Science.gov

Sample records for mrna-binding proteins imps

  1. IMP1, an mRNA binding protein that reduces the metastatic potential of breast cancer in a mouse model

    PubMed Central

    Nwokafor, Chiso U.; Sellers, Rani S.; Singer, Robert H.

    2016-01-01

    Cells that are able to localize β-actin mRNA efficiently have decreased metastatic potential. Invasive carcinoma cells derived from primary mammary tumors have reduced levels of an RNA binding protein IMP1/ZBP1/IGF2BP1, required for β-actin mRNA localization. We showed previously that in human breast carcinoma cells in vitro, this protein suppresses invasion. In this work we examined whether its re-expression can suppress breast cancer metastasis in a breast cancer mouse model. We developed a mouse conditionally expressing IMP1-GFP (hereinafter referred to as the IMP1 transgene) specifically in the mammary gland of a PYMT breast cancer mouse. We found that mice conditionally expressing the IMP1 transgene showed little or no metastases to the lungs from the primary tumor in contrast to PYMT mice not expressing IMP1, which uniformly develop metastases at an early stage. PMID:27655671

  2. Engineered proteins with Pumilio/fem-3 mRNA binding factor scaffold to manipulate RNA metabolism.

    PubMed

    Wang, Yang; Wang, Zefeng; Tanaka Hall, Traci M

    2013-08-01

    Pumilio/fem-3 mRNA binding factor proteins are characterized by a sequence-specific RNA-binding domain. This unique single-stranded RNA recognition module, whose sequence specificity can be reprogrammed, has been fused with functional modules to engineer protein factors with various functions. We summarize the advances made with respect to developing RNA regulatory tools, as well as opportunities for the future.

  3. Cytoplasmic-nuclear shuttling of the urokinase mRNA binding protein regulates message stability.

    PubMed

    Shetty, Sreerama

    2002-08-01

    Treatment of small airway epithelial (SAEC) cells or lung epithelial (Beas2B) cells with TNF-alpha or PMA induces urokinase-type plasminogen activator (uPA) expression. Treatment of these cells with TNF-alpha, PMA or cycloheximide but not TGF-beta increased steady-state expression of uPAmRNA. TNF-alpha, PMA or cycloheximide caused 8-10 fold extensions of the uPAmRNA half-life in SAEC or Beas2B cells treated with DRB, a transcriptional inhibitor. These findings suggest that uPA gene expression involves a post-transcriptional regulatory mechanism. Using gel mobility shift and UV cross-linking assays, we identified a 30 kDa uPA mRNA binding protein (uPA mRNABp) that selectively binds to a 66 nt protein binding fragment of uPA mRNA containing regulatory information for message stabilization. Binding of cytoplasmic uPA mRNABp to uPA mRNA was abolished after treatment with TNF-alpha but not TGF-beta. In addition, we found the accumulation of 30 kDa uPAmRNABp in the nuclear extracts of TNF-alpha but not TGF-beta treated cells. The uPA mRNABp starts moving to the nucleus from the cytoplasmic compartment as early as three hours after TNF-alpha treatment. Complete translocation is achieved between 12-24 h, which coincides with the maximal expression of uPA protein effected by cytokine stimulation. Treatment of Beas2B cells with NaF inhibited TNF-alpha-mediated translocation of uPA mRNABp from the cytoplasm to the nucleus and concomitant inhibition of uPA expression. TNF-alpha stabilizes uPA mRNA by translocating the uPA mRNABp from the cytoplasm to the nucleus. Our results demonstrate a novel mechanism governing uPA mRNA stability through shuttling of uPA mRNABp between the nucleus and cytoplasm. This newly identified pathway may have evolved to regulate uPA-mediated functions of the lung epithelium in inflamation or neoplasia.

  4. Different forms of soluble cytoplasmic mRNA binding proteins and particles in Xenopus laevis oocytes and embryos

    PubMed Central

    1991-01-01

    To gain insight into the mechanisms involved in the formation of maternally stored mRNPs during Xenopus laevis development, we searched for soluble cytoplasmic proteins of the oocyte that are able to selectively bind mRNAs, using as substrate radiolabeled mRNA. In vitro mRNP assembly in solution was followed by UV-cross-linking and RNase digestion, resulting in covalent tagging of polypeptides by nucleotide transfer. Five polypeptides of approximately 54, 56 60, 70, and 100 kD (p54, p56, p60, p70, and p100) have been found to selectively bind mRNA and assemble into mRNPs. These polypeptides, which correspond to previously described native mRNP components, occur in three different particle classes of approximately 4.5S, approximately 6S, and approximately 15S, as also determined by their reactions with antibodies against p54 and p56. Whereas the approximately 4.5S class contains p42, p60, and p70, probably each in the form of individual molecules or small complexes, the approximately 6S particles appears to consist only of p54 and p56, which occur in a near-stoichiometric ratio suggestive of a heterodimer complex. The approximately 15S particles contain, in addition to p54 and p56, p60 and p100 and this is the single occurring form of RNA-binding p100. We have also observed changes in the in vitro mRNA binding properties of these polypeptides during oogenesis and early embryonic development, in relation to their phosphorylation state and to the activity of an approximately 15S particle-associated protein kinase, suggesting that these proteins are involved in the developmental translational regulation of maternal mRNAs. PMID:1670777

  5. Characterization of the Eimeria maxima sporozoite surface protein IMP1.

    PubMed

    Jenkins, M C; Fetterer, R; Miska, K; Tuo, W; Kwok, O; Dubey, J P

    2015-07-30

    The purpose of this study was to characterize Eimeria maxima immune-mapped protein 1 (IMP1) that is hypothesized to play a role in eliciting protective immunity against E. maxima infection in chickens. RT-PCR analysis of RNA from unsporulated and sporulating E. maxima oocysts revealed highest transcription levels at 6-12h of sporulation with a considerable downregulation thereafter. Alignment of IMP1 coding sequence from Houghton, Weybridge, and APU-1 strains of E. maxima revealed single nucleotide polymorphisms that in some instances led to amino acid changes in the encoded protein sequence. The E. maxima (APU-1) IMP1 cDNA sequence was cloned and expressed in 2 different polyHis Escherichia coli expression vectors. Regardless of expression vector, recombinant E. maxima IMP1 (rEmaxIMP1) was fairly unstable in non-denaturing buffer, which is consistent with stability analysis of the primary amino acid sequence. Antisera specific for rEmaxIMP1 identified a single 72 kDa protein or a 61 kDa protein by non-reducing or reducing SDS-PAGE/immunoblotting. Immunofluorescence staining with anti-rEmaxIMP1, revealed intense surface staining of E. maxima sporozoites, with negligible staining of merozoite stages. Immuno-histochemical staining of E. maxima-infected chicken intestinal tissue revealed staining of E. maxima developmental stages in the lamnia propia and crypts at both 24 and 48 h post-infection, and negligible staining thereafter. The expression of IMP1 during early stages of in vivo development and its location on the sporozoite surface may explain in part the immunoprotective effect of this protein against E. maxima infection.

  6. Characterization of the Eimeria maxima sporozoite surface protein IMP1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The purpose of this study was to characterize Eimeria maxima immunoprotective protein IMP1 that is hypothesized to play a role in eliciting protective immunity against E. maxima infection in chickens. RT-PCR analysis of RNA from unsporulated and sporulating E. maxima oocysts revealed highest transc...

  7. Involvement of the mRNA binding protein CRD-BP in the regulation of metastatic melanoma cell proliferation and invasion by hypoxia.

    PubMed

    Craig, Evisabel A; Weber, Jonathan D; Spiegelman, Vladimir S

    2012-12-15

    We have previously shown that the mRNA binding protein CRD-BP is overexpressed in human melanomas, where it promotes cell survival and resistance to chemotherapy. The present study investigates the role of hypoxia, a common characteristic of the tumor microenvironment, in the regulation of CRD-BP expression and melanoma cell responses. We found that hypoxia increases CRD-BP levels in metastatic melanoma cell lines but not in melanocytes or primary melanoma cells. Hypoxic stimulation transcriptionally regulates CRD-BP by facilitating the acetylation of histones within the CRD-BP gene and by modulating the extent of HIF1α binding to the CRD-BP promoter. Hypoxia significantly enhances the proliferative and invasive potential of metastatic melanoma cells but not that of normal or primary melanoma cells. Furthermore, inhibition of CRD-BP impairs the ability of metastatic cells to proliferate and invade in response to hypoxia. These findings identify CRD-BP as a novel effector of hypoxic responses that is relevant for the selection of metastatic cells. This work also describes a previously unknown role for CRD-BP in the regulation of melanoma cell invasion and highlights the importance of the hypoxic microenvironment in determining cell fate.

  8. IMP3 protein promotes chemoresistance in breast cancer cells by regulating breast cancer resistance protein (ABCG2) expression.

    PubMed

    Samanta, Sanjoy; Pursell, Bryan; Mercurio, Arthur M

    2013-05-03

    IMP3, a member of a family of insulin-like growth factor II (IGF-II) mRNA-binding proteins (IMPs), is expressed preferentially in triple-negative breast cancers, which are resistant to many chemotherapeutics. However, the mechanisms by which it impacts breast cancer have not been elucidated. We hypothesized a role for IMP3 in chemoresistance based on these observations. Depletion of IMP3 expression in triple-negative breast cancer cells increased their sensitivity to doxorubicin and mitoxantrone significantly but not to taxol. Given that doxorubicin and mitoxantrone are effluxed by breast cancer resistance protein (BCRP), we assessed whether IMP3 regulates BCRP. The data obtained demonstrate that IMP3 binds to BCRP mRNA and regulates BCRP expression. These findings are significant because they provide insight into the mechanism by which IMP3 contributes to aggressive cancers, and they highlight the potential for targeting this mRNA-binding protein for the clinical management of cancer.

  9. CircRNA-protein complexes: IMP3 protein component defines subfamily of circRNPs

    PubMed Central

    Schneider, Tim; Hung, Lee-Hsueh; Schreiner, Silke; Starke, Stefan; Eckhof , Heinrich; Rossbach, Oliver; Reich, Stefan; Medenbach, Jan; Bindereif , Albrecht

    2016-01-01

    Circular RNAs (circRNAs) constitute a new class of noncoding RNAs in higher eukaryotes generated from pre-mRNAs by alternative splicing. Here we investigated in mammalian cells the association of circRNAs with proteins. Using glycerol gradient centrifugation, we characterized in cell lysates circRNA-protein complexes (circRNPs) of distinct sizes. By polysome-gradient fractionation we found no evidence for efficient translation of a set of abundant circRNAs in HeLa cells. To identify circRNPs with a specific protein component, we focused on IMP3 (IGF2BP3, insulin-like growth factor 2 binding protein 3), a known tumor marker and RNA-binding protein. Combining RNA-seq analysis of IMP3-co-immunoprecipitated RNA and filtering for circular-junction reads identified a set of IMP3-associated circRNAs, which were validated and characterized. In sum, our data suggest that specific circRNP families exist defined by a common protein component. In addition, this provides a general approach to identify circRNPs with a given protein component. PMID:27510448

  10. The oncofetal protein IMP3: a novel biomarker for endometrial serous carcinoma.

    PubMed

    Zheng, Wenxin; Yi, Xiaofang; Fadare, Oluwole; Liang, Sharon X; Martel, Maritza; Schwartz, Peter E; Jiang, Zhong

    2008-02-01

    Insulin-like growth factor II mRNA-binding protein 3 (IMP3) is an oncofetal protein highly expressed in fetal tissue and malignant tumors but rarely found in adult benign tissues. The aim of this study is to determine the expression of IMP3 in benign endometrium, endometrial cancer, and its precursor lesions, trying to see whether IMP3 has any diagnostic usage. Two hundred ninety-eight endometrial samples were examined for IMP3 expression by immunohistochemistry. These included benign endometrium (n=68), atypical hyperplasia or endometrial intraepithelial neoplasia (n=35), endometrial glandular dysplasia (n=21), endometrial intraepithelial carcinoma (n=18), endometrioid carcinoma (n=70), mucinous carcinoma (n=8), serous carcinoma (n=51), clear cell carcinoma (n=12), and other malignancies (n=15). Maturational patterns in the 68 benign endometrial samples included atrophic (n=12), proliferative (n=18), secretory (n=14), menstrual (n=8), and gestational (n=16). Most of the carcinomas were histologically pure; where mixed, the second component constituted <10% of the total tumor volume. The extent and intensity of IMP3 expression was semiquantitatively determined and scored for all samples. A renal cell carcinoma with known IMP3 expression was used as positive control for each immunohistochemistry run. Among the malignant cases, IMP3 expression was predominantly found in endometrial serous carcinoma and its putative precursor lesions, with 3 (14%) of 21 endometrial glandular dysplasia, 16 (89%) of 18 serous endometrial intraepithelial carcinoma, and 48 (94%) of 51 serous carcinomas (P<0.001). In contrast, the frequency of IMP3 expression was significantly lesser in nonserous malignancies with 0 (0%) of 35, 5 (7%) of 70, 0 (0%) of 8, 3 (25%) of 12, and 5 (33%) of 15 positive expression rates in atypical hyperplasia or endometrial intraepithelial neoplasia, endometrioid, mucinous, clear cell carcinomas, and other malignancies, respectively. The IMP3 staining was

  11. An IcmF family protein, ImpLM, is an integral inner membrane protein interacting with ImpKL, and its walker a motif is required for type VI secretion system-mediated Hcp secretion in Agrobacterium tumefaciens.

    PubMed

    Ma, Lay-Sun; Lin, Jer-Sheng; Lai, Erh-Min

    2009-07-01

    An intracellular multiplication F (IcmF) family protein is a conserved component of a newly identified type VI secretion system (T6SS) encoded in many animal and plant-associated Proteobacteria. We have previously identified ImpL(M), an IcmF family protein that is required for the secretion of the T6SS substrate hemolysin-coregulated protein (Hcp) from the plant-pathogenic bacterium Agrobacterium tumefaciens. In this study, we characterized the topology of ImpL(M) and the importance of its nucleotide-binding Walker A motif involved in Hcp secretion from A. tumefaciens. A combination of beta-lactamase-green fluorescent protein fusion and biochemical fractionation analyses revealed that ImpL(M) is an integral polytopic inner membrane protein comprising three transmembrane domains bordered by an N-terminal domain facing the cytoplasm and a C-terminal domain exposed to the periplasm. impL(M) mutants with substitutions or deletions in the Walker A motif failed to complement the impL(M) deletion mutant for Hcp secretion, which provided evidence that ImpL(M) may bind and/or hydrolyze nucleoside triphosphates to mediate T6SS machine assembly and/or substrate secretion. Protein-protein interaction and protein stability analyses indicated that there is a physical interaction between ImpL(M) and another essential T6SS component, ImpK(L). Topology and biochemical fractionation analyses suggested that ImpK(L) is an integral bitopic inner membrane protein with an N-terminal domain facing the cytoplasm and a C-terminal OmpA-like domain exposed to the periplasm. Further comprehensive yeast two-hybrid assays dissecting ImpL(M)-ImpK(L) interaction domains suggested that ImpL(M) interacts with ImpK(L) via the N-terminal cytoplasmic domains of the proteins. In conclusion, ImpL(M) interacts with ImpK(L), and its Walker A motif is required for its function in mediation of Hcp secretion from A. tumefaciens.

  12. Expression of progesterone receptor membrane component 1, serpine mRNA binding protein 1 and nuclear progesterone receptor isoforms A and B in the bovine myometrium during the estrous cycle and early pregnancy.

    PubMed

    Slonina, Dominika; Kowalik, Magdalena K; Kotwica, Jan

    2012-01-01

    The aim of this study was to investigate the (1) expression of progesterone membrane component 1 (PGRMC1), serpine mRNA binding protein 1 (SERBP1) and progesterone receptor (PR) mRNA and (2) protein expression levels of PGRMC1, SERBP1 and PR isoforms A and B in the bovine myometrium during the estrous cycle and early pregnancy. Uteri from cows on days 1-5, 6-10, 11-16 and 17-21 of the estrous cycle and weeks 3-5, 6-8 and 9-12 of pregnancy were used (n=5-6 per period). There were no changes (P>0.05) in PGRMC1 mRNA expression during the estrous cycle, while expression of SERBP1 and PR mRNA was the lowest (P<0.05) on days 11-16 relative to other days of the cycle. The highest mRNA expression of PGRMC1, SERBP1 and PR was found during pregnancy. There were no changes (P>0.05) in SERBP1 protein expression in cycling and pregnant cows, while the highest (P<0.05) PGRMC1 protein expression was found during weeks 3-5 of pregnancy. Similar protein expression profiles for PRA and PRB were found, and protein levels were highest on days 1-5 of the estrous cycle. From day 6 of the cycle, PRA and PRB protein expression decreased and were maintained at this lower level during pregnancy. In conclusion, our study assessed mRNA and protein expression levels of PGRMC1, SERBP1 and PR in the bovine myometrium during the estrous cycle and the first trimester of pregnancy. It is possible that progesterone (P4) affects myometrial function in a genomic and nongenomic manner.

