake scenarios in the URG. Dependency of ground motions and of their variability are analyzed at different frequencies in respect of rupture velocity, roughness degree of slip distribution (stress drop), and hypocenter location. In near-source conditions, ground motion variability is shown to be mostly governed by the uncertainty on source parameters. In our specific configuration (magnitude, distance), the directivity effect is only observed in a limited frequency range. Rather, broadband ground motions are shown to be sensitive to both average rupture velocity and its possible variability, and to slip roughness. Ending up with a comparison of simulation results and GMPEs, we conclude that source parameters and their variability should be set up carefully to obtain reliable broadband ground motion estimations. In particular, our study shows that slip roughness should be set up in respect of the target stress drop. This entails the need for a better understanding of the physics of earthquake source and its incorporation in the ground motion modeling.

Normal and Pathological NCAT Image and PhantomData Based onPhysiologically Realistic Left Ventricle Finite-Element Models

DOE Office of Scientific and Technical Information (OSTI.GOV)

Veress, Alexander I.; Segars, W. Paul; Weiss, Jeffrey A.

2006-08-02

The 4D NURBS-based Cardiac-Torso (NCAT) phantom, whichprovides a realistic model of the normal human anatomy and cardiac andrespiratory motions, is used in medical imaging research to evaluate andimprove imaging devices and techniques, especially dynamic cardiacapplications. One limitation of the phantom is that it lacks the abilityto accurately simulate altered functions of the heart that result fromcardiac pathologies such as coronary artery disease (CAD). The goal ofthis work was to enhance the 4D NCAT phantom by incorporating aphysiologically based, finite-element (FE) mechanical model of the leftventricle (LV) to simulate both normal and abnormal cardiac motions. Thegeometry of the FE mechanical modelmore » was based on gated high-resolutionx-ray multi-slice computed tomography (MSCT) data of a healthy malesubject. The myocardial wall was represented as transversely isotropichyperelastic material, with the fiber angle varying from -90 degrees atthe epicardial surface, through 0 degreesat the mid-wall, to 90 degreesat the endocardial surface. A time varying elastance model was used tosimulate fiber contraction, and physiological intraventricular systolicpressure-time curves were applied to simulate the cardiac motion over theentire cardiac cycle. To demonstrate the ability of the FE mechanicalmodel to accurately simulate the normal cardiac motion as well abnormalmotions indicative of CAD, a normal case and two pathologic cases weresimulated and analyzed. In the first pathologic model, a subendocardialanterior ischemic region was defined. A second model was created with atransmural ischemic region defined in the same location. The FE baseddeformations were incorporated into the 4D NCAT cardiac model through thecontrol points that define the cardiac structures in the phantom whichwere set to move according to the predictions of the mechanical model. Asimulation study was performed using the FE-NCAT combination toinvestigate how the differences in contractile function between thesubendocardial and transmural infarcts manifest themselves in myocardialSPECT images. The normal FE model produced strain distributions that wereconsistent with those reported in the literature and a motion consistentwith that defined in the normal 4D NCAT beating heart model based ontagged MRI data. The addition of a subendocardial ischemic region changedthe average transmural circumferential strain from a contractile value of0.19 to a tensile value of 0.03. The addition of a transmural ischemicregion changed average circumferential strain to a value of 0.16, whichis consistent with data reported in the literature. Model resultsdemonstrated differences in contractile function between subendocardialand transmural infarcts and how these differences in function aredocumented in simulated myocardial SPECT images produced using the 4DNCAT phantom. In comparison to the original NCAT beating heart model, theFE mechanical model produced a more accurate simulation for the cardiacmotion abnormalities. Such a model, when incorporated into the 4D NCATphantom, has great potential for use in cardiac imaging research. Withits enhanced physiologically-based cardiac model, the 4D NCAT phantom canbe used to simulate realistic, predictive imaging data of a patientpopulation with varying whole-body anatomy and with varying healthy anddiseased states of the heart that will provide a known truth from whichto evaluate and improve existing and emerging 4D imaging techniques usedin the diagnosis of cardiac disease.« less

A novel CT acquisition and analysis technique for breathing motion modeling

NASA Astrophysics Data System (ADS)

Low, Daniel A.; White, Benjamin M.; Lee, Percy P.; Thomas, David H.; Gaudio, Sergio; Jani, Shyam S.; Wu, Xiao; Lamb, James M.

