AtlA functions as a peptidoglycan lytic transglycosylase in the Neisseria gonorrhoeae type IV secretion system.

PubMed

Kohler, Petra L; Hamilton, Holly L; Cloud-Hansen, Karen; Dillard, Joseph P

2007-08-01

Type IV secretion systems require peptidoglycan lytic transglycosylases for efficient secretion, but the function of these enzymes is not clear. The type IV secretion system gene cluster of Neisseria gonorrhoeae encodes two peptidoglycan transglycosylase homologues. One, LtgX, is similar to peptidoglycan transglycosylases from other type IV secretion systems. The other, AtlA, is similar to endolysins from bacteriophages and is not similar to any described type IV secretion component. We characterized the enzymatic function of AtlA in order to examine its role in the type IV secretion system. Purified AtlA was found to degrade macromolecular peptidoglycan and to produce 1,6-anhydro peptidoglycan monomers, characteristic of lytic transglycosylase activity. We found that AtlA can functionally replace the lambda endolysin to lyse Escherichia coli. In contrast, a sensitive measure of lysis demonstrated that AtlA does not lyse gonococci expressing it or gonococci cocultured with an AtlA-expressing strain. The gonococcal type IV secretion system secretes DNA during growth. A deletion of ltgX or a substitution in the putative active site of AtlA severely decreased DNA secretion. These results indicate that AtlA and LtgX are actively involved in type IV secretion and that AtlA is not involved in lysis of gonococci to release DNA. This is the first demonstration that a type IV secretion peptidoglycanase has lytic transglycosylase activity. These data show that AtlA plays a role in type IV secretion of DNA that requires peptidoglycan breakdown without cell lysis.

[Diagnostic values of serum type III procollagen N-terminal peptide in type IV gastric cancer].

PubMed

Akazawa, S; Fujiki, T; Kanda, Y; Kumai, R; Yoshida, S

1985-04-01

Since increased synthesis of collagen has been demonstrated in tissue of type IV gastric cancer, we attempted to distinguish type IV gastric cancer from other cancers by measuring serum levels of type III procollagen N-terminal peptide (type III-N-peptide). Mean serum levels in type IV gastric cancer patients without metastasis were found to be elevated above normal values and developed a tendency to be higher than those in types I, II and III gastric cancer patients without metastasis. Highly positive ratios were found in patients with liver diseases including hepatoma and colon cancer, biliary tract cancer, and esophageal cancer patients with liver, lung or bone metastasis, but only 2 out of 14 of these cancer patients without such metastasis showed positive serum levels of type III-N-peptide. Positive cases in patients with type IV gastric cancer were obtained not only in the group with clinical stage IV but also in the groups with clinical stages II and III. In addition, high serum levels of type III-N-peptide in patients with type IV gastric cancer were seen not only in the cases with liver, lung or bone metastasis but also in cases with disseminated peritoneal metastasis alone. These results suggest that if the serum level of type III-N-peptide is elevated above normal values, type IV gastric cancer should be suspected after ruling out liver diseases, myelofibrosis and liver, lung or bone metastasis.

Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues.

PubMed

Foldager, Casper Bindzus; Toh, Wei Seong; Gomoll, Andreas H; Olsen, Bjørn Reino; Spector, Myron

2014-04-01

The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti-collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM.

Genetics Home Reference: familial porencephaly

MedlinePlus

... one component of a protein called type IV collagen. Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

Genetics Home Reference: multicentric osteolysis, nodulosis, and arthropathy

MedlinePlus

... to cut (cleave) a protein called type IV collagen. Type IV collagen is a major structural component of basement membranes, ... enzyme, preventing the normal cleavage of type IV collagen. It is unclear how a loss of enzyme ...

viking: identification and characterization of a second type IV collagen in Drosophila.

PubMed

Yasothornsrikul, S; Davis, W J; Cramer, G; Kimbrell, D A; Dearolf, C R

1997-10-01

We have taken an enhancer trap approach to identify genes that are expressed in hematopoietic cells and tissues of Drosophila. We conducted a molecular analysis of two P-element insertion strains that have reporter gene expression in embryonic hemocytes, strain 197 and vikingICO. This analysis has determined that viking encodes a collagen type IV gene, alpha2(IV). The viking locus is located adjacent to the previously described DCg1, which encodes collagen alpha1(IV), and in the opposite orientation. The alpha2(IV) and alpha1(IV) collagens are structurally very similar to one another, and to vertebrate type IV collagens. In early development, viking and DCg1 are transcribed in the same tissue-specific pattern, primarily in the hemocytes and fat body cells. Our results suggest that both the alpha1 and alpha2 collagen IV chains may contribute to basement membranes in Drosophila. This work also provides the foundation for a more complete genetic dissection of collagen type IV molecules and their developmental function in Drosophila.

A more accurate method using MOVES (Motor Vehicle Emission Simulator) to estimate emission burden for regional-level analysis.

PubMed

Liu, Xiaobo

2015-07-01

The U.S. Environmental Protection Agency's (EPA) Motor Vehicle Emission Simulator (MOVES) is required by the EPA to replace Mobile 6 as an official on-road emission model. Incorporated with annual vehicle mile traveled (VMT) by Highways Performance Monitoring System (HPMS) vehicle class, MOVES allocates VMT from HPMS to MOVES source (vehicle) types and calculates emission burden by MOVES source type. However, the calculated running emission burden by MOVES source type may be deviated from the actual emission burden because of MOVES source population, specifically the population fraction by MOVES source type in HPMS vehicle class. The deviation is also the result of the use of the universal set of parameters, i.e., relative mileage accumulation rate (relativeMAR), packaged in MOVES default database. This paper presents a novel approach by adjusting the relativeMAR to eliminate the impact of MOVES source population on running exhaust emission and to keep start and evaporative emissions unchanged for both MOVES2010b and MOVES2014. Results from MOVES runs using this approach indicated significant improvements on VMT distribution and emission burden estimation for each MOVES source type. The deviation of VMT by MOVES source type is minimized by using this approach from 12% to less than 0.05% for MOVES2010b and from 50% to less than 0.2% for MOVES2014 except for MOVES source type 53. Source type 53 still remains about 30% variation. The improvement of VMT distribution results in the elimination of emission burden deviation for each MOVES source type. For MOVES2010b, the deviation of emission burdens decreases from -12% for particulate matter less than 2.5 μm (PM2.5) and -9% for carbon monoxide (CO) to less than 0.002%. For MOVES2014, it drops from 80% for CO and 97% for PM2.5 to 0.006%. This approach is developed to more accurately estimate the total emission burdens using EPA's MOVES, both MOVES2010b and MOVES2014, by redistributing vehicle mile traveled (VMT) by Highways Performance Monitoring System (HPMS) class to MOVES source type on the basis of comprehensive traffic study, local link-by-link VMT broken down into MOVES source type.

Distribution of type IV collagen in pancreatic adenocarcinoma and chronic pancreatitis.

PubMed Central

Lee, C. S.; Montebello, J.; Georgiou, T.; Rode, J.

1994-01-01

Changes in the basement membrane are present in various neoplastic conditions such as neurofibrosarcoma, cervical carcinoma, colorectal cancers and hepatoblastoma. This study examines the expression of type IV collagen in the basement membrane, using an immunohistochemical method, in the normal pancreas (n = 10), chronic pancreatitis (n = 15) and pancreatic adenocarcinoma (n = 30). The formalin fixed, paraffin embedded tissue was sectioned and pretreated with protease prior to immunostaining for type IV collagen. There was a statistically significant difference in type IV collagen expression between pancreatic carcinoma and chronic pancreatitis (P = 0.0001; chi 2 test with continuity correction). In pancreatic adenocarcinoma, type IV collagen distribution in the basement membrane was discontinuous and irregular or absent around individual or groups of neoplastic cells (n = 30). Most cases of chronic pancreatitis showed continuous pattern of basement membrane type IV collagen around residual ducts (n = 10). In the normal pancreas, only one of the ten cases showed discontinuous basement membrane around pancreatic ducts, while in the rest of the cases, the pattern was continuous. This study suggests that there is abnormal distribution of type IV collagen in the basement membrane in pancreatic carcinoma, which may be related to either abnormal deposition or degradation of the collagen. Immunostaining for type IV collagen may be of some diagnostic use for distinguishing pancreatic adenocarcinoma from problematic cases of chronic pancreatitis. Images Figure 1 Figure 2 Figure 3 PMID:8199008

Genetics Home Reference: hereditary angiopathy with nephropathy, aneurysms, and muscle cramps syndrome

MedlinePlus

... one component of a protein called type IV collagen . Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

Evaluation of secondary alveolar bone grafting outcomes performed after canine eruption in complete unilateral cleft lip and palate.

PubMed

Lorenzoni, Diego Coelho; Janson, Guilherme; Bastos, Juliana Cunha; Carvalho, Roberta Martinelli; Bastos, José Carlos; de Cássia Moura Carvalho Lauris, Rita; Henriques, José Fernando Castanha; Ozawa, Terumi Okada

2017-01-01

Evaluate the results of secondary alveolar bone grafting (SABG) in patients with complete unilateral cleft lip and palate (UCLP), operated after permanent canine eruption (CE). Seventy-four periapical radiographs from patients with complete UCLP (mean age 14 years) submitted to SABG were retrospectively analyzed for the amount of bone in the cleft site through the Bergland and Chelsea scales. Of the cases, 47.3 % was classified as Bergland type I and Chelsea type A, 35.2 % as type II/C, 6.7 % as type III/D, and 10.8 % as type IV/failure. When the canine was moved into the grafted area, the success rate (type I/A) was 56.8 %; for cases in which the space was maintained for an implant or prosthetic finishing, the index was 45.8 %; however, this difference was not statistically significant. Even in advanced ages, after permanent canine eruption, SABG can be considered a highly successful procedure. This research shows good results of secondary alveolar bone grafting performed in patients with unilateral complete cleft lip and palate, even when it was performed after eruption of the permanent canine in the cleft area.

Type IV collagen is a novel DEJ biomarker that is reduced by radiotherapy.

PubMed

McGuire, J D; Gorski, J P; Dusevich, V; Wang, Y; Walker, M P

2014-10-01

The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy--teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. © International & American Associations for Dental Research.

Type IV Collagen is a Novel DEJ Biomarker that is Reduced by Radiotherapy

PubMed Central

McGuire, J.D.; Gorski, J.P.; Dusevich, V.; Wang, Y.; Walker, M.P.

2014-01-01

The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy – teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. PMID:25146181

Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues

PubMed Central

Toh, Wei Seong; Gomoll, Andreas H.; Olsen, Bjørn Reino; Spector, Myron

2014-01-01

Objective: The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Design: Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti–collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. Results: When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. Conclusions: We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM. PMID:26069692

Children's purchase behavior in the snack market: Can branding or lower prices motivate healthier choices?

PubMed

Hartmann, Monika; Cash, Sean B; Yeh, Ching-Hua; Landwehr, Stefanie C; McAlister, Anna R

2017-10-01

Children's dietary-related diseases and their associated costs have expanded dramatically in many countries, making children's food choice a policy issue of increasing relevance. As children spend a considerable amount of money on energy-dense, nutrient-poor (EDNP) products, a better understanding of the main drivers of children's independent food purchase decisions is crucial to move this behavior toward healthier options. The objective of the study is to investigate the role of branding and price in motivating children to choose healthier snack options. The study investigates snack choices of children ages 8 to 11, using a survey and a purchase experiment. The research took place in after-school programs of selected schools in the Boston area. Participants included 116 children. Products in the choice experiment differed on three factors: product type, brand, and price. Data were analyzed using aggregated and mixed logit models. Children's purchase decisions are primarily determined by product type (Importance Value (IV) 56.6%), while brand (IV 22.8%) and price (IV 20.6%) prove to be of less relevance. Only those children who state that they like the familiar brand reveal a preference for the branded product in their purchase decision. Price is a significant predictor of choice when controlling for whether or not children obtain an allowance. It is not simple brand awareness but a child's liking of the brand that determines whether a brand is successful in motivating a child to choose a product. The extent of children's experience with money influences their price responsiveness. To the extent that children who receive an allowance are primarily the ones buying food snacks, higher prices for EDNP snacks could be successful in motivating children to choose a healthier option. Copyright © 2017 Elsevier Ltd. All rights reserved.

Expanding AirSTAR Capability for Flight Research in an Existing Avionics Design

NASA Technical Reports Server (NTRS)

Laughter, Sean A.

2012-01-01

The NASA Airborne Subscale Transport Aircraft Research (AirSTAR) project is an Unmanned Aerial Systems (UAS) test bed for experimental flight control laws and vehicle dynamics research. During its development, the test bed has gone through a number of system permutations, each meant to add functionality to the concept of operations of the system. This enabled the build-up of not only the system itself, but also the support infrastructure and processes necessary to support flight operations. These permutations were grouped into project phases and the move from Phase-III to Phase-IV was marked by a significant increase in research capability and necessary safety systems due to the integration of an Internal Pilot into the control system chain already established for the External Pilot. The major system changes in Phase-IV operations necessitated a new safety and failsafe system to properly integrate both the Internal and External Pilots and to meet acceptable project safety margins. This work involved retrofitting an existing data system into the evolved concept of operations. Moving from the first Phase-IV aircraft to the dynamically scaled aircraft further involved restructuring the system to better guard against electromagnetic interference (EMI), and the entire avionics wiring harness was redesigned in order to facilitate better maintenance and access to onboard electronics. This retrofit and harness re-design will be explored and how it integrates with the evolved Phase-IV operations.

Asymmetric distribution of type IV pili triggered by directional light in unicellular cyanobacteria

PubMed Central

Nishizaka, Takayuki

2017-01-01

The type IV pili (T4P) system is a supermolecular machine observed in prokaryotes. Cells repeat the cycle of T4P extension, surface attachment, and retraction to drive twitching motility. Although the properties of T4P as a motor have been scrutinized with biophysics techniques, the mechanism of regulation remains unclear. Here we provided the framework of the T4P dynamics at the single-cell level in Synechocystis sp. PCC6803, which can recognize light direction. We demonstrated that the dynamics was detected by fluorescent beads under an optical microscope and controlled by blue light that induces negative phototaxis; extension and retraction of T4P was activated at the forward side of lateral illumination to move away from the light source. Additionally, we directly visualized each pilus by fluorescent labeling, allowing us to quantify their asymmetric distribution. Finally, quantitative analyses of cell tracking indicated that T4P was generated uniformly within 0.2 min after blue-light exposure, and within the next 1 min the activation became asymmetric along the light axis to achieve directional cell motility; this process was mediated by the photo-sensing protein, PixD. This sequential process provides clues toward a general regulation mechanism of T4P system, which might be essentially common between archaella and other secretion apparatuses. PMID:28584115

Type IV Ehlers-Danlos Syndrome: A Surgical Emergency? A Case of Massive Retroperitoneal Hemorrhage

PubMed Central

Chun, Stephen G; Pedro, Patrick; Yu, Mihae; Takanishi, Danny M

2011-01-01

Retroperitoneal hemorrhagic bleeding is a known manifestation of Type-IV Ehlers-Danlos Syndrome that is caused by loss-of-function mutations of the pro-alpha-1 chains of type III pro-collagen (COL3A1) resulting in vascular fragility. A number of previous reports describe futile surgical intervention for retroperitoneal bleeding in Type-IV Ehlers-Danlos Syndrome with high post-operative mortality, although the rarity of retroperitoneal bleeding associated with Type-IV Ehlers-Danlos Syndrome precludes an evidence-based approach to clinical management. We report a 23-year-old male with history of Type-IV Ehlers-Danlos Syndrome who presented with severe abdominal pain and tachycardia following an episode of vomiting. Further work-up of his abdominal pain revealed massive retroperitoneal bleeding by CT-scan of the abdomen. Given numerous cases of catastrophic injury caused by surgical intervention in Type-IV Ehlers-Danlos Syndrome, the patient was treated non-operatively, and the patient made a full recovery. This case suggests that even in cases of large retroperitoneal hemorrhages associated with Ehlers-Danlos Syndrome, it may not truly represent a surgical emergency. PMID:21966332

76 FR 66281 - Defense Transportation Regulation, Part IV

Federal Register 2010, 2011, 2012, 2013, 2014

2011-10-26

... managed to serve our DoD customers. Industry will be notified of any subsequent DoD decisions associated with the future of local moves. We thank our industry partners for their review and important...

DSM-5 changes enhance parent identification of symptoms in adolescents with ADHD.

PubMed

Sibley, Margaret H; Kuriyan, Aparajita B

2016-08-30

This study evaluates the impact of the DSM-5 ADHD symptom wording changes on symptom endorsement among adolescents with ADHD. Parents of adolescents with systematically diagnosed DSM-IV-TR ADHD (N=78) completed counterbalanced DSM-IV-TR and DSM-5 ADHD symptom checklists in a single sitting. General linear models were conducted to evaluate whether the new DSM-5 symptom descriptors influenced the total number of ADHD symptoms and overall ADHD symptom severity endorsed by parents, how demographic factors were associated with noted changes in symptom endorsement when moving to the DSM-5, and which DSM ADHD items displayed notable changes in endorsement rates under the new wording. On average, parents identified 1.15 additional symptoms of ADHD in adolescents when moving from the DSM-IV-TR to the DSM-5. Increased symptom identification was not specific to age, sex, ethnicity, race, or socioeconomic status. Over half of the sample experienced increased symptom endorsement when changing texts (59.0%). Under the new DSM-5 wording, four symptoms had statistically significant endorsement increases (range: 11.2-16.7%): difficulty sustaining attention, easily distracted, difficulty organizing tasks and activities, and does not seem to listen. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Emission lines in the long period Cepheid l Carinae

NASA Technical Reports Server (NTRS)

Boehm-Vitense, Erika; Love, Stanley G.

1991-01-01

For the Cepheid (l) Carinae with a pulsation period of 35.5 days we have studied the emission line fluxes as a function of pulsational phase in order to find out whether we see chromosphere and transition layer emission or whether we see emission due to an outward moving shock. All emission lines show a steep increase in flux shortly before maximum light suggestive of a shock moving through the surface layers. The large ratio of the C IV to C II line fluxes shows that these are not transition layer lines. During maximum light the large ratio of the C IV to C II line fluxes also suggests that we see emission from a shock with velocities greater than 100 km/sec such that C IV emission can be excited. With such velocities mass outflow appears possible. The variations seen in the Mg II line profiles show that there is an internal absorption over a broad velocity band independent of the pulsational phase. We attribute this absorption to a circumstellar 'shell'. This 'shell' appears to be seen also as spatially extended emission in the O I line at 1300 angstrom, which is probably excited by resonance with Ly beta.

Consensus in controversy: The modified Delphi method applied to Gynecologic Oncology practice.

PubMed

Cohn, David E; Havrilesky, Laura J; Osann, Kathryn; Lipscomb, Joseph; Hsieh, Susie; Walker, Joan L; Wright, Alexi A; Alvarez, Ronald D; Karlan, Beth Y; Bristow, Robert E; DiSilvestro, Paul A; Wakabayashi, Mark T; Morgan, Robert; Mukamel, Dana B; Wenzel, Lari

2015-09-01

To determine the degree of consensus regarding the probabilities of outcomes associated with IP/IV and IV chemotherapy. A survey was administered to an expert panel using the Delphi method. Ten ovarian cancer experts were asked to estimate outcomes for patients receiving IP/IV or IV chemotherapy. The clinical estimates were: 1) probability of completing six cycles of chemotherapy, 2) probability of surviving five years, 3) median survival, and 4) probability of ER/hospital visits during treatment. Estimates for two patients, one with a low comorbidity index (patient 1) and the other with a moderate index (patient 2), were included. The survey was administered in three rounds, and panelists could revise their subsequent responses based on review of the anonymous opinions of their peers. The ranges were smaller for IV compared with IP/IV therapy. Ranges decreased with each round. Consensus converged around outcomes related to IP/IV chemotherapy for: 1) completion of 6 cycles of therapy (type 1 patient, 62%, type 2 patient, 43%); 2) percentage of patients surviving 5 years (type 1 patient, 66%, type 2 patient, 47%); and 3) median survival (type 1 patient, 83 months, type 2 patient, 58 months). The group required three rounds to achieve consensus on the probabilities of ER/hospital visits (type 1 patient, 24%, type 2 patient, 35%). Initial estimates of survival and adverse events associated with IP/IV chemotherapy differ among experts. The Delphi process works to build consensus and may be a pragmatic tool to inform patients of their expected outcomes. Copyright © 2015 Elsevier Inc. All rights reserved.

Change in genotype of methicillin-resistant Staphylococcus aureus (MRSA) affects the antibiogram of hospital-acquired MRSA.

PubMed

Harada, Dai; Nakaminami, Hidemasa; Miyajima, Eri; Sugiyama, Taku; Sasai, Nao; Kitamura, Yoshinobu; Tamura, Taku; Kawakubo, Takashi; Noguchi, Norihisa

2018-07-01

Recently, the dissemination of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) into hospitals has frequently been reported worldwide. Hospital-acquired MRSA (HA-MRSA) strains exhibit high-level resistance to multiple antimicrobial agents, whereas CA-MRSA strains are usually susceptible to non-β-lactams. Thus, it is predicted that the antibiogram of the HA-MRSA population would change along with the change in genotype of MRSA. Here, we investigated the changes in the MRSA population along with the MRSA antibiogram in a hospital between 2010 and 2016. Staphylococcal cassette chromosome (SCC) mec typing showed that the predominant HA-MRSA strains in the hospital dramatically changed from SCCmec type II, which is the major type of HA-MRSA, to SCCmec type IV, which is the major type of CA-MRSA. Multilocus sequence typing revealed that the predominant SCCmec type IV strain was a clonal complex (CC) 8 clone, which is mainly found among CA-MRSA. Furthermore, the CC1-SCCmec type IV (CC1-IV) clone significantly increased. Both the CC8-IV and CC1-IV clones exhibited high antimicrobial susceptibility. The antibiogram change of the HA-MRSA population was consistent with the antimicrobial susceptibilities and increased prevalence of the CC8-IV and CC1-IV clones. Our data reveal that the change in the genotypes of MRSA strains could impact the antibiogram of HA-MRSA population. Copyright © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Independent verification and validation for Space Shuttle flight software

NASA Technical Reports Server (NTRS)

1992-01-01

The Committee for Review of Oversight Mechanisms for Space Shuttle Software was asked by the National Aeronautics and Space Administration's (NASA) Office of Space Flight to determine the need to continue independent verification and validation (IV&V) for Space Shuttle flight software. The Committee found that the current IV&V process is necessary to maintain NASA's stringent safety and quality requirements for man-rated vehicles. Therefore, the Committee does not support NASA's plan to eliminate funding for the IV&V effort in fiscal year 1993. The Committee believes that the Space Shuttle software development process is not adequate without IV&V and that elimination of IV&V as currently practiced will adversely affect the overall quality and safety of the software, both now and in the future. Furthermore, the Committee was told that no organization within NASA has the expertise or the manpower to replace the current IV&V function in a timely fashion, nor will building this expertise elsewhere necessarily reduce cost. Thus, the Committee does not recommend moving IV&V functions to other organizations within NASA unless the current IV&V is maintained for as long as it takes to build comparable expertise in the replacing organization.

Differential expression of basement membrane type IV collagen α2 and α6 chains as a prognostic factor in patients with extrahepatic bile duct carcinoma.

PubMed

Hirashima, Kotaro; Iyama, Ken-Ichi; Baba, Yoshifumi; Honda, Yumi; Sado, Yoshikazu; Ninomiya, Yoshifumi; Watanabe, Masayuki; Takamori, Hiroshi; Beppu, Toru; Baba, Hideo

2013-03-01

The destruction of the basement membrane (BM) is the first step in cancer invasion and metastasis. Type IV collagen is a major component of the BM, and is composed of six genetically distinct α(IV) chains; α1(IV) to α6(IV). The loss of α5(IV) and α6(IV) chains from the epithelial BM at the early stage of cancer invasion has been reported in several types of cancers. However, the expression of α5(IV) and α6(IV) chains in extrahepatic bile duct carcinoma (EBDC) remains unclear. We examined the expression of α(IV) chains by immunohistochemistry using 71 resected EBDC specimens. Prognostic significance of α(IV) chains was examined by Cox regression and Kaplan-Meier analyses. In the invasive cancer, the expression of α6(IV) chain in the BM was lost partially or completely preceded by the loss of α2(IV) chain. The loss of α6(IV) chain in the BM of the invasive cancer was related to the tumor classification, TNM stages, and the expression of α2(IV) chain. The patients with α2(IV)-negative and α6(IV)-negative chains had significantly poorer prognosis than those with α2(IV)-positive and α6(IV)-positive/negative chains (P = 0.04). The loss of α2(IV) and α6(IV) chains might be a useful prognostic factor in patients with EBDC. Copyright © 2012 Wiley Periodicals, Inc.

Creep Strength Behavior of Boron Added P91 Steel and its Weld in the Temperature Range of 600-650°C

NASA Astrophysics Data System (ADS)

Swaminathan, J.; Das, C. R.; Baral, Jayashree; Phaniraj, C.; Ghosh, R. N.; Albert, S. K.; Bhaduri, A. K.

One of the promising ways for mitigation of Type IV cracking — a failure by cracking at the intercritical /fine grained heat affected zone, a life limiting problem in advanced 9-12 Cr ferritic steel weld like that of P91 is through modification of alloy composition by addition of boron. Addition of boron was observed to improve the microstructure at the weld zone and hence the creep strength. In the present work, boron (100 ppm with controlled nitrogen) added P91 steel after normalizing at 1050°C and 1150°C and tempered at 760°C were studied for the creep behavior in the base metal and welded condition in the temperature range of 600-650°C. Creep strength was characterized in terms of stress and temperature dependence of creep rate and rupture time. Weld creep life was reduced compared to the base metal with rupture occurring at the ICHAZ (Type IV crack). However at longer time (at lower stress levels) exposure creep crack moves from weld metal to HAZ (Type II crack). Rupture life was found to superior for the base and weld in the boron containing steel when higher normalizing temperature is used. Estimation of 105 h was attempted based on short term rupture data available and weld strength factors were calculated. Observed values are better for P91BH condition than the values for P91BLcondition as well as those available for P91 in open literature

Construction, Test and Delivery of Standardized Coaxial Magnetron.

DTIC Science & Technology

1981-09-23

Cavity Pressurization and Pressure Switch . .. 13 4.0 PERFORNANCE OF BAND IV, VMS-1104 COAXIAL AAGNETRON. 14 4.1 Initial Test of Band IV, VNS-1I04, S/N...of the magnetron. 3.7 Ship Air Pressure Switch The insertion of the magnetron deeper into the cabinet to obtain proper alignment of the tube and...waveguide run required reloca- tion of the ship air pressure switch . The switch was moved approxi- mately two inches deeper into the cabinet and rebolted

The role of Shewanella oneidensis MR-1 outer surface structures in extracellular electron transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouhenni, Rachida; Vora, Gary J.; Biffinger, Justin C.

2010-04-20

Shewanella oneidensis is a facultative anaerobe that uses more than 14 different terminal electron acceptors for respiration. These include metal oxides and hydroxyoxides, and toxic metals such as uranium and chromium. Mutants deficient in metal reduction were isolated using the mariner transposon derivative, minihimar RB1. These included mutants with transposon insertions in the prepilin peptidase and type II secretion system genes. All mutants were deficient in Fe(III) and Mn(IV) reduction, and exhibited slow growth when DMSO was used as the electron acceptor. The genome sequence of S. oneidensis contains one prepilin peptidase gene, pilD. A similar prepilin peptidase that maymore » function in the processing of type II secretion prepilins was not found. Single and multiple chromosomal deletions of four putative type IV pilin genes did not affect Fe(III) and Mn(IV) reduction. These results indicate that PilD in S. oneidensis is responsible for processing both type IV and type II secretion prepilin proteins. Type IV pili do not appear to be required for Fe(III) and Mn(IV) reduction.« less

Essential core of the Hawking–Ellis types

NASA Astrophysics Data System (ADS)

Martín-Moruno, Prado; Visser, Matt

2018-06-01

The Hawking–Ellis (Segre–Plebański) classification of possible stress–energy tensors is an essential tool in analyzing the implications of the Einstein field equations in a more-or-less model-independent manner. In the current article the basic idea is to simplify the Hawking–Ellis type I, II, III, and IV classification by isolating the ‘essential core’ of the type II, type III, and type IV stress–energy tensors; this being done by subtracting (special cases of) type I to simplify the (Lorentz invariant) eigenvalue structure as much as possible without disturbing the eigenvector structure. We will denote these ‘simplified cores’ type II0, type III0, and type IV0. These ‘simplified cores’ have very nice and simple algebraic properties. Furthermore, types I and II0 have very simple classical interpretations, while type IV0 is known to arise semi-classically (in renormalized expectation values of standard stress–energy tensors). In contrast type III0 stands out in that it has neither a simple classical interpretation, nor even a simple semi-classical interpretation. We will also consider the robustness of this classification considering the stability of the different Hawking–Ellis types under perturbations. We argue that types II and III are definitively unstable, whereas types I and IV are stable.

Primary Intravenous Set Consumption Across 3 Branded Infusion Pumps

PubMed Central

Hedlund, Nancy; Sarangpur, Shishir; Kayler, Shannon; O'Brien, Kathy

2017-01-01

This retrospective study of 6426 hip replacement, coronary artery bypass graft, and colectomy surgeries across 23 US hospitals found that intravenous (IV) set designs that can be interchanged for use both in gravity-fed and automated pump delivery systems are replaced less frequently than IV sets designed for use primarily by one delivery method. Semistructured interviews with nurses highlighted the impact of set design on nursing workflow when moving between gravity-fed and pump-based administration. Use of interchangeable, single-design IV sets across gravity and automated infusions minimizes disruptions to closed systems, may reduce nurses being distracted from patients' clinical needs when replacing sets, and may yield supply cost savings. PMID:28682999

Observational properties of decameter type IV bursts

NASA Astrophysics Data System (ADS)

Melnik, Valentin; Brazhenko, Anatoly; Rucker, Helmut; Konovalenko, Alexander; Briand, Carine; Dorovskyy, Vladimir; Zarka, Philippe; Frantzusenko, Anatoly; Panchenko, Michael; Poedts, Stefan; Zaqarashvili, Teimuraz; Shergelashvili, Bidzina

2013-04-01

Oscillations of decameter type IV bursts were registered during observations of solar radio emission by UTR-2, URAN-2 and NDA in 2011-2012. Large majority of these bursts were accompanied by coronal mass ejections (CMEs), which were observed by SOHO and STEREO in the visible light. Only in some cases decameter type IV bursts were not associated with CMEs. The largest periods of oscillations P were some tens of minutes. There were some modes of long periods of oscillations simultaneously. Periods of oscillations in flux and in polarization profiles were close. Detailed properties of oscillations at different frequencies were analyzed on the example of two type IV bursts. One of them was observed on April 7, 2011 when a CME happened. Another one (August 1, 2011) was registered without any CME. The 7 April type IV burst had two periods in the frames 75-85 and 35-85 minutes. Interesting feature of these oscillations is decreasing periods with time. The observed decreasing rates dP/dt equaled 0.03-0.07. Concerning type IV burst observed on August 1, 2011 the period of its oscillations increases from 17 min. at 30 MHz to 44 min. at 10 MHz. Connection of type IV burst oscillations with oscillations of magnetic arches and CMEs at corresponding altitudes are discussed. The work is fulfilled in the frame of FP7 project "SOLSPANET".

Endovascular repair of an iliac artery aneurysm in a patient with Ehlers-Danlos syndrome type IV.

PubMed

Tonnessen, Britt H; Sternbergh, W Charles; Mannava, Krishna; Money, Samuel R

2007-01-01

Ehlers-Danlos type IV (EDS-IV) is an inherited condition most notable for its associated vascular complications. Patients are prone to aneurysm formation, arterial dissection, and spontaneous vessel rupture. Intervention for the vascular pathology of EDS-IV carries high morbidity and mortality. We describe a case of a 57-year-old man with EDS-IV and an expanding iliac aneurysm who underwent successful endovascular repair with a stent-graft. Endovascular aneurysm repair is feasible and should be considered for patients with EDS-IV.

Urinary type IV collagen is related to left ventricular diastolic function and brain natriuretic peptide in hypertensive patients with prediabetes.

PubMed

Iida, Masato; Yamamoto, Mitsuru; Ishiguro, Yuko S; Yamazaki, Masatoshi; Ueda, Norihiro; Honjo, Haruo; Kamiya, Kaichirou

2014-01-01

Urinary type IV collagen is an early biomarker of diabetic nephropathy. Concomitant prediabetes (the early stage of diabetes) was associated with left ventricular (LV) diastolic dysfunction and increased brain natriuretic peptide (BNP) in hypertensive patients. We hypothesized that urinary type IV collagen may be related to these cardiac dysfunctions. We studied hypertensive patients with early prediabetes (HbA1c <5.7% and fasting glucose >110, n=18), those with prediabetes (HbA1c 5.7-6.4, n=98), and those with diabetes (HbA1c>6.5 or on diabetes medications, n=92). The participants underwent echocardiography to assess left atrial volume/body surface area (BSA) and the ratio of early mitral flow velocity to mitral annular velocity (E/e'). Left ventricular diastolic dysfunction (LVDD) was defined if patients had E/e'≥15, or E/e'=9-14 accompanied by left atrial volume/BSA≥32ml/mm(2). Urinary samples were collected for type IV collagen and albumin, and blood samples were taken for BNP and HbA1c. Urinary type IV collagen and albumin increased in parallel with the deterioration of glycemic status. In hypertensive patients with prediabetes, subjects with LVDD had higher levels of BNP and urinary type IV collagen than those without LVDD. In contrast, in hypertensive patients with diabetes, subjects with LVDD had higher urinary albumin and BNP than those without LVDD. Urinary type IV collagen correlated positively with BNP in hypertensive patients with prediabetes, whereas it correlated with HbA1c in those with diabetes. In hypertensive patients with prediabetes, urinary type IV collagen was associated with LV diastolic dysfunction and BNP. Copyright © 2014 Elsevier Inc. All rights reserved.

A comparative study of percutaneous atherectomy for femoropopliteal arterial occlusive disease.

PubMed

Gu, Yongquan; Malas, Mahmoud B; Qi, Lixing; Guo, Lianrui; Guo, Jianming; Yu, Hengxi; Tong, Zhu; Gao, Xixiang; Zhang, Jian; Wang, Zhonggao

2017-08-01

SilverHawk™ directional atherectomy has been used to treat more than 300 thousand cases of lower extremity atherosclerotic occlusive disease in the world since it was approved by FDA in 2003. This study aimed to analyze the safety and effectiveness of symptomatic femoral popliteal atherosclerotic disease treated by directional atherectomy (DA). Clinical data of all consecutive patients treated with percutaneous atherectomy utilizing the SilverHawk™ plaque excision was retrospectively analyzed. The anatomic criteria of the atherosclerotic lesions were divided into four types: type I stenosis; type II occlusion; type III in-stent restenosis; type IV stent occlusion. There were 160 patients treated during the study period. Intermittent claudication in 75 patients (47%), rest pain in 55 patients (34.5%) and tissue loss in 30 patients (18.5%). The number of patients was 72, 15, 49 and 24 in type I, II, III and IV lesions, respectively. Technical success rate was 98.6%, 93.3%, 97.9% and 91.7% in type I, II, III and IV lesions, respectively. Debris of intimal plaque was captured by protection device in 92 patients (71.3%). The mean follow-up period was 23.5±10.4 months. Restenosis rate of type I to IV lesions was 21%, 36%, 36% and 40% respectively. Restenosis rate in type I lesion was significantly lower than that in type III and IV lesions (P<0.05). Patients with tissue loss responded to revascularization as follow: type I, 11/13 healed or reduced (84.6%), type II, 3/3 patients improved (100%), type III, 5/6 patients improved (83.3%) and type IV 4/4 healed (100%). In type IV group, four patients had in-stent thrombosis found by postoperative Duplex ultrasonography. They all underwent DA after catheter-directed thrombolysis with good angiographic results. Percutaneous DA is safe and effective for both de-novo atherosclerotic and in-stent stenotic or occlusive lesions. Thrombolysis before plaque excision is recommended in case of in-stenting thrombosis.

Genetic ablation or pharmacological blockade of dipeptidyl peptidase IV does not impact T cell-dependent immune responses

PubMed Central

Vora, Kalpit A; Porter, Gene; Peng, Roche; Cui, Yan; Pryor, Kellyann; Eiermann, George; Zaller, Dennis M

2009-01-01

Background Current literature suggests that dipeptidyl peptidase IV (DPP-IV; CD26) plays an essential role in T-dependent immune responses, a role that could have important clinical consequences. To rigorously define the role of DPP-IV in the immune system, we evaluated genetic and pharmacological inhibition of the enzyme on T-dependent immune responses in vivo. Results The DPP-IV null animals mounted robust primary and secondary antibody responses to the T dependent antigens, 4-hydroxy-3-nitrophenylacetyl-ovalbumin (NP-Ova) and 4-hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG), which were comparable to wild type mice. Serum levels of antigen specific IgM, IgG1, IgG2a, IgG2b and IgG3 were similar between the two groups of animals. DPP-IV null animals mounted an efficient germinal center reaction by day 10 after antigen stimulation that was comparable to wild type mice. Moreover, the antibodies produced by DPP-IV null animals after repeated antigenic challenge were affinity matured. Similar observations were made using wild type animals treated with a highly selective DPP-IV inhibitor during the entire course of the experiments. T cell recall responses to ovalbumin and MOG peptide, evaluated by measuring proliferation and IL-2 release from cells isolated from draining lymph nodes, were equivalent in DPP-IV null and wild type animals. Furthermore, mice treated with DPP-IV inhibitor had intact T-cell recall responses to MOG peptide. In addition, female DPP-IV null and wild type mice treated with DPP-IV inhibitor exhibited normal and robust in vivo cytotoxic T cell responses after challenge with cells expressing the male H-Y minor histocompatibility antigen. Conclusion These data indicate Selective inhibition of DPP-IV does not impair T dependent immune responses to antigenic challenge. PMID:19358731

Relevance and Diversity of Nitrospira Populations in Biofilters of Brackish RAS

PubMed Central

Kruse, Myriam; Keuter, Sabine; Bakker, Evert; Spieck, Eva; Eggers, Till; Lipski, André

2013-01-01

Lithoautotrophic nitrite-oxidizing bacterial populations from moving-bed biofilters of brackish recirculation aquaculture systems (RAS; shrimp and barramundi) were tested for their metabolic activity and phylogenetic diversity. Samples from the biofilters were labeled with 13C-bicarbonate and supplemented with nitrite at concentrations of 0.3, 3 and 10 mM, and incubated at 17 and 28°C, respectively. The biofilm material was analyzed by fatty acid methyl ester - stable isotope probing (FAME-SIP). High portions of up to 45% of Nitrospira-related labeled lipid markers were found confirming that Nitrospira is the major autotrophic nitrite oxidizer in these brackish systems with high nitrogen loads. Other nitrite-oxidizing bacteria such as Nitrobacter or Nitrotoga were functionally not relevant in the investigated biofilters. Nitrospira-related 16S rRNA gene sequences were obtained from the samples with 10 mM nitrite and analyzed by a cloning approach. Sequence studies revealed four different phylogenetic clusters within the marine sublineage IV of Nitrospira, though most sequences clustered with the type strain of Nitrospira marina and with a strain isolated from a marine RAS. Three lipids dominated the whole fatty acid profiles of nitrite-oxidizing marine and brackish enrichments of Nitrospira sublineage IV organisms. The membranes included two marker lipids (16∶1 cis7 and 16∶1 cis11) combined with the non-specific acid 16∶0 as major compounds and confirmed these marker lipids as characteristic for sublineage IV species. The predominant labeling of these characteristic fatty acids and the phylogenetic sequence analyses of the marine Nitrospira sublineage IV identified organisms of this sublineage as main autotrophic nitrite-oxidizers in the investigated brackish biofilter systems. PMID:23705006

Moving East: the Euro-Lupus Nephritis regimen in Asia.

PubMed

Houssiau, Frédéric A

2016-01-01

Treatment of lupus nephritis is more evidenced-based than ever. Yet many areas of uncertainty persist. The article by Rathi et al. brings a piece to the puzzle by comparing, in a group of Indian patients, the Euro-Lupus low-dose i.v. cyclophosphamide regimen with mycophenolate mofetil. Although some caveats must be raised, the results suggest that, after crossing the Atlantic, the Euro-Lupus regimen may well be moving East. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

Secretion of TcpF by the Vibrio cholerae Toxin-Coregulated Pilus Biogenesis Apparatus Requires an N-Terminal Determinant

PubMed Central

Megli, Christina J.

2013-01-01

Type IV pili are important for microcolony formation, biofilm formation, twitching motility, and attachment. We and others have shown that type IV pili are important for protein secretion across the outer membrane, similar to type II secretion systems. This study explored the relationship between protein secretion and pilus formation in Vibrio cholerae. The toxin-coregulated pilus (TCP), a type IV pilus required for V. cholerae pathogenesis, is necessary for the secretion of the colonization factor TcpF (T. J. Kirn, N. Bose, and R. K. Taylor, Mol. Microbiol. 49:81–92, 2003). This phenomenon is not unique to V. cholerae; secreted virulence factors that are dependent on the presence of components of the type IV pilus biogenesis apparatus for secretion have been reported with Dichelobacter nodosus (R. M. Kennan, O. P. Dhungyel, R. J. Whittington, J. R. Egerton, and J. I. Rood, J. Bacteriol. 183:4451–4458, 2001) and Francisella tularensis (A. J. Hager et al., Mol. Microbiol. 62:227–237, 2006). Using site-directed mutagenesis, we demonstrated that the secretion of TcpF is dependent on the presence of selected amino acid R groups at position five. We were unable to find other secretion determinants, suggesting that Y5 is the major secretion determinant within TcpF. We also report that proteins secreted in a type IV pilus biogenesis apparatus-dependent manner have a YXS motif within the first 15 amino acids following the Sec cleavage site. The YXS motif is not present in proteins secreted by type II secretion systems, indicating that this is unique to type IV pilus-mediated secretion. Moreover, we show that TcpF interacts with the pilin TcpA, suggesting that these proteins are secreted by the type IV pilus biogenesis system. These data provide a starting point for understanding how type IV pili can mediate secretion of virulence factors important for bacterial pathogenesis. PMID:23564177

Type IV pili mechanochemically regulate virulence factors in Pseudomonas aeruginosa.

PubMed

Persat, Alexandre; Inclan, Yuki F; Engel, Joanne N; Stone, Howard A; Gitai, Zemer

2015-06-16

Bacteria have evolved a wide range of sensing systems to appropriately respond to environmental signals. Here we demonstrate that the opportunistic pathogen Pseudomonas aeruginosa detects contact with surfaces on short timescales using the mechanical activity of its type IV pili, a major surface adhesin. This signal transduction mechanism requires attachment of type IV pili to a solid surface, followed by pilus retraction and signal transduction through the Chp chemosensory system, a chemotaxis-like sensory system that regulates cAMP production and transcription of hundreds of genes, including key virulence factors. Like other chemotaxis pathways, pili-mediated surface sensing results in a transient response amplified by a positive feedback that increases type IV pili activity, thereby promoting long-term surface attachment that can stimulate additional virulence and biofilm-inducing pathways. The methyl-accepting chemotaxis protein-like chemosensor PilJ directly interacts with the major pilin subunit PilA. Our results thus support a mechanochemical model where a chemosensory system measures the mechanically induced conformational changes in stretched type IV pili. These findings demonstrate that P. aeruginosa not only uses type IV pili for surface-specific twitching motility, but also as a sensor regulating surface-induced gene expression and pathogenicity.

Functional classification of mitochondrion-rich cells in euryhaline Mozambique tilapia (Oreochromis mossambicus) embryos, by means of triple immunofluorescence staining for Na+/K+-ATPase, Na +/K+/2Cl- cotransporter and CFTR anion channel

USGS Publications Warehouse

Hiroi, J.; McCormick, S.D.; Ohtani-Kaneko, R.; Kaneko, T.

2005-01-01

Mozambique tilapia Oreochromis mossambicus embryos were transferred from freshwater to seawater and vice versa, and short-term changes in the localization of three major ion transport proteins, Na+/K +-ATPase, Na+/K+/2Cl- cotransporter (NKCC) and cystic fibrosis transmembrane conductance regulator (CFTR) were examined within mitochondrion-rich cells (MRCs) in the embryonic yolk-sac membrane. Triple-color immunofluorescence staining allowed us to classify MRCs into four types: type I, showing only basolateral Na+/K +-ATPase staining; type II, basolateral Na+/K +-ATPase and apical NKCC; type III, basolateral Na+/K +-ATPase and basolateral NKCC; type IV, basolateral Na +/K+-ATPase, basolateral NKCC and apical CFTR. In freshwater, type-I, type-II and type-III cells were observed. Following transfer from freshwater to seawater, type-IV cells appeared at 12 h and showed a remarkable increase in number between 24 h and 48 h, whereas type-III cells disappeared. When transferred from seawater back to freshwater, type-IV cells decreased and disappeared at 48 h, type-III cells increased, and type-II cells, which were not found in seawater, appeared at 12 h and increased in number thereafter. Type-I cells existed consistently irrespective of salinity changes. These results suggest that type I is an immature MRC, type II is a freshwater-type ion absorptive cell, type III is a dormant type-IV cell and/or an ion absorptive cell (with a different mechanism from type II), and type IV is a seawater-type ion secretory cell. The intracellular localization of the three ion transport proteins in type-IV cells is completely consistent with a widely accepted model for ion secretion by MRCs. A new model for ion absorption is proposed based on type-II cells possessing apical NKCC.

Modulation of type I immediate and type IV delayed immunoreactivity using direct suggestion and guided imagery during hypnosis.

PubMed

Zachariae, R; Bjerring, P; Arendt-Nielsen, L

1989-11-01

Cutaneous reactivity against histamine skin prick test (Type I) and purified tuberculin protein derivative (Mantoux reaction, Type IV) was studied in eight volunteers under hypnosis. Types I and IV immunoreactivity were modulated by direct suggestion (Type I) and guided imagery (Type IV). The volunteers were highly susceptible subjects, selected by means of the Harvard Group Scale of Hypnotic Susceptibility, Form A. When the volunteers underwent hypnotic suggestion to decrease the cutaneous reaction to histamine prick test, a significant (P less than 0.02) reduction of the flare reaction (area of erythema) was observed compared with control histamine skin prick tests. The wheal reaction did not respond to hypnotic suggestion. Neither wheal nor flare reaction could be increased in size by hypnotic suggestion compared with control histamine skin prick tests. A hypnotic suggestion of increasing the Type IV reaction on one arm and decreasing the reaction on the other revealed a significant difference in both erythema size (P less than 0.02) and palpable induration (P less than 0.01). In two cases the reactions were monitored by laser doppler blood flowmetry and skin thickness measurement by ultrasound. The difference between the suggested increased and decreased reaction was 19% for the laser doppler bloodflow (in favor of the augmented side), and 44% for the dermal infiltrate thickness. This study objectively supports the numerous uncontrolled case reports of modulation of immunoreactivity in allergic diseases involving both Type I and Type IV skin reactions following hypnotic suggestions.

Amplified QCM biosensor for type IV collagenase based on collagenase-cleavage of gold nanoparticles functionalized peptide.

PubMed

Dong, Zong-Mu; Jin, Xin; Zhao, Guang-Chao

2018-05-30

The present study develops a rapid, simple and efficient method for the determination of type IV collagenase by using a specific peptide-modified quartz crystal microbalance (QCM). A small peptide (P1), contains a specific sequence (Pro-Gly) and a terminal cysteine, was synthetized and immobilized to the surface of QCM electrode via the reaction between Au and thiol of the cysteine. The peptide bond between proline and glycine can be specific hydrolyzed cleavage by type IV collagenase, which enabled the modified electrode with a high selectivity toward type IV collagenase. The cleaving process caused a frequency change of QCM to give a signal related to the concentration of type IV collagenase. The morphologies of the modified electrodes were characterized by scanning electron microscope (SEM) and the specific hydrolyzed cleavage process was monitored by QCM. When P1 was modified with gold nanoparticles (P1-Au NPs), the signal could be amplified to further enhance the sensitivity of the designed sensor due to the high-mass of the modified Au NPs. Compared the direct unamplified assay, the values obtained for the limit of detection for type IV collagenase was 0.96 ng mL -1 , yielding about 6.5 times of magnitude improvement in sensitivity. This signal enhanced peptide based QCM biosensor for type IV collagenase also showed good selectivity and sensitivity in complex matrix. Copyright © 2018 Elsevier B.V. All rights reserved.

Cocaine action on peripheral, non-monoamine neural substrates as a trigger of electroencephalographic desynchronization and electromyographic activation following i.v. administration in freely moving rats.

PubMed

Smirnov, M S; Kiyatkin, E A

2010-01-20

Many important physiological, behavioral and subjective effects of i.v. cocaine (COC) are exceptionally rapid and transient, suggesting a possible involvement of peripheral neural substrates in their triggering. In the present study, we used high-speed electroencephalographic (EEG) and electromyographic (EMG) recordings (4-s resolution) in freely moving rats to characterize the central electrophysiological effects of i.v. COC at low doses within a self-administration range (0.25-1.0 mg/kg). We found that COC induces rapid, strong, and prolonged desynchronization of cortical EEG (decrease in alpha and increase in beta and gamma activity) and activation of the neck EMG that begin within 2-6 s following the start of a 10-s injection; immediate components of both effects were dose-independent. The rapid effects of COC were mimicked by i.v. COC methiodide (COC-MET), a derivative that cannot cross the blood-brain barrier. At equimolar doses (0.33-1.33 mg/kg), COC-MET had equally fast and strong effects on EEG and EMG total powers, decreasing alpha and increasing beta and gamma activities. Rapid EEG desynchronization and EMG activation was also induced by i.v. procaine, a structurally similar, short-acting local anesthetic with virtually no effects on monoamine uptake; at equipotential doses (1.25-5.0 mg/kg), these effects were weaker and shorter in duration than those of COC. Surprisingly, i.v. saline injection delivered during slow-wave sleep (but not during quiet wakefulness) also induced a transient EEG desynchronization but without changes in EMG and motor activity; these effects were significantly weaker and much shorter than those induced by all tested drugs. These data suggest that in awake animals, i.v. COC induces rapid cortical activation and a subsequent motor response via its action on peripheral non-monoamine neural elements, involving neural transmission via visceral sensory pathways. By providing a rapid neural signal and triggering neural activation, such an action might play a crucial role in the sensory effects of COC, thus contributing to the learning and development of drug-taking behavior.

Optimal and safe treatment of spider leg veins measuring less than 1.5 mm on skin type IV patients, using repeated low-fluence Nd:YAG laser pulses after polidocanol injection.

PubMed

Moreno-Moraga, Javier; Hernández, Esteban; Royo, Josefina; Alcolea, Justo; Isarría, M Jose; Pascu, Mihail Lucian; Smarandache, Adriana; Trelles, Mario

2013-05-01

Treatment of micro-veins of less than 1.5 mm with laser and with chemical sclerosis is technically challenging because of their difficulty to remedy. Laser treatment is even more difficult when dark phototypes are involved.Three groups of 30 patients each, skin type IV, and vessels measuring less than 1.5 mm in diameter, were enrolled for two treatment sessions 8 weeks apart: group A, polidocanol (POL) micro-foam injection; group B, Nd:YAG laser alone; and group C, laser after POL injection. Repeated 8-Hz low-fluence pulses, moving the hand piece over a 3-cm vein segment with an average of five laser passes maximum and with a total time irradiation of 1 s were used. Sixteen weeks after the second treatment, statistically, degree of clearance after examining photographs and patients satisfaction index, plotted on a visual analogue scale and comparing results of all three groups, results were significantly better for group C (p<0.0001). No significant differences in complications were noticed between the three groups. Efficacy of combining POL and laser proved safe and satisfactory in 96 % of patients using low-fluence laser pulses with a total cumulative energy in the 3 cm venous segment, lower than that of conventional treatment. Very few and transient complications were observed. POL foam injection followed by laser pulses is safe and efficient for vein treatment in dark-skinned patients.

Intonation and dialog context as constraints for speech recognition.

PubMed

Taylor, P; King, S; Isard, S; Wright, H

1998-01-01

This paper describes a way of using intonation and dialog context to improve the performance of an automatic speech recognition (ASR) system. Our experiments were run on the DCIEM Maptask corpus, a corpus of spontaneous task-oriented dialog speech. This corpus has been tagged according to a dialog analysis scheme that assigns each utterance to one of 12 "move types," such as "acknowledge," "query-yes/no" or "instruct." Most ASR systems use a bigram language model to constrain the possible sequences of words that might be recognized. Here we use a separate bigram language model for each move type. We show that when the "correct" move-specific language model is used for each utterance in the test set, the word error rate of the recognizer drops. Of course when the recognizer is run on previously unseen data, it cannot know in advance what move type the speaker has just produced. To determine the move type we use an intonation model combined with a dialog model that puts constraints on possible sequences of move types, as well as the speech recognizer likelihoods for the different move-specific models. In the full recognition system, the combination of automatic move type recognition with the move specific language models reduces the overall word error rate by a small but significant amount when compared with a baseline system that does not take intonation or dialog acts into account. Interestingly, the word error improvement is restricted to "initiating" move types, where word recognition is important. In "response" move types, where the important information is conveyed by the move type itself--for example, positive versus negative response--there is no word error improvement, but recognition of the response types themselves is good. The paper discusses the intonation model, the language models, and the dialog model in detail and describes the architecture in which they are combined.

Ultrastructural sinusoidal changes in extrahepatic cholestasis. Light and electron microscopic immunohistochemical localization of collagen type III and type IV.

PubMed

Gulubova, M V

1996-07-01

Extrahepatic cholestasis causes excessive extracellular matrix formation perisinusoidally. Ito cells, transitional and endothelial cells are considered to be a source of extracellular matrix proteins in experimental cholestasis. The localization of collagens type III and type IV in human liver in extrahepatic cholestasis was investigated immunohistochemically in the present study. Immersion fixation was used after modification to be applied to surgical biopsies with commercially available kits. Sinusoidal changes were observed that indicated excessive collagen and matrix formation. Light microscopically, increased immunostaining with the two collagen antibodies was found perisinusoidally and portally. Ultrastructurally, collagen type III positive fibres were found beneath basement membranes of vessels, in collagen bundles and as a fibrillar network in the space of Disse. Collagen type IV immunostaining was located in portal tracts and near hepatocyte microvilli. Intracellular staining with collagen type IV was detected in the rough endoplasmic reticulum of some transitional cells. Immunostaining was located around transitional cells, Ito cells or endothelial cells mainly. Our study indicates that Ito cells, transitional and endothelial cells are the main source of collagens type III and IV in the space of Disse in extrahepatic cholestasis in humans.

Orion moved at Kennedy Space Center on This Week @NASA - October 3, 2014

NASA Image and Video Library

2014-10-03

On Sept. 28, NASA’s Orion spacecraft was moved from Kennedy Space Center’s Payload Hazardous Servicing Facility to its Launch Abort System Facility, for installation of its launch abort system, one of the many critical safety systems that will be evaluated during Orion’s un-crewed Exploration Flight Test -1, in December. NASA’s new deep space capsule is being developed to safely transport astronauts to and from Mars and other destinations on future missions. Also, Delta IV Heavy moved to the launch pad, U.S. spacewalks previewed, NASA and India to discuss joint exploration, Helicopter safety crash test, Combined Federal Campaign underway and Stop, Think, Connect!

48 CFR 652.236-70 - Accident Prevention.

Code of Federal Regulations, 2014 CFR

2014-10-01

...; (iii) Trenching or other excavation greater than one (1) meter in depth; (iv) Earth moving equipment... health such as water tanks, transformer vaults, sewers, cisterns, etc.); (vii) Hazardous materials—a... the corrective actions required. This notice, when delivered to the contractor or the contractor's...

48 CFR 652.236-70 - Accident Prevention.

Code of Federal Regulations, 2011 CFR

2011-10-01

...; (iii) Trenching or other excavation greater than one (1) meter in depth; (iv) Earth moving equipment... health such as water tanks, transformer vaults, sewers, cisterns, etc.); (vii) Hazardous materials—a... the corrective actions required. This notice, when delivered to the contractor or the contractor's...

48 CFR 652.236-70 - Accident Prevention.

Code of Federal Regulations, 2012 CFR

2012-10-01

...; (iii) Trenching or other excavation greater than one (1) meter in depth; (iv) Earth moving equipment... health such as water tanks, transformer vaults, sewers, cisterns, etc.); (vii) Hazardous materials—a... the corrective actions required. This notice, when delivered to the contractor or the contractor's...

48 CFR 652.236-70 - Accident Prevention.

Code of Federal Regulations, 2013 CFR

2013-10-01

...; (iii) Trenching or other excavation greater than one (1) meter in depth; (iv) Earth moving equipment... health such as water tanks, transformer vaults, sewers, cisterns, etc.); (vii) Hazardous materials—a... the corrective actions required. This notice, when delivered to the contractor or the contractor's...

Oxygen microprofile in the prepared sediments and its implication for the sediment oxygen consuming process in a heavily polluted river of China.

PubMed

Wang, Chao; Zhai, Wanying; Shan, Baoqing

2016-05-01

Dissolved oxygen (DO) microprofiles of prepared sediments from 24 sampling sites in the Fuyang River were measured using a gold amalgam microelectrode in this study. The measured microprofiles can be divided into four types. In type I profiles, DO kept constant in the overlying water and decreased smoothly in the pore water; in type II profile, DO showed fluctuation in the pore water; in type III profiles, DO showed peak in the SWI; in type IV profiles, DO decreased obviously in the overlying water. Type I profiles indicated the absence of benthic organisms and thus the degradation of the sediment habitat. Type II and III profiles indicated the activity of benthic animal and epipelic algae, which is common in the healthy aquatic sediment. Type IV profiles indicated that the excessive accumulation of pollutants in the sediment and thus the serious sediment pollution. There are nine sites showing type I profile, three sites showing type II profile, nine sites showing type III profile, and three sites showing type IV profile in the Fuyang River. The dominance of type I and appearance of type IV indicated that sediment oxygen consumption processes in the Fuyang River were strongly influenced by the sediment pollutants release and the vanish of benthic organisms. The pharmacy, metallurgy, and curriery industries may contribute to the sediment deterioration and thus to the occurrence of type I and type IV oxygen profiles in the Fuyang River.

Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome

PubMed Central

Kim, Jeong Gyun; Cho, Won-Sang; Kim, Jeong Eun

2014-01-01

Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure. PMID:24653803

Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome.

PubMed

Kim, Jeong Gyun; Cho, Won-Sang; Kang, Hyun-Seung; Kim, Jeong Eun

2014-02-01

Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure.

A new system for cultivation of human keratinocytes on acellular dermal matrix substitute with the use of human fibroblast feeder layer.

PubMed

Xiao, S; Zhu, S; Ma, B; Xia, Z-F; Yang, J; Wang, G

2008-01-01

To improve the proliferative potential of human keratinocytes (HK) cultured on acellular dermal matrix (ADM), HK and mitomycin C-treated human fibroblasts (MMC-HF) were seeded onto ADM to form four types of composite skin: type I, HK were seeded onto the epidermal side of ADM; type II, both HK and MMC-HF were seeded onto the epidermal side; type III, MMC-HF were preseeded onto the dermal side of ADM, and then HK were seeded onto the epidermal side, and type IV, where MMC-HF were preseeded onto both sides, and then HK were seeded onto the epidermal side. Compared with type I and III, the proliferative potential of HK of type II and IV was significantly higher on day 3, 5, 7 and 9 in vitro. In type I and III, HK grew into one layer on day 7-9, while in type II and IV keratinocytes grew into a confluent monolayer by day 4-6. The adherence to ADM of HK in types II and IV was stronger than that in type I and III. The take rate of type II and IV composite skin was also significantly higher. In conclusion, when MMC-HF and HK were cocultured on the epidermal side of ADM, MMC-HF could serve as excellent feeder cells. Copyright 2007 S. Karger AG, Basel.

Ultraviolet properties of IRAS-selected Be stars

NASA Technical Reports Server (NTRS)

Bjorkman, Karen S.; Snow, Theodore P.

1988-01-01

New IUE observations were obtained of 35 Be stars from a list of stars which show excess infrared fluxes in IRAS data. The IRAS-selected Be stars show larger C IV and Si IV equivalent widths than other Be stars. Excess C IV and Si IV absorption seems to be independent of spectral type for IRAS-selected Be stars later than spectral type B4. This is interpreted as evidence for a possible second mechanism acting in conjunction with radiation pressure for producing the winds in Be stars. No clear correlation of IR excess of v sin i with C IV or Si IV equivalent widths is seen, although a threshold for the occurrence of excess C IV and Si IV absorption appears at a v sin i of 150 km/sec.

Genetics Home Reference: congenital insensitivity to pain with anhidrosis

MedlinePlus

... is also known as hereditary sensory and autonomic neuropathy type IV. The signs and symptoms of CIPA ... to pain with anhidrosis hereditary sensory and autonomic neuropathy type IV hereditary sensory and autonomic neuropathy, type ...

Collagen type IV at the fetal-maternal interface.

PubMed

Oefner, C M; Sharkey, A; Gardner, L; Critchley, H; Oyen, M; Moffett, A

2015-01-01

Extracellular matrix proteins play a crucial role in influencing the invasion of trophoblast cells. However the role of collagens and collagen type IV (col-IV) in particular at the implantation site is not clear. Immunohistochemistry was used to determine the distribution of collagen types I, III, IV and VI in endometrium and decidua during the menstrual cycle and the first trimester of pregnancy. Expression of col-IV alpha chains during the reproductive cycle was determined by qPCR and protein localisation by immunohistochemistry. The structure of col-IV in placenta was examined using transmission electron microscopy. Finally, the expression of col-IV alpha chain NC1 domains and collagen receptors was localised by immunohistochemistry. Col-IV alpha chains were selectively up-regulated during the menstrual cycle and decidualisation. Primary extravillous trophoblast cells express collagen receptors and secrete col-IV in vitro and in vivo, resulting in the increased levels found in decidua basalis compared to decidua parietalis. A novel expression pattern of col-IV in the mesenchyme of placental villi, as a three-dimensional network, was found. NC1 domains of col-IV alpha chains are known to regulate tumour cell migration and the selective expression of these domains in decidua basalis compared to decidua parietalis was determined. Col-IV is expressed as novel forms in the placenta. These findings suggest that col-IV not only represents a structural protein providing tissue integrity but also influences the invasive behaviour of trophoblast cells at the implantation site. Copyright © 2014 Elsevier Ltd. All rights reserved.

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2012 CFR

2012-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2013 CFR

2013-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2014 CFR

2014-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2011 CFR

2011-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Xiu-Li, E-mail: usually.158@163.com; Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, No 169 Donghu Road, Wuchang District, Wuhan 430071; Peng, Chun-Wei, E-mail: pqc278@163.com

Highlights: {yields} HER2 level is closely related to the biologic behaviors of breast cancer cells. {yields} A new method to simultaneously image HER2 and type IV collagen was established. {yields} HER2 status and type IV collagen degradation predict breast cancer invasion. {yields} The complex interactions between tumor and its environment were revealed. -- Abstract: It has been well recognized that human epidermal growth factor receptor 2 (HER2) level in breast cancer (BC) is closely related to the malignant biologic behaviors of the tumor, including invasion and metastasis. Yet, there has been a lack of directly observable evidence to support suchmore » notion. Here we report a quantum dots (QDs)-based double-color imaging technique to simultaneously show the HER2 level on BC cells and the type IV collagen in the tumor matrix. In benign breast tumor, the type IV collagen was intact. With the increasing of HER2 expression level, there has been a progressive decrease in type IV collagen around the cancer nest. At HER2 (3+) expression level, there has virtually been a total destruction of type IV collagen. Moreover, HER2 (3+) BC cells also show direct invasion into the blood vessels. This novel imaging method provides direct observable evidence to support the theory that the HER2 expression level is directly related to BC invasion.« less

41 CFR 302-17.3 - Types of moving expenses or allowances covered and general limitations.

Code of Federal Regulations, 2010 CFR

2010-07-01

...-RELOCATION INCOME TAX (RIT) ALLOWANCE § 302-17.3 Types of moving expenses or allowances covered and general... law authorizes reimbursement of additional income taxes resulting from certain moving expenses... actually paid or incurred, and are not allowable as a moving expense deduction for tax purposes. The types...

On the Directivity of Low-Frequency Type IV Radio Bursts

NASA Technical Reports Server (NTRS)

Gopalswamy, N.; Akiyama, S.; Makela, P.; Yashiro, S.; Cairns, I. H.

2016-01-01

An intense type IV radio burst was observed by the STEREO Behind (STB) spacecraft located about 144 deg. behind Earth. The burst was associated with a large solar eruption that occurred on the backside of the Sun (N05E151) close to the disk center in the STB view. The eruption was also observed by the STEREO Ahead (STA) spacecraft (located at 149 deg. ahead of Earth) as an eruption close to the west limb (N05W60) in that view. The type IV burst was complete in STB observations in that the envelope reached the lowest frequency and then receded to higher frequencies. The burst was partial viewed from STA, revealing only the edge coming down to the lowest frequency. The type IV burst was not observed at all near Earth because the source was 61 deg. behind the east limb. The eruption was associated with a low-frequency type II burst observed in all three views, although it was not very intense. Solar energetic particles were also observed at both STEREOs and at SOHO, suggesting that the shock was much extended, consistent with the very high speed of the CME (2048 km/s). These observations suggest that the type IV emission is directed along a narrow cone above the flare site. We confirm this result statistically using the type IV bursts of solar cycle 23.

Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

PubMed

Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

2012-06-01

Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

78 FR 16302 - Sunshine Act Meeting; Regular Board of Directors Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-03-14

..., Washington, DC 20005. STATUS: Open. CONTACT PERSON FOR MORE INFORMATION: Erica Hall, Assistant Corporate... Discussion IV. Financial Report V. DC Office Move VI. NCST Board VII. Homeownership Challenges..., NFMC & EHLP Reports XII. Executive Session XIII. Adjournment Erica Hall, Assistant Corporate Secretary...

Type IV carbonic anhydrase is present in the gills of spiny dogfish (Squalus acanthias).

PubMed

Gilmour, K M; Bayaa, M; Kenney, L; McNeill, B; Perry, S F

2007-01-01

Physiological and biochemical studies have provided indirect evidence for a membrane-associated carbonic anhydrase (CA) isoform, similar to mammalian type IV CA, in the gills of dogfish (Squalus acanthias). This CA isoform is linked to the plasma membrane of gill epithelial cells by a glycosylphosphatidylinositol anchor and oriented toward the plasma, such that it can catalyze the dehydration of plasma HCO(3)(-) ions. The present study directly tested the hypothesis that CA IV is present in dogfish gills in a location amenable to catalyzing plasma HCO(3)(-) dehydration. Homology cloning techniques were used to assemble a 1,127 base pair cDNA that coded for a deduced protein of 306 amino acids. Phylogenetic analysis suggested that this protein was a type IV CA. For purposes of comparison, a second cDNA (1,107 base pairs) was cloned from dogfish blood; it encoded a deduced protein of 260 amino acids that was identified as a cytosolic CA through phylogenetic analysis. Using real-time PCR and in situ hybridization, mRNA expression for the dogfish type IV CA was detected in gill tissue and specifically localized to pillar cells and branchial epithelial cells that flanked the pillar cells. Immunohistochemistry using a polyclonal antibody raised against rainbow trout type IV CA revealed a similar pattern of CA IV immunoreactivity and demonstrated a limited degree of colocalization with Na(+)-K(+)-ATPase immunoreactivity. The presence and localization of a type IV CA isoform in the gills of dogfish is consistent with the hypothesis that branchial membrane-bound CA with an extracellular orientation contributes to CO(2) excretion in dogfish by catalyzing the dehydration of plasma HCO(3)(-) ions.

Clinical application of antenatal genetic diagnosis of osteogenesis imperfecta type IV.

PubMed

Yuan, Jing; Li, Song; Xu, YeYe; Cong, Lin

2015-04-02

Clinical analysis and genetic testing of a family with osteogenesis imperfecta type IV were conducted, aiming to discuss antenatal genetic diagnosis of osteogenesis imperfecta type IV. Preliminary genotyping was performed based on clinical characteristics of the family members and then high-throughput sequencing was applied to rapidly and accurately detect the changes in candidate genes. Genetic testing of the III5 fetus and other family members revealed missense mutation in c.2746G>A, pGly916Arg in COL1A2 gene coding region and missense and synonymous mutation in COL1A1 gene coding region. Application of antenatal genetic diagnosis provides fast and accurate genetic counseling and eugenics suggestions for patients with osteogenesis imperfecta type IV and their families.

Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: Involvement of type IV collagen in self-defense reaction and metamorphosis.

PubMed

Adachi, Takahiro; Tomita, Masahiro; Yoshizato, Katsutoshi

2005-04-01

The present study shows that hemocytic granular cells synthesize and secrete type IV collagen (ColIV) in the silkworm Bombyx mori (B. mori) and suggests that these cells play roles in the formation of basement membrane, the encapsulation of foreign bodies, and the metamorphic remodeling of the gut. The full- and partial-length cDNA of B. mori prolyl 4-hydroxylase alpha subunit (BmP4Halpha) and B. mori ColIV (BmColIV) were cloned, respectively. In situ hybridization and immunocytochemistry on larval tissues and cells identified hemocytic granular cells as the cells that express mRNAs and proteins of both BmP4Halpha and BmColIV. Immunohistochemistry and immunocytochemistry demonstrated that BmColIV was present in the basement membrane and in the secretory granules of granular cells, respectively. Granular cells in culture secreted BmColIV without accompanying the degranulation and discharged it from the granules when the cells were degranulated. Nylon threads were inserted into the hemocoel of larvae. Granular cells concentrated around the nylon threads and encapsulated them as a self-defense reaction. BmColIV was found to be a component of the capsules. Furthermore, the present study showed that actively BmColIV-expressing granular cells accumulated around the midgut epithelium and formed BmColIV-rich thick basal lamina-like structures there in larval to pupal metamorphosis.

The Role of Dipeptidyl Peptidase IV in Lung Metastasis of Breast Cancer Cells

DTIC Science & Technology

1999-05-01

Our studies focused on (1) cloning and sequencing of wild-type endothelial DPP IV (wtDPP IV) and preparation of truncated DPP IV ( tDPP IV); (2...that was identical to hepatic DPP IV. Acid extraction of rat lung yielded a tDPP IV, which was an effective inhibitor of breast cancer cell adhesion to

Matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in paediatric burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors.

PubMed

Weremijewicz, Artur; Matuszczak, Ewa; Sankiewicz, Anna; Tylicka, Marzena; Komarowska, Marta; Tokarzewicz, Anna; Debek, Wojciech; Gorodkiewicz, Ewa; Hermanowicz, Adam

2018-06-01

The purpose of this study was the determination of matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in the blood plasma of burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors. 31 children scalded by hot water who were managed at the Department of Paediatric Surgery between 2014-2015, after primarily presenting with burns in 4-20% TBSA were included into the study (age 9 months up to 14 years, mean age 2,5+1 years). There were 10 girls and 21 boys. Venous blood samples were drawn 2-6h, and 12-16h after the thermal injury, and on the subsequent days 3, 5 and 7. The matrix metalloproteinase-2, collagen type IV and laminin-5 concentrations were assessed using Surface Plasmon Resonance Imaging by the investigators blinded to the other data. The MMP-2, laminin-5 and collagen type IV concentrations in the blood plasma of patients with burns, were highest 12-16h after thermal injury, the difference was statistically significant. The MMP-2, laminin-5 and collagen type IV concentrations measured 3 days, 5 days and 7 days after the thermal injury, slowly decreased over time, and on the 7th day reached the normal range, when compared with the concentration measured in controls. Current work is the first follow-up study regarding MMP-2 in burns. MMP-2, laminin-5 and collagen type IV levels were elevated early after burn injury in the plasma of studied patients, and were highest 12-16h after the injury. MMP-2, laminin-5 and collagen type IV levels were not proportional to the severity of the burn. We believe in the possibility that the gradual decrease of MMP-2, collagen type IV and laminin-5 concentrations could be connected with the process of healing, but to prove it, more investigation is needed in this area. The SPR imaging biosensor is a good diagnostic tool for determination of MMP-2, laminin-5 and collagen type IV in blood plasma of patients with burns. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

Endovascular Treatment of a Carotid Dissecting Pseudoaneurysm in a Patient with Ehlers-Danlos Syndrome Type IV with Fatal Outcome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lim, Siok Ping, E-mail: siokpinglim@yahoo.co.uk; Duddy, Martin J.