  13. IMP-3 expression in keratoacanthomas and squamous cell carcinomas of the skin: an immunohistochemical study

    PubMed Central

    Soddu, S.; Di Felice, E.; Cabras, S.; Castellanos, M.E.; Atzori, L.; Faa, G.; Pilloni, L.

    2013-01-01

    The protein insulin-like growth factor II mRNA binding protein 3 (IMP-3) is an important factor for cell migration and adhesion in malignancies. Recent studies have shown a remarkable overexpression of IMP-3 in different human malignant neoplasms and also revealed it as an important prognostic marker in some tumor entities. The purpose of this study is to compare IMP-3 immunostaining in cutaneous squamous cell tumors and determine whether IMP-3 can aid in the differential diagnosis of these lesions. To our knowledge, IMP-3 expression has not been investigated in skin squamous cell proliferations thus far. Immunohi-stochemical staining for IMP-3 was performed on slides organized by samples from 67 patients, 34 with keratoacanthoma (KA) and 33 with primary cutaneous squamous cell carcinoma (SCC) (16 invasive and 17 in situ). Seventyfour percent of KAs (25/34) were negative for IMP-3 staining, while 57% of SCCs (19/33) were positive for IMP-3 staining. The percentage of IMP-3 positive cells increased significantly in the invasive SCC group (P=0.0111), and particularly in the SCC in situ group (P=0.0021) with respect to the KA group. IMP-3 intensity staining was significantly higher in invasive SCCs (P=0.0213), and particularly in SCCs in situ (P=0.008) with respect to KA. Our data show that IMP-3 expression is different in keratoacanthoma with respect to squamous cell carcinoma. IMP-3 assessment and staining pattern, together with a careful histological study, can be useful in the differential diagnosis between KA e SCC. PMID:23549465

  14. Expression and localization of progesterone receptor membrane component 1 and 2 and serpine mRNA binding protein 1 in the bovine corpus luteum during the estrous cycle and the first trimester of pregnancy.

    PubMed

    Kowalik, Magdalena K; Rekawiecki, Robert; Kotwica, Jan

    2014-11-01

    The aim of this study was to evaluate the mRNA and protein expression and the localization of progesterone receptor membrane component 1 (PGRMC1), PGRMC2, and the PGRMC1 partner serpine mRNA binding protein 1 (SERBP1) in the bovine CL on Days 2 to 5, 6 to 10, 11 to 16, and 17 to 20 of the estrous cycle as well as during Weeks 3 to 5, 6 to 8, and 9 to 12 of pregnancy (n = 5-6 per each period). The highest levels of PGRMC1 and PGRMC2 mRNA expression were found on Days 6 to 16 (P < 0.05) and 11 to 16, respectively, of the estrous cycle and during pregnancy (P < 0.001). The level of PGRMC1 protein was the highest (P < 0.05) on Days 11 to 16 of the estrous cycle compared with the other stages of the estrous cycle and pregnancy, whereas PGRMC2 protein expression (P < 0.001) was the highest on Days 17 to 20 and also during pregnancy. The mRNA expression of SERBP1 was increased (P < 0.05) on Days 11 to 16, whereas the level of its protein product was decreased (P < 0.05) on Days 6 to 10 of the estrous cycle and was at its lowest (P < 0.001) on Days 17 to 20. In pregnant cows, the patterns of SERBP1 mRNA and protein expression remained constant and were comparable with those observed during the estrous cycle. Progesterone receptor membrane component 1 and PGRMC2 localized to both large and small luteal cells, whereas SERBP1 was observed mainly in small luteal cells and much less frequently in large luteal cells. All proteins were also localized in the endothelial cells of blood vessels. The data obtained indicate the variable expression of PGRMC1, PGRMC2, and SERBP1 mRNA and protein in the bovine CL and suggest that progesterone may regulate CL function via its membrane receptors during both the estrous cycle and pregnancy.

  15. Expression of IMP1 enhances production of murine leukemia virus vector by facilitating viral genomic RNA packaging.

    PubMed

    Mai, Yun; Gao, Guangxia

    2010-12-29

    Murine leukemia virus (MLV)-based retroviral vector is widely used for gene transfer. Efficient packaging of the genomic RNA is critical for production of high-titer virus. Here, we report that expression of the insulin-like growth factor II mRNA binding protein 1 (IMP1) enhanced the production of infectious MLV vector. Overexpression of IMP1 increased the stability of viral genomic RNA in virus producer cells and packaging of the RNA into progeny virus in a dose-dependent manner. Downregulation of IMP1 in virus producer cells resulted in reduced production of the retroviral vector. These results indicate that IMP1 plays a role in regulating the packaging of MLV genomic RNA and can be used for improving production of retroviral vectors.

  16. Local requirement of the Drosophila insulin binding protein imp-L2 in coordinating developmental progression with nutritional conditions.

    PubMed

    Sarraf-Zadeh, Ladan; Christen, Stefan; Sauer, Uwe; Cognigni, Paola; Miguel-Aliaga, Irene; Stocker, Hugo; Köhler, Katja; Hafen, Ernst

    2013-09-01

    In Drosophila, growth takes place during the larval stages until the formation of the pupa. Starvation delays pupariation to allow prolonged feeding, ensuring that the animal reaches an appropriate size to form a fertile adult. Pupariation is induced by a peak of the steroid hormone ecdysone produced by the prothoracic gland (PG) after larvae have reached a certain body mass. Local downregulation of the insulin/insulin-like growth factor signaling (IIS) activity in the PG interferes with ecdysone production, indicating that IIS activity in the PG couples the nutritional state to development. However, the underlying mechanism is not well understood. In this study we show that the secreted Imaginal morphogenesis protein-Late 2 (Imp-L2), a growth inhibitor in Drosophila, is involved in this process. Imp-L2 inhibits the activity of the Drosophila insulin-like peptides by direct binding and is expressed by specific cells in the brain, the ring gland, the gut and the fat body. We demonstrate that Imp-L2 is required to regulate and adapt developmental timing to nutritional conditions by regulating IIS activity in the PG. Increasing Imp-L2 expression at its endogenous sites using an Imp-L2-Gal4 driver delays pupariation, while Imp-L2 mutants exhibit a slight acceleration of development. These effects are strongly enhanced by starvation and are accompanied by massive alterations of ecdysone production resulting most likely from increased Imp-L2 production by neurons directly contacting the PG and not from elevated Imp-L2 levels in the hemolymph. Taken together our results suggest that Imp-L2-expressing neurons sense the nutritional state of Drosophila larvae and coordinate dietary information and ecdysone production to adjust developmental timing under starvation conditions.

  17. IMP3 expression in lesions of the biliary tract: a marker for high-grade dysplasia and an independent prognostic factor in bile duct carcinomas.

    PubMed

    Riener, Marc-Oliver; Fritzsche, Florian R; Clavien, Pierre-Alain; Pestalozzi, Bernhard C; Probst-Hensch, Nicole; Jochum, Wolfram; Kristiansen, Glen

    2009-10-01

    The oncofetal protein IMP3 (insulin-like growth factor II mRNA binding protein 3) is expressed during embryogenesis and carcinogenesis. Various tumor types have been analyzed for IMP3 expression, which was exclusively found in tumor cells and correlated with increased tumor aggressiveness and reduced overall survival. To our knowledge, IMP3 expression has not been investigated in bile duct carcinomas. Using large tissue sections from resection specimens of the extrahepatic biliary tract, we analyzed IMP3 in normal bile ducts (n = 36), bile ducts with acute inflammation and reactive epithelial changes (n = 26), low-grade dysplasia (n = 9), and high-grade dysplasia (n = 11). Furthermore, IMP3 expression was assessed in bile duct carcinoma (n = 115) using clinically well-characterized tissue microarrays. The findings were correlated with clinical-pathologic parameters including survival. High-grade dysplasia was strongly positive for IMP3 in all cases studied compared with no or weak expression in normal, inflamed, and low-grade dysplastic bile ducts. Of the bile duct carcinomas 58.3% (67/115) were strongly positive for IMP3, which was associated with a higher proliferation rate (P = .004) and p53 positivity (P = .022). Patients with strong IMP3 expression had significantly reduced overall survival (P = .037) similarly to the subgroup of pT3 carcinomas (P = .007). In multivariate analysis, IMP3 expression was an independent prognostic factor for overall survival (P = .040, RR = 1.809). This comprehensive study shows that IMP3 is an independent prognostic biomarker in bile duct carcinoma. In addition, it may be a marker for high-grade dysplasia in the extrahepatic biliary tract.

  18. Toward immunomodulation of witches broom disease of lime (WBDL) by targeting immunodominant membrane protein (IMP) of candidatus Phytoplasma aurantifolia.

    PubMed

    Shahryari, F; Safarnejad, M R; Shams-Bakhsh, M; Jouzani, G R Salehi

    2010-01-01

    The witches' broom disease of lime (WBDL) caused by Candidatus Phytoplasma aurantifolia is the most devastating disease of acidian lime in southern part of Iran as it destroy thousands of trees yearly throughout these regions. Traditional methods such as eradication of infected trees and insect vector control have shown limited effect on this case. Therefore, alternative approaches such as plantibody-mediated resistance, have been considered. Throughout present study we prepared sufficient amount of antigen that is required for generation of specific monoclonal recombinant antibodies against Immunodominant membrane protein (IMP) which will be exploited for plantibody-mediated resistance approach. The gene encoding IMP protein was obtained by PCR amplification using specific primers and DNA extracted from the infected plants. Amplified fragment was then inserted into T/A cloning vector. Intact clones containing the right sequence was selected after digestion, PCR amplification and subsequent sequencing analysis. IMP encoding region having the right sequence was sub-cloned into pET28a bacterial expression vector. Large scale expression of His tagged recombinant protein was performed in the BL21-de3 strain of E. coli and purification under native conditions was carried out through immobilized metal ion affinity chromatography (IMAC) in a column containing Ni-NTA agarose beads. Successful expression and purification steps were confirmed by SDS-PAGE and western blotting analyses. The results obtained indicated the successful production of about 18 mg purified recombinant IMP protein with a low level of contamination in one liter cultured medium. Finally the purified protein was dialyzed in phosphate saline buffer and applied for immunization of mice.

  19. Insulin-Like Growth Factor II mRNA-Binding Protein 3 (IMP3) as a Useful Immunohistochemical Marker for the Diagnosis of Adenocarcinoma of Small Intestine

    PubMed Central

    Daikuhara, Seiichi; Uehara, Takeshi; Higuchi, Kayoko; Hosaka, Noriko; Iwaya, Mai; Maruyama, Yasuhiro; Matsuda, Kazuyuki; Arakura, Norikazu; Tanaka, Eiji; Ota, Hiroyoshi

    2015-01-01

    The biological characteristics and roles of insulin-like growth factor II mRNA-binding protein 3 protein (IMP3) expression in small-intestinal adenocarcinoma were investigated. The value of IMP3 immunostaining in the diagnosis of small-intestinal epithelial lesions was also evaluated. Immunohistochemical expression of IMP3 in normal small-intestinal mucosa adjacent to adenoma and adenocarcinoma lesions, and inflamed duodenal and ileal mucosa was analyzed. Samples assessed were: duodenal ulcer (n=6), Crohn’s disease (n=5), low-grade small-intestinal adenoma (n=10), high-grade small-intestinal adenoma (n=13), small-intestinal adenocarcinoma (n=23), lymph node metastases (LNM; n=7), and preoperative biopsies of small-intestinal adenocarcinoma (n=6). Immunohistochemical expression of Ki-67 and p53 was also analyzed in adenoma and adenocarcinoma samples. IMP3 was not expressed in normal epithelium, but weakly expressed in reparative epithelium. Meanwhile, increased IMP3 expression was associated with a higher degree of dysplasia in adenomas, higher T classification, LNM, Ki-67 positivity, histological differentiation, and lower 5-year disease-free survival, but not p53 expression in adenocarcinoma. IMP3 expression appears to be a late event in the small-intestinal carcinogenesis. Assessing the IMP3 staining pattern can be useful in the diagnosis of small-intestinal epithelial lesions when used in conjunction with other histological criteria. PMID:26855452

  20. IMP mission

    NASA Technical Reports Server (NTRS)

    1972-01-01

    The program requirements and operations requirements for the IMP mission are presented. The satellite configuration is described and the missions are analyzed. The support equipment, logistics, range facilities, and responsibilities of the launching organizations are defined. The systems for telemetry, communications, satellite tracking, and satellite control are identified.

  1. Expression of progesterone receptor membrane component (PGRMC) 1 and 2, serpine mRNA binding protein 1 (SERBP1) and nuclear progesterone receptor (PGR) in the bovine endometrium during the estrous cycle and the first trimester of pregnancy.

    PubMed

    Kowalik, Magdalena K; Slonina, Dominika; Rekawiecki, Robert; Kotwica, Jan

    2013-03-01

    Progesterone (P4) is involved in the regulation of essential reproductive functions affecting the target cells through both nuclear progesterone receptors (PGRs) and membrane progesterone receptors. The aim of this study was to determine the mRNA and protein expression for PGRMC1, PGRMC2, SERBP1 and PGR within the bovine endometrium during the estrous cycle and the first trimester of pregnancy. There were no changes in PGRMC1 and PGRMC2 mRNA and protein expression during the estrous cycle, however, mRNA levels of PGRMC1 and PGRMC2 were increased (P<0.001) in pregnant animals. SERBP1 mRNA expression was increased (P<0.05), while the level of this protein was decreased (P<0.05) on days 11-16 of the estrous cycle. The expression of PGR mRNA was higher (P<0.01) on days 17-20 compared to days 6-10 and 11-16 of the estrous cycle and pregnancy. PGR-A and PGR-B protein levels were elevated on days 1-5 and 17-20 of the estrous cycle as compared to other stages of the cycle and during pregnancy. In conclusion, our results indicate that P4 may influence endometrial cells through both genomic and nongenomic way. This mechanism may contribute to the regulation of the estrous cycle and provide protection during pregnancy.

  2. The Cdc15 and Imp2 SH3 domains cooperatively scaffold a network of proteins that redundantly ensure efficient cell division in fission yeast

    PubMed Central

    Ren, Liping; Willet, Alaina H.; Roberts-Galbraith, Rachel H.; McDonald, Nathan A.; Feoktistova, Anna; Chen, Jun-Song; Huang, Haiming; Guillen, Rodrigo; Boone, Charles; Sidhu, Sachdev S.; Beckley, Janel R.; Gould, Kathleen L.

    2015-01-01

    Schizosaccharomyces pombe cdc15 homology (PCH) family members participate in numerous biological processes, including cytokinesis, typically by bridging the plasma membrane via their F-BAR domains to the actin cytoskeleton. Two SH3 domain–containing PCH family members, Cdc15 and Imp2, play critical roles in S. pombe cytokinesis. Although both proteins localize to the contractile ring, with Cdc15 preceding Imp2, only cdc15 is an essential gene. Despite these distinct roles, the SH3 domains of Cdc15 and Imp2 cooperate in the essential process of recruiting other proteins to stabilize the contractile ring. To better understand the connectivity of this SH3 domain–based protein network at the CR and its function, we used a biochemical approach coupled to proteomics to identify additional proteins (Rgf3, Art1, Spa2, and Pos1) that are integrated into this network. Cell biological and genetic analyses of these SH3 partners implicate them in a range of activities that ensure the fidelity of cell division, including promoting cell wall metabolism and influencing cell morphogenesis. PMID:25428987

  3. IMP: a multi-species functional genomics portal for integration, visualization and prediction of protein functions and networks.

    PubMed

    Wong, Aaron K; Park, Christopher Y; Greene, Casey S; Bongo, Lars A; Guan, Yuanfang; Troyanskaya, Olga G

    2012-07-01

    Integrative multi-species prediction (IMP) is an interactive web server that enables molecular biologists to interpret experimental results and to generate hypotheses in the context of a large cross-organism compendium of functional predictions and networks. The system provides a framework for biologists to analyze their candidate gene sets in the context of functional networks, as they expand or focus these sets by mining functional relationships predicted from integrated high-throughput data. IMP integrates prior knowledge and data collections from multiple organisms in its analyses. Through flexible and interactive visualizations, researchers can compare functional contexts and interpret the behavior of their gene sets across organisms. Additionally, IMP identifies homologs with conserved functional roles for knowledge transfer, allowing for accurate function predictions even for biological processes that have very few experimental annotations in a given organism. IMP currently supports seven organisms (Homo sapiens, Mus musculus, Rattus novegicus, Drosophila melanogaster, Danio rerio, Caenorhabditis elegans and Saccharomyces cerevisiae), does not require any registration or installation and is freely available for use at http://imp.princeton.edu.