2013-06-01

To report on a novel technique for providing artifact-free quantitative four-dimensional computed tomography (4DCT) image datasets for breathing motion modeling. Commercial clinical 4DCT methods have difficulty managing irregular breathing. The resulting images contain motion-induced artifacts that can distort structures and inaccurately characterize breathing motion. We have developed a novel scanning and analysis method for motion-correlated CT that utilizes standard repeated fast helical acquisitions, a simultaneous breathing surrogate measurement, deformable image registration, and a published breathing motion model. The motion model differs from the CT-measured motion by an average of 0.65 mm, indicating the precision of the motion model. The integral of the divergence of one of the motion model parameters is predicted to be a constant 1.11 and is found in this case to be 1.09, indicating the accuracy of the motion model. The proposed technique shows promise for providing motion-artifact free images at user-selected breathing phases, accurate Hounsfield units, and noise characteristics similar to non-4D CT techniques, at a patient dose similar to or less than current 4DCT techniques.

Physics-Based Broadband Ground Motion Simulations in Near Fault Conditions: the L'Aquila (Italy) and the Upper Rhine Graben (France-Germany) Case of Studies

NASA Astrophysics Data System (ADS)

Del Gaudio, S.; Lancieri, M.; Hok, S.; Satriano, C.; Chartier, T.; Scotti, O.; Bernard, P.

2016-12-01

Predictions of realistic ground motion for potential future earthquakes are always an interesting task for seismologists and are also the main objective of seismic hazard assessment. While, on one hand, numerical simulations have become more and more accurate and several different techniques have been developed, on the other hand ground motion prediction equations (GMPEs) have become a powerful instrument (due to great improvement of seismic strong motion networks providing a large amount of data). Nevertheless GMPEs do not represent the whole variety of source processes and this can lead to incorrect estimates especially in the near fault conditions because of the lack of records of large earthquakes at short distances. In such cases, physics-based ground motion simulations can be a valid tool to complement prediction equations for scenario studies, provided that both source and propagation are accurately described. We present here a comparison between numerical simulations performed in near fault conditions using two different kinematic source models, which are based on different assumptions and parameterizations: the "k-2 model" and the "fractal model". Wave propagation is taken into account using hybrid Green's function (HGF), which consists in coupling numerical Green's function with an empirical Green's function (EGF) approach. The advantage of this technique is that it does not require a very detailed knowledge of the propagation medium, but requires availability of high quality records of small earthquakes in the target area. The first application we show is on L'Aquila 2009 M 6.3 earthquake, where the main event records provide a benchmark for the synthetic waveforms. Here we can clearly observe which are the limitations of these techniques and investigate which are the physical parameters that are effectively controlling the ground motion level. The second application is a blind test on Upper Rhine Graben (URG) where active faults producing micro seismic activity are very close to sites of interest needing a careful investigation of seismic hazard. Finally we will perform a probabilistic seismic hazard analysis (PSHA) for the URG using numerical simulations to define input ground motion for different scenarios and compare them with a classical probabilistic study based on GMPEs.

Globular Clusters: Absolute Proper Motions and Galactic Orbits

NASA Astrophysics Data System (ADS)

Chemel, A. A.; Glushkova, E. V.; Dambis, A. K.; Rastorguev, A. S.; Yalyalieva, L. N.; Klinichev, A. D.