2008-01-15

We present a patient with Ehlers-Danlos syndrome type IV (EDS IV) with a carotid dissecting pseudoaneurysm causing severe carotid stenosis. This lesion was treated endovascularly. Unfortunately, the patient died of remote vascular catastrophes (intracranial hemorrhage and abdominal aortic rupture). This unique case illustrates the perils of endovascular treatment of EDS IV patients and the need for preoperative screening for concomitant lesions. It also shows that a dissecting pseudoaneurysm can feasibly be treated with a covered stent and that closure is effective using Angioseal in patients with EDS IV.

Space Shuttle Projects

NASA Image and Video Library

1985-04-01

In this photograph the SYNCOM IV-3, also known as LEASAT 3, satellite moves away from the Space Shuttle Orbiter Discovery. SYNCOM (Hughes Geosynchronous Communication Satellite) provides communication services from geosynchronous orbit, principally to the U.S. Government. The satellite was launched on April 12, 1985, aboard the Space Shuttle Orbiter Discovery.

Role of 17 beta-estradiol on type IV collagen fibers volumetric density in the basement membrane of bladder wall.

PubMed

de Fraga, Rogerio; Dambros, Miriam; Miyaoka, Ricardo; Riccetto, Cássio Luís Zanettini; Palma, Paulo César Rodrigues

2007-10-01

The authors quantified the type IV collagen fibers volumetric density in the basement membrane of bladder wall of ovariectomized rats with and without estradiol replacement. This study was conducted on 40 Wistar rats (3 months old) randomly divided in 4 groups: group 1, remained intact (control); group 2, submitted to bilateral oophorectomy and daily replacement 4 weeks later of 17 beta-estradiol for 12 weeks; group 3, sham operated and daily replacement 4 weeks later of sesame oil for 12 weeks; and group 4, submitted to bilateral oophorectomy and killed after 12 weeks. It was used in immunohistochemistry evaluation using type IV collagen polyclonal antibody to stain the fibers on paraffin rat bladder sections. The M-42 stereological grid system was used to analyze the fibers. Ovariectomy had an increase effect on the volumetric density of the type IV collagen fibers in the basement membrane of rat bladder wall. Estradiol replacement in castrated animals demonstrated a significative difference in the stereological parameters when compared to the castrated group without hormonal replacement. Surgical castration performed on rats induced an increasing volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall and the estradiol treatment had a significant effect in keeping a low volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall.

Characterization of Staphylococcus aureus faecal isolates associated with food-borne disease in Korea.

PubMed

Shin, E; Hong, H; Park, J; Oh, Y; Jung, J; Lee, Y

2016-07-01

To characterize Staphylococcus aureus faecal isolates from people suspected to be infected with food poisoning by using antimicrobial susceptibility testing and molecular techniques. A total of 340 Staph. aureus isolates from 6226 people suspected to be infected with food poisoning were identified and characterized by biochemical methods, antimicrobial susceptibility testing and PCR. Samples were obtained from January 2006 to December 2008 from the National Notifiable Diseases Surveillance System at the Research Institute of Public Health and Environment in Seoul Metropolitan, Korea. All strains carried at least one of the eight staphylococcal enterotoxin (se) genes tested and a total of 27 se profiles were produced; the most frequent se profile was seg-sei and the next was sea. Among the total isolates, 36 methicillin-resistant Staphylococcus aureus (MRSAs) isolates were further analysed by multilocus sequence typing (MLST), Staphylococcal cassette chromosome mec (SCCmec) typing, pulsed-field gel electrophoresis (PFGE) and PCR detection for pvl. ST72-SCCmec type IV was the most predominant clone (27 isolates, 75%) followed by ST1-SCCmec type IV (five isolates, 13·8%), ST20-SCCmec type IV (one isolate, 2·8%), ST493-SCCmec type IV (one isolate, 2·8%), ST903-SCCmec type IV (one isolate, 2·8%) and ST5-SCCmec type II (one isolate, 2·8%). By PFGE typing, MRSAs isolated during the same period were grouped together although they were isolated from different regions. None of MRSAs had PVL gene and nine MRSAs were multidrug resistant. Analysis of MRSAs by MLST, SCCmec typing, PFGE and pvl detection showed that the majority of strain associated with food-borne diseases belonged to a Korean community-acquired (CA) MRSA clone with ST72-SCCmec type IV-PVL negative-SEG/SEI and its variations while one strain was hospital-acquired (HA) MRSA. CA-MRSA clone which possessed ST72-SCCmec type IV-PVL negative-SEG/SEI was spread most commonly among MRSAs that were associated with food-borne diseases. This is the first report of ST903 strain in Korea. © 2016 The Society for Applied Microbiology.

Adenocarcinoma of the lung with scattered consolidation: radiological-pathological correlation and prognosis.

PubMed

Jiang, Binghu; Takashima, Shodayu; Hakucho, Tomoaki; Hodaka, Numasaki; Yasuhiko, Tomita; Masahiko, Higashiyama

2013-10-01

To investigate the clinicopathological features and prognosis in patients with adenocarcinoma of the lung with scattered consolidation (ALSC). Between January 2006 and March 2010, 139 consecutive patients with lung adenocarcinoma of ≤3 cm, who underwent pulmonary resection for lung cancer, were investigated retrospectively. Radiologic classification was based on the findings of thin-section CT such as the presence of consolidation or ground-glass opacity (GGO). Type I (n=15) and Type II (n=14), showed a pure GGO and a mixed GGO with consolidation <50%, respectively. Type IV (n=38) and Type V (n=52) showed a mixed GGO with consolidation ≥50% and a pure consolidation, respectively. Type III (n=20) was the adenocarcinoma of the lung with scattered consolidation (ALSC). The clinicopathological features and prognosis of ALSC was investigated with comparative analysis and survival analysis. Because of the similar recurrence rate for Type I and Type II (P=1.000), Type IV and Type V (P=0.343), we merged Type I and Type II as Type I+II, Type IV and Type V as Type IV+V, respectively. In the 20 (14.4%) patients with ALSC, lymph node metastasis was not observed, and it was rare in lymphatic invasion and vascular invasion. On the basis of IASLC/ATS/ERS 2011 classification, 80% of the ALSC were preinvasive lesions. In Noguchi classification, there was no significant difference between Type I+II and ALSC (P=0.260). The prognosis of ALSC was similar to Type I+II (P=0.408), but better than Type IV+V (P=0.040). Adenocarcinoma of the lung with scattered consolidation (ALSC) on thin-section CT was a relatively favorable prognostic factor. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

46 CFR 164.019-3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Guard-approved PFDs. Commandant means the Chief of the Lifesaving and Fire Safety Division, Office of... code PFD type acceptable for use 1 I, II, and III. 2 II and III. 3 III. 4B IV (all Ring Buoys). 4BC IV (Buoyant Cushions). 4RB IV (Recreational Ring Buoys only). 5 Wearable Type V (intended use must be...

Metachronous Bilateral Posterior Tibial Artery Aneurysms in Ehlers-Danlos Syndrome Type IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hagspiel, Klaus D., E-mail: kdh2n@virginia.edu; Bonatti, Hugo; Sabri, Saher

2011-04-15

Ehlers-Danlos syndrome type IV is a life-threatening genetic connective tissue disorder. We report a 24-year-old woman with EDS-IV who presented with metachronous bilateral aneurysms/pseudoaneurysms of the posterior tibial arteries 15 months apart. Both were treated successfully with transarterial coil embolization from a distal posterior tibial approach.

Interstellar C IV and Si IV column densities toward early-type stars

NASA Technical Reports Server (NTRS)

Bruhweiler, F. C.; Kondo, Y.; Mccluskey, G. E.

1980-01-01

Equivalent widths and deduced column densities of Si IV and C IV are examined for 18 early-type close binaries, and physical processes responsible for the origin of these ions in the interstellar medium are investigated. The available C IV/Si IV column density ratios typically lie within a narrow range from 0.8 to 4.5, and there is evidence that the column density of C IV is higher than that of N V along most lines of sight, suggesting that C IV is not formed in the same hot region as O VI. In addition, the existence of regions with a narrowly defined new temperature range around 50,000 deg K is indicated. The detection of the semitorrid gas of Bruhweiler, Kondo, and McCluskey (1978, 1979) is substantiated, and the relation of this gas to the observations of coronal gas in the galactic halo is discussed.

Serotype IV and invasive group B Streptococcus disease in neonates, Minnesota, USA, 2000-2010.

PubMed

Ferrieri, Patricia; Lynfield, Ruth; Creti, Roberta; Flores, Aurea E

2013-04-01

Group B Streptococcus (GBS) is a major cause of invasive disease in neonates in the United States. Surveillance of invasive GBS disease in Minnesota, USA, during 2000-2010 yielded 449 isolates from 449 infants; 257 had early-onset (EO) disease (by age 6 days) and 192 late-onset (LO) disease (180 at age 7-89 days, 12 at age 90-180 days). Isolates were characterized by capsular polysaccharide serotype and surface-protein profile; types III and Ia predominated. However, because previously uncommon serotype IV constitutes 5/31 EO isolates in 2010, twelve type IV isolates collected during 2000-2010 were studied further. By pulsed-field gel electrophoresis, they were classified into 3 profiles; by multilocus sequence typing, representative isolates included new sequence type 468. Resistance to clindamycin or erythromycin was detected in 4/5 serotype IV isolates. Emergence of serotype IV GBS in Minnesota highlights the need for serotype prevalence monitoring to detect trends that could affect prevention strategies.

The effects of wearing Passenger Protective Breathing Equipment on evacuation times through type III and type IV emergency aircraft exits in clear air and smoke.

DOT National Transportation Integrated Search

1989-11-01

The effects of Passenger Protective Breathing Equipment (PPBE) on the time required for simulated emergency evacuations through Type III and Type IV overwing aircraft exits were studied in two quasi-independent experiments, one in clear air and anoth...

The effect of gradational velocities and anisotropy on fault-zone trapped waves

NASA Astrophysics Data System (ADS)

Gulley, A. K.; Eccles, J. D.; Kaipio, J. P.; Malin, P. E.

2017-08-01

Synthetic fault-zone trapped wave (FZTW) dispersion curves and amplitude responses for FL (Love) and FR (Rayleigh) type phases are analysed in transversely isotropic 1-D elastic models. We explore the effects of velocity gradients, anisotropy, source location and mechanism. These experiments suggest: (i) A smooth exponentially decaying velocity model produces a significantly different dispersion curve to that of a three-layer model, with the main difference being that Airy phases are not produced. (ii) The FZTW dispersion and amplitude information of a waveguide with transverse-isotropy depends mostly on the Shear wave velocities in the direction parallel with the fault, particularly if the fault zone to country-rock velocity contrast is small. In this low velocity contrast situation, fully isotropic approximations to a transversely isotropic velocity model can be made. (iii) Fault-aligned fractures and/or bedding in the fault zone that cause transverse-isotropy enhance the amplitude and wave-train length of the FR type FZTW. (iv) Moving the source and/or receiver away from the fault zone removes the higher frequencies first, similar to attenuation. (v) In most physically realistic cases, the radial component of the FR type FZTW is significantly smaller in amplitude than the transverse.

Emergence of complex behavior in pili-based motility in early stages of P. aeruginosa surface adaptation

NASA Astrophysics Data System (ADS)

Brill-Karniely, Yifat; Jin, Fan; Wong, Gerard C. L.; Frenkel, Daan; Dobnikar, Jure

2017-04-01

Pseudomonas aeruginosa move across surfaces by using multiple Type IV Pili (TFP), motorized appendages capable of force generation via linear extension/retraction cycles, to generate surface motions collectively known as twitching motility. Pseudomonas cells arrive at a surface with low levels of piliation and TFP activity, which both progressively increase as the cells sense the presence of a surface. At present, it is not clear how twitching motility emerges from these initial minimal conditions. Here, we build a simple model for TFP-driven surface motility without complications from viscous and solid friction on surfaces. We discover the unanticipated structural requirement that TFP motors need to have a minimal amount of effective angular rigidity in order for cells to perform the various classes of experimentally-observed motions. Moreover, a surprisingly small number of TFP are needed to recapitulate movement signatures associated with twitching: Two TFP can already produce movements reminiscent of recently observed slingshot type motion. Interestingly, jerky slingshot motions characteristic of twitching motility comprise the transition region between different types of observed crawling behavior in the dynamical phase diagram, such as self-trapped localized motion, 2-D diffusive exploration, and super-diffusive persistent motion.

78 FR 36794 - Regular Board of Directors Meeting; Sunshine Act

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-19

..., Washington, DC 20002. STATUS: Open. CONTACT PERSON FOR MORE INFORMATION: Erica Hall, Assistant Corporate... Session IV. Board Elections & Appointments V. CHC/NC Grants VI. Financial Report VII. DC Office Move VIII.... Adjournment Erica Hall, Assistant Corporate Secretary. [FR Doc. 2013-14757 Filed 6-17-13; 4:15 pm] BILLING...

An Analysis of Type IV Precision Measurement Equipment Laboratory Logistical Support Relative to the Implementation of F-15/F-16 Two-Level Maintenance

DTIC Science & Technology

1994-09-01

wife, Margie, for her patience and understanding. Graduate school definitely affects the family . Margie allowed me to use many valuable family hours...Consolidations and reorganizations, in which the face of logistics is changing day -by- day , are taking place throughout the Department of Defense. Two...will focus on Type IV F-15 and Type IV F-16 PMELs. Imporane of Research The two-level maintenance concept significantly alters the structure of

Collagen IV Diseases: A Focus on the Glomerular Basement Membrane in Alport Syndrome

PubMed Central

Cosgrove, Dominic; Liu, Shiguang

2016-01-01

Alport syndrome is the result of mutations in any of three type IV collagen genes, COL4A3, COL4A4, or COL4A5. Because the three collagen chains form heterotrimers, there is an absence of all three proteins in the basement membranes where they are expressed. In the glomerulus, the mature glomerular basement membrane type IV collagen network, normally comprised of two separate networks, α3(IV)/α4(IV)/α5(IV) and α1(IV)/α2(IV), is comprised entirely of collagen α1(IV)/α2. This review addresses the current state of our knowledge regarding the consequence of this change in basement membrane composition, including both the direct, via collagen receptor binding, and indirect, regarding influences on glomerular biomechanics. The state of our current understanding regarding mechanisms of glomerular disease initiation and progression will be examined, as will the current state of the art regarding emergent therapeutic approaches to slow or arrest glomerular disease in Alport patients. PMID:27576055

Glomerular basement membrane injuries in IgA nephropathy evaluated by double immunostaining for α5(IV) and α2(IV) chains of type IV collagen and low-vacuum scanning electron microscopy.

PubMed

Masuda, Yukinari; Yamanaka, Nobuaki; Ishikawa, Arimi; Kataoka, Mitue; Arai, Takashi; Wakamatsu, Kyoko; Kuwahara, Naomi; Nagahama, Kiyotaka; Ichikawa, Kaori; Shimizu, Akira

2015-06-01

The glomerulus contains well-developed capillaries, which are at risk of injury due to high hydrostatic pressure, hyperfiltration, hypertension and inflammation. However, the pathological alterations of the injured glomerular basement membrane (GBM), the main component of the glomerular filtration barrier, are still uncertain in cases of glomerulonephritis. We examined the alterations of the GBM in 50 renal biopsy cases with IgA nephropathy (31.8 ± 17.6 years old) using double immunostaining for the α2(IV) and α5(IV) chains of type IV collagen, and examining the ultrastructural alterations by transmission electron microscopy (TEM) and low-vacuum scanning electron microscopy (LV-SEM). The GBM of IgA nephropathy cases showed various morphological and qualitative alterations. In the TEM findings, thinning, gaps, rupture, thickening with a lamellar and reticular structure and double contours were detected in the GBM. Double immunostaining for α5(IV) and α2(IV) showed thickening of the GBM with reduced α5(IV) and increased α2(IV), or mosaic images of α5(IV) and α2(IV), and holes, fractures, spiny projections and rupture of α5(IV) in the GBM. In addition, LV-SEM showed an etched image and multiple holes in a widening and wavy GBM. These findings might be associated with the development of a brittle GBM in IgA nephropathy. Glomerular basement membrane alterations were frequently noted in IgA nephropathy, and were easily evaluated by double immunostaining for α2(IV) and α5(IV) of type IV collagen and LV-SEM. The application of these analyses to human renal biopsy specimens may enhance our understanding of the alterations of the GBM that occur in human glomerular diseases.

Genetics Home Reference: glycogen storage disease type IV

MedlinePlus

... 000 to 800,000 individuals worldwide. Type IV accounts for roughly 3 percent of all cases of glycogen storage disease. Related Information What information about a genetic condition can statistics ...

Cocaine action on peripheral, non-monoamine neural substrates as a trigger of EEG desynchronization and EMG activation following intravenous administration in freely moving rats

PubMed Central

Smirnov, Michael S.; Kiyatkin, Eugene A.

2009-01-01

Many important physiological, behavioral and subjective effects of intravenous (iv) cocaine (COC) are exceptionally rapid and transient, suggesting a possible involvement of peripheral neural substrates in their triggering. In the present study, we used high-speed EEG and EMG recordings (4-s resolution) in freely moving rats to characterize the central electrophysiological effects of iv COC at low doses within a self-administration range (0.25-1.0 mg/kg). We found that COC induces rapid, strong, and prolonged desynchronization of cortical EEG (decrease in alpha and increase in beta and gamma activity) and activation of the neck EMG that begin within 2-6 s following the start of a 10-s injection; immediate components of both effects were dose-independent. The rapid effects of COC were mimicked by iv COC methiodide, a derivative that cannot cross the blood-brain barrier. At equimolar doses (0.33-1.33 mg/kg), COC methiodide had equally fast and strong effects on EEG and EMG total powers, decreasing alpha and increasing beta and gamma activities. Rapid EEG desynchronization and EMG activation was also induced by iv procaine, a structurally similar, short-acting local anesthetic with virtually no effects on monoamine uptake; at equipotential doses (1.25-5.0 mg/kg), these effects were weaker and shorter in duration than those of COC. Surprisingly, iv saline injection delivered during slow-wave sleep (but not during quiet wakefulness) also induced a transient EEG desynchronization but without changes in EMG and motor activity; these effects were significantly weaker and much shorter than those induced by all tested drugs. These data suggest that in awake animals, iv COC induces rapid cortical activation and a subsequent motor response via its action on peripheral non-monoamine neural elements, involving neural transmission via visceral sensory pathways. By providing a rapid neural signal and triggering neural activation, such an action might play a crucial role in the sensory effects of COC, thus contributing to the learning and development of drug-taking behavior. PMID:19861149

Type 4 pili are dispensable for biofilm development in the cyanobacterium Synechococcus elongatus.

PubMed

Nagar, Elad; Zilberman, Shaul; Sendersky, Eleonora; Simkovsky, Ryan; Shimoni, Eyal; Gershtein, Diana; Herzberg, Moshe; Golden, Susan S; Schwarz, Rakefet

2017-07-01

The hair-like cell appendages denoted as type IV pili are crucial for biofilm formation in diverse eubacteria. The protein complex responsible for type IV pilus assembly is homologous with the type II protein secretion complex. In the cyanobacterium Synechococcus elongatus PCC 7942, the gene Synpcc7942_2071 encodes an ATPase homologue of type II/type IV systems. Here, we report that inactivation of Synpcc7942_2071 strongly affected the suite of proteins present in the extracellular milieu (exo-proteome) and eliminated pili observable by electron microscopy. These results support a role for this gene product in protein secretion as well as in pili formation. As we previously reported, inactivation of Synpcc7942_2071 enables biofilm formation and suppresses the planktonic growth of S. elongatus. Thus, pili are dispensable for biofilm development in this cyanobacterium, in contrast to their biofilm-promoting function in type IV pili-producing heterotrophic bacteria. Nevertheless, pili removal is not required for biofilm formation as evident by a piliated mutant of S. elongatus that develops biofilms. We show that adhesion and timing of biofilm development differ between the piliated and non-piliated strains. The study demonstrates key differences in the process of biofilm formation between cyanobacteria and well-studied type IV pili-producing heterotrophic bacteria. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

10 CFR Appendix IV to Part 960 - Types of Information for the Nomination of Sites as Suitable for Characterization

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false Types of Information for the Nomination of Sites as Suitable for Characterization IV Appendix IV to Part 960 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR..., diapirism, tilting, subsidence, faulting, and volcanism. • Estimate of the geothermal gradient. • Estimate...

Functional analysis of an unusual type IV pilus in the Gram‐positive Streptococcus sanguinis

PubMed Central

Gurung, Ishwori; Spielman, Ingrid; Davies, Mark R.; Lala, Rajan; Gaustad, Peter; Biais, Nicolas

2015-01-01

Summary Type IV pili (Tfp), which have been studied extensively in a few Gram‐negative species, are the paradigm of a group of widespread and functionally versatile nano‐machines. Here, we performed the most detailed molecular characterisation of Tfp in a Gram‐positive bacterium. We demonstrate that the naturally competent S treptococcus sanguinis produces retractable Tfp, which like their Gram‐negative counterparts can generate hundreds of piconewton of tensile force and promote intense surface‐associated motility. Tfp power ‘train‐like’ directional motion parallel to the long axis of chains of cells, leading to spreading zones around bacteria grown on plates. However, S . sanguinis  Tfp are not involved in DNA uptake, which is mediated by a related but distinct nano‐machine, and are unusual because they are composed of two pilins in comparable amounts, rather than one as normally seen. Whole genome sequencing identified a locus encoding all the genes involved in Tfp biology in S . sanguinis. A systematic mutational analysis revealed that Tfp biogenesis in S . sanguinis relies on a more basic machinery (only 10 components) than in Gram‐negative species and that a small subset of four proteins dispensable for pilus biogenesis are essential for motility. Intriguingly, one of the piliated mutants that does not exhibit spreading retains microscopic motility but moves sideways, which suggests that the corresponding protein controls motion directionality. Besides establishing S . sanguinis as a useful new model for studying Tfp biology, these findings have important implications for our understanding of these widespread filamentous nano‐machines. PMID:26435398

Very low density lipoprotein triglyceride transport in type IV hyperlipoproteinemia and the effects of carbohydrate-rich diets.

PubMed

Quarfordt, S H; Frank, A; Shames, D M; Berman, M; Steinberg, D

1970-12-01

Transport of plasma-free fatty acids (FFA) and of fatty acids in triglycerides of plasma very low density lipoproteins (VLDL-TGFA) was studied in two normal subjects, five patients with type IV hyperlipoproteinemia, and two patients with type I hyperlipoproteinemia. After intravenous pulse-labeling with albumin-bound 1-palmitate-(14)C, specific radioactivity of plasma FFA and VLDL-TGFA were determined at intervals up to 24 hr. The results were analyzed using several different multicompartmental models each compatible with the experimental data. Fractional transport of VLDL-TGFA was distinctly lower (no overlap) in the type IV patients than in the control subjects, both on a usual balanced diet (40% of calories from carbohydrate) and on a high-carbohydrate diet (80% of calories). However, net or total transport of VLDL-TGFA in the type IV patients was not clearly distinguishable from that in the control subjects, there being considerable overlap on either diet. The results suggest that in this group of type IV patients the underlying defect leading to the increased pool size of VLDL-TGFA is not overproduction but a relative defect in mechanisms for removal of VLDL-TGFA. Since some of these type IV patients had only a moderate degree of hypertriglyceridemia at the time they were studied, and since it is not established that patients with the type IV phenotype constitute a biochemically homogeneous population, the present results should not be generalized. Four studies were done (in two control subjects and two type IV patients) in which the kinetic parameters in the same individual were determined on the balanced diet and on the high-carbohydrate diet. All subjects showed an increase in VLDL-TGFA pool size. Using two of the models for analysis, all showed an increase in net transport of VLDL-TGFA; using the third model, three of the four studies showed an increase in VLDL-TGFA transport. The results are compatible with the interpretation that the carbohydrate-induced increase in VLDL-TGFA, both in controls and type IV patients, is at least in part due to an increased rate of production of VLDL-TGFA. The magnitude of the increase was approximately the same in controls and patients. Thus, metabolic adjustment to a high-carbohydrate regimen in these type IV patients may not be basically different from that in normal controls; the higher levels of VLDL-TGFA reached may simply be another reflection of a defective removal mechanism. An alternative interpretation, compatible with the data, would involve both a carbohydrate-induced increase in fractional rate of release of VLDL-TGFA from liver to plasma and a decrease in fractional removal of VLDL-TGFA from plasma without increase in net production rate. The simpler hypothesis of a single primary effect on net VLDL-TGFA production from FFA seems more likely.

Alport Syndrome Diagnosis

MedlinePlus

... the presence or absence of the type IV collagen alpha-3, alpha-4 and alpha-5 chains ( ... linked Alport syndrome) is suspected. The type IV collagen alpha-5 chain (COL4A5) is normally present in ...

Levels of heroin and its metabolites in blood and brain extracellular fluid after i.v. heroin administration to freely moving rats

PubMed Central

Gottås, A; Øiestad, E L; Boix, F; Vindenes, V; Ripel, Å; Thaulow, C H; Mørland, J

2013-01-01

BACKGROUND AND PURPOSE Heroin, with low affinity for μ-opioid receptors, has been considered to act as a prodrug. In order to study the pharmacokinetics of heroin and its active metabolites after i.v. administration, we gave a bolus injection of heroin to rats and measured the concentration of heroin and its metabolites in blood and brain extracellular fluid (ECF). EXPERIMENTAL APPROACH After an i.v. bolus injection of heroin to freely moving Sprague–Dawley rats, the concentrations of heroin and metabolites in blood samples from the vena jugularis and in microdialysis samples from striatal brain ECF were measured by ultraperformance LC-MS/MS. KEY RESULTS Heroin levels decreased very fast, both in blood and brain ECF, and could not be detected after 18 and 10 min respectively. 6-Monoacetylmorphine (6-MAM) increased very rapidly, reaching its maximal concentrations after 2.0 and 4.3 min, respectively, and falling thereafter. Morphine increased very slowly, reaching its maximal levels, which were six times lower than the highest 6-MAM concentrations, after 12.6 and 21.3 min, with a very slow decline during the rest of the experiment and only surpassing 6-MAM levels at least 30 min after injection. CONCLUSIONS AND IMPLICATIONS After an i.v. heroin injection, 6-MAM was the predominant opioid present shortly after injection and during the first 30 min, not only in the blood but also in rat brain ECF. 6-MAM might therefore mediate most of the effects observed shortly after heroin intake, and this finding questions the general assumption that morphine is the main and most important metabolite of heroin. PMID:23865556

Urinary type IV collagen excretion predicts subsequent declining renal function in type 2 diabetic patients with proteinuria.

PubMed

Katavetin, Pisut; Katavetin, Paravee; Susantitaphong, Paweena; Townamchai, Natavudh; Tiranathanagul, Khajohn; Tungsanga, Kriang; Eiam-Ong, Somchai

2010-08-01

Baseline urinary type IV collagen excretion was negatively correlated with the subsequent GFR change (r(s)=-0.39, p=0.04) in our cohort of 30 type 2 diabetic patients with proteinuria. Therefore, it could be used to predict subsequent declining renal function in type 2 diabetic patients with proteinuria. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

Determination of Acceptor Concentration, Depletion Width, Donor Level Movement and Sensitivity Factor of ZnO on Diamond Heterojunction under UV Illumination

PubMed Central

Saw, Kim Guan; Tneh, Sau Siong; Yam, Fong Kwong; Ng, Sha Shiong; Hassan, Zainuriah

2014-01-01

The concentration of acceptor carriers, depletion width, magnitude of donor level movement as well as the sensitivity factor are determined from the UV response of a heterojunction consisting of ZnO on type IIb diamond. From the comparison of the I-V measurements in dark condition and under UV illumination we show that the acceptor concentration (∼1017 cm−3) can be estimated from p-n junction properties. The depletion width of the heterojunction is calculated and is shown to extend farther into the ZnO region in dark condition. Under UV illumination, the depletion width shrinks but penetrates both materials equally. The ultraviolet illumination causes the donor level to move closer to the conduction band by about 50 meV suggesting that band bending is reduced to allow more electrons to flow from the intrinsically n-type ZnO. The sensitivity factor of the device calculated from the change of threshold voltages, the ratio of dark and photocurrents and identity factor is consistent with experimental data. PMID:24586707

Two type IV pili of Vibrio parahaemolyticus play different roles in biofilm formation.

PubMed

Shime-Hattori, Akiko; Iida, Tetsuya; Arita, Michiko; Park, Kwon-Sam; Kodama, Toshio; Honda, Takeshi

2006-11-01

Vibrio parahaemolyticus RIMD2210633 has two sets of type IV-A pilus genes. One set is similar to that found in other Gram-negative bacteria, such as Pseudomonas aeruginosa, Vibrio cholerae (chitin-regulated pilus; ChiRP), and Vibrio vulnificus. The other is homologous to the genes for the mannose-sensitive hemagglutinin (MSHA) pilus. In this study, we analyzed the effects of the deletions in the pilin genes for each type IV pilus (the ChiRP and the MSHA pilus) on biofilm formation. Although the MSHA pilin mutant formed aggregates, the number of bacteria that attached directly to the coverslip was reduced, suggesting that this pilus contributes to the bacterial attachment to the surface of the coverslip. In contrast, the ChiRP mutant attached to the surface of the coverslip, but did not form aggregates, suggesting that ChiRP plays a role in bacterial agglutination during biofilm formation. These results suggest that the two type IV pili of V. parahaemolyticus contribute to biofilm formation in different ways. Both mutants showed a lower fitness for adsorption onto chitin particles than that of the wild type. Collectively, these data suggest that the use of two type IV pili is a refined strategy of V. parahaemolyticus for survival in natural environments.

A Split-Luciferase-Based Trimer Formation Assay as a High-throughput Screening Platform for Therapeutics in Alport Syndrome.

PubMed

Omachi, Kohei; Kamura, Misato; Teramoto, Keisuke; Kojima, Haruka; Yokota, Tsubasa; Kaseda, Shota; Kuwazuru, Jun; Fukuda, Ryosuke; Koyama, Kosuke; Matsuyama, Shingo; Motomura, Keishi; Shuto, Tsuyoshi; Suico, Mary Ann; Kai, Hirofumi

2018-05-17

Alport syndrome is a hereditary glomerular disease caused by mutation in type IV collagen α3-α5 chains (α3-α5(IV)), which disrupts trimerization, leading to glomerular basement membrane degeneration. Correcting the trimerization of α3/α4/α5 chain is a feasible therapeutic approach, but is hindered by lack of information on the regulation of intracellular α(IV) chain and the absence of high-throughput screening (HTS) platforms to assess α345(IV) trimer formation. Here, we developed sets of split NanoLuc-fusion α345(IV) proteins to monitor α345(IV) trimerization of wild-type and clinically associated mutant α5(IV). The α345(IV) trimer assay, which satisfied the acceptance criteria for HTS, enabled the characterization of intracellular- and secretion-dependent defects of mutant α5(IV). Small interfering RNA-based and chemical screening targeting the ER identified several chemical chaperones that have potential to promote α345(IV) trimer formation. This split luciferase-based trimer formation assay is a functional HTS platform that realizes the feasibility of targeting α345(IV) trimers to treat Alport syndrome. Copyright © 2018 Elsevier Ltd. All rights reserved.

Diversity, assembly and regulation of archaeal type IV pili-like and non-type-IV pili-like surface structures.

PubMed

Lassak, Kerstin; Ghosh, Abhrajyoti; Albers, Sonja-Verena

2012-01-01

Archaea have evolved fascinating surface structures allowing rapid adaptation to changing environments. The archaeal surface appendages display such diverse biological roles as motility, adhesion, biofilm formation, exchange of genetic material and species-specific interactions and, in turn, increase fitness of the cells. Intriguingly, despite sharing the same functions with their bacterial counterparts, the assembly mechanism of many archaeal surface structures is rather related to assembly of bacterial type IV pili. This review summarizes our state-of-the-art knowledge about unique structural and biochemical properties of archaeal surface appendages with a particular focus on archaeal type IV pili-like structures. The latter comprise not only widely distributed archaella (formerly known as archaeal flagella), but also different highly specialized archaeal pili, which are often restricted to certain species. Recent findings regarding assembly mechanisms, structural aspects and physiological roles of these type IV pili-like structures will be discussed in detail. Recently, first regulatory proteins involved in transition from both planktonic to sessile lifestyle and in assembly of archaella were identified. To conclude, we provide novel insights into regulatory mechanisms underlying the assembly of archaeal surface structures. Copyright © 2012. Published by Elsevier Masson SAS.

Minor Type IV Collagen α5 Chain Promotes Cancer Progression through Discoidin Domain Receptor-1

PubMed Central

Xiao, Qian; Jiang, Yan; Liu, Qingbo; Yue, Jiao; Liu, Chunying; Zhao, Xiaotong; Qiao, Yuemei; Ji, Hongbin; Chen, Jianfeng; Ge, Gaoxiang

2015-01-01

Type IV collagens (Col IV), components of basement membrane, are essential in the maintenance of tissue integrity and proper function. Alteration of Col IV is related to developmental defects and diseases, including cancer. Col IV α chains form α1α1α2, α3α4α5 and α5α5α6 protomers that further form collagen networks. Despite knowledge on the functions of major Col IV (α1α1α2), little is known whether minor Col IV (α3α4α5 and α5α5α6) plays a role in cancer. It also remains to be elucidated whether major and minor Col IV are functionally redundant. We show that minor Col IV α5 chain is indispensable in cancer development by using α5(IV)-deficient mouse model. Ablation of α5(IV) significantly impeded the development of KrasG12D-driven lung cancer without affecting major Col IV expression. Epithelial α5(IV) supports cancer cell proliferation, while endothelial α5(IV) is essential for efficient tumor angiogenesis. α5(IV), but not α1(IV), ablation impaired expression of non-integrin collagen receptor discoidin domain receptor-1 (DDR1) and downstream ERK activation in lung cancer cells and endothelial cells. Knockdown of DDR1 in lung cancer cells and endothelial cells phenocopied the cells deficient of α5(IV). Constitutively active DDR1 or MEK1 rescued the defects of α5(IV)-ablated cells. Thus, minor Col IV α5(IV) chain supports lung cancer progression via DDR1-mediated cancer cell autonomous and non-autonomous mechanisms. Minor Col IV can not be functionally compensated by abundant major Col IV. PMID:25992553

Root canal morphology of South Asian Indian maxillary molar teeth

PubMed Central

Singh, Shishir; Pawar, Mansing

2015-01-01

Objective: The objective was to study the root canal morphology of South Asian Indian Maxillary molars using a tooth clearing technique. Materials and Methods: Hundred teeth each comprising of first, second, and third molars collected from different dental schools and clinics in India were subjected to standard dye penetration, decalcification and clearing procedure before being studied. Results: The first molar mesiobuccal roots exhibited 69% Type I, 24% Type II, 4% Type IV, 2% Type V, and 1% exhibited a Vertuccis Type VIII canal anatomy. In the group with three separate roots the second molar mesiobuccal roots in exhibited 80.6% Type I, 15.3% Type II, 2.7% Type IV, and 1.4% Type V canal anatomy while the third molars mesiobuccal roots exhibited 57.4% Type I, 32% Type II, 2.1% Type III, 8.5% Type IV, 1% had a Type V canal anatomy in the similar group. Conclusion: A varied root canal anatomy was seen in the mesiobuccal root canal of the maxillary molars. PMID:25713497

Characterizing the inverses of block tridiagonal, block Toeplitz matrices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boffi, Nicholas M.; Hill, Judith C.; Reuter, Matthew G.

2014-12-04

We consider the inversion of block tridiagonal, block Toeplitz matrices and comment on the behaviour of these inverses as one moves away from the diagonal. Using matrix M bius transformations, we first present an O(1) representation (with respect to the number of block rows and block columns) for the inverse matrix and subsequently use this representation to characterize the inverse matrix. There are four symmetry-distinct cases where the blocks of the inverse matrix (i) decay to zero on both sides of the diagonal, (ii) oscillate on both sides, (iii) decay on one side and oscillate on the other and (iv)more » decay on one side and grow on the other. This characterization exposes the necessary conditions for the inverse matrix to be numerically banded and may also aid in the design of preconditioners and fast algorithms. Finally, we present numerical examples of these matrix types.« less

Study of Integrated USV/UUV Observation System Performance in Monterey Bay

DTIC Science & Technology

2017-09-01

5 IV. EXPERIMENTAL SETUP... quasi -stationary at depth in low-current environments. This thesis evaluates the performance of deep sensors in determining behavior of a moving source...acoustic sensors that would be quasi -stationary receivers when in drift mode at depth in low current environments. One key advantage to this technique is

Native structure of a type IV secretion system core complex essential for Legionella pathogenesis.

PubMed

Kubori, Tomoko; Koike, Masafumi; Bui, Xuan Thanh; Higaki, Saori; Aizawa, Shin-Ichi; Nagai, Hiroki

2014-08-12

Bacterial type IV secretion systems are evolutionarily related to conjugation systems and play a pivotal role in infection by delivering numerous virulence factors into host cells. Using transmission electron microscopy, we report the native molecular structure of the core complex of the Dot/Icm type IV secretion system encoded by Legionella pneumophila, an intracellular human pathogen. The biochemically isolated core complex, composed of at least five proteins--DotC, DotD, DotF, DotG, and DotH--has a ring-shaped structure. Intriguingly, morphologically distinct premature complexes are formed in the absence of DotG or DotF. Our data suggest that DotG forms a central channel spanning inner and outer membranes. DotF, a component dispensable for type IV secretion, plays a role in efficient embedment of DotG into the functional core complex. These results highlight a common scheme for the biogenesis of transport machinery.

Polyvalent type IV sensitizations to multiple fragrances and a skin protection cream in a metal worker.

PubMed

Tanko, Zita; Shab, Arna; Diepgen, Thomas Ludwig; Weisshaar, Elke

2009-06-01

Fragrances are very common in everyday products. A metalworker with chronic hand eczema and previously diagnosed type IV sensitizations to epoxy resin, balsam of Peru, fragrance mix and fragrance mix II was diagnosed with additional type IV sensitizations to geraniol, hydroxycitronellal, lilial, tree moss, oak moss absolute, citral, citronellol, farnesol, Lyral, fragrance mix II and fragrance mix (with sorbitan sesquioleate). In addition, a type IV sensitization to the skin protection cream containing geraniol and citronellol used at the workplace was detected, and deemed occupationally relevant in this case. The patient could have had contact to fragrances through private use of cosmetics and detergents. On the other hand, the fragrance-containing skin protection cream supports occupational exposure. This case report demonstrates that fragrance contact allergy has to be searched for and clarified individually, which requires a thorough history and a detailed analysis of the work place.

Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli*

PubMed Central

Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

2015-01-01

Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. PMID:26324721

Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli.

PubMed

Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

2015-10-23

Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Spectroscopy of Magnetic Excitations in Magnetic Superconductors Using Vortex Motion

NASA Astrophysics Data System (ADS)

Bulaevskii, L. N.; Hruška, M.; Maley, M. P.

2005-11-01

In magnetic superconductors a moving vortex lattice is accompanied by an ac magnetic field which leads to the generation of spin waves. At resonance conditions the dynamics of vortices in magnetic superconductors changes drastically, resulting in strong peaks in the dc I-V characteristics at voltages at which the washboard frequency of the vortex lattice matches the spin wave frequency ωs(g), where g are the reciprocal vortex lattice vectors. We show that if the washboard frequency lies above the magnetic gap, measurement of the I-V characteristics provides a new method to obtain information on the spectrum of magnetic excitations in borocarbides and cuprate layered magnetic superconductors.

Evaluation of the effectiveness of an intravenous line and fluid bottle fixation design.

PubMed

Chiou, Piao-Yi; Chien, Chih-Yin; Shiu, Ting-Ru; Lin, Pei-Jiun; Lin, Wan-Yu; Jiang, Yi-Rung

2015-01-01

It's important to improve the stability of intravenous (IV) lines and bottles during patient activity and nursing care. We developed an intravenous line and fluid bottle fixation design (ILFBFD) which includes a bottle retaining clip and line fixation kit. We randomly assigned 60 participants each to the experimental and control groups. Participants were asked to push an IV stand without and with ILFBFD 11 meters on uneven pavement and a sloping floor. The distance the IV bottle moved was recorded. Self-administered questionnaires were used to collect the opinions of the participants. Use of ILFBFD, resulted in less movement in the anteroposterior and left/right directions (differences of 46.98 cm2, t= 12.80, p < 0.000 and 39.24 cm2, t= 8.01, p< 0.000, respectively) compared with not using ILFBFD. The average scores for bottle movement when participants walked on a flat floor, uneven pavement and sloping floor, IV line tangling and dropping, and organization of Liv lines were significantly better in those using than not using ILFBFD. The results can be used in clinical practice to reduce knotting of IV lines, and to enhance the safety and quality of patient care.

Ecological mechanisms favouring behavioural diversification in the absence of morphological diversification: a theoretical examination using brook charr (Salvelinus fontinalis).

PubMed

De Kerckhove, Derrick; McLaughlin, Robert L; Noakes, David L G

2006-03-01

1. Behavioural diversification is thought to be an important initial step in the origin of resource polymorphisms. We developed a model for young brook charr (Salvelinus fontinalis Mitchill) to examine four mechanisms that could generate a U-shaped relationship between growth rate (fitness) and the proportion of time spent moving that would favour alternative foraging tactics in the absence of obvious differences in body size and shape. 2. Recently emerged brook charr of similar size and shape inhabit still-water pools along the sides of streams. Some individuals tend to sit and wait for crustacean prey at the pool substrate near the bank, while others tend to search actively for insect prey at the pool surface away from the bank. 3. The ecological mechanisms modelled were (i) the relationship between the rate of prey capture and the proportion of time spent moving is curvilinear, such that net rate of energy gain is maximized at two different levels of activity; (ii) switching between foraging locations and, hence, tactics involves lost opportunity and travel costs; (iii) switching between prey types and, hence, tactics involves a learning cost; and (iv) foraging success is status-dependent with individuals switching between tactics having a lower status than those specializing at a tactic. 4. Singly, no mechanism predicted the U-shaped relationship between growth rate and the proportion of time spent moving. Together, a U-shaped relationship was obtained, indicating that the behavioural diversification and diversifying selection observed in the field may be a consequence of multiple, subtle mechanisms.

Spatial and Functional Relationships Among Pol V-Associated loci, Pol IV-Dependent siRNAs, and Cytosine Methylation in the Arabidopsis Epigenome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wierzbicki, A. T.; Cocklin, Ross; Mayampurath, Anoop

2012-08-15

Multisubunit RNA polymerases IV and V (Pols IV and V) mediate RNA-directed DNA methylation and transcriptional silencing of retrotransposons and heterochromatic repeats in plants. We identified genomic sites of Pol V occupancy in parallel with siRNA deep sequencing and methylcytosine mapping, comparing wild-type plants with mutants defective for Pol IV, Pol V, or both Pols IV and V. Approximately 60% of Pol V-associated regions encompass regions of 24-nucleotide (nt) siRNA complementarity and cytosine methylation, consistent with cytosine methylation being guided by base-pairing of Pol IV-dependent siRNAs with Pol V transcripts. However, 27% of Pol V peaks do not overlap sitesmore » of 24-nt siRNA biogenesis or cytosine methylation, indicating that Pol V alone does not specify sites of cytosine methylation. Surprisingly, the number of methylated CHH motifs, a hallmark of RNA-directed de novo methylation, is similar in wild-type plants and Pol IV or Pol V mutants. In the mutants, methylation is lost at 50%-60% of the CHH sites that are methylated in the wild type but is gained at new CHH positions, primarily in pericentromeric regions. These results indicate that Pol IV and Pol V are not required for cytosine methyltransferase activity but shape the epigenome by guiding CHH methylation to specific genomic sites.« less

Sensing of substratum rigidity and directional migration by fast-crawling cells

NASA Astrophysics Data System (ADS)

Okimura, Chika; Sakumura, Yuichi; Shimabukuro, Katsuya; Iwadate, Yoshiaki

2018-05-01

Living cells sense the mechanical properties of their surrounding environment and respond accordingly. Crawling cells detect the rigidity of their substratum and migrate in certain directions. They can be classified into two categories: slow-moving and fast-moving cell types. Slow-moving cell types, such as fibroblasts, smooth muscle cells, mesenchymal stem cells, etc., move toward rigid areas on the substratum in response to a rigidity gradient. However, there is not much information on rigidity sensing in fast-moving cell types whose size is ˜10 μ m and migration velocity is ˜10 μ m /min . In this study, we used both isotropic substrata with different rigidities and an anisotropic substratum that is rigid on the x axis but soft on the y axis to demonstrate rigidity sensing by fast-moving Dictyostelium cells and neutrophil-like differentiated HL-60 cells. Dictyostelium cells exerted larger traction forces on a more rigid isotropic substratum. Dictyostelium cells and HL-60 cells migrated in the "soft" direction on the anisotropic substratum, although myosin II-null Dictyostelium cells migrated in random directions, indicating that rigidity sensing of fast-moving cell types differs from that of slow types and is induced by a myosin II-related process.

Sensing of substratum rigidity and directional migration by fast-crawling cells.

PubMed

Okimura, Chika; Sakumura, Yuichi; Shimabukuro, Katsuya; Iwadate, Yoshiaki

2018-05-01

Living cells sense the mechanical properties of their surrounding environment and respond accordingly. Crawling cells detect the rigidity of their substratum and migrate in certain directions. They can be classified into two categories: slow-moving and fast-moving cell types. Slow-moving cell types, such as fibroblasts, smooth muscle cells, mesenchymal stem cells, etc., move toward rigid areas on the substratum in response to a rigidity gradient. However, there is not much information on rigidity sensing in fast-moving cell types whose size is ∼10 μm and migration velocity is ∼10 μm/min. In this study, we used both isotropic substrata with different rigidities and an anisotropic substratum that is rigid on the x axis but soft on the y axis to demonstrate rigidity sensing by fast-moving Dictyostelium cells and neutrophil-like differentiated HL-60 cells. Dictyostelium cells exerted larger traction forces on a more rigid isotropic substratum. Dictyostelium cells and HL-60 cells migrated in the "soft" direction on the anisotropic substratum, although myosin II-null Dictyostelium cells migrated in random directions, indicating that rigidity sensing of fast-moving cell types differs from that of slow types and is induced by a myosin II-related process.

Neurons of human nucleus accumbens.

PubMed

Sazdanović, Maja; Sazdanović, Predrag; Zivanović-Macuzić, Ivana; Jakovljević, Vladimir; Jeremić, Dejan; Peljto, Amir; Tosevski, Jovo

2011-08-01

Nucleus accumbens is a part of the ventral striatum also known as a drug active brain region, especially related with drug addiction. The aim of the study was to investigate the Golgi morphology of the nucleus accumbens neurons. The study was performed on the frontal and sagittal sections of 15 human brains by the Golgi Kopsch method. We classified neurons in the human nucleus accumbens according to their morphology and size into four types: type I--fusiform neurons; type II--fusiform neurons with lateral dendrite, arising from a part of the cell body; type III--pyramidal-like neuron; type IV--multipolar neuron. The medium spiny neurons, which are mostly noted regarding to the drug addictive conditions of the brain, correspond to the type IV--multipolar neurons. Two regions of human nucleus accumbens could be clearly recognized on Nissl and Golgi preparations each containing different predominant neuronal types. Central part of nucleus accumbens, core region, has a low density of impregnated neurons with predominant type III, pyramidal-like neurons, with spines on secondary branches and rare type IV, multipolar neurons. Contrary to the core, peripheral region, shell of nucleus, has a high density of impregnated neurons predominantly contained of type I and type IV--multipolar neurons, which all are rich in spines on secondary and tertiary dendritic branches. Our results indicate great morphological variability of human nucleus accumbens neurons. This requires further investigations and clarifying clinical significance of this important brain region.

Solar radio emission

NASA Technical Reports Server (NTRS)

Goldman, M. V.; Smith, D. F.

1981-01-01

Active areas of both observational and theoretical research in which rapid progress is being made are discussed. These include: (1) the dynamic spectrum or frequency versus time plot; (2) physical mechanisms in the development of various types of bursts; (3) microwave type 1, 2, 3, and moving type 4 bursts; (4) bursts caused by trapped electrons; (5) physics of type 3bursts; (6) the physics of type 2 bursts and their related shocks; (7) the physics of both stationary and moving traps and associated type 1 and moving type 4 bursts; and (8) the status of the field of solar radio emission.

KSC-2009-6782

NASA Image and Video Library

2009-12-11

CAPE CANAVERAL, Fla. – Workers move the second stage of a Delta IV rocket from a test cell in the hangar of the Delta Operations Center at Cape Canaveral Air Force Station in Florida into a turnover stand following the completion of nozzle extension deployment system testing. The United Launch Alliance Delta IV rocket is slated to launch GOES-P, the latest Geostationary Operational Environmental Satellite developed by NASA for the National Oceanic and Atmospheric Administration, or NOAA. Next, the second stage will be transported to the Horizontal Integration Facility where it will be inspected and prepared for mating with the Delta IV rocket's first stage. GOES-P, a meteorological satellite, is designed to watch for storm development and observed current weather conditions on Earth. Launch of GOES-P is scheduled for no earlier than Feb. 25, 2010, from Launch Complex 37. For information on GOES-P, visit http://goespoes.gsfc.nasa.gov/goes/spacecraft/n_p_spacecraft.html. Photo credit: NASA/Glenn Benson

Skin phototyping in a Chinese female population: analysis of four hundred and four cases from four major cities of China.

PubMed

Liu, W; Lai, W; Wang, X M; Li, L; Tian, Y; Lu, Y; Wu, Y Y; Li, Y; Zhang, P; Wu, Y; Chen, L

2006-08-01

The sun-reactive skin types in 404 Chinese females living in different cities were investigated in this study. A questionnaire was designed according to the original concept of skin types proposed by Fitzpatrick and the investigation was conducted in two ways: self-administered reporting and then a personal interview. Minimal erythema dose (MED) and minimal persistent pigmentation dose (MPPD) were also measured in part of the volunteers with a standard solar simulator. The results show that in the way of personal interview, the predominant skin type of the investigated group is type III (71.4%), and then type II (14.7%) and type IV (14.2%), while in the self-reporting manner, the result is as follows: type III, 74.3%, type II, 25.6% and type IV, 1%. There are no skin type I, V or VI in the studied group. MED and MPPD from the same population show some relevance to the skin types, e.g. with the change of skin type from Type II to IV, the mean value of MED increases gradually and the MPPD decreases slightly. From the study we concluded that the skin types of the investigated Chinese females are principally type III (more than 70%), and then type II and type IV. The different ways of answering the questionnaire did not affect the results remarkably. The measurements of photobiology parameters confirmed that there is a certain correlation between skin types and MED or MPPD determined in this group of volunteers.

Proposal for a histopathological consensus classification of the periprosthetic interface membrane

PubMed Central

Morawietz, L; Classen, R‐A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer‐Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

2006-01-01

Aims The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Methods Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Results Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter‐observer reproducibility sufficient (85%). Conclusion The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non‐infectious, non‐particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients. PMID:16731601

Proposal for a histopathological consensus classification of the periprosthetic interface membrane.

PubMed

Morawietz, L; Classen, R-A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer-Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

2006-06-01

The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter-observer reproducibility sufficient (85%). The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non-infectious, non-particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients.

Environmentally Safe and Effective Processes for Paint Removal

DTIC Science & Technology

1995-04-01

Urea Formaldehyde 3.5 1.5 Type III Melamine Formaldehyde 4.0 1.5 Type IV Phenol Formaldehyde 3.5 1.5...Polyester 3.0 34 - 42 1.04 - 1.46 Type II Urea Formaldehyde 3.5 54 - 62 1.47- 1.54 Type III Melamine Formaldehyde 4.0 64- 72 1.47- 1.52 Type IV Phenol... Melamine Formaldehyde electronics industry and to remove coatings from fibreglass and composite materials. Melamine formaldehyde resin is produced

Projections of Demand for Waterborne Transportation, Ohio River Basin, 1980, 1990, 2000, 2020, 2040. Volume 6. Group IV. Aggregates.

DTIC Science & Technology

1980-12-01

moved piece by piece rather than by conveyor belt. B-2. Institutional Factors Production of aggregates is highly centralized and vertically integrated ... Marketing of the product is most often done by the producers. Much production is used by the producers themselves; for example, as input into ready

Broad and Narrow CHC Abilities Measured and Not Measured by the Wechsler Scales: Moving beyond Within-Battery Factor Analysis

ERIC Educational Resources Information Center

Flanagan, Dawn P.; Alfonso, Vincent C.; Reynolds, Matthew R.

2013-01-01

In this commentary, we reviewed two clinical validation studies on the Wechsler Scales conducted by Weiss and colleagues. These researchers used a rigorous within-battery model-fitting approach that demonstrated the factorial invariance of the Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV) and Wechsler Adult Intelligence…

Ehlers-Danlos syndrome type IV

PubMed Central

Germain, Dominique P

2007-01-01

Ehlers-Danlos syndrome type IV, the vascular type of Ehlers-Danlos syndromes (EDS), is an inherited connective tissue disorder defined by characteristic facial features (acrogeria) in most patients, translucent skin with highly visible subcutaneous vessels on the trunk and lower back, easy bruising, and severe arterial, digestive and uterine complications, which are rarely, if at all, observed in the other forms of EDS. The estimated prevalence for all EDS varies between 1/10,000 and 1/25,000, EDS type IV representing approximately 5 to 10% of cases. The vascular complications may affect all anatomical areas, with a tendency toward arteries of large and medium diameter. Dissections of the vertebral arteries and the carotids in their extra- and intra-cranial segments (carotid-cavernous fistulae) are typical. There is a high risk of recurrent colonic perforations. Pregnancy increases the likelihood of a uterine or vascular rupture. EDS type IV is inherited as an autosomal dominant trait that is caused by mutations in the COL3A1 gene coding for type III procollagen. Diagnosis is based on clinical signs, non-invasive imaging, and the identification of a mutation of the COL3A1 gene. In childhood, coagulation disorders and Silverman's syndrome are the main differential diagnoses; in adulthood, the differential diagnosis includes other Ehlers-Danlos syndromes, Marfan syndrome and Loeys-Dietz syndrome. Prenatal diagnosis can be considered in families where the mutation is known. Choriocentesis or amniocentesis, however, may entail risk for the pregnant woman. In the absence of specific treatment for EDS type IV, medical intervention should be focused on symptomatic treatment and prophylactic measures. Arterial, digestive or uterine complications require immediate hospitalisation, observation in an intensive care unit. Invasive imaging techniques are contraindicated. Conservative approach is usually recommended when caring for a vascular complication in a patient suffering from EDS type IV. Surgery may, however, be required urgently to treat potentially fatal complications. PMID:17640391

Computational prediction of secretion systems and secretomes of Brucella: identification of novel type IV effectors and their interaction with the host.

PubMed

Sankarasubramanian, Jagadesan; Vishnu, Udayakumar S; Dinakaran, Vasudevan; Sridhar, Jayavel; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash

2016-01-01

Brucella spp. are facultative intracellular pathogens that cause brucellosis in various mammals including humans. Brucella survive inside the host cells by forming vacuoles and subverting host defence systems. This study was aimed to predict the secretion systems and the secretomes of Brucella spp. from 39 complete genome sequences available in the databases. Furthermore, an attempt was made to identify the type IV secretion effectors and their interactions with host proteins. We predicted the secretion systems of Brucella by the KEGG pathway and SecReT4. Brucella secretomes and type IV effectors (T4SEs) were predicted through genome-wide screening using JVirGel and S4TE, respectively. Protein-protein interactions of Brucella T4SEs with their hosts were analyzed by HPIDB 2.0. Genes coding for Sec and Tat pathways of secretion and type I (T1SS), type IV (T4SS) and type V (T5SS) secretion systems were identified and they are conserved in all the species of Brucella. In addition to the well-known VirB operon coding for the type IV secretion system (T4SS), we have identified the presence of additional genes showing homology with T4SS of other organisms. On the whole, 10.26 to 14.94% of total proteomes were found to be either secreted (secretome) or membrane associated (membrane proteome). Approximately, 1.7 to 3.0% of total proteomes were identified as type IV secretion effectors (T4SEs). Prediction of protein-protein interactions showed 29 and 36 host-pathogen specific interactions between Bos taurus (cattle)-B. abortus and Ovis aries (sheep)-B. melitensis, respectively. Functional characterization of the predicted T4SEs and their interactions with their respective hosts may reveal the secrets of host specificity of Brucella.

Study of the relationship between mononuclear inflammatory infiltrate and Ki-67 and basement membrane and extracellular matrix protein expression in radicular cysts.

PubMed

Mourão, R V C; Júnior, E C Pinheiro; Barros Silva, P G; Turatti, E; Mota, M R L; Alves, A P N N

2016-05-01

To evaluate the relationship between mononuclear inflammatory infiltrate and the expression of a proliferative immunomarker (Ki-67) as well as to evaluate basement membrane and extracellular matrix proteins (laminin and collagen type IV) in radicular cysts and dentigerous cysts (DC). Immunohistochemical analyses were performed in heavily inflamed radicular cysts (HIRC), slightly inflamed radicular cysts (SIRC) and DC (n = 20) using Ki-67 (Dako(®) , 1 : 50), anticollagen type IV (DBS(®) , 1 : 40) and antilaminin (DBS(®) , 1 : 20). The data were analysed using anova/Tukey's test (Ki-67) and Kruskal-Wallis/Dunn's test (collagen type IV and laminin) (P < 0.05). The immunoexpression of Ki-67 was significantly greater in the SIRC group compared with the HIRC and DC (P = 0.0040). Likewise, the immunoexpression of collagen type IV in the basement membrane of the SIRC group was significantly more continuous (P = 0.0475) than in the HIRC group. DC had significantly less collagen type IV in extracellular matrix immunoexpression than HIRC and SIRC (P = 0.0246). Laminin was absent in the basement membrane in the SIRC and DC groups, and the extracellular matrix of the HIRC was weak and punctate. The presence of inflammatory factors in the radicular cyst wall modified the expression of proliferation factors in the epithelial lining and the expression of collagen type IV and laminin in the basement membrane, but did not modify extracellular matrix behaviour in radicular cysts. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

[Elective reconstruction of thoracoabdominal aortic aneurysm type IV by transabdominal approach].

PubMed

Marjanović, Ivan; Jevtić, Miodrag; Misović, Sidor; Sarac, Momir

2012-01-01

Thoracoabdominal aortic aneurysm (TAAA) type IV represents an aortic dilatation from the level of the diaphragmatic hiatus to the iliac arteries branches, including visceral branches of the aorta. In the traditional procedure of TAAA type IV repair, the body is opened using thoractomy and laparotomy in order to provide adequate exposure of the descending thoracic and abdominal aorta for safe aortic reconstruction. We reported a 71-year-old man with elective reconstruction of the TAAA type IV performed by transabdominal approach. Computed tomography scans angiography revealed a TAAA type IV with diameter of 62 mm in the region of celiac trunk andsuperior mesenteric artery branching, and the largest diameter of 75 mm in the infrarenal aortic level. The patient comorbidity included a chronic obstructive pulmonary disease and hypertension, therefore he was treated for a prolonged period. In preparation for the planned aortic reconstruction asymptomatic carotid disease (occlusion of the left internal carotid artery and subtotal stenosis of the right internal carotid artery) was diagnosed. Within the same intervention percutaneous transluminal angioplasty with stent placement in right internal carotid artery was made. In general, under endotracheal anesthesia and epidural analgesia, with transabdominal approach performed aortic reconstruction with tubular dakron graft 24 mm were, and reimplantation of visceral aortic branches into the graft performed. Postoperative course was uneventful, and the patient was discharged on the postoperative day 17. Control computed tomography scan angiography performed three months after the operation showed vascular state of the patient to be in order. Complete transabdominal approach to TAAA type IV represents an appropriate substitute for thoracoabdominal approach, without compromising safety of the patient. This approach is less traumatic, especially in patients with impaired pulmonary function, because there is no thoracotomy and any complications that could follow this approach.

Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

PubMed Central

Miyakawa, T; Kojima, M; Ui, M

1998-01-01

Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation. PMID:9405282

Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

PubMed

Miyakawa, T; Kojima, M; Ui, M

1998-01-01

Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation.

Alterations of type IV collagen alpha chains in patients with chronic acquired glomerulopathies: mRNA levels, protein expression and urinary loss.

PubMed

Sanna-Cherchi, Simone; Carnevali, Maria Luisa; Martorana, Davide; Cravedi, Paolo; Maggiore, Umberto; Alinovi, Rossella; Bovino, Achiropita; Mattei, Silvia; Orlandini, Guido; Gatti, Rita; Savi, Mario; Sado, Yoshikazu; Neri, Tauro M; Allegri, Landino

2007-01-01

Type IV collagen is a major structural component of the normal kidney glomerulus. However, its role in chronic acquired glomerulopathies has been only partially elucidated. Urinary levels of col(IV)alpha1, col(IV)alpha3 and col(IV)alpha5 collagen chains were analyzed in 107 patients with chronic acquired glomerulopathies. In a subgroup of 33 patients, tissue mRNA levels, protein expression and urinary excretion were evaluated for all col(IV)alpha chains, from col(IV)alpha1 to col(IV)alpha5. The renal specimens were examined to get a semiquantitative score of the acute and chronic activity of the histological lesions. Urines obtained from 13 healthy subjects and 10 normal renal tissue samples were used as controls. Urinary levels of col(IV)alpha1, col(IV)alpha3, col(IV)alpha5 chains were significantly higher in patients than in controls [p < 0.01 for all], while only col(IV)alpha1 and col(IV)alpha3 urinary excretion correlated with the degree of chronic histological damage [col(IV)alpha1 R = 0.44, p < 0.001; col(IV)alpha3: R = 0.47, p < 0.001]. Compared with controls, patients showed a renal expression of mRNA for col(IV)alpha5 chain significantly higher [p = 0.001], while having a significantly lower protein expression of col(IV)alpha3, col(IV)alpha4 and col(IV)alpha5 chains [p < 0.01 for all]. Patients with chronic acquired glomerulopathies show important alterations in the col(IV)alpha chain network mimicking some molecular features of the X-linked Alport's syndrome. Further studies are needed to show whether urinary levels of the col(IV)alpha chains may be used as markers for monitoring renal injury. Copyright 2007 S. Karger AG, Basel.

Mechanisms of chiral discrimination by topoisomerase IV

PubMed Central

Neuman, K. C.; Charvin, G.; Bensimon, D.; Croquette, V.

2009-01-01

Topoisomerase IV (Topo IV), an essential ATP-dependent bacterial type II topoisomerase, transports one segment of DNA through a transient double-strand break in a second segment of DNA. In vivo, Topo IV unlinks catenated chromosomes before cell division and relaxes positive supercoils generated during DNA replication. In vitro, Topo IV relaxes positive supercoils at least 20-fold faster than negative supercoils. The mechanisms underlying this chiral discrimination by Topo IV and other type II topoisomerases remain speculative. We used magnetic tweezers to measure the relaxation rates of single and multiple DNA crossings by Topo IV. These measurements allowed us to determine unambiguously the relative importance of DNA crossing geometry and enzymatic processivity in chiral discrimination by Topo IV. Our results indicate that Topo IV binds and passes DNA strands juxtaposed in a nearly perpendicular orientation and that relaxation of negative supercoiled DNA is perfectly distributive. Together, these results suggest that chiral discrimination arises primarily from dramatic differences in the processivity of relaxing positive and negative supercoiled DNA: Topo IV is highly processive on positively supercoiled DNA, whereas it is perfectly distributive on negatively supercoiled DNA. These results provide fresh insight into topoisomerase mechanisms and lead to a model that reconciles contradictory aspects of previous findings while providing a framework to interpret future results. PMID:19359479

Serotype IV Sequence Type 468 Group B Streptococcus Neonatal Invasive Disease, Minnesota, USA.

PubMed

Teatero, Sarah; Ferrieri, Patricia; Fittipaldi, Nahuel

2016-11-01

To further understand the emergence of serotype IV group B Streptococcus (GBS) invasive disease, we used whole-genome sequencing to characterize 3 sequence type 468 strains isolated from neonates in Minnesota, USA. We found that strains of tetracycline-resistant sequence type 468 GBS have acquired virulence genes from a putative clonal complex 17 GBS donor by recombination.

Diagnostic Accuracy of History and Physical Examination of Superior Labrum Anterior-Posterior Lesions

PubMed Central

Michener, Lori A.; Doukas, William C.; Murphy, Kevin P.; Walsworth, Matthew K.

2011-01-01

Context: Type I superior labrum anterior-posterior (SLAP) lesions involve degenerative fraying and probably are not the cause of shoulder pain. Type II to IV SLAP lesions are tears of the labrum. Objective: To determine the diagnostic accuracy of patient history and the active compression, anterior slide, and crank tests for type I and type II to IV SLAP lesions. Design: Cohort study. Setting: Clinic. Patients or Other Participants: Fifty-five patients (47 men, 8 women; age = 40.6 ± 15.1 years) presenting with shoulder pain. Intervention(s): For each patient, an orthopaedic surgeon conducted a clinical examination of history of trauma; sudden onset of symptoms; history of popping, clicking, or catching; age; and active compression, crank, and anterior slide tests. The reference standard was the intraoperative diagnosis. The operating surgeon was blinded to the results of the clinical examination. Main Outcome Measure(s): Diagnostic utility was calculated using the receiver operating characteristic curve and area under the curve (AUC), sensitivity, specificity, positive likelihood ratio (+LR), and negative likelihood ratio (−LR). Forward stepwise binary regression was used to determine a combination of tests for diagnosis. Results: No history item or physical examination test had diagnostic accuracy for type I SLAP lesions (n = 13). The anterior slide test had utility (AUC = 0.70, +LR = 2.25, −LR = 0.44) to confirm and exclude type II to IV SLAP lesions (n = 10). The combination of a history of popping, clicking, or catching and the anterior slide test demonstrated diagnostic utility for confirming type II to IV SLAP lesions (+LR = 6.00). Conclusions: The anterior slide test had limited diagnostic utility for confirming and excluding type II to IV SLAP lesions; diagnostic values indicated only small shifts in probability. However, the combination of the anterior slide test with a history of popping, clicking, or catching had moderate diagnostic utility for confirming type II to IV SLAP lesions. No single item or combination of history items and physical examination tests had diagnostic utility for type I SLAP lesions. PMID:21944065

Terminal ileum gangrene secondary to a type IV paraesophageal hernia.

PubMed

Hsu, Ching Tsai; Hsiao, Po Jen; Chiu, Chih Chien; Chan, Jenq Shyong; Lin, Yee Fung; Lo, Yuan Hung; Hsiao, Chia Jen

2016-02-28

Type IV paraesophageal hernia (PEH) is very rare, and is characterized by the intrathoracic herniation of the abdominal viscera other than the stomach into the chest. We describe a 78-year-old woman who presented at our emergency department because of epigastric pain that she had experienced over the past 24 h. On the day after admission, her pain became severe and was accompanied by right chest pain and dyspnea. Chest radiography revealed an intrathoracic intestinal gas bubble occupying the right lower lung field. Emergency explorative laparotomy identified a type IV PEH with herniation of only the terminal ileum through a hiatal defect into the right thoracic cavity. In this report, we also present a review of similar cases in the literature published between 1980 and 2015 in PubMed. There were four published cases of small bowel herniation into the thoracic cavity during this period. Our patient represents a rare case of an individual diagnosed with type IV PEH with incarceration of only the terminal ileum.

Atypical hereditary sensory and autonomic neuropathy type IV with neither mental retardation nor pain insensitivity.

PubMed

Jung, Chae Lim; Ki, Chang-Seok; Kim, Byoung Joon; Lee, Jong-Hyuck; Sung, Ki-Sun; Kim, Jong-Won; Park, Youn-Soo

2013-12-01

Hereditary sensory and autonomic neuropathy type IV is an autosomal recessive disorder characterized by severe mental retardation and self-mutilation-related complications. Recently, we investigated a 16-year-old Korean boy with normal intelligence. He had preserved pain sensation but was suspected of having hereditary sensory and autonomic neuropathy type IV because of the recurrent bone fractures and painless joint destruction in the absence of any predisposing medical conditions. Genetic analysis of the NTRK1 gene revealed compound heterozygous mutations including c.851-33T>A and c.2303C>T (p.Pro768Leu) in the NTRK1 gene. The p.Pro768Leu mutation has been identified in 2 Japanese patients with a mild phenotype. Therefore, although it is rare, hereditary sensory and autonomic neuropathy type IV should be considered in patients with recurrent bone fractures and painless joint destruction who do not have any predisposing conditions even when they do not have typical clinical features such as mental retardation or pain insensitivity.

Type IV Hypersensitivity to Gold Weight Upper-Eyelid Implant: Case Report and Review of the Literature.

PubMed

Kilduff, Caroline L S; Casswell, Edward J; Imonikhe, Richard; Marjanovic, Branka

2017-05-04

Complications associated with gold-weight insertion for lagophthalmos are uncommon, recent reports have provided evidence to suggest that type IV hypersensitivity to gold can cause a persistent inflammatory reaction. We present a case of a 46-year-old man who experienced persistent post-operative inflammation, and summarize previously documented cases. This patient underwent uncomplicated insertion of an upper eyelid gold weight for right-sided facial nerve palsy. He had no allergies or implanted metalwork. Post-operatively erythema was noted at seven-weeks and did not resolve. The weight was removed after six-months. The histopathological findings were in keeping with type IV hypersensitivity and similar to previous cases. Although infrequent, this complication has poor outcomes. The definitive management is removal of the weight. Information regarding implanted gold, and previous reactions should be elicited pre-operatively. Type IV hypersensitivity should be considered in patients with persistent inflammation that do not respond to antibiotic or steroid therapy.

[Clinical study on vocal cords spontaneous rehabilitation after CO2 laser surgery].

PubMed

Zhang, Qingxiang; Hu, Huiying; Sun, Guoyan; Yu, Zhenkun

2014-10-01

To study the spontaneous rehabilitation and phonation quality of vocal cords after different types of CO2 laser microsurgery. Surgical procedures based on Remacle system Type I, Type II, Type III, Type IV and Type V a respectively. Three hundred and fifteen cases with hoarseness based on strobe laryngoscopy results were prospectively assigned to different group according to vocal lesions apperence,vocal vibration and imaging of larynx CT/MRI. Each group holded 63 cases. The investigation included the vocal cords morphological features,the patients' subjective feelings and objective results of vocal cords. There are no severe complications for all patients in perioperative period. Vocal scar found in Type I ,1 case; Type II, 9 cases ;Type III, 47 cases; Type IV, 61 cases and Type Va 63 cases respectively after surgery. The difference of Vocal scar formation after surgery between surgical procedures are statistical significance (χ2 = 222.24, P < 0.05). Hoarseness improved after the surgery in 59 cases of Type I , 51 cases of Type II, 43 cases of Type III, 21 cases of Type IV and 17 cases of Type Va. There are statistically significance (χ2 = 89.46, P < 0.05) between different surgical procedures. The parameters of strobe laryngoscope: there are statistical significance on jitter between procedures (F 44.51, P < 0.05), but without difference within Type I and Type II (P > 0.05). This happened in shimmer parameter and the maximum phonation time (MPT) as jitter. There are no statistical significance between Type IV and Type Va on MPT (P > 0.05). Morphological and functional rehabilitation of vocal cord will be affected obviously when the body layer is injured. The depth and range of the CO2 laser microsurgery are the key factors affecting the vocal rehabilitation.

Identification of Surprisingly Diverse Type IV Pili, across a Broad Range of Gram-Positive Bacteria

PubMed Central

Roos, David S.; Pohlschröder, Mechthild

2011-01-01

Background In Gram-negative bacteria, type IV pili (TFP) have long been known to play important roles in such diverse biological phenomena as surface adhesion, motility, and DNA transfer, with significant consequences for pathogenicity. More recently it became apparent that Gram-positive bacteria also express type IV pili; however, little is known about the diversity and abundance of these structures in Gram-positives. Computational tools for automated identification of type IV pilins are not currently available. Results To assess TFP diversity in Gram-positive bacteria and facilitate pilin identification, we compiled a comprehensive list of putative Gram-positive pilins encoded by operons containing highly conserved pilus biosynthetic genes (pilB, pilC). A surprisingly large number of species were found to contain multiple TFP operons (pil, com and/or tad). The N-terminal sequences of predicted pilins were exploited to develop PilFind, a rule-based algorithm for genome-wide identification of otherwise poorly conserved type IV pilins in any species, regardless of their association with TFP biosynthetic operons (http://signalfind.org). Using PilFind to scan 53 Gram-positive genomes (encoding >187,000 proteins), we identified 286 candidate pilins, including 214 in operons containing TFP biosynthetic genes (TBG+ operons). Although trained on Gram-positive pilins, PilFind identified 55 of 58 manually curated Gram-negative pilins in TBG+ operons, as well as 53 additional pilin candidates in operons lacking biosynthetic genes in ten species (>38,000 proteins), including 27 of 29 experimentally verified pilins. False positive rates appear to be low, as PilFind predicted only four pilin candidates in eleven bacterial species (>13,000 proteins) lacking TFP biosynthetic genes. Conclusions We have shown that Gram-positive bacteria contain a highly diverse set of type IV pili. PilFind can be an invaluable tool to study bacterial cellular processes known to involve type IV pilus-like structures. Its use in combination with other currently available computational tools should improve the accuracy of predicting the subcellular localization of bacterial proteins. PMID:22216142

Accentuated hyperparathyroidism in type II Bartter syndrome.