  4. IMP-8 Magnetometer Experiment

    NASA Technical Reports Server (NTRS)

    Szabo, Adam

    2011-01-01

    IMP-8 (IMP-J) was launched by NASA on October 26, 1973 to measure the magnetic fields, plasmas, and energetic charged particles (e.g., cosmic rays) of the Earth's magnetotail and magnetosheath and of the near-Earth solar wind. IMP-8, the last often IMP (Interplanetary Monitoring Platform) or AIMP (Anchored-IMP) spacecraft launched in 10 years, operated until October 7, 2006, in a near-circular, 35 Earth Radii, 12-day orbit. It was an important adjunct to the International Solar Terrestrial Physics program, provided in-ecliptic, one Astronomical Unit baseline data for the deep space Pioneer, Voyager and Ulysses missions, and built a long-time-series database useful in understanding long-term solar processes .

  5. BRCA-mutated Invasive Breast Carcinomas: Immunohistochemical Analysis of Insulin-like Growth Factor II mRNA-binding Protein (IMP3), Cytokeratin 8/18, and Cytokeratin 14.

    PubMed

    Mohanty, Sambit K; Lai, Jin-Ping; Gordon, Ora K; Pradhan, Dinesh; Bose, Shikha; Dadmanesh, Farnaz

    2015-01-01

    To evaluate the expression of insulin-like growth factor II mRNA-binding protein (IMP3), CK8/18, and CK14 in BRCA mutated and sporadic invasive breast carcinoma. Immunohistochemistry for IMP3, CK8/18, and CK14 was performed on 39 cases of invasive breast carcinomas with BRCA mutation (24 BRCA1, 14 BRCA2, and 1 dual BRCA1/BRCA2) and 54 cases of sporadic invasive breast carcinomas. The relationship between the IMP3, CK8/18, and CK14 and the tumor grade and molecular phenotypes were analyzed. IMP3, CK8/18, and CK14 positivity were present in 20 (51%), 22 (56%), and 14 (36%) of 39 BRCA-mutated breast carcinomas, and 11 (20%), 53 (98%), and 24 (44%) of 54 sporadic breast carcinomas respectively. The rates of IMP3 expression and absence of CK8/18 (44% versus 2%) in BRCA-mutated breast carcinomas was significantly higher than the sporadic breast carcinomas (p = 0.002 and p < 0.001). No significant difference was observed for CK14 among the two groups (p = 0.408). No significant difference was observed among BRCA1-related and BRCA2-related breast carcinomas in the immunoprofile for IMP3, CK8/18, and CK14. No significant correlation was identified between the expression of IMP3 and CK8/18 and the tumor grade in both BRCA-mutated and sporadic breast carcinomas (p > 0.05). In cases with luminal A and B phenotypes, the rates of expression of IMP3 and loss of CK8/18 were significantly higher in BRCA-mutated as compared to sporadic breast carcinoma (p < 0.001). In cases with basal-like phenotype, the absence of CK8/18 expression was significantly higher in BRCA-mutated breast carcinomas (54% versus 0%, p = 0.001), while no difference was observed for IMP3 expression (p = 0.435). Regardless of mutation type, histologic grade, or molecular phenotype, the absence of CK8/18 expression and presence of IMP3 expression are seen at much higher rate in BRCA mutated breast carcinomas.

  6. IMP-1 Satellite

    NASA Technical Reports Server (NTRS)

    Alvarez, H.

    1975-01-01

    Computer programs and procedures developed to process type 3 burst data obtained by IMP-6 are given. Data are primarily concerned with bursts that drift down to 130 kHz or lower. Graphical methods devised fit models to data are also considered. Burst time of arrival as well as direction of arrival were determined for several frequencies.

  7. IMP series report/bibliography

    NASA Technical Reports Server (NTRS)

    King, J. H.

    1971-01-01

    The main characteristics of the IMP spacecraft and experiments are considered and the scientific knowledge gained is presented in the form of abstracts of scientific papers using IMP data. Spacecraft characteristics, including temporal and spatial coverages, are presented followed by an annotated bibliography. Experiments conducted on all IMP's (including prelaunch IMP's H and J) are described. Figures are presented showing the time histories, through the end of 1970, of magnetic field, plasma, and energetic particle experiments.

  8. IMP 2.0: a multi-species functional genomics portal for integration, visualization and prediction of protein functions and networks.

    PubMed

    Wong, Aaron K; Krishnan, Arjun; Yao, Victoria; Tadych, Alicja; Troyanskaya, Olga G

    2015-07-01

    IMP (Integrative Multi-species Prediction), originally released in 2012, is an interactive web server that enables molecular biologists to interpret experimental results and to generate hypotheses in the context of a large cross-organism compendium of functional predictions and networks. The system provides biologists with a framework to analyze their candidate gene sets in the context of functional networks, expanding or refining their sets using functional relationships predicted from integrated high-throughput data. IMP 2.0 integrates updated prior knowledge and data collections from the last three years in the seven supported organisms (Homo sapiens, Mus musculus, Rattus norvegicus, Drosophila melanogaster, Danio rerio, Caenorhabditis elegans, and Saccharomyces cerevisiae) and extends function prediction coverage to include human disease. IMP identifies homologs with conserved functional roles for disease knowledge transfer, allowing biologists to analyze disease contexts and predictions across all organisms. Additionally, IMP 2.0 implements a new flexible platform for experts to generate custom hypotheses about biological processes or diseases, making sophisticated data-driven methods easily accessible to researchers. IMP does not require any registration or installation and is freely available for use at http://imp.princeton.edu.

  9. IMP - INTEGRATED MISSION PROGRAM

    NASA Technical Reports Server (NTRS)

    Dauro, V. A.

    1994-01-01

    IMP is a simulation language that is used to model missions around the Earth, Moon, Mars, or other planets. It has been used to model missions for the Saturn Program, Apollo Program, Space Transportation System, Space Exploration Initiative, and Space Station Freedom. IMP allows a user to control the mission being simulated through a large event/maneuver menu. Up to three spacecraft may be used: a main, a target and an observer. The simulation may begin at liftoff, suborbital, or orbital. IMP incorporates a Fehlberg seventh order, thirteen evaluation Runge-Kutta integrator with error and step-size control to numerically integrate the equations of motion. The user may choose oblate or spherical gravity for the central body (Earth, Mars, Moon or other) while a spherical model is used for the gravity of an additional perturbing body. Sun gravity and pressure and Moon gravity effects are user-selectable. Earth/Mars atmospheric effects can be included. The optimum thrust guidance parameters are calculated automatically. Events/maneuvers may involve many velocity changes, and these velocity changes may be impulsive or of finite duration. Aerobraking to orbit is also an option. Other simulation options include line-of-sight communication guidelines, a choice of propulsion systems, a soft landing on the Earth or Mars, and rendezvous with a target vehicle. The input/output is in metric units, with the exception of thrust and weight which are in English units. Input is read from the user's input file to minimize real-time keyboard input. Output includes vehicle state, orbital and guide parameters, event and total velocity changes, and propellant usage. The main output is to the user defined print file, but during execution, part of the input/output is also displayed on the screen. An included FORTRAN program, TEKPLOT, will display plots on the VDT as well as generating a graphic file suitable for output on most laser printers. The code is double precision. IMP is written in

  10. An oncofetal antigen, IMP-3-derived long peptides induce immune responses of both helper T cells and CTLs

    PubMed Central

    Hirayama, Masatoshi; Tomita, Yusuke; Yuno, Akira; Tsukamoto, Hirotake; Senju, Satoru; Imamura, Yuya; Sayem, Mohammad Abu; Irie, Atsushi; Yoshitake, Yoshihiro; Fukuma, Daiki; Shinohara, Masanori; Hamada, Akinobu; Jono, Hirofumi; Yuba, Eiji; Kono, Kenji; Yoshida, Koji; Tsunoda, Takuya; Nakayama, Hideki; Nishimura, Yasuharu

    2016-01-01

    ABSTRACT Insulin-like growth factor II mRNA-binding protein 3 (IMP-3), an oncofetal antigen identified using genome-wide cDNA microarray analyses, is overexpressed in several malignancies. IMP-3-derived cytotoxic T lymphocyte (CTL) epitopes have been used for peptide-based immunotherapies against various cancers. In addition to CTLs, induction of tumor-associated antigen (TAA)-specific helper T (Th) cells is crucial for establishment of effective antitumor immunity. In this study, we aimed to identify IMP-3-derived long peptides (IMP-3-LPs) carrying CTL and promiscuous Th-cell epitopes for use in cancer immunotherapy. IMP-3-derived Th-cell epitopes that bind to multiple HLA-class II molecules were predicted by in silico analysis, and their immunogenicity was determined by utilizing human T cells. We identified two highly immunogenic IMP-3-LPs presented by multiple HLA-class II molecules. One of the IMP-3-LPs encompassed two CTL epitopes that have been used for peptide-vaccine immunotherapy in ongoing clinical trials. IMP-3-LPs-specific Th cells responded to autologous dendritic cells (DCs) loaded with the recombinant IMP-3 proteins, suggesting that these s (LPs) can be naturally processed and presented. The IMP-3-LPs and specific Th cells augmented the expansion of IMP-3-specific CTLs, which was further enhanced by programmed cell death-1 (PD-1) blockade. In addition, IMP-3-LP encapsulated in liposomes was efficiently cross-presented in vitro, and this LP successfully cross-primed CTLs in HLA-A2 transgenic mice (Tgm) in vivo. Furthermore, one of the IMP-3-LPs induced IMP-3-specific Th cells from peripheral blood mononuclear cells (PBMCs) of head-and-neck malignant tumor (HNMT) patients. These findings suggest the potential usefulness of IMP-3-LPs in propagating both Th cells and CTLs and may have implications for IMP-3-LPs-based cancer immunotherapy. PMID:27471607

  11. Male-specific splicing of the silkworm Imp gene is maintained by an autoregulatory mechanism.

    PubMed

    Suzuki, Masataka G; Kobayashi, Sayaka; Aoki, Fugaku

    2014-02-01

    Sexual differentiation in the silkworm Bombyx mori is controlled by sex-specific splicing of Bmdsx, in which exons 3 and 4 are skipped in males. B. mori insulin-like growth factor II mRNA-binding protein (Imp) is a factor involved in the male-specific splicing of Bmdsx. In this study, we found that the male-specific Imp mRNA is formed as a result of the inclusion of exon 8 and the promoter-distal poly(A) site choice, whereas non-sex-specific polyadenylation occurs at the promoter-proximal poly(A) site downstream of exon 7. Recent studies revealed that Drosophila Sxl, tra in several dipteran and hymenopteran insects, and fem in Apis mellifera, play a central role in sex determination and maintain their productive mode of expression via an autoregulatory function. To determine whether Imp protein is required for the maintenance of the male-specific splicing of its own pre-mRNA, we knocked down endogenous Imp in male cells and assessed the male-specific splicing of an exogenous Imp minigene. Knockdown of endogenous Imp inhibited the male-specific splicing of the Imp minigene transcript. In contrast, overexpression of Imp in female cells induced the male-specific splicing of the Imp minigene transcript. Moreover, deletion of adenine-rich (A-rich) sequences located downstream of the proximal poly(A) site repressed the male-specific splicing of the Imp minigene transcript. Finally, gel shift analysis demonstrated that Imp binds to the A-rich sequences. These data suggest that Imp binds to the A-rich sequences in its own pre-mRNA to induce the male-specific splicing of its pre-mRNA.

  12. IMP I, H, and J

    NASA Technical Reports Server (NTRS)

    1973-01-01

    The schedule for the IMP project for the eighth, ninth, and tenth satellites of the series is presented. A description of the spacecraft and the weekly summaries of the operations performed on the spacecraft are provided. The project planning, project problems, recommendations, and reports of launch operations are described. Drawings of the satellite structures are included.

  13. Rapid discrimination of blaIMP-1, blaIMP-6, and blaIMP-34 using a multiplex PCR.

    PubMed

    Kayama, Shizuo; Ohge, Hiroki; Sugai, Motoyuki

    2017-04-01

    Stealth-type carbapenem-resistant Enterobacteriaceae that are resistant to almost all β-lactams except imipenem is emerging in Japan. This resistance is mediated by specific variants of the metallo-β-lactamases (blaIMP-6 or blaIMP-34) that differs by one amino acid from the common variant blaIMP-1. We developed an amplification refractory mutation system (ARMS) PCR assay enabling rapid, sequence independent, identification of these variants.

  14. IMP2, a gene involved in the expression of glucose-repressible genes in Saccharomyces cerevisiae.

    PubMed

    Lodi, T; Goffrini, P; Ferrero, I; Donnini, C

    1995-09-01

    Two mutants carrying different deletions of the IMP2 coding sequence of Saccharomyces cerevisiae, delta T1, which encodes a protein lacking the last 26 C-terminal amino acids, and delta T2, which completely lacks the coding region, were analysed for derepression of glucose-repressible maltose, galactose, raffinose and ethanol utilization pathways in response to glucose limitation. The role of the IMP2 gene product in the regulation of carbon catabolite repressible enzymes maltase, invertase, alcohol dehydrogenase, NAD-dependent glutamate dehydrogenase (NAD-GDH) and L-lactate:ferricytochrome-c oxidoreductase (L-LCR) was also analysed. The IMP2 gene product is required for the rapid glucose derepression of all above-mentioned carbon source utilization pathways and of all the enzymes except for L-LCR. NAD-GDH is regulated by IMP2 in the opposite way and, in fact, this enzyme was released at higher levels in both imp2 mutants than in the wild-type strain. Therefore, the product of IMP2 appears to be involved in positive and negative regulation. Both deletions result in growth and catalytic defects; in some cases partial modification of the gene product yielded more dramatic effects than its complete absence. Moreover, evidence is provided that the IMP2 gene product regulates galactose- and maltose-inducible genes at the transcriptional level and is a positive regulator of maltase, maltose permease and galactose permease gene expression.

  15. Post-transcriptional regulation of cyclins D1, D3 and G1 and proliferation of human cancer cells depend on IMP-3 nuclear localization.

    PubMed

    Rivera Vargas, T; Boudoukha, S; Simon, A; Souidi, M; Cuvellier, S; Pinna, G; Polesskaya, A

    2014-05-29

    RNA-binding proteins of the IMP family (insulin-like growth factor 2 (IGF2) mRNA-binding proteins 1-3) are important post-transcriptional regulators of gene expression. Multiple studies have linked high expression of IMP proteins, and especially of IMP-3, to an unfavorable prognosis in numerous types of cancer. The specific importance of IMP-3 for cancer transformation remains poorly understood. We here show that all three IMPs can directly bind the mRNAs of cyclins D1, D3 and G1 (CCND1, D3 and G1) in vivo and in vitro, and yet only IMP-3 regulates the expression of these cyclins in a significant manner in six human cancer cell lines of different origins. In the absence of IMP-3, the levels of CCND1, D3 and G1 proteins fall dramatically, and the cells accumulate in the G1 phase of the cell cycle, leading to almost complete proliferation arrest. Our results show that, compared with IMP-1 and IMP-2, IMP-3 is enriched in the nucleus, where it binds the transcripts of CCND1, D3 and G1. The nuclear localization of IMP-3 depends on its protein partner HNRNPM and is indispensable for the post-transcriptional regulation of expression of the cyclins. Cytoplasmic retention of IMP-3 and HNRNPM in human cancer cells leads to significant drop in proliferation. In conclusion, a nuclear IMP-3-HNRNPM complex is important for the efficient synthesis of CCND1, D3 and G1 and for the proliferation of human cancer cells.

  16. IMP-8. Volume 2: Scientific section. [Bibliography

    NASA Technical Reports Server (NTRS)

    1980-01-01

    Results of the analysis of the IMP-8 data, which was collected during the first six and one-half years after launch of the IMP-8 spacecraft are presented. The plasma wave experiment data were processed and are available in an easily accessible summary form. These data continue to provide a valuable source for comparative studies with plasma wave experiments on other spacecraft operating in the solar wind and within the Earth's magnetosphere.