2018-04-01

We cross-match objects from several different astronomical catalogs to determine the absolute proper motions of stars within the 30-arcmin radius fields of 115 Milky-Way globular clusters with the accuracy of 1-2 mas yr-1. The proper motions are based on positional data recovered from the USNO-B1, 2MASS, URAT1, ALLWISE, UCAC5, and Gaia DR1 surveys with up to ten positions spanning an epoch difference of up to about 65 years, and reduced to Gaia DR1 TGAS frame using UCAC5 as the reference catalog. Cluster members are photometrically identified by selecting horizontal- and red-giant branch stars on color-magnitude diagrams, and the mean absolute proper motions of the clusters with a typical formal error of about 0.4 mas yr-1 are computed by averaging the proper motions of selected members. The inferred absolute proper motions of clusters are combined with available radial-velocity data and heliocentric distance estimates to compute the cluster orbits in terms of the Galactic potential models based on Miyamoto and Nagai disk, Hernquist spheroid, and modified isothermal dark-matter halo (axisymmetric model without a bar) and the same model + rotating Ferre's bar (non-axisymmetric). Five distant clusters have higher-than-escape velocities, most likely due to large errors of computed transversal velocities, whereas the computed orbits of all other clusters remain bound to the Galaxy. Unlike previously published results, we find the bar to affect substantially the orbits of most of the clusters, even those at large Galactocentric distances, bringing appreciable chaotization, especially in the portions of the orbits close to the Galactic center, and stretching out the orbits of some of the thick-disk clusters.

Vehicle lift-off modelling and a new rollover detection criterion

NASA Astrophysics Data System (ADS)

Mashadi, Behrooz; Mostaghimi, Hamid

2017-05-01

The modelling and development of a general criterion for the prediction of rollover threshold is the main purpose of this work. Vehicle dynamics models after the wheels lift-off and when the vehicle moves on the two wheels are derived and the governing equations are used to develop the rollover threshold. These models include the properties of the suspension and steering systems. In order to study the stability of motion, the steady-state solutions of the equations of motion are carried out. Based on the stability analyses, a new relation is obtained for the rollover threshold in terms of measurable response parameters. The presented criterion predicts the best time for the prevention of the vehicle rollover by applying a correcting moment. It is shown that the introduced threshold of vehicle rollover is a proper state of vehicle motion that is best for stabilising the vehicle with a low energy requirement.

Error modeling of precision orientation sensors in a fixed base simulation. Ph.D. Thesis; [models of noise and dynamic characteristics of a gyro and autocollimator for very small signals

NASA Technical Reports Server (NTRS)

Klinger, D. L.

1974-01-01

Models of noise and dynamic characteristics of gyro and autocollimator for very small signal levels are presented. Measurements were evaluated using spectral techniques for identifying noise from base motion. The experiment was constructed to measure the precession, due to relativistic effects, of an extremely precise earth-orbiting gyroscope. The design goal for nonrelativistic gyro drift is 0.001 arcsec per year. An analogous fixed base simulator was used in developing methods of instrument error modeling and performance evaluation applicable to the relativity experiment sensors and other precision pointing instruments. Analysis of autocollimator spectra uncovered the presence of a platform gimbal resonance. The source of resonance was isolated to gimbal bearing elastic restraint properties most apparent at very small levels of motion. A model of these properties which include both elastic and coulomb friction characteristics is discussed, and a describing function developed.

Statistics of Storm Updraft Velocities from TWP-ICE Including Verification with Profiling Measurements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collis, Scott; Protat, Alain; May, Peter T.

2013-08-01

Comparisons between direct measurements and modeled values of vertical air motions in precipitating systems are complicated by differences in temporal and spatial scales. On one hand, vertically profiling radars more directly measure the vertical air motion but do not adequately capture full storm dynamics. On the other hand, vertical air motions retrieved from two or more scanning Doppler radars capture the full storm dynamics but require model constraints that may not capture all updraft features because of inadequate sampling, resolution, numerical constraints, and the fact that the storm is evolving as it is scanned by the radars. To investigate themore » veracity of radar-based retrievals, which can be used to verify numerically modeled vertical air motions, this article presents several case studies from storm events around Darwin, Northern Territory, Australia, in which measurements from a dual-frequency radar profiler system and volumetric radar-based wind retrievals are compared. While a direct comparison was not possible because of instrumentation location, an indirect comparison shows promising results, with volume retrievals comparing well to those obtained from the profiling system. This prompted a statistical analysis of an extended period of an active monsoon period during the Tropical Warm Pool International Cloud Experiment (TWP-ICE). Results show less vigorous deep convective cores with maximum updraft velocities occurring at lower heights than some cloudresolving modeling studies suggest. 1. Introduction The regionalization of global climate models has been a driver of demand for more complex convective parameterization schemes. A key readjustment of the modeled atmosphere« less