PubMed

Landau, Daniel; Gurevich, Evgenia; Sinai-Treiman, Levana; Shalev, Hannah

2016-07-01

Bartter syndrome (BS) may be associated with different degrees of hypercalciuria, but marked parathyroid hormone (PTH) abnormalities have not been described. We compared clinical and laboratory data of patients with either ROMK-deficient type II BS (n = 14) or Barttin-deficient type IV BS (n = 20). Only BS-IV patients remained mildly hypokalemic in spite of a higher need for potassium supplementation. Estimated glomerular filtration rate (eGFR) was mildly decreased in only four BS-IV patients. Average PTH values were significantly higher in BS-II (160.6 ± 85.8 vs. 92.5 ± 48 pg/ml in BS-IV, p = 0.006). In both groups, there was a positive correlation between age and log(PTH). Levels of 25(OH) vitamin D were not different. Total serum calcium was lower (within normal limits) and age-related serum phosphate (Pi)-SDS was increased in BS-II (1.19 ± 0.71 vs. 0.01 ± 1.04 in BS-IV, p < 0.001). The GFR threshold for Pi reabsorption was higher in BS-II (5.63 ± 1.25 vs. 4.36 ± 0.98, p = 0.002). Spot urine calcium/creatinine ratio and nephrocalcinosis rate (100 vs. 16 %) were higher in the BS-II group. PTH, serum Pi levels, and urinary threshold for Pi reabsorption are significantly elevated in type II vs. type IV BS, suggesting a PTH resistance state. This may be a response to more severe long-standing hypercalciuria, leading to a higher rate of nephrocalcinosis in BS-II.

Properties of the highly ionized disk and halo gas toward two distant high-latitude stars

NASA Technical Reports Server (NTRS)

Savage, Blair D.; Sembach, K. R.

1994-01-01

Goddard High Resolution Spectrograph (GHRS) intermediate -resolution observations of S III, Si III, Al III, Si IV, C IV, and N V absorption along the sight lines to HD 18100 (l = 217.9 deg, b = -62.7, d = 3.1 kpc, z = -2.8 kpc) and HD 100340 (l = 258.9 deg, b = +61.2 deg, d = 5.3 kpc, z = 4.6 kpc) are presented. These small science aperture spectra have resolutions ranging from 11 to 20 km/s full width at half maximum (FWHM) and S/N from 30 to 65 per diode substep. Strong absorption by moderately and highly ionized gas is seen in each direction. The absorption in the direction of the south Galactic polar region (HD 18100) is kinematically simple, while the absorption in the direction of north Galactic polar region (HD 100304) is kinematically complex. In each case the absorption by the highly ionized gas lies within the velocity range of absorption by neutral and weakly ionized gas. Along each sight line, the velocity dispersion determined from the unsaturated absorption lines increases with the energy required to create each ion. The logarithmic column densities for Al III, Si IV, C IV, and N V are log N(atoms/sq cm = 12.71, 13.10, 13.58, and 12.75 toward HD 18100 and log N = 12.88, 13.31, 13.83, and 13.04 toward HD 100340. Average ionic ratios among these species are very similar along the two sight lines. Differences in profile shape between the absorption for AL II, Si IV, C IV, and N V provide additional support for the claim of Savage, Sembach, & Cardelli (1994) that there exists two types of highly ionized gas in the interstellar medium. One type of highly ionized gas is responsible for the structured Si IV absorption and part of the C IV absorption. In this gas N(C IV)/N(Si IV) approximately 3.0 and N(C IV)/N(N V) greater than 6. The absorption by this gas seems to be associated with some type of self-regulating interface or mixing layer between the warm and hot interstellar medium. The other type of highly ionized gas is responsible for most of the N V absorption, part of the C IV absorption, and has very little associated Si IV absorption. In this gas N(C IV)/N(N V) is approximately 1 to 3. This gas is hot (T greater than 2 x 10(exp 5) K) and may be tracing the cooling gas of supernova (SN) bubbles or a Galactic fountain. The relative mixture of these two types of highly ionized gas varies from one sight line to the next. The two sight lines in this study sample halo gas in the solar neighborhood and have a smaller percentage of the more highly ionized gas than inner Galaxy sight lines.

Selective thoracic surgery in the Lenke type 1A: King III and King IV type curves.

PubMed

Parisini, P; Di Silvestre, M; Lolli, F; Bakaloudis, G

2009-06-01

Pedicle screw fixation enables enhanced three-dimensional correction of spinal deformities and effectively shortens the distal fusion level. However, the choice of distal fusion level is still controversial in single thoracic idiopathic scoliosis with the lumbar compensatory curve not crossing the middle line (Lenke type 1 with modifier A or King type III and IV curves).The authors retrospectively analyzed 31 patients treated by segmental pedicular instrumentation alone, affected by a single thoracic adolescent idiopathic scoliosis with a compensatory lumbar curve not crossing the midline (Lenke 1A), with an average age of 16.3 years (range 10-22 years). The patients with regard to the King classification were also assessed. A statistical analysis was performed to determine whether the two groups (King III, King IV) presented differences concerning the level of the stable vertebra (SV), end vertebra (EV), and neutral vertebra (NV) and were also analyzed the results at follow-up regarding the relationships between the SV, EV, and lowest instrumented vertebra (LIV). The statistical analysis showed a significant difference between the two curve types. In the King III type curve the SV, EV, and NV appeared to be more proximal than those of the King IV type curve and the segments between the SV, EV, and NV appeared to be reduced in King III curves compared with King IV curves. At a follow-up of 3.2 years (range 2.2-5) the thoracic curve showed a correction of 58.4% (from 62.3 degrees to 26.6 degrees ) and compensatory lumbar curve an average spontaneous correction of 52.4% (from 38.1 degrees to 18.1 degrees ).The position of the LIV was shorter than the position of the SV in 30 patients (97%) with an average "salvage" of 2.1 (from 1 to 4) distal fusion levels. Four cases (13%), all affected by a King IV type curve, presented at follow-up an unsatisfactory results due to an "adding on" phenomenon. The statistical analysis confirmed that this phenomenon was correlated with The King IV curve (P = 0.043; Chi-square test) and that the only predictive parameter for its onset was the LIV-SV difference (odds ratio = 0.093; with a confidence interval of 0.008-1): every time that in King IV curve type the LIV was three or more levels shorter than the stable vertebra at follow-up the "adding on" phenomenon was present. The authors conclude that Lenke's type 1 with modifier A includes two kinds of curves, King III and King IV and that the Lenke's type 2 curves and King V with the lumbar curve not crossing the middle line have a similar behavior. Therefore, it is of authors' opinion that "the adding on phenomenon" could be prevented by more rigidly defining K. IV versus K. III curves. In Lenke's 1/2 A-K. IV/V type with the rotation of the first vertebra just below the thoracic lower EV in the same direction as the thoracic curve, and when SV and EV show more than two levels of difference, it is necessary to extend the lower fusion down to L2 or L3 (not more than two levels shorter than the SV). Whereas in Lenke's 1/2 A-K. III/V with the rotation of the first proximal vertebra of lumbar curve in the opposite direction to the thoracic apex and when SV and EV show not more than two level gap differences, the position of the lowest instrumented vertebra can be two or three levels shorter than the stable vertebra with satisfactory postoperative spinal balance. Therefore, the stable vertebra and the rotation of lumbar curve are considered to be a reliable guide for selecting the lower level of fusion.

Specific Accumulation of Tumor-Derived Adhesion Factor in Tumor Blood Vessels and in Capillary Tube-Like Structures of Cultured Vascular Endothelial Cells

NASA Astrophysics Data System (ADS)

Akaogi, Kotaro; Okabe, Yukie; Sato, Junji; Nagashima, Yoji; Yasumitsu, Hidetaro; Sugahara, Kazuyuki; Miyazaki, Kaoru

1996-08-01

Tumor-derived adhesion factor (TAF) was previously identified as a cell adhesion molecule secreted by human bladder carcinoma cell line EJ-1. To elucidate the physiological function of TAF, we examined its distribution in human normal and tumor tissues. Immunochemical staining with an anti-TAF monoclonal antibody showed that TAF was specifically accumulated in small blood vessels and capillaries within and adjacent to tumor nests, but not in those in normal tissues. Tumor blood vessel-specific staining of TAF was observed in various human cancers, such as esophagus, brain, lung, and stomach cancers. Double immunofluorescent staining showed apparent colocalization of TAF and type IV collagen in the vascular basement membrane. In vitro experiments demonstrated that TAF preferentially bound to type IV collagen among various extracellular matrix components tested. In cell culture experiments, TAF promoted adhesion of human umbilical vein endothelial cells to type IV collagen substrate and induced their morphological change. Furthermore, when the endothelial cells were induced to form capillary tube-like structures by type I collagen, TAF and type IV collagen were exclusively detected on the tubular structures. The capillary tube formation in vitro was prevented by heparin, which inhibited the binding of TAF to the endothelial cells. These results strongly suggest that TAF contributes to the organization of new capillary vessels in tumor tissues by modulating the interaction of endothelial cells with type IV collagen.

Cassini is moved to Pad 40, CCAS, and placed atop its Titan IV launcher

NASA Technical Reports Server (NTRS)

1997-01-01

The Cassini spacecraft is lowered to the top of its Titan IV/Centaur launch vehicle at Launch Complex 40, Cape Canaveral Air Station (CCAS). Cassini is an international mission conducted by the National Aeronautics and Space Administration (NASA), the European Space Agency (ESA), and the Italian Space Agency (ASI). The two-story-tall spacecraft, scheduled for launch on Oct. 6, is destined to arrive at Saturn in July 2004, where it will orbit and study Saturn, its rings, moons and magnetic environment in detail over a four-year period. The Cassini mission is managed for NASA's Office of Space Science by the Jet Propulsion Laboratory, a division of the California Institute of Technology.

Successful Multiresistant Community-Associated Methicillin-Resistant Staphylococcus aureus Lineage from Taipei, Taiwan, That Carries Either the Novel Staphylococcal Chromosome Cassette mec (SCCmec) Type VT or SCCmec Type IV

PubMed Central

Boyle-Vavra, Susan; Ereshefsky, Ben; Wang, Chih-Chien; Daum, Robert S.

2005-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) isolates carry the methicillin resistance gene (mecA) on a horizontally transferred genetic element called the staphylococcal chromosome cassette mec (SCCmec). Community-acquired MRSA (CAMRSA) isolates usually carry SCCmec type IV. We previously reported that 76% of 17 CAMRSA isolates (multilocus sequence type 59) obtained from pediatric patients with skin and soft tissue infections (SSTI) from Taipei did not carry SCCmec types I to IV. We used DNA sequence analysis to determine that the element harbored by these nontypeable isolates is a novel subtype of SCCmec V called SCCmec VT. It contains a ccrC recombinase gene variant (ccrC2) and mec complex C2. One SSTI isolate contained molecular features of SCCmec IV but also contained ccrC2 (a feature of SCCmec VT), suggesting that it may harbor a composite SCCmec element. The genes lukS-PV and lukF-PV encoding the Panton-Valentine leukocidin (PVL) were present in all CAMRSA SSTI isolates whether they contained SCCmec type IV or VT. SCCmec VT was also present in 5 of 34 (14.7%) CAMRSA colonization isolates collected from healthy children from Taipei who lacked MRSA risk factors. Four (80%) of the these isolates contained lukS-PV and lukF-PV, as did 1 of 27 (3.7%) SCCmec IV-containing colonization isolates. A total of 63% (10 of 16) of the SSTI isolates and 61.7% (21 of 34) of the colonization isolates tested were resistant to at least four classes of non-β-lactam antimicrobials. SCCmec VT is a novel SCCmec variant that is found in multiply resistant CAMRSA strains with sequence type 59 in Taipei in association with the PVL leukotoxin genes. PMID:16145133

Change in residential remoteness during the first 5 years of life in an Australian cerebral palsy cohort.

PubMed

DeLacy, Michael J; Louca, Christalla; Smithers-Sheedy, Hayley; McIntyre, Sarah

2016-02-01

To determine if families of children with cerebral palsy living in Australia move to less remote areas between birth and 5 years. Children on the Australian Cerebral Palsy Register (n=3399) born 1996 to 2005, were assigned a remoteness value for family residence at birth and 5 years using a modification of the Australian Statistical Geography Standard. Each value at birth was subtracted from the value at 5 years yielding a positive difference if they moved more remotely, negative difference if they moved less remotely and a value of zero if they did not move or moved to an equally remote residence. The small net increase in remoteness across this cohort was non-significant (p=0.43). Fifty-seven per cent of families changed postcode but only 20% changed remoteness, 11% more remotely, and 9% less remotely. There was a small trend for families with a child with more impaired gross motor function (Gross Motor Function Classification System levels IV and V) to move to a less remote area. This cohort of families with children with cerebral palsy did not appear to move to less remote areas by age 5 years. Remoteness at birth and level of gross motor function seem to have little effect. © 2016 The Authors. Developmental Medicine & Child Neurology © 2016 Mac Keith Press.

(2R)-4-Oxo-4[3-(Trifluoromethyl)-5,6-diihydro:1,2,4}triazolo[4,3-a}pyrazin-7(8H)-y1]-1-(2,4,5-trifluorophenyl)butan-2-amine: A Potent, Orally Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 Diabetes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, D.; Wang, L.; Beconi, M.

2010-11-10

A novel series of {beta}-amino amides incorporating fused heterocycles, i.e., triazolopiperazines, were synthesized and evaluated as inhibitors of dipeptidyl peptidase IV (DPP-IV) for the treatment of type 2 diabetes. (2R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine (1) is a potent, orally active DPP-IV inhibitor (IC{sub 50} = 18 nM) with excellent selectivity over other proline-selective peptidases, oral bioavailability in preclinical species, and in vivo efficacy in animal models. MK-0431, the phosphate salt of compound 1, was selected for development as a potential new treatment for type 2 diabetes.

Genetics Home Reference: mucolipidosis type IV

MedlinePlus

... PubMed Vergarajauregui S, Puertollano R. Mucolipidosis type IV: the importance of functional lysosomes for efficient autophagy. Autophagy. 2008 ... Reviewed : August 2013 Published : June 26, 2018 The resources on this site should not be used as a substitute ... Department of Health & Human Services National Institutes of Health National Library of ...

Mass loss in the interacting semi-detached binary delta librae

NASA Technical Reports Server (NTRS)

Mccluskey, George E., Jr.; Mccluskey, Carolina P. S.; Kondo, Yoji

1995-01-01

The interacting Algol-type binary Delta Librae (AOV + G: V) has been observed with the International Ultraviolet Explorer (IUE) satellite. More than fifty high resolution spectra in the far-ultraviolet and mid-ultraviolet spectrum have been analyzed in order to model the mass flow in the Delta Librae system. The resonance lines of Si IV and C IV are present in absorption and vary in strength both secularly and with phase. The radial velocities of the Si IV and C IV absorption lines generally follow the orbital motion of the primary star but deviate by typically a few tens of kilometers per second in the direction of the observer. The presence of Si IV and C IV features indicates the existence of a region considerably hotter than the normal AOV photosphere and, since these lines are present at all phases, this region must be fairly extensive. These results are interpreted in terms of a 'pseudo-photosphere' around the equatorial region of the AOV star, created by matter being accreted from the G-type companion. The widths of the Si IV and C IV absorption features imply that some of the matter lost by the G-star leaves the system entirely.

Laboratory Assessment of Commercially Available Ultrasonic Rangefinders

DTIC Science & Technology

2015-11-01

how the room was designed to prevent sound reflections (a combination of the wedges absorbing the waveforms and not having a flat wall ). When testing... sound booth at 0.5 m. ...................................................................................... 5  iv This page is intentionally...environments for sound measurements using a tape measure. This mapping method can be time- consuming and unreliable as objects frequently move around in

Structural studies of a bifunctional inhibitor of neprilysin and DPP-IV.

PubMed

Oefner, Christian; Pierau, Sabine; Schulz, Henk; Dale, Glenn E

2007-09-01

Neutral endopeptidase (NEP) is the major enzyme involved in the metabolic inactivation of a number of bioactive peptides including the enkephalins, substance P, endothelin, bradykinin and atrial natriuretic factor, as well as the incretin hormone glucagon-like peptide 1 (GLP-1), which is a potent stimulator of insulin secretion. The activity of GLP-1 is also rapidly abolished by the serine protease dipeptidyl peptidase IV (DPP-IV), which led to an elevated interest in inhibitors of this enzyme for the treatment of type II diabetes. A dual NEP/DPP-IV inhibitor concept is proposed, offering an alternative strategy for the treatment of type 2 diabetes. Here, the synthesis and crystal structures of the soluble extracellular domain of human NEP (residues 52-749) complexed with the NEP, competitive and potent dual NEP/DPP-IV inhibitor MCB3937 are described.

[Mucolipidoses type IV in a patient with mapuche ancestry].

PubMed

Hernández Ch, Marta; Méndez C, José Ignacio; Concha G, María José; Huete L, Isidro; González B, Sergio; Durán S, Gloria P

2008-07-01

We report a 7 year-old girl with mapuche ancestors, diagnosed as a cerebral palsy since infancy and on active rehabilitation. She acquired motor and cognitive skills at 3 years of age. At 5 years of age, a slow neurological deterioration started, associated to visual impairment. Optic atrophy was added to the typical neurological exam of ataxic cerebral palsy and the diagnosis was re-considered. Neuroimaging showed a slow and progressive atrophy of intracerebral structures and ultramicroscopy revealed intracytoplasmatic inclusions in conjunctiva and skin, compatible with mucolipidoses type IV (ML-IV). ML-IV must be included in the differential diagnosis of cerebral palsy associated with loss of acquired skills and progressive visual impairment. Electron microscopy of skin or conjunctiva is a useful diagnostic test. Suspicion of ML-IV must not be restricted to Ashkenazi Jewish population.

Apparatus for generating partially coherent radiation

DOEpatents

Naulleau, Patrick P.

2004-09-28

The effective coherence of an undulator beamline can be tailored to projection lithography requirements by using a simple single moving element and a simple stationary low-cost spherical mirror. The invention is particularly suited for use in an illuminator device for an optical image processing system requiring partially coherent illumination. The illuminator includes: (i) source of coherent or partially coherent radiation which has an intrinsic coherence that is higher than the desired coherence; (ii) a reflective surface that receives incident radiation from said source; (iii) means for moving the reflective surface through a desired range of angles in two dimensions wherein the rate of the motion is fast relative to integration time of said image processing system; and (iv) a condenser optic that re-images the moving reflective surface to the entrance plane of said image processing system, thereby, making the illumination spot in said entrance plane essentially stationary.

Basement Membrane Type IV Collagen and Laminin: An Overview of Their Biology and Value as Fibrosis Biomarkers of Liver Disease.

PubMed

Mak, Ki M; Mei, Rena

2017-08-01

Basement membranes provide structural support to epithelium, endothelium, muscles, fat cells, Schwann cells, and axons. Basement membranes are multifunctional: they modulate cellular behavior, regulate organogenesis, promote tissue repair, form a barrier to filtration and tumor metastasis, bind growth factors, and mediate angiogenesis. All basement membranes contain type IV collagen (Col IV), laminin, nidogen, and perlecan. Col IV and laminin self-assemble into two independent supramolecular networks that are linked to nidogen and perlecan to form a morphological discernable basement membrane/basal lamina. The triple helical region, 7S domain and NCI domain of Col IV, laminin and laminin fragment P1 have been evaluated as noninvasive fibrosis biomarkers of alcoholic liver disease, viral hepatitis, and nonalcoholic fatty liver disease. Elevated serum Col IV and laminin are related to degrees of fibrosis and severity of hepatitis, and may reflect hepatic basement membrane metabolism. But the serum assays have not been linked to disclosing the anatomical sites and lobular distribution of perisinusoidal basement membrane formation in the liver. Hepatic sinusoids normally lack a basement membrane, although Col IV is a normal matrix component of the space of Disse. In liver disease, laminin deposits in the space of Disse and codistributes with Col IV, forming a perisinusoidal basement membrane. Concomitantly, the sinusoidal endothelium loses its fenestrae and is transformed into vascular type endothelium. These changes lead to capillarization of hepatic sinusoids, a significant pathology that impairs hepatic function. Accordingly, codistribution of Col IV and laminin serves as histochemical marker of perisinusoidal basement membrane formation in liver disease. Anat Rec, 300:1371-1390, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Odorant transfer characteristics of white bread during baking.

PubMed

Onishi, Masanobu; Inoue, Michiko; Araki, Tetsuya; Iwabuchi, Hisakatsu; Sagara, Yasuyuki

2011-01-01

The potent odorants in the crust and crumb of white bread were identified and quantified by gas chromatography-mass spectrometry and gas chromatography/olfactometry. The weight loss ratio of the samples baked at 220 °C was controlled in the range of 0-28%. The odorants were classified into 5 types by the transfer characteristics: i) All amounts of odorant transferred from the crust to external space (type-I). ii) All transferred from the crust to the crumb and external space (type-II). iii) Certain amount remaining in the crust and the rest transferred to the crumb and external space (type-III). iv) All transferred from the crumb to external space (type-IV). v) Certain amount remaining in the crumb and the rest transferred to the crust and external space (type-V). The odorants of type-IV were not apparent after the crust had formed. The results indicate that the crust could be a barrier to prevent the odorants from being transferred to external space.

Modulation of substance P signaling by dipeptidyl peptidase-IV enzymatic activity in human glioma cell lines.

PubMed

Busek, P; Stremenová, J; Krepela, E; Sedo, A

2008-01-01

Dipeptidyl peptidase-IV (DPP-IV, CD26) is a serine protease almost ubiquitously expressed on cell surface and present in body fluids. DPP-IV has been suggested to proteolytically modify a number of biologically active peptides including substance P (SP) and the chemokine stromal cell derived factor-1alpha (SDF-1alpha, CXCL12). SP and SDF-1alpha have been implicated in the regulation of multiple biological processes and also induce responses that may be relevant for glioma progression. Both SP and SDF-1alpha are signaling through cell surface receptors and use intracellular calcium as a second messenger. The effect of DPP-IV on intracellular calcium mobilization mediated by SP and SDF-1alpha was monitored in suspension of wild type U373 and DPP-IV transfected U373DPPIV glioma cells using indicator FURA-2. Nanomolar concentrations of SP triggered a transient dose dependent increase in intracellular calcium rendering the cells refractory to repeated stimulation, while SDF-1 had no measurable effect. SP signaling in DPP-IV overexpressing U373DPPIV cells was not substantially different from that in wild type cells. However, preincubation of SP with the DPP-IV overexpressing cells lead to the loss of its signaling potential, which could be prevented with DPP-IV inhibitors. Taken together, DPP-IV may proteolytically inactivate local mediators involved in gliomagenesis.

Immunotherapy using regulatory T cells in cancer suggests more flavors of hypersensitivity type IV.

PubMed

Pakravan, Nafiseh; Hassan, Zuhair Mohammad

2018-03-01

Regulatory T cells (Tregs) profoundly affect tumor microenvironment and exert dominant suppression over antitumor immunity in response to self-antigen expressed by tumor. Immunotherapy targeting Tregs lead to a significant improvement in antitumor immunity. Intradermal injection of tumor antigen results in negative delayed-type hypersensitivity (DTH) type IV. However, anti-Tregs treatment/use of adjuvant along with tumor antigens turns DTH to positive. Considering Tregs as the earliest tumor sensor/responders, tumor can be regarded as Treg-mediated type IV hypersensitivity and negative DTH to tumor antigen is due to anti-inflammatory action of Tregs to tumor antigens at the injection site. Such a view would help us in basic and clinical situations to testify a candidate vaccine via dermal administration and evaluation of Treg proportion at injection site.

THE FURTHER SEPARATION OF TYPES AMONG THE PNEUMOCOCCI HITHERTO INCLUDED IN GROUP IV AND THE DEVELOPMENT OF THERAPEUTIC ANTISERA FOR THESE TYPES

PubMed Central

Cooper, Georgia; Rosenstein, Carolyn; Walter, Annabel; Peizer, Lenore

1932-01-01

The unclassified strains known as Group IV have been separated into twenty-nine types which are designated by the Roman numerals IV and XXXII. Only a small percentage of the pneumococcus strains isolated in New York City for this study were left unclassified. The majority of the types gave very slight cross-reactions, the exceptions being Types II and V, III and VIII, VII and XVIII and XV and XXX. In the series of cases studied, Types IV, V, VII and VIII were found more prevalent in the lobar pneumonia of adults and Types V, VI a and XIV in children. The majority of the types were also found in normal individuals and in persons having respiratory infections other than pneumonia. Types VI a and XIX were most prevalent in the limited number of strains studied by us. Fourteen of the types were found in pneumococcus meningitis; Type XVIII was found most often. Antisera suitable for clinical trial have been prepared for fourteen types. From the majority of the horses inoculated for more than a year, antisera having 500 to 1000 units per cc. were obtained. Antisera of lower potency were concentrated and preparations obtained equal to or stronger than high grade unconcentrated serum. Potent bivalent antisera have been prepared for types which were found to give marked cross-agglutination reactions. The results with each type as to prevalence, severity of cases, presence in normal individuals, and in spinal meningitis, potency of antisera produced for therapeutic trial and virulence of strains for mice have been considered under the different type headings. PMID:19870011

Long-term blood glucose monitoring with implanted telemetry device in conscious and stress-free cynomolgus monkeys.

PubMed

Wang, B; Sun, G; Qiao, W; Liu, Y; Qiao, J; Ye, W; Wang, H; Wang, X; Lindquist, R; Wang, Y; Xiao, Y-F

2017-09-01

Continuous blood glucose monitoring, especially long-term and remote, in diabetic patients or research is very challenging. Nonhuman primate (NHP) is an excellent model for metabolic research, because NHPs can naturally develop Type 2 diabetes mellitus (T2DM) similarly to humans. This study was to investigate blood glucose changes in conscious, moving-free cynomolgus monkeys (Macaca fascicularis) during circadian, meal, stress and drug exposure. Blood glucose, body temperature and physical activities were continuously and simultaneously recorded by implanted HD-XG telemetry device for up to 10 weeks. Blood glucose circadian changes in normoglycemic monkeys significantly differed from that in diabetic animals. Postprandial glucose increase was more obvious after afternoon feeding. Moving a monkey from its housing cage to monkey chair increased blood glucose by 30% in both normoglycemic and diabetic monkeys. Such increase in blood glucose declined to the pre-procedure level in 30 min in normoglycemic animals and >2 h in diabetic monkeys. Oral gavage procedure alone caused hyperglycemia in both normoglycemic and diabetic monkeys. Intravenous injection with the stress hormones, angiotensin II (2 μg/kg) or norepinephrine (0.4 μg/kg), also increased blood glucose level by 30%. The glucose levels measured by the telemetry system correlated significantly well with glucometer readings during glucose tolerance tests (ivGTT or oGTT), insulin tolerance test (ITT), graded glucose infusion (GGI) and clamp. Our data demonstrate that the real-time telemetry method is reliable for monitoring blood glucose remotely and continuously in conscious, stress-free, and moving-free NHPs with the advantages highly valuable to diabetes research and drug discovery.

Evidence for an interaction between leptin, T cell costimulatory antigens CD28, CTLA-4 and CD26 (dipeptidyl peptidase IV) in BCG-induced immune responses of leptin- and leptin receptor-deficient mice.

PubMed

Rüter, Jens; Hoffmann, Torsten; Demuth, Hans-Ulrich; Moschansky, Petra; Klapp, Burghard F; Hildebrandt, Martin

2004-06-01

We assessed changes of the enzyme dipeptidyl peptidase IV (DPP IV, CD26) in the context of leptin or leptin receptor deficiency. C57BL/6 mice, Leptin-deficient mice (ob/ob mice, B6.V-Lep) and Leptin-receptor-deficient mice (db/db mice, B6.Cg-m+/+Lepr) were infected with B. Calmette-Guerin (BCG) and sacrificed three days later. DPP IV activity in serum was higher in ob/ob mice and in db/db mice than in wild-type mice. The expression of DPP IV/CD26 on splenocytes was higher in ob/ob mice than in wild-type animals, and lower in db/db mice, and decreased upon stimulation with BCG in ob/ob mice only. Several T cell antigens including CTLA-4 were expressed aberrantly in ob/ob and in db/db mice. Our observations provide evidence for a relationship between DPP IV and leptin.

A theoretical framework for the changing spectral properties of meter-scale Farley-Buneman waves between 90 and 125 km altitudes

NASA Astrophysics Data System (ADS)

St.-Maurice, Jean-Pierre; Chau, Jorge L.

2016-10-01

Stimulated by recent observations described in a companion paper, we have revisited existing theories of the Farley-Buneman instability throughout the altitude range 90 to 125 km. We have assumed that the irregularities detected by radars at a given altitude are dominated by structures moving at the threshold speed in a direction associated with maximum linear growth rate conditions. We included recent nonisothermal electron and ion theories, which can modify threshold speeds by considerable amounts. We included altitude-dependent models of ion and electron temperature and of the ion motion in the phase velocity calculations. Our treatment of the instability explains why some spectra are slow (Doppler shifts typically 200 m/s) and narrow, while others are fast (1500 m/s or close to the E × B) and narrow. These narrow spectra have all the characteristics of what has been labeled as "Type III" and "Type IV" in the past. Our calculations also offer an explanation for the observation of a strong asymmetry in the number of events with positive Doppler shifts near the nominal ion-acoustic speed and those with negative Doppler shifts of the same magnitude.

Cardiac arrest after anesthetic management in a patient with hereditary sensory autonomic neuropathy type IV.

PubMed

Ergül, Yakup; Ekici, Bariş; Keskin, Sabiha

2011-01-01

Hereditary sensory autonomic neuropathy type IV is a rare disorder with an autosomal recessive transmission and characterized by self-mutilation due to a lack in pain and heat sensation. Recurrent hyperpyrexia and anhydrosis are seen in patients as a result of a lack of sweat gland innervation. Self-mutilation and insensitivity to pain result in orthopedic complications and patients undergone recurrent surgical interventions with anesthesia. However, these patients are prone to perioperative complications such as hyperthermia, hypothermia, and cardiac complications like bradycardia and hypotension. We report a 5-year-old boy with hereditary sensory autonomic neuropathy type IV, developing hyperpyrexia and cardiac arrest after anesthesia.

Flap flexibility amongst plasmepsins I, II, III, IV, and V: Sequence, structural, and molecular dynamics analyses.

PubMed

McGillewie, Lara; Soliman, Mahmoud E

2015-09-01

Herein, for the first time, we comparatively report the opening and closing of apo plasmepsin I - V. Plasmepsins belong the aspartic protease family of enzymes, and are expressed during the various stages of the P. falciparum lifecycle, the species responsible for the most lethal and virulent malaria to infect humans. Plasmepsin I, II, IV and HAP degrade hemoglobin from infected red blood cells, whereas plasmepsin V transport proteins crucial to the survival of the malaria parasite across the endoplasmic reticulum. Flap-structures covering the active site of aspartic proteases (such as HIV protease) are crucial to the conformational flexibility and dynamics of the protein, and ultimately control the binding landscape. The flap-structure in plasmepsins is made up of a flip tip in the N-terminal lying perpendicular to the active site, adjacent to the flexible loop region in the C-terminal. Using molecular dynamics, we propose three parameters to better describe the opening and closing of the flap-structure in apo plasmepsins. Namely, the distance, d1, between the flap tip and the flexible region; the dihedral angle, ϕ, to account for the twisting motion; and the TriCα angle, θ1. Simulations have shown that as the flap-structure twists, the flap and flexible region move apart opening the active site, or move toward each other closing the active site. The data from our study indicate that of all the plasmepsins investigated in the present study, Plm IV and V display the highest conformational flexibility and are more dynamic structures versus Plm I, II, and HAP. © 2015 Wiley Periodicals, Inc.

Robotic astrobiology - prospects for enhancing scientific productivity of mars rover missions

NASA Astrophysics Data System (ADS)

Ellery, A. A.

2018-07-01

Robotic astrobiology involves the remote projection of intelligent capabilities to planetary missions in the search for life, preferably with human-level intelligence. Planetary rovers would be true human surrogates capable of sophisticated decision-making to enhance their scientific productivity. We explore several key aspects of this capability: (i) visual texture analysis of rocks to enable their geological classification and so, astrobiological potential; (ii) serendipitous target acquisition whilst on the move; (iii) continuous extraction of regolith properties, including water ice whilst on the move; and (iv) deep learning-capable Bayesian net expert systems. Individually, these capabilities will provide enhanced scientific return for astrobiology missions, but together, they will provide full autonomous science capability.

Decameter Type IV Burst Associated with a Behind-the-limb CME Observed on 7 November 2013

NASA Astrophysics Data System (ADS)

Melnik, V. N.; Brazhenko, A. I.; Konovalenko, A. A.; Dorovskyy, V. V.; Rucker, H. O.; Panchenko, M.; Frantsuzenko, A. V.; Shevchuk, M. V.

2018-03-01

We report on the results of observations of a type IV burst made by the Ukrainian Radio interferometer of the Academy of Sciences (URAN-2) in the frequency range 22 - 33 MHz. The burst is associated with a coronal mass ejection (CME) initiated by a behind-the-limb active region (N05E151) and was also observed by the Nançay Decameter Array (NDA) radio telescope in the frequency band 30 - 60 MHz. The purpose of the article is the determination of the source of this type IV burst. After analysis of the observational data obtained with the URAN-2, the NDA, the Solar-Terrestrial Relations Observatory (STEREO) A and B spacecraft, and the Solar and Heliospheric Observatory (SOHO) spacecraft, we come to the conclusion that the source of the burst is the core of a behind-the-limb CME. We conclude that the radio emission can escape the center of the CME core at a frequency of 60 MHz and originates from the periphery of the core at a frequency of 30 MHz that is due to occultation by the solar corona at the corresponding frequencies. We find plasma densities in these regions assuming the plasma mechanism of radio emission. We show that the frequency drift of the start of the type IV burst is governed by an expansion of the CME core. The type III bursts that were observed against this type IV burst are shown to be generated by fast electrons propagating through the CME core plasma. A type II burst was registered at frequencies of 44 - 64 MHz and 3 - 16 MHz and was radiated by a shock with velocities of about 1000 km s^{-1} and 800 km s^{-1}, respectively.

Transport Modeling for Metallic Electrode: Semiconducting Nanotube Systems

NASA Technical Reports Server (NTRS)

Yamada, Toshishige; Biegel, Bryan (Technical Monitor)

2001-01-01

Recently, current-voltage (I-V) characteristics have been reported by Collins et al. for a system with a scanning tunneling microscope (STM) tip and a carbon nanotube. The STM tip was driven forward into a film of many entangled nanotubes on a substrate, and then was retracted, so that one of nanotubes bridged the STM and the film. I-V characteristics had two different patterns for different heights. One showed large dI/ dV with V greater than 0, small dI/dV with V less than 0, and I = 0 near V = 0 (type-I), while the other showed rectification, i.e., I does not equal 0 only with V less than 0 (type-II), with the tip grounded. We propose a physical mechanism to explain the observed I-V patterns. We consider that the observed characteristics strongly reflected the nature of the tip (metal) - nanotube (semiconductor) contact. The other end of the nanotube was entangled well in the film, and simply provided a good Ohmic contact. We will argue that there are two different contact modes: vacuum gap and touching modes, depending on the presence or absence of a tiny vacuum gap d approx. 0.1 - 0.2 nm at the junction. These modes may be related to physisorption and chemisorption, respectively. Once admitting their existence, it is naturally shown that I-V characteristics are type-I in the vacuum gap mode, and type-II in the touching mode. We argue that the nanotube had to be an n-type semiconductor judging from the I-V characteristics, contrary to often observed p-type in the transistor applications, where p-type is probably due to the oxidation in air or the trapped charges in the silicon dioxide. Additional information is contained in the original extended abstract.

Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors.

PubMed

Richter, Lubna V; Franks, Ashley E; Weis, Robert M; Sandler, Steven J

2017-04-15

Geobacter sulfurreducens , an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c -type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. Copyright © 2017 American Society for Microbiology.

Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors

PubMed Central

Franks, Ashley E.; Weis, Robert M.; Sandler, Steven J.

2017-01-01

ABSTRACT Geobacter sulfurreducens, an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c-type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. PMID:28138101

Hereditary sensory and autonomic neuropathy type IV and orthopaedic complications.

PubMed

Kim, W; Guinot, A; Marleix, S; Chapuis, M; Fraisse, B; Violas, P

2013-11-01

Hereditary sensory and autonomic neuropathy type IV (HSAN-IV) is a very rare autosomal recessive disorder characterized by recurrent episodes of unexplained fever, extensive anhidrosis, total insensitivity to pain, hypotonia, and mental retardation. The most frequent complications of this disease are corneal scarring, multiple fractures, joint deformities, osteomyelitis, and disabling self-mutilations. We reported the case of a 12-year-old boy. The goal was to discuss our decision-making and compare this case with cases described in the literature. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Campylobacter fetus subspecies contain conserved type IV secretion systems on multiple genomic islands and plasmids

USDA-ARS?s Scientific Manuscript database

The features contributing to the differences in pathogenicity of the C. fetus subspecies are unknown. Putative factors involved in pathogenesis are located in genomic islands that encode type IV secretion system (T4SS) and fic-domain (filamentation induced by cyclic AMP) proteins. In the genomes of ...

A unique evolution of the kidney phenotype in a patient with autosomal recessive Alport syndrome.

PubMed

Vischini, Gisella; Kapp, Meghan E; Wheeler, Ferrin C; Hopp, Laszlo; Fogo, Agnes B

2018-03-09

Alport syndrome is due to mutations in one of the genes encoding (α3,4,5) type IV collagen resulting in defective type IV collagen, a key component of the glomerular basement membrane (GBM). The GBM is initially thin, and with ongoing remodeling, develops a thickened basket-woven appearance. We report a unique case of a 9-year-old boy who was biopsied for hematuria and proteinuria, diagnosed as IgA nephropathy, with normal GBM appearance and thickness. Due to a family history of hematuria and chronic kidney disease, he subsequently underwent genetic evaluation and a mutation of α3 type IV collagen (COL4A3) was detected. Additional studies of the initial biopsy demonstrated abnormal type IV collagen immunostaining. A repeat biopsy 4years later showed characteristic glomerular basement membrane morphology of Alport syndrome, and scarring consistent with sequelae of IgA nephropathy. This is the first description of this unusual transition from an initial normal appearance of the glomerular basement membrane to the classic Alport phenotype. Copyright © 2018. Published by Elsevier Inc.

Colorectal laterally spreading tumors show characteristic expression of cell polarity factors, including atypical protein kinase C λ/ι, E-cadherin, β-catenin and basement membrane component.

PubMed

Ichikawa, Yasushi; Nagashima, Yoji; Morioka, Kaori; Akimoto, Kazunori; Kojima, Yasuyuki; Ishikawa, Takashi; Goto, Ayumu; Kobayashi, Noritoshi; Watanabe, Kazuteru; Ota, Mitsuyoshi; Fujii, Shoichi; Kawamata, Mayumi; Takagawa, Ryo; Kunizaki, Chikara; Takahashi, Hirokazu; Nakajima, Atsushi; Maeda, Shin; Shimada, Hiroshi; Inayama, Yoshiaki; Ohno, Shigeo; Endo, Itaru

2014-09-01

Colorectal flat-type tumors include laterally spreading tumors (LSTs) and flat depressed-type tumors. The former of which shows a predominant lateral spreading growth rather than an invasive growth. The present study examined the morphological characteristics of LSTs, in comparison with polypoid- or flat depressed-type tumors, along with the expression of atypical protein kinase C (aPKC) λ/ι, a pivotal cell polarity regulator, and the hallmarks of cell polarity, as well as with type IV collagen, β-catenin and E-cadherin. In total, 37 flat-type (24 LSTs and 13 flat depressed-type tumors) and 20 polypoid-type colorectal tumors were examined. The LSTs were classified as 15 LST adenoma (LST-A) and nine LST cancer in adenoma (LST-CA). An immunohistochemical examination was performed on aPKC λ/ι, type IV collagen, β-catenin and E-cadherin. The LST-A and -CA showed a superficial replacing growth pattern, with expression of β-catenin and E-cadherin in the basolateral membrane and type IV collagen along the basement membrane. In addition, 86.6% of LST-A and 55.6% of LST-CA showed aPKC λ/ι expression of 1+ (weak to normal intensity staining in the cytoplasm compared with the normal epithelium). Furthermore, ~45% of the polypoid-type adenomas showed 2+ (moderate intensity staining in the cytoplasm and/or nucleus) and 66.7% of the polypoid-type cancer in adenoma were 3+ (strong intensity staining in the cytoplasm and nucleus). A statistically significant positive correlation was observed between the expression of aPKC λ/ι and β-catenin (r=0.842; P<0.001), or type IV collagen (r=0.823; P<0.001). The LSTs showed a unique growth pattern, different from the expanding growth pattern presented by a polypoid tumor and invasive cancer. The growth characteristics of LST appear to be caused by adequate coexpression of β-catenin, type IV collagen and aPKC λ/ι.

Exploring new classification criteria for the earliest type stars: the 3400 Aregion

NASA Astrophysics Data System (ADS)

Morrell, Nidia I.; Walborn, Nolan R.; Arias, Julia I.

2002-02-01

We propose spectroscopic observations of a sample of standard O2-O4 stars in the wavelength region containing the N IV 3479-83-85 Aand O IV 3381-85-3412 Alines, in order to analyze the behavior of these spectral features as a function of the spectral type. We aim to define new classification criteria for the hottest stars, evaluating these N IV and O IV lines near 3400 Aas possible temperature and luminosity discriminators. The former spectral class O3 has just been split into three different classes: O2, O3 and O3.5 (Walborn et al. 2001). The paucity of classification criteria at these types in the traditional wavelength domain (4000 - 4700 Å), makes clear the need to explore other spectral ranges in order to define additional constraints on the determination of spectral types and luminosity classes. The wavelength range around 3400 Ahas been observed in many faint, crowded early O-type stars by HST/FOS, the corresponding data being available from the HST archive. This enhances our interest in observing this spectral range in the classification standards for the early O-type stars in order to make these existing HST observations even more useful, allowing the determination of accurate spectral types for unknown objects from them, once the behavior of the new criteria in the standards has been charted.

Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

PubMed

Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

2016-06-01

Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. © 2016 Tuluc et al.

Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels

PubMed Central

Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred

2016-01-01

Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3–S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3–S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3–S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3–S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3–S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. PMID:27185857

A Solar Stationary Type IV Radio Burst and Its Radiation Mechanism

NASA Astrophysics Data System (ADS)

Liu, Hongyu; Chen, Yao; Cho, Kyungsuk; Feng, Shiwei; Vasanth, Veluchamy; Koval, Artem; Du, Guohui; Wu, Zhao; Li, Chuanyang

2018-04-01

A stationary Type IV (IVs) radio burst was observed on September 24, 2011. Observations from the Nançay RadioHeliograph (NRH) show that the brightness temperature (TB) of this burst is extremely high, over 10^{11} K at 150 MHz and over 108 K in general. The degree of circular polarization (q) is between -60% ˜ -100%, which means that it is highly left-handed circularly polarized. The flux-frequency spectrum follows a power-law distribution, and the spectral index is considered to be roughly -3 ˜ -4 throughout the IVs. Radio sources of this event are located in the wake of the coronal mass ejection and are spatially dispersed. They line up to present a formation in which lower-frequency sources are higher. Based on these observations, it is suggested that the IVs was generated through electron cyclotron maser emission.

Developmental changes in children's comprehension and explanation of spatial metaphors for time.

PubMed

Stites, Lauren J; Özçalişkan, Şeyda

2013-11-01

Time is frequently expressed with spatial motion, using one of three different metaphor types: moving-time, moving-ego, and sequence-as-position. Previous work shows that children can understand and explain moving-time metaphors by age five (Özçalışkan, 2005). In this study, we focus on all three metaphor types for time, and ask whether metaphor type has an effect on children's metaphor comprehension and explanation abilities. Analysis of the responses of three- to six-year-old children and adults showed that comprehension and explanation of all three metaphor types emerge at an early age. Moreover, children's metaphor comprehension and explanation vary by metaphor type: children perform better in understanding and explaining metaphors that structure time in relation to the observer of time (moving-ego, moving-time) than metaphors that structure time without any relation to the observer of time (sequence-as-position-on-a-path). Our findings suggest that children's bodily experiences might play a role in their developing understanding of the abstract concept of time.

Practice patterns for the use of iodinated i.v. contrast media for pediatric CT studies: a survey of the Society for Pediatric Radiology.

PubMed

Callahan, Michael J; Servaes, Sabah; Lee, Edward Y; Towbin, Alexander J; Westra, Sjirk J; Frush, Donald P

2014-04-01

There are limited data available on the use of i.v. contrast media for CT studies in the pediatric population. The purpose of this study is to determine the practice patterns of i.v. contrast media usage for pediatric CT by members of the Society for Pediatric Radiology (SPR). SPR members were surveyed regarding the use of i.v. contrast media for pediatric CT studies. Questions pertained to information required before administering i.v. contrast media, types of central catheters for injecting i.v. contrast media, injection rates based on angiocatheter size and study type, and management of i.v. contrast media extravasation. The response rate of 6% (88/1545) represented practice patterns of 26% (401/1545) of the SPR membership. Most respondents thought the following clinical information was mandatory before i.v. contrast media administration: allergy to i.v. contrast media (97%), renal insufficiency (97%), current metformin use (72%), significant allergies (61%), diabetes (54%), and asthma (52%). Most administered i.v. contrast media through nonimplanted central venous catheters (78%), implanted venous ports (78%), and peripherally inserted central catheters (72%). The most common maximum i.v. contrast media injection rates were 5.0 mL/s or greater for a 16-gauge angiocatheter, 4.0 mL/s for an 18-gauge angiocatheter, 3.0 mL/s for a 20-gauge angiocatheter, and 2.0 mL/s for a 22-gauge angiocatheter. For soft-tissue extravasation of i.v. contrast media, 95% elevate the affected extremity, 76% use ice, and 45% use heat. The results of this survey illustrate the collective opinion of a subset of SPR members relating to the use of i.v. contrast media in pediatric CT, providing guidelines for clinical histories needed before i.v. contrast media, maximum i.v. contrast injection rates for standard angiocatheters, contrast media injection rates for specific CT studies, and management of i.v. contrast media soft-tissue extravasation.

A study of lip print pattern in Goan dental students - A digital approach.

PubMed

Prabhu, Rachana V; Dinkar, Ajit; Prabhu, Vishnudas

2012-10-01

To find the incidence of different types of lip patterns, the dominant pattern, quadrant wise, amongst the Goan population. To assess, the quadrant wise differences in lip patterns among males and females and to report new lip print pattern in Goan population. Lip prints of 100 students studying in Goa Dental College & Hospital were taken using 14 mm wide and 50 mm long Scotch tape without any distortion. These prints were then scanned (256 gray shades at a resolution of 300 dpi.) for the digital analysis. Using various applications of Adobe Photoshop 7 software an attempt was made to trace each and every line. K. Suzuki and Y. Tsuchihashi's classification was followed to define the patterns of the grooves. The current study has found the most predominant pattern in Quadrant I to be Type V (580 lines; 52.39%) followed in order by Type I' (196 lines; 17.70%), Type I (166 lines; 14.99%), Type II (166 lines; 10.47%), Type IV (40 lines; 3.61%), Type III (9 lines; 0.81%). In Quadrant II of this study the most predominant pattern recorded was Type V (589 lines; 50.47%) followed in order by Type I' (209 lines; 17.90%), Type I (204 lines; 17.48%), Type II (130 lines; 11.13%), Type IV (34 lines; 2.91%), Type III (1 line; 0.08%). In Quadrant III of this study the most predominant pattern recorded was again Type V (484 lines; 52.09%) followed in order by Type I' (174 lines; 18.72%), Type I (155 lines; 16.68%), Type II (102 lines; 10.97%), Type IV (9 lines; 0.96%), Type III (5 lines; 0.53%). In Quadrant IV of this study the most predominant pattern recorded was Type V (543 lines; 58.19%) followed in order by Type I (151 lines; 16.18%), Type I' (138 lines; 14.79%), Type II (85 lines; 9.11%), Type III (9 lines; 0.96%), Type IV (7 line; 0.75%). In all four Quadrants the most predominant pattern found in males and females was Type V. The present study recorded the following types of type V patterns for the first time; Trifurcations, Bridge or 'H' pattern, Horizontal Lines, Cartwheel, Pineapple Skin and Multiple Branching Appearance. The digital method of analyzing the Lip Print images using Adobe Photoshop 7 software serves as a convenient method that provides better visualization and ease in identification and recording of the Lip Print pattern. Predominant pattern in all four quadrants was Type V followed by the linear pattern i.e. Type I' in quadrants I, II, and III and Type I in quadrant IV in the studied population. Distribution of pattern is not affected by the sex. Although type V is the most predominant pattern found in Goan population, the sub-classification of this type defines the more defined term and aids in accuracy of the classification. Copyright © 2012. Published by Elsevier Ltd.

Insights into early extracellular matrix evolution: spongin short chain collagen-related proteins are homologous to basement membrane type IV collagens and form a novel family widely distributed in invertebrates.

PubMed

Aouacheria, Abdel; Geourjon, Christophe; Aghajari, Nushin; Navratil, Vincent; Deléage, Gilbert; Lethias, Claire; Exposito, Jean-Yves

2006-12-01

Collagens are thought to represent one of the most important molecular innovations in the metazoan line. Basement membrane type IV collagen is present in all Eumetazoa and was found in Homoscleromorpha, a sponge group with a well-organized epithelium, which may represent the first stage of tissue differentiation during animal evolution. In contrast, spongin seems to be a demosponge-specific collagenous protein, which can totally substitute an inorganic skeleton, such as in the well-known bath sponge. In the freshwater sponge Ephydatia mülleri, we previously characterized a family of short-chain collagens that are likely to be main components of spongins. Using a combination of sequence- and structure-based methods, we present evidence of remote homology between the carboxyl-terminal noncollagenous NC1 domain of spongin short-chain collagens and type IV collagen. Unexpectedly, spongin short-chain collagen-related proteins were retrieved in nonsponge animals, suggesting that a family related to spongin constitutes an evolutionary sister to the type IV collagen family. Formation of the ancestral NC1 domain and divergence of the spongin short-chain collagen-related and type IV collagen families may have occurred before the parazoan-eumetazoan split, the earliest divergence among extant animal phyla. Molecular phylogenetics based on NC1 domain sequences suggest distinct evolutionary histories for spongin short-chain collagen-related and type IV collagen families that include spongin short-chain collagen-related gene loss in the ancestors of Ecdyzosoa and of vertebrates. The fact that a majority of invertebrates encodes spongin short-chain collagen-related proteins raises the important question to the possible function of its members. Considering the importance of collagens for animal structure and substratum attachment, both families may have played crucial roles in animal diversification.

Anomalous ionization seen in the spectra of B supergiants

NASA Technical Reports Server (NTRS)

Cassinelli, J. P.; Abbott, D. C.

1981-01-01

An IUE survey of B supergiants has been conducted to study the persistence with spectral type of the ultraviolet resonance lines of N V, C IV and Si IV. N V is seen as late as B2.5Ia, C IV until B6Ia and Si IV throughout the range from B1.5 to B9. This is in fairly good agreement with the Auger ionization model of Cassinelli and Olson (1979). The terminal velocities are derived for the 20 stars in the sample and it is found that the ratio v(T)/v(esc) decreases monotonically with spectral type from the value of 3.0 that it has in the O spectral range to the value 1.0 at B9Ia.

Design and analysis of permanent magnet moving coil type generator used in a micro-CHP generation system

NASA Astrophysics Data System (ADS)

Oros Pop, Susana Teodora; Berinde, Ioan; Vadan, Ioan

2015-12-01

This paper presents the design and analysis of a permanent magnet moving coil type generator driven by a free piston Stirling engine. This assemble free piston Stirling engine - permanent magnet moving coil type generator will be used in a combined heat and power (CHP) system for producing heat and power in residential area. The design procedure for moving coil type linear generator starts from the rated power imposed and finally uses the Faraday law of induction. The magneto-static magnetic field generated by permanent magnets is analyzed by means of Reluctance method and Finite Element Method in order to evaluate the magnetic flux density in the air gap, which is a design data imposed in the design stage, and the results are compared.

SOME COMMENTS ON TYPE IV BURSTS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, H.; Kakinuma, T.

1962-01-01

It has become clear that a large continuum burst is composed of 4 distinctive types, CM/sub 1/, CM/sub 2/, DM, and IV, which originate from different altitudes over the photosphere. The observational characters of each type are given. CM/sub 1/ is the main phase of a centimeter-wave burst originating from about 0.02-0.05 R/sub S/ in height. DM burst is polarized in the ordinary sense, which is the cause of reversal of polarization with frequency. Its center frequency lies between about 1000 and 200 Mc/s, and is often misunderstood as the original Type IV burst. The movement of magnetic field duringmore » a burst is suggested. CM/sub 2/ may be considered as an enhancement of the upper part of the source of S-component caused by this movement of the field. (auth)« less

Singular cosmological evolution using canonical and ghost scalar fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nojiri, Shin'ichi; Odintsov, S.D.; Oikonomou, V.K.

2015-09-01

We demonstrate that finite time singularities of Type IV can be consistently incorporated in the Universe's cosmological evolution, either appearing in the inflationary era, or in the late-time regime. While using only one scalar field instabilities can in principle occur at the time of the phantom-divide crossing, when two fields are involved we are able to avoid such instabilities. Additionally, the two-field scalar-tensor theories prove to be able to offer a plethora of possible viable cosmological scenarios, at which various types of cosmological singularities can be realized. Amongst others, it is possible to describe inflation with the appearance of amore » Type IV singularity, and phantom late-time acceleration which ends in a Big Rip. Finally, for completeness, we also present the Type IV realization in the context of suitably reconstructed F(R) gravity.« less

Object permanence in cats: Analysis in locomotor space.

PubMed

Thinus-Blanc, C; Poucet, B; Chapuis, N

1982-04-01

Stages IV and V object permanence were studied with 38-40-week-old cats. A constraining apparatus preventing animals from pursuing the bowl containing meat before it was concealed was used. Either the bowl was seen moving and disappeared from view behind a screen (stage IV trials), or after this sequence, it reappeared from behind the first screen and disappeared behind a second screen (stage V trials). In both situations cats performed significantly above chance but the paths taken to reach the food were different according to the stage. In stage V trials, cats expressed a preference for the path leading to the end of the second screen where the food was last seen disappearing. Copyright © 1982. Published by Elsevier B.V.

Cassini is moved to Pad 40, CCAS, and placed atop its Titan IV launcher

NASA Technical Reports Server (NTRS)

1997-01-01

The Cassini spacecraft arrives at Complex 40, Cape Canaveral Air Station (CCAS), where it will be lifted to the top of its Titan IV/Centaur launch vehicle. Cassini is an international mission conducted by the National Aeronautics and Space Administration (NASA), the European Space Agency (ESA), and the Italian Space Agency (ASI). The two-story-tall spacecraft, scheduled for launch on Oct. 6, is destined to arrive at Saturn in July 2004, where it will orbit and study Saturn, its rings, moons and magnetic environment in detail over a four-year period. The Cassini mission is managed for NASA's Office of Space Science by the Jet Propulsion Laboratory, a division of the California Institute of Technology.

KSC-04PD-2266

NASA Technical Reports Server (NTRS)

2004-01-01

KENNEDY SPACE CENTER, FLA. At the Boeing Delta Operations Center, a crane moves to the ground the top of the shipping container at right. The container holds the Boeing Delta IV second stage inside. The Delta IV rocket will be used for the 2005 launching of the GOES-N weather satellite for NASA and NOAA (National Oceanic and Atmospheric Administration). The first in a series of three advanced weather satellites including GOES-O and GOES-P, the GOES-N will provide continuous monitoring necessary for intensive data analysis. It will provide a constant vigil for the atmospheric triggers of severe weather conditions such as tornadoes, flash floods, hail storms and hurricanes. When these conditions develop, GOES-N will be able to monitor storm development and track their movements.

The search for the elusive companion of EG andromedae

NASA Technical Reports Server (NTRS)

Pesce, Joseph E.; Stencel, Robert E.; Oliversen, Nancy A.

1987-01-01

Observations are reported at opposite quadratures of the interacting symbiotic binary EG And (HD-4174, Period = 470 d). After correcting for absolute motion at the system, it appears, surprisingly, that many of the nebular lines arise from material that moves with the red giant star. This fact is used to interpret the observed complex line profiles of C IV and He II in the object.

Prototype Development of Low-Cost, Augmented Reality Trainer for Crew Service Weapons

DTIC Science & Technology

2008-09-01

2008 Thesis Co- Advisors : Mathias Kolsch Joseph Sullivan THIS PAGE INTENTIONALLY LEFT BLANK i NSN 7540-01-280-5500 Standard Form 298 (Rev. 2-89...by: Mathias Kölsch Thesis Co- Advisor Joseph Sullivan Thesis Co- Advisor Mathias Kölsch, Ph.D. Chair, MOVES Academic Committee iv...CURRENT QUALIFICATION AND TRAINING METHODS .........9 1. Weapon Qualification / Killer Tomato ..........9 2. Robo -Ski

AGOR 28

DTIC Science & Technology

2014-08-28

release; distribution unlimited. Report No. A002.062 1. Meetings: i. Participated in weekly conference calls. ii. Design Review 16 2...outfitting lists for Sally Ride. iv. Working on NS5 Hierarchy 4. Sally Ride Progress: • HVAC – Ducting installation is moving forward with...large sections of ductwork being installed on the main deck port and starboard. HVAC crew is laying out runs on the foc’sle and 01 decks. • Pilot

Effects of Mineral Compositions on Matrix Diffusion and Sorption of 75Se(IV) in Granite.

PubMed

Yang, Xiaoyu; Ge, Xiangkun; He, Jiangang; Wang, Chunli; Qi, Liye; Wang, Xiangyun; Liu, Chunli

2018-02-06

Exploring the migration behaviors of selenium in granite is critical for the safe disposal of radioactive waste. The matrix diffusion and sorption of 75 Se(IV) (analogue for 79 Se) in granite were systematically studied to set reliable parameters in this work. Through-diffusion and batch sorption experiments were conduct with four types of Beishan granite. The magnitudes of the obtained apparent diffusion coefficient (D a ) values are of the following order: monzogranite > granodiorite-2 > granodiorite-1, which is opposite to the sequence of the K d values obtained from both the diffusion model and batch sorption experiments. The EPMA results of the granitic flakes showed that there was no obvious enrichment of Se(IV) on quartz, microcline and albite. Only biotite showed a weak affinity for Se(IV). Macroscopic sorption behaviors of Se(IV) on the four types of granite were identical with the sequence of the granitic biotite contents. Quantitative fitting results were also provided. XPS and XANES spectroscopy data revealed that bidentate inner-sphere complexes were formed between Se(IV) and Fe(III). Our results indicate that biotite can be representative of the Se(IV) sorption in complex mineral assemblages such as granite, and the biotite contents are critically important to evaluate Se(IV) transport in granite.

Development of reversible vas deferens occlusive device: IV. Rigid prosthetic devices.

PubMed

Drueschke, E E; Zaneveld, L J; Burns, M; Rodzen, R; Wingfield, J R; Maness, J H

1975-01-01

Different types of rigid, reversible, vas deferens occlusive devices were developed and evaluated in 14 unilaterally vasectomized dogs. All prosthetic devices had molded silicone rubber bodies, and rigid inflow and outflow tubes. Various techniques for the removal of the vas luminal epithelium, and for the preparation of porous ceramic and etched stainless steel surfaces to encourage tissue ingrowth into the prosthetic device end tubues were attempted. The devices differed in their methods of achieving occlusion. One device used a "rotary stem valve" which had a C-section rotating mechanism; the others used the "shuttle stem valve" which possessed an occlusive element that moved transverse to the axis of flow in the device, thus occluding the device when the stem was depressed. The rotarystem valve was implanted by means of a longitudinal incision. The remaining 13 shuttle stem devices were placed in the vas using either a longitudinal or a transverse implantation. Inno case was sperm transport through the prosthetic devices obtained for more than a few ejaculations.

Beta-ketoacyl-acyl carrier protein synthase IV: a key enzyme for regulation of medium-chain fatty acid synthesis in Cuphea lanceolata seeds.

PubMed

Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich

2002-09-01

With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.

Pros and Cons While Looking Through an Asian Window on the Rome IV Criteria for Irritable Bowel Syndrome: Pros.

PubMed

Ghoshal, Uday C

2017-07-30

A decade after Rome III, in 2016, Rome IV criteria were published. There are major differences between Rome IV and the earlier iteration, some of which are in line with Asian viewpoints. The clinical applicability of the Rome IV criteria of irritable bowel syndrome (IBS) in Asian perspective is reviewed here. Instead of considering functional gastrointestinal disorders (FGIDs) to be largely psychogenic, Rome IV suggested the importance of the gut over brain ("disorders of gut-brain interaction" not "brain-gut interaction"). The word "functional" is underplayed. Multi-dimensional clinical profile attempts to recognize micro-organic nature, like slow colon transit and fecal evacuation disorders in constipation and dietary intolerance including that of lactose and fructose, bile acid malabsorption, non-celiac wheat sensitivity, small intestinal bacterial overgrowth, and gastrointestinal infection in diarrhea. Overlap between different FGIDs has been recognized as Rome IV suggests these to be a spectrum rather than discrete disorders. Bloating, common in Asia, received attention, though less. Sub-typing of IBS may be more clinician-friendly now as the patient-reported stool form may be used than a diary. However, a few issues, peculiar to Asia, need consideration; Rome IV, like Rome III, suggests that Bristol type I-II stool to denote constipation though Asian experts include type III as well. Work-up for physiological factors should be given greater importance. Language issue is important. Bloating, common in IBS, should be listed in the criteria. Threshold values for symptoms in Rome IV criteria are based on Western data. Post-infectious malabsorption (tropical sprue) should be excluded to diagnose post-infectious IBS, particularly in Asia.

Glycated Apolipoprotein A-IV Induces Atherogenesis in Patients With CAD in Type 2 Diabetes.

PubMed

Dai, Yang; Shen, Ying; Li, Qing Run; Ding, Feng Hua; Wang, Xiao Qun; Liu, Hong Juan; Yan, Xiao Xiang; Wang, Ling Jie; Yang, Ke; Wang, Hai Bo; Chen, Qiu Jing; Shen, Wei Feng; Zhang, Rui Yan; Lu, Lin

2017-10-17

Nonenzymatic glycation of apolipoproteins plays a role in the pathogenesis of the vascular complications of diabetes. This study investigated whether apolipoprotein (apo) A-IV was glycated in patients with type 2 diabetes mellitus (T2DM) and whether apoA-IV glycation was related to coronary artery disease (CAD). The study also determined the biological effects of glycated apoA-IV. The authors consecutively enrolled 204 patients with T2DM without CAD (Group I), 515 patients with T2DM with CAD (Group II), and 176 healthy subjects (control group) in this study. ApoA-IV was precipitated from ultracentrifugally isolated high-density lipoprotein, and its glycation level was determined based on Western blotting densitometry (relative intensity of apoA-IV glycation). ApoA-IV NƐ-(carboxylmethyl) lysine (CML) modification sites were identified by mass spectrometry in 37 control subjects, 63 patients in Group I, and 138 patients in Group II. Saline or glycated apoA-IV (g-apoA-IV) generated by glyoxal culture was injected into apoE -/- mice to evaluate atherogenesis, and was also used for the cell experiments. The relative intensity and the abundance of apoA-IV glycation were associated with the presence and severity of CAD in patients with T2DM (all p < 0.05). The experiments showed that g-apoA-IV induced proinflammatory reactions in vitro and promoted atherogenesis in apoE -/- mice through the nuclear receptor NR4A3. G-apoA-IV with mutations (K-A) at high-frequency glycation sites exhibited more weakened proinflammatory and atherogenic effects than did g-apoA-IV both in vitro and in vivo. ApoA-IV glycation is associated with CAD severity in patients with T2DM, and g-apoA-IV induces atherogenesis through NR4A3 in apoE -/- mice. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

PubMed

Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

2008-05-01

Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

NASA Technical Reports Server (NTRS)

Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

1985-01-01

Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

NASA Astrophysics Data System (ADS)

Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

1985-08-01

Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

Immunohistochemical diagnosis of Alport's syndrome in paraffin-embedded renal sections: antigen retrieval with autoclave heating.

PubMed

Naito, Ichiro; Ninomiya, Yoshifumi; Nomura, Shinsuke

2003-03-01

Alport's syndrome (AS) is a hereditary renal disease caused by mutations in the genes encoding collagen type IV. Immunohistochemical analysis of the alpha chains of collagen type IV has been found to be useful for the diagnosis of this disease. The monoclonal antibodies (mAbs) generated by us recognize alpha 1(IV) through alpha 6(IV) chains of collagen type IV on fresh-frozen sections but not on paraffin-embedded sections. Antigen retrieval by autoclave heating has been found to restore the epitopes recognized by the mAbs; however the heating conditions had not been well established. In this study, the heating conditions were carefully examined using renal sections obtained from AS and non-AS patients. The heating was performed in an autoclave, at 105 degrees -127 degrees C for 6-8 min. During the heating, the sections were immersed in 0.2 N HCl solution (pH 0.9). Then, the mAbs were applied for 30 min, and the bound mAbs were detected using the LSAB kit. The optimal temperature for the antigen retrieval varied among specimens, and was dependent on the type of basement membrane examined. Thus, it was considered that heating at two or three different temperatures could be helpful for the precise diagnosis of AS. Adopting the antigen retrieval method could extend the possibility of immunohistochemical diagnosis of AS to cases without using fresh-frozen sections.

From Single-Parent Families to Stepfamilies: Is the Transition Associated with Adolescent Alcohol Initiation?

ERIC Educational Resources Information Center

Kirby, James B.

2006-01-01

This study addresses two questions: Is stepfamily formation associated with the likelihood that adolescents will initiate alcohol use, and if so, does this association differ by the type of single-parent families from which adolescents move or the type of stepfamilies to which they move? The author found that adolescents who moved to stepfamilies…

Simulation of Flow and Long-Term Plutonium (Pu) Transport in the Vadose Zone at the Savannah River National Laboratory (SRNL)

NASA Astrophysics Data System (ADS)

Demirkanli, I.; Molz, F. J.; Kaplan, D. I.; Fjeld, R. A.; Serkiz, S. M.

2006-05-01

An improved understanding of flow and radionuclide transport in vadose zone sediments is fundamental to all types of future planning involving radioactive materials. One way to obtain such understanding is to perform long-term experimental studies of Pu transport in complex natural systems. With this in mind, a series of field experiments were initiated at the SRNL in the early 1980s. Lysimeters containing sources of different Pu oxidation states were placed in the shallow subsurface and left open to the natural environment for 2 to 11 years. At the end of the experiments, Pu activities were measured along vertical cores obtained from the lysimeters. Pu distributions were anomalous in nature, with transport from oxidized Pu sources being less than expected, and a small fraction of Pu from reduced sources moving more. Laboratory studies with lysimeter sediments suggested that surface-mediated, oxidation/reduction (redox) reactions could be responsible for the anomalous behavior, and this hypothesis is tested by performing both steady-state and transient Pu transport simulations that include retardation along with first-order redox reactions on mineral surfaces. Based on the simulations, we conclude that the surface-mediated, redox hypothesis is consistent with the observed downward Pu activity profiles in the experiments, and such profiles are captured well by a steady-state, net downward, flow model. (Discussion is presented as to why a steady model appears to work in a highly transient flow environment.) The redox model explains how Pu(V/VI) sources release activity that moves downward more slowly than expected based on adsorptive retardation alone, and how Pu(III/IV) sources result in a small fraction of activity that moves downward more rapidly than expected. The calibrated parameter values were robust and relatively well-defined throughout all four sets of simulations. Pu(V/VI) (i.e., oxidized Pu)retardation factors were about 15, and reduced Pu(III/IV) retardation factors were about 10,000. For these values, ko (1st order oxidation rate) averaged 2.4x10-7/hr with a standard deviation of 1.6x10-7, and kr (reduction rate)was 7.1x10-4/hr with a standard deviation of 1.6x10-4. Preliminary transient flow simulations showed a very slight increase in the fitted reaction rate constants, but otherwise reproduced the steady-state results. To date, neither approach is able to simulate the observed Pu movement above the source.

Variation in arterial supply to the floor of the mouth and assessment of relative hemorrhage risk in implant surgery.

PubMed

Katsumi, Yuji; Tanaka, Ray; Hayashi, Takafumi; Koga, Taketo; Takagi, Ritsuo; Ohshima, Hayato

2013-04-01

Bleeding in the floor of the mouth during implant surgery is attributed to arterial injuries in the sublingual space: clinicians may injure the submental and sublingual arteries, which originate from the facial and lingual arteries, respectively. This study aimed to clarify the three-dimensional courses of submental and sublingual arteries and their topographic relation to the mandible. During the gross anatomy course at the Faculty of Dentistry and Graduate School, Niigata University (2009-2011), we investigated the relationship between the courses of submental and sublingual arteries and their dividing patterns of the mylohyoid muscle, sublingual gland, and mandible using 27 human cadavers. The courses of submental and sublingual arteries were divided into four patterns: (1) the sublingual space was supplied by the sublingual artery (type I: 63%), (2) it was supplied by both the sublingual and submental arteries (type II: 5.6%), (3) it was supplied by the submental artery without the sublingual artery (type III: 29.6%), and (4) type III without the deep lingual artery originated from the lingual artery (type IV: 1.8%). In type II, III, and IV, the submental artery perforates the mylohyoid muscle or takes a roundabout route to travel near the surface of the mandible. The percentage occurrence of arteries traveling between the sublingual gland and mandible in type II, III, and IV (55%) is higher than that in type I (8.8%). Susceptibility of the submental artery in type II, III, and IV to injury during implant surgery is suggested. © 2011 John Wiley & Sons A/S.

A systematic review of the management and outcome of ERCP related duodenal perforations using a standardized classification system.

PubMed

Cirocchi, Roberto; Kelly, Michael Denis; Griffiths, Ewen A; Tabola, Renata; Sartelli, Massimo; Carlini, Luigi; Ghersi, Stefania; Di Saverio, Salomone

2017-12-01

The incidence of duodenal perforation after ERCP ranges from 0.09% to 1.67% and mortality up to 8%. This systematic review was registered in Prospective Register of Systematic Reviews, PROSPERO. Stapfer classification of ERCP-related duodenal perforations was used. The systematic search yielded 259 articles. Most frequent post-ERCP perforation was Stapfer type II (58.4%), type I second most frequent perforation (17.8%) followed by Stapfer type III in 13.2% and type IV in 10.6%. Rate of NOM was lowest in Stapfer type I perforations (13%), moderate in type III lesions (58.1%) and high in other types of perforations (84.2% in type II and 84.6% in IV). In patients underwent early surgical treatment (<24 h from ERCP) the most frequent operation was simple duodenal suture with or without omentopexy (93.7%). In patients undergoing late surgical treatment (>24 h from ERCP) interventions performed were more complex. In type I lesions post-operative mortality rate was higher in patients underwent late operation (>24 h). In type I lesions, failure of NOM occurred in 42.8% of patients. In type II failure of NOM occurred in 28.9% of patients and in type III there was failure of NOM in only 11.1%, none in type IV. Postoperative mortality after NOM failure was 75% in type I, 22.5% in type II and none died after surgical treatment for failure of NOM in type III perforations. This systematic review showed that in patients with Stapfer type I lesions, early surgical treatment gives better results, however the opposite seems true in Stapfer III and IV lesions. Copyright © 2017 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

Continued expansion of USA300-like methicillin-resistant Staphylococcus aureus (MRSA) among hospitalized patients in the United States.