  17. Imp2, the PSTPIP homolog in fission yeast, affects sensitivity to the immunosuppressant FK506 and membrane trafficking in fission yeast

    SciTech Connect

    Kita, Ayako; Higa, Mari; Doi, Akira; Satoh, Ryosuke; Sugiura, Reiko

    2015-02-13

    Cytokinesis is a highly ordered process that divides one cell into two cells, which is functionally linked to the dynamic remodeling of the plasma membrane coordinately with various events such as membrane trafficking. Calcineurin is a highly conserved serine/threonine protein phosphatase, which regulates multiple biological functions, such as membrane trafficking and cytokinesis. Here, we isolated imp2-c3, a mutant allele of the imp2{sup +} gene, encoding a homolog of the mouse PSTPIP1 (proline-serine-threonine phosphatase interacting protein 1), using a genetic screen for mutations that are synthetically lethal with calcineurin deletion in fission yeast. The imp2-c3 mutants showed a defect in cytokinesis with multi-septated phenotypes, which was further enhanced upon treatment with the calcineurin inhibitor FK506. Notably, electron micrographs revealed that the imp2-c3 mutant cells accumulated aberrant multi-lamella Golgi structures and putative post-Golgi secretory vesicles, and exhibited fragmented vacuoles in addition to thickened septa. Consistently, imp2-c3 mutants showed a reduced secretion of acid phosphatase and defects in vacuole fusion. The imp2-c3 mutant cells exhibited a weakened cell wall, similar to the membrane trafficking mutants identified in the same genetic screen such as ypt3-i5. These findings implicate the PSTPIP1 homolog Imp2 in Golgi/vacuole function, thereby affecting various cellular processes, including cytokinesis and cell integrity. - Highlights: • We isolated imp2-c3, in a synthetic lethal screen with calcineurin in fission yeast. • The imp2{sup +} gene encodes a component of the actin contractile ring similar to Cdc15. • The imp2-c3 mutants showed defects in cytokinesis, which were exacerbated by FK506. • The imp2-c3 mutants were defective in membrane trafficking and cell wall integrity. • Our study revealed a novel role for Imp2 in the Golgi/vacuolar membrane trafficking.

  18. The IMP-H ion composition experiment

    NASA Technical Reports Server (NTRS)

    Acuna, M. H.; Ogilvie, K. W.

    1971-01-01

    A compact mass energy spectrometer to be flown aboard the IMP-H spacecraft is described. Scientific aims include determination of the relative and absolute fluxes of He-4(2+), He-4 (+), 0(6+), and 0(7+), and He-3(2+).

  19. Chromosome 12p abnormalities and IMP3 expression in prepubertal pure testicular teratomas.

    PubMed

    Cornejo, Kristine M; Cheng, Liang; Church, Alanna; Wang, Mingsheng; Jiang, Zhong

    2016-03-01

    Although the histologic appearance of pure testicular teratomas (PTTs) is similar in children and adults, the prognosis is dramatically different. Prepubertal PTTs are rare, with a benign clinical course, whereas the adult cases typically have malignant outcomes. Chromosome 12p abnormalities are seen in most adult testicular germ cell tumors but have not been found in prepubertal PTTs. IMP3 is an oncofetal protein that is highly expressed in many malignancies. Recently, we demonstrated IMP3 is expressed in adult mature testicular teratomas but not in mature ovarian teratomas. The aim of this study was to evaluate prepubertal PTTs for chromosome 12p abnormalities and expression of IMP3. A total of 11 cases (excision, n=1; orchiectomy, n=10) were obtained from the surgical pathology archives of 2 large medical centers (1957-2013). All 11 cases were investigated for isochromosome 12p and 12p copy number gain using interphase fluorescence in situ hybridization analysis and were examined by immunohistochemistry for IMP3 expression. Patients ranged in age from 0.9 to 7.0 (mean, 2.4) years. A positive immunohistochemical stain for IMP3 (cytoplasmic staining) was identified in 5 (46%) of 11 cases. Isochromosome 12p was detected in 2 cases (18%) that also expressed IMP3. Somatic copy number alterations of 12p were not observed (0%). We are the first to describe 12p abnormalities and IMP3 expression in prepubertal PTTs. Our data demonstrate a small subset of PTTs harbor typical molecular alterations observed in adult testicular germ cell tumors. Although prepubertal PTTs are considered to be benign neoplasms, it may be a heterogeneous group.

  20. Global Molecular Epidemiology of IMP-Producing Enterobacteriaceae.

    PubMed

    Matsumura, Yasufumi; Peirano, Gisele; Motyl, Mary R; Adams, Mark D; Chen, Liang; Kreiswirth, Barry; DeVinney, Rebekah; Pitout, Johann D D

    2017-04-01

    International data on the molecular epidemiology of Enterobacteriaceae with IMP carbapenemases are lacking. We performed short-read (Illumina) whole-genome sequencing on a global collection of 38 IMP-producing clinical Enterobacteriaceae (2008 to 2014). IMP-producing Enterobacteriaceae (7 varieties within 11 class 1 integrons) were mainly present in the South Pacific and Asia. Specific blaIMP-containing integrons (In809 with blaIMP-4, In722 with blaIMP-6, and In687 with blaIMP-14) were circulating among different bacteria in countries such as Australia, Japan, and Thailand. In1312 with blaIMP-1 was present in Klebsiella pneumoniae from Japan and Citrobacter freundii from Brazil. Klebsiella pneumoniae (n = 22) was the most common species; clonal complex 14 (CC14) from Philippines and Japan was the most common clone and contained In1310 with blaIMP-26 and In1321 with blaIMP-6 The Enterobacter cloacae complex (n = 9) consisted of Enterobacter hormaechei and E. cloacae cluster III. CC78 (from Taiwan) containing In73 with blaIMP-8 was the most common clone among the E. cloacae complex. This study highlights the importance of surveillance programs using the latest molecular techniques for providing insight into the characteristics and global distribution of Enterobacteriaceae with blaIMP genes.

  1. Interspecies Transfer of blaIMP-4 in a Patient with Prolonged Colonization by IMP-4-Producing Enterobacteriaceae

    PubMed Central

    Heney, Claire; George, Narelle M.; Nimmo, Graeme R.; Paterson, David L.

    2014-01-01

    A patient was colonized by IMP-4-producing Enterobacter cloacae and Escherichia coli strains for 7 months. IMP-4-producing E. cloacae strains were first and last isolated at day 33 and at 8 months after admission, respectively. IMP-4-producing E. coli strains were first and last isolated at days 88 and 181 after admission, respectively. The E. cloacae and E. coli isolates shared identical genetic features in terms of blaIMP-4, blaTEM-1, qnrB2, aacA4, HI2 plasmids, and ISCR1. This study shows the first prolonged colonization with in vivo interspecies transfer of blaIMP-4. PMID:25056334

  2. Benchmark of different CFL conditions for IMPES

    NASA Astrophysics Data System (ADS)

    Franc, Jacques; Horgue, Pierre; Guibert, Romain; Debenest, Gerald

    2016-10-01

    The IMplicit Pressure Explicit Saturation (IMPES) method is a prevalent way to simulate multiphase flows in porous media. The numerical stability of this sequential method implies limitations on the time step, which may depend on the flow regime studied. In this note, three stability criteria related to the IMPES method, that differ in their construction on the observed variables, are compared on homogeneous and heterogeneous configurations for different two-phase flow regimes (viscous/capillary/gravitational). This highlights that there is no single optimal criterion always ensuring stability and efficiency. For capillary dominated flows, the Todd's condition is the most efficient one, while the standard Coat condition should be preferred for viscous flows. When gravity effects are present, Coat's condition must be restricted, but remains more efficient than the Todd's condition. xml:lang="fr"

  3. Imp3p and Imp4p mediate formation of essential U3–precursor rRNA (pre-rRNA) duplexes, possibly to recruit the small subunit processome to the pre-rRNA

    PubMed Central

    Gérczei, Tímea; Correll, Carl C.

    2004-01-01

    In eukaryotes, formation of short duplexes between the U3 small nucleolar RNA (snoRNA) and the precursor rRNA (pre-rRNA) at multiple sites is a prerequisite for three endonucleolytic cleavages that initiate small subunit biogenesis by releasing the 18S rRNA precursor from the pre-rRNA. The most likely role of these RNA duplexes is to guide the U3 snoRNA and its associated proteins, designated the small subunit processome, to the target cleavage sites on the pre-rRNA. Studies by others in Saccharomyces cerevisiae have identified the proteins Mpp10p, Imp3p, and Imp4p as candidates to mediate U3–pre-rRNA interactions. We report here that Imp3p and Imp4p appear to stabilize an otherwise unstable duplex between the U3 snoRNA hinge region and complementary bases in the external transcribed spacer of the pre-rRNA. In addition, Imp4p, but not Imp3p, seems to rearrange the U3 box A stem structure to expose the site that base-pairs with the 5′ end of the 18S rRNA, thereby mediating duplex formation at a second site. By mediating formation of both essential U3–pre-rRNA duplexes, Imp3p and Imp4p may help the small subunit processome to dock onto the pre-rRNA, an event indispensable for ribosome biogenesis and hence for cell growth. PMID:15489263

  4. IMP2 expression distinguishes endometrioid from serous endometrial adenocarcinomas.

    PubMed

    Zhang, Liping; Liu, Yuxin; Hao, Suyang; Woda, Bruce A; Lu, Di

    2011-06-01

    Among various endometrial adenocarcinomas, endometrioid carcinoma can be very difficult to separate from serous carcinomas. Various biomarkers have been studied with proven value, including p53, Ki-67, and p16. In this study, we present data on another biomarker, IMP2, which we believe is sensitive and specific. Using 320 endometrial biopsy cases, we demonstrate that IMP2 is normally expressed in all proliferative and inactive endometrial glandular cells. The pattern of such expression is unchanged in serous carcinomas. IMP2 expression is, however, lost in all cases of endometrioid carcinomas by at least 25% to >95% of tumor cell populations. Therefore, loss of IMP2 expression can differentiate endometrioid from serous carcinomas. Such finding of IMP2 expression remained the same in mixed endometrioid and serous carcinomas; IMP2 expression is lost in all endometrioid components by at least 25% of tumor cell population, whereas it remained diffuse and strong in all serous components of carcinomas.

  5. Surface science capabilities from IMP spectral imaging

    NASA Technical Reports Server (NTRS)

    Singer, Robert B.

    1994-01-01

    The Imager for Mars Pathfinder (IMP) had a single 12-position filter wheel for one of its two 'eyes'. Originally eight, and then nine, of these filters were optimized for surface science, and three narrow-band filters for atmospheric science. Because of some design revisions we will now have filter wheels on both sides. The wheels for right and left eyes are identical, 12 filter positions each, and rigidly linked to the same rotation shaft. There are now 13 surface filters, in addition to 5 for atmospheric observations. Details of all the filter positions are tabulated and approximate gaussian bandpasses for the 13 surface filters are shown.

  6. Adaption of a corrector module to the IMP dynamics program

    NASA Technical Reports Server (NTRS)

    1972-01-01

    The corrector module of the RAEIOS program and the IMP dynamics computer program were combined to achieve a date-fitting capability with the more general spacecraft dynamics models of the IMP program. The IMP dynamics program presents models of spacecraft dynamics for satellites with long, flexible booms. The properties of the corrector are discussed and a description is presented of the performance criteria and search logic for parameter estimation. A description is also given of the modifications made to add the corrector to the IMP program. This includes subroutine descriptions, common definitions, definition of input, and a description of output.

  7. Method To Identify Specific Inhibiutors Of Imp Dehydrogenase

    DOEpatents

    Collart, Frank R.; Huberman, Eliezer

    2000-11-28

    This invention relates to methods to identify specific inhibitors of the purine nucleotide synthesis enzyme, IMP dehydrogenase (IMPDH). IMPDH is an essential enzyme found in all free-living organisms from humans to bacteria and is an important therapeutic target. The invention allows the identification of specific inhibitors of any IMPDH enzyme which can be expressed in a functional form in a recombinant host cell. A variety of eukaryotic or prokaryotic host systems commonly used for the expression of recombinant proteins are suitable for the practice of the invention. The methods are amenable to high throughput systems for the screening of inhibitors generated by combinatorial chemistry or other methods such as antisense molecule production. Utilization of exogenous guanosine as a control component of the methods allows for the identification of inhibitors specific for IMPDH rather than other causes of decreased cell proliferation.

  8. Protective immunity against Eimeria tenella infection in chickens induced by immunization with a recombinant C-terminal derivative of EtIMP1.

    PubMed

    Yin, Guangwen; Lin, Qian; Wei, Wenjun; Qin, Mei; Liu, Xianyong; Suo, Xun; Huang, Zhijian

    2014-12-15

    Immune mapped protein-1 (IMP1) is a new protective protein in apicomplexan parasites, and exits in Eimeria tenella. Cloning and sequence analysis has predicted the antigen to be a novel membrane protein of apicomplexan parasites. In order to assess the immunogenicity of EtIMP1, a C-terminal derivative of EtIMP1 was expressed in a bacterial host system and was used to immunize chickens. The protective efficacy against a homologous challenge was evaluated by body weight gains, lesion scores and fecal oocyst shedding. The results showed that the subunit vaccine can improve weight gains, reduced cecal pathology and lower oocyst fecal shedding compared with non immunized controls. The results suggested that the C-terminal derivative of EtIMP1 might be considered as a candidate in the development of subunit vaccines against Eimeria infection.

  9. Accumulation of I-123 IMP in hepatic cell adenoma

    SciTech Connect

    Suto, Yuji; Kodama, Fumiko; Kato, Takashi

    1995-07-01

    I-123 IMP is now widely used as a radioactive material for cerebral blood flow scintigraphy. It is also known that this substance will accumulate in certain types of tumors. The authors present a case of a 47-year-old woman who showed accumulation of I-123 IMP in hepatic cell adenoma. 6 refs., 3 figs.

  10. Biomedical research with heavy ions at the IMP accelerators

    NASA Astrophysics Data System (ADS)

    Li, Qiang

    The main ion-beam acceleration facilities and research activities at the Institute of Modern Physics (IMP), Chinese Academy of Sciences are briefly introduced. Some of the biomedical research with heavy ions such as heavy-ion biological effect, basic research related to heavy-ion cancer therapy and radiation breeding at the IMP accelerators are presented.

  11. IMP dehydrogenase from Pneumocystis carinii as a potential drug target.

    PubMed Central

    O'Gara, M J; Lee, C H; Weinberg, G A; Nott, J M; Queener, S F

    1997-01-01

    Mycophenolic acid, a specific inhibitor of IMP dehydrogenase (IMPDH; EC 1.1.1.205), is a potent inhibitor of Pneumocystis carinii growth in culture, suggesting that IMPDH may be a sensitive target for chemotherapy in this organism. The IMPDH gene was cloned as a first step to characterizing the enzyme and developing selective inhibitors. A 1.3-kb fragment containing a portion of the P. carinii IMPDH gene was amplified by PCR with two degenerate oligonucleotides based on conserved sequences in IMPDH from humans and four different microorganisms. Northern hybridization analysis showed the P. carinii IMPDH mRNA to be approximately 1.6 kb. The entire cDNA encoding P. carinii IMPDH was isolated and cloned. The deduced amino acid sequence of P. carinii IMPDH shared homology with bacterial (31 to 38%), protozoal (48 to 59%), mammalian (60 to 62%), and fungal (62%) IMPDH enzymes. The IMPDH cDNA was expressed by using a T7 expression system in an IMPDH-deficient strain of Escherichia coli (strain S phi 1101). E. coli S phi 1101 cells containing the P. carinii IMPDH gene were able to grow on medium lacking guanine, implying that the protein expressed in vivo was functional. Extracts of these E. coli cells contained IMPDH activity that had an apparent Km for IMP of 21.7 +/- 0.3 microM and an apparent Km for NAD of 314 +/- 84 microM (mean +/- standard error of the mean; n = 3), and the activity was inhibited by mycophenolic acid (50% inhibitory concentration, 24 microM; n = 2). PMID:8980752

  12. Dissemination of IMP-4-encoding pIMP-HZ1-related plasmids among Klebsiella pneumoniae and Pseudomonas aeruginosa in a Chinese teaching hospital

    PubMed Central

    Feng, Wei; Zhou, Dongsheng; Wang, Qian; Luo, Wenbo; Zhang, Defu; Sun, Qiang; Tong, Yigang; Chen, Weijun; Sun, Fengjun; Xia, Peiyuan

    2016-01-01

    A total of 26 blaIMP-4-carrying strains of Pseudomonas aeruginosa and Klebsiella pneumoniae were isolated from 2009 to 2013 in a Chinese teaching hospital, and these strains can be assigned into multiple sequence types or allelic profiles as determined by multilocus sequence typing. Of these strains, P. aeruginosa P378 and K. pneumoniae 1220 harbor the IMP-4-encoding plasmids pP378-IMP and p1220-IMP, respectively, whose complete nucleotide sequences are determined to be genetically closely related to the IncN1-type plasmid pIMP-HZ1. pP378-IMP/p1220-IMP-like plasmids are hinted to be present in all the other blaIMP-4-carrying strains, indicating the dissemination of pIMP-HZ1-related plasmids among K. pneumoniae or P. aeruginosa of different genotypes in this hospital. pP378-IMP carries two distinct accessory resistance regions, a blaIMP-4-carrying class 1 integron In823b, and a truncated Tn3-family unit transposon ΔTn6292-3′ harboring the quinolone resistance gene qnrS1. Massive fragmentation and rearrangement of these accessory genetic contents occur among p1220-IMP and IMP-HZ1 relative to pP378-IMP. blaIMP-4 is also present in the In823b remnants from p1220-IMP and IMP-HZ1, while qnrS1 is located in a Tn6292-derive fragment from pIMP-HZ1 but not found in p1220-IMP. pP378-IMP represents the first fully sequenced IncN-type plasmid from P. aeruginosa. PMID:27641711

  13. Solar flare accelerated isotopes of hydrogen and helium. [observed by IMP-4 and IMP-5

    NASA Technical Reports Server (NTRS)

    Anglin, J. D.; Dietrich, W. F.; Simpson, J. A.