Fast computation of derivative based sensitivities of PSHA models via algorithmic differentiation

NASA Astrophysics Data System (ADS)

Leövey, Hernan; Molkenthin, Christian; Scherbaum, Frank; Griewank, Andreas; Kuehn, Nicolas; Stafford, Peter

2015-04-01

Probabilistic seismic hazard analysis (PSHA) is the preferred tool for estimation of potential ground-shaking hazard due to future earthquakes at a site of interest. A modern PSHA represents a complex framework which combines different models with possible many inputs. Sensitivity analysis is a valuable tool for quantifying changes of a model output as inputs are perturbed, identifying critical input parameters and obtaining insight in the model behavior. Differential sensitivity analysis relies on calculating first-order partial derivatives of the model output with respect to its inputs. Moreover, derivative based global sensitivity measures (Sobol' & Kucherenko '09) can be practically used to detect non-essential inputs of the models, thus restricting the focus of attention to a possible much smaller set of inputs. Nevertheless, obtaining first-order partial derivatives of complex models with traditional approaches can be very challenging, and usually increases the computation complexity linearly with the number of inputs appearing in the models. In this study we show how Algorithmic Differentiation (AD) tools can be used in a complex framework such as PSHA to successfully estimate derivative based sensitivities, as is the case in various other domains such as meteorology or aerodynamics, without no significant increase in the computation complexity required for the original computations. First we demonstrate the feasibility of the AD methodology by comparing AD derived sensitivities to analytically derived sensitivities for a basic case of PSHA using a simple ground-motion prediction equation. In a second step, we derive sensitivities via AD for a more complex PSHA study using a ground motion attenuation relation based on a stochastic method to simulate strong motion. The presented approach is general enough to accommodate more advanced PSHA studies of higher complexity.

Two modes of motion of the alligator lizard cochlea: Measurements and model predictions

NASA Astrophysics Data System (ADS)

Aranyosi, A. J.; Freeman, Dennis M.

2005-09-01

Measurements of motion of an in vitro preparation of the alligator lizard basilar papilla in response to sound demonstrate elliptical trajectories. These trajectories are consistent with the presence of both a translational and rotational mode of motion. The translational mode is independent of frequency, and the rotational mode has a displacement peak near 5 kHz. These measurements can be explained by a simple mechanical system in which the basilar papilla is supported asymmetrically on the basilar membrane. In a quantitative model, the translational admittance is compliant while the rotational admittance is second order. Best-fit model parameters are consistent with estimates based on anatomy and predict that fluid flow across hair bundles is a primary source of viscous damping. The model predicts that the rotational mode contributes to the high-frequency slopes of auditory nerve fiber tuning curves, providing a physical explanation for a low-pass filter required in models of this cochlea. The combination of modes makes the sensitivity of hair bundles more uniform with radial position than that which would result from pure rotation. A mechanical analogy with the organ of Corti suggests that these two modes of motion may also be present in the mammalian cochlea.

Multi-model approach to characterize human handwriting motion.

PubMed

Chihi, I; Abdelkrim, A; Benrejeb, M

2016-02-01

This paper deals with characterization and modelling of human handwriting motion from two forearm muscle activity signals, called electromyography signals (EMG). In this work, an experimental approach was used to record the coordinates of a pen tip moving on the (x, y) plane and EMG signals during the handwriting act. The main purpose is to design a new mathematical model which characterizes this biological process. Based on a multi-model approach, this system was originally developed to generate letters and geometric forms written by different writers. A Recursive Least Squares algorithm is used to estimate the parameters of each sub-model of the multi-model basis. Simulations show good agreement between predicted results and the recorded data.