PubMed

Tickler, Isabella A; Goering, Richard V; Mediavilla, Jose R; Kreiswirth, Barry N; Tenover, Fred C

2017-08-01

We characterized spa types, SCCmec types, and antimicrobial resistance patterns of 516 methicillin-resistant Staphylococcus aureus (MRSA) isolates, collected between 2011 and 2014 from nares and blood cultures of United States patients. Among nares isolates, 45 spa types were observed; 29.9% were t002/SCCmec II and 30.9% were t008/SCCmec IV. Among blood isolates, 40 spa types were identified; 24.4% were t002/SCCmec II and 39.9% were type t008/SCCmec IV. Compared to data from our 2009-2010 survey, the percentage of t008/SCCmec IV isolates from nares increased significantly (20.4%-30.9%; P=0.004) while the percentage from positive blood cultures remained similar (39.2% versus 39.9%; P=0.921). There were also significant changes in the overall antimicrobial resistance patterns observed, including the decrease of the clindamycin, erythromycin, levofloxacin and moxifloxacin multidrug resistance pattern, likely the result of t002/SCCmec II strains being displaced by t008/SCCmec IV strains. Rates of high-level mupirocin resistance did not change significantly from our past study (4.1% compared to 4.7%; P=0.758) but an increase in low-level resistance, particularly among t002/SCCmec II isolates, was observed. Copyright © 2017 Elsevier Inc. All rights reserved.

Detection and modeling of leakage current in AlGaN-based deep ultraviolet light-emitting diodes

DOE PAGES

Moseley, Michael William; Allerman, Andrew A.; Crawford, Mary H.; ...

2015-03-01

Current-voltage (IV) characteristics of two AlGaN-based deep ultraviolet (DUV) light-emitting diodes (LEDs) with differing densities of open-core threading dislocations (nanopipes) are analyzed. A three-diode circuit is simulated to emulate the IV characteristics of the DUV-LEDs, but is only able to accurately model the lower leakage current, lower nanopipe density DUV-LED. It was found that current leakage through the nanopipes in these structures is rectifying, despite nanopipes being previously established as inherently n-type. Using defect-sensitive etching, the nanopipes are revealed to terminate within the p-type GaN capping layer of the DUV-LEDs. The circuit model is modified to account for another p-nmore » junction between the n-type nanopipes and the p-type GaN, and an excellent fit to the IV characteristics of the leaky DUV-LED is achieved.« less

Chemical Basis for Qualitative and Quantitative Differences Between ABO Blood Groups and Subgroups: Implications for Organ Transplantation.

PubMed

Jeyakanthan, M; Tao, K; Zou, L; Meloncelli, P J; Lowary, T L; Suzuki, K; Boland, D; Larsen, I; Burch, M; Shaw, N; Beddows, K; Addonizio, L; Zuckerman, W; Afzali, B; Kim, D H; Mengel, M; Shapiro, A M J; West, L J

2015-10-01

Blood group ABH(O) carbohydrate antigens are carried by precursor structures denoted type I-IV chains, creating unique antigen epitopes that may differ in expression between circulating erythrocytes and vascular endothelial cells. Characterization of such differences is invaluable in many clinical settings including transplantation. Monoclonal antibodies were generated and epitope specificities were characterized against chemically synthesized type I-IV ABH and related glycans. Antigen expression was detected on endomyocardial biopsies (n = 50) and spleen (n = 11) by immunohistochemical staining and on erythrocytes by flow cytometry. On vascular endothelial cells of heart and spleen, only type II-based ABH antigens were expressed; type III/IV structures were not detected. Type II-based ABH were expressed on erythrocytes of all blood groups. Group A1 and A2 erythrocytes additionally expressed type III/IV precursors, whereas group B and O erythrocytes did not. Intensity of A/B antigen expression differed among group A1 , A2 , A1 B, A2 B and B erythrocytes. On group A2 erythrocytes, type III H structures were largely un-glycosylated with the terminal "A" sugar α-GalNAc. Together, these studies define qualitative and quantitative differences in ABH antigen expression between erythrocytes and vascular tissues. These expression profiles have important implications that must be considered in clinical settings of ABO-incompatible transplantation when interpreting anti-ABO antibodies measured by hemagglutination assays with reagent erythrocytes. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

Bevacizumab and Cediranib Maleate in Treating Patients With Metastatic or Unresectable Solid Tumor, Lymphoma, Intracranial Glioblastoma, Gliosarcoma or Anaplastic Astrocytoma

ClinicalTrials.gov

2014-02-14

Adult Grade III Lymphomatoid Granulomatosis; Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Childhood Burkitt Lymphoma; Childhood Diffuse Large Cell Lymphoma; Childhood Grade III Lymphomatoid Granulomatosis; Childhood Immunoblastic Large Cell Lymphoma; Childhood Nasal Type Extranodal NK/T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Hepatosplenic T-cell Lymphoma; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Noncutaneous Extranodal Lymphoma; Peripheral T-cell Lymphoma; Progressive Hairy Cell Leukemia, Initial Treatment; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Childhood Anaplastic Large Cell Lymphoma; Recurrent Childhood Large Cell Lymphoma; Recurrent Childhood Lymphoblastic Lymphoma; Recurrent Childhood Small Noncleaved Cell Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent/Refractory Childhood Hodgkin Lymphoma; Refractory Hairy Cell Leukemia; Small Intestine Lymphoma; Splenic Marginal Zone Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Childhood Anaplastic Large Cell Lymphoma; Stage IV Childhood Hodgkin Lymphoma; Stage IV Childhood Large Cell Lymphoma; Stage IV Childhood Lymphoblastic Lymphoma; Stage IV Childhood Small Noncleaved Cell Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IVA Mycosis Fungoides/Sezary Syndrome; Stage IVB Mycosis Fungoides/Sezary Syndrome; T-cell Large Granular Lymphocyte Leukemia; Testicular Lymphoma; Unspecified Adult Solid Tumor, Protocol Specific; Unspecified Childhood Solid Tumor, Protocol Specific; Waldenström Macroglobulinemia

Specific Phobia among U.S. Adolescents: Phenomenology and Typology

PubMed Central

Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

2014-01-01

Background Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. Methods The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13–18 years in the continental United States. Results Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Conclusions Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. PMID:23108894

Protease nexin 1 is a potent urinary plasminogen activator inhibitor in the presence of collagen type IV.

PubMed

Crisp, Robert J; Knauer, Mary F; Knauer, Daniel J

2002-12-06

Protease nexin 1 (PN1) in solution forms inhibitory complexes with thrombin or urokinase, which have opposing effects on the blood coagulation cascade. An initial report provided data supporting the idea that PN1 target protease specificity is under the influence of collagen type IV (1). Although collagen type IV demonstrated no effect on the association rate between PN1 and thrombin, the study reported that the association rate between PN1 and urokinase was allosterically reduced 10-fold. This has led to the generally accepted idea that the primary role of PN1 in the brain is to act as a rapid thrombin inhibition and clearance mechanism during trauma and loss of vascular integrity. In studies to identify the structural determinants of PN1 that mediate the allosteric interaction with collagen type IV, we found that protease specificity was only affected after transient exposure of PN1 to acidic conditions that mimic the elution protocol from a monoclonal antibody column. Because PN1 used in previous studies was purified over a monoclonal antibody column, we propose that the allosteric regulation of PN1 target protease specificity by collagen type IV is a result of the purification protocol. We provide both biochemical and kinetic data to support this conclusion. This finding is significant because it implies that PN1 may play a much larger role in the modeling and remodeling of brain tissues during development and is not simply an extravasated thrombin clearance mechanism as previously suggested.

Highly ionized gas absorption in the disk and halo toward HD 167756 at 3.5 kilometers per second resolution

NASA Technical Reports Server (NTRS)

Savage, Blair D.; Sembach, Kenneth R.; Cardelli, Jason A.

1994-01-01

High-resolution spectra of interstellar Si IV, C IV, and N V absorption lines along the 4 kpc path to the inner Galaxy star HD 167756 at z = -0.85 kpc are presented. The spectra were obtained with the echelle mode of Goddard High Resolution Spectrograph (GHRS) aboard the Hubble Space Telescope (HST) and have signal-to-noise ratios ranging from 23 to 38. The high resolution of the measurements full width at half maximum (FWHM = 3.5 km/s) results in fully resolved line profiles for the highly ionized gas absorption. The measurements provide information on the column density per unit velocity, N(v), as a function of velocity for Si IV, C IV, and N V. The C IV and N V profiles extend from -70 to +70 km/s, while the Si IV profiles extend from -40 to +70 km/s. The integrated logarithmic column densities are long N(Si IV) = 13.09 +/- 0.02, log N(C IV) = 13.83 +/- 0.02, and log N(N V) = 13.56 +/- 0.03. The N V profile is broad, asymmetric, and featureless, while the Si IV profile contains narrow absorption components near V(sub LSR) = -19, 0, +20, and +52 km/s with Doppler spread parameters, b about = 10-12 km/s. The C IV profile contains both broad and narrow structure. The high ion feature near +52 km/s is also detected in the low-ionization lines of Ca II, O I, Si II, and Fe II. The other narrow Si IV and C IV components occur within several km/s of components seen in low-ionization species. The sight line contains at least two types of highly ionized gas. One type gives rise to a broad N V profile, and the other results in the more structured Si IV profile. The C IV profile contains contributions from both types of highly ionized gas. The broad but asymmetric N V profile is well represented by a large Galactic scale height gas which is participating in Galactic rotation and has a combination of thermal and turbulent broadening with b(sub tot) about = 42 km/s. The C IV to N V abundance ratio of 1.0 +/- 0.3 for the gas implies T about 1.6 x 10(exp 5) K or about 8 x 10(exp 5) K if the gas is in collisional ionization equilibrium and has a solar carbon to nitrogen abundance ratio. This absorption may be associated with cooling hot gas situated in Galactic shells and supershells along the sight line. The gas producing the narrow Si IV and C IV absorption components has line widths that are compatible with origins in conductive interfaces between the warm and hot interstellar medium. Kinematic flows associated with the photoionized edges of clouds might also produce Si IV and C IV lines with Doppler spread parameters similar to those observed, but the C IV to Si IV ratio in this gas is 3.5, which leads us to favor the conductive interface interpretation.

Community-associated methicillin-resistant Staphylococcus aureus causing chronic pneumonia.

PubMed

Enayet, Iram; Nazeri, Ali; Johnson, Leonard B; Riederer, Kathleen; Pawlak, Joan; Saravolatz, Louis D

2006-04-01

A young woman presented with pneumonia of a 3-month duration with predominantly nodular pulmonary infiltrates. Methicillin-resistant Staphylococcus aureus was identified in multiple cultures of sputum specimens. According to findings of pulsed-field gel electrophoresis, the isolate was identical to USA 300 and carried a type IV Staphylococcus cassette chromosome mec type IV gene and the genes for Panton-Valentine leukocidin.

Treatment with 17-allylamino-17-demethoxygeldanamycin ameliorated symptoms of Bartter syndrome type IV caused by mutated Bsnd in mice.

PubMed

Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich

2013-11-22

Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.

Association of change in the type of job with prevalence of components of the metabolic syndrome-special reference to job stress.

PubMed

Mikurube, Hajime; Kaneko, Mitsunobu; Murata, Chisato; Komaki, Yoko; Ishikawa, Noriko; Higashiyama, Reiichi; Fukasawa, Kenji; Watanabe, Tetsu

2005-11-01

It is well established that job stress is a leading cause of cardiovascular disease. The relationship with the metabolic syndrome, however, has received only limited attention. The present study was designed to investigate associations between change of the type of job and the prevalence of metabolic syndrome components from the aspect of on-the-job stress and alteration in life style. Thirty-six male workers of the manufacturing department were transferred to the carsales department at the same automobile company in 1992 to 1993. These same workers were transferred back to the manufacturing department after two years. We compared the first health-check data before the transfer in 1992 (Term A), a second set of data two years after transfer in 1994-95 (Term B) and a third set of data two years following transfer back to the manufacturing department in 1996-1998 (Term C). The workers were requested to provide information about drinking and smoking habits, and answer Karasek's questionnaire and a simple stress questionnaire in order to clarify the possibility of job stress in occurrence of the metabolic syndrome, defined in terms of obesity, hypertension, dyslipidemia, and impaired glucose tolerance as components. Five workers had two or more components of the metabolic syndrome before the transfer to the car-sales department (Group I). One demonstrated improvement, three no change, and one increase in symptoms from A to B. Seven workers had more than two components after the transfer to car-sales department (Group II), and six of them exhibited decrease two years following transfer back to the manufacturing department. Five of them also showed elevated liver enzymes in serum with the appearance of the components, and three of them demonstrated recover. Three workers had two components of the metabolic syndrome only at time point C (Group III), while the remaining 21 workers had 0 to one component throughout the observation period (Group IV). Amount of drinking and smoking increased significantly when working in the sales department but these items returned to the previous values after rejoining manufacturing, though differences were not observed between workers with (Group II) and without (Group IV) components of the metabolic syndrome. Body mass index (BMI) and alanine aminotransferase (ALT) increased significantly when workers moved to the sales department and that was significant in Group II as compared to Group IV. Three components of Karasek's JCQ changed significantly during job transfer, though differences were not observed between the workers with (Group II) and without (Group IV) components of the metabolic syndrome. Logistic regression analysis with age, lifestyle, Karasek's JCQ, and ALT revealed that elevation of ALT value was associated with having two or more components of metabolic syndrome, while hours of sleep demonstrated an inverse association. Elevated ALT and reduction of sleep hours may be associated with development of the metabolic syndrome in workers who change their type of job.

Comorbid Anxiety and Depression and Their Impact on Cardiovascular Disease in Type 2 Diabetes: The Fremantle Diabetes Study Phase II.

PubMed

Bruce, David G; Davis, Wendy A; Dragovic, Milan; Davis, Timothy M E; Starkstein, Sergio E

2016-10-01

The aims were to determine whether anxious depression, defined by latent class analysis (LCA), predicts cardiovascular outcomes in type 2 diabetes and to compare the predictive power of anxious depression with Diagnostic & Statistical Manual Versions IV and 5 (DSM-IV/5) categories of depression and generalized anxiety disorder (GAD). Prospective observational study of 1,337 type 2 participants. Baseline assessment with the 9-item Patient Health Questionnaire and the GAD Scale; LCA-defined groups with minor or major anxious depression based on anxiety and depression symptoms. Cox modeling used to compare the independent impact of: (1) LCA anxious depression, (2) DSM-IV/5 depression, (3) GAD on incident cardiovascular events and deaths after 4 years. LCA minor and major anxious depression was present in 21.9 and 7.8% of participants, respectively, DSM-IV/5 minor and major depression in 6.2 and 6.1%, respectively, and GAD in 4.8%. There were 110 deaths, 31 cardiovascular deaths, and 199 participants had incident cardiovascular events. In adjusted models, minor anxious depression (Hazard ratio (95% confidence intervals): 1.70 (1.15-2.50)) and major anxious depression (1.90 (1.11-3.25)) predicted incident cardiovascular events and major anxious depression also predicted cardiovascular mortality (4.32 (1.35-13.86)). By comparison, incident cardiovascular events were predicted by DSM-IV/5 major depression (2.10 (1.22-3.62)) only and cardiovascular mortality was predicted by both DSM-IV/5 major depression (3.56 (1.03-12.35)) and GAD (5.92 (1.84-19.08)). LCA-defined anxious depression is more common than DSM-IV/5 categories and is a strong predictor of cardiovascular outcomes in type 2 diabetes. These data suggest that this diagnostic scheme has predictive validity and clinical relevance. © 2016 Wiley Periodicals, Inc.

The willingness of patients to pay for intravenous patient-controlled analgesia in Korea.

PubMed

Lim, Hyungsun; Lee, Duck-Hyoung; Lee, Jeongwoo; Han, Young Jin; Choe, Huhn; Son, Ji-Seon

2012-06-01

The use of intravenous patient-controlled analgesia (IV-PCA) has been increasing because it has advantages such as improved pain relief, greater patient satisfaction, and fewer postoperative complications. However, current research has not considered the patients' thoughts about IV-PCA's cost-effectiveness. The purpose of this study was to investigate the willingness to pay (WTP) for IV-PCA and the relationship between patients' characteristics and WTP in Korea. We enrolled 400 adult patients who were scheduled for elective surgery. The patient was requested to indicate a series of predefined amounts of money (Korean won; 30,000/50,000/100,000/150,000/200,000/300,000/500,000). We also recorded patient characteristics, such as age, sex, type of surgery, IV-PCA history, education level, the person responsible for medical expenses, type of insurance, net annual income, and residential area. Three days after surgery, we asked about the degree of satisfaction and the WTP for IV-PCA. For IV-PCA, the median WTP was 100,000 won (25-75%; 50,000-200,000 won: US$1 = W1078.04; July 19, 2011) before surgery. All patients' characteristics were not related to preoperative WTP for IV-PCA, whereas the increase in WTP after surgery showed a tendency correlated to higher IV-PCA satisfaction. The median WTP was 100,000 won. The satisfaction of IV-PCA increased patients' WTP after surgery, but the WTP may be independent of patient characteristics in Korea.

Bond Strength of Gold Alloys Laser Welded to Cobalt-Chromium Alloy

PubMed Central

Watanabe, Ikuya; Wallace, Cameron

2008-01-01

The objective of this study was to investigate the joint properties between cast gold alloys and Co-Cr alloy laser-welded by Nd:YAG laser. Cast plates were fabricated from three types of gold alloys (Type IV, Type II and low-gold) and a Co-Cr alloy. Each gold alloy was laser-welded to Co-Cr using a dental laser-welding machine. Homogeneously-welded and non-welded control specimens were also prepared. Tensile testing was conducted and data were statistically analyzed using ANOVA. The homogeneously-welded groups showed inferior fracture load compared to corresponding control groups, except for Co-Cr. In the specimens welded heterogeneously to Co-Cr, Type IV was the greatest, followed by low-gold and Type II. There was no statistical difference (P<0.05) in fracture load between Type II control and that welded to Co-Cr. Higher elongations were obtained for Type II in all conditions, whereas the lowest elongation occurred for low-gold welded to Co-Cr. This study indicated that, of the three gold alloys tested, the Type IV gold alloy was the most suitable alloy for laser-welding to Co-Cr. PMID:19088892

Central Procurement Workload Projection Model

DTIC Science & Technology

1981-02-01

generated by the P&P Directorates such as procurement actions (PA’s) are pursued. Specifi- cally, Box-Jenkins Autoregressive Integrated Moving Average...Breakout of PA’s to over and under $10,000 23 IV. FINDINGS AND RECOMMENDATIONS 24 A. General 24 B. Findings 24 C. Recommendations 25...the model will predict the actual values and hence the error will be zero . Therefore, after forecasting 3 quarters into the future no error

Los Elefantes Rosas en las Cupulas en la Legislatura: An Empirical Analysis of the Texas Education Finance Mechanism with Special Emphasis on Bilingual Education

ERIC Educational Resources Information Center

Rolle, Anthony; Torres, Mario; Eason, Noelle

2010-01-01

The State of Texas' education finance mechanism--known as the Foundation School Program (FSP)--was challenged in a series of litigation known as "Edgewood v. Kirby I-IV" and "West Orange Cove I-II". Though the state Supreme Court's holding ultimately moved the Texas Assembly to make changes in the funding mechanism, not since…

Federal Student Financial Aid: 2011 National Profile of Programs in Title IV of the Higher Education Act

ERIC Educational Resources Information Center

National Association of Student Financial Aid Administrators (NJ1), 2011

2011-01-01

As college costs have soared and the U.S. economy struggles to move out of the recession, more and more Americans have relied on federal student financial assistance programs to help them meet their postsecondary expenses. Data from the Federal Student Aid (FSA), an office of the U.S. Department of Education (ED), show that the number of students…

Flexible Manufacturing System Handbook. Volume IV. Appendices

DTIC Science & Technology

1983-02-01

and Acceptance Test(s)" on page 26 of this Proposal Request. 1.1.10 Options 1. Centralized Automatic Chip/Coolant Recovery System a. Scope The...viable, from manual- ly moving the pallet/fixture/part combinations from machine to machine to fully automatic , unmanned material handling systems , such...English. Where dimensions are shown in metric units, the English system (inch) equivalent will also be shown. Hydraulic, pneumatic , and electrical

Reassessment of patients with Eating Disorders after moving from DSM-IV towards DSM-5: a retrospective study in a clinical sample.

PubMed

Gualandi, Malvina; Simoni, Marzia; Manzato, Emilia; Scanelli, Giovanni

2016-12-01

To compare the relative prevalence of eating disorders moving from DSM-IV to DSM-5, and to reassess the overall medical impairment in the revised diagnostic classes. We applied DSM-5 to 206 patients (age 15-56 years) previously studied and classified according to DSM-IV. Medical impairment was classified as low, medium, or high, based on a cumulative score of clinical severity (SCS), computed as the sum of specific weights assigned to different pathological conditions and their ascertained prognostic impact. Application of DSM-5 produced a decrease in Eating Disorders Not Otherwise Specified (EDNOS) by 17 %, an increase in anorexia (AN) by 14 % and bulimia (BN) by 2.4 %; 44.6 % of EDNOS migrated to AN, 8 % to BN, and 30.8 % was reclassified as Other Specified Feeding and Eating Disorders (OSFED). Mean SCS was higher in AN than in other diagnoses independent of classification. Differently from EDNOS, no high score was found in OSFED. BMI (OR 0.74, 95 % CI 0.56-0.98) and duration of amenorrhea >1 year (OR 6.63, 95 % CI 1.29-34.16) resulted significantly associated with the risk for medium-high SCS level in AN classified with DSM-5. The results confirmed that DSM-5 reduces the number of EDNOS. DSM-5 seems to better represent the clinical picture in OSFED than in EDNOS. The clinical relevance of BMI and duration of amenorrhea should be considered even more now that they are no longer used as diagnostic hallmarks of AN.

Regulation of COX-2–mediated signaling by α3 type IV noncollagenous domain in tumor angiogenesis

PubMed Central

Boosani, Chandra Shekhar; Mannam, Arjuna P.; Cosgrove, Dominic; Silva, Rita; Hodivala-Dilke, Kairbaan M.; Keshamouni, Venkateshwar G.

2007-01-01

Human α3 chain, a noncollagenous domain of type IV collagen [α3(IV)NC1], inhibits angiogenesis and tumor growth. These biologic functions are partly attributed to the binding of α3(IV)NC1 to αVβ3 and α3β1 integrins. α3(IV)NC1 binds αVβ3 integrin, leading to translation inhibition by inhibiting focal adhesion kinase/phosphatidylinositol 3-kinase/Akt/mTOR/4E-BP1 pathways. In the present study, we evaluated the role of α3β1 and αVβ3 integrins in tube formation and regulation of cyclooxygenase-2 (COX-2) on α3(IV)NC1 stimulation. We found that although both integrins were required for the inhibition of tube formation by α3(IV)NC1 in endothelial cells, only α3β1 integrin was sufficient to regulate COX-2 in hypoxic endothelial cells. We show that binding of α3(IV)NC1 to α3β1 integrin leads to inhibition of COX-2–mediated pro-angiogenic factors, vascular endothelial growth factor, and basic fibroblast growth factor by regulating IκBα/NFκB axis, and is independent of αVβ3 integrin. Furthermore, β3 integrin–null endothelial cells, when treated with α3(IV)NC1, inhibited hypoxia-mediated COX-2 expression, whereas COX-2 inhibition was not observed in α3 integrin–null endothelial cells, indicating that regulation of COX-2 by α3(IV)NC1 is mediated by integrin α3β1. Our in vitro and in vivo findings demonstrate that α3β1 integrin is critical for α3(IV)NC1-mediated inhibition of COX-2–dependent angiogenic signaling and inhibition of tumor progression. PMID:17426256

Loss of Intralipid®- but Not Sevoflurane-Mediated Cardioprotection in Early Type-2 Diabetic Hearts of Fructose-Fed Rats: Importance of ROS Signaling

PubMed Central

Zhang, Liyan; Affolter, Andreas; Gandhi, Manoj; Hersberger, Martin; Warren, Blair E.; Lemieux, Hélène; Sobhi, Hany F.; Clanachan, Alexander S.; Zaugg, Michael

2014-01-01

Background Insulin resistance and early type-2 diabetes are highly prevalent. However, it is unknown whether Intralipid® and sevoflurane protect the early diabetic heart against ischemia-reperfusion injury. Methods Early type-2 diabetic hearts from Sprague-Dawley rats fed for 6 weeks with fructose were exposed to 15 min of ischemia and 30 min of reperfusion. Intralipid® (1%) was administered at the onset of reperfusion. Peri-ischemic sevoflurane (2 vol.-%) served as alternative protection strategy. Recovery of left ventricular function was recorded and the activation of Akt and ERK 1/2 was monitored. Mitochondrial function was assessed by high-resolution respirometry and mitochondrial ROS production was measured by Amplex Red and aconitase activity assays. Acylcarnitine tissue content was measured and concentration-response curves of complex IV inhibition by palmitoylcarnitine were obtained. Results Intralipid® did not exert protection in early diabetic hearts, while sevoflurane improved functional recovery. Sevoflurane protection was abolished by concomitant administration of the ROS scavenger N-2-mercaptopropionyl glycine. Sevoflurane, but not Intralipid® produced protective ROS during reperfusion, which activated Akt. Intralipid® failed to inhibit respiratory complex IV, while sevoflurane inhibited complex I. Early diabetic hearts exhibited reduced carnitine-palmitoyl-transferase-1 activity, but palmitoylcarnitine could not rescue protection and enhance postischemic functional recovery. Cardiac mitochondria from early diabetic rats exhibited an increased content of subunit IV-2 of respiratory complex IV and of uncoupling protein-3. Conclusions Early type-2 diabetic hearts lose complex IV-mediated protection by Intralipid® potentially due to a switch in complex IV subunit expression and increased mitochondrial uncoupling, but are amenable to complex I-mediated sevoflurane protection. PMID:25127027

Comparison of adverse events of laser and light-assisted hair removal systems in skin types IV-VI.

PubMed

Breadon, Jonith Y; Barnes, Chad A

2007-01-01

Photoepilation, utilizing lasers and noncoherent light sources, is designed to irradiate as much of the follicular unit as possible, with melanin as the target chromophore. Wavelength absorption should generate energy sufficient to heat and destroy the hair follicle, while preserving the surrounding tissue. When performing photoepilation on African-American skin (Fitzpatrick skin types IV-VI) a greater risk of potential epidermal adverse events, such as dyspigmentation, blistering, crusting, edema, and subsequent scarring, is possible. To reduce epidermal melanin absorption of energy longer wavelengths are considered safer for use on Fitzpatrick skin types IV to VI. This article reviews and compares the reported incidences of adverse events in African-American skin, utilizing lasers and noncoherent light sources for assisted hair removal.

Identification of dipeptidyl peptidase-IV inhibitory peptides from mare whey protein hydrolysates.

PubMed

Song, J J; Wang, Q; Du, M; Ji, X M; Mao, X Y

2017-09-01

Inhibition of dipeptidyl peptidase-IV (DPP-IV) activity is a promising strategy for treatment of type 2 diabetes. In the current study, DPP-IV inhibitory peptides were identified from mare whey protein hydrolysates obtained by papain. The results showed that all the mare whey protein hydrolysates obtained at various hydrolysis durations possessed more potent DPP-IV inhibitory activity compared with intact whey protein. The 4-h hydrolysates showed the greatest DPP-IV inhibitory activity with half-maximal inhibitory concentration of 0.18 mg/mL. The 2 novel peptides from 4-h hydrolysate fractions separated by successive chromatographic steps were characterized by liquid chromatography-electrospray ionization tandem mass spectrometry. The novel peptides Asn-Leu-Glu-Ile-Ile-Leu-Arg and Thr-Gln-Met-Val-Asp-Glu-Glu-Ile-Met-Glu-Lys-Phe-Arg, which corresponded to β-lactoglobulin 1 f(71-77) and β-lactoglobulin 1 f(143-155), demonstrated DPP-IV inhibitory activity with half-maximal inhibitory concentrations of 86.34 and 69.84 μM, respectively. The DPP-IV inhibitory activity of the 2 peptides was retained or even improved after simulated gastrointestinal digestion in vitro. Our findings indicate that mare whey protein-derived peptides may possess potential as functional food ingredients in the management of type 2 diabetes. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Equilibrium between Different Coordination Geometries in Oxidovanadium(IV) Complexes

ERIC Educational Resources Information Center

Ugone, Valeria; Garribba, Eugenio; Micera, Giovanni; Sanna, Daniele

2015-01-01

In this laboratory activity, the equilibrium between square pyramidal and octahedral V(IV)O[superscript 2+] complexes is described. We propose a set of experiments to synthesize and characterize two types of V(IV)O[superscript 2+] complexes. The experiment allows great flexibility and may be effectively used at a variety of levels and the activity…

Kidney diseases caused by glomerular basement membrane type IV collagen defects in dogs.

PubMed

Lees, George E

2013-01-01

To review the pathogenesis, as well as the clinical and pathologic features of canine glomerular diseases caused by genetic type IV collagen defects. Original studies and review articles from human and veterinary medical fields. Presence in glomerular basement membranes (GBM) of a network composed of α3.α4.α5 heterotrimers of type IV collagen is required to maintain structure and function of glomerular capillary walls. Hereditary nephropathy (HN) is the most commonly used name for kidney diseases that occur in dogs due to genetic type IV collagen abnormalities. To date, 4 different collagen IV gene mutations have been identified in dogs with HN; 2 are COL4A5 mutations that cause X-linked HN (XL-HN), and 2 are COL4A4 mutations that cause autosomal recessive HN (AR-HN). Affected males with XL-HN and affected males and females with AR-HN develop juvenile-onset kidney disease manifested by proteinuria typically starting at 3-6 months of age and followed by progressive kidney disease leading to terminal failure usually at 6-24 months of age. Carrier female dogs with XL-HN also develop proteinuria starting at 3-6 months of age, but progressive disease causing kidney failure is uncommon until they are >5 years old. The distinctive pathologic lesions of HN are extensive multilaminar splitting and thickening of the GBM, as demonstrated by electron microscopy, and abnormal type IV collagen α-chain content of basement membranes, as demonstrated by immunolabeling. Identification of the underlying gene mutations has permitted genetic testing and selective breeding practices that currently are minimizing HN in breeds known to be at risk. Canine HN is a rare disease that should be considered whenever a dog exhibits a juvenile-onset kidney disease characterized partly by proteinuria, but highly specialized methods are required to pursue a definitive diagnosis. © Veterinary Emergency and Critical Care Society 2013.

Chronic constipation recognized as a sign of a SOX10 mutation in a patient with Waardenburg syndrome.

PubMed

Arimoto, Yukiko; Namba, Kazunori; Nakano, Atsuko; Matsunaga, Tatsuo

2014-05-01

Waardenburg syndrome is characterized by hearing loss, pigmentation abnormalities, dysmorphologic features, and neurological phenotypes. Waardenburg syndrome consists of four distinct subtypes, and SOX10 mutations have been identified in type II and type IV. Type IV differs from type II owing to the presence of Hirschsprung disease. We identified a de novo nonsense mutation in SOX10 (p.G39X) in a female pediatric patient with Waardenburg syndrome with heterochromia iridis, profound bilateral sensorineural hearing loss, inner ear malformations, and overall hypopigmentation of the hair without dystopia canthorum. This patient has experienced chronic constipation since she was a neonate, but anorectal manometry showed a normal anorectal reflex. Chronic constipation in this patient was likely to be a consequence of a mild intestinal disorder owing to the SOX10 mutation, and this patient was considered to have a clinical phenotype intermediate between type II and type IV of the syndrome. Chronic constipation may be recognized as indicative of a SOX10 mutation in patients with Waardenburg syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

Classification of corkscrew collaterals in thromboangiitis obliterans (Buerger's disease): relationship between corkscrew type and prevalence of ischemic ulcers.

PubMed

Fujii, Yuichi; Soga, Junko; Nakamura, Shuji; Hidaka, Takayuki; Hata, Takaki; Idei, Naomi; Fujimura, Noritaka; Nishioka, Kenji; Chayama, Kazuaki; Kihara, Yasuki; Higashi, Yukihito

2010-08-01

A corkscrew collateral appearance on angiography is one of the diagnostic criteria for Buerger's disease. The purpose of the present study was to classify the angiographic findings of corkscrew collaterals and to evaluate the relationship between corkscrew collateral type and the severity of Buerger's disease. Corkscrew collaterals were assessed on digital subtraction angiography in lower extremities of 28 patients with Buerger's disease (55 limbs). The corkscrew sign was classified into 4 types by size and pattern as follows: type I, artery diameter >2 mm, large helical sign; type II, diameter >1.5 mm and or=1 mm and

Level III and IV Ecoregions by State

EPA Pesticide Factsheets

Information and links to downloadable maps and datasets for Level III and IV ecoregions, listed by state. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

Level III and IV Ecoregions by EPA Region

EPA Pesticide Factsheets

Information and downloadable maps and datasets for Level III and IV ecoregions, listed by EPA region. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

Cassini is moved to Pad 40, CCAS, and placed atop its Titan IV launcher

NASA Technical Reports Server (NTRS)

1997-01-01

Technicians at Launch Complex 40, Cape Canaveral Air Station (CCAS), connect the crane to the top of the Cassini spacecraft in preparation for the lift to the top of its Titan IV/Centaur launch vehicle. Cassini is an international mission conducted by the National Aeronautics and Space Administration (NASA), the European Space Agency (ESA), and the Italian Space Agency (ASI). The two-story-tall spacecraft, scheduled for launch on Oct. 6, is destined to arrive at Saturn in July 2004, where it will orbit and study Saturn, its rings, moons and magnetic environment in detail over a four-year period. The Cassini mission is managed for NASA's Office of Space Science by the Jet Propulsion Laboratory, a division of the California Institute of Technology.

Cassini is moved to Pad 40, CCAS, and placed atop its Titan IV launcher

NASA Technical Reports Server (NTRS)

1997-01-01

Technicians at Cape Canaveral Air Station (CCAS) begin to remove the transportation cover from the Cassini spacecraft after it was lifted to the top of the Titan IV/Centaur launch vehicle at Complex 40. Cassini is an international mission conducted by the National Aeronautics and Space Administration (NASA), the European Space Agency (ESA), and the Italian Space Agency (ASI). The two-story-tall spacecraft, scheduled for launch on Oct. 6, is destined to arrive at Saturn in July 2004, where it will orbit and study Saturn, its rings, moons and magnetic environment in detail over a four-year period. The Cassini mission is managed for NASA's Office of Space Science by the Jet Propulsion Laboratory, a division of the California Institute of Technology.

Distribution of Porphyromonas gingivalis fimA genotypes in chronic apical periodontitis associated with symptoms.

PubMed

Wang, Qian; Zhou, Xue-dong; Zheng, Qing-hua; Wang, Yao; Tang, Lu; Huang, Ding-ming

2010-11-01

Porphyromonas gingivalis (P. gingivalis) is an anaerobic bacterium involved in root canal infections whose fimbriae are classified into six genotypes (types I-V and Ib) based on nucleotide sequence. Accumulated evidence suggests there is significant association between P. gingivalis and some clinical symptoms of periodontal diseases. The present study aims to determine the prevalence of P. gingivalis fimA genotypes in apical periodontitis and to investigate the correlation between P. gingivalis fimA genotypes and clinical symptoms. Samples were obtained from 158 infected root canals with apical periodontitis. DNA was extracted and analyzed with a polymerase chain reaction-based identification assay. Odds ratios, 95% confidence intervals, and contingency coefficient were calculated for associating the fimA-specific genes with clinical symptoms. P. gingivalis was detected in 39.9% of the inflected root canal samples and was found in 44.5% of P. gingivalis-positive specimens with symptoms. Types II (69.4%) were the most frequent in the symptomatic cases followed by type IV (32.7%). The occurrence of type I (64.3%) was significantly higher than any other genotypes in the asymptomatic apical periodontitis, whereas type II and type Ib were not identified. Statistical analysis revealed that the occurrences of types II, IV, and Ib fimA were associated with greater risk of clinical signs (swelling, sinus tract, or intracanal exudates) than type I. Results from this study reinforce the association between P. gingivalis-specific fimA genotypic clones and apical periodontitis, indicating that fimA genotypes (types II, IV, and Ib) were related to the etiology of symptomatic periradicular diseases. Copyright © 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Comparison of DNA decatenation by Escherichia coli topoisomerase IV and topoisomerase III: implications for non-equilibrium topology simplification

PubMed Central

Seol, Yeonee; Hardin, Ashley H.; Strub, Marie-Paule; Charvin, Gilles; Neuman, Keir C.

2013-01-01

Type II topoisomerases are essential enzymes that regulate DNA topology through a strand-passage mechanism. Some type II topoisomerases relax supercoils, unknot and decatenate DNA to below thermodynamic equilibrium. Several models of this non-equilibrium topology simplification phenomenon have been proposed. The kinetic proofreading (KPR) model postulates that strand passage requires a DNA-bound topoisomerase to collide twice in rapid succession with a second DNA segment, implying a quadratic relationship between DNA collision frequency and relaxation rate. To test this model, we used a single-molecule assay to measure the unlinking rate as a function of DNA collision frequency for Escherichia coli topoisomerase IV (topo IV) that displays efficient non-equilibrium topology simplification activity, and for E. coli topoisomerase III (topo III), a type IA topoisomerase that unlinks and unknots DNA to equilibrium levels. Contrary to the predictions of the KPR model, topo IV and topo III unlinking rates were linearly related to the DNA collision frequency. Furthermore, topo III exhibited decatenation activity comparable with that of topo IV, supporting proposed roles for topo III in DNA segregation. This study enables us to rule out the KPR model for non-equilibrium topology simplification. More generally, we establish an experimental approach to systematically control DNA collision frequency. PMID:23460205

A clinicopathological study of the expression of extracellular matrix components in urothelial carcinoma.

PubMed

Ioachim, Elli; Michael, Michalis; Stavropoulos, Nicolaos E; Kitsiou, Evangelia; Salmas, Marios; Malamou-Mitsi, Vasiliki

2005-03-01

To measure the immunohistochemical expression of the extracellular matrix (ECM) components tenascin, fibronectin, collagen type IV and laminin in urothelial carcinomas, and to correlate their expression with clinicopathological features to clarify the prognostic value of these molecules and their role in tumour progression. Tumour specimens obtained during transurethral resection of bladder tumour (TURBT) from 103 patients (82 men and 2 1 women, mean age 66.7 years, range 27-89) were studied retrospectively. The expression of tenascin, fibronectin, collagen type IV and laminin was correlated with clinicopathological features (tumour grade and stage, multiplicity, simultaneous in situ component, the proliferative activity as estimated by the two proliferation associated indices, Ki-67 and proliferating cell nuclear antigen, the recurrence rate, and the progression of invading tumour). Specimens investigated for tenascin expression from patients with superficial bladder cancers were categorized into 28 treated by TURBT only and 53 who had TURBT followed by intravesical instillations of interferon. Cytoplasmic tenascin expression was detected in tumour cells in 20% of specimens. Tenascin was expressed in the tumour stroma in 76% of specimens, and was positively correlated with tumour grade and stage. Stromal tenascin expression was positively correlated with proliferative activity, and with the expression of fibronectin and collagen type IV. Fibronectin was expressed in the tumour stroma in 89% of specimens and was positively correlated with tumour stage, proliferative activity, and expression of collagen type IV and laminin. Collagen type IV was expressed in 93% of specimens, and was positively correlated with tumour grade and stage. Laminin was expressed in 78% of specimens and had no significant correlation with the clinicopathological features. Patients treated with TURBT alone and who had low levels of tenascin had a longer tumour-free interval than those with high levels of tenascin. Levels of tenascin might be valuable for predicting the risk of early recurrence. The expression of tenascin, fibronectin and collagen type IV seems to be correlated with more aggressive tumour behaviour. Furthermore, their interrelationships could indicate that they are involved in the remodelling of bladder cancer tissue, probably influencing tumour progression.

A novel arctigenin-containing latex glove prevents latex allergy by inhibiting type I/IV allergic reactions.

PubMed

Wang, Yong-Xin; Xue, Dan-Ting; Liu, Meng; Zhou, Zheng-Min; Shang, Jing

2016-03-01

The present study aimed at developing a natural compound with anti-allergic effect and stability under latex glove manufacturing conditions and investigating whether its anti-allergic effect is maintained after its addition into the latex. The effects of nine natural compounds on growth of the RBL-2H3 cells and mouse primary spleen lymphocytes were determined using MTT assay. The compounds included glycyrrhizin, osthole, tetrandrine, tea polyphenol, catechin, arctigenin, oleanolic acid, baicalin and oxymatrine. An ELISA assay was used for the in vitro anti-type I/IV allergy screening; in this process β-hexosaminidase, histamine, and IL-4 released from RBL-2H3 cell lines and IFN-γ and IL-2 released from mouse primary spleen lymphocytes were taken as screening indices. The physical stability of eight natural compounds and the dissolubility of arctigenin, selected based on the in vitro pharnacodynamaic screening and the stability evaluation, were detected by HPLC. The in vivo pharmacodynamic confirmation of arctigenin and final latex product was evaluated with a passive cutaneous anaphylaxis (PCA) model and an allergen-specific skin response model. Nine natural compounds showed minor growth inhibition on RBL-2H3 cells and mouse primary spleen lymphocytes. Baicalin and arctigenin had the best anti-type I and IV allergic effects among the natural compounds based on the in vitro pharmacodynamic screening. Arctigenin and catechin had the best physical stability under different manufacturing conditions. Arctigenin was the selected for further evaluation and proven to have anti-type I and IV allergic effects in vivo in a dose-dependent manner. The final product of the arctigenin-containing latex glove had anti-type I and IV allergic effects in vivo which were mainly attributed to arctigenin as proved from the dissolubility results. Arctigenin showed anti-type I and IV allergic effects in vitro and in vivo, with a good stability under latex glove manufacturing conditions, and a persistent anti-allergic effect after being added into the latex to prevent latex allergy. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

Period variations of Algol-type eclipsing binaries AD And, TWCas and IV Cas

NASA Astrophysics Data System (ADS)

Parimucha, Štefan; Gajdoš, Pavol; Kudak, Viktor; Fedurco, Miroslav; Vaňko, Martin

2018-04-01

We present new analyses of variations in O – C diagrams of three Algol-type eclipsing binary stars: AD And, TW Cas and IV Cas. We have used all published minima times (including visual and photographic) as well as newly determined ones from our and SuperWasp observations. We determined orbital parameters of 3rd bodies in the systems with statistically significant errors, using our code based on genetic algorithms and Markov chain Monte Carlo simulations. We confirmed the multiple nature of AD And and the triple-star model of TW Cas, and we proposed a quadruple-star model of IV Cas.

Acute pancreatitis complicating choledochal cysts in children.

PubMed

Muthucumaru, Mathievathaniy; Ljuhar, Damir; Panabokke, Gayathri; Paul, Eldho; Nataraja, Ramesh; Ferguson, Peter; Dagia, Charuta; Clarnette, Tom; King, Sebastian

2017-03-01

To analyse the characteristics of patients with choledochal cysts presenting with acute pancreatitis. Multicenter retrospective review of all paediatric patients (<18 years) with choledochal cysts managed over a 14-year period (2001-2014) at two tertiary paediatric surgical centres. Patient data were analysed for demographics, presentation, radiological classification of cyst type (Todani), operative interventions, complications and long-term follow-up. A total of 49 patients with choledochal cysts were identified with 15 (31%) being Type I fusiform, 18 (37%) Type I cystic and 16 (32%) Type IV-A. Seventeen (35%) patients presented with acute pancreatitis, one having had an ante-natally diagnosed choledochal cyst. Patients presenting with pancreatitis were older when compared to the non-pancreatitis group (5.1 vs. 1.2 years, P = 0.005). Nine out of 16 (53%) patients with Type IV-A cysts presented with pancreatitis compared to five (33%) of Type I fusiform and three (17%) of Type I cystic. There was however no statistically significant association between Todani types and the development of pancreatitis (Type I fusiform, P = 1.0; Type I cystic, P = 0.063; Type IV-A, P = 0.053). The rate of complications was similar in both groups. Pancreatitis was a common presentation in children with a choledochal cyst, however, there was no clear statistically significant association with Todani types and pancreatitis. © 2016 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

Identification of the DotL coupling protein subcomplex of the Legionella Dot/Icm type IV secretion system.

PubMed

Vincent, Carr D; Friedman, Jonathan R; Jeong, Kwang Cheol; Sutherland, Molly C; Vogel, Joseph P

2012-07-01

Legionella pneumophila, the causative agent of Legionnaires' disease, survives in macrophages by altering the endocytic pathway of its host cell. To accomplish this, the bacterium utilizes a type IVB secretion system to deliver effector molecules into the host cell cytoplasm. In a previous report, we performed an extensive characterization of the L. pneumophila type IVB secretion system that resulted in the identification of a critical five-protein subcomplex that forms the core of the secretion apparatus. Here we describe a second Dot/Icm protein subassembly composed of the type IV coupling protein DotL, the apparatus proteins DotM and DotN, and the secretion adaptor proteins IcmS and IcmW. In the absence of IcmS or IcmW, DotL becomes destabilized at the transition from the exponential to stationary phases of growth, concurrent with the expression of many secreted substrates. Loss of DotL is dependent on ClpA, a regulator of the cytoplasmic protease ClpP. The resulting decreased levels of DotL in the icmS and icmW mutants exacerbates the intracellular defects of these strains and can be partially suppressed by overproduction of DotL. Thus, in addition to their role as chaperones for Legionella type IV secretion system substrates, IcmS and IcmW perform a second function as part of the Dot/Icm type IV coupling protein subcomplex. © 2012 Blackwell Publishing Ltd.

The diagnostic accuracy of multiparametric MRI to determine pediatric brain tumor grades and types.

PubMed

Koob, Mériam; Girard, Nadine; Ghattas, Badih; Fellah, Slim; Confort-Gouny, Sylviane; Figarella-Branger, Dominique; Scavarda, Didier

2016-04-01

Childhood brain tumors show great histological variability. The goal of this retrospective study was to assess the diagnostic accuracy of multimodal MR imaging (diffusion, perfusion, MR spectroscopy) in the distinction of pediatric brain tumor grades and types. Seventy-six patients (range 1 month to 18 years) with brain tumors underwent multimodal MR imaging. Tumors were categorized by grade (I-IV) and by histological type (A-H). Multivariate statistical analysis was performed to evaluate the diagnostic accuracy of single and combined MR modalities, and of single imaging parameters to distinguish the different groups. The highest diagnostic accuracy for tumor grading was obtained with diffusion-perfusion (73.24%) and for tumor typing with diffusion-perfusion-MR spectroscopy (55.76%). The best diagnostic accuracy was obtained for tumor grading in I and IV and for tumor typing in embryonal tumor and pilocytic astrocytoma. Poor accuracy was seen in other grades and types. ADC and rADC were the best parameters for tumor grading and typing followed by choline level with an intermediate echo time, CBV for grading and Tmax for typing. Multiparametric MR imaging can be accurate in determining tumor grades (primarily grades I and IV) and types (mainly pilocytic astrocytomas and embryonal tumors) in children.

[Purging behaviors and nutritional status in anorexia nervosa and bulimia nervosa].

PubMed

Vaz, F J; García-Herráiz, A; López-Vinuesa, B; Monge, M; Fernández-Gil, M A; Guisado, J A

2003-01-01

The aim of the study was to investigate whether the use of purgative methods in patients with eating disorders (anorexia nervosa [AN] and bulimia nervosa [BN]) could be capable of producing changes in the nutritional status of the patients. The group under study was composed of 184 female eating disordered outpatients. One hundred and sixteen patients (63.0%) fulfilled the DSM-IV diagnostic criteria for BN (90 purging type, 26 nonpurging type). Sixty eight patients (37.0%) fulfilled the DSM-IV criteria for the diagnosis of AN (48 restricting type, 20 binging-purging type). The assessment process included anthropometry (body circumferences and skinfold thickness) and body impedance analysis. The two subgroups of AN patients significantly differed from each of the BN subgroups. From a nutritional point of view, some significant differences between the two DSM-IV subtypes of AN existed, but not between the purging type and the nonpurging type of BN. The paper discusses the clinical significance of these findings. An alternative subtypification of AN patients is proposed: 1) restricting type [patients who control their food intake and do not purge]; 2) purging type [patient with true episodes of binging which are followed by purgative behaviors]; and 3) pseudopurging type [patients with subjective binging episodes who use purging methods].

Free testosterone concentration is inversely associated with markers of liver fibrosis in men with type 2 diabetes mellitus.

PubMed

Miyauchi, Shozo; Miyake, Teruki; Miyazaki, Masumi; Eguchi, Toru; Niiya, Tetsuji; Yamamoto, Shin; Senba, Hidenori; Furukawa, Shinya; Matsuura, Bunzo; Hiasa, Yoichi

2017-12-28

The association between serum testosterone level and liver fibrosis in patients with non-alcoholic fatty liver disease is unclear. To clarify this association, we investigated the relationship between serum free testosterone concentration and markers of liver fibrosis in men with type 2 diabetes mellitus but no obvious features of alcohol consumption. This retrospective observational cross-sectional study enrolled 248 men with type 2 diabetes mellitus. The FIB-4 index was measured as a marker of liver fibrosis, and multiple linear regression analysis was performed to examine its association with serum free testosterone concentration. In addition, the 7S domain of type IV collagen (IV-7S) was examined in 140 of the 248 patients. The mean free testosterone concentration was 10.6 ± 6.8 pg/mL and the means of the FIB-4 index and IV-7S were 1.64 ± 1.19 and 4.02 ± 1.11 ng/mL, respectively. After adjusting for all relevant variables, serum free testosterone concentrations were inversely associated with both the FIB-4 index and IV-7S (β; -0.28, P < 0.0001, and β; -0.28, P = 0.002, respectively). Measuring serum free testosterone concentrations in men with type 2 diabetes mellitus may help to predict progression to advanced liver disease. Identifying patients at risk may help to prevent the development of cirrhosis and hepatocellular carcinoma.

Specific phobia among U.S. adolescents: phenomenology and typology.

PubMed

Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

2012-12-01

Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13-18 years in the continental United States. Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

Irradiation Alters MMP-2/TIMP-2 System and Collagen Type IV Degradation in Brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Won Hee; Warrington, Junie P.; Sonntag, William E.

Purpose: Blood-brain barrier (BBB) disruption is one of the major consequences of radiation-induced normal tissue injury in the central nervous system. We examined the effects of whole-brain irradiation on matrix metalloproteinases (MMPs)/tissue inhibitors of metalloproteinases (TIMPs) and extracellular matrix (ECM) degradation in the brain. Methods and Materials: Animals received either whole-brain irradiation (a single dose of 10 Gy {gamma}-rays or a fractionated dose of 40 Gy {gamma}-rays, total) or sham-irradiation and were maintained for 4, 8, and 24 h following irradiation. mRNA expression levels of MMPs and TIMPs in the brain were analyzed by real-time reverse transcriptase-polymerase chain reaction (PCR).more » The functional activity of MMPs was measured by in situ zymography, and degradation of ECM was visualized by collagen type IV immunofluorescent staining. Results: A significant increase in mRNA expression levels of MMP-2, MMP-9, and TIMP-1 was observed in irradiated brains compared to that in sham-irradiated controls. In situ zymography revealed a strong gelatinolytic activity in the brain 24 h postirradiation, and the enhanced gelatinolytic activity mediated by irradiation was significantly attenuated in the presence of anti-MMP-2 antibody. A significant reduction in collagen type IV immunoreactivity was also detected in the brain at 24 h after irradiation. In contrast, the levels of collagen type IV were not significantly changed at 4 and 8 h after irradiation compared with the sham-irradiated controls. Conclusions: The present study demonstrates for the first time that radiation induces an imbalance between MMP-2 and TIMP-2 levels and suggests that degradation of collagen type IV, a major ECM component of BBB basement membrane, may have a role in the pathogenesis of brain injury.« less

Multiparametric in situ mRNA hybridization analysis to predict disease recurrence in patients with colon carcinoma.

PubMed Central

Kitadai, Y.; Ellis, L. M.; Tucker, S. L.; Greene, G. F.; Bucana, C. D.; Cleary, K. R.; Takahashi, Y.; Tahara, E.; Fidler, I. J.

1996-01-01

We examined the expression level of several genes that regulate different steps of metastasis in formalin-fixed, paraffin-embedded archival specimens of primary human colon carcinomas from patients with at least 5 years of follow-up. The expression of epidermal growth factor receptor, basic fibroblast growth factor, type IV collagenase, E-cadherin, and multidrug resistance (mdr-1) was examined by a colorimetric in situ mRNA hybridization technique concentrating on reactivity at the periphery of the neoplasms. The in situ hybridization technique revealed inter- and intratumor heterogeneity for expression of the metastasis-related genes. The expression of basic fibroblast growth factor, collagenase type IV, epidermal growth factor receptor, and mdr-1 mRNA was higher in Dukes's stage D than in Dukes' stage B tumors. Among the 22 Dukes' stage B neoplasms, 5 specimens exhibited a high expression level of epidermal growth factor receptor, basic fibroblast growth factor, and collagenase type IV. Clinical outcome data (5-year follow-up) revealed that all 5 patients with Dukes' stage B tumors developed distant metastasis (recurrent disease), whereas the other 17 patients with Dukes' stage B tumors expressing low levels of the metastasis-related genes were disease-free. Multivariate analysis identified high levels of expression of collagenase type IV and low levels of expression of E-cadherin as independent factors significantly associated with metastasis or recurrent disease. More specifically, metastatic or recurrent disease was associated with a high ratio (> 1.35) of expression of collagenase type IV to E-cadherin (specificity of 95%). Collectively, the data show that multiparametric in situ hybridization analysis for several metastasis-related genes may predict the metastatic potential, and hence the clinical outcome, of individual lymph-node-negative human colon cancers. Images Figure 1 Figure 2 PMID:8909244

An inert marker study for palladium silicide formation - Si moves in polycrystalline Pd2Si

NASA Technical Reports Server (NTRS)

Ho, K. T.; Lien, C.-D.; Shreter, U.; Nicolet, M.-A.

1985-01-01

A novel use of Ti marker is introduced to investigate the moving species during Pd2Si formation on 111 and 100 line-type Si substrates. Silicide formed from amorphous Si is also studied using a W marker. Although these markers are observed to alter the silicide formation in the initial stage, the moving species can be identified once a normal growth rate is resumed. It is found that Si is the dominant moving species for all three types of Si crystallinity. However, Pd will participate in mass transport when Si motion becomes obstructed.

Identification and tissue distribution of mRNAs encoding salmon-type calcitonins-IV and -V in the rainbow trout.

PubMed

Hidaka, Yoshie; Suzuki, Masakazu

2004-06-01

Four types of calcitonin are produced in salmonid fish, although their functional diversity is almost unknown. To explore the significance of these isoforms, we have characterized salmon-type calcitonin (sCT) mRNAs in the rainbow trout (Oncorhynchus mykiss), and examined their tissue distribution. In addition to the previously isolated sCT-I cDNAs, two new forms of sCT cDNA were cloned from the ultimobranchial gland, and one of them (sCT-IV cDNA) was predicted to encode an N-terminal peptide of 80 amino acid residues, a putative cleavage site Lys-Arg, sCT-IV, a cleavage and amidation sequence Gly-Lys-Lys-Arg, and a C-terminal peptide of 18 amino acids. The sCT-IV precursor was 78% identical with the rainbow trout sCT-I precursors. The other cloned cDNA encoded a precursor for a novel CT, sCT-V. The sCT-V peptide was different from sCT-IV by only one amino acid residue: Val at position 8 in the latter was replaced by Met. The sCT-V precursor had 80 and 90% identity with the sCT-I and -IV precursors respectively. No cDNA clones were obtained for sCTs-II or -III.Tissue distribution of sCT-I, -IV and -V mRNAs was examined by RT-PCR and specific cleavage with restriction enzymes. An amplified fragment from sCT-I mRNA was detected not only in the ultimobranchial gland, but also in the gills, testis and ovary. RT-PCR analysis coupled to restriction digestion further revealed that sCT-IV mRNA was expressed in both the testis and the ultimobranchial gland. The expression sites of sCT-IV mRNA were localized to the Leydig cells of the testis and to the parenchymal cells of the ultimobranchial gland, by in situ hybridization histochemistry. Although the amino acid sequence of sCT-V peptide was nearly the same as that of sCT-IV, the sCT-V gene showed a much wider pattern of expression: the band amplified by RT-PCR was detected in all the tissues examined except the kidney, gills and blood cells. The sCT-V mRNA was shown to be localized in the parenchymal cells of the ultimobranchial gland, but not in other tissues at the cellular level, suggesting very low expression of sCT-V mRNA in those tissues. Our results show different patterns of tissue expression of three types of sCT genes in the rainbow trout, suggesting that sCTs-I, -IV and -V might differ in their local actions.

Analysis of offshore platforms lifting with fixed pile structure type (fixed platform) based on ASD89

NASA Astrophysics Data System (ADS)

Sugianto, Agus; Indriani, Andi Marini

2017-11-01

Platform construction GTS (Gathering Testing Sattelite) is offshore construction platform with fix pile structure type/fixed platform functioning to support the mining of petroleum exploitation. After construction fabrication process platform was moved to barges, then shipped to the installation site. Moving process is generally done by pull or push based on construction design determined when planning. But at the time of lifting equipment/cranes available in the work area then the moving process can be done by lifting so that moving activity can be implemented more quickly of work. This analysis moving process of GTS platform in a different way that is generally done to GTS platform types by lifting using problem is construction reinforcement required, so the construction can be moved by lifting with analyzing and checking structure working stress that occurs due to construction moving process by lifting AISC code standard and analysis using the SAP2000 structure analysis program. The analysis result showed that existing condition cannot be moved by lifting because stress ratio is above maximum allowable value that is 0.950 (AISC-ASD89). Overstress occurs on the member 295 and 324 with stress ratio value 0.97 and 0.95 so that it is required structural reinforcement. Box plate aplication at both members so that it produces stress ratio values 0.78 at the member 295 and stress ratio of 0.77 at the member 324. These results indicate that the construction have qualified structural reinforcement for being moved by lifting.

Level III and IV Ecoregions of the Continental United States

EPA Pesticide Factsheets

Information and downloadable maps and datasets for Level III and IV ecoregions of the continental United States. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

Enteral Contrast in the Computed Tomography Diagnosis of Appendicitis

PubMed Central

Drake, Frederick Thurston; Alfonso, Rafael; Bhargava, Puneet; Cuevas, Carlos; Dighe, Manjiri K.; Florence, Michael G.; Johnson, Morris G.; Jurkovich, Gregory J.; Steele, Scott R.; Symons, Rebecca Gaston; Thirlby, Richard C.; Flum, David R.

2014-01-01

Objective Our goal was to perform a comparative effectiveness study of intravenous (IV)-only versus IV + enteral contrast in computed tomographic (CT) scans performed for patients undergoing appendectomy across a diverse group of hospitals. Background Small randomized trials from tertiary centers suggest that enteral contrast does not improve diagnostic performance of CT for suspected appendicitis, but generalizability has not been demonstrated. Eliminating enteral contrast may improve efficiency, patient comfort, and safety. Methods We analyzed data for adult patients who underwent nonelective appendectomy at 56 hospitals over a 2-year period. Data were obtained directly from patient charts by trained abstractors. Multivariate logistic regression was utilized to adjust for potential confounding. The main outcome measure was concordance between final radiology interpretation and final pathology report. Results A total of 9047 adults underwent appendectomy and 8089 (89.4%) underwent CT, 54.1% of these with IV contrast only and 28.5% with IV + enteral contrast. Pathology findings correlated with radiographic findings in 90.0% of patients who received IV + enteral contrast and 90.4% of patients scanned with IV contrast alone. Hospitals were categorized as rural or urban and by their teaching status. Regardless of hospital type, there was no difference in concordance between IV-only and IV + enteral contrast. After adjusting for age, sex, comorbid conditions, weight, hospital type, and perforation, odds ratio of concordance for IV + enteral contrast versus IV contrast alone was 0.95 (95% CI: 0.72–1.25). Conclusions Enteral contrast does not improve CT evaluation of appendicitis in patients undergoing appendectomy. These broadly generalizable results from a diverse group of hospitals suggest that enteral contrast can be eliminated in CT scans for suspected appendicitis. PMID:24598250

The type IV pilin of Burkholderia mallei is highly immunogenic but fails to protect against lethal aerosol challenge in a murine model.

PubMed

Fernandes, Paula J; Guo, Qin; Waag, David M; Donnenberg, Michael S

2007-06-01

Burkholderia mallei is the cause of glanders and a proven biological weapon. We identified and purified the type IV pilin protein of this organism to study its potential as a subunit vaccine. We found that purified pilin was highly immunogenic. Furthermore, mice infected via sublethal aerosol challenge developed significant increases in titers of antibody against the pilin, suggesting that it is expressed in vivo. Nevertheless, we found no evidence that high-titer antipilin antisera provided passive protection against a sublethal or lethal aerosol challenge and no evidence of protection afforded by active immunization with purified pilin. These results contrast with the utility of type IV pilin subunit vaccines against other infectious diseases and highlight the need for further efforts to identify protective responses against this pathogen.

Resolution of Large Azygos Vein Aneurysm Following Stent-Graft Shunt Placement in a Patient with Ehlers-Danlos Syndrome Type IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Souza, Estelle S.; Williams, David M.; Deeb, G.M.

2006-10-15

Ehlers-Danlos syndrome (EDS) type IV is a rare connective tissue disorder associated with thin-walled, friable arteries and veins predisposing patients to aneurysm formation, dissection, fistula formation, and vessel rupture. Azygos vein aneurysm is an extremely rare condition which has not been reported in association with EDS in the literature. We present a patient with EDS type IV and interrupted inferior vena cava (IVC) with azygos continuation who developed an azygos vein aneurysm. In order to decrease flow through the azygos vein and reduce the risk of aneurysm rupture, a stent-graft shunt was created from the right hepatic vein to themore » azygos vein via a transhepatic, retroperitoneal route. At 6 month follow-up the shunt was open and the azygos vein aneurysm had resolved.« less

Differential recognition of geometric isomers by the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae): Evidence for only three essential components in aggregation pheromone.

PubMed

Dickens, J C; Prestwich, G D

1989-02-01

For two decades, the aggregation pheromone of the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae), was thought to consist of four compounds: I [(+)-(Z)-2-isopropenyl-1-methylcyclobutane ethanol]; II [(Z)-3,3-dimethyl-Δ(I,β)-cyclohexane ethanol]; III [(Z)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde); and IV [(E)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde). Evidence is presented from behavioral and electrophysiological studies to show that only three of these components, I, II, and IV, are essential for attraction. Competitive field tests, in which each possible three-component blend was tested against the four-component mixture, demonstrated that omission of I, II. or IV resulted in decreased trap captures (P < 0.01). Trap captures by these blends lacking I, II, or IV resembled those by the hexane solvent alone in a similar experiment. However, omission of III did not significantly alter field attractiveness of the blend. Dosage-response curves constructed from electroantennogram responses of both males and females to serial dilutions of III, IV, and a 50∶50 mixture of the geometric isomers III and IV showed both sexes to be 10- to 100-fold more sensitive to IV than III. Data from the electrophysiological studies were consistent with a single acceptor type for the (E)-cyclohexylidene aldehyde, IV, for males, and possibly one or two acceptor types for III and IV for females. Possible roles for the (Z)-cyclohexylidene aldehyde, III, and implications for the pheromonal attractant currently used in boll weevil eradication/suppression programs are discussed.

Predominance of Three Closely Related Methicillin-Resistant Staphylococcus aureus Clones Carrying a Unique ccrC-Positive SCCmec type III and the Emergence of spa t304 and t690 SCCmec type IV pvl+ MRSA Isolates in Kinta Valley, Malaysia.

PubMed

Ho, Wai-Yew; Choo, Quok-Cheong; Chew, Choy-Hoong

2017-03-01

We investigated the epidemiology and clonality of 175 nonrepetitive methicillin-resistant Staphylococcus aureus (MRSA) isolates from clinical specimens collected between 2011 and 2012 in Kinta Valley in Malaysia. Molecular tools such as polymerase chain reaction, pulsed-field gel electrophoresis, and staphylococcal protein A (spa) typing were used. Our study revealed the predominance of three closely related ermA + SCCmec type III pulsotypes belonging to spa type t037 (Brazilian-Hungarian clone), which were deficient in the locus F, but positive for the ccrC gene in majority (65.7%) of the MRSA infections in this region. The first evidence of SCCmec type II MRSA in the country, belonging to spa type t2460, was also noted. Although the carriage of pvl gene was uncommon (8.6%) and mostly confined to either SCCmec type IV or SCCmec type V isolates, most of these isolates belonged to spa types t345 or t657, which are associated with the Bengal-Bay CA-MRSA clone. Interestingly, spa t304 and t690 SCCmec type IV pvl + were also detected among the MRSA isolates. Data from this study show the rise of uncommon clones among MRSA isolates in Malaysia.

Multidisciplinary Treatment of Severe Osteogenesis Imperfecta: Functional Outcomes at Skeletal Maturity.

PubMed

Montpetit, Kathleen; Palomo, Telma; Glorieux, Francis H; Fassier, François; Rauch, Frank

2015-10-01

To determine the functional outcomes associated with long-term multidisciplinary treatment, intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation in children with severe osteogenesis imperfecta (OI) (diagnosed clinically as OI types III or IV). Retrospective study where outcomes were measured prospectively. Pediatric orthopedic hospital. Adolescents (N=41; age range, 15-21y) with severe OI (OI type III: n=17; OI type IV: n=24) who had started therapy before the age of 6 years, had received treatment for at least 10 years, and had achieved final height. Intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation. Pediatric Evaluation of Disability Inventory. At the time of the last available follow-up examination, none of the individuals diagnosed with OI type III (most severely affected group) was able to ambulate without ambulation aids, whereas 20 (83%) patients with OI type IV were able to ambulate without ambulation aids. Regarding self-care, we specifically assessed 8 skills that we deemed essential for living independently (grooming; dressing; toileting; bed, chair, toilet, tub, and car transfers). Only 6 (35%) of the youths with OI type III were able to complete all 8 items, whereas 23 (96%) individuals with OI type IV managed to perform all tasks. Teens with OI type III often needed assistance for the transfer to toilet, tub, and car and for personal hygiene and clothing management associated with toileting, usually because of limitations in upper-extremity function. These observations suggest that further improvements in the functional status of the most severely affected children with OI are contingent on advances in the clinical management of upper-extremity issues. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Fatal Peritoneal Bleeding Following Embolization of a Carotid-Cavernous Fistula in Ehlers-Danlos Syndrome Type IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Usinskiene, Jurgita; Mazighi, Mikael; Bisdorff, Annouk

2006-12-15

We report the case of a 25-year-old woman treated for a spontaneous carotid-cavernous fistula in a context of Ehlers-Danlos syndrome type IV. Embolization with a transvenous approach was achieved without complications; however, the patient died 72 hr later of massive intraperitoneal bleeding. At autopsy, no lesion of the digestive arteries was identified. Possible causes of this bleeding are discussed.

Advances in containment methods and plutonium recovery strategies that led to the structural characterization of plutonium(IV) tetrachloride tris-diphenylsulfoxide, PuCl 4(OSPh 2) 3

DOE PAGES

Schrell, Samantha K.; Boland, Kevin Sean; Cross, Justin Neil; ...

2017-01-18

In an attempt to further advance the understanding of plutonium coordination chemistry, we report a robust method for recycling and obtaining plutonium aqueous stock solutions that can be used as a convenient starting material in plutonium synthesis. This approach was used to prepare and characterize plutonium(IV) tetrachloride tris-diphenylsulfoxide, PuCl 4(OSPh 2) 3, by single crystal X-ray diffraction. The PuCl 4(OSPh 2) 3 compound represents a rare example of a 7-coordinate plutonium(IV) complex. Structural characterization of PuCl 4(OSPh 2) 3 by X-ray diffraction utilized a new containment method for radioactive crystals. The procedure makes use of epoxy, polyimide loops, and amore » polyester sheath to provide a robust method for safely containing and easily handling radioactive samples. Lastly, the described procedure is more user friendly than traditional containment methods that employ fragile quartz capillary tubes. Additionally, moving to polyester, instead of quartz, lowers the background scattering from the heavier silicon atoms.« less

The General Assessment of Personality Disorder (GAPD): factor structure, incremental validity of self-pathology, and relations to DSM-IV personality disorders.

PubMed

Hentschel, Annett G; Livesley, W John

2013-01-01

Recent developments in the classification of personality disorder, especially moves toward more dimensional systems, create the need to assess general personality disorder apart from individual differences in personality pathology. The General Assessment of Personality Disorder (GAPD) is a self-report questionnaire designed to evaluate general personality disorder. The measure evaluates 2 major components of disordered personality: self or identity problems and interpersonal dysfunction. This study explores whether there is a single factor reflecting general personality pathology as proposed by the Diagnostic and Statistical Manual of Mental Disorders (5th ed.), whether self-pathology has incremental validity over interpersonal pathology as measured by GAPD, and whether GAPD scales relate significantly to Diagnostic and Statistical Manual of Mental Disorders (4th ed. [DSM-IV]) personality disorders. Based on responses from a German psychiatric sample of 149 participants, parallel analysis yielded a 1-factor model. Self Pathology scales of the GAPD increased the predictive validity of the Interpersonal Pathology scales of the GAPD. The GAPD scales showed a moderate to high correlation for 9 of 12 DSM-IV personality disorders.

Structure and function of the adhesive type IV pilus of Sulfolobus acidocaldarius

PubMed Central

Henche, Anna-Lena; Ghosh, Abhrajyoti; Yu, Xiong; Jeske, Torsten; Egelman, Edward; Albers, Sonja-Verena

2014-01-01

Archaea display a variety of type IV pili on their surface and employ them in different physiological functions. In the crenarchaeon Sulfolobus acidocaldarius the most abundant surface structure is the aap pilus (archaeal adhesive pilus). The construction of in frame deletions of the aap genes revealed that all the five genes (aapA, aapX, aapE, aapF, aapB) are indispensible for assembly of the pilus and an impact on surface motility and biofilm formation was observed. Our analyses revealed that there exists a regulatory cross-talk between the expression of aap genes and archaella (formerly archaeal flagella) genes during different growth phases. The structure of the aap pilus is entirely different from the known bacterial type IV pili as well as other archaeal type IV pili. An aap pilus displayed 3 stranded helices where there is a rotation per subunit of ~ 138° and a rise per subunit of ~ 5.7 Å. The filaments have a diameter of ~ 110 Å and the resolution was judged to be ~ 9 Å. We concluded that small changes in sequence might be amplified by large changes in higher-order packing. Our finding of an extraordinary stability of aap-pili possibly represents an adaptation to harsh environments that S. acidocaldarius encounters. PMID:23078543

Alteration of Escherichia coli topoisomerase IV to novobiocin resistance.

PubMed

Hardy, Christine D; Cozzarelli, Nicholas R

2003-03-01

DNA gyrase and topoisomerase IV (topo IV) are the two essential type II topoisomerases of Escherichia coli. Gyrase is responsible for maintaining negative supercoiling of the bacterial chromosome, whereas topo IV's primary role is in disentangling daughter chromosomes following DNA replication. Coumarins, such as novobiocin, are wide-spectrum antimicrobial agents that primarily interfere with DNA gyrase. In this work we designed an alteration in the ParE subunit of topo IV at a site homologous to that which confers coumarin resistance in gyrase. This parE mutation renders the encoded topo IV approximately 40-fold resistant to inhibition by novobiocin in vitro and imparts a similar resistance to inhibition of topo IV-mediated relaxation of supercoiled DNA in vivo. We conclude that topo IV is a secondary target of novobiocin and that it is very likely to be inhibited by the same mechanism as DNA gyrase.