    1973-01-01

    Measurements of solar flare hydrogen, deuterium, tritium, helium-3, and helium-4 in the energy range approximately 10 to 50 MeV per nucleon obtained with instrumentation on the IMP-4 and IMP-5 satellites are reported and studies based on these results which place several constraints on theories of solar flare particle acceleration are discussed. A brief review of previous work and the difficulties in studying the rare isotopes of hydrogen and helium is also included. Particular emphasis is placed on the fact that the information to be obtained from the solar flare products of high energy interactions is not available through either solar wind observations where both the acceleration mechanism and the coronal source of the nuclear species are different, or optical measurements of solar active regions.

  14. IMP 8. Volume 1: EM field experiment

    NASA Technical Reports Server (NTRS)

    1980-01-01

    The electromagnetic fields experiment on IMP-J used two electric dipole antennas and a triaxial search coil magnetic antenna to sense the electric and magnetic field of plasma waves in space. The electric dipole antennas consisted of a fine wire, 0.021 inches in diameter, with a nominal extended tip-to-tip length of 400 ft. The outermost 50 ft. of each element was conducting and the rest of the antenna was covered with an insulating coating. The search coil antennas each consisted of a high mu core with two separate windings of 40,000 turns each to sense ac magnetic fields. The search coils had a length of 18 inches tip-to-tip and are mounted on the end of a boom. The axes of the x prime and y prime search coil antennas were parallel to the x prime and y prime electric antenna axes.

  15. Structure of Cryptosporidium IMP dehydrogenase bound to an inhibitor with in vivo antiparasitic activity

    DOE PAGES

    Kim, Youngchang; Makowska-Grzyska, Magdalena; Gorla, Suresh Kumar; ...

    2015-04-21

    Inosine 5´-monophosphate dehydrogenase (IMPDH) is a promising target for the treatment of Cryptosporidium infections. Here, the structure of C. parvum IMPDH (CpIMPDH) in complex with inosine 5´-monophosphate (IMP) and P131, an inhibitor with in vivo anticryptosporidial activity, is reported. P131 contains two aromatic groups, one of which interacts with the hypoxanthine ring of IMP, while the second interacts with the aromatic ring of a tyrosine in the adjacent subunit. In addition, the amine and NO2 moieties bind in hydrated cavities, forming water-mediated hydrogen bonds to the protein. The design of compounds to replace these water molecules is a new strategymore » for the further optimization of C. parvum inhibitors for both antiparasitic and antibacterial applications.« less

  16. Wind and IMP 8 Solar Wind, Magnetosheath and Shock Data

    NASA Technical Reports Server (NTRS)

    2004-01-01

    The purpose of this project was to provide the community access to magnetosheath data near Earth. We provided 27 years of IMP 8 magnetosheath proton velocities, densities, and temperatures with our best (usually 1-min.) time resolution. IMP 8 crosses the magnetosheath twice each 125 day orbit, and we provided magnetosheath data for the roughly 27 years of data for which magnetometer data are also available (which are needed to reliably pick boundaries). We provided this 27 years of IMP 8 magnetosheath data to the NSSDC; this data is now integrated with the IMP 8 solar wind data with flags indicating whether each data point is in the solar wind, magnetosheath, or at the boundary between the two regions. The plasma speed, density, and temperature are provided for each magnetosheath point. These data are also available on the MIT web site ftp://space .mit.edu/pub/plasma/imp/www/imp.html. We provide ASCII time-ordered rows of data giving the observation time, the spacecraft position in GSE, the velocity is GSE, the density and temperature for protons. We also have analyzed and archived on our web site the Wind magnetosheath plasma parameters. These consist of ascii files of the proton and alpha densities, speeds, and thermal speeds. These data are available at ftp://space.mit.edu/pub/plasma/wind/sheath These are the two products promised in the work statement and they have been completed in full.

  17. The last enzyme of the de novo purine synthesis pathway 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC) plays a central role in insulin signaling and the Golgi/endosomes protein network.

    PubMed

    Boutchueng-Djidjou, Martial; Collard-Simard, Gabriel; Fortier, Suzanne; Hébert, Sébastien S; Kelly, Isabelle; Landry, Christian R; Faure, Robert L

    2015-04-01

    Insulin is internalized with its cognate receptor into the endosomal apparatus rapidly after binding to hepatocytes. We performed a bioinformatic screen of Golgi/endosome hepatic protein fractions and found that ATIC, which is a rate-limiting enzyme in the de novo purine biosynthesis pathway, and PTPLAD1 are associated with insulin receptor (IR) internalization. The IR interactome (IRGEN) connects ATIC to AMPK within the Golgi/endosome protein network (GEN). Forty-five percent of the IR Golgi/endosome protein network have common heritable variants associated with type 2 diabetes, including ATIC and AMPK. We show that PTPLAD1 and AMPK are rapidly compartmentalized within the plasma membrane (PM) and Golgi/endosome fractions after insulin stimulation and that ATIC later accumulates in the Golgi/endosome fraction. Using an in vitro reconstitution system and siRNA-mediated partial knockdown of ATIC and PTPLAD1 in HEK293 cells, we show that both ATIC and PTPLAD1 affect IR tyrosine phosphorylation and endocytosis. We further show that insulin stimulation and ATIC knockdown readily increase the level of AMPK-Thr172 phosphorylation in IR complexes. We observed that IR internalization was markedly decreased after AMPKα2 knockdown, and treatment with the ATIC substrate AICAR, which is an allosteric activator of AMPK, increased IR endocytosis in cultured cells and in the liver. These results suggest the presence of a signaling mechanism that senses adenylate synthesis, ATP levels, and IR activation states and that acts in regulating IR autophosphorylation and endocytosis.

  18. Metabotropic glutamate receptors are involved in the detection of IMP and L-amino acids by mouse taste sensory cells.

    PubMed

    Pal Choudhuri, S; Delay, R J; Delay, E R

    2016-03-01

    G-protein-coupled receptors are thought to be involved in the detection of umami and L-amino acid taste. These include the heterodimer taste receptor type 1 member 1 (T1r1)+taste receptor type 1 member 3 (T1r3), taste and brain variants of mGluR4 and mGluR1, and calcium sensors. While several studies suggest T1r1+T1r3 is a broadly tuned lLamino acid receptor, little is known about the function of metabotropic glutamate receptors (mGluRs) in L-amino acid taste transduction. Calcium imaging of isolated taste sensory cells (TSCs) of T1r3-GFP and T1r3 knock-out (T1r3 KO) mice was performed using the ratiometric dye Fura 2 AM to investigate the role of different mGluRs in detecting various L-amino acids and inosine 5' monophosphate (IMP). Using agonists selective for various mGluRs such as (RS)-3,5-dihydroxyphenylglycine (DHPG) (an mGluR1 agonist) and L-(+)-2-amino-4-phosphonobutyric acid (l-AP4) (an mGluR4 agonist), we evaluated TSCs to determine if they might respond to these agonists, IMP, and three L-amino acids (monopotassium L-glutamate, L-serine and L-arginine). Additionally, we used selective antagonists against different mGluRs such as (RS)-L-aminoindan-1,5-dicarboxylic acid (AIDA) (an mGluR1 antagonist), and (RS)-α-methylserine-O-phosphate (MSOP) (an mGluR4 antagonist) to determine if they can block responses elicited by these L-amino acids and IMP. We found that L-amino acid- and IMP-responsive cells also responded to each agonist. Antagonists for mGluR4 and mGluR1 significantly blocked the responses elicited by IMP and each of the L-amino acids. Collectively, these data provide evidence for the involvement of taste and brain variants of mGluR1 and mGluR4 in L-amino acid and IMP taste responses in mice, and support the concept that multiple receptors contribute to IMP and L-amino acid taste.

  19. Hemimegalencephaly: Clinical, EEG, neuroimaging, and IMP-SPECT correlation

    SciTech Connect

    Konkol, R.J.; Maister, B.H.; Wells, R.G.; Sty, J.R. )

    1990-11-01

    Iofetamine-single photon emission computed tomography (IMP-SPECT) was performed on 2 girls (5 1/2 and 6 years of age) with histories of intractable seizures, developmental delay, and unilateral hemiparesis secondary to hemimegalencephaly. Electroencephalography (EEG) revealed frequent focal discharges in 1 patient, while a nearly continuous burst suppression pattern over the malformed hemisphere was recorded in the other. IMP-SPECT demonstrated a good correlation with neuroimaging studies. In spite of the different EEG patterns, which had been proposed to predict contrasting clinical outcomes, both IMP-SPECT scans disclosed a similar decrease in tracer uptake in the malformed hemisphere. These results are consistent with the pattern of decreased tracer uptake found in other interictal studies of focal seizures without cerebral malformations. In view of recent recommendations for hemispherectomy in these patients, we suggest that the IMP-SPECT scan be used to compliment EEG as a method to define the extent of abnormality which may be more relevant to long-term prognosis than EEG alone.

  20. Transcriptional Switch of the dia1 and impA Promoter during the Growth/Differentiation Transition

    PubMed Central

    Hirose, Shigenori; Mayanagi, Taira; Pears, Catherine; Amagai, Aiko; Loomis, William F.; Maeda, Yasuo

    2005-01-01

    When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition. PMID:16087752

  1. IMP-GMP 5'-nucleotidase in reptiles: occurrence in a turtle, a tortoise and three species of snakes.

    PubMed

    Itoh, Roichi; Kimura, Kayoko

    2003-08-01

    IMP-hydrolyzing activity, which is reactive with goose anti-pig lung IMP-GMP 5'-nucleotidase (c-N-II: EC.3.1.3.5) serum, was detected in extracts from liver, heart, kidney, spleen, stomach, skeletal muscle and lung from several species of reptiles: The values found in liver (U/mg protein) of one animal were: 4.5 for an ammono-ureotelic turtle (Trionyx sinensis japonicus); 3.7 for an ureo-uricotelic tortoise (Testudo elegans); 13-23 for three species of uricotelic snakes: Elaphe quadrivirgata, Elaphe conspicillata and Elaphe climacophora. These findings suggest that in the liver of snakes, c-N-II may participate in the production of uric acid as an end product of amino acid metabolism.

  2. [Compartment analysis of 123I-IMP brain SPECT].

    PubMed

    Higano, S; Shishido, F; Aizawa, Y; Miura, S; Murakami, M; Inugami, A; Kanno, I; Fujita, H; Uemura, K

    1990-01-01

    To clarify the kinetics of N-isopropyl [123I]p-iodoamphetamine (IMP) in the brain, 2-compartment analysis was applied for brain SPECT with 57-minute dynamic scan in 9 subjects. The model consisted of blood component and brain tissue component. Two transfer rate constants were defined; k1 showed the rate from the blood to the brain tissue, and k2 was that of back diffusion. The late scan was performed 210 minutes after the tracer injection. Suitable k values best fitting to the dynamic data were determined for all regions of interest. Predicted regional cerebral activity at 210 minutes using 57-minute dynamic data was well agreed with measured activity. These showed the kinetics of IMP in the brain was well described by the 2-compartment model. The partition coefficient (k1/k2 ratio) was as large as about 35, and almost constant in the various brain structures including hypoperfused areas. These findings indicated that the initial IMP images reflected the reasonable CBF distribution, which gave relatively reliable CBF values even if using microsphere model.

  3. Report on final recommendations for IMPS engineering-science payload

    NASA Technical Reports Server (NTRS)

    Garrett, H. B.

    1984-01-01

    Six general categories of key scientific and engineering concerns for the interactions measurements payload for shuttle (IMPS) mission are addressed: (1) dielectric charging; (2) material property changes; (3) electromagnetic interference, plasma interactions, and plasma wake effects associated with high-voltage solar arrays and large space structures; (4) radio frequency distortion and nonlinearities due to the enhanced plasma in the shuttle ram/wake; (5) shuttle glow and contamination; and (6) plasma interactions with the space-based radar. Lesser concerns are the interactions associated with EVA; the radiation and SEU effects peculiar to the auroral/polar cap environments; and space debris. The measurements needed to address the concerns associated with the general categories are described and a list of generic investigations capable of making the required measurements, emphasizing the spectrum of measurements necessary to quantize the interactions in the auroral/polar environments are included. A suggested ground-test plan for the IMPS project, a description of proposed follow-on IMPS missions, and a detailed bibliography for each of the interactions discussed are included.

  4. Irregular Mare Patches (IMPs): 100 Ma or 3 Ga?

    NASA Technical Reports Server (NTRS)

    Stopar, Julie; Robinson, Mark Southwick; van der Bogert, Carolyn H.; Giguere, Thomas; Lawrence, Samuel J.; Ostrach, Lillian Rose; Clegg-Watkins, Ryan N.

    2016-01-01

    IMPs exhibit a perplexing combination of characteristics that are consistent with either an approximately 100 Ma or 3 Ga formation. Dozens of small-area IMPs have crisp morphologies and crater size-frequency distributions (SFDs) that denote relatively recent geologic activity (less than 100 Ma); however, the apparently well-developed regolith on portions of the IMPs are in conflict with such a young age [1]. To test possible formation hypotheses (e.g., [1-5]), which range from ancient volcanism to contemporary outgassing, we examined IMP morphology at the meter-scale with LROC NAC images and derived elevation models. We focused on the largest IMPs (Ina, Sosigenes, Cauchy, Maskelyne, and Nubium), where contacts between deposits are best developed. Most of our observations are consistent with multiple generations of inflation and breakouts (or squeeze-ups) of basaltic lavas that were affected by local slopes. Some of the extrusions coalesced into larger mounds or filled pre-existing craters. We did not observe evidence of large-scale void space (e.g., fissures, fractures, linear depressions, or pits) within or beneath the mounds or rougher deposits (e.g., [5]). But, small-scale voids may be signified by isolated pitted textures. We also did not detect evidence of the cooling fractures or lava plates expected in young lava flows and observed in lunar impact melt deposits. The smooth texture of the mounds is enigmatic. Block-less craters suggest at least 5 m of friable or poorly-cohesive material (such as regolith), yet mound margins exhibit slopes greater than 30 deg requiring significant material strength. Blocks are not common on the mounds, but are sometimes excavated by impacts (usually excavated from beneath the mounds). The uneven deposits are equally enigmatic and texturally varied (blocky, pitted, and crenulated). They are deficient in superposed craters compared to the mounds. If the mounds are indeed of similar age to the rougher units, then their different

  5. Regulation of Transfer Functions by the imp Locus of the Streptomyces coelicolor Plasmidogenic Element SLP1

    PubMed Central

    Hagege, Juliette M.; Brasch, Michael A.; Cohen, Stanley N.

    1999-01-01

    SLP1int is a 17.2-kb genetic element that normally is integrated site specifically into the chromosome of Streptomyces coelicolor A3(2). The imp operon within SLP1int represses replication of both chromosomally integrated and extrachromosomal SLP1. During mating with S. lividans, SLP1int can excise, delete part of imp, and form a family of autonomously replicating conjugative plasmids. Earlier work has shown that impA and impC gene products act in concert to control plasmid maintenance and regulate their own transcription. Here we report that these imp genes act also on a second promoter, Popimp (promoter opposite imp), located adjacent to, and initiating transcription divergent from, imp to regulate loci involved in the intramycelial transfer of SLP1 plasmids. spdB1 and spdB2, two overlapping genes immediately 3′ to Popimp and directly regulated by imp, are shown by Tn5 mutagenesis to control transfer-associated growth inhibition (i.e., pocking). Additional genes resembling transfer genes of other Streptomyces spp. plasmids and required for SLP1 transfer and/or postconjugal intramycelial spread are located more distally to Popimp. Expression of impA and impC in an otherwise competent recipient strain prevented SLP1-mediated gene transfer of chromosomal and plasmid genes but not plasmid-independent chromosome-mobilizing activity, suggesting that information transduced to recipients after the formation of mating pairs affects imp activity. Taken together with earlier evidence that the imp operon regulates SLP1 DNA replication, the results reported here implicate imp in the overall regulation of functions related to the extrachromosomal state of SLP1. PMID:10498709

  6. Detection of a variant metallo-beta-lactamase, IMP-10, from two unrelated strains of Pseudomonas aeruginosa and an alcaligenes xylosoxidans strain.