A Personal Navigation System Based on Inertial and Magnetic Field Measurements

DTIC Science & Technology

2010-09-01

MATLAB IMPLEMENTATION.................................................................74 G. A MODEL FOR PENDULUM MOTION SENSOR DATA...76 1. Pendulum Model for MATLAB Simulation....................................76 2. Sensor Data Generated with the Pendulum Model... PENDULUM ..................................................................................................88 I. FILTER PERFORMANCE WITH REAL PENDULUM DATA

Rapid modeling of complex multi-fault ruptures with simplistic models from real-time GPS: Perspectives from the 2016 Mw 7.8 Kaikoura earthquake

NASA Astrophysics Data System (ADS)

Crowell, B.; Melgar, D.

2017-12-01

The 2016 Mw 7.8 Kaikoura earthquake is one of the most complex earthquakes in recent history, rupturing across at least 10 disparate faults with varying faulting styles, and exhibiting intricate surface deformation patterns. The complexity of this event has motivated the need for multidisciplinary geophysical studies to get at the underlying source physics to better inform earthquake hazards models in the future. However, events like Kaikoura beg the question of how well (or how poorly) such earthquakes can be modeled automatically in real-time and still satisfy the general public and emergency managers. To investigate this question, we perform a retrospective real-time GPS analysis of the Kaikoura earthquake with the G-FAST early warning module. We first perform simple point source models of the earthquake using peak ground displacement scaling and a coseismic offset based centroid moment tensor (CMT) inversion. We predict ground motions based on these point sources as well as simple finite faults determined from source scaling studies, and validate against true recordings of peak ground acceleration and velocity. Secondly, we perform a slip inversion based upon the CMT fault orientations and forward model near-field tsunami maximum expected wave heights to compare against available tide gauge records. We find remarkably good agreement between recorded and predicted ground motions when using a simple fault plane, with the majority of disagreement in ground motions being attributable to local site effects, not earthquake source complexity. Similarly, the near-field tsunami maximum amplitude predictions match tide gauge records well. We conclude that even though our models for the Kaikoura earthquake are devoid of rich source complexities, the CMT driven finite fault is a good enough "average" source and provides useful constraints for rapid forecasting of ground motion and near-field tsunami amplitudes.

Economy of scale: a motion sensor with variable speed tuning.

PubMed

Perrone, John A

2005-01-26

We have previously presented a model of how neurons in the primate middle temporal (MT/V5) area can develop selectivity for image speed by using common properties of the V1 neurons that precede them in the visual motion pathway (J. A. Perrone & A. Thiele, 2002). The motion sensor developed in this model is based on two broad classes of V1 complex neurons (sustained and transient). The S-type neuron has low-pass temporal frequency tuning, p(omega), and the T-type has band-pass temporal frequency tuning, m(omega). The outputs from the S and T neurons are combined in a special way (weighted intersection mechanism [WIM]) to generate a sensor tuned to a particular speed, v. Here I go on to show that if the S and T temporal frequency tuning functions have a particular form (i.e., p(omega)/(m(omega) = k/omega), then a motion sensor with variable speed tuning can be generated from just two V1 neurons. A simple scaling of the S- or T-type neuron output before it is incorporated into the WIM model produces a motion sensor that can be tuned to a wide continuous range of optimal speeds.

Robustness of external/internal correlation models for real-time tumor tracking to breathing motion variations

NASA Astrophysics Data System (ADS)

Seregni, M.; Cerveri, P.; Riboldi, M.; Pella, A.; Baroni, G.

2012-11-01

In radiotherapy, organ motion mitigation by means of dynamic tumor tracking requires continuous information about the internal tumor position, which can be estimated relying on external/internal correlation models as a function of external surface surrogates. In this work, we propose a validation of a time-independent artificial neural networks-based tumor tracking method in the presence of changes in the breathing pattern, evaluating the performance on two datasets. First, simulated breathing motion traces were specifically generated to include gradually increasing respiratory irregularities. Then, seven publically available human liver motion traces were analyzed for the assessment of tracking accuracy, whose sensitivity with respect to the structural parameters of the model was also investigated. Results on simulated data showed that the proposed method was not affected by hysteretic target trajectories and it was able to cope with different respiratory irregularities, such as baseline drift and internal/external phase shift. The analysis of the liver motion traces reported an average RMS error equal to 1.10 mm, with five out of seven cases below 1 mm. In conclusion, this validation study proved that the proposed method is able to deal with respiratory irregularities both in controlled and real conditions.