First Report of cfr-Carrying Plasmids in the Pandemic Sequence Type 22 Methicillin-Resistant Staphylococcus aureus Staphylococcal Cassette Chromosome mec Type IV Clone

PubMed Central

Shore, Anna C.; Lazaris, Alexandros; Kinnevey, Peter M.; Brennan, Orla M.; Brennan, Gráinne I.; O'Connell, Brian; Feßler, Andrea T.; Schwarz, Stefan

2016-01-01

Linezolid is often the drug of last resort for serious methicillin-resistant Staphylococcus aureus (MRSA) infections. Linezolid resistance is mediated by mutations in 23S rRNA and genes for ribosomal proteins; cfr, encoding phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A (PhLOPSA) resistance; its homologue cfr(B); or optrA, conferring oxazolidinone and phenicol resistance. Linezolid resistance is rare in S. aureus, and cfr is even rarer. This study investigated the clonality and linezolid resistance mechanisms of two MRSA isolates from patients in separate Irish hospitals. Isolates were subjected to cfr PCR, PhLOPSA susceptibility testing, 23S rRNA PCR and sequencing, DNA microarray profiling, spa typing, pulsed-field gel electrophoresis (PFGE), plasmid curing, and conjugative transfer. Whole-genome sequencing was used for single-nucleotide variant (SNV) analysis, multilocus sequence typing, L protein mutation identification, cfr plasmid sequence analysis, and optrA and cfr(B) detection. Isolates M12/0145 and M13/0401 exhibited linezolid MICs of 64 and 16 mg/liter, respectively, and harbored identical 23S rRNA and L22 mutations, but M12/0145 exhibited the mutation in 2/6 23S rRNA alleles, compared to 1/5 in M13/0401. Both isolates were sequence type 22 MRSA staphylococcal cassette chromosome mec type IV (ST22-MRSA-IV)/spa type t032 isolates, harbored cfr, exhibited the PhLOPSA phenotype, and lacked optrA and cfr(B). They differed by five PFGE bands and 603 SNVs. Isolate M12/0145 harbored cfr and fexA on a 41-kb conjugative pSCFS3-type plasmid, whereas M13/0401 harbored cfr and lsa(B) on a novel 27-kb plasmid. This is the first report of cfr in the pandemic ST22-MRSA-IV clone. Different cfr plasmids and mutations associated with linezolid resistance in genotypically distinct ST22-MRSA-IV isolates highlight that prudent management of linezolid use is essential. PMID:26953212

Lesch typology and temperament in opioid dependence: a cross-sectional study.

PubMed

Salem, B A; Vyssoki, B; Lesch, O M; Erfurth, A

2014-08-01

The first aim of this study is to investigate the impact of different temperaments in opiate dependency patients. The second aim of this study is to define therapy relevant subgroups in opiate addiction for further basic clinical research and therapy. In the time period from September to November 2010, 101 patients (72 males and 29 females) which fulfilled the diagnosis of opiate dependency according to DSM-IV-TR were recruited consecutively. All patients were in treatment at the Oum El Nour rehabilitation center/Lebanon (Inpatient and Outpatient groups). Lesch Alcoholism Typology modified for assessment of opiate addicts, and the briefTEMPS-M, Arabic version were used. The organic Type IV group was the most prevalent (48.5%) among the sample followed by the Affective Type III group (41.6%) and the minority represented the two other types (I & II). The organic Type IV group represented the major type in the cyclothymic and anxious temperament. In the contrary the other two groups (I & II) were the minority among the cyclothymics. Copyright © 2014 Elsevier B.V. All rights reserved.

Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis.

PubMed

Luvan, M; Kanthan, S R; Roshan, G; Saw, A

2015-11-01

Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy.

A unifying concept: pancreatic ductal anatomy both predicts and determines the major complications resulting from pancreatitis.

PubMed

Nealon, William H; Bhutani, Manoop; Riall, Taylor S; Raju, Gottumukkala; Ozkan, Orhan; Neilan, Ryan

2009-05-01

Precepts about acute pancreatitis, necrotizing pancreatitis, and pancreatic fluid collections or pseudocyst rarely include the impact of pancreatic ductal injuries on their natural course and outcomes. We previously examined and established a system to categorize ductal changes. We sought a unifying concept that may predict course and direct therapies in these complex patients. We use our system categorizing ductal changes in pseudocyst of the pancreas and severe necrotizing pancreatitis (type I, normal duct; type II, duct stricture; type III, duct occlusion or "disconnected duct"; and type IV, chronic pancreatitis). From 1985 to 2006, a policy was implemented of routine imaging (cross-sectional, endoscopic retrograde cholangiopancreatography, or magnetic resonance cholangiopancreatography). Clinical outcomes were measured. Among 563 patients with pseudocyst, 142 resolved spontaneously (87% of type I, 5% of type II, and no type III, and 3% of type IV). Percutaneous drainage was successful in 83% of type I, 49% of type II, and no type III or type IV. Among 174 patients with severe acute pancreatitis percutaneous drainage was successful in 64% of type I, 38% of type II, and no type III. Operative debridement was required in 39% of type I and 83% and 85% of types II and III, respectively. Persistent fistula after debridement occurred in 27%, 54%, and 85% of types I, II, and III ducts, respectively. Late complications correlated with duct injury. Pancreatic ductal changes predict spontaneous resolution, success of nonoperative measures, and direct therapies in pseudocyst. Ductal changes also predict patients with necrotizing pancreatitis who are most likely to have immediate and delayed complications.

Health and well-being of movers in rural and urban areas--a grid-based analysis of northern Finland birth cohort 1966.

PubMed

Lankila, Tiina; Näyhä, Simo; Rautio, Arja; Koiranen, Markku; Rusanen, Jarmo; Taanila, Anja

2013-01-01

We examined the association of health and well-being with moving using a detailed geographical scale. 7845 men and women born in northern Finland in 1966 were surveyed by postal questionnaire in 1997 and linked to 1 km(2) geographical grids based on each subject's home address in 1997-2000. Population density was used to classify each grid as rural (1-100 inhabitants/km²) or urban (>100 inhabitants/km²) type. Moving was treated as a three-class response variate (not moved; moved to different type of grid; moved to similar type of grid). Moving was regressed on five explanatory factors (life satisfaction, self-reported health, lifetime morbidity, activity-limiting illness and use of health services), adjusting for factors potentially associated with health and moving (gender, marital status, having children, housing tenure, education, employment status and previous move). The results were expressed as odds ratios (OR) and their 95% confidence intervals (CI). Moves from rural to urban grids were associated with dissatisfaction with current life (adjusted OR 2.01; 95% CI 1.26-3.22) and having somatic (OR 1.66; 1.07-2.59) or psychiatric (OR 2.37; 1.21-4.63) morbidities, the corresponding ORs for moves from rural to other rural grids being 1.71 (0.98-2.98), 1.63 (0.95-2.78) and 2.09 (0.93-4.70), respectively. Among urban dwellers, only the frequent use of health services (≥ 21 times/year) was associated with moving, the adjusted ORs being 1.65 (1.05-2.57) for moves from urban to rural grids and 1.30 (1.03-1.64) for urban to other urban grids. We conclude that dissatisfaction with life and history of diseases and injuries, especially psychiatric morbidity, may increase the propensity to move from rural to urbanised environments, while availability of health services may contribute to moves within urban areas and also to moves from urban areas to the countryside, where high-level health services enable a good quality of life for those attracted by the pastoral environment. Copyright © 2012 Elsevier Ltd. All rights reserved.

[Outcome of operative treatment for supination-external rotation Lauge-Hansen stage IV ankle fractures].

PubMed

Kołodziej, Łukasz; Boczar, Tomasz; Bohatyrewicz, Andrzej; Zietek, Paweł

2010-01-01

Ankle fractures are among the most common musculoskeletal injures. These fractures occur with an overall age- and sex-adjusted incidence rate around 180 per 100 000 person-years. The most frequent mechanism is considered to be supination-external rotation (60 to 80% of all ankle fractures) consisting of pathologic external rotation of the foot initially placed in some degree of supination. According to Lauge-Hansen classification, ankle joint structures are damaged in a sequence where the final, stage IV injuries, represents transverse fracture of the medial malleolus or its equivalent-rupture of the deltoid ligament. The aim of this study is to compare the results of two subtypes of supination-external rotation stage IV fractures. 43 patients treated surgically in 2006 to 2007 at Authors institution because of stage IV supination-external rotation ankle fracture were submitted to retrospective analysis. There were 25 patients with bimalleolar fracture (type 1) and in 18 patients with lateral malleolar fracture with accompanying rupture of the deltoid ligament (type 2). The mean age was 46 years (from 20 to 82 years). Average follow up period was 37 months (from 24 to 46 months). For the evaluation of treatment AOFAS hind-foot score (American Orthopedic Foot and Ankle Society) was used. The mean AOFAS score scale for Type 1 fractures was 85 points and for type 2 was significantly higher and amounted to 91 points (p < 0.05). Supination-external rotation stage IV ankle fractures with medial malleolar fracture, requires the implementation of additional diagnostic and therapeutic strategies and procedures in order to improve the outcome of results.

Adult presentation of Bartter syndrome type IV with erythrocytosis.

PubMed

Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

2015-01-01

Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis.

Audiological findings in children with mucopolysaccharidoses type i-iv.

PubMed

Vargas-Gamarra, María F; de Paula-Vernetta, Carlos; Vitoria Miñana, Isidro; Ibañez-Alcañiz, Isabel; Cavallé-Garrido, Laura; Alamar-Velazquez, Agustín

The aim of our study is to reflect hearing impairment of 23children diagnosed with mucopolysaccharidosis (MPS) typeI, II, III and IV. Retrospective study of the clinical, audiological and treatment (medical vs surgical) findings of 23children diagnosed with MPS typeI, II, III or IV followed at a Tertiary Referral Hospital between 1997 and 2015. Six cases of MPSI, 8 of MPSII, 4 of MPSIII and 5 of MPSIV were reviewed. 71.2% of patients had secretory otitis media (SOM) and 54% of patients had some type of hearing loss (HL). The behaviour of hearing loss was variable in each of the subgroups of MPS, finding greater involvement and variability in typesI and II. Children with MPS have a high risk of hearing loss. A significant percentage of transmissive HL progressing to mixed or sensorineural HL was observed. This was more common in typesI and II. Periodic follow up of these patients is mandatory because of hearing impairment and consequences for their development and quality of life. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. All rights reserved.

The Caenorhabditis elegans mucolipin-like gene cup-5 is essential for viability and regulates lysosomes in multiple cell types.

PubMed

Hersh, Bradley M; Hartwieg, Erika; Horvitz, H Robert

2002-04-02

The misregulation of programmed cell death, or apoptosis, contributes to the pathogenesis of many diseases. We used Nomarski microscopy to screen for mutants containing refractile cell corpses in a C. elegans strain in which all programmed cell death is blocked and such corpses are absent. We isolated a mutant strain that accumulates refractile bodies resembling irregular cell corpses. We rescued this mutant phenotype with the C. elegans mucolipidosis type IV (ML-IV) homolog, the recently identified cup-5 (coelomocyte-uptake defective) gene. ML-IV is a human autosomal recessive lysosomal storage disease characterized by psychomotor retardation and ophthalmological abnormalities. Our null mutations in cup-5 cause maternal-effect lethality. In addition, cup-5 mutants contain excess lysosomes in many and possibly all cell types and contain lamellar structures similar to those observed in ML-IV cell lines. The human ML-IV gene is capable of rescuing both the maternal-effect lethality and the lysosome-accumulation abnormality of cup-5 mutants. cup-5 mutants seem to contain excess apoptotic cells as detected by staining with terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling. We suggest that the increased apoptosis seen in cup-5 mutants is a secondary consequence of the lysosomal defect, and that abnormalities in apoptosis may be associated with human lysosomal storage disorders.

Risk evaluation for in-vehicle sign information.

DOT National Transportation Integrated Search

2016-05-01

The goal of the study was to examine the influence of in-vehicle signing (IVS) pertaining to four types of changing : driving conditions and determine the utility and potential safety costs associated with the IVS information. Signage : displayed on ...

KSC-04pd1671

NASA Image and Video Library

2004-08-09

KENNEDY SPACE CENTER, FLA. - The first of two Boeing Delta IV first stages is moved inside the Horizontal Integration Facility at Launch Complex 37, Cape Canaveral Air Force Station. The rockets were shipped by barge from Decatur, Ala., to Port Canaveral and offloaded onto Elevating Platform Transporters. . A Boeing Delta IV will be used for the December launching of the GOES-N weather satellite for NASA and NOAA. The GOES-N is the first in a series of three advanced weather satellites including GOES-O and GOES-P. This satellite will provide continuous monitoring necessary for intensive data analysis. It will provide a constant vigil for the atmospheric “triggers” of severe weather conditions such as tornadoes, flash floods, hail storms and hurricanes. When these conditions develop, GOES-N will be able to monitor storm development and track their movements.

Optimal Search for Moving Targets in Continuous Time and Space using Consistent Approximations

DTIC Science & Technology

2011-09-01

σnNµ )q/ν M q = κ b −n log c̄ log b +B1B2 + K( b σnNµ )q/ν ( b σnNµ )q/ν M q = B2 [ κ B2b −n log c̄ log b +B1 + ( b σnNµ )q/ν B2M q Kσq/νnq/νNµq/ν bq/ν...IV.52) Since −nb log c̄ log b → a1 ∈ [ pq µq + νp ,∞), 106 the expression κ B2b −n log c̄ log b (IV.53) goes to 0, as b→∞. In addition, we know...Burden, R. (1993). Numerical methods. Boston, Massachusetts: PWS Publishing Company . Ghabcheloo, R., Kaminer, I., Aguiar, A., & Pascoal, A. (2009). A

KSC-2014-3694

NASA Image and Video Library

2014-08-29

CAPE CANAVERAL, Fla. – Inside the Delta Operations Center at Cape Canaveral Air Force Station, United Launch Alliance technicians lower the second stage of a Delta IV Heavy rocket following testing in preparation for the unpiloted Exploration Flight Test-1, or EFT-1. The second stage will be moved to the Horizontal Integration Facility at Space Launch Complex 37 for mating with the Delta IV Heavy booster stages. During the mission, Orion will travel farther into space than any human spacecraft has gone in more than 40 years. The data gathered during the flight will influence design decisions, validate existing computer models and innovative new approaches to space systems development, as well as reduce overall mission risks and costs for later Orion flights. Liftoff of Orion on the first flight test is planned for December 2014. Photo credit: NASA/Kim Shiflett

KSC-2014-3696

NASA Image and Video Library

2014-08-29

CAPE CANAVERAL, Fla. – Inside the Delta Operations Center at Cape Canaveral Air Force Station, United Launch Alliance technicians stand by with a transporter to move the second stage of a Delta IV Heavy rocket following testing in preparation for the unpiloted Exploration Flight Test-1, or EFT-1. The second stage will be transported to the Horizontal Integration Facility at Space Launch Complex 37 for mating with the Delta IV Heavy booster stages. During the mission, Orion will travel farther into space than any human spacecraft has gone in more than 40 years. The data gathered during the flight will influence design decisions, validate existing computer models and innovative new approaches to space systems development, as well as reduce overall mission risks and costs for later Orion flights. Liftoff of Orion on the first flight test is planned for December 2014. Photo credit: NASA/Kim Shiflett

KSC-2014-3699

NASA Image and Video Library

2014-08-29

CAPE CANAVERAL, Fla. – Inside the Delta Operations Center at Cape Canaveral Air Force Station, United Launch Alliance technicians place the second stage of a Delta IV Heavy rocket on a transporter following testing in preparation for the unpiloted Exploration Flight Test-1, or EFT-1. The second stage will be moved to the Horizontal Integration Facility at Space Launch Complex 37 for mating with the Delta IV Heavy booster stages. During the mission, Orion will travel farther into space than any human spacecraft has gone in more than 40 years. The data gathered during the flight will influence design decisions, validate existing computer models and innovative new approaches to space systems development, as well as reduce overall mission risks and costs for later Orion flights. Liftoff of Orion on the first flight test is planned for December 2014. Photo credit: NASA/Kim Shiflett

Cassini is moved to Pad 40, CCAS, and placed atop its Titan IV launcher

NASA Technical Reports Server (NTRS)

1997-01-01

The Cassini spacecraft is rolled out of the Payload Hazardous Servicing Facility (PHSF) at Kennedy Space Center, Fla., shortly before being transported to Complex 40 at Cape Canaveral Air Station (CCAS) where it will be lifted to the top of its Titan IV/Centaur launch vehicle. Cassini is an international mission conducted by the National Aeronautics and Space Administration (NASA), the European Space Agency (ESA), and the Italian Space Agency (ASI). The two-story-tall spacecraft, scheduled for launch on Oct. 6, is destined to arrive at Saturn in July 2004, where it will orbit and study Saturn, its rings, moons and magnetic environment in detail over a four-year period. The Cassini mission is managed for NASA's Office of Space Science by the Jet Propulsion Laboratory, a division of the California Institute of Technology.

Nonstatic radiating spheres in general relativity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krori, K.D.; Borgohain, P.; Sarma, R.

1985-02-15

The method of Herrera, Jimenez, and Ruggeri of obtaining nonstatic solutions of Einstein's field equations to study the evolution of stellar bodies is applied to obtain two models of nonstatic radiating spheres from two well-known static solutions of field equations, viz., Tolman's solutions IV and V. Whereas Tolman's type-IV model is found to be contracting for the period under investigation, Tolman's type-V model shows a bounce after attaining a minimum radius.

Retrobulbar Hematoma from Warfarin Toxicity and the Limitations of Bedside Ocular Sonography

DTIC Science & Technology

2010-05-01

Nontraumatic RBH occurs rarely and has been associated with arteriovenous malformations,1 following thrombolysis,2 Type IV Ehlers - Danlos Syndrome ,3...infarction. N Engl J Med. 2007; 357:1448-9. 3. Shaikh S, Braun M, Eliason J. Spontaneous retrobulbar hemorrhage in type IV Ehlers - Danlos syndrome . Am J...compartment syndrome . DISCUSSION We believe this is the first case report of a nontraumatic RBH associated with warfarin toxicity. Our patient also had

Electro-mechanical coupling of semiconductor film grown on stainless steel by oxidation

NASA Astrophysics Data System (ADS)

Lin, M. C.; Wang, G.; Guo, L. Q.; Qiao, L. J.; Volinsky, Alex A.

2013-09-01

Electro-mechanical coupling phenomenon in oxidation film on stainless steel has been discovered by using current-sensing atomic force microscopy, along with the I-V curves measurements. The oxidation films exhibit either ohmic, n-type, or p-type semiconductor properties, according to the obtained I-V curves. This technique allows characterizing oxidation films with high spatial resolution. Semiconductor properties of oxidation films must be considered as additional stress corrosion cracking mechanisms.

Type IV-a choledochal cyst--a rare adolescent presentation as acute abdomen.

PubMed

Satya, Ramadass; Vijayakumar, Vani

2006-10-01

A 17-year-old adolescent girl from El Salvador presented to the emergency room (ER) with severe abdominal pain associated with one episode of nausea and vomiting. The pain that started 5 days earlier was sharp in nature and epigastric in location with radiation to back and was relieved by half a tablet of Vicodin. The patient has a history of intermittent epigastric pain for the past 2 years and was treated for Helicobacter pylori for 1 year. In the ER, the serum chemistry demonstrated elevated amylase. Further workup with abdominal ultrasonography (US), computed tomography (CT), magnetic resonance cholangiopancreatography (MRCP), and hepatobiliary scintigraphy confirmed a type IV-a choledochal cyst with intra- and extrahepatic dilation of bile ducts. We report an unusual acute abdomen presentation of type IV-a choledochal cyst in a 17-year-old young adult from El Salvador.

Evaluation of Different Disinfactants on Dimensional Accuracy and Surface Quality of Type IV Gypsum Casts Retrieved from Elastomeric Impression Materials.

PubMed

Pal, P K; Kamble, Suresh S; Chaurasia, Ranjitkumar Rampratap; Chaurasia, Vishwajit Rampratap; Tiwari, Samarth; Bansal, Deepak

2014-06-01

The present study was done to evaluate the dimensional stability and surface quality of Type IV gypsum casts retrieved from disinfected elastomeric impression materials. In an in vitro study contaminated impression material with known bacterial species was disinfected with disinfectants followed by culturing the swab sample to assess reduction in level of bacterial colony. Changes in surface detail reproduction of impression were assessed fallowing disinfection. All the three disinfectants used in the study produced a 100% reduction in colony forming units of the test organisms. All the three disinfectants produced complete disinfection, and didn't cause any deterioration in surface detail reproduction. How to cite the article: Pal PK, Kamble SS, Chaurasia RR, Chaurasia VR, Tiwari S, Bansal D. Evaluation of dimensional stability and surface quality of type IV gypsum casts retrieved from disinfected elastomeric impression materials. J Int Oral Health 2014;6(3):77-81.

Biomarker for Glycogen Storage Diseases

ClinicalTrials.gov

2017-07-03

Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

Spectrophotometric Measurement of Minimal Erythema Dose Sites after Narrowband Ultraviolet B Phototesting: Clinical Implication of Spetrophotometric Values in Phototherapy

PubMed Central

Jeon, Su-Young; Lee, Chae-Young; Song, Ki-Hoon

2014-01-01

Background The spectrophotometer is well known to be a useful tool for estimating the objective minimal erythema dose (MED) during planning of phototherapy protocol. However, only a few spectrophotometric values are used to evaluate the erythema and pigmentation of the MED site during phototesting. Objective To determinea new meaning of the relationships among spectrophotometric values during phototesting. Methods Twenty-five patients with psoriasis and 23 patients with vitiligo were selected before undergoing narrowband ultraviolet B phototherapy. We interpreted the gross findings of erythema and measured the L*a*b* values using a spectrophotometer at each phototest spot. We compared MEDs, basic spectrophotometric values (L*a*b*), and b*/L* values separately according to skin type, and determined the correlation of each spectrophotometric value and the correlation between a* and b*/L* values. Results Among L*a*b* values, only b* values showed a statistically significant difference between the type III and IV groups (p=0.003). There was a positive correlation only between MEDs and b* values (p<0.05). The average b*/L*value in the type IV group was significantly higher than the type III group (p<0.05). Conclusion The higher b* values in type IV skin indicates that skin tanning develops more prominently than type III. The correlation between MEDs and b* values may signify that the skin pigmentation status is deepened with the higher MEDs. The difference in b*/L*values between type III and IV skin reflects that the b*/L*value is thought to be an index of tanning. The a* value, known as an index of erythema, does not influence the degree of tanning. PMID:24648682

Self aligned hysteresis free carbon nanotube field-effect transistors

NASA Astrophysics Data System (ADS)

Shlafman, M.; Tabachnik, T.; Shtempluk, O.; Razin, A.; Kochetkov, V.; Yaish, Y. E.

2016-04-01

Hysteresis phenomenon in the transfer characteristics of carbon nanotube field effect transistor (CNT FET) is being considered as the main obstacle for successful realization of electronic devices based on CNTs. In this study, we prepare four kinds of CNTFETs and explore their hysteretic behavior. Two kinds of devices comprise on-surface CNTs (type I) and suspended CNTs (type II) with thin insulating layer underneath and a single global gate which modulates the CNT conductance. The third and fourth types (types III and IV) consist of suspended CNT over a metallic local gate underneath, where for type IV the local gate was patterned self aligned with the source and drain electrodes. The first two types of devices, i.e., type I and II, exhibit substantial hysteresis which increases with scanning range and sweeping time. Under high vacuum conditions and moderate electric fields ( |E |>4 ×106 V /cm ), the hysteresis for on-surface devices cannot be eliminated, as opposed to suspended devices. Interestingly, type IV devices exhibit no hysteresis at all at ambient conditions, and from the different roles which the global and local gates play for the four types of devices, we could learn about the hysteresis mechanism of this system. We believe that these self aligned hysteresis free FETs will enable the realization of different electronic devices and sensors based on CNTs.

The human clone ST22 SCCmec IV methicillin-resistant Staphylococcus aureus isolated from swine herds and wild primates in Nepal: is man the common source?

PubMed

Roberts, Marilyn C; Joshi, Prabhu Raj; Greninger, Alexander L; Melendez, Daira; Paudel, Saroj; Acharya, Mahesh; Bimali, Nabin Kishor; Koju, Narayan P; No, David; Chalise, Mukesh; Kyes, Randall C

2018-05-01

Swine nasal samples [n = 282] were collected from 12 randomly selected farms around Kathmandu, Nepal, from healthy animals. In addition, wild monkey (Macaca mulatta) saliva samples [n = 59] were collected near temples areas in Kathmandu using a non-invasive sampling technique. All samples were processed for MRSA using standardized selective media and conventional biochemical tests. MRSA verification was done and isolates characterized by SCCmec, multilocus sequence typing, whole genome sequencing [WGS] and antibiotic susceptibilities. Six (2.1%) swine MRSA were isolated from five of the different swine herds tested, five were ST22 type IV and one ST88 type V. Four (6.8%) macaques MRSA were isolated, with three ST22 SCCmec type IV and one ST239 type III. WGS sequencing showed that the eight ciprofloxacin resistant ST22 isolates carried gyrA mutation [S84L]. Six isolates carried the erm(C) genes, five isolates carried aacC-aphD genes and four isolates carried blaZ genes. The swine linezolid resistant ST22 did not carry any known acquired linezolid resistance genes but had a mutation in ribosomal protein L22 [A29V] and an insertion in L4 [68KG69], both previously associated with linezolid resistance. Multiple virulence factors were also identified. This is the first time MRSA ST22 SCCmec IV has been isolated from livestock or primates.

Immunohistochemical assessment of collagen types I, III, IV and VI in biopsy samples of the bovine uterine wall collected during the oestrous cycle.

PubMed

Boos, A

2000-01-01

Uterine biopsies were collected at cycle days 1 (oestrous), 8, 15 and 19 in six cows. Unfixed cryostat sections were used to immunolocalise collagen types I, III, IV and VI by an indirect FITC method. Collagen I was sparsely found in the endometrium where it formed a fine meshwork of thin fibres directly below the surface epithelium, clearly visible only at cycle days 8 and 15. Collagen III formed the bulk of connective tissue fibres and was arranged in fine aggregates within the superficial endometrial stroma, while in the deeper areas it consisted of many thick fibre bundles. Collagen IV was found in basement membranes underlying all endometrial epithelia. Furthermore, it surrounded smooth muscle cells of blood vessels. A few single fibrils also stained positively within the endometrial stroma, more numerous at cycle days 1 and 19 as compared to days 8 and 15. Collagen VI formed a mesh of fine and pericellularly situated fibrils within the endometrial stroma. The contribution of the collagen types studied to the connective tissue of caruncles, blood vessels, lymph follicles, and myometrium is also reported. The results of the present study indicate that the connective tissue of the bovine uterine wall is composed of different collagen types, which exhibit a characteristic distribution pattern each. The day of cycle may influence amounts and organisation of collagen types I and IV as demonstrated here at the light-microscopical level. Copyright 2000 S. Karger AG, Basel

Mutational Analysis of the QRRQ Motif in the Yeast Hig1 Type 2 Protein Rcf1 Reveals a Regulatory Role for the Cytochrome c Oxidase Complex*

PubMed Central

Garlich, Joshua; Strecker, Valentina; Wittig, Ilka; Stuart, Rosemary A.

2017-01-01

The yeast Rcf1 protein is a member of the conserved family of proteins termed the hypoxia-induced gene (domain) 1 (Hig1 or HIGD1) family. Rcf1 interacts with components of the mitochondrial oxidative phosphorylation system, in particular the cytochrome bc1 (complex III)-cytochrome c oxidase (complex IV) supercomplex (termed III-IV) and the ADP/ATP carrier proteins. Rcf1 plays a role in the assembly and modulation of the activity of complex IV; however, the molecular basis for how Rcf1 influences the activity of complex IV is currently unknown. Hig1 type 2 isoforms, which include the Rcf1 protein, are characterized in part by the presence of a conserved motif, (Q/I)X3(R/H)XRX3Q, termed here the QRRQ motif. We show that mutation of conserved residues within the Rcf1 QRRQ motif alters the interactions between Rcf1 and partner proteins and results in the destabilization of complex IV and alteration of its enzymatic properties. Our findings indicate that Rcf1 does not serve as a stoichiometric component, i.e. as a subunit of complex IV, to support its activity. Rather, we propose that Rcf1 serves to dynamically interact with complex IV during its assembly process and, in doing so, regulates a late maturation step of complex IV. We speculate that the Rcf1/Hig1 proteins play a role in the incorporation and/or remodeling of lipids, in particular cardiolipin, into complex IV and. possibly, other mitochondrial proteins such as ADP/ATP carrier proteins. PMID:28167530

Impact of Type of Needle on Incidence of Intravascular Injection During Diagnostic Lumbar Medial Branch Block.

PubMed

Joo, Young; Kim, Yong Chul; Lee, Sang Chul; Kim, Hye Young; Park, Keun Suk; Choi, Eun Joo; Moon, Jee Youn

2016-01-01

Intravascular (IV) injection of local anesthetics is a potential cause of false-negative results after lumbar medial branch nerve blockade (L-MBB) performed to diagnose facetogenic back pain. The aim of the present study was to identify the relationship between the needle type and the incidence of IV injection in patients undergoing L-MBB using fluoroscopy with digital subtraction imaging (DSI). In this prospective randomized study, we compared the incidence of IV uptake of contrast medium using the Quincke needle and Whitacre needle under real-time DSI during L-MBB. Clinical and demographic factors associated with the occurrence of IV uptake were also investigated. In total, 126 patients were randomized into the Quincke needle group (n = 62) and Whitacre needle group (n = 64). Intravascular uptake of contrast medium was observed in 66 (9.8%) of 671 L-MBB procedures under DSI. The incidence of IV uptake was 13.9% (47/338) using the Quincke needle and 5.7% (19/333) using the Whitacre needle. In the multivariate generalized estimating equations analysis, use of a Quincke needle was related to positive IV injection at a 1.898-fold higher rate than was use of a Whitacre needle (95% confidence interval, 1.025-3.516) and a positive aspiration test predicted IV injection at a 21.735-fold higher rate (95% confidence interval, 11.996-52.258). Lumbar medial branch nerve blockade using the Quincke needle was associated with a 1.9-fold higher rate of IV injection than was L-MBB using the Whitacre needle under DSI. Although further study is needed to confirm the clinical efficacy, Whitacre needles can be considered to reduce the risk of IV injection during L-MBB.

Shifts in the Clonal Distribution of Methicillin-Resistant Staphylococcus aureus in Kuwait Hospitals: 1992-2010

PubMed Central

Boswihi, Samar S.; Udo, Edet E.; Al-Sweih, Noura

2016-01-01

Background As the epidemiology of methicillin-resistant Staphylococcus aureus (MRSA) is constantly changing globally, determining the prevailing MRSA clones in a local healthcare facility is important for better management of infections. This study investigated clonal composition and distribution of MRSA isolates in Kuwait’s hospitals using a combination of molecular typing methods. Materials and Methods In total, 400 non-repeat MRSA isolates were obtained between 1992 and 2010 in 13 public hospitals and were characterized using antibiogram, SCCmec typing, spa typing, and multilocus-sequence typing. Clonal assignment and detection of virulence factors and antibiotic resistance genes were performed by DNA microarray. Results The isolates were resistant to kanamycin (74.2%), erythromycin (69.5%), tetracycline (66.7%), gentamicin (61%), ciprofloxacin, (61%), fusidic acid (53.5%), clindamycin (41.5%), high-level mupirocin resistance (5.2%) and carried aphA3, aacA-aphD, ermA, ermC, mupA, tetK, tetM, fusC and far1. Molecular typing revealed 31 different MRSA clones consisting of ST239-MRSA-III (52.2%), ST22-MRSA-IV (9.2%), ST80-MRSA-IV (7.5%), ST5-MRSA-II/IV/V/VI (6.5%), ST30-MRSA-IV (3.5%), ST241-MRSA-III (2.7%), ST6-MRSA-IV (2.2%), ST36-MRSA-II (2%) and ST772-MRSA-V (1.75%). The isolates differed in the carriage of genes for enterotoxins, Panton–Valentine leukocidin (PVL), toxic shock syndrome toxin (tst-1), arginine catabolic mobile element (ACME) and exfoliative toxins. The number of clones increased from one (ST239-III-t037) in 1992 to 30 in 2010 including ST8-IV-t008 [PVL+] [ACME+] (USA300), ST772-V (Bengal Bay clone) and ST2816 identified for the first time in Kuwait. Conclusion The study revealed that the MRSA isolates belonged to diverse clones that changed in numbers and diversity overtime. Although ST239-MRSA-III, a healthcare-associated clone remained the dominant MRSA clone overtime, the newly emerged clones consisted mostly of community-associated. PMID:27631623

Community-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complex 80 Type IV (CC80-MRSA-IV) Isolated from the Middle East: A Heterogeneous Expanding Clonal Lineage

PubMed Central

Harastani, Houda H.; Tokajian, Sima T.

2014-01-01

Background The emergence of community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) has caused a change in MRSA epidemiology worldwide. In the Middle East, the persistent spread of CA-MRSA isolates that were associated with multilocus sequence type (MLST) clonal complex 80 and with staphylococcal cassette chromosome mec (SCCmec) type IV (CC80-MRSA-IV), calls for novel approaches for infection control that would limit its spread. Methodology/Principal Findings In this study, the epidemiology of CC80-MRSA-IV was investigated in Jordan and Lebanon retrospectively covering the period from 2000 to 2011. Ninety-four S. aureus isolates, 63 (67%) collected from Lebanon and 31 (33%) collected from Jordan were included in this study. More than half of the isolates (56%) were associated with skin and soft tissue infections (SSTIs), and 73 (78%) were Panton-Valentine Leukocidin (PVL) positive. Majority of the isolates (84%) carried the gene for exofoliative toxin d (etd), 19% had the Toxic Shock Syndrome Toxin-1 gene (tst), and seven isolates from Jordan had a rare combination being positive for both tst and PVL genes. spa typing showed the prevalence of type t044 (85%) and pulsed-field gel electrophoresis (PFGE) recognized 21 different patterns. Antimicrobial susceptibility testing showed the prevalence (36%) of a unique resistant profile, which included resistance to streptomycin, kanamycin, and fusidic acid (SKF profile). Conclusions The genetic diversity among the CC80 isolates observed in this study poses an additional challenge to infection control of CA-MRSA epidemics. CA-MRSA related to ST80 in the Middle East was distinguished in this study from the ones described in other countries. Genetic diversity observed, which may be due to mutations and differences in the antibiotic regimens between countries may have led to the development of heterogeneous strains. Hence, it is difficult to maintain “the European CA-MRSA clone” as a uniform clone and it is better to designate as CC80-MRSA-IV isolates. PMID:25078407

Navy Family Advocacy Program. Appendix. Analysis of Central Registry Reports.

DTIC Science & Technology

1983-12-01

2/76) 2 Suspected Abuzso/Malect/Sexua1 Assault an ae2404 65.) "Suspected Abuso /Neglect/ Sexual Assault and Rape Report" 2226 60.5 NAVMED 6320/15A...ANALYSIS OF SEXUAL ASSAULT REPORTS ........... 50 HAPTER V: SUMAY ANALYSIS Or rAMILY ADVOCACY PROGRAM REPORTS . 56 APPENDIX...cont’d)I PAGE CHAPTER IV: SEXUAL ASSAULT TV-1 Fore . . . . . . . . . . . . . . . . . . . . . 51 IV-2 Type of Maltreatment ............... 53 IV-3

Involvement of DPP IV/CD26 in cutaneous wound healing process in mice.

PubMed

Baticic Pucar, Lara; Pernjak Pugel, Ester; Detel, Dijana; Varljen, Jadranka

2017-01-01

Dipeptidyl peptidase IV (DPP IV/CD26) is a widely distributed multifunctional protein that plays a significant role in different physiological as well as pathological processes having a broad spectrum of bioactive substrates and immunomodulative properties. It has potential influence on different processes crucial for wound healing, including cell adhesion, migration, apoptosis, and extracellular matrix degradation. However, despite its known enzymatic and immunomodulative functions, limited data characterize the role of DPP IV/CD26 in cutaneous wound healing mechanisms. The aim of this study was to investigate the process of wound healing in conditions of CD26 deficiency in order to obtain better insights on the role of DPP IV/CD26 in cutaneous regeneration. Experimental wounds were made on the dorsal part of CD26 deficient (CD26 -/- ) and wild-type mice (C57BL/6). The process of cutaneous wound healing was monitored on defined time schedule postwounding by macroscopic, microscopic, and biochemical analyses. Obtained results revealed a better rate of wound closure, revascularization and cell proliferation in CD26 -/- mice, with enhanced local expression of hypoxia-inducible factor 1α and vascular endothelial growth factor. CD26 deficiency induced prompt macrophage recruitment at the site of skin damage but did not influence mobilization of T-cells in comparison with wild-type mice. CD26 -/- mice have significantly higher values of IP-10 in serum and control skins compared with wild-type mice but values in wounds did not differ significantly on days 2, 4, and 7 of wound healing. DPP IV/CD26 activity was found to be decreased 4 days postwounding in serum and 2, 4, and 7 days postwounding in wounds of wild-type animals compared with control skins. These findings contribute to better understanding of wound healing mechanisms and could give a support in finding new therapeutic approaches for wound healing and tissue regeneration. © 2016 by the Wound Healing Society.

United States Air Force Summer Faculty Research Program (1986). Program Technical Report. Volume 3

DTIC Science & Technology

1986-12-01

Engineering University of New Mexico Assigned: WL Albuquerque, NM 87131 (505) 271-6296 Dr. Roy M. Ventullo Degree: Ph.D., Microbiology, 1978 Associate...from Holloman Air Force Base, New Mexico . The figure includes the altitude and azimuth of each satellite. (Courtesy of Rockwell Collins) IV AFGL...energy systems over the past six years. I served as Manager of Solar Electric Projects at the New Mexico Solar Energy Institute prior to my recent move

Clinical and radiographic outcomes of femoral head fractures: excision vs. fixation of fragment in Pipkin type I: what is the optimal choice for femoral head fracture?

PubMed

Park, Kyung-Soon; Lee, Keun-Bae; Na, Bo-Ram; Yoon, Taek-Rim

2015-07-01

In this work, we present relatively long-term results of femoral head fractures with a specific focus on Pipkin type I fractures. Fifty-nine femoral head fractures were treated according to modified Pipkin's classification as follows: type I, small fragment distal to the fovea centralis (FC); type II, large fragment distal to the FC; type III, large fragment proximal to the FC; type IV, comminuted fracture. There were 15 cases of type I, 28 of type II, 9 of type III, and 7 of type IV fractures. Conservative treatment with skeletal traction was performed in 4 type II cases, excision of the fragment in 15 type I and 10 type II cases, fixation of the fragment in 14 type II and all 9 type III cases, and total hip replacement in all 7 type IV cases. The overall clinical and radiographic outcomes were evaluated using previously published criteria, focusing on the results in Pipkin type I fractures with relatively large fragments. Based on Epstein criteria, in type II fractures, excellent or good clinical results were seen in 6 of 10 patients (60.0 %) treated by excision of the fragment and 12 of 14 patients (85.7 %) treated by internal fixation (p = 0.05). Also, excellent or good radiologic results were seen in 4 of 10 (40.0 %) patients treated by excision of the fragment and 12 of 14 (85.7 %) patients treated by internal fixation (p = 0.03). Even in Pipkin type I fractures, if the fragment is large (modified Pipkin type II), early reduction and internal fixation can produce good results.

Moving House for Education in the Pre-School Years

ERIC Educational Resources Information Center

Hansen, Kirstine

2014-01-01

This paper uses data from the Millennium Cohort Study (MCS) to examine house moves that take place in the pre-school years, focusing on families who move for the education of their children. We present results showing that education- related house moves do indeed occur in the pre-school years with particular types of parents making these…

[Alcohol-related cognitive impairment and the DSM-5].

PubMed

Walvoort, S J W; Wester, A J; Doorakkers, M C; Kessels, R P C; Egger, J I M

2016-01-01

It is evident from the dsm-iv-tr that alcohol-related impairment is extremely difficult to classify accurately. As a result, cognitive deficits can easily be overlooked. The dsm-5, however, incorporates a new category, namely 'neurocognitive disorders', which may lead to significant improvements in clinical practice. To compare the classification of alcohol-related cognitive dysfunction in dsm-iv-tr and dsm-5 and to discuss the clinical relevance of the revised classification in the dsm-5. We compare the chapters of the dsm-iv-tr and the dsm-5 concerning alcohol-related cognitive impairment and describe the changes that have been made. The dsm-5 puts greater emphasis on alcohol-related neurocognitive impairment. Not only does dsm-5 distinguish between the degree of severity (major or minor neurocognitive disorder), it also distinguishes between the type of impairment (non-amnestic-type versus confabulating-amnestic type). It also makes a distinction between the durations of impairment (behavioural and/or persistent disorders). The dsm-5 gives a clearer description of alcohol-related neurocognitive dysfunction than does dsm-iv-tr and it stresses the essential role of neuropsychological assessment in the classification, diagnosis, and treatment of neurocognitive disorders.

Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis

PubMed Central

Luvan, M; Roshan, G; Saw, A

2015-01-01

Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy. PMID:28611907

The Molecular Epidemiology of the Highly Virulent ST93 Australian Community Staphylococcus aureus Strain

PubMed Central

Coombs, Geoffrey W.; Goering, Richard V.; Chua, Kyra Y. L.; Monecke, Stefan; Howden, Benjamin P.; Stinear, Timothy P.; Ehricht, Ralf; O’Brien, Frances G.; Christiansen, Keryn J.

2012-01-01

In Australia the PVL - positive ST93-IV [2B], colloquially known as “Queensland CA-MRSA” has become the dominant CA-MRSA clone. First described in the early 2000s, ST93-IV [2B] is associated with skin and severe invasive infections including necrotizing pneumonia. A singleton by multilocus sequence typing (MLST) eBURST analysis ST93 is distinct from other S aureus clones. To determine if the increased prevalence of ST93-IV [2B] is due to the widespread transmission of a single strain of ST93-IV [2B] the genetic relatedness of 58 S. aureus ST93 isolated throughout Australia over an extended period were studied in detail using a variety of molecular methods including pulsed-field gel electrophoresis, spa typing, MLST, microarray DNA, SCCmec typing and dru typing. Identification of the phage harbouring the lukS-PV/lukF-PV Panton Valentine leucocidin genes, detection of allelic variations in lukS-PV/lukF-PV, and quantification of LukF-PV expression was also performed. Although ST93-IV [2B] is known to have an apparent enhanced clinical virulence, the isolates harboured few known virulence determinants. All PVL-positive isolates carried the PVL-encoding phage ΦSa2USA and the lukS-PV/lukF-PV genes had the same R variant SNP profile. The isolates produced similar expression levels of LukF-PV. Although multiple rearrangements of the spa sequence have occurred, the core genome in ST93 is very stable. The emergence of ST93-MRSA is due to independent acquisitions of different dru-defined type IV and type V SCCmec elements in several spa-defined ST93-MSSA backgrounds. Rearrangement of the spa sequence in ST93-MRSA has subsequently occurred in some of these strains. Although multiple ST93-MRSA strains were characterised, little genetic diversity was identified for most isolates, with PVL-positive ST93-IVa [2B]-t202-dt10 predominant across Australia. Whether ST93-IVa [2B] t202-dt10 arose from one PVL-positive ST93-MSSA-t202, or by independent acquisitions of SCCmec-IVa [2B]-dt10 into multiple PVL-positive ST93-MSSA-t202 strains is not known. PMID:22900085

Actin homolog MreB affects chromosome segregation by regulating topoisomerase IV in Escherichia coli.

PubMed

Madabhushi, Ram; Marians, Kenneth J

2009-01-30

In Escherichia coli, topoisomerase IV, a type II topoisomerase, mediates the resolution of topological linkages between replicated daughter chromosomes and is essential for chromosome segregation. Topo IV activity is restricted to only a short interval late in the cell cycle. However, the mechanism that confers this temporal regulation is unknown. Here we report that the bacterial actin homolog MreB participates in the temporal oscillation of Topo IV activity. We show that mreB mutant strains are deficient in Topo IV activity. In addition, we demonstrate that, depending upon whether it is in a monomeric or polymerized state, MreB affects Topo IV activity differentially. In addition, MreB physically interacts with the ParC subunit of Topo IV. Together, these results may explain how dynamics of the bacterial cytoskeleton are coordinated with the timing of chromosome segregation.

Respirator Performance against Nanoparticles under Simulated Workplace Activities

PubMed Central

Vo, Evanly; Zhuang, Ziqing; Horvatin, Matthew; Liu, Yuewei; He, Xinjian; Rengasamy, Samy

2017-01-01

Filtering facepiece respirators (FFRs) and elastomeric half-mask respirators (EHRs) are commonly used by workers for protection against potentially hazardous particles, including engineered nanoparticles. The purpose of this study was to evaluate the performance of these types of respirators against 10–400 nm particles using human subjects exposed to NaCl aerosols under simulated workplace activities. Simulated workplace protection factors (SWPFs) were measured for eight combinations of respirator models (2 N95 FFRs, 2 P100 FFRs, 2 N95 EHRs, and 2 P100 EHRs) worn by 25 healthy test subjects (13 females and 12 males) with varying face sizes. Before beginning a SWPF test for a given respirator model, each subject had to pass a quantitative fit test. Each SWPF test was performed using a protocol of six exercises for 3 min each: (i) normal breathing, (ii) deep breathing, (iii) moving head side to side, (iv) moving head up and down, (v) bending at the waist, and (vi) a simulated laboratory-vessel cleaning motion. Two scanning mobility particle sizers were used simultaneously to measure the upstream (outside the respirator) and downstream (inside the respirator) test aerosol; SWPF was then calculated as a ratio of the upstream and downstream particle concentrations. In general, geometric mean SWPF (GM-SWPF) was highest for the P100 EHRs, followed by P100 FFRs, N95 EHRs, and N95 FFRs. This trend holds true for nanoparticles (10–100 nm), larger size particles (100–400 nm), and the ‘all size’ range (10–400 nm). All respirators provided better or similar performance levels for 10–100 nm particles as compared to larger 100–400 nm particles. This study found that class P100 respirators provided higher SWPFs compared to class N95 respirators (P<0.05) for both FFR and EHR types. All respirators provided expected performance (i.e. fifth percentile SWPF > 10) against all particle size ranges tested. PMID:26180261

The conveyor belt hypothesis for thymocyte migration: participation of adhesion and de-adhesion molecules.

PubMed

Villa-Verde, D M; Calado, T C; Ocampo, J S; Silva-Monteiro, E; Savino, W

1999-05-01

Thymocyte differentiation is the process by which bone marrow-derived precursors enter the thymus, proliferate, rearrange the genes and express the corresponding T cell receptors, and undergo positive and/or negative selection, ultimately yielding mature T cells that will represent the so-called T cell repertoire. This process occurs in the context of cell migration, whose cellular and molecular basis is still poorly understood. Kinetic studies favor the idea that these cells leave the organ in an ordered pattern, as if they were moving on a conveyor belt. We have recently proposed that extracellular matrix glycoproteins, such as fibronectin, laminin and type IV collagen, among others, produced by non-lymphoid cells both in the cortex and in the medulla, would constitute a macromolecular arrangement allowing differentiating thymocytes to migrate. Here we discuss the participation of both molecules with adhesive and de-adhesive properties in the intrathymic T cell migration. Functional experiments demonstrated that galectin-3, a soluble beta-galactoside-binding lectin secreted by thymic microenvironmental cells, is a likely candidate for de-adhesion proteins by decreasing thymocyte interaction with the thymic microenvironment.

Serum Levels of Soluble CD26/Dipeptidyl Peptidase-IV in Type 2 Diabetes Mellitus and Its Association with Metabolic Syndrome and Therapy with Antidiabetic Agents in Malaysian Subjects.

PubMed

Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Muniandy, Sekaran

2015-01-01

A soluble form of CD26/dipeptidyl peptidase-IV (sCD26/DPP-IV) induces DPP-IV enzymatic activity that degrades incretin. We investigated fasting serum levels of sCD26/DPP-IV and active glucagon-like peptide-1 (GLP-1) in Malaysian patients with type 2 diabetes mellitus (T2DM) with and without metabolic syndrome (MetS), as well as the associations between sCD26/DPP-IV levels, MetS, and antidiabetic therapy. We assessed sCD26/DPP-IV levels, active GLP-1 levels, body mass index (BMI), glucose, insulin, A1c, glucose homeostasis indices, and lipid profiles in 549 Malaysian subjects (including 257 T2DM patients with MetS, 57 T2DM patients without MetS, 71 non-diabetics with MetS, and 164 control subjects without diabetes or metabolic syndrome). Fasting serum levels of sCD26/DPP-IV were significantly higher in T2DM patients with and without MetS than in normal subjects. Likewise, sCD26/DPP-IV levels were significantly higher in patients with T2DM and MetS than in non-diabetic patients with MetS. However, active GLP-1 levels were significantly lower in T2DM patients both with and without MetS than in normal subjects. In T2DM subjects, sCD26/DPP-IV levels were associated with significantly higher A1c levels, but were significantly lower in patients using monotherapy with metformin. In addition, no significant differences in sCD26/DPP-IV levels were found between diabetic subjects with and without MetS. Furthermore, sCD26/DPP-IV levels were negatively correlated with active GLP-1 levels in T2DM patients both with and without MetS. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-cholesterol (LDL-c) levels. Serum sCD26/DPP-IV levels increased in T2DM subjects with and without MetS. Active GLP-1 levels decreased in T2DM patients both with and without MetS. In addition, sCD26/DPP-IV levels were associated with Alc levels and negatively correlated with active GLP-1 levels. Moreover, metformin monotherapy was associated with reduced sCD26/DPP-IV levels. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-c.

Incidence of intravenous contrast extravasation: increased risk for patients with deep brachial catheter placement from the emergency department.

PubMed

Hardie, Andrew D; Kereshi, Borko

2014-06-01

Deep brachial intravenous catheter (IV) placement can be performed in emergency department patients with difficult vascular access, but the safety of deep brachial IV for iodinated contrast administration has not been assessed. This study compares the relative risk for extravasation of deep brachial IV compared with antecubital IV during power injected computed tomography (CT) examinations. A departmental practice quality improvement was performed to assess the rate of IV extravasation for all CT examinations during a 1 year period. De-identified data was analyzed with a waiver of informed consent to identify the rate and relative risk of iodinated contrast extravasation by catheter type. A total of 10,750 injections were performed, with 82 extravasation events (0.8 %). There were 51 extravasations of antecubital IV from approximately 8,599 placed (0.6 %). For 123 deep brachial IV placed, there were eight extravasations (6.5 %). The relative risk of a deep brachial IV extravasation was 9.4 compared to 0.4 for antecubital placement. Deep brachial IV demonstrated a markedly higher rate of contrast extravasation than antecubital IV. For power injected iodinated contrast administration, it is recommended to avoid the use of deep brachial IV whenever possible.

Initial Screening of Environmentally Sustainable Surface Pretreatments for Adhesive Bonding Applications

DTIC Science & Technology

2017-05-17

490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as bonding...sustainable TT-C-490F pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as...pretreatment was applied. Environmentally sustainable TT-C-490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during

Palliative treatment with radiation-emitting metallic stents in unresectable Bismuth type III or IV hilar cholangiocarcinoma.

PubMed

Lu, Jian; Guo, Jin-He; Zhu, Hai-Dong; Zhu, Guang-Yu; Wang, Yong; Zhang, Qi; Chen, Li; Wang, Chao; Pan, Tian-Fan; Teng, Gao-Jun

2017-01-01

The emerging data for stenting in combination with brachytherapy in unresectable hilar cholangiocarcinoma are encouraging. The aim of this study was to evaluate the efficacy and safety of radiation-emitting metallic stents (REMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma. Consecutive patients who underwent percutaneous placement with REMS or uncovered self-expandable metallic stent (SEMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma between September 2011 and April 2016 were identified into this retrospective study. Data on patient demographics and overall survival, functional success, stent patency and complications were collected at the authors' hospital. A total of 59 patients were included: 33 (55.9%) in the REMS group and 26 (44.1%) in the SEMS group. The median overall survival was 338 days in the REMS group and 141 days in the SEMS group (p<0.001). The median stent patency time was 385 days for REMS and 142 days for SEMS (p<0.001). The functional success rate (87.9% vs 84.6%, p=0.722) and incidence of overall complications (27.3% vs 26.9%, p=0.999) did not differ in the two groups. Placement with REMS is safe and effective in palliation for unresectable Bismuth type III or IV hilar cholangiocarcinoma, and seems to prolong survival as well as patency of stent in these patients.

Adult presentation of Bartter syndrome type IV with erythrocytosis

PubMed Central

Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

2015-01-01

Abstract Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis. PMID:26537508

An outbreak of post-partum breast abscesses in Mumbai, India caused by ST22-MRSA-IV: genetic characteristics and epidemiological implications

PubMed Central

MANOHARAN, A.; ZHANG, L.; POOJARY, A.; BHANDARKAR, L.; KOPPIKAR, G.; ROBINSON, D. A.

2012-01-01

SUMMARY A cluster of methicillin-resistant Staphylococcus aureus (MRSA) breast abscesses in women who had given birth at a hospital in Mumbai, India was investigated retrospectively. Nineteen of twenty cases were caused by a single clone: pvl-positive, spa type 648 (Ridom t852), ccrB:dru subtype 3:0, ST22-MRSA-IV. Despite the presence of pvl and SCCmec type IV, which are common genetic markers among community-associated MRSA, this outbreak was caused by a healthcare-associated, community-onset MRSA that was common in the hospital environment. Thus, infection control practices may have an important role in limiting the spread of this virulent clone. PMID:22475374

Finite element analysis of steady and transiently moving/rolling nonlinear viscoelastic structure. II - Shell and three-dimensional simulations

NASA Technical Reports Server (NTRS)

Kennedy, Ronald; Padovan, Joe

1987-01-01

In a three-part series of papers, a generalized finite element solution strategy is developed to handle traveling load problems in rolling, moving and rotating structure. The main thrust of this section consists of the development of three-dimensional and shell type moving elements. In conjunction with this work, a compatible three-dimensional contact strategy is also developed. Based on these modeling capabilities, extensive analytical and experimental benchmarking is presented. Such testing includes traveling loads in rotating structure as well as low- and high-speed rolling contact involving standing wave-type response behavior. These point to the excellent modeling capabilities of moving element strategies.

Diagnostic accuracy of level IV portable sleep monitors versus polysomnography for obstructive sleep apnea: a systematic review and meta-analysis.

PubMed

Abrahamyan, Lusine; Sahakyan, Yeva; Chung, Suzanne; Pechlivanoglou, Petros; Bielecki, Joanna; Carcone, Steven M; Rac, Valeria E; Fitzpatrick, Michael; Krahn, Murray

2018-01-09

Obstructive sleep apnea (OSA) is the most common sleep-related breathing disorder. In-laboratory, overnight type I polysomnography (PSG) is the current "gold standard" for diagnosing OSA. Home sleep apnea testing (HSAT) using portable monitors (PMs) is an alternative testing method offering better comfort and lower costs. We aimed to systematically review the evidence on diagnostic ability of type IV PMs compared to PSG in diagnosing OSA. Participants: patients ≥16 years old with symptoms suggestive of OSA;intervention: type IV PMs (devices with < 2 respiratory channels); comparator: in-laboratory PSG; outcomes: diagnostic accuracy measures;studies: cross-sectional, prospective observational/experimental/quasi-experimental studies; information sources: MEDLINE and Cochrane Library from January 1, 2010 to May 10, 2016. All stages of review were conducted independently by two investigators. We screened 6054 abstracts and 117 full-text articles to select 24 full-text articles for final review. These 24 studies enrolled a total of 2068 patients with suspected OSA and evaluated 10 different PMs with one to six channels. Only seven (29%) studies tested PMs in the home setting. The mean difference (bias) between PSG-measured and PM-measured apnea-hypopnea index (AHI) ranged from - 14.8 to 10.6 events/h. At AHI ≥ 5 events/h, the sensitivity of type IV PMs ranged from 67.5-100% and specificity ranged from 25 to 100%. While current evidence is not very strong for the stand-alone use of level IV PMs in clinical practice, they can potentially widen access to diagnosis and treatment of OSA. Policy recommendations regarding HSAT use should also consider the health and broader social implications of false positive and false negative diagnoses.

Risk-Informed Mean Recurrence Intervals for Updated Wind Maps in ASCE 7-16.

PubMed

McAllister, Therese P; Wang, Naiyu; Ellingwood, Bruce R

2018-05-01

ASCE 7 is moving toward adopting load requirements that are consistent with risk-informed design goals characteristic of performance-based engineering (PBE). ASCE 7-10 provided wind maps that correspond to return periods of 300, 700, and 1,700 years for Risk Categories I, II, and combined III/IV, respectively. The risk targets for Risk Categories III and IV buildings and other structures (designated as essential facilities) are different in PBE. The reliability analyses reported in this paper were conducted using updated wind load data to (1) confirm that the return periods already in ASCE 7-10 were also appropriate for risk-informed PBE, and (2) to determine a new risk-based return period for Risk Category IV. The use of data for wind directionality factor, K d , which has become available from recent wind tunnel tests, revealed that reliabilities associated with wind load combinations for Risk Category II structures are, in fact, consistent with the reliabilities associated with the ASCE 7 gravity load combinations. This paper shows that the new wind maps in ASCE 7-16, which are based on return periods of 300, 700, 1,700, and 3,000 years for Risk Categories I, II, III, and IV, respectively), achieve the reliability targets in Section 1.3.1.3 of ASCE 7-16 for nonhurricane wind loads.

The effect of dipeptidyl peptidase-IV inhibition on bone in a mouse model of type 2 diabetes

PubMed Central

Gallagher, Emily Jane; Sun, Hui; Kornhauser, Caroline; Tobin-Hess, Aviva; Epstein, Sol; Yakar, Shoshana; LeRoith, Derek

2017-01-01

Background Individuals with type 2 diabetes (T2D) are at greater risk of bone fractures than those without diabetes. Certain oral diabetic medications may further increase the risk of fracture. Dipeptidyl peptidase-IV (DPP-IV) inhibitors are incretin-based therapies that are being increasingly used for the management of T2D. It has been hypothesized that these agents may reduce fracture risk in those with T2D. In this study, we used a mouse model of T2D to examine the effects of the DPP-IV inhibitor, MK-0626, on bone. Methods Male wild type (WT) and diabetic muscle-lysine-arginine (MKR) mice were treated with MK-0626, pioglitazone, alendronate or vehicle. The effects of treatment with MK-0626 on bone microarchitecture and turnover were compared with treatment with pioglitazone, alendronate and vehicle. Osteoblast differentiation was determined by alkaline phosphatase staining of bone marrow cells from WT and MKR mice after treatment with pioglitazone, MK-0626 or phosphate buffered saline. Results We found that MK-0626 had neutral effects on cortical and trabecular bone in diabetic mice. Pioglitazone had detrimental effects on the trabecular bone of WT but not of diabetic mice. Alendronate caused improvements in cortical and trabecular bone architecture in diabetic and WT mice. MK-0626 did not alter osteoblast differentiation, but pioglitazone impaired osteoblast differentiation in vitro. Conclusions Overall, the DPP-IV inhibitor, MK-0626, had no adverse effects on bone in an animal model of T2D or directly on osteoblasts in culture. These findings are reassuring as DPP-IV inhibitors are being widely used to treat patients with T2D who are already at an increased risk of fractures. PMID:24023014

Proline residues in transmembrane segment IV are critical for activity, expression and targeting of the Na+/H+ exchanger isoform 1.

PubMed Central

Slepkov, Emily R; Chow, Signy; Lemieux, M Joanne; Fliegel, Larry

2004-01-01

NHE1 (Na+/H+ exchanger isoform 1) is a ubiquitously expressed integral membrane protein that regulates intracellular pH in mammalian cells. Proline residues within transmembrane segments have unusual properties, acting as helix breakers and increasing flexibility of membrane segments, since they lack an amide hydrogen. We examined the importance of three conserved proline residues in TM IV (transmembrane segment IV) of NHE1. Pro167 and Pro168 were mutated to Gly, Ala or Cys, and Pro178 was mutated to Ala. Pro168 and Pro178 mutant proteins were expressed at levels similar to wild-type NHE1 and were targeted to the plasma membrane. However, the mutants P167G (Pro167-->Gly), P167A and P167C were expressed at lower levels compared with wild-type NHE1, and a significant portion of P167G and P167C were retained intracellularly, possibly indicating induced changes in the structure of TM IV. P167G, P167C, P168A and P168C mutations abolished NHE activity, and P167A and P168G mutations caused markedly decreased activity. In contrast, the activity of the P178A mutant was not significantly different from that of wild-type NHE1. The results indicate that both Pro167 and Pro168 in TM IV of NHE1 are required for normal NHE activity. In addition, mutation of Pro167 affects the expression and membrane targeting of the exchanger. Thus both Pro167 and Pro168 are strictly required for NHE function and may play critical roles in the structure of TM IV of the NHE. PMID:14680478

Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: a systematic review

PubMed Central

Abdulgader, Shima M.; Shittu, Adebayo O.; Nicol, Mark P.; Kaba, Mamadou

2015-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) infections are a serious global problem, with considerable impact on patients and substantial health care costs. This systematic review provides an overview on the clonal diversity of MRSA, as well as the prevalence of Panton-Valentine leukocidin (PVL)-positive MRSA in Africa. A search on the molecular characterization of MRSA in Africa was conducted by two authors using predefined terms. We screened for articles published in English and French through to October 2014 from five electronic databases. A total of 57 eligible studies were identified. Thirty-four reports from 15 countries provided adequate genotyping data. CC5 is the predominant clonal complex in the healthcare setting in Africa. The hospital-associated MRSA ST239/ST241-III [3A] was identified in nine African countries. This clone was also described with SCCmec type IV [2B] in Algeria and Nigeria, and type V [5C] in Niger. In Africa, the European ST80-IV [2B] clone was limited to Algeria, Egypt and Tunisia. The clonal types ST22-IV [2B], ST36-II [2A], and ST612-IV [2B] were only reported in South Africa. No clear distinctions were observed between MRSA responsible for hospital and community infections. The community clones ST8-IV [2B] and ST88-IV [2B] were reported both in the hospital and community settings in Angola, Cameroon, Gabon, Ghana, Madagascar, Nigeria, and São Tomé and Príncipe. The proportion of PVL-positive MRSA carriage and/or infections ranged from 0.3 to 100% in humans. A number of pandemic clones were identified in Africa. Moreover, some MRSA clones are limited to specific countries or regions. We strongly advocate for more surveillance studies on MRSA in Africa. PMID:25983721

Validity of DSM-IV attention–deficit/hyperactivity disorder symptom dimensions and subtypes

PubMed Central

Willcutt, Erik G.; Nigg, Joel T.; Pennington, Bruce F.; Solanto, Mary V.; Rohde, Luis A.; Tannock, Rosemary; Loo, Sandra K.; Carlson, Caryn L.; McBurnett, Keith; Lahey, Benjamin B.

2013-01-01

DSM-IV criteria for ADHD specify two dimensions of inattention and hyperactivity-impulsivity symptoms that are used to define three nominal subtypes: predominantly hyperactive-impulsive type (ADHD-H), predominantly inattentive type (ADHD-I), and combined type (ADHD-C). To aid decision-making for DSM-5 and other future diagnostic systems, a comprehensive literature review and meta-analysis of 546 studies was completed to evaluate the validity of the DSM-IV model of ADHD. Results indicated that DSM-IV criteria identify individuals with significant and persistent impairment in social, academic, occupational, and adaptive functioning when intelligence, demographic factors, and concurrent psychopathology are controlled. Available data overwhelmingly support the concurrent, predictive, and discriminant validity of the distinction between inattention and hyperactivity-impulsivity symptoms, and indicate that nearly all differences among the nominal subtypes are consistent with the relative levels of inattention and hyperactivity-impulsivity symptoms that define the subtypes. In contrast, the validity of the DSM-IV subtype model is compromised by weak evidence for the validity of ADHD-H after first grade, minimal support for the distinction between ADHD-I and ADHD-C in studies of etiological influences, academic and cognitive functioning, and treatment response, and the marked longitudinal instability of all three subtypes. Overall, it is concluded that the DSM-IV ADHD subtypes provide a convenient clinical shorthand to describe the functional and behavioral correlates of current levels of inattention and hyperactivity-impulsivity symptoms, but do not identify discrete subgroups with sufficient long-term stability to justify the classification of distinct forms of the disorder. Empirical support is stronger for an alternative model that would replace the subtypes with dimensional modifiers that reflect the number of inattention and hyperactivity-impulsivity symptoms at the time of assessment. PMID:22612200

Choice of intravenous antibiotic prophylaxis for colorectal surgery does matter.

PubMed

Deierhoi, Rhiannon J; Dawes, Lillian G; Vick, Catherine; Itani, Kamal M F; Hawn, Mary T

2013-11-01

The Surgical Care Improvement Program endorses mandatory compliance with approved intravenous prophylactic antibiotics; however, oral antibiotics are optional. We hypothesized that surgical site infection (SSI) rates may vary depending on the choice of antibiotic prophylaxis. A retrospective cohort study of elective colorectal procedures using Veterans Affairs Surgical Quality Improvement Program (VASQIP) and SSI outcomes data was linked to the Office of Informatics and Analytics (OIA) and Pharmacy Benefits Management (PBM) antibiotic data from 2005 to 2009. Surgical site infection rates by type of IV antibiotic agent alone (IV) or in combination with oral antibiotic (IV + OA) were determined. Generalized estimating equations were used to examine the association between type of antibiotic prophylaxis and SSI for the entire cohort and stratified by use of oral antibiotics. After 5,750 elective colorectal procedures, 709 SSIs (12.3%) developed within 30 days. Oral antibiotic + IV (n = 2,426) had a lower SSI rate than IV alone (n = 3,324) (6.3% vs 16.7%, p < 0.0001). There was a significant difference in the SSI rate based on type of preoperative IV antibiotic given (p ≤ 0.0001). Generalized estimating equations adjusting for significant covariates of age, body mass index, procedure work relative value units, and operation duration demonstrated an independent protective effect of oral antibiotics (odds ratio [OR] 0.37, 95% CI 0.29 to 0.46), as well as increased rates of SSI associated with ampicillin/sulbactam (OR 2.21, 95% CI 1.37 to 3.56) and second generation cephalosporins (cefoxitin, OR 2.50, 95% CI 1.83 to 3.42; cefotetan, OR 2.70, 95% CI 1.72 to 4.22) when compared with first generation cephalosporin/metronidazole. The choice of IV antibiotic was related to the SSI rate; however, oral antibiotics were associated with reduced SSI rate for every antibiotic class. Published by Elsevier Inc.

Influence of hospital type on survival in stage IV colorectal cancer.

PubMed

Hoshino, Nobuaki; Hasegawa, Suguru; Hida, Koya; Kawada, Kenji; Okamura, Ryosuke; Hamada, Madoka; Munemoto, Yoshinori; Sakai, Yoshiharu; Watanabe, Masahiko

2016-08-01

Hospital factors along with various patient and surgeon factors are considered to affect the prognosis of colorectal cancer. Hospital volume is well known, but little is known regarding other hospital factors. We reviewed data on 853 patients with stage IV colorectal cancer who underwent elective palliative primary tumor resection between January 2006 and December 2007. To detect the hospital factors that could influence the prognosis of incurable colorectal cancer, the relationships between patient/hospital factors and overall survival were analyzed. Among hospital factors, hospital type (Group A: university hospital or cancer center; Group B: community hospital), hospital volume, and number of colorectal surgeons were examined. In univariate analysis, Group A hospitals showed significantly better prognosis than Group B hospitals (p = 0.034), while hospital volume and number of colorectal surgeons were not associated with overall survival. After adjustment for patient factors in multivariate analysis, hospital type was significantly associated with overall survival (hazard ratio: 1.31; 95 % confidence interval: 1.05-1.63; p = 0.016). However, there was no significant difference in short-term outcomes between hospital types. Hospital type was identified as a hospital factor that possibly affects the prognosis of stage IV colorectal cancer patients.

Negative Differential Resistance (NDR) frequency conversion with gain

NASA Technical Reports Server (NTRS)

Hwu, R. J.; Alm, R. W.; Lee, S. C.

1992-01-01

The dependence of the I-V characteristic of the negative differential resistance (NDR) devices on the power level and frequency of the rf input signal has been theoretically analyzed with a modified large- and small-signal nonlinear circuit analysis program. The NDR devices we used in this work include both the tunnel diode (without the antisymmetry in the I-V characteristic) and resonant-tunneling devices (with the antisymmetry in the I-V characteristic). Absolute negative conductance can be found from a zero-biased resonant tunneling device when the applied pump power is within a small range. This study verifies the work of Sollner et al. Variable negative conductances at the fundamental and harmonic frequencies can also be obtained from both the unbiased and biased tunnel diodes. The magnitude of the negative conductances can be adjusted by varying the pump amplitude -- a very useful circuit property. However, the voltage range over which the negative conductance occurs moves towards the more positive side of the voltage axis with increasing frequency. Furthermore, the range of the pumping amplitude to obtain negative conductance varies with the parasitics (resistance and capacitance) of the device. The theoretical observation of the dependence of the I-V characteristic of the NDR devices on the power and frequency of the applied pump signal is supported by the experimental results. In addition, novel functions of a NDR device such as self-oscillating frequency multiplier and mixer with gain have been experimentally demonstrated. The unbiased oscillator have also been successfully realized with a NDR device with an antisymmetrical I-V characteristic. Finally, the applications of these device functions will be discussed.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Identification of type IV collagen exposure as a molecular imaging target for early detection of thoracic aortic dissection

PubMed Central

Xu, Ke; Xu, Chen; Zhang, Yanzhenzi; Qi, Feiran; Yu, Bingran; Li, Ping; Jia, Lixin; Li, Yulin; Xu, Fu-jian; Du, Jie

2018-01-01

Thoracic aortic dissection (TAD) is an aggressive and life-threatening vascular disease and there is no effective means of early diagnosis of dissection. Type IV collagen (Col-IV) is a major component of the sub-endothelial basement membrane, which is initially exposed followed by endothelial injury as early-stage event of TAD. So, we want to build a noninvasive diagnostic method to detect early dissection by identifying the exposed Col-IV via MRI. Methods: Col-IV-targeted magnetic resonance/ fluorescence dual probe (Col-IV-DOTA-Gd-rhodamine B; CDR) was synthesized by amide reaction and coordination reaction. Flow cytometry analysis was used to evaluate the cell viability of SMC treated with CDR and fluorescence assays were used to assess the Col-IV targeting ability of CDR in vitro. We then examined the sensitivity and specificity of CDR at different stages of TAD via MRI and bioluminescence imaging in vivo. Results: The localization of Col-IV (under the intima) was observed by histology images. CDR bound specifically to Col-IV-expressing vascular smooth muscle cells and BAPN-induced dissected aorta. The CDR signal was co-detected by magnetic resonance imaging (MRI) and bioluminescence imaging as early as 2 weeks after BAPN administration (pre-dissection stage). The ability to detect rupture of dissected aorta was indicated by a strong normalized signal enhancement (NSE) in vivo. Moreover, NSE was negatively correlated with the time of dissection rupture after BAPN administration (r2 = 0.8482). Conclusion: As confirmed by in vivo studies, the CDR can identify the exposed Col-IV in degenerated aorta to monitor the progress of aortic dissection from the early stage to the rupture via MRI. Thus, CDR-enhanced MRI proposes a potential method for dissection screening, and for monitoring disease progression and therapeutic response. PMID:29290819

Expression of heat shock protein 47 is increased in remnant kidney and correlates with disease progression

PubMed Central

SUNAMOTO, MASAAKI; KUZE, KOGO; IEHARA, NORIYUKI; TAKEOKA, HIROYA; NAGATA, KAZUHIRO; KITA, TORU; DOI, TOSHIO

1998-01-01

Glomerulosclerosis is characterized by accumulation of the mesangial extracellular matrix, including type I and IV collagen. The processing for the collagens in the glomeruli may play a critical role for development of glomerulosclerosis. We examined the expression of heat shock protein 47 (HSP47), a collagen-binding molecular chaperone in the progresive glomerulosclerosis model. Subtotally nephrectomized rats, unlike sham-operated rats, developed focal and segmental glomerulosclerosis. Immunological staining demonstrated an increased expression of HSP47 which paralleled the expression of type I and IV collagen in the glomeruli of the nephrectomized rats as the glomerulosclerosis developed. The mRNA levels encoding type I and type IV collagen and HSP47 were increased 3.4 fold, 3.6 fold and 2.8 fold, respectively, at week 7 after nephrectomy. By in situ hybridization, the expression of HSP47 mRNA was determined to be localized to the glomeruli with segmental sclerosis. These results suggest that HSP47 may play a central role in the process of extracellular matrix accumulation during the development of glomerulosclerosis. PMID:9741355

Hot Gas Lines in T Tauri Stars

NASA Astrophysics Data System (ADS)

Ardila, David R.; Herczeg, Gregory J.; Gregory, Scott G.; Ingleby, Laura; France, Kevin; Brown, Alexander; Edwards, Suzan; Johns-Krull, Christopher; Linsky, Jeffrey L.; Yang, Hao; Valenti, Jeff A.; Abgrall, Hervé; Alexander, Richard D.; Bergin, Edwin; Bethell, Thomas; Brown, Joanna M.; Calvet, Nuria; Espaillat, Catherine; Hillenbrand, Lynne A.; Hussain, Gaitee; Roueff, Evelyne; Schindhelm, Eric R.; Walter, Frederick M.