    PubMed

    Iyobe, Shizuko; Kusadokoro, Haruko; Takahashi, Ayako; Yomoda, Sachie; Okubo, Toyoji; Nakamura, Akio; O'Hara, Koji

    2002-06-01

    The gene bla(IMP-10) of a variant metallo-beta-lactamase, IMP-10, had a single base replacement of G by T at nucleotide 145, which led to an amino acid alteration of Val49 to Phe compared to the IMP-1 enzyme, indicating that IMP-10 was a point mutation derivative of IMP-1. Highly purified enzymes revealed that IMP-10 was different from IMP-1 in its extremely low hydrolyzing activities for penicillins, such as benzylpenicillin, ampicillin, and piperacillin.

  7. IMP: a pipeline for reproducible reference-independent integrated metagenomic and metatranscriptomic analyses.

    PubMed

    Narayanasamy, Shaman; Jarosz, Yohan; Muller, Emilie E L; Heintz-Buschart, Anna; Herold, Malte; Kaysen, Anne; Laczny, Cédric C; Pinel, Nicolás; May, Patrick; Wilmes, Paul

    2016-12-16

    Existing workflows for the analysis of multi-omic microbiome datasets are lab-specific and often result in sub-optimal data usage. Here we present IMP, a reproducible and modular pipeline for the integrated and reference-independent analysis of coupled metagenomic and metatranscriptomic data. IMP incorporates robust read preprocessing, iterative co-assembly, analyses of microbial community structure and function, automated binning, as well as genomic signature-based visualizations. The IMP-based data integration strategy enhances data usage, output volume, and output quality as demonstrated using relevant use-cases. Finally, IMP is encapsulated within a user-friendly implementation using Python and Docker. IMP is available at http://r3lab.uni.lu/web/imp/ (MIT license).

  8. Thermal design of the IMP-I and H spacecraft

    NASA Technical Reports Server (NTRS)

    Hoffman, R. H.

    1974-01-01

    A description of the thermal subsystem of the IMP-I and H spacecraft is presented. These two spacecraft were of a larger and more advanced type in the Explorer series and were successfully launched in March 1971 and September 1972. The thermal requirements, analysis, and design of each spacecraft are described including several specific designs for individual experiments. Techniques for obtaining varying degrees of thermal isolation and contact are presented. The thermal control coatings including the spaceflight performance of silver-coated FEP Teflon are discussed. Predicted performance is compared to measured flight data. The good agreement between them verifies the validity of the thermal model and the selection of coatings.

  9. Structural and Mutagenic Analysis of Metallo-β-Lactamase IMP-18

    PubMed Central

    Furuyama, Takamitsu; Nonomura, Haruka; Ishii, Yoshikazu; Hanson, Nancy D.

    2016-01-01

    IMP-type metallo-β-lactamases (MBLs) are exogenous zinc metalloenzymes that hydrolyze a broad range of β-lactams, including carbapenems. Here we report the crystal structure of IMP-18, an MBL cloned from Pseudomonas aeruginosa, at 2.0-Å resolution. The overall structure of IMP-18 resembles that of IMP-1, with an αβ/βα “folded sandwich” configuration, but the loop that covers the active site has a distinct conformation. The relationship between IMP-18's loop conformation and its kinetic properties was investigated by replacing the amino acid residues that can affect the loop conformation (Lys44, Thr50, and Ile69) in IMP-18 with those occupying the corresponding positions in the well-described enzyme IMP-1. The replacement of Thr50 with Pro considerably modified IMP-18's kinetic properties, specifically those pertaining to meropenem, with the kcat/Km value increased by an order of magnitude. The results indicate that this is a key residue that defines the kinetic properties of IMP-type β-lactamases. PMID:27381398

  10. Different motif requirements for the localization zipcode element of β-actin mRNA binding by HuD and ZBP1

    PubMed Central

    Kim, Hak Hee; Lee, Seung Joon; Gardiner, Amy S.; Perrone-Bizzozero, Nora I.; Yoo, Soonmoon

    2015-01-01

    Interactions of RNA-binding proteins (RBPs) with their target transcripts are essential for regulating gene expression at the posttranscriptional level including mRNA export/localization, stability, and translation. ZBP1 and HuD are RBPs that play pivotal roles in mRNA transport and local translational control in neuronal processes. While HuD possesses three RNA recognition motifs (RRMs), ZBP1 contains two RRMs and four K homology (KH) domains that either increase target specificity or provide a multi-target binding capability. Here we used isolated cis-element sequences of the target mRNA to examine directly protein-RNA interactions in cell-free systems. We found that both ZBP1 and HuD bind the zipcode element in rat β-actin mRNA's 3′ UTR. Differences between HuD and ZBP1 were observed in their binding preference to the element. HuD showed a binding preference for U-rich sequence. In contrast, ZBP1 binding to the zipcode RNA depended more on the structural level, as it required the proper spatial organization of a stem-loop that is mainly determined by the U-rich element juxtaposed to the 3′ end of a 5′-ACACCC-3′ motif. On the basis of this work, we propose that ZBP1 and HuD bind to overlapping sites in the β-actin zipcode, but they recognize different features of this target sequence. PMID:26152301

  11. Reduction and analysis of data from the plasma wave instruments on the IMP-6 and IMP-8 spacecraft

    NASA Technical Reports Server (NTRS)

    Gurnett, D. A.; Anderson, R. R.

    1983-01-01

    The primary data reduction effort during the reporting period was to process summary plots of the IMP 8 plasma wave data and to submit these data to the National Space Science Data Center. Features of the electrostatic noise are compared with simultaneous observations of the magnetic field, plasma and energetic electrons. Spectral characteristics of the noise and the results of this comparison both suggest that in its high frequency part at least the noise does not belong to normal modes of plasma waves but represents either quasi-thermal noise in the non-Maxwellian plasma or artificial noise generated by spacecraft interaction with the medium.

  12. The first interdisciplinary experiments at the IMP high energy microbeam

    NASA Astrophysics Data System (ADS)

    Du, Guanghua; Guo, Jinlong; Wu, Ruqun; Guo, Na; Liu, Wenjing; Ye, Fei; Sheng, Lina; Li, Qiang; Li, Huiyun

    2015-04-01

    The high energy beam of tens to hundred MeV/u ions possesses mm-to-cm penetration depth in materials and can be easily extracted into air without significant energy loss and beam scattering. Combination of high energy ions and microbeam technology facilitates the microprobe application to many practical studies in large scale samples. The IMP heavy ion microbeam facility has recently been integrated with microscopic positioning and targeting irradiation system. This paper introduced the first interdisciplinary experiments performed at the IMP microbeam facility using the beam of 80.5 MeV/u carbon ions. Bystander effect induction via medium transferring was not found in the micro-irradiation study using HeLa cells. The mouse irradiation experiment demonstrated that carbon irradiation of 10 Gy dose to its tuberomammillary nucleus did not impair the sleep nerve system. The fault injection attack on RSA (Rivest-Shamir-Adleman) decryption proved that the commercial field-programmable gate array chip is vulnerable in single event effect to low linear-energy-transfer carbon irradiation, and the attack can cause the leakage of RSA private key. This work demonstrates the potential of high energy microbeam in its application to biology, biomedical, radiation hardness, and information security studies.

  13. TRW plasma wave experiment for the IMP-H mission

    NASA Technical Reports Server (NTRS)

    Virobik, P. F.; Scarf, F. L.

    1973-01-01

    The IMP-H plasma wave experiment is designed to extend knowledge of wave-particle interactions in the disturbed cislunar region, the distant geomagnetic tail, the upstream solar wind, and the flanks of the magnetosheath-shock interface. It is expected to identify plasma instabilities, study particle acceleration and heating at collisionless shocks and other discontinuities, analyze turbulent conductivity and field line merging, and provide new information on dissipation processes for suprathermal particles. Instrumentation for the plasma wave experiment is designed to measure local electric and magnetic field oscillations over the frequency range 10 Hz to 100 kHz. A 24 inch electric dipole, a 7 inch diameter air core search coil, and the associated preamplifiers are mounted on a spacecraft counterweight boom. The frequency range of 10 Hz to 100 kHz for both E and B is processed using an eight-channel spectrum analyzer located in the instrument main-body package (a standard IMP trapezoidal module, 3 inches high). Electric fields as small as 10-100 microvolts/meter and magnetic signals as small as 1-3 milligamma will be detected.

  14. Combination of IMP-4 metallo-beta-lactamase production and porin deficiency causes carbapenem resistance in a Klebsiella oxytoca clinical isolate.

    PubMed

    Chen, Li-Rong; Zhou, Hong-Wei; Cai, Jia-Chang; Zhang, Rong; Chen, Gong-Xiang

    2009-10-01

    This study shows for the first time the mechanism of carbapenem resistance of a Klebsiella oxytoca clinical isolate ZC101 recovered from a Zhejiang University Hospital in Hangzhou, China. MIC values of imipenem, meropenem, and ertapenem for K. oxytoca ZC101 were 16, 16, and 128 microg/mL, respectively. Conjugation experiments demonstrated the transferability of a resistance determinant from K. oxytoca ZC101 to Escherichia coli EC600. Results from isoelectric focusing, polymerase chain reactions, and DNA sequencing confirmed that K. oxytoca ZC101 produced IMP-4 metallo-beta-lactamase (MBL) and CTX-M-14 extended-spectrum beta-lactamase, whereas E. coli transconjugant only produced the IMP-4. Amplification of integron revealed that bla(IMP-4) gene is located within a class I integron that was carried in a plasmid approximately 55 kb in size. Sodium dodecyl sulfate polyacrylamide gel electrophoresis profiling of outer membrane proteins of K. oxytoca ZC101 indicated lack of expression of the OmpK36 porin. DNA sequence analysis of ompK36 gene of K. oxytoca ZC101 showed the gene was disrupted by an insertion sequence IS5. In all, the results show that plasmid-mediated IMP-4 MBL production combined with the loss of OmpK36 porin caused the resistance in K. oxytoca ZC101 to carbapenems.

  15. Structure of human IFIT1 with capped RNA reveals adaptable mRNA binding and mechanisms for sensing N1 and N2 ribose 2'-O methylations.

    PubMed

    Abbas, Yazan M; Laudenbach, Beatrice Theres; Martínez-Montero, Saúl; Cencic, Regina; Habjan, Matthias; Pichlmair, Andreas; Damha, Masad J; Pelletier, Jerry; Nagar, Bhushan

    2017-03-14

    IFIT1 (IFN-induced protein with tetratricopeptide repeats-1) is an effector of the host innate immune antiviral response that prevents propagation of virus infection by selectively inhibiting translation of viral mRNA. It relies on its ability to compete with the translation initiation factor eIF4F to specifically recognize foreign capped mRNAs, while remaining inactive against host mRNAs marked by ribose 2'-O methylation at the first cap-proximal nucleotide (N1). We report here several crystal structures of RNA-bound human IFIT1, including a 1.6-Å complex with capped RNA. IFIT1 forms a water-filled, positively charged RNA-binding tunnel with a separate hydrophobic extension that unexpectedly engages the cap in multiple conformations (syn and anti) giving rise to a relatively plastic and nonspecific mode of binding, in stark contrast to eIF4E. Cap-proximal nucleotides encircled by the tunnel provide affinity to compete with eIF4F while allowing IFIT1 to select against N1 methylated mRNA. Gel-shift binding assays confirm that N1 methylation interferes with IFIT1 binding, but in an RNA-dependent manner, whereas translation assays reveal that N1 methylation alone is not sufficient to prevent mRNA recognition at high IFIT1 concentrations. Structural and functional analysis show that 2'-O methylation at N2, another abundant mRNA modification, is also detrimental for RNA binding, thus revealing a potentially synergistic role for it in self- versus nonself-mRNA discernment. Finally, structure-guided mutational analysis confirms the importance of RNA binding for IFIT1 restriction of a human coronavirus mutant lacking viral N1 methylation. Our structural and biochemical analysis sheds new light on the molecular basis for IFIT1 translational inhibition of capped viral RNA.

  16. pIMP-PH114 carrying bla IMP-4 in a Klebsiella pneumoniae strain is closely related to other multidrug-resistant IncA/C2 plasmids.

    PubMed

    Ho, Pak-Leung; Lo, Wai-U; Chan, Jane; Cheung, Yuk-Yam; Chow, Kin-Hung; Yam, Wing-Cheong; Lin, Chi-Ho; Que, Tak-Lun

    2014-02-01

    The IncA/C plasmids are broad host-range vehicles which have been associated with wide dissemination of CMY-2 among Enterobacteriaceae of human and animal origins. Acquired metallo-β-lactamases (MBLs) such as the IMP-type enzymes are increasingly reported in multidrug-resistant Gram-negative bacteria worldwide, particularly in Enterobacteriaceae. We described the complete sequence of the first IMP-4-encoding IncA/C2 plasmid, pIMP-PH114 (151,885 bp), from a sequence type 1 Klebsiella pneumoniae strain that was recovered from a patient who was hospitalized in the Philippines. pIMP-PH114 consists of a backbone from the IncA/C2 plasmids, with the insertion of a novel Tn21-like class 1 integron composite structure (containing the cassette array bla IMP-4-qacG-aacA4-catB3, followed by a class C β-lactamase bla DHA-1 and the mercury resistance operon, merRTPCADE) and a sul2-floR encoding region. Phylogenetic analysis of the IncA/C repA sequences showed that pIMP-PH114 formed a subgroup with other IncA/C plasmids involved in the international spread of CMY-2, TEM-24 and NDM-1. Identical bla IMP-4 arrays have been described among different Enterobacteriaceae and Acinetobacter spp. in China, Singapore and Australia but the genetic context is different. The broad host range of IncA/C plasmids may have facilitated dissemination of the bla IMP-4 arrays among different diverse groups of bacteria.

  17. Improvement of hydrophobic integral membrane protein identification by mild performic acid oxidation-assisted digestion.

    PubMed

    Cao, Rui; Liu, Yisong; Chen, Ping; Lv, Rong; Song, Qin; Sheng, Tingting; He, Quanyuan; Wang, Yin; Wang, Xianchun; Liang, Songping

    2010-12-15

    Integral membrane proteins (IMPs) are critical for the maintenance of biological systems and represent important targets for the treatment of disease. The hydrophobicity and low abundance of IMPs make them difficult to analyze. In proteomic analyses, hydrophobic peptides including transmembrane domains are often underrepresented, and this reduces the sequence coverage and reliability of the identified IMPs. Here we report a new strategy, mild performic acid oxidation treatment (mPAOT), for improvement of IMP identification. In the mPAOT strategy, the hydrophobicity of IMPs is significantly decreased by oxidizing their methionine and cysteine residues with performic acid, thereby improving the solubility and enzymolysis of these proteins. The application of the mPAOT strategy to the analysis of IMPs from human nasopharyngeal carcinoma CNE1 cell line demonstrated that many IMPs, including those with high hydrophobicity, could be reliably identified.

  18. Increased IMP dehydrogenase gene expression in solid tumor tissues and tumor cell lines

    SciTech Connect

    Collart, F.R.; Chubb, C.B.; Mirkin, B.L.; Huberman, E.

    1992-07-10

    IMP dehydrogenase, a regulatory enzyme of guanine nucleotide biosynthesis, may play a role in cell proliferation and malignancy. To assess this possibility, we examined IMP dehydrogenase expression in a series of human solid tumor tissues and tumor cell lines in comparison with their normal counterparts. Increased IMP dehydrogenase gene expression was observed in brain tumors relative to normal brain tissue and in sarcoma cells relative to normal fibroblasts. Similarly, in several B- and T-lymphoid leukemia cell lines, elevated levels of IMP dehydrogenase mRNA and cellular enzyme were observed in comparison with the levels in peripheral blood lymphocytes. These results are consistent with an association between increased IMP dehydrogenase expression and either enhanced cell proliferation or malignant transformation.

  19. Diagnostic usefulness of EMA, IMP3, and GLUT-1 for the immunocytochemical distinction of malignant cells from reactive mesothelial cells in effusion cytology using cytospin preparations.