A hybrid approach to estimate the complex motions of clouds in sky images

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peng, Zhenzhou; Yu, Dantong; Huang, Dong

Tracking the motion of clouds is essential to forecasting the weather and to predicting the short-term solar energy generation. Existing techniques mainly fall into two categories: variational optical flow, and block matching. In this article, we summarize recent advances in estimating cloud motion using ground-based sky imagers and quantitatively evaluate state-of-the-art approaches. Then we propose a hybrid tracking framework to incorporate the strength of both block matching and optical flow models. To validate the accuracy of the proposed approach, we introduce a series of synthetic images to simulate the cloud movement and deformation, and thereafter comprehensively compare our hybrid approachmore » with several representative tracking algorithms over both simulated and real images collected from various sites/imagers. The results show that our hybrid approach outperforms state-of-the-art models by reducing at least 30% motion estimation errors compared with the ground-truth motions in most of simulated image sequences. Furthermore, our hybrid model demonstrates its superior efficiency in several real cloud image datasets by lowering at least 15% Mean Absolute Error (MAE) between predicted images and ground-truth images.« less

A hybrid approach to estimate the complex motions of clouds in sky images

DOE PAGES

Peng, Zhenzhou; Yu, Dantong; Huang, Dong; ...

2016-09-14

Tracking the motion of clouds is essential to forecasting the weather and to predicting the short-term solar energy generation. Existing techniques mainly fall into two categories: variational optical flow, and block matching. In this article, we summarize recent advances in estimating cloud motion using ground-based sky imagers and quantitatively evaluate state-of-the-art approaches. Then we propose a hybrid tracking framework to incorporate the strength of both block matching and optical flow models. To validate the accuracy of the proposed approach, we introduce a series of synthetic images to simulate the cloud movement and deformation, and thereafter comprehensively compare our hybrid approachmore » with several representative tracking algorithms over both simulated and real images collected from various sites/imagers. The results show that our hybrid approach outperforms state-of-the-art models by reducing at least 30% motion estimation errors compared with the ground-truth motions in most of simulated image sequences. Furthermore, our hybrid model demonstrates its superior efficiency in several real cloud image datasets by lowering at least 15% Mean Absolute Error (MAE) between predicted images and ground-truth images.« less

Method and system for non-linear motion estimation

NASA Technical Reports Server (NTRS)

Lu, Ligang (Inventor)

2011-01-01

A method and system for extrapolating and interpolating a visual signal including determining a first motion vector between a first pixel position in a first image to a second pixel position in a second image, determining a second motion vector between the second pixel position in the second image and a third pixel position in a third image, determining a third motion vector between one of the first pixel position in the first image and the second pixel position in the second image, and the second pixel position in the second image and the third pixel position in the third image using a non-linear model, determining a position of the fourth pixel in a fourth image based upon the third motion vector.

Simple Harmonics Motion experiment based on LabVIEW interface for Arduino

NASA Astrophysics Data System (ADS)

Tong-on, Anusorn; Saphet, Parinya; Thepnurat, Meechai

2017-09-01

In this work, we developed an affordable modern innovative physics lab apparatus. The ultrasonic sensor is used to measure the position of a mass attached on a spring as a function of time. The data acquisition system and control device were developed based on LabVIEW interface for Arduino UNO R3. The experiment was designed to explain wave propagation which is modeled by simple harmonic motion. The simple harmonic system (mass and spring) was observed and the motion can be realized using curve fitting to the wave equation in Mathematica. We found that the spring constants provided by Hooke’s law and the wave equation fit are 9.9402 and 9.1706 N/m, respectively.