2013-07-01

For Classical T Tauri Stars (CTTSs), the resonance doublets of N V, Si IV, and C IV, as well as the He II 1640 Å line, trace hot gas flows and act as diagnostics of the accretion process. In this paper we assemble a large high-resolution, high-sensitivity data set of these lines in CTTSs and Weak T Tauri Stars (WTTSs). The sample comprises 35 stars: 1 Herbig Ae star, 28 CTTSs, and 6 WTTSs. We find that the C IV, Si IV, and N V lines in CTTSs all have similar shapes. We decompose the C IV and He II lines into broad and narrow Gaussian components (BC and NC). The most common (50%) C IV line morphology in CTTSs is that of a low-velocity NC together with a redshifted BC. For CTTSs, a strong BC is the result of the accretion process. The contribution fraction of the NC to the C IV line flux in CTTSs increases with accretion rate, from ~20% to up to ~80%. The velocity centroids of the BCs and NCs are such that V BC >~ 4 V NC, consistent with the predictions of the accretion shock model, in at most 12 out of 22 CTTSs. We do not find evidence of the post-shock becoming buried in the stellar photosphere due to the pressure of the accretion flow. The He II CTTSs lines are generally symmetric and narrow, with FWHM and redshifts comparable to those of WTTSs. They are less redshifted than the CTTSs C IV lines, by ~10 km s-1. The amount of flux in the BC of the He II line is small compared to that of the C IV line, and we show that this is consistent with models of the pre-shock column emission. Overall, the observations are consistent with the presence of multiple accretion columns with different densities or with accretion models that predict a slow-moving, low-density region in the periphery of the accretion column. For HN Tau A and RW Aur A, most of the C IV line is blueshifted suggesting that the C IV emission is produced by shocks within outflow jets. In our sample, the Herbig Ae star DX Cha is the only object for which we find a P-Cygni profile in the C IV line, which argues for the presence of a hot (105 K) wind. For the overall sample, the Si IV and N V line luminosities are correlated with the C IV line luminosities, although the relationship between Si IV and C IV shows large scatter about a linear relationship and suggests that TW Hya, V4046 Sgr, AA Tau, DF Tau, GM Aur, and V1190 Sco are silicon-poor, while CV Cha, DX Cha, RU Lup, and RW Aur may be silicon-rich.

Chondroitin sulphates A, B and C, collagen types I-IV and fibronectin in venous sinus of the red pulp in human spleen.

PubMed

Rovenská, E; Michalka, P; Papincák, J; Durdík, S; Jakubovský, J

2005-01-01

The morphological relationship of chondroitin sulphates A, B, and C, collagen types I-IV and fibronectin in the wall of venous sinuses of the red pulp in human spleen has not been a focus of interest among morphologists. Regarding the hypothesis that the structure of the spleen lends it the function of a blood filter the substances described in our study might play a significant role in the functional morphology. Of 146 human spleen surgical specimens, groups of 12 specimens each were examined under a light microscope using the method of antibodies against fibronectin, against collagen types I-IV and against chondroitin sulphates A, B, and C. The sections of the red pulp of human spleen stained with hematoxylin and eosin provided limited information about the wall of the sinuses. Chondroitin sulphates A and B were observed on the surface of sinus-lining cells (SLC), and fibronectin was detected on the surface of the annular fibers. Collagen type 11 was observed almost in the same places as chondroitin sulphates A and B. Collagen type IV was present in annular fibers of the wall of the sinus and in the basement membrane, like fibronectin. Chondroitin sulphate was not present in the walls of sinuses. Binding of antibodies against chondroitin sulphate A and against chondroitin sulphate B indicates the presence of chondroitin sulfates on the surface of SLC, where they probably play a role in helping the human organism to recognize alien and self substances. The presence of chondroitin,sulphates A and B probably affects inhibition of binding of cells with collagen type I, but not with fibronectin.

Association of history of allergies and influenza-like infections with laryngeal cancer in a case-control study.

PubMed

Filippidis, Filippos T; Schwartz, Stephen M; Becker, Nikolaus; Dyckhoff, Gerhard; Kirschfink, Michael; Dietz, Andreas; Becher, Heiko; Ramroth, Heribert

2015-08-01

Prior studies suggest that history of allergy and infections early in life might be inversely associated with cancer. We explored the association between allergies, recent influenza infections and laryngeal cancer risk. We used data from a case-control study which included 229 cases of laryngeal cancer and 769 population controls matched for age and sex. History of a physician-diagnosed allergy, influenza-like infections in the past 5 years, smoking, alcohol consumption and occupational exposure to carcinogens were self-reported. Allergies were classified into two groups (Type I and Type IV), according to the underlying immunologic mechanism. Conditional logistic regression models were fitted using laryngeal cancer as the outcome, adjusting for smoking, alcohol consumption and occupational exposure and stratified for age and sex. Having any allergy was not associated significantly with laryngeal cancer. Although Type I and Type IV allergies were non-significantly associated with laryngeal cancer, Type IV allergies showed a strong inverse association after adjusting for smoking and alcohol (OR 0.50, 95 % CI 0.22-1.2). Participants who reported at least one influenza-like infection during the past 5 years were significantly less likely to have laryngeal cancer (OR 0.57, 95 % CI 0.39-0.81). After considering fever (≥38.5 °C) as a criterion for influenza infection, the association between influenza infection and laryngeal cancer was even stronger (OR 0.29, 95 % CI 0.13-0.63). We found no significant association between any allergy and laryngeal cancer, some indication of an inverse association between Type IV allergy and laryngeal cancer, whereas recent influenza infections were inversely associated with laryngeal cancer risk.

Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases

PubMed Central

Charvin, G.; Bensimon, D.; Croquette, V.

2003-01-01

Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of ≈2.9 s–1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of ≈2.4 s–1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. PMID:12902541

L-arginine mediated renaturation enhances yield of human, α6 type IV collagen non-collagenous domain from bacterial inclusion bodies

PubMed Central

Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Akul Sudhakar, Yakkanti

2012-01-01

The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated. PMID:22512648

L-arginine mediated renaturation enhances yield of human, α6 Type IV collagen non-collagenous domain from bacterial inclusion bodies.

PubMed

Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Sudhakar, Yakkanti Akul

2012-10-01

The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated.

[Joint endoprosthesis pathology. Histopathological diagnostics and classification].

PubMed

Krenn, V; Morawietz, L; Jakobs, M; Kienapfel, H; Ascherl, R; Bause, L; Kuhn, H; Matziolis, G; Skutek, M; Gehrke, T

2011-05-01

Prosthesis durability has steadily increased with high 10-year rates of 88-95%. However, four pathogenetic groups of diseases can decrease prosthesis durability: (1) periprosthetic wear particle disease (aseptic loosening) (2) bacterial infection (septic loosening) (3) periprosthetic ossification, and (4) arthrofibrosis. The histopathological "extended consensus classification of periprosthetic membranes" includes four types of membranes, arthrofibrosis, and osseous diseases of endoprosthetics: The four types of neosynovia are: wear particle-induced type (type I), mean prosthesis durability (MPD) in years 12.0; infectious type (type II), MPD 2.5; combined type (type III) MPD 4.2; and indeterminate type (type IV), MPD 5.5. Arthrofibrosis can be determined in three grades: grade 1 needs clinical information to be differentiated from a type IV membrane, and grades 2 & 3 can be diagnosed histopathologically. Periprosthetic ossification, osteopenia-induced fractures, and aseptic osteonecrosis can be histopathologically diagnosed safely with clinical information. The extended consensus classification of periprosthetic membranes may be a diagnostic groundwork for a future national endoprosthesis register.

NATIONAL COASTAL CONDITION REPORT IV | Science ...

EPA Pesticide Factsheets

The National Coastal Condition Report IV (NCCR IV) is the fourth in a series of environmental assessments of U.S. coastal waters and the Great Lakes. The report includes assessments of all the nation’s estuaries in the contiguous 48 states and Puerto Rico, south-eastern Alaska, Hawaii, the U.S. Virgin Islands, Guam, and American Samoa. The NCCR IV presents four main types of data: (1) coastal monitoring data, (2) coastal ocean/ offshore monitoring data, (3) offshore fisheries data, and (4) assessment and advisory data (new to NCCR IV). The NCCR IV relies heavily on coastal monitoring data from EPA’s National Coastal Assessment (NCA) to assess coastal condition by evaluating five indicators of condition—water quality, sediment quality, benthic community condition, coastal habitat loss, and fish tissue contaminants. To assess and report on the condition of the nation's coastal resources

2- and 3-substituted imidazo[1,2-a]pyrazines as inhibitors of bacterial type IV secretion

PubMed Central

Sayer, James R.; Walldén, Karin; Pesnot, Thomas; Campbell, Frederick; Gane, Paul J.; Simone, Michela; Koss, Hans; Buelens, Floris; Boyle, Timothy P.; Selwood, David L.; Waksman, Gabriel; Tabor, Alethea B.

2014-01-01

A novel series of 8-amino imidazo[1,2-a]pyrazine derivatives has been developed as inhibitors of the VirB11 ATPase HP0525, a key component of the bacterial type IV secretion system. A flexible synthetic route to both 2- and 3-aryl substituted regioisomers has been developed. The resulting series of imidazo[1,2-a]pyrazines has been used to probe the structure–activity relationships of these inhibitors, which show potential as antibacterial agents. PMID:25438770

Moving Up the CMMI Capability and Maturity Levels Using Simulation

DTIC Science & Technology

2008-01-01

Alternative Process Tools, Including NPV and ROI 6 Figure 3: Top-Level View of the Full Life-Cycle Version of the IEEE 12207 PSIM, Including IV&V Layer 19...Figure 4: Screenshot of the Incremental Version Model 19 Figure 5: IEEE 12207 PSIM Showing the Top-Level Life-Cycle Phases 22 Figure 6: IEEE 12207 ...Software Detailed Design for the IEEE 12207 Life- Cycle Process 24 Figure 8: Incremental Life Cycle PSIM Configured for a Specific Project Using SEPG

InxGa1-xSb Channel p-Metal-Oxide-Semiconductor Field Effect Transistors: Effect of Strain and Heterostructure Design

DTIC Science & Technology

2011-07-06

biaxial compressive strain is known to split the light- and heavy-hole bands, reducing the interband scattering and causing the light hole band to move up...and heterostructure design are presented. In Section V, we use temperature- dependent measurements and pulsed I-V measurements to analyze the results...minimal in our devices. The temperature dependence of hole mobility was stud- ied for both the surface and buried channel devices, as plot- ted in Fig

Sfg

NASA Astrophysics Data System (ADS)

Fischer, R. X.; Baur, W. H.

This document is part of Subvolume E `Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes RON to STI' of Volume 14 `Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV `Physical Chemistry'.

Vet

NASA Astrophysics Data System (ADS)

Fischer, R. X.; Baur, W. H.

This document is part of Subvolume F 'Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes STO to ZON' of Volume 14 'Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV 'Physical Chemistry'.

Juvenile pityriasis rubra pilaris: report of 28 cases in Taiwan.

PubMed

Yang, Chao-Chun; Shih, I-Hsin; Lin, Wan-Lung; Yu, Yi-Sheng; Chiu, Hsien-Ching; Huang, Po-Han; Cheng, Yu-Wen; Lee, Julia Yu-Yun; Chen, WenChieh

2008-12-01

Pityriasis rubra pilaris (PRP) is a papulosquamous dermatosis uncommon in juveniles. Large-scale studies are limited, especially from Asian countries. We sought to analyze the clinical manifestations of juvenile PRP in Taiwanese patients and compare them with reported series in the literature. The diagnosis of juvenile PRP was made based on clinical-histopathologic correlation. The therapeutic response and disease course were followed up by re-examination of the patients or by telephone. A total of 47 patients were identified, with histopathologic confirmation of the clinical diagnosis of juvenile PRP in 28 cases. A preponderance of Griffiths' type IV PRP (85.7%) rather than type III PRP (14.3%) was found. Palmoplantar hyperkeratosis appeared to be a cardinal feature. In patients with type IV PRP, skin lesions in areas other than the elbows/knees and palms/soles were common. Treatment with systemic acitretin in 6 patients failed to effect a dose- or time-dependent improvement. In contrast with other studies, two thirds of our patients with type III and IV juvenile PRP had a protracted course lasting more than 3 years. This study was a retrospective review. Patient compliance with treatment was frequently poor. Type IV juvenile PRP predominated but our cases showed a wider distribution of skin lesions than is typically described. When children present with an acute onset of diffuse palmoplantar hyperkeratosis, a diagnosis of juvenile PRP should be considered. Because of the divergent clinical manifestations of juvenile PRP in different populations, there is a need to modify and re-evaluate classification systems based on regional differences.

Alternative Neisseria spp. type IV pilin glycosylation with a glyceramido acetamido trideoxyhexose residue

PubMed Central

Chamot-Rooke, Julia; Rousseau, Benoit; Lanternier, Fanny; Mikaty, Guillain; Mairey, Emilie; Malosse, Christian; Bouchoux, Guy; Pelicic, Vladimir; Camoin, Luc; Nassif, Xavier; Duménil, Guillaume

2007-01-01

The importance of protein glycosylation in the interaction of pathogenic bacteria with their host is becoming increasingly clear. Neisseria meningitidis, the etiological agent of cerebrospinal meningitis, crosses cellular barriers after adhering to host cells through type IV pili. Pilin glycosylation genes (pgl) are responsible for the glycosylation of PilE, the major subunit of type IV pili, with the 2,4-diacetamido-2,4,6-trideoxyhexose residue. Nearly half of the clinical isolates, however, display an insertion in the pglBCD operon, which is anticipated to lead to a different, unidentified glycosylation. Here the structure of pilin glycosylation was determined in such a strain by “top-down” MS approaches. MALDI-TOF, nanoelectrospray ionization Fourier transform ion cyclotron resonance, and nanoelectrospray ionization quadrupole TOF MS analysis of purified pili preparations originating from N. meningitidis strains, either wild type or deficient for pilin glycosylation, revealed a glycan mass inconsistent with 2,4-diacetamido-2,4,6-trideoxyhexose or any sugar in the databases. This unusual modification was determined by in-source dissociation of the sugar from the protein followed by tandem MS analysis with collision-induced fragmentation to be a hexose modified with a glyceramido and an acetamido group. We further show genetically that the nature of the sugar present on the pilin is determined by the carboxyl-terminal region of the pglB gene modified by the insertion in the pglBCD locus. We thus report a previously undiscovered monosaccharide involved in posttranslational modification of type IV pilin subunits by a MS-based approach and determine the molecular basis of its biosynthesis. PMID:17804791

KSC-07pd3617

NASA Image and Video Library

2007-12-11

KENNEDY SPACE CENTER, FLA. -- After arrival at the dock, the Delta IV first stage that will be used to launch the GOES-O satellite moves through Cape Canaveral Air Force Station in Florida. It is being transported to Complex 37. The satellite is part of the series developed by the Geostationary Operational Environmental Satellite Program, a joint effort of NASA and the National Oceanic and Atmospheric Administration, known as NOAA. Currently, the GOES system consists of GOES-12 operating as GOES-East in the eastern part of the constellation at 75° west longitude, and GOES-10 operating as GOES-West at 135° west longitude. These spacecraft help meteorologists observe and predict local weather events, including thunderstorms, tornadoes, fog, flash floods, and other severe weather. In addition, GOES observations have proven helpful in monitoring dust storms, volcanic eruptions and forest fires. GOES-O is targeted for launch on July 20 aboard a Boeing Delta IV rocket. Photo credit: NASA/Jim Grossmann

KSC-07pd3621

NASA Image and Video Library

2007-12-11

KENNEDY SPACE CENTER, FLA. -- The Delta IV first stage that will be used to launch the GOES-O satellite moves into Complex 37 on Cape Canaveral Air Force Station in Florida. The satellite is part of the series developed by the Geostationary Operational Environmental Satellite Program, a joint effort of NASA and the National Oceanic and Atmospheric Administration, known as NOAA. Currently, the GOES system consists of GOES-12 operating as GOES-East in the eastern part of the constellation at 75° west longitude, and GOES-10 operating as GOES-West at 135° west longitude. These spacecraft help meteorologists observe and predict local weather events, including thunderstorms, tornadoes, fog, flash floods, and other severe weather. In addition, GOES observations have proven helpful in monitoring dust storms, volcanic eruptions and forest fires. GOES-O is targeted for launch on July 20 aboard a Boeing Delta IV rocket. Photo credit: NASA/Jim Grossmann

Impulsive EUV bursts observed in C IV with OSO-8. [UV solar spectra

NASA Technical Reports Server (NTRS)

Athay, R. G.; White, O. R.; Lites, B. W.; Bruner, E. C., Jr.

1980-01-01

Time sequences of profiles of the 1548 A line of C IV containing 51 EUV bursts observed in or near active regions are analyzed to determine the brightness, Doppler shift and line broadening characteristics of the bursts. The bursts have mean lifetimes of approximately 150 s, and mean increases in brightness at burst maximum of four-fold as observed with a field of view of 2 x 20 arc sec. Mean burst diameters are estimated to be 3 arc sec, or smaller. All but three of the bursts show Doppler shifts with velocities sometimes exceeding 75 km/s; 31 are dominated by red shifts and 17 are dominated by blue shifts. Approximately half of the latter group have red-shifted precursors. The bursts are interpreted as prominence material, such as surges and coronal rain, moving through the field of view of the spectrometer.

KSC-2014-3695

NASA Image and Video Library

2014-08-29

CAPE CANAVERAL, Fla. – Inside the Delta Operations Center at Cape Canaveral Air Force Station, United Launch Alliance technicians place the second stage of a Delta IV Heavy rocket on a support fixture following testing in preparation for the unpiloted Exploration Flight Test-1, or EFT-1. The second stage will be placed on a transporter for the move to the Horizontal Integration Facility at Space Launch Complex 37 for mating with the Delta IV Heavy booster stages. During the mission, Orion will travel farther into space than any human spacecraft has gone in more than 40 years. The data gathered during the flight will influence design decisions, validate existing computer models and innovative new approaches to space systems development, as well as reduce overall mission risks and costs for later Orion flights. Liftoff of Orion on the first flight test is planned for December 2014. Photo credit: NASA/Kim Shiflett

Failure mechanisms and closed reduction of a constrained tripolar acetabular liner.

PubMed

Robertson, William J; Mattern, Christopher J; Hur, John; Su, Edwin P; Pellicci, Paul M

2009-02-01

Unlike traditional bipolar constrained liners, the Osteonics Omnifit constrained acetabular insert is a tripolar device, consisting of an inner bipolar bearing articulating within an outer, true liner. Every reported failure of the Omnifit tripolar implant has been by failure at the shell-bone interface (Type I failure), failure at the shell-liner interface (Type II failure), or failure of the locking mechanism resulting in dislocation of the bipolar-liner interface (Type III failure). In this report we present two cases of failure of the Omnifit tripolar at the bipolar-femoral head interface. To our knowledge, these are the first reported cases of failure at the bipolar-femoral head interface (Type IV failure). In addition, we described the first successful closed reduction of a Type IV failure.

Effects of stimulant medication on the lateralisation of line bisection judgements of children with attention deficit hyperactivity disorder.

PubMed

Sheppard, D M; Bradshaw, J L; Mattingley, J B; Lee, P

1999-01-01

Deficits in the maintenance of attention may underlie problems in attention deficit hyperactivity disorder (ADHD). Children with ADHD also show asymmetric attention deficits in traditional lateralisation and visuospatial orienting tasks, suggesting right hemispheric (and left hemispace) attentional disturbance. This study aimed to examine the lateralisation of selective attention in ADHD; specifically, the effect of a moving, random dot background, and stimulant medication in the line bisection task. The performance of children with ADHD, on and off methylphenidate, was examined using a computerised horizontal line bisection task with moving and blank backgrounds. Twenty children with a DSM-IV diagnosis of ADHD participated with 20 controls, individually matched for age, sex, grade at school, and IQ. Twelve of the 20 children with ADHD were on stimulant medication at the time of testing. Horizontal lines of varying length were presented in the centre of a computer screen, with either a blank background, or a moving, random dot field. The random dots moved either leftward or rightward across the screen at either 40 mm/s or 80 mm/s. The children with ADHD off medication bisected lines significantly further to the right compared with controls, who showed a small leftward error. Methylphenidate normalised the performance of the children with ADHD for the task with the moving dots. These results support previous evidence for a right hemispheric hypoarousal theory of attentional dysfunction, and are consistent with the emerging picture of a lateralised dysfunction of frontostriatal circuitry in ADHD.

Intravenous S-Ketamine Does Not Inhibit Alveolar Fluid Clearance in a Septic Rat Model

PubMed Central

Weber, Nina C.; van der Sluijs, Koen; Hackl, Florian; Hotz, Lorenz; Dahan, Albert; Hollmann, Markus W.; Berger, Marc M.

2014-01-01

We previously demonstrated that intratracheally administered S-ketamine inhibits alveolar fluid clearance (AFC), whereas an intravenous (IV) bolus injection had no effect. The aim of the present study was to characterize whether continuous IV infusion of S-ketamine, yielding clinically relevant plasma concentrations, inhibits AFC and whether its effect is enhanced in acute lung injury (ALI) which might favor the appearance of IV S-ketamine at the alveolar surface. AFC was measured in fluid-instilled rat lungs. S-ketamine was administered IV over 6 h (loading dose: 20 mg/kg, followed by 20 mg/kg/h), or intratracheally by addition to the instillate (75 µg/ml). ALI was induced by IV lipopolysaccharide (LPS; 7 mg/kg). Interleukin (IL)-6 and cytokine-induced neutrophil chemoattractant (CINC)-3 were measured by ELISA in plasma and bronchoalveolar lavage fluid. Isolated rat alveolar type-II cells were exposed to S-ketamine (75 µg/ml) and/or LPS (1 mg/ml) for 6 h, and transepithelial ion transport was measured as short circuit current (ISC). AFC was 27±5% (mean±SD) over 60 min in control rats and was unaffected by IV S-ketamine. Tracheal S-ketamine reduced AFC to 18±9%. In LPS-treated rats, AFC decreased to 16±6%. This effect was not enhanced by IV S-ketamine. LPS increased IL-6 and CINC-3 in plasma and bronchoalveolar lavage fluid. In alveolar type-II cells, S-ketamine reduced ISC by 37% via a decrease in amiloride-inhibitable sodium transport. Continuous administration of IV S-ketamine does not affect rat AFC even in endotoxin-induced ALI. Tracheal application with direct exposure of alveolar epithelial cells to S-ketamine decreases AFC by inhibition of amiloride-inhibitable sodium transport. PMID:25386677

Two-View Gravity Stress Imaging Protocol for Nondisplaced Type II Supination External Rotation Ankle Fractures: Introducing the Gravity Stress Cross-Table Lateral View.

PubMed

Boffeli, Troy J; Collier, Rachel C; Gervais, Samuel J

Assessing ankle stability in nondisplaced Lauge-Hansen supination external rotation type II injuries requires stress imaging. Gravity stress mortise imaging is routinely used as an alternative to manual stress imaging to assess deltoid integrity with the goal of differentiating type II from type IV injuries in cases without a posterior or medial fracture. A type II injury with a nondisplaced fibula fracture is typically treated with cast immobilization, and a type IV injury is considered unstable and often requires operative repair. The present case series (two patients) highlights a standardized 2-view gravity stress imaging protocol and introduces the gravity stress cross-table lateral view. The gravity stress cross-table lateral view provides a more thorough evaluation of the posterior malleolus owing to the slight external rotation and posteriorly directed stress. External rotation also creates less bony overlap between the tibia and fibula, allowing for better visualization of the fibula fracture. Gravity stress imaging confirmed medial-sided injury in both cases, confirming the presence of supination external rotation type IV or bimalleolar equivalent fractures. Open reduction and internal fixation was performed, and both patients achieved radiographic union. No further treatment was required at 21 and 33 months postoperatively. Copyright © 2017 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

Fine typing of methicillin-resistant Staphylococcus aureus isolates using direct repeat unit and staphylococcal interspersed repeat unit typing methods.

PubMed

Ho, Cheng-Mao; Ho, Mao-Wang; Li, Chi-Yuan; Lu, Jang-Jih

2015-08-01

Methicillin-resistant Staphylococcus aureus (MRSA) typing is an important epidemiologic tool for monitoring trends and preventing outbreaks. However, the efficiency of various MRSA typing methods for each SCCmec MRSA isolate is rarely evaluated. A total of 157 MRSA isolates from four different regions in Taiwan were typed with five different molecular methods, including SCCmec typing, multilocus sequence typing (MLST), spa typing, mec-associated direct repeat unit (dru) copy number determination, and staphylococcal interspersed repeat unit (SIRU) profiling. There were four SCCmec types, eight MLST types, 15 spa types, 11 dru types, and 31 SIRU profiles. The most common type determined by each molecular typing method was SCCmec III (115 isolates, 73.2%), ST239 (99 isolates, 63.1%), t037 (107 isolates, 68.2%), 14 dru copies (76 isolates, 48.4%), and SIRU profile 3013722 (102 isolates, 65%), respectively. When using the combination of MLST, spa typing, and dru copy number, ST5-t002-4 (n = 8), ST239-t037-14 (n = 68), ST59-t437-9 (n = 9), and ST59-t437-11 (n = 6) were found to be the most common types of SCCmec types II (n = 9), III (n = 115), IV (n = 21), and VT (n = 11) isolates, respectively. SCCmec type III isolates were further classified into 11 dru types. Of the 21 SCCmec type IV isolates, 14 SIRU profiles were found. Seven SIRU patterns were observed in the 11 SCCmec type VT isolates. Different typing methods showed a similar Hunter-Gaston discrimination index among the 157 MRSA isolates. However, dru and SIRU typing methods had a better discriminatory power for SCCmec type III and SCCmec types IV and VT isolates, respectively, suggesting that dru and SIRU can be used to further type these isolates. Copyright © 2013. Published by Elsevier B.V.

Malleolar fractures and their ligamentous injury equivalents have similar outcomes in supination-external rotation type IV fractures of the ankle treated by anatomical internal fixation.

PubMed

Berkes, M B; Little, M T M; Lazaro, L E; Sculco, P K; Cymerman, R M; Daigl, M; Helfet, D L; Lorich, D G

2012-11-01

It has previously been suggested that among unstable ankle fractures, the presence of a malleolar fracture is associated with a worse outcome than a corresponding ligamentous injury. However, previous studies have included heterogeneous groups of injury. The purpose of this study was to determine whether any specific pattern of bony and/or ligamentous injury among a series of supination-external rotation type IV (SER IV) ankle fractures treated with anatomical fixation was associated with a worse outcome. We analysed a prospective cohort of 108 SER IV ankle fractures with a follow-up of one year. Pre-operative radiographs and MRIs were undertaken to characterise precisely the pattern of injury. Operative treatment included fixation of all malleolar fractures. Post-operative CT was used to assess reduction. The primary and secondary outcome measures were the Foot and Ankle Outcome Score (FAOS) and the range of movement of the ankle. There were no clinically relevant differences between the four possible SER IV fracture pattern groups with regard to the FAOS or range of movement. In this population of strictly defined SER IV ankle injuries, the presence of a malleolar fracture was not associated with a significantly worse clinical outcome than its ligamentous injury counterpart. Other factors inherent to the injury and treatment may play a more important role in predicting outcome.

Vortex depinning as a nonequilibrium phase transition phenomenon: Scaling of current-voltage curves near the low and the high critical-current states in 2 H -Nb S2 single crystals

NASA Astrophysics Data System (ADS)

Bag, Biplab; Sivananda, Dibya J.; Mandal, Pabitra; Banerjee, S. S.; Sood, A. K.; Grover, A. K.

2018-04-01

The vortex depinning phenomenon in single crystals of 2 H -Nb S2 superconductors is used as a prototype for investigating properties of the nonequilibrium (NEQ) depinning phase transition. The 2 H -Nb S2 is a unique system as it exhibits two distinct depinning thresholds, viz., a lower critical current Icl and a higher one Ich. While Icl is related to depinning of a conventional, static (pinned) vortex state, the state with Ich is achieved via a negative differential resistance (NDR) transition where the velocity abruptly drops. Using a generalized finite-temperature scaling ansatz, we study the scaling of current (I)-voltage (V) curves measured across Icl and Ich. Our analysis shows that for I >Icl , the moving vortex state exhibits Arrhenius-like thermally activated flow behavior. This feature persists up to a current value where an inflexion in the IV curves is encountered. While past measurements have often reported similar inflexion, our analysis shows that the inflexion is a signature of a NEQ phase transformation from a thermally activated moving vortex phase to a free flowing phase. Beyond this inflection in IV, a large vortex velocity flow regime is encountered in the 2 H -Nb S2 system, wherein the Bardeen-Stephen flux flow limit is crossed. In this regime the NDR transition is encountered, leading to the high Ich state. The IV curves above Ich we show do not obey the generalized finite-temperature scaling ansatz (as obeyed near Icl). Instead, they scale according to the Fisher's scaling form [Fisher, Phys. Rev. B 31, 1396 (1985), 10.1103/PhysRevB.31.1396] where we show thermal fluctuations do not affect the vortex flow, unlike that found for depinning near Icl.

Moving Beyond Average Values: Assessing the Night-To-Night Instability of Sleep and Arousal in DSM-IV-TR Insomnia Subtypes

PubMed Central

Sánchez-Ortuño, M. Montserrat; Carney, Colleen E.; Edinger, Jack D.; Wyatt, James K.; Harris, Andrea

2011-01-01

Study Objectives: We explored differences between individuals with DSM-IV-TR diagnoses of primary insomnia (PI) and insomnia related to a mental disorder (IMD) by using serial measurements of self-reported sleep variables (sleep onset latency, SOL; wake after sleep onset, WASO; total sleep time, TST; sleep efficiency, SE), and visual analogue scale ratings of 2 forms of bedtime arousal (cognitive and emotional). Furthermore, we sought to examine the relationship between sleep and arousal within each diagnostic subgroup. Design: Between-group and within-group comparisons. Setting: Duke and Rush University Medical Centers, USA. Participants: One hundred eighty-seven insomnia sufferers (126 women, average age 47.15 years) diagnosed by sleep specialists at 2 sleep centers as PI patients (n = 126) and IMD patients (n = 61). Interventions: N/A Measurements and Results: Multilevel models for sleep measures indicated that IMD displayed significantly more instability across nights in their TST (i.e., larger changes) than did PI patients. With respect to pre-sleep arousal, IMD patients exhibited higher mean levels of emotional arousal, as well as more instability on the nightly ratings of this measure. Within the PI group, correlational analyses revealed a moderate relationship between the 2 arousal variables and SOL (r values 0.29 and 0.26), whereas the corresponding correlations were negligible and statistically nonsignificant in the IMD group. Conclusions: We found a number of differences on nighttime variables between those diagnosed with primary insomnia and those diagnosed with insomnia related to a mental disorder. These differences imply different perpetuating mechanisms involved in their ongoing sleep difficulties. Additionally, they support the categorical distinctiveness and the concurrent validity of these insomnia subtypes. Citation: Sánchez-Ortuño MM; Carney CE; Edinger JD; Wyatt JK; Harris A. Moving beyond average values: assessing the night-to-night instability of sleep and arousal in DSM-IV-TR insomnia subtypes. SLEEP 2011;34(4):531-539 PMID:21461332

Genetics of Lesch's typology of alcoholism.

PubMed

Samochowiec, Jerzy; Kucharska-Mazur, Jolanta; Grzywacz, Anna; Pelka-Wysiecka, Justyna; Mak, Monika; Samochowiec, Agnieszka; Bienkowski, Przemyslaw

2008-02-15

It is widely accepted that dopamine and serotonin (5-HT) neurotransmission can be critically involved in the development of alcohol abuse and alcohol dependence. Lesch's typology of alcoholism has been gaining increasing popularity as it qualitatively differentiates patients into different treatment response subgroups. The aim of the present study was to evaluate a possible genetic background of Lesch's typology with special emphasis placed on dopamine- and serotonin-related genes. 122 alcoholics (the mean age: 35+/-9 years) were investigated. According to Lesch's typology, 58 patients were of type I, 36 patients of type II, 11 patients of type III, and 17 patients of type IV. Alcohol drinking and family history was assessed by means of a structured interview, based on the Semi-Structured Assessment for the Genetics of Alcoholism. 150 control subjects without psychiatric disorders were also recruited. The control group was ethnically-, age- and gender-matched to the patients. The DRD2 TaqIA, exon 8, and promoter -141C ins/del polymorphisms as well as COMT Val158Met, 5HTT 44 bp del in promoter, and DAT 40 bp VNTR polymorphisms were detected by means of PCR. No significant differences were observed when the whole group of alcoholics and the controls were compared. Similarly, there were no differences between either the Lesch type I or type II alcoholics and the control subjects. No significant differences were observed between type I and type II alcoholics. Alleles frequencies were not calculated for the Lesch type III and type IV alcoholics since the number of patients was too small. The present results argue against any major role of the investigated polymorphisms in either Lesch type I or type II alcoholism. More comprehensive studies are needed to define the role of the investigated polymorphisms in Lesch type III and type IV alcoholism.

Mechanisms and implications of a type IV functional response for short-term intake rate of dry matter in large mammalian herbivores.

PubMed

Mezzalira, Jean C; Bonnet, Olivier J F; Carvalho, Paulo C de F; Fonseca, Lidiane; Bremm, Carolina; Mezzalira, Carlos C; Laca, Emilio A

2017-09-01

The functional response (i.e. the relationship between consumers' intake rate and resource density) is central in plant-herbivore interactions. Its shape and the biological processes leading to it have significant implications for both foraging theory and ecology of grazing systems. A type IV functional response (i.e. dome-shaped relationship) of short-term intake rate of dry matter (intake while grazing) has rarely been reported for large herbivores and the conditions that can lead to it are poorly understood. We report a type IV functional response observed in heifers grazing monocultures of Cynodon sp. and Avena strigosa. The mechanisms and consequences of this type of functional response for grazed system dynamics are discussed. Intake rate was higher at intermediate than at short or tall sward heights in both grass species. The type IV functional response resulted from changes in bite mass instead of a longer time needed to encounter and process bites. Thus, the decrease of intake rate of dry matter in tall swards is not explained by a shift from process 3 (potential bites are concentrated and apparent) to process 2 (potential bites are apparent but dispersed, Spalinger & Hobbs 1992). Bite mass was smaller in tall than in intermediate swards due to a reduction of bite volume possibly caused by the greater proportion of stem and sheath acting as a physical barrier to bite formation. It is generally accepted that potential bites are abundant and apparent in most grassland and meadow systems, as they were in the present experiments. Therefore, a type IV response of intake rate not directly related to digestive constraints may determine the dynamics of intake and defoliation under a much larger set of conditions than previously thought. These results have implications for foraging theory and stability of grazing systems. For example, if animals prefer patches of intermediate stature that yield the highest intake rate, grazing should lead to the widely observed bimodal distribution of plant mass per unit area, even when tall patches are not of significantly lower digestive quality than the pasture average. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.

Slope Stability of Geosynthetic Clay Liner Test Plots

EPA Science Inventory

Fourteen full-scale field test plots containing five types of geosynthetic clay liners (GCLs) were constructed on 2H:IV and 3H:IV slopes for the purpose of assessing slope stability. The test plots were designed to simulate typical final cover systems for landfill. Slides occurr...

A novel GBE1 gene variant in a child with glycogen storage disease type IV.

PubMed

Said, Samar M; Murphree, Marine I; Mounajjed, Taofic; El-Youssef, Mounif; Zhang, Lizhi

2016-08-01

Glycogen storage disease type IV is an autosomal recessive disorder of carbohydrates caused by deficiency of amylo-1-4-glycanoglycosyltransferase, which leads to accumulation of amylopectin-like polysaccharides in tissues including liver, heart and neuromuscular system. More than 40 different mutations in the glycogen branching enzyme gene (GBE1) have been described. In this study, we report a 2-year-old boy who presented with developmental delay and muscle weakness. He subsequently was diagnosed with glycogen storage disease type IV based on a liver biopsy histology and electron microscopy. Glycogen branching enzyme activity was in the low range. Genetic analysis demonstrated a novel heterozygous variant (c.760A>G; p.Thr254Ala) in exon 6 of the GBE1 gene, which is believed to be pathogenic. This variant was inherited from the patient's mother who was asymptomatic with normal glycogen branching enzyme activity. Whole-exome sequencing failed to reveal additional variations in the GBE1 gene. Copyright © 2016 Elsevier Inc. All rights reserved.

Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC.

PubMed

Ahmed, Zubair M; Smith, Tenesha N; Riazuddin, Saima; Makishima, Tomoko; Ghosh, Manju; Bokhari, Sirosh; Menon, Puthezhath S N; Deshmukh, Dilip; Griffith, Andrew J; Riazuddin, Sheikh; Friedman, Thomas B; Wilcox, Edward R

2002-06-01

Human chromosome 11 harbors two Usher type I loci, USHIB and USHIC, which encode myosin VIIA and harmonin, respectively. The USHIC locus overlaps the reported critical interval for nonsyndromic deafness locus DFNB18. We found an IVS12+5G-->C mutation in the USHIC gene, which is associated with nonsyndromic recessive deafness ( DFNB18) segregating in the original family, S-11/12. No other disease-associated mutation was found in the other 27 exons or in the intron-exon boundaries, and the IVS12+5G-->C mutation was not present in 200 representative unaffected individuals ascertained from the same area of India. An exon-trapping assay with a construct harboring IVS12+5G-->C generated wildtype spliced mRNA having exons 11 and 12 and mRNA that skipped exon 12. We conclude that mutations of USHIC can cause both Usher syndrome type IC and nonsyndromic recessive deafness DFNB18.

Diagnostic efficiency of amylase and type IV collagen in predicting chronic pancreatitis.

PubMed

Das, Subir Kumar; Varadhan, Sowmya; Dhanya, L; Mukherjee, Sukhes; Mohana, S; Balakrishnan, V; Vasudevan, D M

2009-01-01

Chronic pancreatitis, an irreversible inflammatory disease of the pancreas, is associated with the replacement of the destroyed parenchyma by extended development of fibrosis. Despite marked progress in diagnostic tools, no consensus has been reached in diagnosis of chronic pancreatitis. In this study we examined the hematological and biochemical parameters among 40 chronic pancreatitis patients within 18 to 67 yrs. ESR level and ALP activity was elevated in 40% cases. Serum amylase activity increased in 32 patients and it showed significant correlation with ALP (r=0.458, p=0.003), CA-19.9 (r=0.556, p<0.001), and calcium level (r=-0.472, p=0.002). Type IV collagen level in chronic pancreatitis also elevated (164.4 ± 55.5 ng/ml) and showed negative significant correlation with calcium level (r= -0.505, p=0.001). However, no significant correlation was observed between amylase activity and type IV collagen (r=0.289, p= 0.07).

Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae

PubMed Central

2011-01-01

Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA), the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (Vir)B/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail. PMID:21489243

Effect of microwave disinfection on compressive and tensile strengths of dental stones.

PubMed

Robati Anaraki, Mahmood; Moslehifard, Elnaz; Aminifar, Soran; Ghanati, Hamed

2013-01-01

Although microwave irradiation has been used for disinfection of dental stone casts, there are concerns regarding mechanical damage to casts during the process. The aim of this study was to evaluate the effect of microwave irradiation on the compressive strength (CS) and diametral tensile strength (DTS) of stone casts. In this in vitro study, 80 cylindrical type III and IV stone models (20 × 40 mm) were prepared and divided into 8 groups of 10. The DTS and CS of the specimens were measured by a mechanical testing machine at a crosshead speed of 0.5 cm/min after 7 times of frequent wetting, irradiating at an energy level of 600 W for 3 minutes and cooling. Data were analyzed by Student's t-test. Microwave irradiation significantly increased DTS of type III and IV to 5.23 ± 0.64 and 8.17 ± 0.94, respectively (P < 0.01). According to the results, microwave disinfection increases DTS of type III and IV stone casts without any effects on their CS.

Identification of another module involved in the horizontal transfer of the Haemophilus genomic island ICEHin1056.

PubMed

Juhas, Mario; Dimopoulou, Ioanna; Robinson, Esther; Elamin, Abdel; Harding, Rosalind; Hood, Derek; Crook, Derrick

2013-09-01

A significant part of horizontal gene transfer is facilitated by genomic islands. Haemophilus influenzae genomic island ICEHin1056 is an archetype of a genomic island that accounts for pandemic spread of antibiotics resistance. ICEHin1056 has modular structure and harbors modules involved in type IV secretion and integration. Previous studies have shown that ICEHin1056 encodes a functional type IV secretion system; however, other modules have not been characterized yet. Here we show that the module on the 5' extremity of ICEHin1056 consists of 15 genes that are well conserved in a number of related genomic islands. Furthermore by disrupting six genes of the investigated module of ICEHin1056 by site-specific mutagenesis we demonstrate that in addition to type IV secretion system module, the investigated module is also important for the successful conjugal transfer of ICEHin1056 from donor to recipient cells. Copyright © 2013 Elsevier Inc. All rights reserved.

Exome sequencing establishes a gelsolin mutation as the cause of inherited bulbar-onset neuropathy.

PubMed

Caress, James B; Johnson, Janel O; Abramzon, Yevgeniya A; Hawkins, Gregory A; Gibbs, J Raphael; Sullivan, Elizabeth A; Chahal, Chamanpreet S; Traynor, Bryan J

2017-11-01

Progressive bulbar motor neuropathy is primarily caused by bulbar-onset ALS. Hereditary amyloidosis type IV also presents with a bulbar neuropathy that mimics motor neuron disease. The disease is prevalent in Finland only and is not commonly included in the differential diagnosis of ALS. We studied 18 members of a family in which some had bulbar motor neuropathy, and we performed exome sequencing. Five affected family members were found to have a D187Y substitution in the GSN gene known to cause hereditary amyloidosis type IV. This American family presented with progressive bulbar neuropathy due to a gelsolin mutation not found in Finland. Hereditary amyloidosis type IV presents with bulbar motor neuropathy and not with peripheral neuropathy as occurs with common forms of amyloidosis. This report demonstrates the power of exome sequencing to determine the cause of rare hereditary diseases with incomplete or atypical phenotypes. Muscle Nerve 56: 1001-1005, 2017. © 2016 Wiley Periodicals, Inc.

Gluteo-vaginal sinus formation complicating posterior intravaginal slingplasty followed by successful IVS removal. A case report and review of the literature.

PubMed

Mikos, Themistoklis; Tsalikis, Tryfon; Papanikolaou, Alexios; Pournaropoulos, Fotios; Bontis, John N

2008-03-01

Posterior intravaginal slingplasty (IVS) is a technique used for the treatment of apical prolapse. Type III meshes have been mostly used with this technique. In this article, a case of bilateral gluteo-vaginal sinus tract formation that complicated a posterior vaginal slingplasty with a type III mesh is presented. At 3 months follow-up, the patient complained for bulking through the vagina, continuous offensive vaginal discharge, and constant pain at the buttocks. She had prolapse recurrence, and there was defective healing at the gluteal entry points of the posterior IVS. Ten months after the initial surgery, she underwent a laparotomic subtotal hysterectomy and sacrocervicopexy with prolene type I mesh. At the same time, the posterior mesh was removed allowing the surgeon to discover communication of the canal of the mesh extending from gluteal incisions to the vagina epithelium. The sinus tract was managed surgically with excision of the surrounding tissues. There was no recurrence or other complications at 2 months follow-up.

In vivo imaging of cortical pathology in multiple sclerosis using ultra-high field MRI

PubMed Central

Mainero, C; Benner, T; Radding, A; van der Kouwe, A; Jensen, R; Rosen, B R.; Kinkel, R P.

2009-01-01

Objective: We used ultra-high field MRI to visualize cortical lesion types described by neuropathology in 16 patients with multiple sclerosis (MS) compared with 8 age-matched controls; to characterize the contrast properties of cortical lesions including T2*, T2, T1, and phase images; and to investigate the relationship between cortical lesion types and clinical data. Methods: We collected, on a 7-T scanner, 2-dimensional fast low-angle shot (FLASH)-T2*-weighted spoiled gradient-echo, T2-weighted turbo spin-echo (TSE) images (0.33 × 033 × 1 mm3), and a 3-dimensional magnetization-prepared rapid gradient echo. Results: Overall, 199 cortical lesions were detected in patients on both FLASH-T2* and T2-TSE scans. Seven-tesla MRI allowed for characterization of cortical plaques into type I (leukocortical), type II (intracortical), and type III/IV (subpial extending partly or completely through the cortical width) lesions as described histopathologically. Types III and IV were the most frequent type of cortical plaques (50.2%), followed by type I (36.2%) and type II (13.6%) lesions. Each lesion type was more frequent in secondary progressive than in relapsing–remitting MS. This difference, however, was significant only for type III/IV lesions. T2*-weighted images showed the highest, while phase images showed the lowest, contrast-to-noise ratio for all cortical lesion types. In patients, the number of type III/IV lesions was associated with greater disability (p < 0.02 by Spearman test) and older age (p < 0.04 by Spearman test). Conclusions: Seven-tesla MRI detected different histologic cortical lesion types in our small multiple sclerosis (MS) sample, suggesting, if validated in a larger population, that it may prove a valuable tool to assess the contribution of cortical MS pathology to clinical disability. GLOSSARY ANOVA = analysis of variance; BN = background noise; CNR = contrast-to-noise ratio; DIR = double-inversion recovery; EDSS = Expanded Disability Status Scale; FLAIR = fluid-attenuated inversion recovery; FLASH = fast low-angle shot; GM = gray matter; MPRAGE = magnetization-prepared rapid gradient echo; MR = magnetic resonance; MS = multiple sclerosis; NACGM = normal-appearing cortical gray matter; RF = radiofrequency; ROI = region of interest; RRMS = relapsing–remitting multiple sclerosis; SNR = signal-to-noise ratio; SPMS = secondary progressive multiple sclerosis; TA = time of acquisition; TE = echo time; TR = repetition time; TSE = turbo spin-echo; WM = white matter. PMID:19641168

Thermoelectric Behavior of Low Thermal Conductivity Cu-based and IV-V Chalcogenides

NASA Astrophysics Data System (ADS)

Olvera, Alan Anthony

In an ever-changing global environment, energy-related issues have become a central feature in the day-to-day conversations of the general public. A niche field that has recently made major advancements in conversion performance is thermoelectric (TE) energy conversion, where progress in material optimization has resulted in the highest efficiency thermoelectric materials to date. This includes superionic copper chalcogenides and IV-VI selenide compounds, such as Cu2Se and PbSe. Hence, this work focuses on the reliable synthesis and characterization of thermoelectric Cu-based and IV-V compounds. The electronic and optical properties of Cu-based energy conversion materials are greatly affected by synthesis-induced defects. To alleviate this issue, a novel method is developed using the topochemical redox reaction of CuSe 2 into the desired material. It is predicted that CuSe2 -serves as a sacrificial structural template for the facile synthesis of structurally related materials. This was specifically verified in the case of CuInSe 2, where CuSe2 is gradually transformed into CuInSe 2 when reacted with elemental indium. Evidently, this synthetic method is a potential avenue for new material prediction and fabrication of novel composite materials. Using the method described, a composite of CuInSe2 and the known TE material, Cu2Se, is formed. Considering the structural similarity of both compounds, the efficiency of Cu2Se is drastically increased due to enhanced carrier mobility provided by tetrahedral indium subunits. These subunits simultaneously disrupt phonon propagation which result in reduced thermal conductivity and increased TE efficiency (ZT ≈ 2.6 at 850K). More significant is the increased chemical stability of Cu2Se while under applied current and temperature. It is observed that 1 mol % indium stabilizes Cu-ion migration, encouraging the commercialization of Cu 2Se. Currently, CuAgSe is the only promising n-type Cu-based superionic TE material. Accordingly, to find a compatible material for p-type Cu2Se at high temperatures, a series of materials with the formula Cu4-xAgxSe2 were synthesized. It was found that the composition of Cu3AgSe2 ( x = 1) is a two-phase mixture at low temperatures but becomes a single-phase p-type superionic material above 440 K. On the other hand, CuAg 3Se2 (x = 3) remains a two-phase n-type mixture throughout the measured temperature range, contrary to reports of CuAg3Se2 as a single-phase high temperature material. The most important finding is the high temperature n-type behavior of CuAgSe (x = 2), which is the first instance of CuAgSe as an n-type superionic material above 470 K. It is proposed that off-stoichiometry leads to p-type behavior of CuAgSe. Moving to IV-V compounds, a detailed experimental and computational study of the material Pb7Bi4Se13 shows excellent thermoelectric properties for a non-optimized system. It behaves as an n-type material with a small band gap of about 0.23 eV, which is confirmed by band structure calculations and experimental results. It demonstrates ultralow thermal conductivity largely due to the complex atomic-scale structure and heavy constituent atoms. This results in a ZT of approximately 0.9 at 775 K, which is a promising value for further optimization. Additional results from CuSe2 structural template reactions show that several composite materials and new materials can be predicted and synthesized. This includes Cu2Se-Cu(Ga,Al)Se2 composites and new materials such as Cu(Zn,Ni)1.5Se2 and CuPb 0.75Se2. Further work in Sn-Bi-Se compounds is discussed due their complex crystal structure that may result in promising thermoelectric properties. Finally, the preliminary results of high entropy chalcogenides are presented with discussion on future development.

Behavioural syndromes and social insects: personality at multiple levels.

PubMed

Jandt, Jennifer M; Bengston, Sarah; Pinter-Wollman, Noa; Pruitt, Jonathan N; Raine, Nigel E; Dornhaus, Anna; Sih, Andrew

2014-02-01

Animal personalities or behavioural syndromes are consistent and/or correlated behaviours across two or more situations within a population. Social insect biologists have measured consistent individual variation in behaviour within and across colonies for decades. The goal of this review is to illustrate the ways in which both the study of social insects and of behavioural syndromes has overlapped, and to highlight ways in which both fields can move forward through the synergy of knowledge from each. Here we, (i) review work to date on behavioural syndromes (though not always referred to as such) in social insects, and discuss mechanisms and fitness effects of maintaining individual behavioural variation within and between colonies; (ii) summarise approaches and principles from studies of behavioural syndromes, such as trade-offs, feedback, and statistical methods developed specifically to study behavioural consistencies and correlations, and discuss how they might be applied specifically to the study of social insects; (iii) discuss how the study of social insects can enhance our understanding of behavioural syndromes-research in behavioural syndromes is beginning to explore the role of sociality in maintaining or developing behavioural types, and work on social insects can provide new insights in this area; and (iv) suggest future directions for study, with an emphasis on examining behavioural types at multiple levels of organisation (genes, individuals, colonies, or groups of individuals). © 2013 The Authors. Biological Reviews © 2013 Cambridge Philosophical Society.

Transarterial treatment with Onyx of Cognard type IV anterior cranial fossa dural arteriovenous fistulas.

PubMed

Li, Chuanhui; Wu, Zhongxue; Yang, Xinjian; Li, Youxiang; Jiang, Chuhan; He, Hongwei

2014-03-01

Cognard type IV anterior cranial fossa dural arteriovenous fistulas (DAVFs) are rare lesions with a high risk of intracranial hemorrhage. We present our experience with the use of Onyx via the arterial route in these aggressive lesions. Between October 2009 and October 2011, six consecutive patients diagnosed with Cognard type IV anterior cranial fossa DAVFs were treated transarterially with Onyx in our department. All patients were male; mean age was 55 years (range 38-68). Four patients presented with intracranial hemorrhage as the initial manifestation; one patient presented with seizures at the time of diagnosis and experienced intracranial hemorrhage during the antiepileptic therapy; and the other patient was asymptomatic. In five patients, complete obliteration was achieved with transarterial Onyx injection in a single treatment session; in the remaining patient, subtotal occlusion was achieved and gamma knife treatment was followed. The average time of injection was 19 min (range 5-28) for every pedicle catheterized and the average amount of Onyx was 3.2 ml (range 0.4-6.3) for each lesion. All patients recovered uneventfully after embolization. No mortality or permanent morbidity was observed in this series. Follow-up digital subtraction or MR angiography confirmed durable obliteration of the fistulas in five cured cases. No patients suffered intracranial hemorrhage during the follow-up period. In this small series, our experience with the use of Onyx for arterial embolization of Cognard type IV DAVFs is encouraging, with durable complete cure in most lesions without severe complications.

CT-based radiomics signature for differentiating Borrmann type IV gastric cancer from primary gastric lymphoma.

PubMed

Ma, Zelan; Fang, Mengjie; Huang, Yanqi; He, Lan; Chen, Xin; Liang, Cuishan; Huang, Xiaomei; Cheng, Zixuan; Dong, Di; Liang, Changhong; Xie, Jiajun; Tian, Jie; Liu, Zaiyi

2017-06-01

To evaluate the value of CT-based radiomics signature for differentiating Borrmann type IV gastric cancer (GC) from primary gastric lymphoma (PGL). 40 patients with Borrmann type IV GC and 30 patients with PGL were retrospectively recruited. 485 radiomics features were extracted and selected from the portal venous CT images to build a radiomics signature. Subjective CT findings, including gastric wall peristalsis, perigastric fat infiltration, lymphadenopathy below the renal hila and enhancement pattern, were assessed to construct a subjective findings model. The radiomics signature, subjective CT findings, age and gender were integrated into a combined model by multivariate analysis. The diagnostic performance of these three models was assessed with receiver operating characteristics curves (ROC) and were compared using DeLong test. The subjective findings model, the radiomics signature and the combined model showed a diagnostic accuracy of 81.43% (AUC [area under the curve], 0.806; 95% CI [confidence interval]: 0.696-0.917; sensitivity, 63.33%; specificity, 95.00%), 84.29% (AUC, 0.886 [95% CI: 0.809-0.963]; sensitivity, 86.67%; specificity, 82.50%), 87.14% (AUC, 0.903 [95%CI: 0.831-0.975]; sensitivity, 70.00%; specificity, 100%), respectively. There were no significant differences in AUC among these three models (P=0.051-0.422). Radiomics analysis has the potential to accurately differentiate Borrmann type IV GC from PGL. Copyright © 2017 Elsevier B.V. All rights reserved.

43 CFR 10005.19 - Decision factors.

Code of Federal Regulations, 2012 CFR

2012-10-01

... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

43 CFR 10005.19 - Decision factors.

Code of Federal Regulations, 2011 CFR

2011-10-01

... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

43 CFR 10005.19 - Decision factors.

Code of Federal Regulations, 2013 CFR

2013-10-01

... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

43 CFR 10005.19 - Decision factors.

Code of Federal Regulations, 2014 CFR

2014-10-01

... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

Standard-Cell, Open-Architecture Power Conversion Systems

DTIC Science & Technology

2005-10-01

TLmax Maximum junction temperature 423 OK Table 5. 9. PEBB average model description in VTB. Terminal Type Name - 4 -, A Power DC Bus + B Power AC Pole...5 A. Switching models ........................................................................................ 5 B. Average ...11-6 IV. Average Modeling of PEBB-Based Converters...................................................... 11-10 0 IV. 1.Voltage

Vorinostat and Azacitidine in Treating Patients With Locally Recurrent or Metastatic Nasopharyngeal Cancer or Nasal Natural Killer T-Cell Lymphoma

ClinicalTrials.gov

2018-04-20

Adult Nasal Type Extranodal NK/T-Cell Lymphoma; Recurrent Nasopharyngeal Keratinizing Squamous Cell Carcinoma; Recurrent Nasopharyngeal Undifferentiated Carcinoma; Stage IV Nasopharyngeal Keratinizing Squamous Cell Carcinoma AJCC v7; Stage IV Nasopharyngeal Undifferentiated Carcinoma AJCC v7

Effects of intravenous delivery systems on infused red blood cells.

PubMed

Gibson, J S; Leff, R D; Roberts, R J

1984-03-01

The effects of various intravenous delivery systems on the integrity of infused red blood cells (RBCs) were studied. Using a factorial design, whole blood and packed RBCs were infused through i.v. delivery systems employing various combinations of i.v. tubing diameter and length, needle gauge, infusion rate (5 and 50 ml/hr), type of infusion pump (piston, diaphragm, or peristaltic operation), and type of blood product. The age and temperature of the blood filter used were held constant. A 5-ml sample of the blood product obtained during each experimental run was analyzed for plasma free-hemoglobin to assess the degree of hemolysis. Osmotic fragility of the RBCs was evaluated by measuring the percentage of hemolysis in the blood products in various concentrations of sodium chloride solution. Type of blood product and i.v. pump were the only variables significantly influencing RBC hemolysis. In both blood products, a greater degree of hemolysis occurred with the peristaltic-type pump than with the other types of pumps. In packed RBCs, the diaphragm-type pump produced greater hemolysis than the piston-type pump, but hemolysis was similar in whole-blood samples. Regardless of the type of pump, more hemolysis occurred in whole blood at the 5-ml/hr infusion rate than at the 50-ml/hr rate, but the converse was true in packed RBCs. Samples of both blood products were less osmotically fragile than their respective controls at sodium chloride concentrations ranging from 0.30 to 0.50%.(ABSTRACT TRUNCATED AT 250 WORDS)

Renal tubular acidosis type IV in hyperkalaemic patients--a fairy tale or reality?

PubMed

Haas, Christian S; Pohlenz, Inga; Lindner, Ulrich; Muck, Philip M; Arand, Jovana; Suefke, Sven; Lehnert, Hendrik

2013-05-01

Hyperkalaemia is a common feature in hospitalized patients and often attributed to drugs antagonizing the renin-angiotensin-aldosterone system (RAAS) and/or acute kidney injury (AKI), despite significantly preserved glomerular filtration rate (GFR). The objective of this study was to determine the prevalence and role of renal tubular acidosis type IV (RTA IV) in the development of significant hyperkalaemia. A single-centre retrospective study. Patients admitted to a University Hospital over 12 months. Patients with a potassium value > 6·0 mm were identified. Clinical and laboratory data were revisited, and patients with a normal anion gap metabolic acidosis were evaluated for the existence of RTA IV. A total of 57 patients having significant hyperkalaemia (>6·0 mm) were identified. Twelve patients had end-stage renal disease, while 21 patients had solely AKI or progressive chronic renal failure. RTA IV was present in 24 patients (42%), of whom 71% had pre-existing renal insufficiency because of diabetic nephropathy or tubulointerstitial nephritis. All hyperkalaemic patients with urinary/serum electrolytes suggestive of RTA IV had evidence of AKI, but creatinine levels were significantly lower (P < 0·05), while the number of drugs antagonizing the RAAS was comparable. We demonstrated that RTA IV (i) is very common in patients with hyperkalaemia; (ii) should always be suspected in hyperkalaemic patients with only moderately impaired GFR; and (iii) may result in significant hyperkalaemia in the presence of both AKI and drugs antagonizing the RAAS. © 2012 Blackwell Publishing Ltd.

A Comprehensive Functional Analysis of NTRK1 Missense Mutations Causing Hereditary Sensory and Autonomic Neuropathy Type IV (HSAN IV).

PubMed

Shaikh, Samiha S; Chen, Ya-Chun; Halsall, Sally-Anne; Nahorski, Michael S; Omoto, Kiyoyuki; Young, Gareth T; Phelan, Anne; Woods, Christopher Geoffrey

2017-01-01

Hereditary sensory and autonomic neuropathy type IV (HSAN IV) is an autosomal recessive disorder characterized by a complete lack of pain perception and anhidrosis. Here, we studied a cohort of seven patients with HSAN IV and describe a comprehensive functional analysis of seven novel NTRK1 missense mutations, c.1550G >A, c.1565G >A, c.1970T >C, c.2096T >C, c.2254T >A, c.2288G >C, and c.2311C >T, corresponding to p.G517E, p.G522E, p.L657P, p.I699T, p.C752S, p.C763S, and p.R771C, all of which were predicted pathogenic by in silico analysis. The results allowed us to assess the pathogenicity of each mutation and to gain novel insights into tropomyosin receptor kinase A (TRKA) downstream signaling. Each mutation was systematically analyzed for TRKA glycosylation states, intracellular and cell membrane expression patterns, nerve growth factor stimulated TRKA autophosphorylation, TRKA-Y496 phosphorylation, PLCγ activity, and neurite outgrowth. We showed a diverse range of functional effects: one mutation appeared fully functional, another had partial activity in all assays, one mutation affected only the PLCγ pathway and four mutations were proved null in all assays. Thus, we conclude that complete abolition of TRKA kinase activity is not the only pathogenic mechanism underlying HSAN IV. By corollary, the assessment of the clinical pathogenicity of HSAN IV mutations is more complex than initially predicted and requires a multifaceted approach. © 2016 WILEY PERIODICALS, INC.

Predicting DPP-IV inhibitors with machine learning approaches

NASA Astrophysics Data System (ADS)

Cai, Jie; Li, Chanjuan; Liu, Zhihong; Du, Jiewen; Ye, Jiming; Gu, Qiong; Xu, Jun

2017-04-01

Dipeptidyl peptidase IV (DPP-IV) is a promising Type 2 diabetes mellitus (T2DM) drug target. DPP-IV inhibitors prolong the action of glucagon-like peptide-1 (GLP-1) and gastric inhibitory peptide (GIP), improve glucose homeostasis without weight gain, edema, and hypoglycemia. However, the marketed DPP-IV inhibitors have adverse effects such as nasopharyngitis, headache, nausea, hypersensitivity, skin reactions and pancreatitis. Therefore, it is still expected for novel DPP-IV inhibitors with minimal adverse effects. The scaffolds of existing DPP-IV inhibitors are structurally diversified. This makes it difficult to build virtual screening models based upon the known DPP-IV inhibitor libraries using conventional QSAR approaches. In this paper, we report a new strategy to predict DPP-IV inhibitors with machine learning approaches involving naïve Bayesian (NB) and recursive partitioning (RP) methods. We built 247 machine learning models based on 1307 known DPP-IV inhibitors with optimized molecular properties and topological fingerprints as descriptors. The overall predictive accuracies of the optimized models were greater than 80%. An external test set, composed of 65 recently reported compounds, was employed to validate the optimized models. The results demonstrated that both NB and RP models have a good predictive ability based on different combinations of descriptors. Twenty "good" and twenty "bad" structural fragments for DPP-IV inhibitors can also be derived from these models for inspiring the new DPP-IV inhibitor scaffold design.

Alport syndrome and thin glomerular basement membrane nephropathy: a practical approach to diagnosis.

PubMed

Haas, Mark

2009-02-01

Alport syndrome and thin glomerular basement membrane nephropathy (TBMN) are genetically heterogeneous conditions characterized by structural abnormalities in the glomerular basement membrane and an initial presentation that usually involves hematuria. Approximately 40% of patients with TBMN are heterozygous carriers for autosomal recessive Alport syndrome, with mutations at the genetic locus encoding type IV collagen alpha(3) [alpha(3)(IV)] and alpha(4) chains. However, although the clinical course of TBMN is usually benign, Alport syndrome, particularly the X-linked form with mutations in the locus encoding the alpha(5) chain of type IV collagen [alpha(5)(IV)], typically results in end-stage renal disease. Electron microscopy is essential to diagnosis of TBMN and Alport syndrome on renal biopsy, although electron microscopy alone is of limited value in distinguishing between TBMN, the heterozygous carrier state of X-linked Alport syndrome, autosomal recessive Alport syndrome, and even early stages of X-linked Alport syndrome. To review diagnostic pathologic features of each of the above conditions, emphasizing the need for immunohistology for alpha(3)(IV) and alpha(5)(IV) in addition to electron microscopy to resolve this differential diagnosis on a renal biopsy. The diagnostic value of immunofluorescence studies for alpha(5)(IV) on a skin biopsy in family members of patients with Alport syndrome also is reviewed. Original and comprehensive review articles on the diagnosis of Alport syndrome and TBMN from the past 35 years, primarily the past 2 decades, and experience in our own renal pathology laboratory. Although Alport syndrome variants and TBMN do not show characteristic light microscopic findings and can be difficult to differentiate from each other even by electron microscopy, using a combination of electron microscopy and immunohistology for alpha(3)(IV) and alpha(5)(IV) enables pathologists to definitively diagnose these disorders on renal biopsy in most cases.

Clinical outcome in women with HER2-positive de novo or recurring stage IV breast cancer receiving trastuzumab-based therapy.

PubMed

Rossi, Valentina; Nolè, Franco; Redana, Stefania; Adamoli, Laura; Martinello, Rossella; Aurilio, Gaetano; Verri, Elena; Sapino, Anna; Viale, Giuseppe; Aglietta, Massimo; Montemurro, Filippo

2014-02-01

Five to 10% of women with newly diagnosed breast cancer have synchronous metastases (de novo stage IV). A further 20% will develop metastases during follow-up (recurring stage IV). We compared the clinical outcomes of women with HER2-positive metastatic breast cancer (MBC) receiving first-line trastuzumab-based therapy according to type of metastatic presentation. Retrospective analysis of 331 MBC patients receiving first-line trastuzumab-based treatment. Response rates (RR) were compared by the chi-square test. Time-to progression (TTP) and overall survival (OS) curves were compared by the log-rank test. Cox-proportional hazards models were used to study predictors of PFS and OS, including the type of metastatic presentation. Seventy-seven patients (23%) had de novo stage IV disease. Forty-six of these patients underwent surgery of the primary ("de novo/surgery"). Response rates to first-line trastuzumab-based therapy and median progression-free survival did not differ in patients with "recurring", "de novo/surgery" and "de novo" without surgery ("de novo/no surgery) stage IV breast cancer. However, women with "de novo/surgery" stage IV breast cancer had the longest median OS (60 months), and those with "de novo/no surgery" stage IV breast cancer the shortest (26 months). For women with recurring metastatic breast cancer median OS was 40 months (overall log-rank test, p < 0.01). Multivariate analysis confirmed these findings. Our analysis shows that response rates and PFS to first-line trastuzumab-based therapy do not differ significantly between de novo and recurring stage IV, HER2 positive breast cancer. The observed difference in OS favoring women with de novo stage IV disease submitted to surgery of the primary tumor could be the result of a selection bias. Copyright © 2013 Elsevier Ltd. All rights reserved.

Genome-Enabled Studies of Anaerobic, Nitrate-Dependent Iron Oxidation in the Chemolithoautotrophic Bacterium Thiobacillus denitrificans

NASA Astrophysics Data System (ADS)

Beller, H. R.; Zhou, P.; Legler, T. C.; Chakicherla, A.; O'Day, P. A.

2013-12-01

Thiobacillus denitrificans is a chemolithoautotrophic bacterium capable of anaerobic, nitrate-dependent U(IV) and Fe(II) oxidation, both of which can strongly influence the long-term efficacy of in situ reductive immobilization of uranium in contaminated aquifers. We previously identified two c-type cytochromes involved in nitrate-dependent U(IV) oxidation in T. denitrificans and hypothesized that c-type cytochromes would also catalyze Fe(II) oxidation, as they have been found to play this role in anaerobic phototrophic Fe(II)-oxidizing bacteria. Here we report on efforts to identify genes associated with nitrate-dependent Fe(II) oxidation, namely (a) whole-genome transcriptional studies [using FeCO3, Fe2+, and U(IV) oxides as electron donors under denitrifying conditions], (b) Fe(II) oxidation assays performed with knockout mutants targeting primarily highly expressed or upregulated c-type cytochromes, and (c) random transposon-mutagenesis studies with screening for Fe(II) oxidation. Assays of mutants for 26 target genes, most of which were c-type cytochromes, indicated that none of the mutants tested were significantly defective in nitrate-dependent Fe(II) oxidation. The non-defective mutants included the c1-cytochrome subunit of the cytochrome bc1 complex (complex III), which has relevance to a previously proposed role for this complex in nitrate-dependent Fe(II) oxidation and to current concepts of reverse electron transfer. Of the transposon mutants defective in Fe(II) oxidation, one mutant with a disrupted gene associated with NADH:ubiquinone oxidoreductase (complex I) was ~35% defective relative to the wild-type strain; this strain was similarly defective in nitrate reduction with thiosulfate as the electron donor. Overall, our results indicate that nitrate-dependent Fe(II) oxidation in T. denitrificans is not catalyzed by the same c-type cytochromes involved in U(IV) oxidation, nor have other c-type cytochromes yet been implicated in the process.

Genome-enabled studies of anaerobic, nitrate-dependent iron oxidation in the chemolithoautotrophic bacterium Thiobacillus denitrificans

PubMed Central

Beller, Harry R.; Zhou, Peng; Legler, Tina C.; Chakicherla, Anu; Kane, Staci; Letain, Tracy E.; A. O’Day, Peggy

2013-01-01

Thiobacillus denitrificans is a chemolithoautotrophic bacterium capable of anaerobic, nitrate-dependent U(IV) and Fe(II) oxidation, both of which can strongly influence the long-term efficacy of in situ reductive immobilization of uranium in contaminated aquifers. We previously identified two c-type cytochromes involved in nitrate-dependent U(IV) oxidation in T. denitrificans and hypothesized that c-type cytochromes would also catalyze Fe(II) oxidation, as they have been found to play this role in anaerobic phototrophic Fe(II)-oxidizing bacteria. Here we report on efforts to identify genes associated with nitrate-dependent Fe(II) oxidation, namely (a) whole-genome transcriptional studies [using FeCO3, Fe2+, and U(IV) oxides as electron donors under denitrifying conditions], (b) Fe(II) oxidation assays performed with knockout mutants targeting primarily highly expressed or upregulated c-type cytochromes, and (c) random transposon-mutagenesis studies with screening for Fe(II) oxidation. Assays of mutants for 26 target genes, most of which were c-type cytochromes, indicated that none of the mutants tested were significantly defective in nitrate-dependent Fe(II) oxidation. The non-defective mutants included the c1-cytochrome subunit of the cytochrome bc1 complex (complex III), which has relevance to a previously proposed role for this complex in nitrate-dependent Fe(II) oxidation and to current concepts of reverse electron transfer. A transposon mutant with a disrupted gene associated with NADH:ubiquinone oxidoreductase (complex I) was ~35% defective relative to the wild-type strain; this strain was similarly defective in nitrate reduction with thiosulfate as the electron donor. Overall, our results indicate that nitrate-dependent Fe(II) oxidation in T. denitrificans is not catalyzed by the same c-type cytochromes involved in U(IV) oxidation, nor have other c-type cytochromes yet been implicated in the process. PMID:24065960

Rib Cage Deformities Alter Respiratory Muscle Action and Chest Wall Function in Patients with Severe Osteogenesis Imperfecta

PubMed Central

LoMauro, Antonella; Pochintesta, Simona; Romei, Marianna; D'Angelo, Maria Grazia; Pedotti, Antonio; Turconi, Anna Carla; Aliverti, Andrea

2012-01-01

Background Osteogenesis imperfecta (OI) is an inherited connective tissue disorder characterized by bone fragility, multiple fractures and significant chest wall deformities. Cardiopulmonary insufficiency is the leading cause of death in these patients. Methods Seven patients with severe OI type III, 15 with moderate OI type IV and 26 healthy subjects were studied. In addition to standard spirometry, rib cage geometry, breathing pattern and regional chest wall volume changes at rest in seated and supine position were assessed by opto-electronic plethysmography to investigate if structural modifications of the rib cage in OI have consequences on ventilatory pattern. One-way or two-way analysis of variance was performed to compare the results between the three groups and the two postures. Results Both OI type III and IV patients showed reduced FVC and FEV1 compared to predicted values, on condition that updated reference equations are considered. In both positions, ventilation was lower in OI patients than control because of lower tidal volume (p<0.01). In contrast to OI type IV patients, whose chest wall geometry and function was normal, OI type III patients were characterized by reduced (p<0.01) angle at the sternum (pectus carinatum), paradoxical inspiratory inward motion of the pulmonary rib cage, significant thoraco-abdominal asynchronies and rib cage distortions in supine position (p<0.001). Conclusions In conclusion, the restrictive respiratory pattern of Osteogenesis Imperfecta is closely related to the severity of the disease and to the sternal deformities. Pectus carinatum characterizes OI type III patients and alters respiratory muscles coordination, leading to chest wall and rib cage distortions and an inefficient ventilator pattern. OI type IV is characterized by lower alterations in the respiratory function. These findings suggest that functional assessment and treatment of OI should be differentiated in these two forms of the disease. PMID:22558284

Transarterial Onyx embolization of intracranial dural arteriovenous fistulas: a single center experience.