    PubMed

    Ikeda, Katsuhide; Tate, Genshu; Suzuki, Takao; Kitamura, Takashi; Mitsuya, Toshiyuki

    2011-06-01

    To differentiate reactive mesothelial cells (RMs) from metastatic carcinoma and malignant mesothelioma (MM) in effusion cytology is crucial for the cytologic diagnosis and the management of the patients. In the present study, the immunocytochemical staining profile of the epithelial membrane antigen (EMA), the insulin-like growth factor-II mRNA-binding protein 3 (IMP3), and the glucose transporter-1 (GLUT-1) was examined to distinguish RMs from malignant cells. A total of 171 pleural (n = 87) and peritoneal (n = 84) effusion specimens, including 50 benign effusions with RMs, 11 MM effusions, and 110 metastatic malignant effusions, were evaluated for immunocytochemistry. EMA, IMP3, monoclonal GLUT-1, and polyclonal GLUT-1 immunoreactivity were observed in 26.0%, 6.0%, 20.0%, and 18.0% of RMs, respectively. In contrast to RMs, the immunoreactivity in MM was 100%, 36.4%, 100%, and 90.9%; adenocarcinoma (AC) was 100%, 80.8%, 81.7%, and 72.1%; squamous-cell carcinoma was 83.3%, 83.3%, 83.3%, and 66.7%. EMA, IMP3, mGLUT-1, and pGLUT-1 expressions were observed in 98.4%, 65.6%, 88.5%, and 75.4% in the pleural effusion with malignant cells, and 100%, 88.3%, 78.3%, and 71.7% in ascites containing malignant cells, respectively. The findings of the present study indicate that the immunocytochemical staining for EMA, IMP3, and GLUT-1 is a useful diagnostic tool for distinguishing effusions containing malignant cells from those that contain benign cells, and in particular, we suggest that the combination of mGLUT-1 and EMA, and IMP3 and EMA are extremely useful in pleural effusion and in ascites, respectively.

  20. Quantitative iodine-123 IMP imaging of brain perfusion in schizophrenia

    SciTech Connect

    Cohen, M.B.; Lake, R.R.; Graham, L.S.; King, M.A.; Kling, A.S.; Fitten, L.J.; O'Rear, J.; Bronca, G.A.; Gan, M.; Servrin, R. )

    1989-10-01

    Decreased perfusion in the frontal lobes of patients with chronic schizophrenia has been reported by multiple observes using a variety of techniques. Other observers have been unable to confirm this finding using similar techniques. In this study quantitative single photon emission computed tomography brain imaging was performed using p,5n ({sup 123}I)IMP in five normal subjects and ten chronically medicated patients with schizophrenia. The acquisition data were preprocessed with an image dependent Metz filter and reconstructed using a ramp filtered back projection technique. The uptake in each of 50 regions of interest in each subject was normalized to the uptake in the cerebellum. There were no significant confirmed differences in the comparable ratios of normal subjects and patients with schizophrenia even at the p = 0.15 level. Hypofrontality was not observed.

  1. Magnetospheric substorms in the distant magnetotail observed by Imp 3.

    NASA Technical Reports Server (NTRS)

    Meng, C. I.; Akasofu, S.; Kawasaki, K.; Hones, E. W., Jr.

    1971-01-01

    Study of variations of the magnetic field and plasma sheet in the distant magnetotail (20 to 40 earth radii) during magnetospheric substorms on the basis of the Imp 3 magnetic-field and particle data. Depending on the locations of the satellite with respect to the boundary of the plasma sheet, the variations differ greatly. However, the present results and the results of other workers give a clear indication of an increase of the magnitude of the field outside the plasma sheet and of the simultaneous ?thinning' of the plasma sheet during an early phase of substorms. At about the maximum epoch or during the recovery phase of substorms, the plasma sheet expands and appears to be inflated to at least the presubstorm level. Furthermore, a large excessive flux of the magnetic (approximately equal to Z component) field, as compared with the flux of the original dipole field, appears across the neutral sheet.

  2. Isolation and plasmid characterization of carbapenemase (IMP-4) producing Salmonella enterica Typhimurium from cats

    PubMed Central

    Abraham, Sam; O’Dea, Mark; Trott, Darren J.; Abraham, Rebecca J.; Hughes, David; Pang, Stanley; McKew, Genevieve; Cheong, Elaine Y. L.; Merlino, John; Saputra, Sugiyono; Malik, Richard; Gottlieb, Thomas

    2016-01-01

    Carbapenem-resistant Enterobacteriaceae (CRE) are a pressing public health issue due to limited therapeutic options to treat such infections. CREs have been predominantly isolated from humans and environmental samples and they are rarely reported among companion animals. In this study we report on the isolation and plasmid characterization of carbapenemase (IMP-4) producing Salmonella enterica Typhimurium from a companion animal. Carbapenemase-producing S. enterica Typhimurium carrying blaIMP-4 was identified from a systemically unwell (index) cat and three additional cats at an animal shelter. All isolates were identical and belonged to ST19. Genome sequencing revealed the acquisition of a multidrug-resistant IncHI2 plasmid (pIMP4-SEM1) that encoded resistance to nine antimicrobial classes including carbapenems and carried the blaIMP-4-qacG-aacA4-catB3 cassette array. The plasmid also encoded resistance to arsenic (MIC-150 mM). Comparative analysis revealed that the plasmid pIMP4-SEM1 showed greatest similarity to two blaIMP-8 carrying IncHI2 plasmids from Enterobacter spp. isolated from humans in China. This is the first report of CRE carrying a blaIMP-4 gene causing a clinical infection in a companion animal, with presumed nosocomial spread. This study illustrates the broader community risk entailed in escalating CRE transmission within a zoonotic species such as Salmonella, and in a cycle that encompasses humans, animals and the environment. PMID:27767038

  3. Biochemical Characterization of IMP-30, a Metallo-β-Lactamase with Enhanced Activity toward Ceftazidime

    PubMed Central

    Pegg, Kevin M.; Liu, Eleanor M.; LaCuran, Alecander E.

    2013-01-01

    IMP-type enzymes constitute a clinically important family of metallo-β-lactamases that has grown dramatically in the past decade to its current 45 known members. Here, we report the biochemical characterization of IMP-30 in comparison to IMP-1, from which it deviates by a single E59K mutation. Kinetics, MIC assays, docking, and molecular dynamics simulations support a scenario in which Lys59 interacts with the ceftazidime R1 group, resulting in increased water access and enhanced turnover and MIC of ceftazidime. PMID:23836186

  4. Emergence of Raoultella ornithinolytica Coproducing IMP-4 and KPC-2 Carbapenemases in China

    PubMed Central

    Zheng, Beiwen; Zhang, Jing; Ji, Jinru; Fang, Yunhui; Shen, Ping; Ying, Chaoqun; Lv, Jifang

    2015-01-01

    We report here the emergence of seven IMP-4-producing Raoultella ornithinolytica isolates obtained from one patient. All isolates carried the blaIMP-4 carbapenemase gene, five isolates also carried blaSHV-12, four contained blaTEM-1, and one contained blaOXA-1. Notably, the R. ornithinolytica isolate Ro25724 also expressed Klebsiella pneumoniae carbapenemase (KPC)-2. The blaKPC-2 gene was located on a Tn3-Tn4401 integration structure on a plasmid of ∼450 kb. This is the first description of the coexistence of blaKPC-2 and blaIMP-4 from the genus Raoultella. PMID:26282422

  5. IMP 7 (Explorer 47) trajectory, September 26, 1972 to September 25, 1978

    NASA Technical Reports Server (NTRS)

    Milligan, Pamela A.; Lazarus, Alan J.

    1988-01-01

    The trajectory plots for IMP 7 (Explorer 47) are contained. For each orbit the trajectory is shown in five panels on two pages; each panel is a different representation or projection. The trajectory parameters were obtained from the multi-coordinate ephemeris (MCE) tapes supplied to IMP experimenters by the IMP project. The plots on the right hand pages use a geocentric, solar-ecliptic coordinate system. Distances are in units of earth radii. The plots on the left hand pages use geocentric, solar magnetospheric coordinates with distances in earth radii.

  6. Structure of Cryptosporidium IMP dehydrogenase bound to an inhibitor with in vivo antiparasitic activity

    SciTech Connect

    Kim, Youngchang; Makowska-Grzyska, Magdalena; Gorla, Suresh Kumar; Gollapalli, Deviprasad R.; Cuny, Gregory D.; Joachimiak, Andrzej; Hedstrom, Lizbeth

    2015-04-21

    Inosine 5´-monophosphate dehydrogenase (IMPDH) is a promising target for the treatment of Cryptosporidium infections. Here, the structure of C. parvum IMPDH (CpIMPDH) in complex with inosine 5´-monophosphate (IMP) and P131, an inhibitor with in vivo anticryptosporidial activity, is reported. P131 contains two aromatic groups, one of which interacts with the hypoxanthine ring of IMP, while the second interacts with the aromatic ring of a tyrosine in the adjacent subunit. In addition, the amine and NO2 moieties bind in hydrated cavities, forming water-mediated hydrogen bonds to the protein. The design of compounds to replace these water molecules is a new strategy for the further optimization of C. parvum inhibitors for both antiparasitic and antibacterial applications.

  7. Physiological Response to Membrane Protein Overexpression in E. coli*

    PubMed Central

    Gubellini, Francesca; Verdon, Grégory; Karpowich, Nathan K.; Luff, Jon D.; Boël, Grégory; Gauthier, Nils; Handelman, Samuel K.; Ades, Sarah E.; Hunt, John F.

    2011-01-01

    Overexpression represents a principal bottleneck in structural and functional studies of integral membrane proteins (IMPs). Although E. coli remains the leading organism for convenient and economical protein overexpression, many IMPs exhibit toxicity on induction in this host and give low yields of properly folded protein. Different mechanisms related to membrane biogenesis and IMP folding have been proposed to contribute to these problems, but there is limited understanding of the physical and physiological constraints on IMP overexpression and folding in vivo. Therefore, we used a variety of genetic, genomic, and microscopy techniques to characterize the physiological responses of Escherichia coli MG1655 cells to overexpression of a set of soluble proteins and IMPs, including constructs exhibiting different levels of toxicity and producing different levels of properly folded versus misfolded product on induction. Genetic marker studies coupled with transcriptomic results indicate only minor perturbations in many of the physiological systems implicated in previous studies of IMP biogenesis. Overexpression of either IMPs or soluble proteins tends to block execution of the standard stationary-phase transcriptional program, although these effects are consistently stronger for the IMPs included in our study. However, these perturbations are not an impediment to successful protein overexpression. We present evidence that, at least for the target proteins included in our study, there is no inherent obstacle to IMP overexpression in E. coli at moderate levels suitable for structural studies and that the biochemical and conformational properties of the proteins themselves are the major obstacles to success. Toxicity associated with target protein activity produces selective pressure leading to preferential growth of cells harboring expression-reducing and inactivating mutations, which can produce chemical heterogeneity in the target protein population, potentially

  8. Dominance of IMP-4-Producing Enterobacter cloacae among Carbapenemase-Producing Enterobacteriaceae in Australia

    PubMed Central

    Townell, Nicola; Nimmo, Graeme R.; George, Narelle M.; Robson, Jennifer; Vohra, Renu; Davis, Louise; Heney, Claire; Paterson, David L.

    2015-01-01

    The prevalence of carbapenemase-producing Enterobacteriaceae (CPE) has been increasing worldwide. blaIMP has been reported to be the predominant carbapenemase-encoding gene within Enterobacteriaceae in Australia. However, there are limited data currently available on CPE from Queensland, Australia. A total of 58 CPE isolates were isolated between July 2009 and March 2014 from Queensland hospitals. The clonality of isolates was determined by Diversilab repetitive sequence-based PCR. The isolates were investigated for the resistance mechanisms carbapenemase, extended-spectrum β-lactamase, and AmpC β-lactamase and for aminoglycoside resistance and plasmid-mediated quinolone resistance genes by PCR. The plasmid types associated with carbapenemase-encoding genes were characterized. The majority of the CPE were Enterobacter cloacae (n = 29). The majority of Queensland CPE isolates were IMP producers and comprised 11 species (n = 48). Nine NDM-producing Enterobacteriaceae were identified. One NDM-producing Klebsiella pneumoniae isolate coproduced OXA-48. One K. pneumoniae isolate was an OXA-181 producer. The incidence of IMP producers increased significantly in 2013. blaIMP-4 was found in all IMP-producing isolates. blaTEM, qnrB, and aacA4 were common among IMP-4 producers. The HI2 (67%) and L/M (21%) replicons were associated with blaIMP-4. All HI2 plasmids were of sequence type 1 (ST1). All but one of the NDM producers possessed blaCTX-M-15. The 16S rRNA methylase genes found among NDM producers were armA, rmtB, rmtC, and rmtF. The substantial increase in the prevalence of CPE in Queensland has been associated mainly with the emergence E. cloacae strains possessing HI2 plasmids carrying blaIMP-4 over the past 2 years. The importation of NDM producers and/or OXA-48-like producers in patients also contributed to the increased emergence of CPE. PMID:25918153

  9. Dominance of IMP-4-producing enterobacter cloacae among carbapenemase-producing Enterobacteriaceae in Australia.

    PubMed

    Sidjabat, Hanna E; Townell, Nicola; Nimmo, Graeme R; George, Narelle M; Robson, Jennifer; Vohra, Renu; Davis, Louise; Heney, Claire; Paterson, David L

    2015-07-01

    The prevalence of carbapenemase-producing Enterobacteriaceae (CPE) has been increasing worldwide. blaIMP has been reported to be the predominant carbapenemase-encoding gene within Enterobacteriaceae in Australia. However, there are limited data currently available on CPE from Queensland, Australia. A total of 58 CPE isolates were isolated between July 2009 and March 2014 from Queensland hospitals. The clonality of isolates was determined by Diversilab repetitive sequence-based PCR. The isolates were investigated for the resistance mechanisms carbapenemase, extended-spectrum β-lactamase, and AmpC β-lactamase and for aminoglycoside resistance and plasmid-mediated quinolone resistance genes by PCR. The plasmid types associated with carbapenemase-encoding genes were characterized. The majority of the CPE were Enterobacter cloacae (n = 29). The majority of Queensland CPE isolates were IMP producers and comprised 11 species (n = 48). Nine NDM-producing Enterobacteriaceae were identified. One NDM-producing Klebsiella pneumoniae isolate coproduced OXA-48. One K. pneumoniae isolate was an OXA-181 producer. The incidence of IMP producers increased significantly in 2013. blaIMP-4 was found in all IMP-producing isolates. blaTEM, qnrB, and aacA4 were common among IMP-4 producers. The HI2 (67%) and L/M (21%) replicons were associated with blaIMP-4. All HI2 plasmids were of sequence type 1 (ST1). All but one of the NDM producers possessed blaCTX-M-15. The 16S rRNA methylase genes found among NDM producers were armA, rmtB, rmtC, and rmtF. The substantial increase in the prevalence of CPE in Queensland has been associated mainly with the emergence E. cloacae strains possessing HI2 plasmids carrying blaIMP-4 over the past 2 years. The importation of NDM producers and/or OXA-48-like producers in patients also contributed to the increased emergence of CPE.

  10. Nosocomial Infections with IMP-19−Producing Pseudomonas aeruginosa Linked to Contaminated Sinks, France

    PubMed Central

    Amoureux, Lucie; Riedweg, Karena; Chapuis, Angélique; Bador, Julien; Siebor, Eliane; Péchinot, André; Chrétien, Marie-Lorraine; de Curraize, Claire

    2017-01-01

    We isolated IMP-19–producing Pseudomonas aeruginosa from 7 patients with nosocomial infections linked to contaminated sinks in France. We showed that blaIMP-19 was located on various class 1 integrons among 8 species of gram-negative bacilli detected in sinks: P. aeruginosa, Achromobacter xylosoxidans, A. aegrifaciens, P. putida, Stenotrophomonas maltophilia, P. mendocina, Comamonas testosteroni, and Sphingomonas sp. PMID:28098548

  11. Comparison of I-123 IMP cerebral uptake and MR spectroscopy following experimental carotid occlusion

    SciTech Connect

    Holman, B.L.; Jolesz, F.A.; Polak, J.F.; Kronauge, J.F.; Adams, D.F.

    1985-07-01

    Both I-123 IMP scintigraphy and MRI have been suggested as sensitive detectors of changes shortly after acute cerebral infarction. We compared the uptake of N-isopropyl I-123 p-iodoamphetamine (IMP) and MR spectroscopy of the brain after internal carotid artery ligation. Thirteen gerbils were lightly anesthetized with ether. After neck dissection, an internal carotid artery was occluded. After 2.8 hours, 100 muCi I-123 IMP was injected intravenously into the 13 experimental animals plus three controls. Seven gerbils remained asymptomatic while six developed hemiparesis. At 3 hours after ligation, the animals were killed. The brains were bisected and T1 and T2 relaxation times were determined for the right and left hemispheres by MR spectroscopy immediately after dissection. I-123 IMP uptake was then determined in the samples. Interhemispheric differences in uptake for I-123 IMP were 0.1 +/- 1.7% (SEM) in the control, 33.5 +/- 10% in the asymptomatic and 54.6 +/- 9.7% in the symptomatic animals. Significant differences were seen with I-123 IMP in 6/7 asymptomatic and 6/6 symptomatic animals. In conclusion, I-123 is more sensitive than T1 or T2 relaxation times for the detection of cerebral perfusion abnormalities. Prolongation in T1 and T2 relaxation times correlates closely with increased brain tissue water content and the development of symptoms, indicators of structural brain damage and probable infarction.