PubMed

Luo, Chao-Bao; Chang, Feng-Chi; Mu-Huo Teng, Michael; Lin, Chung-Jung; Wu, Hsiu-Mei; Guo, Wan-Yuo; Chang, Cheng-Yen

2014-04-01

Transarterial embolization of intracranial dural arteriovenous fistulas (DAVFs) is usually associated with inadequate embolization. The purpose of this study was to report our experience of transarterial Onyx embolization of intracranial DAVFs with an emphasis on treatment outcome with this new embolic agent in different types of DAVFs. In the past 3 years, a total of 14 intracranial DAVFs have been treated by transarterial Onyx embolization. Among these, there were nine males and five females, aged from 30 years to 82 years (mean = 62 years). We retrospectively analyzed the injection volume and time of Onyx embolization as well as outcomes in different types of DAVFs. The locations of the DAVFs were sigmoid sinus (n = 6), tentorium (n = 3), sinus confluence (n = 2), transverse-sigmoid sinus (n = 1), sigmoid sinus-jugular bulb (n = 1) and the superior petrous sinus (n = 1). The mean volume and time of Onyx injection were 3.4 mL and 28 minutes, respectively (Cognard type I: 4.9 mL, 40 minutes; type II: 4.5 mL, 34 minutes; type III: 2.2 mL, 21 minutes; type IV: 2 mL, 22 minutes). Total fistula occlusion was achieved in six out of seven patients of type III and type IV DAVFs, and in four out of seven patients of type I and type II DAVFs. Nine patients had total resolution of their symptoms, whereas partial regression occurred in five patients. No significant periprocedural complication was found. Mean clinical follow-up period was 16 months. Transarterial Onyx embolization of intracranial DAVFs is safe and effective. This technique is particularly useful in type III and type IV DAVFs with a high cure rate, and lower volume of Onyx as well as a short injection time. Copyright © 2014. Published by Elsevier B.V.

Solar radio bursts of spectral type II, coronal shocks, and optical coronal transients

NASA Technical Reports Server (NTRS)

Maxwell, A.; Dryer, M.

1981-01-01

An examination is presented of the association of solar radio bursts of spectral type II and coronal shocks with solar flare ejecta observed in H-alpha, the green coronal line, and white-light coronagraphs. It is suggested that fast-moving optical coronal transients should for the most part be identified with piston-type phenomena well behind the outward-traveling shock waves that generate type II radio bursts. A general model is presented which relates type II radio bursts and coronal shocks to optically observed ejecta and consists of three main velocity regimes: (1) a quasi-hemispherical shock wave moving outward from the flare at speeds of 1000-2000 km/sec and Alfven Mach number of about 1.5; (2) the velocity of the piston driving the shock, on the order of 0.8 that of the shock; and (3) the regime of the slower-moving H-alpha ejecta, with velocities of 300-500 km/sec.

Analysis of Phoenix Anomalies and IV & V Findings Applied to the GRAIL Mission

NASA Technical Reports Server (NTRS)

Larson, Steve

2012-01-01

NASA IV&V was established in 1993 to improve safety and cost-effectiveness of mission critical software. Since its inception the tools and strategies employed by IV&V have evolved. This paper examines how lessons learned from the Phoenix project were developed and applied to the GRAIL project. Shortly after selection, the GRAIL project initiated a review of the issues documented by IV&V for Phoenix. The motivation was twofold: the learn as much as possible about the types of issues that arose from the flight software product line slated for use on GRAIL, and to identify opportunities for improving the effectiveness of IV&V on GRAIL. The IV&V Facility provided a database dump containing 893 issues. These were categorized into 16 bins, and then analyzed according to whether the project responded by changing the affected artifacts or using as-is. The results of this analysis were compared to a similar assessment of post-launch anomalies documented by the project. Results of the analysis were discussed with the IV&V team assigned to GRAIL. These discussions led to changes in the way both the project and IV&V approached the IV&V task, and improved the efficiency of the activity.

Activation of Ran GTPase by a Legionella Effector Promotes Microtubule Polymerization, Pathogen Vacuole Motility and Infection

PubMed Central

Rothmeier, Eva; Pfaffinger, Gudrun; Hoffmann, Christine; Harrison, Christopher F.; Grabmayr, Heinrich; Repnik, Urska; Hannemann, Mandy; Wölke, Stefan; Bausch, Andreas; Griffiths, Gareth; Müller-Taubenberger, Annette; Itzen, Aymelt; Hilbi, Hubert

2013-01-01

The causative agent of Legionnaires' disease, Legionella pneumophila, uses the Icm/Dot type IV secretion system (T4SS) to form in phagocytes a distinct “Legionella-containing vacuole” (LCV), which intercepts endosomal and secretory vesicle trafficking. Proteomics revealed the presence of the small GTPase Ran and its effector RanBP1 on purified LCVs. Here we validate that Ran and RanBP1 localize to LCVs and promote intracellular growth of L. pneumophila. Moreover, the L. pneumophila protein LegG1, which contains putative RCC1 Ran guanine nucleotide exchange factor (GEF) domains, accumulates on LCVs in an Icm/Dot-dependent manner. L. pneumophila wild-type bacteria, but not strains lacking LegG1 or a functional Icm/Dot T4SS, activate Ran on LCVs, while purified LegG1 produces active Ran(GTP) in cell lysates. L. pneumophila lacking legG1 is compromised for intracellular growth in macrophages and amoebae, yet is as cytotoxic as the wild-type strain. A downstream effect of LegG1 is to stabilize microtubules, as revealed by conventional and stimulated emission depletion (STED) fluorescence microscopy, subcellular fractionation and Western blot, or by microbial microinjection through the T3SS of a Yersinia strain lacking endogenous effectors. Real-time fluorescence imaging indicates that LCVs harboring wild-type L. pneumophila rapidly move along microtubules, while LCVs harboring ΔlegG1 mutant bacteria are stalled. Together, our results demonstrate that Ran activation and RanBP1 promote LCV formation, and the Icm/Dot substrate LegG1 functions as a bacterial Ran activator, which localizes to LCVs and promotes microtubule stabilization, LCV motility as well as intracellular replication of L. pneumophila. PMID:24068924

KSC-2009-3556

NASA Image and Video Library

2009-06-05

CAPE CANAVERAL, Fla. – At the Astrotech payload processing facility in Titusville, Fla., workers prepare to move the platform on which the encapsulated GOES-O satellite sits in preparation for moving GOES-O to Cape Canaveral Air Force Station's Launch Complex 37 pad where it will be mated with the United Launch Alliance Delta IV expendable launch vehicle. The GOES-O satellite is targeted to launch no earlier than June 26. The latest Geostationary Operational Environmental Satellite, GOES-O was developed by NASA for the National Oceanic and Atmospheric Administration, or NOAA. The GOES satellites continuously provide observations of 60 percent of the Earth including the continental United States, providing weather monitoring and forecast operations as well as a continuous and reliable stream of environmental information and severe weather warnings. Once in orbit, GOES-O will be designated GOES-14, and NASA will provide on-orbit checkout and then transfer operational responsibility to NOAA. Photo credit: NASA/Jack Pfaller

KSC-2009-3557

NASA Image and Video Library

2009-06-05

CAPE CANAVERAL, Fla. – At the Astrotech payload processing facility in Titusville, Fla., workers move the platform on which the encapsulated GOES-O satellite sits in preparation for moving GOES-O to Cape Canaveral Air Force Station's Launch Complex 37 pad where it will be mated with the United Launch Alliance Delta IV expendable launch vehicle. The GOES-O satellite is targeted to launch no earlier than June 26. The latest Geostationary Operational Environmental Satellite, GOES-O was developed by NASA for the National Oceanic and Atmospheric Administration, or NOAA. The GOES satellites continuously provide observations of 60 percent of the Earth including the continental United States, providing weather monitoring and forecast operations as well as a continuous and reliable stream of environmental information and severe weather warnings. Once in orbit, GOES-O will be designated GOES-14, and NASA will provide on-orbit checkout and then transfer operational responsibility to NOAA. Photo credit: NASA/Jack Pfaller

KSC-2009-3558

NASA Image and Video Library

2009-06-05

CAPE CANAVERAL, Fla. – At the Astrotech payload processing facility in Titusville, Fla., workers move the platform on which the encapsulated GOES-O satellite sits in preparation for moving GOES-O to Cape Canaveral Air Force Station's Launch Complex 37 pad where it will be mated with the United Launch Alliance Delta IV expendable launch vehicle. The GOES-O satellite is targeted to launch no earlier than June 26. The latest Geostationary Operational Environmental Satellite, GOES-O was developed by NASA for the National Oceanic and Atmospheric Administration, or NOAA. The GOES satellites continuously provide observations of 60 percent of the Earth including the continental United States, providing weather monitoring and forecast operations as well as a continuous and reliable stream of environmental information and severe weather warnings. Once in orbit, GOES-O will be designated GOES-14, and NASA will provide on-orbit checkout and then transfer operational responsibility to NOAA. Photo credit: NASA/Jack Pfaller

KSC-2014-3154

NASA Image and Video Library

2014-06-30

CAPE CANAVERAL, Fla. – Inside the Delta Operations Center near Space Launch Complex 37 on Cape Canaveral Air Force Station in Florida, the second stage for the United Launch Alliance Delta IV Heavy for Exploration Flight Test-1, or EFT-1, is lowered by crane into a cradle for the move to a test cell. At the Horizontal Integration Facility, all three booster stages will be processed and checked out before being moved to the nearby launch pad and hoisted into position. During the EFT-1 mission, Orion will travel farther into space than any human spacecraft has gone in more than 40 years. The data gathered during the flight will influence design decisions, validate existing computer models and innovative new approaches to space systems development, as well as reduce overall mission risks and costs for later Orion flights. Liftoff of Orion on EFT-1 is planned for fall 2014. Photo credit: NASA/Frankie Martin

KSC-2014-3152

NASA Image and Video Library

2014-06-30

CAPE CANAVERAL, Fla. – Inside the Delta Operations Center near Space Launch Complex 37 on Cape Canaveral Air Force Station in Florida, the second stage for the United Launch Alliance Delta IV Heavy for Exploration Flight Test-1, or EFT-1, is lowered by crane into a cradle for the move to a test cell. At the Horizontal Integration Facility, all three booster stages will be processed and checked out before being moved to the nearby launch pad and hoisted into position. During the EFT-1 mission, Orion will travel farther into space than any human spacecraft has gone in more than 40 years. The data gathered during the flight will influence design decisions, validate existing computer models and innovative new approaches to space systems development, as well as reduce overall mission risks and costs for later Orion flights. Liftoff of Orion on EFT-1 is planned for fall 2014. Photo credit: NASA/Frankie Martin

KSC-2014-3153

NASA Image and Video Library

2014-06-30

CAPE CANAVERAL, Fla. – Inside the Delta Operations Center near Space Launch Complex 37 on Cape Canaveral Air Force Station in Florida, the second stage for the United Launch Alliance Delta IV Heavy for Exploration Flight Test-1, or EFT-1, is lowered by crane into a cradle for the move to a test cell. At the Horizontal Integration Facility, all three booster stages will be processed and checked out before being moved to the nearby launch pad and hoisted into position. During the EFT-1 mission, Orion will travel farther into space than any human spacecraft has gone in more than 40 years. The data gathered during the flight will influence design decisions, validate existing computer models and innovative new approaches to space systems development, as well as reduce overall mission risks and costs for later Orion flights. Liftoff of Orion on EFT-1 is planned for fall 2014. Photo credit: NASA/Frankie Martin

KSC-2014-3158

NASA Image and Video Library

2014-06-30

CAPE CANAVERAL, Fla. – Inside the Delta Operations Center near Space Launch Complex 37 on Cape Canaveral Air Force Station in Florida, the second stage for the United Launch Alliance Delta IV Heavy for Exploration Flight Test-1, or EFT-1, is lifted high by crane for the move to a test cell. At the Horizontal Integration Facility, all three booster stages will be processed and checked out before being moved to the nearby launch pad and hoisted into position. During the EFT-1 mission, Orion will travel farther into space than any human spacecraft has gone in more than 40 years. The data gathered during the flight will influence design decisions, validate existing computer models and innovative new approaches to space systems development, as well as reduce overall mission risks and costs for later Orion flights. Liftoff of Orion on EFT-1 is planned for fall 2014. Photo credit: NASA/Frankie Martin

KSC-2014-3155

NASA Image and Video Library

2014-06-30

CAPE CANAVERAL, Fla. – Inside the Delta Operations Center near Space Launch Complex 37 on Cape Canaveral Air Force Station in Florida, the second stage for the United Launch Alliance Delta IV Heavy for Exploration Flight Test-1, or EFT-1, is secured in its cradle for the move to a test cell. At the Horizontal Integration Facility, all three booster stages will be processed and checked out before being moved to the nearby launch pad and hoisted into position. During the EFT-1 mission, Orion will travel farther into space than any human spacecraft has gone in more than 40 years. The data gathered during the flight will influence design decisions, validate existing computer models and innovative new approaches to space systems development, as well as reduce overall mission risks and costs for later Orion flights. Liftoff of Orion on EFT-1 is planned for fall 2014. Photo credit: NASA/Frankie Martin

Physicochemical characteristics and microbial community evolution of biofilms during the start-up period in a moving bed biofilm reactor.

PubMed

Zhu, Yan; Zhang, Yan; Ren, Hong-Qiang; Geng, Jin-Ju; Xu, Ke; Huang, Hui; Ding, Li-Li

2015-03-01

This study aimed to investigate biofilm properties evolution coupled with different ages during the start-up period in a moving bed biofilm reactor system. Physicochemical characteristics including adhesion force, extracellular polymeric substances (EPS), morphology as well as volatile solid and microbial community were studied. Results showed that the formation and development of biofilms exhibited four stages, including (I) initial attachment and young biofilm formation, (II) biofilms accumulation, (III) biofilm sloughing and updating, and (IV) biofilm maturation. During the whole start-up period, adhesion force was positively and significantly correlated with the contents of EPS, especially the content of polysaccharide. In addition, increased adhesion force and EPS were beneficial for biofilm retention. Gram-negative bacteria mainly including Sphaerotilus, Zoogloea and Haliscomenobacter were predominant in the initial stage. Actinobacteria was beneficial to resist sloughing. Furthermore, filamentous bacteria were dominant in maturation biofilm. Copyright © 2015 Elsevier Ltd. All rights reserved.

Contribution of alpha3(IV)alpha4(IV)alpha5(IV) Collagen IV to the Mechanical Properties of the Glomerular Basement Membrane

NASA Astrophysics Data System (ADS)

Gyoneva, Lazarina

The glomerular basement membrane (GBM) is a vital part of the blood-urine filtration barrier in the kidneys. In healthy GBMs, the main tension-resisting component is alpha3(IV)alpha4(IV)alpha5(IV) type IV collagen, but in some diseases it is replaced by other collagen IV isoforms. As a result, the GBM becomes leaky and disorganized, ultimately resulting in kidney failure. Our goal is to understanding the biomechanical aspects of the alpha3(IV)alpha4(IV)alpha5(IV) chains and how their absence could be responsible for (1) the initial injury to the GBM and (2) progression to kidney failure. A combination of experiments and computational models were designed for that purpose. A model basement membrane was used to compare experimentally the distensibility of tissues with the alpha3(IV)alpha4(IV)alpha5(IV) chains present and missing. The experiments showed basement membranes containing alpha3(IV)alpha4(IV)alpha5(IV) chains were less distensible. It has been postulated that the higher level of lateral cross-linking (supercoiling) in the alpha3(IV)alpha4(IV)alpha5(IV) networks contributes additional strength/stability to basement membranes. In a computational model of supercoiled networks, we found that supercoiling greatly increased the stiffness of collagen IV networks but only minimally decreased the permeability, which is well suited for the needs of the GBM. It is also known that the alpha3(IV)alpha4(IV)alpha5(IV) networks are more protected from enzymatic degradation, and we explored their significance in GBM remodeling. Our simulations showed that the more protected network was needed to prevent the system from entering a dangerous feedback cycle due to autoregulation mechanisms in the kidneys. Overall, the work adds to the evidence of biomechanical differences between the alpha3(IV)alpha4(IV)alpha5(IV) networks and other collagen IV networks, points to supercoiling as the main source of biomechanical differences, discusses the suitability of alpha3(IV)alpha4(IV)alpha5(IV) networks to meet the mechanics and permeability needs of the GBM, and explores the role of biomechanics and enzymatic digestion in GBM remodeling.

A Morphological Analysis of Gamma-Ray Burst Early-optical Afterglows

NASA Astrophysics Data System (ADS)

Gao, He; Wang, Xiang-Gao; Mészáros, Peter; Zhang, Bing

2015-09-01

Within the framework of the external shock model of gamma-ray burst (GRB) afterglows, we perform a morphological analysis of the early-optical light curves to directly constrain model parameters. We define four morphological types, i.e., the reverse shock-dominated cases with/without the emergence of the forward shock peak (Type I/Type II), and the forward shock-dominated cases without/with νm crossing the band (Type III/IV). We systematically investigate all of the Swift GRBs that have optical detection earlier than 500 s and find 3/63 Type I bursts (4.8%), 12/63 Type II bursts (19.0%), 30/63 Type III bursts (47.6%), 8/63 Type IV bursts (12.7%), and 10/63 Type III/IV bursts (15.9%). We perform Monte Carlo simulations to constrain model parameters in order to reproduce the observations. We find that the favored value of the magnetic equipartition parameter in the forward shock ({ɛ }B{{f}}) ranges from 10-6 to 10-2, and the reverse-to-forward ratio of ɛB ({{R}}B) is about 100. The preferred electron equipartition parameter {ɛ }{{e}}{{r},{{f}}} value is 0.01, which is smaller than the commonly assumed value, e.g., 0.1. This could mitigate the so-called “efficiency problem” for the internal shock model, if ɛe during the prompt emission phase (in the internal shocks) is large (say, ˜0.1). The preferred {{R}}B value is in agreement with the results in previous works that indicate a moderately magnetized baryonic jet for GRBs.

Comparative c-type cytochrome expression analysis in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C grown with soluble and insoluble oxidised metal electron acceptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nissen, Silke; Liu, Xiaoxin; Chourey, Karuna

2012-01-01

The genomes of Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C encode 40 and 69 putative c-type cytochrome genes, respectively. Deletion mutant and biochemical studies have assigned specific functions to a few c-type cytochromes involved in electron transfer to oxidised metals in Shewanella oneidensis strain MR-1. Although promising, the genetic approach is limited to gene deletions that produce a distinct phenotype, and organism for which a genetic system is available. To more comprehensively investigate and compare c-type cytochrome expression in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C, proteomic measurements were used to characterise lysates of cells grownmore » with soluble Fe(III) (as ferric citrate) and insoluble Mn(IV) (as MnO2) as electron acceptors. Strain MR-1 expressed 19 and 20, and strain 2CP-C expressed 27 and 25 c-type cytochromes when grown with Fe(III) and Mn(IV), respectively. The majority of c-type cytochromes (77% for strain MR-1 and 63% for strain 2CP-C) were expressed under both growth conditions; however, the analysis also revealed unique c-type cytochromes that were specifically expressed in cells grown with soluble Fe(III) or insoluble Mn(IV). Proteomic characterisation proved to be a promising approach for determining the c-type cytochrome complement expressed under different growth conditions, and will help elucidating the specific functions of more c-type cytochromes that are the basis for Shewanella and Anaeromyxobacter respiratory versatility.« less

The effect of display movement angle, indicator type and display location on control/display stereotype strength.

PubMed

Hoffmann, Errol R; Chan, Alan H S

2017-08-01

Much research on stereotype strength relating display and control movements for displays moving in the vertical or horizontal directions has been reported. Here we report effects of display movement angle, where the display moves at angles (relative to the vertical) of between 0° and 180°. The experiment used six different controls, four display locations relative to the operator and three types of indicator. Indicator types were included because of the strong effects of the 'scale-side principle' that are variable with display angle. A directional indicator had higher stereotype strength than a neutral indicator, and showed an apparent reversal in control/display stereotype direction beyond an angle of 90°. However, with a neutral indicator this control reversal was not present. Practitioner Summary: The effects of display moving at angles other than the four cardinal directions, types of control, location of display and types of indicator are investigated. Indicator types (directional and neutral) have an effect on stereotype strength and may cause an apparent control reversal with change of display movement angle.

The Pseudomonas aeruginosa ribbon-helix-helix DNA-binding protein AlgZ (AmrZ) controls twitching motility and biogenesis of type IV pili.

PubMed

Baynham, Patricia J; Ramsey, Deborah M; Gvozdyev, Borys V; Cordonnier, Ellen M; Wozniak, Daniel J

2006-01-01

Pseudomonas aeruginosa is an opportunistic pathogen that is commonly found in water and soil. In order to colonize surfaces with low water content, P. aeruginosa utilizes a flagellum-independent form of locomotion called twitching motility, which is dependent upon the extension and retraction of type IV pili. This study demonstrates that AlgZ, previously identified as a DNA-binding protein absolutely required for transcription of the alginate biosynthetic operon, is required for twitching motility. AlgZ may be required for the biogenesis or function of type IV pili in twitching motility. Transmission electron microscopy analysis of an algZ deletion in nonmucoid PAO1 failed to detect surface pili. To examine expression and localization of PilA (the major pilin subunit), whole-cell extracts and cell surface pilin preparations were analyzed by Western blotting. While the PilA levels present in whole-cell extracts were similar for wild-type P. aeruginosa and P. aeruginosa with the algZ deletion, the amount of PilA on the surface of the cells was drastically reduced in the algZ mutant. Analysis of algZ and algD mutants indicates that the DNA-binding activity of AlgZ is essential for the regulation of twitching motility and that this is independent of the role of AlgZ in alginate expression. These data show that AlgZ DNA-binding activity is required for twitching motility independently of its role in alginate production and that this involves the surface localization of type IV pili. Given this new role in twitching motility, we propose that algZ (PA3385) be designated amrZ (alginate and motility regulator Z).

Diagnostic accuracy study of anorectal manometry for diagnosis of dyssynergic defaecation

PubMed Central

Grossi, Ugo; Carrington, Emma V; Bharucha, Adil E; Horrocks, Emma J; Scott, S Mark; Knowles, Charles H

2015-01-01

Objective The diagnostic accuracy of anorectal manometry (AM), which is necessary to diagnose functional defaecatory disorders (FDD), is unknown. Using blinded analysis and standardised reporting of diagnostic accuracy (STARD), we evaluated whether AM could discriminate between asymptomatic controls and patients with functional constipation (FC). Design Derived line-plots of anorectal pressure profiles during simulated defaecation were independently analysed in random order by 3 expert observers blinded to health status in 85 women with FC and 85 age-matched asymptomatic healthy volunteers (HV). Using accepted criteria, these pressure profiles were characterized as normal (i.e. increased rectal pressure coordinated with anal relaxation) or types I-IV dyssynergia. Inter-observer agreement and diagnostic accuracy were determined. Results Blinded consensus-based assessment disclosed a normal pattern in 16/170 (9%) of all participants and only 11/85 (13%) HV. The combined frequency of dyssynergic patterns (I-IV) was very similar in FC (80/85 [94%]) and HV (74/85 [87%]). Type I dyssynergia (‘paradoxical’ contraction) was less prevalent in FC (17/85 [20%] than HV (31/85 [36.5%], p=0.03). After statistical correction, only type IV dyssynergia was moderately useful for discriminating between FC (39/85 [46%] and HV 17/85 [20%], p=0.001, PPV=70.0%, positive LR=2.3). Inter-observer agreement was substantial or moderate for identifying a normal pattern, dyssynergia types I and IV, and FDD, and fair for types II and III. Conclusions While the interpretation of AM patterns is reproducible, nearly 90% of HV have a pattern that is currently regarded as “abnormal” by AM. Hence AM is of limited utility for distinguishing between FC and HV. PMID:25765461

Does microvascularization of the footprint play a role in rotator cuff healing of the shoulder?

PubMed

Bonnevialle, Nicolas; Bayle, Xavier; Faruch, Marie; Wargny, Matthieu; Gomez-Brouchet, Anne; Mansat, Pierre

2015-08-01

The aim of the study was to evaluate the relationship between bone microvascularization of the footprint and tendon integrity after rotator cuff repair of the shoulder. Forty-eight patients (mean age, 59 years; ±7.9) with a chronic rotator cuff tear underwent a tendon repair with a single-row technique and were studied prospectively. A core obtained from the footprint during the procedure allowed determination of the bone's microvascularization with an immunohistochemistry technique using anti-CD34 antibodies. Clinical evaluation was performed at a minimum of 12-month follow-up, and rotator cuff integrity was assessed with ultrasound according to Sugaya's classification. At a mean follow-up of 13 months, the Constant score improved from 40 to 75 points; American Shoulder and Elbow Surgeons score, from 59 to 89 points; and subjective shoulder value, from 38% to 83% (P < .001). Ultrasound identified 18 patients with Sugaya type I healing, 27 patients with type II, and 3 patients with type IV. No patients showed Sugaya type III or V repairs. The rate of microvascularization of the footprint was 15.6%, 13.9%, and 4.2% for type I, II, and IV tendon integrity, respectively (I vs. II, P = .22; II vs. IV, P = .02; I vs. IV, P = .0022). Patients with a history of corticosteroid injection had a lower rate of microvascularization than the others (10.3% vs. 16.2%; P = .03). Even if overall satisfactory clinical outcomes are achieved after a rotator cuff repair, bone microvascularization of the footprint plays a role in rotator cuff healing. A lower rate of microvessels decreases the tendon integrity and healing potential after repair. Copyright © 2015 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

On the source of flare-ejecta responsible for geomagnetic storms

NASA Technical Reports Server (NTRS)

Sakurai, K.

1974-01-01

It is shown that magnetic bottles as the sources of moving metric type 4 bursts are not responsible for the development of geomagnetic storms, despite the fact that shock waves producing type 2 bursts are the sources of the interplanetary shock waves, which produce SSC's on the geomagnetic field. These magnetic bottles, in general, tend to move in the solar envelope with the speed of several hundred Km/sec at most, which is much slower than that of the motion of type 2 radio sources.

A case of mild phenotype Alport syndrome caused by COL4A3 mutations.

PubMed

Kamijo, Masafumi; Kitamura, Mineaki; Muta, Kumiko; Uramatsu, Tadashi; Obata, Yoko; Nozu, Kandai; Kaito, Hiroshi; Iijima, Kazumoto; Mukae, Hiroshi; Nishino, Tomoya

2017-11-01

In a case of 41-year-old man with mild nephropathy, Alport syndrome (AS) was diagnosed from the renal biopsy. However, the α5 chain of type IV collagen expressed in the glomerular basement membrane, which was the atypical staining pattern of AS. Genetic testing suggested autosomal recessive AS from heterozygous mutations at two positions in the type IV collagen α3 chain. These two gene mutations represented a new pattern of mutation and was suggested the association with an atypical α5 chain expression and mild phenotype.

Bacteria use type IV pili to walk upright and detach from surfaces.

PubMed

Gibiansky, Maxsim L; Conrad, Jacinta C; Jin, Fan; Gordon, Vernita D; Motto, Dominick A; Mathewson, Margie A; Stopka, Wiktor G; Zelasko, Daria C; Shrout, Joshua D; Wong, Gerard C L

2010-10-08

Bacterial biofilms are structured multicellular communities involved in a broad range of infections. Knowing how free-swimming bacteria adapt their motility mechanisms near surfaces is crucial for understanding the transition between planktonic and biofilm phenotypes. By translating microscopy movies into searchable databases of bacterial behavior, we identified fundamental type IV pili-driven mechanisms for Pseudomonas aeruginosa surface motility involved in distinct foraging strategies. Bacteria stood upright and "walked" with trajectories optimized for two-dimensional surface exploration. Vertical orientation facilitated surface detachment and could influence biofilm morphology.

Catalase-loaded cisplatin-prodrug-constructed liposomes to overcome tumor hypoxia for enhanced chemo-radiotherapy of cancer.

PubMed

Zhang, Rui; Song, Xuejiao; Liang, Chao; Yi, Xuan; Song, Guosheng; Chao, Yu; Yang, Yu; Yang, Kai; Feng, Liangzhu; Liu, Zhuang

2017-09-01

Aiming at improved therapeutic efficacies, the combination of chemotherapy and radiotherapy (chemo-radiotherapy) has been widely studied and applied in clinic. However, the hostile characteristics of tumor microenvironment such as hypoxia often limit the efficacies in both types of cancer therapies. Herein, catalase (CAT), an antioxidant enzyme, is encapsulated inside liposomes constituted by cisplatin (IV)-prodrug-conjugated phospholipid, forming CAT@Pt (IV)-liposome for enhanced chemo-radiotherapy of cancer. After being loaded inside liposomes, CAT within CAT@Pt (IV)-liposome shows retained and well-protected enzyme activity, and is able to trigger decomposition of H 2 O 2 produced by tumor cells, so as to produce additional oxygen for hypoxia relief. As the result, treatment of CAT@Pt (IV)-liposome induces the highest level of DNA damage in cancer cells after X-ray radiation compared to the control groups. In vivo tumor treatment further demonstrates a remarkably improved therapeutic outcome in chemo-radiotherapy with such CAT@Pt (IV)-liposome nanoparticles. Hence, an exquisite type of liposome-based nanoparticles is developed in this work by integrating cisplatin-based chemotherapy and catalase-induced tumor hypoxia relief together for combined chemo-radiotherapy with great synergistic efficacy, promising for clinical translation in cancer treatment. Copyright © 2017. Published by Elsevier Ltd.

Pelvic Arterial Anatomy Relevant to Prostatic Artery Embolisation and Proposal for Angiographic Classification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Assis, André Moreira de, E-mail: andre.maa@gmail.com; Moreira, Airton Mota, E-mail: motamoreira@gmail.com; Paula Rodrigues, Vanessa Cristina de, E-mail: vanessapaular@yahoo.com.br

PurposeTo describe and categorize the angiographic findings regarding prostatic vascularization, propose an anatomic classification, and discuss its implications for the PAE procedure.MethodsAngiographic findings from 143 PAE procedures were reviewed retrospectively, and the origin of the inferior vesical artery (IVA) was classified into five subtypes as follows: type I: IVA originating from the anterior division of the internal iliac artery (IIA), from a common trunk with the superior vesical artery (SVA); type II: IVA originating from the anterior division of the IIA, inferior to the SVA origin; type III: IVA originating from the obturator artery; type IV: IVA originating from themore » internal pudendal artery; and type V: less common origins of the IVA. Incidences were calculated by percentage.ResultsTwo hundred eighty-six pelvic sides (n = 286) were analyzed, and 267 (93.3 %) were classified into I–IV types. Among them, the most common origin was type IV (n = 89, 31.1 %), followed by type I (n = 82, 28.7 %), type III (n = 54, 18.9 %), and type II (n = 42, 14.7 %). Type V anatomy was seen in 16 cases (5.6 %). Double vascularization, defined as two independent prostatic branches in one pelvic side, was seen in 23 cases (8.0 %).ConclusionsDespite the large number of possible anatomical variations of male pelvis, four main patterns corresponded to almost 95 % of the cases. Evaluation of anatomy in a systematic fashion, following a standard classification, will make PAE a faster, safer, and more effective procedure.« less

Management of inferior vena cava aneurysm.

PubMed

Montero-Baker, M F; Branco, B C; Leon, L L; Labropoulos, N; Echeverria, A; Mills, J L

2015-10-01

Inferior vena cava (IVC) aneurysm is an infrequent but potentially lethal abnormality. We have seen one such case in our group practice. We have added this case to a review of 53 previously reported cases in order to develop a management algorithm for this entity. We conducted a MedLine search of all English-language articles from the first reported case in 1950 through August 2013. Patient demographics, clinical data, management and outcomes were extracted. IVC aneurysms were categorized in 4 types as per Gradman and Steinberg classification. The mean patient age was 27.1 years (range 5-89) and 57.4% were male. A total of 11 (20.3%) had associated vascular anomalies and iliocaval thrombosis was found in 10 (18.5%). There were 23 type I aneurysms, 8 type IIs, 21 type IIIs and 2 type IVs. All but 1 type I was successfully managed conservatively without complications. For type IIs, only 3 patients were managed conservatively with 1 death related to stroke from paradoxical embolus. For type IIIs, resection was the most common management option (14 patients). One patient was treated endovascularly with aneurysm embolization. A total of 6 asymptomatic patients were treated conservatively with 1 death due to thromboembolism. For type IVs, all cases underwent expectant management with 1 death due to aneurysm rupture. IVC aneurysms are rare with only 54 cases reported in the literature. Associated vascular anomalies and iliocaval thrombosis should be expected in approximately 20% of cases. Type I aneurysms can be managed expectantly with close surveillance unless symptomatic. For type II-IV, surgical consideration should be given based on high rates of thromboembolic complications and non-negligible risk of rupture.

Decreased fracture rate, pharmacogenetics and BMD response in 79 Swedish children with osteogenesis imperfecta types I, III and IV treated with Pamidronate.

PubMed

Lindahl, K; Kindmark, A; Rubin, C-J; Malmgren, B; Grigelioniene, G; Söderhäll, S; Ljunggren, Ö; Åström, E

2016-06-01

Osteogenesis imperfecta (OI) is an inherited heterogeneous bone fragility disorder, usually caused by collagen I mutations. It is well established that bisphosphonate treatment increases lumbar spine (LS) bone mineral density (BMD), as well as improves vertebral geometry in severe OI; however, fracture reduction has been difficult to prove, pharmacogenetic studies are scarce, and it is not known at which age, or severity of disease, treatment should be initiated. COL1A1 and COL1A2 were analyzed in 79 children with OI (type I n=33, type III n=25 and type IV n=21) treated with Pamidronate. Data on LS BMD, height, and radiologically confirmed non-vertebral and vertebral fractures were collected prior to, and at several time points during treatment. An increase in LS BMD Z-score was observed for all types of OI, and a negative correlation to Δ LS BMD was observed for both age and LS BMD Z-score at treatment initiation. Supine height Z-scores were not affected by Pamidronate treatment, The fracture rate was reduced for all OI types at all time points during treatment (overall p<0.0003, <0.0001 and 0.0003 for all OI types I, III and IV respectively). The reduced fracture rate was maintained for types I and IV, while an additional decrease was observed over time for type III. The fracture rate was reduced also in individuals with continued low BMD after >4yrs Pamidronate. Twice as many boys as girls with OI type I were treated with Pamidronate, and the fracture rate the year prior treatment was 2.2 times higher for boys (p=0.0236). Greater Δ LS BMD, but smaller Δ fracture numbers were observed on Pamidronate for helical glycine mutations in COL1A1 vs. COL1A2. Vertebral compression fractures did not progress in any individual during treatment; however, they did not improve in 9%, and these individuals were all >11years of age at treatment initiation (p<0.0001). Pamidronate treatment in children with all types of OI increased LS BMD, decreased fracture rate, and improved vertebral compression fractures. Fracture reduction was prompt and maintained during treatment, irrespective of age at treatment initiation and collagen I mutation type. Copyright © 2016 Elsevier Inc. All rights reserved.

Love-type wave propagation in a pre-stressed viscoelastic medium influenced by smooth moving punch

NASA Astrophysics Data System (ADS)

Singh, A. K.; Parween, Z.; Chatterjee, M.; Chattopadhyay, A.

2015-04-01

In the present paper, a mathematical model studying the effect of smooth moving semi-infinite punch on the propagation of Love-type wave in an initially stressed viscoelastic strip is developed. The dynamic stress concentration due to the punch for the force of a constant intensity has been obtained in the closed form. Method based on Weiner-hopf technique which is indicated by Matczynski has been employed. The study manifests the significant effect of various affecting parameters viz. speed of moving punch associated with Love-type wave speed, horizontal compressive/tensile initial stress, vertical compressive/tensile initial stress, frequency parameter, and viscoelastic parameter on dynamic stress concentration due to semi-infinite punch. Moreover, some important peculiarities have been traced out and depicted by means of graphs.

The lateral mobility of cell adhesion molecules is highly restricted at septate junctions in Drosophila.

PubMed

Laval, Monique; Bel, Christophe; Faivre-Sarrailh, Catherine

2008-07-18

A complex of three cell adhesion molecules (CAMs) Neurexin IV(Nrx IV), Contactin (Cont) and Neuroglian (Nrg) is implicated in the formation of septate junctions between epithelial cells in Drosophila. These CAMs are interdependent for their localization at septate junctions and e.g. null mutation of nrx IV or cont induces the mislocalization of Nrg to the baso-lateral membrane. These mutations also result in ultrastructural alteration of the strands of septate junctions and breakdown of the paracellular barrier. Varicose (Vari) and Coracle (Cora), that both interact with the cytoplasmic tail of Nrx IV, are scaffolding molecules required for the formation of septate junctions. We conducted photobleaching experiments on whole living Drosophila embryos to analyze the membrane mobility of CAMs at septate junctions between epithelial cells. We show that GFP-tagged Nrg and Nrx IV molecules exhibit very stable association with septate junctions in wild-type embryos. Nrg-GFP is mislocalized to the baso-lateral membrane in nrx IV or cont null mutant embryos, and displays increased mobile fraction. Similarly, Nrx IV-GFP becomes distributed to the baso-lateral membrane in null mutants of vari and cora, and its mobile fraction is strongly increased. The loss of Vari, a MAGUK protein that interacts with the cytoplasmic tail of Nrx IV, has a stronger effect than the null mutation of nrx IV on the lateral mobility of Nrg-GFP. The strands of septate junctions display a stable behavior in vivo that may be correlated with their role of paracellular barrier. The membrane mobility of CAMs is strongly limited when they take part to the multimolecular complex forming septate junctions. This restricted lateral diffusion of CAMs depends on both adhesive interactions and clustering by scaffolding molecules. The lateral mobility of CAMs is strongly increased in embryos presenting alteration of septate junctions. The stronger effect of vari by comparison with nrx IV null mutation supports the hypothesis that this scaffolding molecule may cross-link different types of CAMs and play a crucial role in stabilizing the strands of septate junctions.

Apolipoprotein A-IV concentrations and clinical outcomes in haemodialysis patients with type 2 diabetes mellitus--a post hoc analysis of the 4D Study.

PubMed

Kollerits, B; Krane, V; Drechsler, C; Lamina, C; März, W; Ritz, E; Wanner, C; Kronenberg, F

2012-12-01

Apolipoprotein A-IV (apoA-IV) is an anti-atherogenic and anti-oxidative plasma glycoprotein involved in reverse cholesterol transport. The aim of this study was to examine the association between apoA-IV and all-cause mortality, cardiovascular endpoints and parameters of protein-energy wasting and nutrition in haemodialysis patients. This post hoc analysis was performed in the German Diabetes Dialysis Study (4D Study) evaluating atorvastatin in 1255 haemodialysis patients with type 2 diabetes mellitus, followed for a median of 4 years. The association between apoA-IV and relevant outcomes was analysed using Cox proportional hazards regression analyses. Body mass index (BMI) was used as a marker of protein-energy wasting. In addition, a definition of extended wasting was applied, combining median values of BMI, serum albumin, creatinine and sensitive C-reactive protein, to classify patients. Mean (±SD) apoA-IV concentration was 49.8 ± 14.2 mg dL(-1). Age- and gender-adjusted apoA-IV concentrations were strongly associated with the presence of congestive heart failure at baseline [odds ratio = 0.81, 95% confidence interval (CI) 0.74-0.88 per 10 mg dL(-1) increase; P < 0.001). During the prospective follow-up, the strongest association was found for all-cause mortality [hazard ratio (HR) = 0.89, 95% CI 0.85-0.95, P = 0.001), which was mainly because of patients with BMI > 23 kg m(-2) (HR = 0.87, 95% CI 0.82-0.94, P < 0.001) and those in the nonwasting group according to the extended definition (HR = 0.89, 95% CI 0.84-0.96, P = 0.001). This association remained significant after additionally adjusting for parameters associated with apoA-IV at baseline. Further associations were observed for sudden cardiac death. ApoA-IV was less strongly associated with atherogenic events such as myocardial infarction. Low apoA-IV levels seem to be a risk predictor of all-cause mortality and sudden cardiac death. This association might be modified by nutritional status. © 2012 The Association for the Publication of the Journal of Internal Medicine.

Comparison of efficacies of a dipeptidyl peptidase IV inhibitor and alpha-glucosidase inhibitors in oral carbohydrate and meal tolerance tests and the effects of their combination in mice.

PubMed

Yamazaki, Kazuto; Inoue, Takashi; Yasuda, Nobuyuki; Sato, Yoshiaki; Nagakura, Tadashi; Takenaka, Osamu; Clark, Richard; Saeki, Takao; Tanaka, Isao

2007-05-01

E3024 (3-but-2-ynyl-5-methyl-2-piperazin-1-yl-3,5-dihydro-4H-imidazo[4,5-d]pyridazin-4-one tosylate) is a dipeptidyl peptidase IV (DPP-IV) inhibitor. Since the target of both DPP-IV inhibitors and alpha-glucosidase inhibitors is the lowering of postprandial hyperglycemia, we compared antihyperglycemic effects for E3024 and alpha-glucosidase inhibitors in various oral carbohydrate and meal tolerance tests using normal mice. In addition, we investigated the combination effects of E3024 and voglibose on blood glucose levels in a meal tolerance test using mice fed a high-fat diet. ER-235516-15 (the trifluoroacetate salt form of E3024, 1 mg/kg) lowered glucose excursions consistently, regardless of the kind of carbohydrate loaded. However, the efficacy of acarbose (10 mg/kg) and of voglibose (0.1 mg/kg) varied with the type of carbohydrate administered. The combination of E3024 (3 mg/kg) and voglibose (0.3 mg/kg) improved glucose tolerance additively, with the highest plasma active glucagon-like peptide-1 levels. This study shows that compared to alpha-glucosidase inhibitors, DPP-IV inhibitors may have more consistent efficacy to reduce postprandial hyperglycemia, independent of the types of carbohydrate contained in a meal, and that the combination of a DPP-IV inhibitor and an alpha-glucosidase inhibitor is expected to be a promising option for lowering postprandial hyperglycemia.

Bowel perforation in type IV vascular Ehlers-Danlos syndrome. A systematic review.

PubMed

El Masri, H; Loong, T-H; Meurette, G; Podevin, J; Zinzindohoue, F; Lehur, P-A

2018-05-01

Spontaneous gastrointestinal (GI) perforation is a well-known complication occurring in patients suffering from Type IV vascular Ehlers-Danlos syndrome (EDS IV). The aim of the present study was to review the current literature on spontaneous GI perforation in EDS IV and illustrate the surgical management and outcome when possible. A systematic review of all the published data on EDS IV patients with spontaneous GI perforation between January 2000 and December 2015 was conducted using three major databases PUBMED, EMBASE, and Cochrane Central Register of Controlled Trails. References of the selected articles were screened to avoid missing main articles. Twenty-seven published case reports and four retrospective studies, including 31 and 527 cases, respectively, matched the search criteria. A case from our institution was added. Mean age was 26 years (range 6-64 years). The most frequent site of perforation was the colon, particularly the sigmoid, followed by small bowel, upper rectum, and finally stomach. The majority of cases were initially managed with Hartmann's procedure. In recurrent perforations, total colectomy was performed. The reperforation rate was considerably higher in the "partial colectomy with anastomosis" group than in the Hartmann group. Colonic perforation is the most common spontaneous GI perforation in EDS IV patients. An unexpected fragility of the tissues should raise the possibility of a connective tissue disorder and prompt further investigation with eventual management of these high-risk patients with a multidisciplinary team approach in dedicated centres. In the emergency setting, a Hartmann procedure should be performed.

Molecular Characterization of Methicillin-Resistant Staphylococcus aureus Isolates, Isolated from a Burn Hospital in Southwest Iran in 2006 and 2014.

PubMed

Ghaznavi-Rad, Ehsanollah; Ekrami, Alireza

2018-01-01

Incidence of methicillin-resistant Staphylococcus aureus (MRSA) is increasing every year, especially in burn patients with a high rate of morbidity and mortality. Molecular and epidemiologic studies are useful practices for understanding the relatedness of isolates in a single patient or a hospital. This study aimed at determining molecular characterizations of isolates collected in 2006 and 2014 using S. aureus -specific staphylococcal protein A (Spa) typing and Multilocus Sequence Typing (MLST) methods. Totally, 71 MRSA isolates were collected during the last two studies (2006 and 2014) from burn patients at Taleghani Burn Centre. After confirmation, all isolates were analysed using MLST and Spa typing methods. We reported the emergence of Spa type t021, ST-30-IV MRSA isolates, which were PVL-positive in 14.6% of the cases and t12366, ST-8-IV isolates, which were PVL-negative in 9.8% of the cases. In 2014 study, Spa typing of MRSA isolates revealed five different spa types. Overall, in two studies, t037, ST-239, SCC mec III, and CC8 were predominant clones and they were reported in 63% of the cases. The predominance of ST-239 in this region during the last eight years is a major concern. It also has a disturbing impact on the management of staphylococcal infections. Moreover, the SCC mec type IV strain is able to disseminate rapidly in hospital environments, demanding an improvement in infection-control policy.

Polyglycine hydrolases secreted by Pleosporineae fungi that target the linker region of plant class IV chitinases*

USDA-ARS?s Scientific Manuscript database

Chitinase modifying proteins (cmps) are fungal proteases that truncate plant class IV chitinases by cleaving near their amino termini. We previously described Fv-cmp, a fungalysin protease that cleaves a conserved glycine-cysteine bond within the hevein domain. Here we describe a new type of cmp—pol...

Antimicrobial peptide inhibition of fungalysin proteases that target plant type 19 Family IV defense chitinases

USDA-ARS?s Scientific Manuscript database

Cereal crops and other plants produce secreted seed chitinases that reduce pathogenic infection, most likely by targeting the fungal chitinous cell wall. We have shown that corn (Zea mays) produces three GH family 19, plant class IV chitinases, that help in protecting the plant against Fusarium and ...

Least Squares Moving-Window Spectral Analysis.

PubMed

Lee, Young Jong

2017-08-01

Least squares regression is proposed as a moving-windows method for analysis of a series of spectra acquired as a function of external perturbation. The least squares moving-window (LSMW) method can be considered an extended form of the Savitzky-Golay differentiation for nonuniform perturbation spacing. LSMW is characterized in terms of moving-window size, perturbation spacing type, and intensity noise. Simulation results from LSMW are compared with results from other numerical differentiation methods, such as single-interval differentiation, autocorrelation moving-window, and perturbation correlation moving-window methods. It is demonstrated that this simple LSMW method can be useful for quantitative analysis of nonuniformly spaced spectral data with high frequency noise.

Poole-Frenkel effect on electrical characterization of Al-doped ZnO films deposited on p-type GaN

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Bohr-Ran; Liao, Chung-Chi; Ke, Wen-Cheng, E-mail: wcke@saturn.yzu.edu.tw

2014-03-21

This paper presents the electrical properties of Al-doped ZnO (AZO) films directly grown on two types of p-type GaN thin films. The low-pressure p-GaN thin films (LP-p-GaN) exhibited structural properties of high-density edge-type threading dislocations (TDs) and compensated defects (i.e., nitrogen vacancy). Compared with high-pressure p-GaN thin films (HP-p-GaN), X-ray photoemission spectroscopy of Ga 3d core levels indicated that the surface Fermi-level shifted toward the higher binding-energy side by approximately 0.7 eV. The high-density edge-type TDs and compensated defects enabled surface Fermi-level shifting above the intrinsic Fermi-level, causing the surface of LP-p-GaN thin films to invert to n-type semiconductor. A highlymore » nonlinear increase in leakage current regarding reverse-bias voltage was observed for AZO/LP-p-GaN. The theoretical fits for the reverse-bias voltage region indicated that the field-assisted thermal ionization of carriers from defect associated traps, which is known as the Poole-Frenkel effect, dominated the I-V behavior of AZO/LP-p-GaN. The fitting result estimated the trap energy level at 0.62 eV below the conduction band edge. In addition, the optical band gap increased from 3.50 eV for as-deposited AZO films to 3.62 eV for 300 °C annealed AZO films because of the increased carrier concentration. The increasing Fermi-level of the 300 °C annealed AZO films enabled the carrier transport to move across the interface into the LP-p-GaN thin films without any thermal activated energy. Thus, the Ohmic behavior of AZO contact can be achieved directly on the low-pressure p-GaN films at room temperature.« less

Poole-Frenkel effect on electrical characterization of Al-doped ZnO films deposited on p-type GaN

NASA Astrophysics Data System (ADS)

Huang, Bohr-Ran; Liao, Chung-Chi; Ke, Wen-Cheng; Chang, Yuan-Ching; Huang, Hao-Ping; Chen, Nai-Chuan

2014-03-01

This paper presents the electrical properties of Al-doped ZnO (AZO) films directly grown on two types of p-type GaN thin films. The low-pressure p-GaN thin films (LP-p-GaN) exhibited structural properties of high-density edge-type threading dislocations (TDs) and compensated defects (i.e., nitrogen vacancy). Compared with high-pressure p-GaN thin films (HP-p-GaN), X-ray photoemission spectroscopy of Ga 3d core levels indicated that the surface Fermi-level shifted toward the higher binding-energy side by approximately 0.7 eV. The high-density edge-type TDs and compensated defects enabled surface Fermi-level shifting above the intrinsic Fermi-level, causing the surface of LP-p-GaN thin films to invert to n-type semiconductor. A highly nonlinear increase in leakage current regarding reverse-bias voltage was observed for AZO/LP-p-GaN. The theoretical fits for the reverse-bias voltage region indicated that the field-assisted thermal ionization of carriers from defect associated traps, which is known as the Poole-Frenkel effect, dominated the I-V behavior of AZO/LP-p-GaN. The fitting result estimated the trap energy level at 0.62 eV below the conduction band edge. In addition, the optical band gap increased from 3.50 eV for as-deposited AZO films to 3.62 eV for 300 °C annealed AZO films because of the increased carrier concentration. The increasing Fermi-level of the 300 °C annealed AZO films enabled the carrier transport to move across the interface into the LP-p-GaN thin films without any thermal activated energy. Thus, the Ohmic behavior of AZO contact can be achieved directly on the low-pressure p-GaN films at room temperature.

Validity of DSM-IV attention deficit/hyperactivity disorder symptom dimensions and subtypes.

PubMed

Willcutt, Erik G; Nigg, Joel T; Pennington, Bruce F; Solanto, Mary V; Rohde, Luis A; Tannock, Rosemary; Loo, Sandra K; Carlson, Caryn L; McBurnett, Keith; Lahey, Benjamin B

2012-11-01

Diagnostic and Statistical Manual of Mental Disorders, 4th Edition (DSM-IV) criteria for attention deficit/hyperactivity disorder (ADHD) specify two dimensions of inattention and hyperactivity-impulsivity symptoms that are used to define three nominal subtypes: predominantly hyperactive-impulsive type (ADHD-H), predominantly inattentive type (ADHD-I), and combined type (ADHD-C). To aid decision making for DSM-5 and other future diagnostic systems, a comprehensive literature review and meta-analysis of 546 studies was completed to evaluate the validity of the DSM-IV model of ADHD. Results indicated that DSM-IV criteria identify individuals with significant and persistent impairment in social, academic, occupational, and adaptive functioning when intelligence, demographic factors, and concurrent psychopathology are controlled. Available data overwhelmingly support the concurrent, predictive, and discriminant validity of the distinction between inattention and hyperactivity-impulsivity symptoms, and indicate that nearly all differences among the nominal subtypes are consistent with the relative levels of inattention and hyperactivity-impulsivity symptoms that define the subtypes. In contrast, the DSM-IV subtype model is compromised by weak evidence for the validity of ADHD-H after first grade, minimal support for the distinction between ADHD-I and ADHD-C in studies of etiological influences, academic and cognitive functioning, and treatment response, and the marked longitudinal instability of all three subtypes. Overall, we conclude that the DSM-IV ADHD subtypes provide a convenient clinical shorthand to describe the functional and behavioral correlates of current levels of inattention and hyperactivity-impulsivity symptoms, but do not identify discrete subgroups with sufficient long-term stability to justify the classification of distinct forms of the disorder. Empirical support is stronger for an alternative model that would replace the subtypes with dimensional modifiers that reflect the number of inattention and hyperactivity-impulsivity symptoms at the time of assessment. (PsycINFO Database Record (c) 2012 APA, all rights reserved).

Molecular and Functional Effects of a Splice Site Mutation in the MYL2 Gene Associated with Cardioskeletal Myopathy and Early Cardiac Death in Infants

PubMed Central

Zhou, Zhiqun; Huang, Wenrui; Liang, Jingsheng; Szczesna-Cordary, Danuta

2016-01-01

The homozygous appearance of the intronic mutation (IVS6-1) in the MYL2 gene encoding for myosin ventricular/slow-twitch skeletal regulatory light chain (RLC) was recently linked to the development of slow skeletal muscle fiber type I hypotrophy and early cardiac death. The IVS6-1 (c403-1G>C) mutation resulted from a cryptic splice site in MYL2 causing a frameshift and replacement of the last 32 codons by 19 different amino acids in the RLC mutant protein. Infants who were IVS6-1+∕+-positive died between 4 and 6 months of age due to cardiomyopathy and heart failure. In this report we have investigated the molecular mechanism and functional consequences associated with the IVS6-1 mutation using recombinant human cardiac IVS6-1 and wild-type (WT) RLC proteins. Recombinant proteins were reconstituted into RLC-depleted porcine cardiac muscle preparations and subjected to enzymatic and functional assays. IVS6-1-RLC showed decreased binding to the myosin heavy chain (MHC) compared with WT, and IVS6-1-reconstituted myosin displayed reduced binding to actin in rigor. The IVS6-1 myosin demonstrated a significantly lower Vmax of the actin-activated myosin ATPase activity compared with WT. In stopped-flow experiments, IVS6-1 myosin showed slower kinetics of the ATP induced dissociation of the acto-myosin complex and a significantly reduced slope of the kobs-[MgATP] relationship compared to WT. In skinned porcine cardiac muscles, RLC-depleted and IVS6-1 reconstituted muscle strips displayed a significant decrease in maximal contractile force and a significantly increased Ca2+ sensitivity, both hallmarks of hypertrophic cardiomyopathy-associated mutations in MYL2. Our results showed that the amino-acid changes in IVS6-1 were sufficient to impose significant conformational alterations in the RLC protein and trigger a series of abnormal protein-protein interactions in the cardiac muscle sarcomere. Notably, the mutation disrupted the RLC-MHC interaction and the steady-state and kinetics of the acto-myosin interaction. Specifically, slower myosin cross-bridge turnover rates and slower second-order MgATP binding rates of acto-myosin interactions were observed in IVS6-1 vs. WT reconstituted cardiac preparations. Our in vitro results suggest that when placed in vivo, IVS6-1 may lead to cardiomyopathy and early death of homozygous infants by severely compromising the ability of myosin to develop contractile force and maintain normal systolic and diastolic cardiac function. PMID:27378946

Singular F(R) cosmology unifying early- and late-time acceleration with matter and radiation domination era

NASA Astrophysics Data System (ADS)

Odintsov, S. D.; Oikonomou, V. K.

2016-06-01

We present some cosmological models which unify the late- and early-time acceleration eras with the radiation and the matter domination era, and we realize the cosmological models by using the theoretical framework of F(R) gravity. Particularly, the first model unifies the late- and early-time acceleration with the matter domination era, and the second model unifies all the evolution eras of our Universe. The two models are described in the same way at early and late times, and only the intermediate stages of the evolution have some differences. Each cosmological model contains two Type IV singularities which are chosen to occur one at the end of the inflationary era and one at the end of the matter domination era. The cosmological models at early times are approximately identical to the R 2 inflation model, so these describe a slow-roll inflationary era which ends when the slow-roll parameters become of order one. The inflationary era is followed by the radiation era and after that the matter domination era follows, which lasts until the second Type IV singularity, and then the late-time acceleration era follows. The models have two appealing features: firstly they produce a nearly scale invariant power spectrum of primordial curvature perturbations and a scalar-to-tensor ratio which are compatible with the most recent observational data and secondly, it seems that the deceleration-acceleration transition is crucially affected by the presence of the second Type IV singularity which occurs at the end of the matter domination era. As we demonstrate, the Hubble horizon at early times shrinks, as expected for an initially accelerating Universe, then during the matter domination era, it expands and finally after the Type IV singularity, the Hubble horizon starts to shrink again, during the late-time acceleration era. Intriguingly enough, the deceleration-acceleration transition, occurs after the second Type IV singularity. In addition, we investigate which F(R) gravity can successfully realize each of the four cosmological epochs.

Using type IV Pearson distribution to calculate the probabilities of underrun and overrun of lists of multiple cases.

PubMed

Wang, Jihan; Yang, Kai

2014-07-01

An efficient operating room needs both little underutilised and overutilised time to achieve optimal cost efficiency. The probabilities of underrun and overrun of lists of cases can be estimated by a well defined duration distribution of the lists. To propose a method of predicting the probabilities of underrun and overrun of lists of cases using Type IV Pearson distribution to support case scheduling. Six years of data were collected. The first 5 years of data were used to fit distributions and estimate parameters. The data from the last year were used as testing data to validate the proposed methods. The percentiles of the duration distribution of lists of cases were calculated by Type IV Pearson distribution and t-distribution. Monte Carlo simulation was conducted to verify the accuracy of percentiles defined by the proposed methods. Operating rooms in John D. Dingell VA Medical Center, United States, from January 2005 to December 2011. Differences between the proportion of lists of cases that were completed within the percentiles of the proposed duration distribution of the lists and the corresponding percentiles. Compared with the t-distribution, the proposed new distribution is 8.31% (0.38) more accurate on average and 14.16% (0.19) more accurate in calculating the probabilities at the 10th and 90th percentiles of the distribution, which is a major concern of operating room schedulers. The absolute deviations between the percentiles defined by Type IV Pearson distribution and those from Monte Carlo simulation varied from 0.20  min (0.01) to 0.43  min (0.03). Operating room schedulers can rely on the most recent 10 cases with the same combination of surgeon and procedure(s) for distribution parameter estimation to plan lists of cases. Values are mean (SEM). The proposed Type IV Pearson distribution is more accurate than t-distribution to estimate the probabilities of underrun and overrun of lists of cases. However, as not all the individual case durations followed log-normal distributions, there was some deviation from the true duration distribution of the lists.

Inhibition of dipeptidyl-peptidase IV catalyzed peptide truncation by Vildagliptin ((2S)-{[(3-hydroxyadamantan-1-yl)amino]acetyl}-pyrrolidine-2-carbonitrile).

PubMed

Brandt, Inger; Joossens, Jurgen; Chen, Xin; Maes, Marie-Berthe; Scharpé, Simon; De Meester, Ingrid; Lambeir, Anne-Marie

2005-07-01

Vildagliptin (NVP-LAF237/(2S)-{[(3-hydroxyadamantan-1-yl)amino]acetyl}-pyrrolidine-2-carbonitrile) was described as a potent, selective and orally bio-available dipeptidyl-peptidase IV (DPP IV, EC 3.4.14.5) inhibitor [Villhauer EB, Brinkman JA, Naderi GB, Burkey BF, Dunning BE, Prasad K, et al.1-[[(3-Hydroxy-1-adamantyl)amino]acetyl]-2-cyano-(S)-pyrrolidine: a potent, selective, and orally bioavailable dipeptidyl peptidase IV inhibitor with antihyperglycemic properties. J Med Chem 2003;46:2774-89]. Phase III clinical trials for the use of this compound in the treatment of Type 2 diabetes were started in the first quarter of 2004. In this paper, we report on (1) the kinetics of binding, (2) the type of inhibition, (3) the selectivity with respect to other peptidases, and (4) the inhibitory potency on the DPP IV catalyzed degradation of glucagon-like peptide-1 (GLP-1), glucose-dependent insulinotropic polypeptide (GIP) and substance P. Vildagliptin behaved as a slow-binding DPP IV inhibitor with an association rate constant of 1.4x10(5)M(-1)s(-1) and a K(i) of 17nM. It is a micromolar inhibitor for dipeptidyl-peptidase 8 and does not significantly inhibit dipeptidyl-peptidase II (EC 3.4.11.2), prolyl oligopeptidase (EC 3.4.21.26), aminopeptidase P (EC 3.4.11.9) or aminopeptidase M (EC 3.4.11.2). There was no evidence for substrate specific inhibition of DPP IV by Vildagliptin or for important allosteric factors affecting the inhibition constant in presence of GIP and GLP-1.

Discovery of 2-[4-{{2-(2S,5R)-2-cyano-5-ethynyl-1-pyrrolidinyl]-2-oxoethyl]amino]- 4-methyl-1-piperidinyl]-4-pyridinecarboxylic acid (ABT-279): a very potent, selective, effective, and well-tolerated inhibitor of dipeptidyl peptidase-IV, useful for the treatment of diabetes.

PubMed

Madar, David J; Kopecka, Hana; Pireh, Daisy; Yong, Hong; Pei, Zhonghua; Li, Xiaofeng; Wiedeman, Paul E; Djuric, Stevan W; Von Geldern, Thomas W; Fickes, Michael G; Bhagavatula, Lakshmi; McDermott, Todd; Wittenberger, Steven; Richards, Steven J; Longenecker, Kenton L; Stewart, Kent D; Lubben, Thomas H; Ballaron, Stephen J; Stashko, Michael A; Long, Michelle A; Wells, Heidi; Zinker, Bradley A; Mika, Amanda K; Beno, David W A; Kempf-Grote, Anita J; Polakowski, James; Segreti, Jason; Reinhart, Glenn A; Fryer, Ryan M; Sham, Hing L; Trevillyan, James M

2006-10-19

Dipeptidyl peptidase-IV (DPP-IV) inhibitors are poised to be the next major drug class for the treatment of type 2 diabetes. Structure-activity studies of substitutions at the C5 position of the 2-cyanopyrrolidide warhead led to the discovery of potent inhibitors of DPP-IV that lack activity against DPP8 and DPP9. Further modification led to an extremely potent (Ki(DPP)(-)(IV) = 1.0 nM) and selective (Ki(DPP8) > 30 microM; Ki(DPP9) > 30 microM) clinical candidate, ABT-279, that is orally available, efficacious, and remarkably safe in preclinical safety studies.

Ultraviolet light sensitivity and prolonged UVR-erythema

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilson, P.D.; Kaidbey, K.H.; Kligman, A.M.

The erythema and tanning responses in skin type I (n . 15) and skin type IV (n . 17) have been compared in caucasoids following a single exposure to solar simulated radiation. The former sunburn easily and do not tan while the latter do not burn and tan readily. The dose of radiation was 5 times the Minimal Erythema Dose (MED). The test sites were the extensor aspect of the forearm (exposed site) and flexor aspect of the upper arm (nonexposed site). The responses were monitored at 24 and 48 hr and then twice weekly for 8 weeks. The groupmore » of skin type I individuals had a lower MED and a much more prolonged erythema on both the exposed and nonexposed sites than the group of type IV individuals. All differences were highly significant (p less than 0.005). After 4 weeks erythema remained present in all of the type I subjects but had disappeared in 16 of the 17 type IV subjects. Within the groups there was no difference between erythema duration on exposed vs. nonexposed sites, but there was a highly significant difference (p less than 0.005) between the lower MED on the upper arm and higher MED on the forearm. These results contrast with those of other reports in which prolonged erythema could not be correlated with fair complexion, sunburn sensitivity, ethnic background, or skin type but was instead found to be a distinct feature of persons who had developed nonmelanoma skin cancer. Since prolonged erythema is related to skin type it is therefore not solely a feature of patients with skin cancer.« less

Testing for Drug Hypersensitivity Syndromes

PubMed Central

Rive, Craig M; Bourke, Jack; Phillips, Elizabeth J

2013-01-01

Adverse drug reactions are a common cause of patient morbidity and mortality. Type B drug reactions comprise only 20% of all drug reactions but they tend to be primarily immunologically mediated and less dependent on the drug’s pharmacological action and dose. Common Type B reactions seen in clinical practice are those of the immediate, IgE, Gell-Coombs Type I reactions, and the delayed, T-cell mediated, Type IV reactions. Management of these types of reactions, once they have occurred, requires careful consideration and recognition of the utility of routine diagnostic tests followed by ancillary specialised diagnostic testing. For Type I, IgE mediated reactions this includes prick/intradermal skin testing and oral provocation. For Type IV, T-cell mediated reactions this includes a variety of in vivo (patch testing) and ex vivo tests, many of which are currently mainly used in highly specialised research laboratories. The recent association of many serious delayed (Type IV) hypersensitivity reactions to specific drugs with HLA class I and II alleles has created the opportunity for HLA screening to exclude high risk populations from exposure to the implicated drug and hence prevent clinical reactions. For example, the 100% negative predictive value of HLA-B*5701 for true immunologically mediated abacavir hypersensitivity and the development of feasible, inexpensive DNA-based molecular tests has led to incorporation of HLA-B*5701 screening in routine HIV clinical practice. The mechanism by which drugs specifically interact with HLA has been recently characterised and promises to lead to strategies for pre-clinical screening to inform drug development and design. PMID:23592889

Treatment of Crowe Type-IV Hip Dysplasia Using Cementless Total Hip Arthroplasty and Double Chevron Subtrochanteric Shortening Osteotomy: A 5- to 10-Year Follow-Up Study.

PubMed

Li, Xigong; Lu, Yang; Sun, Junying; Lin, Xiangjin; Tang, Tiansi

2017-02-01

The purpose of this study was to evaluate the functional and radiographic results of patients with Crowe type-IV hip dysplasia treated by cementless total hip arthroplasty and double chevron subtrochanteric osteotomy. From January 2000 to February 2006, cementless total hip arthroplasty with a double chevron subtrochanteric shortening osteotomy was performed on 18 patients (22 hips) with Crowe type-IV dysplasia. The acetabular cup was placed in the position of the anatomic hip center, and subtrochanteric femoral shortening osteotomy was performed with the use of a double chevron design. The clinical and radiographic outcomes were reviewed with a mean follow-up of 6.5 years (5-10 years). The mean amount of femoral subtrochanteric shortening was 38 mm (25-60 mm). All osteotomy sites were healed by 3-6 months without complications. The mean Harris Hip Score improved significantly from 47 points (35-65 points) preoperatively to 88 points (75-97 points) at the final follow-up. The Trendelenburg sign was corrected from a positive preoperative status to a negative postoperative status in 12 of 22 hips. No acetabular and femoral components have loosened or required revision during the period of follow-up. Cementless total hip arthroplasty using double chevron subtrochanteric osteotomy allowed for restoration of anatomic hip center with safely functional limb lengthening, achieved correction of preoperative limp, and good functional and radiographic outcomes for 22 Crowe type-IV dislocation hips at the time of the 5- to 10-year follow-up. Copyright © 2016 Elsevier Inc. All rights reserved.

Influence of polyurethane resin dies on the fit and adaptation of full veneer crowns.

PubMed

Lillywhite, Graeme R R; Vohra, Fahim

2015-01-01

Polyurethane resin is a possible alternative to type IV dental stone for fabrication of indirect restorations however its dimensional accuracy is questionable. The aim was to investigate the dimensional accuracy of silica filled polyurethane resin die material by evaluating the marginal fit and adaptation of indirect gold castings. Experimental, in vitro study. Totally 40 copper plated replicas of a nickel chrome master die analogous to a veneer gold crown preparation were made and impressions recorded using polyvinylsiloxane material. Twenty impressions were poured in type IV dental stone (control group (Vel-mix, Kerr, UK) and the remaining (n = 20) in silica filled polyurethane die material (test group) (Alpha Die MF, CA, USA). Gold castings were fabricated for each die using standardized techniques. The castings were seated on their respective copper plated dies, embedded in resin and sectioned. The specimens were analyzed by measuring marginal opening and the area beneath the casting at a ×63 magnification and using image analysis software. Data were analyzed using a Student's t-test. No significant difference was observed between the experimental groups (P > 0.05). The mean marginal opening for type IV, dental stone and polyurethane resin, was 57 ± 22.6 μm and 63.47 ± 27.1 μm, respectively. Stone displayed a smaller area beneath the casting (31581 ± 16297 μm 2 ) as compared to polyurethane resin (35003 ± 23039 μm 2 ). The fit and adaptation of indirect gold castings made on polyurethane and type IV dental stone dies were comparable.

[Longitudinal preputial pedicled flap urethroplasty for chordee of Donnahoo type IV].

PubMed

Zeng, Li; Shan, Wei; Yuan, Miao; Huang, Guizhen; Huang, Lugang

2012-11-01

To investigate the effectiveness of longitudinal preputial pedicled flap urethroplasty for chordee of Donnahoo IV type. Between June 1994 and October 2011, 30 patients with chordee (Donnahoo type IV) underwent longitudinal preputial pedicled flap urethroplasty. The patients' age ranged from 2 to 16 years (mean, 5.8 years). The morphology of the balanus-navicular fossa-external urethral orifice ranged normal; the penis length was 2.5-6.8 cm (mean, 4.3 cm); the penis bending angle was 35-70 degrees (mean, 40.1 degrees). Primary and secondary operation was 27 cases and 3 cases, respectively. The size of flap ranged from 1.5 cm x 1.3 cm to 4.0 cm x 2.0 cm. After correction, the penis length was 3.0-8.5 cm (mean, 6.6 cm); the penis bending angle was 0-10 degrees (mean, 1.2 degrees). All patients were followed up 6 months to 12 years (mean, 33 months). No recurrence, stabbing pain of the balanus, or foreign body sensation occurred during follow-up. Of them, 4 patients (13.33%) had urinary fistular, they had satisfactory results after the second operation; 2 patients (6.67%) had urethral stricture 1 month after operation, they also had satisfactory results after arethral dilatation. The other patients showed no scattering urinary flow and good direction without complication. Six patients had satisfactory sexual function after puberty without erection disorder, pain, or dyspareunia. Longitudinal preputial pedicled flap urethroplasty can achieve maximum utilization of prepuce and aesthetic and functional improvement with less complication, so it is a relatively ideal mean for treating chordee of Donnahoo type IV.

National Estimates of Exposure to Traumatic Events and PTSD Prevalence Using DSM-IV and DSM-5 Criteria

PubMed Central

Kilpatrick, Dean G.; Resnick, Heidi S.; Milanak, Melissa E.; Miller, Mark W.; Keyes, Katherine M.; Friedman, Matthew J.

2014-01-01

Prevalence of posttraumatic stress disorder (PTSD) defined according to the American Psychiatric Association’s Diagnostic and Statistical Manual fifth edition (DSM-5; 2013) and fourth edition (DSM-IV; 1994) was compared in a national sample of U.S. adults (N = 2,953) recruited from an online panel. Exposure to traumatic events, PTSD symptoms, and functional impairment were assessed online using a highly structured, self-administered survey. Traumatic event exposure using DSM-5 criteria was high (89.7%), and exposure to multiple traumatic event types was the norm. PTSD caseness was determined using Same Event (i.e., all symptom criteria met to the same event type) and Composite Event (i.e., symptom criteria met to a combination of event types) definitions. Lifetime, past-12-month, and past 6-month PTSD prevalence using the Same Event definition for DSM-5 was 8.3%, 4.7%, and 3.8% respectively. All 6 DSM-5 prevalence estimates were slightly lower than their DSM-IV counterparts, although only 2 of these differences were statistically significant. DSM-5 PTSD prevalence was higher among women than among men, and prevalence increased with greater traumatic event exposure. Major reasons individuals met DSM-IV criteria, but not DSM-5 criteria were the exclusion of nonaccidental, nonviolent deaths from Criterion A, and the new requirement of at least 1 active avoidance symptom. PMID:24151000

A retrospective chart review to assess the safety of nonablative fractional laser resurfacing in Fitzpatrick skin types IV to VI.

PubMed

Clark, Charlotte M; Silverberg, Jonathan I; Alexis, Andrew F

2013-04-01

Laser resurfacing in patients with Fitzpatrick skin phototypes (SPT) IV to VI is associated with a higher risk of pigmentary alteration. There is a paucity of studies evaluating optimum treatment parameters for fractional lasers in darkly pigmented skin types. This is a retrospective review of medical records for patients with SPT IV to VI who were treated with a 1,550 nm erbium-doped fractional nonablative laser (Fraxel Re:Store SR 1550; Solta Medical, Hayword, CA). Data were collected from patient charts and the clinic laser logbook from January 2008 to January 2012. The frequency of treatment-associated postinflammatory hyperpigmentation (PIH) and treatment settings used were evaluated. A total of 115 total laser sessions (45 patients) were included in our analysis. Five of the sessions (4%) were accompanied by PIH, 2 of which occurred in a single patient. Only 1 episode of PIH lasted longer than 1 month (2 months). Two of the 5 cases had only transient PIH (≤7 days), one of which was reported by the patient and not clinically evident on examination. The 1,550 nm erbium-doped fractional laser is well tolerated in SPT IV to VI. Fractional laser resurfacing, with the settings used and pretreatment and posttreatment hydroquinone 4% cream, was associated with a low risk of PIH in darker skin types.

Induced rotational motion with nonabutting inducing and induced stimuli: implications regarding two forms of induced motion.

PubMed

Reinhardt-Rutland, A H

2003-07-01

Induced motion is the illusory motion of a static stimulus in the opposite direction to a moving stimulus. Two types of induced motion have been distinguished: (a) when the moving stimulus is distant from the static stimulus and undergoes overall displacement, and (b) when the moving stimulus is pattern viewed within fixed boundaries that abut the static stimulus. Explanations of the 1st type of induced motion refer to mediating phenomena, such as vection, whereas the 2nd type is attributed to local processing by motion-sensitive neurons. The present research was directed to a display that elicited induced rotational motion with the characteristics of both types of induced motion: the moving stimulus lay within fixed boundaries, but the inducing and induced stimuli were distant from each other. The author investigated the properties that distinguished the two types of induced motion. In 3 experiments, induced motion persisted indefinitely, interocular transfer of the aftereffect of induced motion was limited to about 20%, and the time-course of the aftereffect of induced motion could not be attributed to vection. Those results were consistent with fixed-boundary induced motion. However, they could not be explained by local processing. Instead, the results might reflect the detection of object motion within a complex flow-field that resulted from the observer's motion.

Immunohistochemical distribution of collagens type I, III, IV and VI, of undulin and of tenascin in oral fibrous hyperplasia.

PubMed

Becker, J; Schuppan, D; Müller, S

1993-11-01

The distribution of collagens type I, IV and VI, of procollagen type III, of undulin and of tenascin was studied in 10 lesions which were clinically and histologically diagnosed as localized oral fibrous hyperplasias. The immunohistochemical distribution of these proteins was similar to that observed for normal oral mucosa. Undulin showed a pattern of parallel fibers throughout. Collagen type VI was pronounced in the subepithelial connective tissue, whereas the collagen fiber bundles were equally reactive for collagens type I and III. Tenascin was observed close to the subepithelial basement membrane and in proximity to collagen fiber bundles in the upper connective tissue. The present findings indicate that oral fibrous hyperplasias that are probably caused by inflammation or chronic irritation show the differentiated and ordered pattern of extracellular matrix proteins characteristic of normal oral mucosa.

Molecular Study of Three Lebanese and Syrian Patients with Waardenburg Syndrome and Report of Novel Mutations in the EDNRB and MITF Genes.

PubMed

Haddad, N M; Ente, D; Chouery, E; Jalkh, N; Mehawej, C; Khoueir, Z; Pingault, V; Mégarbané, A

2011-01-01

Waardenburg syndrome (WS) is a genetic disorder characterized primarily by depigmentation of the skin and hair, heterochromia of the irides, sensorineural deafness, and sometimes by dystopia canthorum, and Hirschsprung disease. WS presents a large clinical and genetic heterogeneity. Four different types have been individualized and linked to 5 different genes. We report 2 cases of WS type II and 1 case of WS type IV from Lebanon and Syria. The genetic studies revealed 2 novel mutations in the MITF gene of the WS type II cases and 1 novel homozygous mutation in the EDNRB gene of the WS type IV case. This is the first molecular study of patients from the Arab world. Additional cases will enable a more detailed description of the clinical spectrum of Waardenburg syndrome in this region.

Molecular Study of Three Lebanese and Syrian Patients with Waardenburg Syndrome and Report of Novel Mutations in the EDNRB and MITF Genes

PubMed Central

Haddad, N.M.; Ente, D.; Chouery, E.; Jalkh, N.; Mehawej, C.; Khoueir, Z.; Pingault, V.; Mégarbané, A.

2011-01-01

Waardenburg syndrome (WS) is a genetic disorder characterized primarily by depigmentation of the skin and hair, heterochromia of the irides, sensorineural deafness, and sometimes by dystopia canthorum, and Hirschsprung disease. WS presents a large clinical and genetic heterogeneity. Four different types have been individualized and linked to 5 different genes. We report 2 cases of WS type II and 1 case of WS type IV from Lebanon and Syria. The genetic studies revealed 2 novel mutations in the MITF gene of the WS type II cases and 1 novel homozygous mutation in the EDNRB gene of the WS type IV case. This is the first molecular study of patients from the Arab world. Additional cases will enable a more detailed description of the clinical spectrum of Waardenburg syndrome in this region. PMID:21373256

Sunlight exposure and photoprotection behaviour of white Caucasian adolescents in the UK.

PubMed

Gould, M; Farrar, M D; Kift, R; Berry, J L; Mughal, M Z; Bundy, C; Vail, A; Webb, A R; Rhodes, L E

2015-04-01

Sun exposure has positive and negative effects on health, yet little is known about the sun exposure behaviour of UK adolescents, including those more prone or less prone to sunburn. To examine sun exposure behaviour of UK white Caucasian adolescents including time spent outdoors, holiday behaviour, use of sunscreen and clothing, with assessment for differences between sun-reactive skin type groups. White Caucasian adolescents (12-15 years) attending schools in Greater Manchester completed a two-page questionnaire to assess sun exposure and photoprotective behaviour. A total of 133 adolescents (median age 13.4 years; 39% skin type I/II, 61% skin type III/IV) completed the questionnaire. In summer, adolescents spent significantly longer outdoors at weekends (median 4 h/day, range 0.25-10) than on weekdays (2, 0.25-6; P < 0.0001). When at home in the UK during summer, 44% reported never wearing sunscreen compared to just 1% when on a sunny holiday. Sunscreen use was also greater (frequency/coverage) when on a sunny holiday than at home in the UK summer (P < 0.0001). Adolescents of skin types I/II (easy burning) spent significantly less time outdoors than skin types III/IV (easy tanning) on summer weekends (P < 0.001), summer weekdays (P < 0.05) and on a sunny holiday (P = 0.001). Furthermore, skin types I/II reported greater sunscreen use during summer in the UK and on sunny holiday (both P < 0.01), and wore clothing covering a greater skin area on a sunny holiday (P < 0.01) than skin types III/IV. There was no difference in sun exposure behaviour/protection between males and females. The greater sun-protective measures reported by adolescents of sun-reactive skin type group I/II than III/IV suggest those who burn more easily are aware of the greater need to protect their skin. However, use of sunscreen during the UK summer is low and may need more effective promotion in adolescents. © 2014 European Academy of Dermatology and Venereology.

Effects of enzyme replacement therapy for cardiac-type Fabry patients with a Chinese hotspot late-onset Fabry mutation (IVS4+919G>A)

PubMed Central

Lin, Hsiang-Yu; Liu, Hao-Chuan; Huang, Yu-Hsiu; Liao, Hsuan-Chieh; Hsu, Ting-Rong; Shen, Chia-I; Li, Shao-Tzu; Li, Cheng-Fang; Lee, Li-Hong; Lee, Pi-Chang; Huang, Chun-Kai; Chiang, Chuan-Chi; Lin, Ching-Yuang; Lin, Shuan-Pei; Niu, Dau-Ming

2013-01-01

Objective Current studies of newborn screening for Fabry disease in Taiwan have revealed a remarkably high prevalence of cardiac-type Fabry disease with a Chinese hotspot late-onset Fabry mutation (IVS4+919G>A). Design Retrospective cohort study. Setting Tertiary medical centre. Participants 21 patients with cardiac-type Fabry disease (15 men and 6 women) as well as 15 patients with classic Fabry disease (4 men and 11 women) treated with biweekly intravenous infusions of agalsidase β (1 mg/kg) or agalsidase α (0.2 mg/kg) for at least 6 months. Outcome measures These data were collected at the time before enzyme replacement therapy (ERT) began and followed up after ERT for at least 6 months, including patient demographics, medical history, parameter changes of cardiac status and renal functions, plasma globotriaosylsphingosine (lyso-Gb3) and Mainz Severity Score Index. Results After 6–39 months of ERT, plasma lyso-Gb3 was found to be reduced in 89% (17/19) and 93% (14/15) of patients with cardiac-type and classic Fabry disease, respectively, which indicated an improvement of disease severity. For patients with cardiac-type Fabry disease, echocardiography revealed the reduction or stabilisation of left ventricular mass index (LVMI), the thicknesses of intraventricular septum (IVS) and left posterior wall (LPW) in 83% (15/18), 83% (15/18) and 67% (12/18) of patients, respectively, as well as 77% (10/13), 73% (11/15) and 60% (9/15) for those with classic type. Most patients showed stable renal function after ERT. There were statistically significant improvements (p<0.05) between the data at baseline and those after ERT for values of plasma lyso-Gb3, LVMI, IVS, LPW and Mainz Severity Score Index. No severe clinical events were reported during the treatment. Conclusions ERT is beneficial and appears to be safe for Taiwanese patients with cardiac-type Fabry disease, as well as for those with the classic type. PMID:23864212

Environmental Impact Analysis Process. Deployment Area Selection and Land Withdrawal/Acquisition DEIS. Chapter IV. Part II. Environmental Consequences to the Study Regions and Operating Base Vicinities.

DTIC Science & Technology

1980-12-01

PARMER COUNTY, TX. FAmt- M R LUNG IE ’ ALEA LONG Tam NATIVE *-X INUCED CHNGE NATIVE N-x INDE CANG 0( above normal growth baseline) ( above normal...your family, the clean air to see the next mountain and the freedom to climb it. The concerns expressed by local residents about population growth and... mountain passes, where capacity is severely reduced by steep grades and winding alignment, congestion might occur at times due to slow moving trucks

Prospective Computed Tomographic Analysis of Osteochondral Lesions of the Ankle Joint Associated With Ankle Fractures.

PubMed

Nosewicz, Tomasz L; Beerekamp, M Suzan H; De Muinck Keizer, Robert-Jan O; Schepers, Tim; Maas, Mario; Niek van Dijk, C; Goslings, J Carel

2016-08-01

Osteochondral lesions (OCLs) associated with ankle fracture correlate with unfavorable outcome. The goals of this study were to detect OCLs following ankle fracture, to associate fracture type to OCLs and to investigate whether OCLs affect clinical outcome. 100 ankle fractures requiring operative treatment were prospectively included (46 men, 54 women; mean age 44 ± 14 years, range 20-77). All ankle fractures (conventional radiography; 71 Weber B, 22 Weber C, 1 Weber A, 4 isolated medial malleolus and 2 isolated posterior malleolus fractures) were treated by open reduction and internal fixation. Multidetector computed tomography (CT) was performed postoperatively. For each OCL, the location, size, and Loomer OCL classification (CT modified Berndt and Harty classification) were determined. The subjective Foot and Ankle Outcome Scoring (FAOS) was used for clinical outcome at 1 year. OCLs were found in 10/100 ankle fractures (10.0%). All OCLs were solitary talar lesions. Four OCLs were located posteromedial, 4 posterolateral, 1 anterolateral, and 1 anteromedial. There were 2 type I OCLs (subchondral compression), 6 type II OCLs (partial, nondisplaced fracture) and 2 type IV OCLs (displaced fracture). Mean OCL size (largest diameter) was 4.4 ± 1.7 mm (range, 1.7 mm to 6.2 mm). Chi-square analysis showed no significant association between ankle fracture type and occurrence of OCLs. OCLs did occur only in Lauge-Hansen stage III/IV ankle fractures. There were no significant differences in FAOS outcome between patients with or without OCLs. Ten percent of investigated ankle fractures had associated OCLs on CT. Although no significant association between fracture type and OCL was found, OCLs only occurred in Lauge-Hansen stage III/IV ankle fractures. With the numbers available, OCLs did not significantly affect clinical outcome at 1 year according to FAOS. Level IV, observational study. © The Author(s) 2016.

Effects of bfp Mutations on Biogenesis of Functional Enteropathogenic Escherichia coli Type IV Pili

PubMed Central

Anantha, Ravi P.; Stone, Kelly D.; Donnenberg, Michael S.

2000-01-01

Enteropathogenic Escherichia coli expresses a type IV fimbria known as the bundle-forming pilus (BFP) that is required for autoaggregation and localized adherence (LA) to host cells. A cluster of 14 genes is sufficient to reconstitute BFP biogenesis in a laboratory strain of E. coli. We have undertaken a systematic mutagenesis of the individual genes to determine the effect of each mutation on BFP biogenesis and LA. Here we report the construction and analysis of nonpolar mutations in six genes of the bfp cluster, bfpG, bfpB, bfpC, bfpD, bfpP, and bfpH, as well as the further analysis of a previously described bfpA mutant strain that is unable to express bundlin, the pilin protein. We found that mutations in bfpB, which encodes an outer membrane protein; bfpD, which encodes a putative nucleotide-binding protein; and bfpG and bfpC, which do not have sequence homologues in other type IV pilus systems, do not affect prebundlin expression or processing but block both BFP biogenesis and LA. The mutation in bfpP, the prepilin peptidase gene, does not affect prebundlin expression but blocks signal sequence cleavage of prebundlin, BFP biogenesis, and LA. The mutation in bfpH, which is predicted to encode a lytic transglycosylase, has no effect on prebundlin expression, prebundlin processing, BFP biogenesis, or LA. For each mutant for which altered phenotypes were detected, complementation with a plasmid containing the corresponding wild-type allele restored the wild-type phenotypes. We also found that association of prebundlin or bundlin with sucrose density flotation gradient fractions containing both inner and outer membrane proteins does not require any accessory proteins. These studies indicate that many bfp gene products are required for biogenesis of functional type IV pili but that mutations in the individual genes do not lead to the identification of new phases of pilus assembly. PMID:10762251

Prenatal diagnosis of fetal glutaric aciduria type 1 with rare compound heterozygous mutations in GCDH gene.

PubMed

Peng, Hsiu-Huei; Shaw, Sheng-Wen; Huang, Kuan-Gen

2018-02-01

Glutaric aciduria type 1 is a rare disease, with the estimated prevalence about 1 in 100,000 newborns. GCDH gene mutation can lead to glutaric acid and 3- OH glutaric acid accumulation, with clinical manifestation of neuronal damage, brain atrophy, microencephalic macrocephaly, decreased coordination of swallowing, poor muscle coordination, spasticity, and severe dystonic movement disorder. A 22-year-old female, Gravida 4 Para 2, is pregnancy at 13 weeks of gestational age. Her first child is normal, however, the second child was diagnosed as glutaric aciduria type I after birth. She came to our hospital for prenatal genetic counselling of her fetus at 13 weeks of gestational age. We performed GCDH gene mutation analysis of maternal blood showed IVS 3 + 1 G > A heterozygous mutation, GCDH gene mutation analysis of paternal blood showed c. 1240 G > A heterozygous mutation, and the second child has compound heterozygous IVS 3 + 1 G > A and c. 1240 G > A mutations. Later, we performed amniocentesis at 16 weeks of gestational age for chromosome study and GCDH gene mutation analysis for the fetus. The fetal chromosome study showed normal karyotype, however, GCDH gene mutation analysis showed compound heterozygous IVS 3 + 1 G > A and c. 1240 G > A mutations. The couple decided to termination of pregnancy thereafter. Glutaric acidemia type 1 is an autosomal recessive disorder because of pathogenic mutations in the GCDH gene. Early diagnosis and therapy of glutaric acidemia type 1 can reduce the risk of neuronal damage and acute dystonia. We report a case of prenatal diagnosis of fetal glutaric aciduria type 1 with rare compound heterozygous GCDH gene mutation at IVS 3 + 1 G > A and c. 1240 G > A mutations, which provide better genetic counselling for the couples. Copyright © 2018. Published by Elsevier B.V.

The recent emergence in hospitals of multidrug-resistant community-associated sequence type 1 and spa type t127 methicillin-resistant Staphylococcus aureus investigated by whole-genome sequencing: Implications for screening

PubMed Central

Earls, Megan R.; Kinnevey, Peter M.; Brennan, Gráinne I.; Lazaris, Alexandros; Skally, Mairead; O’Connell, Brian; Humphreys, Hilary; Shore, Anna C.

2017-01-01

Community-associated spa type t127/t922 methicillin-resistant Staphylococcus aureus (MRSA) prevalence increased from 1%-7% in Ireland between 2010–2015. This study tracked the spread of 89 such isolates from June 2013-June 2016. These included 78 healthcare-associated and 11 community associated-MRSA isolates from a prolonged hospital outbreak (H1) (n = 46), 16 other hospitals (n = 28), four other healthcare facilities (n = 4) and community-associated sources (n = 11). Isolates underwent antimicrobial susceptibility testing, DNA microarray profiling and whole-genome sequencing. Minimum spanning trees were generated following core-genome multilocus sequence typing and pairwise single nucleotide variation (SNV) analysis was performed. All isolates were sequence type 1 MRSA staphylococcal cassette chromosome mec type IV (ST1-MRSA-IV) and 76/89 were multidrug-resistant. Fifty isolates, including 40/46 from H1, were high-level mupirocin-resistant, carrying a conjugative 39 kb iles2-encoding plasmid. Two closely related ST1-MRSA-IV strains (I and II) and multiple sporadic strains were identified. Strain I isolates (57/89), including 43/46 H1 and all high-level mupirocin-resistant isolates, exhibited ≤80 SNVs. Two strain I isolates from separate H1 healthcare workers differed from other H1/strain I isolates by 7–47 and 12–53 SNVs, respectively, indicating healthcare worker involvement in this outbreak. Strain II isolates (19/89), including the remaining H1 isolates, exhibited ≤127 SNVs. For each strain, the pairwise SNVs exhibited by healthcare-associated and community-associated isolates indicated recent transmission of ST1-MRSA-IV within and between multiple hospitals, healthcare facilities and communities in Ireland. Given the interchange between healthcare-associated and community-associated isolates in hospitals, the risk factors that inform screening for MRSA require revision. PMID:28399151

Deposition of sedimentary organic matter in black shale facies indicated by the geochemistry and petrography of high-resolution samples, blake nose, western North Atlantic

USGS Publications Warehouse

Barker, C.E.; Pawlewicz, M.; Cobabe, E.A.

2001-01-01

A transect of three holes drilled across the Blake Nose, western North Atlantic Ocean, retrieved cores of black shale facies related to the Albian Oceanic Anoxic Events (OAE) lb and ld. Sedimentary organic matter (SOM) recovered from Ocean Drilling Program Hole 1049A from the eastern end of the transect showed that before black shale facies deposition organic matter preservation was a Type III-IV SOM. Petrography reveals that this SOM is composed mostly of degraded algal debris, amorphous SOM and a minor component of Type III-IV terrestrial SOM, mostly detroinertinite. When black shale facies deposition commenced, the geochemical character of the SOM changed from a relatively oxygen-rich Type III-IV to relatively hydrogen-rich Type II. Petrography, biomarker and organic carbon isotopic data indicate marine and terrestrial SOM sources that do not appear to change during the transition from light-grey calcareous ooze to the black shale facies. Black shale subfacies layers alternate from laminated to homogeneous. Some of the laminated and the poorly laminated to homogeneous layers are organic carbon and hydrogen rich as well, suggesting that at least two SOM depositional processes are influencing the black shale facies. The laminated beds reflect deposition in a low sedimentation rate (6m Ma-1) environment with SOM derived mostly from gravity settling from the overlying water into sometimes dysoxic bottom water. The source of this high hydrogen content SOM is problematic because before black shale deposition, the marine SOM supplied to the site is geochemically a Type III-IV. A clue to the source of the H-rich SOM may be the interlayering of relatively homogeneous ooze layers that have a widely variable SOM content and quality. These relatively thick, sometimes subtly graded, sediment layers are thought to be deposited from a Type II SOM-enriched sediment suspension generated by turbidities or direct turbidite deposition.

Chronic administration of DSP-7238, a novel, potent, specific and substrate-selective DPP IV inhibitor, improves glycaemic control and beta-cell damage in diabetic mice.

PubMed

Furuta, Y; Horiguchi, M; Sugaru, E; Ono-Kishino, M; Otani, M; Sakai, M; Masui, Y; Tsuchida, A; Sato, Y; Takubo, K; Hochigai, H; Kimura, H; Nakahira, H; Nakagawa, T; Taiji, M

2010-05-01

The purpose of this study is to assess the in vitro enzyme inhibition profile of DSP-7238, a novel non-cyanopyrrolidine dipeptidyl peptidase (DPP) IV inhibitor and to evaluate the acute and chronic effects of this compound on glucose metabolism in two different mouse models of type 2 diabetes. The in vitro enzyme inhibition profile of DSP-7238 was assessed using plasma and recombinant enzymes including DPP IV, DPP II, DPP8, DPP9 and fibroblast activation protein alpha (FAPalpha) with fluorogenic substrates. The inhibition type was evaluated based on the Lineweaver-Burk plot. Substrate selectivity of DSP-7238 and comparator DPP IV inhibitors (vildagliptin, sitagliptin, saxagliptin and linagliptin) was evaluated by mass spectrometry based on the changes in molecular weight of peptide substrates caused by release of N-terminal dipeptides. In the in vivo experiments, high-fat diet-induced obese (DIO) mice were subjected to oral glucose tolerance test (OGTT) following a single oral administration of DSP-7238. To assess the chronic effects of DSP-7238 on glycaemic control and pancreatic beta-cell damage, DSP-7238 was administered for 11 weeks to mice made diabetic by a combination of high-fat diet (HFD) and a low-dose of streptozotocin (STZ). After the dosing period, HbA1c was measured and pancreatic damage was evaluated by biological and histological analyses. DSP-7238 and sitagliptin both competitively inhibited recombinant human DPP IV (rhDPP IV) with K(i) values of 0.60 and 2.1 nM respectively. Neither vildagliptin nor saxagliptin exhibited competitive inhibition of rhDPP IV. DSP-7238 did not inhibit DPP IV-related enzymes including DPP8, DPP9, DPP II and FAPalpha, whereas vildagliptin and saxagliptin showed inhibition of DPP8 and DPP9. Inhibition of glucagon-like peptide-1 (GLP-1) degradation by DSP-7238 was apparently more potent than its inhibition of chemokine (C-X-C motif) ligand 10 (IP-10) or chemokine (C-X-C motif) ligand 12 (SDF-1alpha) degradation. In contrast, vildagliptin and saxagliptin showed similar degree of inhibition of degradation for all the substrates tested. Compared to treatment with the vehicle, single oral administration of DSP-7238 dose-dependently decreased plasma DPP IV activity and improved glucose tolerance in DIO mice. In addition, DSP-7238 significantly decreased HbA1c and ameliorated pancreatic damage following 11 weeks of chronic treatment in HFD/STZ mice. We have shown in this study that DSP-7238 is a potent DPP IV inhibitor that has high specificity for DPP IV and substrate selectivity against GLP-1. We have also found that chronic treatment with DSP-7238 improves glycaemic control and ameliorates beta-cell damage in a mouse model with impaired insulin sensitivity and secretion. These findings indicate that DSP-7238 may be a new therapeutic agent for the treatment of type 2 diabetes.

Uranium(IV) adsorption by natural organic matter in anoxic sediments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bone, Sharon E.; Dynes, James J.; Cliff, John

2017-01-09

Uranium is an important fuel source and a global environmental contaminant. It accumulates in the tetravalent state, U(IV), in anoxic sediments, including ore deposits, marine basins, and contaminated aquifers. However, very little is known about the speciation of U(IV) in low temperature geochemical environments, inhibiting the development of a conceptual model of U behavior. Until recently, U(IV) was assumed to exist predominantly as the sparingly soluble mineral uraninite (UO 2) in anoxic sediments; yet studies now show that UO 2 is not often dominant in these environments. However, a model of U(IV) speciation under environmentally relevant conditions has not yetmore » been developed. Here we show that complexes of U(IV) adsorb on organic carbon and organic carbon-coated clays in an organic-rich natural substrate under field-relevant conditions. Whereas previous research assumed that the U(IV) product depended on the reduction pathway, our results demonstrate that UO 2 formation can be inhibited simply by decreasing the U:solid ratio. Thus, it is the number and type of surface ligands that controls U(IV) speciation subsequent to U(VI) reduction. Projections of U transport and bioavailability, and thus its threat to human and ecosystem health, must consider retention of U(IV) ions within the local sediment environment.« less

Secondary flow structures in the presence of Type-IV stent fractures through a bent tube model for curved arteries: Effect of circulation thresholding

NASA Astrophysics Data System (ADS)

Hussain, Shadman; Bulusu, Kartik V.; Plesniak, Michael W.

2013-11-01

A common treatment for atherosclerosis is the opening of narrowed arteries resulting from obstructive lesions by angioplasty and stent implantation to restore unrestricted blood flow. ``Type-IV'' stent fractures involve complete transverse, linear fracture of stent struts, along with displacement of the stent fragments. Experimental data pertaining to secondary flows in the presence of stents that underwent ``Type-IV'' fractures in a bent artery model under physiological inflow conditions were obtained through a two-component, two-dimensional (2C-2D) PIV technique. Concomitant stent-induced flow perturbations result in secondary flow structures with complex, multi-scale morphologies and varying size-strength characteristics. Ultimately, these flow structures may have a role to play in restenosis and progression of atherosclerotic plaque. Vortex circulation thresholds were established with the goal of resolving and tracking iso-circulation secondary flow vortical structures and their morphological changes. This allowed for a parametric evaluation and quantitative representation of secondary flow structures undergoing deformation and spatial reorganization. Supported by NSF Grant No. CBET- 0828903 and GW Center for Biomimetics and Bioinspired Engineering.

Assessment of Pathological Traits in DSM-5 Personality Disorders by the DAPP-BQ: How Do These Traits Relate to the Six Personality Disorder Types of the Alternative Model?

PubMed

Berghuis, Han; Ingenhoven, Theo J M; van der Heijden, Paul T; Rossi, Gina M P; Schotte, Chris K W

2017-11-09

The six personality disorder (PD) types in DSM-5 section III are intended to resemble their DSM-IV/DSM-5 section II PD counterparts, but are now described by the level of personality functioning (criterion A) and an assigned trait profile (criterion B). However, concerns have been raised about the validity of these PD types. The present study examined the continuity between the DSM-IV/DSM-5 section II PDs and the corresponding trait profiles of the six DSM-5 section III PDs in a sample of 350 Dutch psychiatric patients. Facets of the Dimensional Assessment of Personality Pathology-Basic Questionnaire (DAPP-BQ) were presumed as representations (proxies) of the DSM-5 section III traits. Correlational patterns between the DAPP-BQ and the six PDs were consistent with previous research between DAPP-BQ and DSM-IV PDs. Moreover, DAPP-BQ proxies were able to predict the six selected PDs. However, the assigned trait profile for each PD didn't fully match the corresponding PD.

Open angle glaucoma in a case of Type IV Ehler Danlos syndrome: A rarely reported association

PubMed Central

Mitra, Arijit; Ramakrishnan, R.; Kader, Mohideen Abdul

2014-01-01

A 26-year-old male presented to us with defective vision in the left eye. He had best corrected visual acuity (BCVA) of hand movement (HM) in right eye and 6/9 in left eye. He had ptosis with ectropion in both eyes and relative afferent pupillary defect (RAPD) in right eye. Intraocular pressure (IOP) was 46 and 44 mmHg in right and left eye, respectively. Fundus showed glaucomatous optic atrophy (GOA) in right eye and cup disc ratio (CDR) of 0.75 with bipolar rim thinning in left eye. Systemic examination showed hyperextensible skin and joints, acrogeria, hypodontia, high arched palate, and varicose veins. He gave history of easy bruising and tendency to fall and history of intestinal rupture 5 years ago for which he had undergone surgery. He was diagnosed as a case of Type IV Ehler-Danlos syndrome (EDS) with open angle glaucoma. He underwent trabeculectomy in both eyes. This is a rare case that shows glaucoma in a patient of EDS Type IV. Very few such cases have been reported in literature. PMID:25230966

Open angle glaucoma in a case of Type IV Ehler Danlos syndrome: a rarely reported association.

PubMed

Mitra, Arijit; Ramakrishnan, R; Kader, Mohideen Abdul

2014-08-01

A 26-year-old male presented to us with defective vision in the left eye. He had best corrected visual acuity (BCVA) of hand movement (HM) in right eye and 6/9 in left eye. He had ptosis with ectropion in both eyes and relative afferent pupillary defect (RAPD) in right eye. Intraocular pressure (IOP) was 46 and 44 mmHg in right and left eye, respectively. Fundus showed glaucomatous optic atrophy (GOA) in right eye and cup disc ratio (CDR) of 0.75 with bipolar rim thinning in left eye. Systemic examination showed hyperextensible skin and joints, acrogeria, hypodontia, high arched palate, and varicose veins. He gave history of easy bruising and tendency to fall and history of intestinal rupture 5 years ago for which he had undergone surgery. He was diagnosed as a case of Type IV Ehler-Danlos syndrome (EDS) with open angle glaucoma. He underwent trabeculectomy in both eyes. This is a rare case that shows glaucoma in a patient of EDS Type IV. Very few such cases have been reported in literature.

Spectroscopic Studies of Abiotic and Biological Nanomaterials: Silver Nanoparticles, Rhodamine 6G Adsorbed on Graphene, and c-Type Cytochromes and Type IV Pili in Geobacter sulfurreducens

NASA Astrophysics Data System (ADS)

Thrall, Elizabeth S.

This thesis describes spectroscopic studies of three different systems: silver nanoparticles, the dye molecule rhodamine 6G adsorbed on graphene, and the type IV pili and c-type cytochromes produced by the dissimilatory metal-reducing bacterium Geobacter sulfurreducens. Although these systems are quite different in some ways, they can all be considered examples of nanomaterials. A nanomaterial is generally defined as having at least one dimension below 100 nm in size. Silver nanoparticles, with sub-100 nm size in all dimensions, are examples of zero-dimensional nanomaterials. Graphene, a single atomic layer of carbon atoms, is the paradigmatic two-dimensional nanomaterial. And although bacterial cells are on the order of 1 μm in size, the type IV pili and multiheme c-type cytochromes produced by G. sulfurreducens can be considered to be one- and zero-dimensional nanomaterials respectively. A further connection between these systems is their strong interaction with visible light, allowing us to study them using similar spectroscopic tools. The first chapter of this thesis describes research on the plasmon-mediated photochemistry of silver nanoparticles. Silver nanoparticles support coherent electron oscillations, known as localized surface plasmons, at resonance frequencies that depend on the particle size and shape and the local dielectric environment. Nanoparticle absorption and scattering cross-sections are maximized at surface plasmon resonance frequencies, and the electromagnetic field is amplified near the particle surface. Plasmonic effects can enhance the photochemistry of silver particles alone or in conjunction with semiconductors according to several mechanisms. We study the photooxidation of citrate by silver nanoparticles in a photoelectrochemical cell, focusing on the wavelength-dependence of the reaction rate and the role of the semiconductor substrate. We find that the citrate photooxidation rate does not track the plasmon resonance of the silver nanoparticles but instead rises monotonically with photon energy. These results are discussed in terms of plasmonic enhancement mechanisms and a theoretical model describing hot carrier photochemistry. The second chapter explores the electronic absorption and resonance Raman scattering of the dye molecule rhodamine 6G (R6G) adsorbed on graphene. Graphene has been shown to quench the fluorescence of adsorbed molecules and quantum dots, and some previous studies have reported that the Raman scattering from molecules adsorbed on graphene is enhanced. We show that reflective contrast spectroscopy can be used to obtain the electronic absorption spectrum of R6G adsorbed on graphene, allowing us to estimate the surface concentration of the dye molecule. From these results we are able to calculate the absolute Raman scattering cross-section for R6G adsorbed on bilayer graphene. We find that there is no evidence of enhancement but instead that the cross-section is reduced by more than three-fold from its value in solution. We further show that a model incorporating electromagnetic interference effects can reproduce the observed dependence of the R6G Raman intensity on the number of graphene layers. The third and final chapter describes the preliminary results from studies of the dissimilatory metal-reducing bacterium Geobacter sulfurreducens . This anaerobic bacterium couples the oxidation of organic carbon sources to the reduction of iron oxides and other extracellular electron acceptors, a type of anaerobic respiration that necessitates an electron transport chain that can move electrons from the interior of the cell to the extracellular environment. The electron transport chain in G. sulfurreducens has not been completely characterized and two competing mechanisms for the charge transport have been proposed. The first holds that G. sulfurreducens produces type IV pili, protein filaments several nanometers in width, with intrinsic metallic-like conductivity. According to this mechanism, the conductive pili mediate electron transport to extracellular acceptors. The second proposed mechanism is that charge transport proceeds by electron hopping between the heme groups in the many c-type cytochromes produced by G. sulfurreducens. In this picture, the observed conductivity of the pili is due to hopping through associated cytochrome proteins. Our aim is to explore these alternative mechanisms for electron transport in G. sulfurreducens through electrical and optical studies. We report the work we have done thus far to culture and characterize G. sulfurreducens , and we show that preliminary micro-Raman studies of G. sulfurreducens cells confirm that we can detect the spectroscopic signature of c-type cytochrome proteins. Future directions for this ongoing work are briefly discussed.

(2S,4S)-4-Fluoro-1-{[(2-hydroxy-1,1-dimethylethyl)amino]acetyl}-pyrrolidine-2-carbonitrile monobenzenesulfonate (TS-021) is a selective and reversible dipeptidyl peptidase IV inhibitor.

PubMed

Tajima, Atsushi; Yamamoto, Koji; Kozakai, Akinori; Okumura-Kitajima, Lisa; Mita, Yasuo; Kitano, Kiyokazu; Jingu, Shigeji; Nakaike, Shiro

2011-03-25

The incretin hormone glucagon-like peptide-1 (GLP-1) has significant roles in the regulation of postprandial glucose metabolism, and the active form of GLP-1 is rapidly degraded by dipeptidyl peptidase (DPP)-IV. Therefore, DPP-IV inhibition is a promising approach for the treatment of type 2 diabetes. In the present study, we investigated the character of a DPP-IV inhibitor, TS-021, (2S, 4S)-4-fluoro-1-{[(2-hydroxy-1,1-dimethylethyl)amino]acetyl}-pyrrolidine-2-carbonitrile monobenzenesulfonate both in vitro and in vivo. TS-021 inhibits DPP-IV activity in human plasma with an IC(50) value of 5.34nM. In kinetics experiments, TS-021 had a relatively higher dissociation rate constant, with a k(off) value of 1.09×10(-3)s, despite exhibiting a potent human plasma DPP-IV inhibition activity with a K(i) value of 4.96nM. TS-021 exhibited significant inhibition selectivity against DPP-8 (>600 fold), DPP-9 (>1200 fold) and other peptidases examined (>15,000 fold). In normal rats, dogs and monkeys, a single oral dose of TS-021 exhibited favorable pharmacokinetic profiles. In Zucker fatty (fa/fa) rats, a rat model of obesity and impaired glucose tolerance, the oral administration of TS-021 resulted in the suppression of plasma DPP-IV activity and an increase in the active form of GLP-1. Furthermore, TS-021 exhibited a significant improvement in glucose tolerance by increasing the plasma insulin level during oral glucose tolerance tests at doses of 0.02-0.5mg/kg. These results suggest that TS-021 is a selective and reversible dipeptidyl peptidase IV inhibitor and has excellent characteristics as an oral anti-diabetic agent for postprandial hyperglycemia in patients with impaired glucose tolerance or type 2 diabetes. Copyright © 2011 Elsevier B.V. All rights reserved.

Functional diversification of maize RNA polymerase IV and V subtypes via alternative catalytic subunits

DOE PAGES

Haag, Jeremy R.; Brower-Toland, Brent; Krieger, Elysia K.; ...

2014-10-02

Unlike nuclear multisubunit RNA polymerases I, II, and III, whose subunit compositions are conserved throughout eukaryotes, plant RNA polymerases IV and V are nonessential, Pol II-related enzymes whose subunit compositions are still evolving. Whereas Arabidopsis Pols IV and V differ from Pol II in four or five of their 12 subunits, respectively, and differ from one another in three subunits, proteomic analyses show that maize Pols IV and V differ from Pol II in six subunits but differ from each other only in their largest subunits. Use of alternative catalytic second subunits, which are nonredundant for development and paramutation, yieldsmore » at least two sub-types of Pol IV and three subtypes of Pol V in maize. Pol IV/Pol V associations with MOP1, RMR1, AGO121, Zm_DRD1/CHR127, SHH2a, and SHH2b extend parallels between paramutation in maize and the RNA-directed DNA methylation pathway in Arabidopsis.« less

Adipokine Profile in Patients with Type 2 Diabetes Depends on Degree of Obesity

PubMed Central

Kocot, Joanna; Dziemidok, Piotr; Kiełczykowska, Małgorzata; Hordyjewska, Anna; Szcześniak, Grzegorz; Musik, Irena

2017-01-01

Background The fast pace of life, promoting fast food consumption and low physical activity, has resulted in obesity and/or diabetes as being serious social problems. The aim of the present study was to evaluate concentrations of selected adipokines (leptin, adiponectin, resistin, and visfatin) and to assess the leptin/adiponectin ratio in plasma of type 2 diabetes (T2D) patients in relation to degree of obesity. Material/Methods The study comprised 92 T2D subjects divided into 4 groups according to BMI value – I (normal body weight), II (overweight), III (obesity), and IV (severe obesity) – and 20 healthy volunteers (control group). Each group was divided into male and female subgroups. Plasma concentrations of adipokines were determined by enzyme-linked immunosorbent assay. Results In women, leptin concentration was significantly higher in group IV, whereas in men it was higher in groups III and IV than in the control group and groups I and II. Irrespective of sex, a significant decrease in adiponectin level was observed in group III vs. control. There was no significant difference in resistin levels. In women visfatin was markedly enhanced in group III, whereas in men in groups II, III and IV vs. control. Leptin/adiponectin ratio was increased in groups III and IV vs. control in women, whereas in men vs. both control and group I. Conclusions The obese type 2 diabetic patients presented a disturbed adipokine profile, which seems to be an important link between obesity and T2D. The future studies concerning the question if regulating of adipokines’ concentrations could be a promising approach for managing metabolic disorders seem to be well-grounded. PMID:29049270

Prevention of Contrast-Induced AKI: A Review of Published Trials and the Design of the Prevention of Serious Adverse Events following Angiography (PRESERVE) Trial

PubMed Central

Gallagher, Martin; Kaufman, James; Cass, Alan; Parikh, Chirag R.; Chertow, Glenn M.; Shunk, Kendrick A.; McCullough, Peter A.; Fine, Michael J.; Mor, Maria K.; Lew, Robert A.; Huang, Grant D.; Conner, Todd A.; Brophy, Mary T.; Lee, Joanne; Soliva, Susan; Palevsky, Paul M.

2013-01-01

Summary Contrast-induced AKI (CI-AKI) is a common condition associated with serious, adverse outcomes. CI-AKI may be preventable because its risk factors are well characterized and the timing of renal insult is commonly known in advance. Intravenous (IV) fluids and N-acetylcysteine (NAC) are two of the most widely studied preventive measures for CI-AKI. Despite a multitude of clinical trials and meta-analyses, the most effective type of IV fluid (sodium bicarbonate versus sodium chloride) and the benefit of NAC remain unclear. Careful review of published trials of these interventions reveals design limitations that contributed to their inconclusive findings. Such design limitations include the enrollment of small numbers of patients, increasing the risk for type I and type II statistical errors; the use of surrogate primary endpoints defined by small increments in serum creatinine, which are associated with, but not necessarily causally related to serious, adverse, patient-centered outcomes; and the inclusion of low-risk patients with intact baseline kidney function, yielding low event rates and reduced generalizability to a higher-risk population. The Prevention of Serious Adverse Events following Angiography (PRESERVE) trial is a randomized, double-blind, multicenter trial that will enroll 8680 high-risk patients undergoing coronary or noncoronary angiography to compare the effectiveness of IV isotonic sodium bicarbonate versus IV isotonic sodium chloride and oral NAC versus oral placebo for the prevention of serious, adverse outcomes associated with CI-AKI. This article discusses key methodological issues of past trials investigating IV fluids and NAC and how they informed the design of the PRESERVE trial. PMID:23660180

77 FR 56138 - World Trade Center Health Program; Addition of Certain Types of Cancer to the List of WTC-Related...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-12

... of Rulemaking on Federal Agencies IV. Methods Used by the Administrator To Determine Whether To Add... [ssquf] Rare cancers The Administrator developed a hierarchy of methods (detailed in Section IV of this... treating 9/11- exposed patients; health and research organizations; the WTC Health Program Survivors...

LEOPARD; SPOTS; sjectrum calculation with depletion. [IBM360; UNIVAC1108; FORTRAN IV(H) (IBM360) and FORTRAN V (UNIVAC1108)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barry, R.F.

LEOPARD is a unit cell homogenization and spectrum generation (MUFT-SOFOCATE type) program with a fuel depletion option.IBM360;UNIVAC1108; FORTRAN IV(H) (IBM360) and FORTRAN V (UNIVAC1108); OS/360 (IBM360) and EXEC2 (UNIVAC1108); 50K (decimal) memory.

7 CFR 42.112 - Defects of containers: Tables IV, V, VI, VII, VIII, IX, and X.

Code of Federal Regulations, 2014 CFR

2014-01-01

..., and X. 42.112 Section 42.112 Agriculture Regulations of the Department of Agriculture AGRICULTURAL... Stationary Lot Sampling and Inspection § 42.112 Defects of containers: Tables IV, V, VI, VII, VIII, IX, and X... Table X—Unitizing [Plastic or other type of casing/unitizing] Defects Categories Major Minor Not...

Lenalidomide Maintenance Therapy After High Dose BEAM With or Without Rituximab

ClinicalTrials.gov

2018-01-13

Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Nodal Marginal Zone B-cell Lymphoma; Peripheral T-cell Lymphoma; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Grade III Lymphomatoid Granulomatosis; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Cutaneous T-cell Non-Hodgkin Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Marginal Zone Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent Small Lymphocytic Lymphoma; Splenic Marginal Zone Lymphoma; Stage III Adult Burkitt Lymphoma; Stage III Adult Diffuse Large Cell Lymphoma; Stage III Adult Diffuse Mixed Cell Lymphoma; Stage III Adult Diffuse Small Cleaved Cell Lymphoma; Stage III Adult Immunoblastic Large Cell Lymphoma; Stage III Adult Lymphoblastic Lymphoma; Stage III Cutaneous T-cell Non-Hodgkin Lymphoma; Stage III Grade 1 Follicular Lymphoma; Stage III Grade 2 Follicular Lymphoma; Stage III Grade 3 Follicular Lymphoma; Stage III Mantle Cell Lymphoma; Stage III Marginal Zone Lymphoma; Stage III Mycosis Fungoides/Sezary Syndrome; Stage III Small Lymphocytic Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Cutaneous T-cell Non-Hodgkin Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IV Marginal Zone Lymphoma; Stage IV Mycosis Fungoides/Sezary Syndrome; Stage IV Small Lymphocytic Lymphoma; Waldenström Macroglobulinemia

Antimicrobial Dose in Obese Patient

PubMed Central

Kassab, Sawsan; Syed Sulaiman, Syed Azhar; Abdul Aziz, Noorizan

2007-01-01

Introduction Obesity is a chronic disease that has become one of major public health issue in Malaysia because of its association with other disease states including cardiovascular disease and diabetes. Despite continuous efforts to educate the public about the health risks associated with obesity, prevalence of the disease continues to increase. Dosing of many medications are based on weight, limited data are available on how antimicrobial agents should be dosed in obesity. The aim of this case presentation is to discuss dose of antibiotic in obese patient. Case report: Patient: GMN, Malay, Female, 45 year old, 150kg, transferred from medical ward to ICU with problems of fever, orthopnea, sepsis secondary to nosocomial pneumonia. She was admitted to hospital a week ago for SOB on exertion, cyanosis, mildly dyspneic, somasthenia, bilateral ankle swelling. There was no fever, cough, chest pain, clubbing, flapping tremor. Her grand father has pre-morbid history of obesity, HPT, DM and asthma. She was non alcoholic, smoker, and not on diet control. The diagnosis Pickwickian syndrome was made. Patient was treated with IV Dopamine 11mcg/kg/min, IV Morphine 4mg/h. IV GTN 15mcg/min, IV Ca gluconate 10g/24h for 3/7, IV Zantac 50mg tds, IV Augmentin 1.2g tds, IV Lasix 40mg od, IV Plasil 10mg tds, S.c heparin 5000IU bd. patient become stable and moved to medical ward to continue her treatment. Discussion: The altered physiologic function seen in obese patients is a concern in patients receiving antimicrobial agents because therapeutic outcomes depend on achieving a minimum inhibitory concentration (MIC). The therapeutic effect of any drug can be altered when any of the 4 pharmacokinetic processes (absorption, distribution, metabolism, or elimination) are altered. Decreased blood flow rates and increased renal clearance in obese patients can affect drug distribution and elimination. Changes in serum protein levels can change the metabolism and distribution of drugs that are highly protein bound; the effects of these physiologic differences should be considered when administrating antimicrobial agents in obese patients. Conclusion: Generally this patient was moderately well managed in view of inappropriate combination of antibiotic, duplication or unnecessary use of antibiotic for treatment of sepsis, more clinical studies are needed to determine antibiotic dose in obese patient.

Fabricate heterojunction diode by using the modified spray pyrolysis method to deposit nickel-lithium oxide on indium tin oxide substrate.

PubMed

Wu, Chia-Ching; Yang, Cheng-Fu

2013-06-12

P-type lithium-doped nickel oxide (p-LNiO) thin films were deposited on an n-type indium tin oxide (ITO) glass substrate using the modified spray pyrolysis method (SPM), to fabricate a transparent p-n heterojunction diode. The structural, optical, and electrical properties of the p-LNiO and ITO thin films and the p-LNiO/n-ITO heterojunction diode were characterized by field emission scanning electron microscopy (FE-SEM), X-ray diffraction (XRD), UV-visible spectroscopy, Hall effect measurement, and current-voltage (I-V) measurements. The nonlinear and rectifying I-V properties confirmed that a heterojunction diode characteristic was successfully formed in the p-LNiO/n-ITO (p-n) structure. The I-V characteristic was dominated by space-charge-limited current (SCLC), and the Anderson model demonstrated that band alignment existed in the p-LNiO/n-ITO heterojunction diode.

Identification of branched-chain amino acid aminotransferases active towards (R)-(+)-1-phenylethylamine among PLP fold type IV transaminases.

PubMed

Bezsudnova, Ekaterina Yu; Dibrova, Daria V; Nikolaeva, Alena Yu; Rakitina, Tatiana V; Popov, Vladimir O

2018-04-10

New class IV transaminases with activity towards L-Leu, which is typical of branched-chain amino acid aminotransferases (BCAT), and with activity towards (R)-(+)-1-phenylethylamine ((R)-PEA), which is typical of (R)-selective (R)-amine:pyruvate transaminases, were identified by bioinformatics analysis, obtained in recombinant form, and analyzed. The values of catalytic activities in the reaction with L-Leu and (R)-PEA are comparable to those measured for characteristic transaminases with the corresponding specificity. Earlier, (R)-selective class IV transaminases were found to be active, apart from (R)-PEA, only with some other (R)-primary amines and D-amino acids. Sequences encoding new transaminases with mixed type of activity were found by searching for changes in the conserved motifs of sequences of BCAT by different bioinformatics tools. Copyright © 2018 Elsevier B.V. All rights reserved.

A novel pattern of leaf movement: the case of Capparis spinosa L.

PubMed

Levizou, Efi; Kyparissis, Aris

2016-09-01

A novel type of heliotropic leaf movement is presented for Capparis spinosa L., a summer perennial shrub of Mediterranean and arid ecosystems. In contrast to plants that demonstrate uniform diaheliotropic and/or paraheliotropic movement for all their foliage, the alternate leaves of C. spinosa follow different movement patterns according to their stem azimuth and the side of the stem that they come from (cluster). Additionally, leaf movement for each cluster may not be uniform throughout the day, showing diaheliotropic characteristics during half of the day and paraheliotropic characteristics during the rest of the day. In an attempt to reveal the adaptive significance of this differential movement pattern, the following hypotheses were tested: (i) increase of the intercepted solar radiation and photosynthesis, (ii) avoidance of photoinhibitory conditions, (iii) amelioration of water-use efficiency and (iv) adjustment of the leaf temperature microenvironment. No evidence was found in support of the first two hypotheses. A slight difference toward a better water use was found for the moving compared with immobilized leaves, in combination with a better cooling effect. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Different Topological Quantum States in Ternary Zintl compounds: BaCaX (X = Si, Ge, Sn and Pb)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lin-Lin; Kaminski, Adam; Canfield, Paul C.

Topological quantum states require stringent combination of crystal symmetry and spin–orbit coupling (SOC) strength. Here in this paper, we report that the ternary Zintl compound series BaCaX (X = Si, Ge, Sn and Pb, Group IV) in the same crystal structure having eight valence electrons per formula unit can host two different topological quantum phases, controlled by atomic size and SOC strength. BaCaSi is a nodal-line semimetal (NLSM) with band inversion protected by mirror symmetry and hosts a strong topological insulator (TI) state when SOC is turned on, thus, a NLSM-TI phase. Moving to larger atomic sizes and heavier atoms,more » BaCaGe and BaCaSn are normal insulators (NIs); then, with the strongest SOC in BaCaPb, a different band inversion is induced, giving a strong TI phase without the need of NLSM. Thus, we also predict two types of topological transitions in a phase diagram for BaCaX: (1) NLSM-TI to NI, then to TI by tuning atomic size and SOC strength via alloying, and (2) NI or TI to NLSM-TI via pressure.« less

Different Topological Quantum States in Ternary Zintl compounds: BaCaX (X = Si, Ge, Sn and Pb)

DOE PAGES

Wang, Lin-Lin; Kaminski, Adam; Canfield, Paul C.; ...

2017-12-14

Topological quantum states require stringent combination of crystal symmetry and spin–orbit coupling (SOC) strength. Here in this paper, we report that the ternary Zintl compound series BaCaX (X = Si, Ge, Sn and Pb, Group IV) in the same crystal structure having eight valence electrons per formula unit can host two different topological quantum phases, controlled by atomic size and SOC strength. BaCaSi is a nodal-line semimetal (NLSM) with band inversion protected by mirror symmetry and hosts a strong topological insulator (TI) state when SOC is turned on, thus, a NLSM-TI phase. Moving to larger atomic sizes and heavier atoms,more » BaCaGe and BaCaSn are normal insulators (NIs); then, with the strongest SOC in BaCaPb, a different band inversion is induced, giving a strong TI phase without the need of NLSM. Thus, we also predict two types of topological transitions in a phase diagram for BaCaX: (1) NLSM-TI to NI, then to TI by tuning atomic size and SOC strength via alloying, and (2) NI or TI to NLSM-TI via pressure.« less

KSC-2014-2560

NASA Image and Video Library

2014-05-07

CAPE CANAVERAL, Fla. -- A transporter for oversize loads carries the port booster for the United Launch Alliance Delta IV Heavy for Exploration Flight Test-1, or EFT-1, into the Horizontal Integration Facility, or HIF, at Space Launch Complex 37 on Cape Canaveral Air Force Station in Florida. The port booster joins the other two boosters of the Delta IV Heavy already in the HIF. The upper stage and spacecraft adapter arrived with the booster on a barge at the U.S. Army Outpost wharf at Port Canaveral, and were transported to the HIF on May 6. At the HIF, all three booster stages will be processed and checked out before being moved to the nearby launch pad and hoisted into position. The spacecraft adapter will connect Orion to the ULA Delta IV, and also will connect Orion to NASA's new rocket, the Space Launch System, on its first mission in 2017. During the EFT-1 mission, Orion will travel farther into space than any human spacecraft has gone in more than 40 years. The data gathered during the flight will influence design decisions, validate existing computer models and innovative new approaches to space systems development, as well as reduce overall mission risks and costs for later Orion flights. Liftoff of Orion on EFT-1 is planned for fall 2014. Photo credit: NASA/Kim Shiflett

KSC-2014-2558

NASA Image and Video Library

2014-05-07

CAPE CANAVERAL, Fla. -- A transporter for oversize loads carries the port booster for the United Launch Alliance Delta IV Heavy for Exploration Flight Test-1, or EFT-1, into the Horizontal Integration Facility, or HIF, at Space Launch Complex 37 on Cape Canaveral Air Force Station in Florida. The port booster joins the other two boosters of the Delta IV Heavy already in the HIF. The upper stage and spacecraft adapter arrived with the booster on a barge at the U.S. Army Outpost wharf at Port Canaveral, and were transported to the HIF on May 6. At the HIF, all three booster stages will be processed and checked out before being moved to the nearby launch pad and hoisted into position. The spacecraft adapter will connect Orion to the ULA Delta IV, and also will connect Orion to NASA's new rocket, the Space Launch System, on its first mission in 2017. During the EFT-1 mission, Orion will travel farther into space than any human spacecraft has gone in more than 40 years. The data gathered during the flight will influence design decisions, validate existing computer models and innovative new approaches to space systems development, as well as reduce overall mission risks and costs for later Orion flights. Liftoff of Orion on EFT-1 is planned for fall 2014. Photo credit: NASA/Kim Shiflett

KSC-2014-2559

NASA Image and Video Library

2014-05-07

CAPE CANAVERAL, Fla. -- A transporter for oversize loads carries the port booster for the United Launch Alliance Delta IV Heavy for Exploration Flight Test-1, or EFT-1, into the Horizontal Integration Facility, or HIF, at Space Launch Complex 37 on Cape Canaveral Air Force Station in Florida. The port booster joins the other two boosters of the Delta IV Heavy already in the HIF. The upper stage and spacecraft adapter arrived with the booster on a barge at the U.S. Army Outpost wharf at Port Canaveral, and were transported to the HIF on May 6. At the HIF, all three booster stages will be processed and checked out before being moved to the nearby launch pad and hoisted into position. The spacecraft adapter will connect Orion to the ULA Delta IV, and also will connect Orion to NASA's new rocket, the Space Launch System, on its first mission in 2017. During the EFT-1 mission, Orion will travel farther into space than any human spacecraft has gone in more than 40 years. The data gathered during the flight will influence design decisions, validate existing computer models and innovative new approaches to space systems development, as well as reduce overall mission risks and costs for later Orion flights. Liftoff of Orion on EFT-1 is planned for fall 2014. Photo credit: NASA/Kim Shiflett

Divorce, Separation, and Housing Changes: A Multiprocess Analysis of Longitudinal Data from England and Wales.

PubMed

Mikolai, Júlia; Kulu, Hill

2018-02-01

This study investigates the effect of marital and nonmarital separation on individuals' residential and housing trajectories. Using rich data from the British Household Panel Survey (BHPS) and applying multilevel competing-risks event history models, we analyze the risk of a move of single, married, cohabiting, and separated men and women to different housing types. We distinguish moves due to separation from moves of separated people and account for unobserved codeterminants of moving and separation risks. Our analysis shows that many individuals move due to separation, as expected, but that the likelihood of moving is also relatively high among separated individuals. We find that separation has a long-term effect on individuals' residential careers. Separated women exhibit high moving risks regardless of whether they moved out of the joint home upon separation, whereas separated men who did not move out upon separation are less likely to move. Interestingly, separated women are most likely to move to terraced houses, whereas separated men are equally likely to move to flats (apartments) and terraced (row) houses, suggesting that family structure shapes moving patterns of separated individuals.

A search for the cause of cyclical wind variability in O stars. Simultaneous UV and optical observations including magnetic field measurements of the O7.5III star xi Persei

NASA Astrophysics Data System (ADS)

de Jong, J. A.; Henrichs, H. F.; Kaper, L.; Nichols, J. S.; Bjorkman, K.; Bohlender, D. A.; Cao, H.; Gordon, K.; Hill, G.; Jiang, Y.; Kolka, I.; Morrison, N.; Neff, J.; O'Neal, D.; Scheers, B.; Telting, J. H.

2001-03-01

We present the results of an extensive observing campaign on the O7.5 III star xi Persei. The UV observations were obtained with the International Ultraviolet Explorer. xi Per was monitored continuously in October 1994 during 10 days at ultraviolet and visual wavelengths. The ground-based optical observations include magnetic field measurements, Hα and He I lambda 6678 spectra, and were partially covered by photometry and polarimetry. We describe a method to automatically remove the variable contamination of telluric lines in the groundbased spectra. The aim of this campaign was to search for the origin of the cyclical wind variability in this star. We determined a very accurate period of 2.086(2) d in the resonance lines of Si Iv and in the subordinate N Iv and Hα line profiles. The epochs of maximum absorption in the UV resonance lines due to discrete absorption components (DACs) coincide in phase with the maxima in blue-shifted Hα absorption. This implies that the periodic variability originates close to the stellar surface. The phase-velocity relation shows a maximum at -1400 km s-1. The general trend of these observations can be well explained by the corotating interaction region (CIR) model. In this model the wind is perturbed by one or more fixed patches on the stellar surface, which are most probably due to small magnetic field structures. Our magnetic field measurements gave, however, only a null-detection with a 1sigma errorbar of 70 G in the longitudinal component. Some observations are more difficult to fit into this picture. The 2-day period is not detected in the photospheric/transition region line He I lambda 6678. The dynamic spectrum of this line shows a pattern indicating the presence of non-radial pulsation, consistent with the previously reported period of 3.5 h. The edge variability around -2300 km s-1 in the saturated wind lines of C Iv and N V is nearly identical to the edge variability in the unsaturated Si Iv line, supporting the view that this type of variability is also due to the moving DACs. A detailed analysis using Fourier reconstructions reveals that each DAC actually consists of 2 different components: a ``fast'' and a ``slow'' one which merge at higher velocities. Based on observations obtained using the International Ultraviolet Explorer, collected at NASA Goddard Space Flight Center and Villafranca Satellite Tracking Station of the European Space Agency.

Effects of Twenty-four Move Shadow Boxing Combined with psychosomatic relaxation on Depression and Anxiety in Patients with Type-2 Diabetes.

PubMed

Zheng, Yingying; Zhou, Yiyi; Lai, Qiujia

2015-06-01

The aim of the current study was to observe the effects of Twenty-four Move Shadow Boxing combined with psychosomatic relaxation on depression and anxiety in patients with Type-2 Diabetes. One hundred and twenty (120) patients with Type-2 Diabetes and depressive/anxious symptoms were divided into intervention group (60 cases) and control group (60 cases) according to the minimum distribution principle of unbalanced indicators. Twenty-four Move Shadow Boxing group used this intervention combined with psychosomatic relaxation. Control group underwent conventional treatment. All the patients in the two groups completed the Self-rating Depression Scale (SDS) and Self-Rating Anxiety Scale (SAS) before and after treatment. Among the 52 people included in the statistical analysis, the recovery rate was 13.3%. The differences between depression and anxiety scores in the intervention group before and after treatment were statistically significant (P<0.001), whereas these differences were non-significant in the control group (P=0.123). After the treatment, the glycated hemoglobin reduction in the intervention group was greater than that of the control group (t=2.438, P=0.016). The combination of Twenty-four Move Shadow Boxing and psychosomatic relaxation has a beneficial auxiliary therapeutic effect on depression and anxiety accompanying Type-2 Diabetes.

Identification of the DotL Coupling Protein Subcomplex of the Legionella Dot/Icm Type IV Secretion System

PubMed Central

Vincent, Carr D.; Friedman, Jonathan R.; Jeong, Kwang Cheol; Sutherland, Molly C.; Vogel, Joseph P.

2012-01-01

Summary Legionella pneumophila, the causative agent of Legionnaires’ disease, survives in macrophages by altering the endocytic pathway of its host cell. To accomplish this, the bacterium utilizes a type IVB secretion system to deliver effector molecules into the host cell cytoplasm. In a previous report, we performed an extensive characterization of the L. pneumophila type IVB secretion system that resulted in the identification of a critical five-protein subcomplex that forms the core of the secretion apparatus. Here we describe a second Dot/Icm protein subassembly composed of the type IV coupling protein DotL, the apparatus proteins DotM and DotN, and the secretion adaptor proteins IcmS and IcmW. In the absence of IcmS or IcmW, DotL becomes destabilized at the transition from the exponential to stationary phases of growth, concurrent with the expression of many secreted substrates. Loss of DotL is dependent on ClpA, a regulator of the cytoplasmic protease ClpP. The resulting decreased levels of DotL in the icmS and icmW mutants exacerbates the intracellular defects of these strains and can be partially suppressed by overproduction of DotL. Thus, in addition to their role as chaperones for Legionella T4SS substrates, IcmS and IcmW perform a second function as part of the Dot/Icm type IV coupling protein subcomplex. PMID:22694730

Schottky barrier parameters and low frequency noise characteristics of graphene-germanium Schottky barrier diode

NASA Astrophysics Data System (ADS)

Khurelbaatar, Zagarzusem; Kil, Yeon-Ho; Shim, Kyu-Hwan; Cho, Hyunjin; Kim, Myung-Jong; Lee, Sung-Nam; Jeong, Jae-chan; Hong, Hyobong; Choi, Chel-Jong

2016-03-01

We investigated the electrical properties of chemical vapor deposition-grown monolayer graphene/n-type germanium (Ge) Schottky barrier diodes (SBD) using current-voltage (I-V) characteristics and low frequency noise measurements. The Schottky barrier parameters of graphene/n-type Ge SBDs, such as Schottky barrier height (VB), ideality factor (n), and series resistance (Rs), were extracted using the forward I-V and Cheung's methods. The VB and n extracted from the forward ln(I)-V plot were found to be 0.63 eV and 1.78, respectively. In contrast, from Cheung method, the VB and n were calculated to be 0.53 eV and 1.76, respectively. Such a discrepancy between the values of VB calculated from the forward I-V and Cheung's methods indicated a deviation from the ideal thermionic emission of graphene/n-type Ge SBD associated with the voltage drop across graphene. The low frequency noise measurements performed at the frequencies in the range of 10 Hz-1 kHz showed that the graphene/n-type Ge SBD had 1/f γ frequency dependence, with γ ranging from 1.09 to 1.12, regardless of applied forward biases. Similar to forward-biased SBDs operating in the thermionic emission mode, the current noise power spectral density of graphene/n-type Ge SBD was linearly proportional to the forward current.

Distribution of Porphyromonas gingivalis fimA genotypes in primary endodontic infections.

PubMed

Rôças, Isabela N; Siqueira, José F

2010-03-01

Long fimbriae (FimA) are important virulence factors of Porphyromonas gingivalis. Based on the diversity of the fimA gene, this species is classified into 6 genotypes. This study surveyed samples from primary endodontic infections for the presence of these P. gingivalis fimA variants. Genomic DNA isolated from samples taken from 25 root canals of teeth with chronic apical periodontitis and 25 aspirates from acute apical abscess was used as template in polymerase chain reaction (PCR) assays directed toward the detection of the different P. gingivalis fimA genotypes. Porphyromonas gingivalis was detected by a 16S rRNA gene-based PCR in 36% of the total number of cases sampled (44% of chronic apical periodontitis and 28% of abscess aspirates). In cases of chronic apical periodontitis, P. gingivalis variant type IV was the most prevalent (24%), followed by types I (20%), II (16%), and III (8%). In acute abscess samples, variant type II was the most prevalent (12%), followed by types III and IV (8% of each) and type I (4%). Combinations of up to 3 different genotypes were detected in a few cases. No single fimA genotype variant or combination thereof was significantly associated with symptoms. Overall, fimA types IV (16%), II (14%), and I (12%) were the most prevalent. Findings demonstrated that different P. gingivalis fimA genotypes can be present in primary endodontic infections. Copyright 2010 Mosby, Inc. All rights reserved.

Root Canal Anatomy and Morphology of Mandibular First Molars in a Selected Iranian Population: An In Vitro Study

PubMed Central

Mohammadzadeh Akhlaghi, Nahid; Khalilak, Zohreh; Vatanpour, Mehdi; Mohammadi, Saman; Pirmoradi, Sakineh; Fazlyab, Mahta; Safavi, Kamran

2017-01-01

Introduction: The aim of this study was to evaluate root canal anatomy of mandibular first molars (MFM) in a selected Iranian Population using clearing technique. Methods and Materials: A total of 150 extracted MFMs were cleared. The root canal morphology (including the root numbers and root length) and the anatomy of the root canal system (including is the number and type of canals based on Vertucci’s classification, canal curvature according to Schneider's method and the presence of isthmus) was evaluated using the buccolingual and mesiodistal parallel x-rays and stereomicroscope. The data were analyzed using the chi-square test. Results: Two and three roots were present in 96.7% and 33% of the teeth, respectively (P=0.0001). All the teeth (100%) had two canals in the mesial root, while 61.3% of the samples had one distal root canal (P=0.006). The root canal configuration in the mesial canal included type IV (55.3%) and type II (41.3%) (P=0.0001). In doubled-canalled distal roots, 68.8% and 24.3% were type II and type IV, respectively (P=0.0001). Isthmii were observed in 44.6% of mesial and 27.3% of distal roots (P=0.0001). Conclusion: The notable prevalence of type IV configuration in both roots of mandibular first molars, presence of isthmus and root curvature, necessitates the careful negotiation and cleaning of all accessible canal spaces. PMID:28179932

Mapping General Anesthetic Sites in Heteromeric γ-Aminobutyric Acid Type A Receptors Reveals a Potential For Targeting Receptor Subtypes.

PubMed

Forman, Stuart A; Miller, Keith W

2016-11-01

IV general anesthetics, including propofol, etomidate, alphaxalone, and barbiturates, produce important actions by enhancing γ-aminobutyric acid type A (GABAA) receptor activation. In this article, we review scientific studies that have located and mapped IV anesthetic sites using photoaffinity labeling and substituted cysteine modification protection. These anesthetics bind in transmembrane pockets between subunits of typical synaptic GABAA receptors, and drugs that display stereoselectivity also show remarkably selective interactions with distinct interfacial sites. These results suggest strategies for developing new drugs that selectively modulate distinct GABAA receptor subtypes.

Successful treatment of direct carotid-cavernous fistula in a patient with Ehlers-Danlos syndrome type IV without arterial puncture: the transvenous triple-overlay embolization (TAILOREd) technique.

PubMed

Huynh, Thien J; Morton, Ryan P; Levitt, Michael R; Ghodke, Basavaraj V; Wink, Onno; Hallam, Danial K

2017-08-18

We report successful transvenous treatment of direct carotid-cavernous fistula in a patient with Ehlers-Danlos syndrome type IV using a novel triple-overlay embolization (TAILOREd) technique without the need for arterial puncture, which is known to be highly risky in this patient group. The TAILOREd technique allowed for successful treatment using preoperative MR angiography as a three-dimensional overlay roadmap combined with cone beam CT and live fluoroscopy, precluding the need for an arterial puncture. 2017 BMJ Publishing Group Ltd.

[Ehlers Danlos type IV syndrome presenting with simultaneous dissection of both internal carotid and both vertebral arteries].

PubMed

Mondon, K; de Toffol, B; Georgesco, G; Cassarini, J-F; Machet, M-C; Cottier, J-P; Arbeille, B; Autret, A

2004-04-01

Dissection of cervical arteries is a frequent cause of stroke in young subjects. We report the case of a 34-year-old patient who experienced simultaneous dissection of both internal carotid arteries and both vertebral arteries leading to repeated motor deficit of the right half-body associated with persistent otalgia. Search for an etiology led to the diagnosis of Ehlers-Danlos syndrome type IV. Search for the cause of cervical artery dissection must consider connective tIssue disease, particularly vascular forms of Ehler-Danlos syndrome. Diagnostic, therapeutic as well as prognostic aspects are discussed.

Treatment of melasma with low fluence, large spot size, 1064-nm Q-switched neodymium-doped yttrium aluminum garnet (Nd:YAG) laser for the treatment of melasma in Fitzpatrick skin types II-IV.

PubMed

Brown, Alia S; Hussain, Mussarat; Goldberg, David J

2011-12-01

Melasma is a common condition affecting over six million American women. Treatment of dermal or combined melasma is difficult and does not respond well to conventional topical therapies. Various light sources have been used recently in the treatment of melasma including fractionated ablative and non-ablative lasers as well as intense pulse light. We report the use of low fluence, large spot size Q-switched, Nd:Yag laser for the treatment of melasma in skin types II-IV.

Steps in the development of a Vibrio cholerae El Tor biofilm

PubMed Central

Watnick, Paula I.; Kolter, Roberto

2010-01-01

Summary We report that, in a simple, static culture system, wild-type Vibrio cholerae El Tor forms a three-dimensional biofilm with characteristic water channels and pillars of bacteria. Furthermore, we have isolated and characterized transposon insertion mutants of V. cholerae that are defective in biofilm development. The transposons were localized to genes involved in (i) the biosynthesis and secretion of the mannose-sensitive haemagglutinin type IV pilus (MSHA); (ii) the synthesis of exopolysaccharide; and (iii) flagellar motility. The phenotypes of these three groups suggest that the type IV pilus and flagellum accelerate attachment to the abiotic surface, the flagellum mediates spread along the abiotic surface, and exopolysaccharide is involved in the formation of three-dimensional biofilm architecture. PMID:10564499

Stage-Specific Action of Matrix Metalloproteinases Influences Progressive Hereditary Kidney Disease

PubMed Central

Zeisberg, Michael; Khurana, Mona; Rao, Velidi H; Cosgrove, Dominic; Rougier, Jean-Philippe; Werner, Michelle C; Shield, Charles F; Werb, Zena; Kalluri, Raghu

2006-01-01

Background Glomerular basement membrane (GBM), a key component of the blood-filtration apparatus in the in the kidney, is formed through assembly of type IV collagen with laminins, nidogen, and sulfated proteoglycans. Mutations or deletions involving α3(IV), α4(IV), or α5(IV) chains of type IV collagen in the GBM have been identified as the cause for Alport syndrome in humans, a progressive hereditary kidney disease associated with deafness. The pathological mechanisms by which such mutations lead to eventual kidney failure are not completely understood. Methods and Findings We showed that increased susceptibility of defective human Alport GBM to proteolytic degradation is mediated by three different matrix metalloproteinases (MMPs)—MMP-2, MMP-3, and MMP-9—which influence the progression of renal dysfunction in α3(IV) −/− mice, a model for human Alport syndrome. Genetic ablation of either MMP-2 or MMP-9, or both MMP-2 and MMP-9, led to compensatory up-regulation of other MMPs in the kidney glomerulus. Pharmacological ablation of enzymatic activity associated with multiple GBM-degrading MMPs, before the onset of proteinuria or GBM structural defects in the α3(IV) −/− mice, led to significant attenuation in disease progression associated with delayed proteinuria and marked extension in survival. In contrast, inhibition of MMPs after induction of proteinuria led to acceleration of disease associated with extensive interstitial fibrosis and early death of α3(IV) −/− mice. Conclusions These results suggest that preserving GBM/extracellular matrix integrity before the onset of proteinuria leads to significant disease protection, but if this window of opportunity is lost, MMP-inhibition at the later stages of Alport disease leads to accelerated glomerular and interstitial fibrosis. Our findings identify a crucial dual role for MMPs in the progression of Alport disease in α3(IV) −/− mice, with an early pathogenic function and a later protective action. Hence, we propose possible use of MMP-inhibitors as disease-preventive drugs for patients with Alport syndrome with identified genetic defects, before the onset of proteinuria. PMID:16509766

Pathogenic Natural Antibodies Recognizing Annexin IV Are Required to Develop Intestinal Ischemia-Reperfusion Injury1

PubMed Central

Kulik, Liudmila; Fleming, Sherry D.; Moratz, Chantal; Reuter, Jason W.; Novikov, Aleksey; Chen, Kuan; Andrews, Kathy A.; Markaryan, Adam; Quigg, Richard J.; Silverman, Gregg J.; Tsokos, George C.; Holers, V. Michael

2010-01-01

Intestinal ischemia-reperfusion (IR)3 injury is initiated when natural IgM antibodies recognize neo-epitopes that are revealed on ischemic cells. The target molecules and mechanisms whereby these neo-epitopes become accessible to recognition are not well understood. Proposing that isolated intestinal epithelial cells (IEC) may carry IR-related neo-epitopes, we used in vitro IEC binding assays to screen hybridomas created from B cells of unmanipulated wild type C57BL/6 mice. We identified a novel IgM monoclonal antibody (mAb B4) that reacted with the surface of IEC by flow cytometric analysis and was alone capable of causing complement activation, neutrophil recruitment and intestinal injury in otherwise IR-resistant Rag1−/− mice. Monoclonal Ab B4 was found to specifically recognize mouse annexin IV. Pre-injection of recombinant annexin IV blocked IR injury in wild type C57BL/6 mice, demonstrating the requirement for recognition of this protein in order to develop IR injury in the context of a complex natural antibody repertoire. Humans were also found to exhibit IgM natural antibodies that recognize annexin IV. These data in toto identify annexin IV as a key ischemia-related target antigen that is recognized by natural Abs in a pathologic process required in vivo to develop intestinal IR injury. PMID:19380783

The very high rotators in the late-B and early-A stars: Shell stars with Si IV and C IV features the case of HD 119921

NASA Technical Reports Server (NTRS)

Freireferrero, R.; Bruhweiler, Frederick C.; Grady, C. A.

1990-01-01

Study of several stars in the late B and early A spectral types shows that very high rotators are associated with shell characteristics (sometimes not detected at all in the visible spectra) and also with C IV and some Si IV spectral absorption features which can be explained by circumstellar phenomena superimposed over stellar metallic blends. These particularities are evidenced by comparison with other spectra of low and high rotators in the same spectral range. HD 119921, a star with similar characteristics to the other ones of the sample, is given special attention. A possible scenario is suggested to explain the observed superionization features.