  12. Interactions of the human, rat, Saccharomyces cerevisiae and Escherichia coli 3-methyladenine-DNA glycosylases with DNA containing dIMP residues

    PubMed Central

    Saparbaev, Murat; Mani, Jean-Claude; Laval, Jacques

    2000-01-01

    In DNA, the deamination of dAMP generates 2′-deoxyinosine 5′-monophosphate (dIMP). Hypoxanthine (HX) residues are mutagenic since they give rise to A·T→G·C transition. They are excised, although with different efficiencies, by an activity of the 3-methyladenine (3-meAde)-DNA glycosylases from Escherichia coli (AlkA protein), human cells (ANPG protein), rat cells (APDG protein) and yeast (MAG protein). Comparison of the kinetic constants for the excision of HX residues by the four enzymes shows that the E.coli and yeast enzymes are quite inefficient, whereas for the ANPG and the APDG proteins they repair the HX residues with an efficiency comparable to that of alkylated bases, which are believed to be the primary substrates of these DNA glycosylases. Since the use of various substrates to monitor the activity of HX-DNA glycosylases has generated conflicting results, the efficacy of the four 3-meAde-DNA glycosylases of different origin was compared using three different substrates. Moreover, using oligonucleotides containing a single dIMP residue, we investigated a putative sequence specificity of the enzymes involving the bases next to the HX residue. We found up to 2–5-fold difference in the rates of HX excision between the various sequences of the oligonucleotides studied. When the dIMP residue was placed opposite to each of the four bases, a preferential recognition of dI:T over dI:dG, dI:dC and dI:dA mismatches was observed for both human (ANPG) and E.coli (AlkA) proteins. At variance, the yeast MAG protein removed more efficiently HX from a dI:dG over dI:dC, dI:T and dI:dA mismatches. PMID:10684927

  13. Thermodynamic characterization of the exchange of detergents and amphipols at the surfaces of integral membrane proteins.

    PubMed

    Tribet, C; Diab, C; Dahmane, T; Zoonens, M; Popot, J-L; Winnik, F M

    2009-11-03

    The aggregation of integral membrane proteins (IMPs) in aqueous media is a significant concern for mechanistic investigations and pharmaceutical applications of this important class of proteins. Complexation of IMPs with amphiphiles, either detergents or short amphiphilic polymers known as amphipols (APols), renders IMPs water-soluble. It is common knowledge that IMP-detergent complexes are labile, while IMP-APol complexes are exceptionally stable and do not dissociate even under conditions of extreme dilution. To understand the thermodynamic origin of this difference in stability and to guide the design of new APols, we have studied by isothermal titration calorimetry (ITC) the heat exchanges during two reciprocal processes, the "trapping" of detergent-solubilized IMPs in APols and the "stripping" of IMP-APol complexes by detergents, using two IMPs (the transmembrane domain of porin OmpA from Escherichia coli and bacteriorhodopsin from Halobium salinarium), two APols [an anionic polymer derived from acrylic acid (A8-35) and a cationic phosphorylcholine-based polymer (C22-43)], and two neutral detergents [n-octyl thioglucoside (OTG) and n-octyltetraethylene glycol (C(8)E(4))]. In the presence of detergent, free APols and IMP-APol complexes form mixed particles, APol-detergent and IMP-APol-detergent, respectively, according to the regular mixing model. Diluting IMP-APol-detergent complexes below the critical micellar concentration (CMC) of the detergent triggers the dispersion of detergent molecules as monomers, a process characterized by an enthalpy of demicellization. The enthalpy of APol <--> detergent exchange on the hydrophobic surface of IMPs is negligibly small, an indication of the similarity of the molecular interactions of IMPs with the two types of amphiphiles. The enhanced stability against dilution of IMP-APol complexes, compared to IMP-detergent ones, originates from the difference in entropy gain achieved upon release in water of a few APol molecules

  14. Intramembrane particles and the organization of lymphocyte membrane proteins.

    PubMed

    Kuby, J M; Wofsy, L

    1981-03-01

    An experimental system was developed in which the majority of all lymphocyte cell-surface proteins, regardless of antigenic specificity, could be cross-linked and redistributed in the membrane to determine whether this would induce a corresponding redistribution of intramembrane particles (IMP). Mouse spleen cells were treated with P-diazoniumphenyl- beta-D-lactoside (lac) to modify all exposed cell-surface proteins. Extensive azo- coupling was achieved without significantly reducing cell viability or compromising cellular function in mitogen- or antigen-stimulated cultures. When the lac-modified cell- surface proteins were capped with a sandwich of rabbit antilactoside antibody and fluorescein-goat anti-rabbit Ig, freeze-fracture preparations obtained from these cells revealed no obvious redistribution of IMP on the majority of fracture faces. However, detailed analysis showed a statistically significant 35 percent decrease (P less than 0.01) in average IMP density in the E face of the lac-capped spleen cells compared with control cells, whereas a few E-face micrographs showed intense IMP aggregation. In contrast, there was no significant alteration of P-face IMP densities or distribution. Apparently, the majority of E-face IMP and virtually all P-face IMP densities or distribution. Apparently, the majority of E-face IMP and virtually all P-face IMP do not present accessible antigenic sites on the lymphocyte surface and do not associate in a stable manner with surface protein antigens. This finding suggests that IMP, as observed in freeze-fracture analysis, may not comprise a representative reflection of lymphocyte transmembrane protein molecules and complexes because other evidence establishes: (a) that at least some common lymphocyte surface antigens are indeed exposed portions of transmembrane proteins and (b) that the aggregation of molecules of any surface antigen results in altered organization of contractile proteins at the cytoplasmic face of the membrane.

  15. Intramembrane particles and the organization of lymphocyte membrane proteins

    PubMed Central

    Kuby, JM; Wofsy, L

    1981-01-01

    An experimental system was developed in which the majority of all lymphocyte cell-surface proteins, regardless of antigenic specificity, could be cross-linked and redistributed in the membrane to determine whether this would induce a corresponding redistribution of intramembrane particles (IMP). Mouse spleen cells were treated with P-diazoniumphenyl- β-D-lactoside (lac) to modify all exposed cell-surface proteins. Extensive azo- coupling was achieved without significantly reducing cell viability or compromising cellular function in mitogen- or antigen-stimulated cultures. When the lac-modified cell- surface proteins were capped with a sandwich of rabbit antilactoside antibody and fluorescein-goat anti-rabbit Ig, freeze-fracture preparations obtained from these cells revealed no obvious redistribution of IMP on the majority of fracture faces. However, detailed analysis showed a statistically significant 35 percent decrease (P less than 0.01) in average IMP density in the E face of the lac-capped spleen cells compared with control cells, whereas a few E-face micrographs showed intense IMP aggregation. In contrast, there was no significant alteration of P-face IMP densities or distribution. Apparently, the majority of E-face IMP and virtually all P-face IMP densities or distribution. Apparently, the majority of E-face IMP and virtually all P-face IMP do not present accessible antigenic sites on the lymphocyte surface and do not associate in a stable manner with surface protein antigens. This finding suggests that IMP, as observed in freeze-fracture analysis, may not comprise a representative reflection of lymphocyte transmembrane protein molecules and complexes because other evidence establishes: (a) that at least some common lymphocyte surface antigens are indeed exposed portions of transmembrane proteins and (b) that the aggregation of molecules of any surface antigen results in altered organization of contractile proteins at the cytoplasmic face of the membrane

  16. A Link Between Integral Membrane Protein Expression and Simulated Integration Efficiency

    PubMed Central

    Müller, Axel; Tiemann, Katrin; Saladi, Shyam M.; Galimidi, Rachel P.; Zhang, Bin; Clemons, William M.; Miller, Thomas F.

    2016-01-01

    Integral membrane proteins (IMP) control the flow of information and nutrients across cell membranes, yet IMP mechanistic studies are hindered by difficulties in expression. We investigate this issue by addressing the connection between IMP sequence and observed expression levels. For homologs of the IMP TatC, observed expression levels widely vary and are affected by small changes in protein sequence. The effect of sequence changes on experimentally observed expression levels strongly correlates with the simulated integration efficiency obtained from coarse-grained modeling, which is directly confirmed using an in vivo assay. Furthermore, mutations that improve the simulated integration efficiency likewise increase the experimentally observed expression levels. Demonstration of these trends in both Escherichia coli and Mycobacterium smegmatis suggests that the results are general to other expression systems. This work suggests that IMP integration is a determinant for successful expression, raising the possibility of controlling IMP expression via rational design. PMID:27524616

  17. Modification to the MED and LED source-encoding circuitry for the IMP H and J spacecraft

    NASA Technical Reports Server (NTRS)

    Garrahan, N. M.

    1972-01-01

    The circuitry and fabrication changes made on the MED and LED electronics cards for the IMP H and J are reported. Except for the noted changes, the circuitry and module-matrix arrangement is essentially the same as the IMP-1 electronics cards described. In addition, analysis of the IMP-1 transmitted data indicated the desirability of incorporating additional coincident-event threshold detection levels to further discriminate between received particles.

  18. Characterization of a novel IMP-28 metallo-β-lactamase from a Spanish Klebsiella oxytoca clinical isolate.

    PubMed

    Pérez-Llarena, Francisco José; Fernández, Ana; Zamorano, Laura; Kerff, Frédéric; Beceiro, Alejandro; Aracil, Belén; Cercenado, Emilia; Miro, Elisenda; Oliver, Antonio; Oteo, Jesús; Navarro, Ferran; Bou, Germán

    2012-08-01

    An isolate of Klebsiella oxytoca carrying a novel IMP metallo-β-lactamase was discovered in Madrid, Spain. The bla(IMP-28) gene is part of a chromosomally located class I integron. The IMP-28 k(cat)/K(m) values for ampicillin, ceftazidime, and cefepime and, to a lesser extent, imipenem and meropenem, are clearly lower than those of IMP-1. The His306Gln mutation may induce important modifications of the L3 loop and thus of substrate accessibility and hydrolysis and be the main reason for this behavior.

  19. Hypoxic Vasospasm Mediated by cIMP: When Soluble Guanylyl Cyclase Turns Bad

    PubMed Central

    Chen, Zhengju; Leung, Susan W. S.; Vanhoutte, Paul M.

    2015-01-01

    Abstract: In a number of isolated blood vessel types, hypoxia causes an acute contraction that is dependent on the presence of nitric oxide and activation of soluble guanylyl cyclase. It is more pronounced when the preparations are constricted and is therefore termed hypoxic augmentation of vasoconstriction. This hypoxic response is accompanied by increases in the intracellular level of inosine 5′-triphosphate and in the synthesis of inosine 3′,5′-cyclic monophosphate (cIMP) by soluble guanylyl cyclase. The administration of exogenous cIMP or inosine 5′-triphosphate causes augmented vasoconstriction to hypoxia. Furthermore, the vasoconstriction evoked by hypoxia and cIMP is associated with increased activity of Rho kinase (ROCK), indicating that cIMP may mediate the hypoxic effect by sensitizing the myofilaments to Ca2+ through ROCK. Hypoxia is implicated in exaggerated vasoconstriction in the pathogenesis of coronary artery disease, myocardial infarction, hypertension, and stroke. The newly found role of cIMP may help to identify unique therapeutic targets for certain cardiovascular disorders. PMID:25264755

  20. Ciliary Entry of the Hedgehog Transcriptional Activator Gli2 Is Mediated by the Nuclear Import Machinery but Differs from Nuclear Transport in Being Imp-α/β1-Independent.

    PubMed

    Torrado, Belén; Graña, Martín; Badano, José L; Irigoín, Florencia

    2016-01-01

    Gli2 is the primary transcriptional activator of Hedgehog signalling in mammals. Upon stimulation of the pathway, Gli2 moves into the cilium before reaching the nucleus. However, the mechanisms underlying its entry into the cilium are not completely understood. Since several similarities have been reported between nuclear and ciliary import, we investigated if the nuclear import machinery participates in Gli2 ciliary entry. Here we show that while two conserved classical nuclear localization signals mediate Gli2 nuclear localization via importin (Imp)-α/β1, these sequences are not required for Gli2 ciliary import. However, blocking Imp-mediated transport through overexpression of GTP-locked Ran reduced the percentage of Gli2 positive cilia, an effect that was not explained by increased CRM1-dependent export of Gli2 from the cilium. We explored the participation of Imp-β2 in Gli2 ciliary traffic and observed that this transporter is involved in moving Gli2 into the cilium, as has been described for other ciliary proteins. In addition, our data indicate that Imp-β2 might also collaborate in Gli2 nuclear entry. How does Imp-β2 determine the final destination of a protein that can localize to two distinct subcellular compartments remains an open question. Therefore, our data shows that the nuclear-cytoplasmic shuttling machinery plays a critical role mediating the subcellular distribution of Gli2 and the activation of the pathway, but distinct importins likely play a differential role mediating its ciliary and nuclear translocation.

  1. Ciliary Entry of the Hedgehog Transcriptional Activator Gli2 Is Mediated by the Nuclear Import Machinery but Differs from Nuclear Transport in Being Imp-α/β1-Independent

    PubMed Central

    Torrado, Belén; Graña, Martín; Badano, José L.; Irigoín, Florencia

    2016-01-01

    Gli2 is the primary transcriptional activator of Hedgehog signalling in mammals. Upon stimulation of the pathway, Gli2 moves into the cilium before reaching the nucleus. However, the mechanisms underlying its entry into the cilium are not completely understood. Since several similarities have been reported between nuclear and ciliary import, we investigated if the nuclear import machinery participates in Gli2 ciliary entry. Here we show that while two conserved classical nuclear localization signals mediate Gli2 nuclear localization via importin (Imp)-α/β1, these sequences are not required for Gli2 ciliary import. However, blocking Imp-mediated transport through overexpression of GTP-locked Ran reduced the percentage of Gli2 positive cilia, an effect that was not explained by increased CRM1-dependent export of Gli2 from the cilium. We explored the participation of Imp-β2 in Gli2 ciliary traffic and observed that this transporter is involved in moving Gli2 into the cilium, as has been described for other ciliary proteins. In addition, our data indicate that Imp-β2 might also collaborate in Gli2 nuclear entry. How does Imp-β2 determine the final destination of a protein that can localize to two distinct subcellular compartments remains an open question. Therefore, our data shows that the nuclear-cytoplasmic shuttling machinery plays a critical role mediating the subcellular distribution of Gli2 and the activation of the pathway, but distinct importins likely play a differential role mediating its ciliary and nuclear translocation. PMID:27579771

  2. Comparison of I-123 IMP uptake and NMR spectroscopy in the brain following experimental carotid occlusion

    SciTech Connect

    Holman, B.L.; Jolesz, F.; Polak, J.F.; Kronauge, J.; Adams, D.F.

    1984-01-01

    Both I-123 IMP scintigraphy and NMR have been suggested as sensitive detectors of changes shortly after acute cerebral infarction. The authors compared the uptake of N-isopropul I-123 p-iodoamphetamine (IMP) and NMR spectroscopy of the brain after internal carotid artery ligation. Thirteen gerbils were lightly anesthetized with ether. After neck dissection, an internal carotid artery was occluded. After 2.8 hours, 100 ..mu..Ci I-123 IMP was injected intravenously into the 13 experimental animals plus 3 controls. Seven gerbils remained asymptomatic while 6 developed hemiparesis. At 3 hours after ligation, the animals were killed. The brains were bisected and T/sub 1/ and T/sub 2/ relaxation times were determined for the right and left hemispheres by NMR spectroscopy immediately after dissection. I-123 IMP uptake was then determined in the samples. Interhemispheric differences in uptake for I-123 IMP uptake was 2.2% +- 0.5% in the control, 33.5% +- 9.6% in the asymptomatic and 54.6% +- 9.7% in the symptomatic animals. Significant differences were seen with I-123 IMP in 6/7 asymptomatic and 6/6 symptomatic animals. Significant differences in T/sub 1/ and T/sub 2/ were seen in 2/7 of the asymptomatic and 5/6 of the symptomatic animals. The authors conclude that I-123 is more sensitive than T/sub 1/ or T/sub 2/ for the detection of cerebral perfusion abnormalities while T/sub 1/ and T/sub 2/ more accurately separate symptomatic from asymptomatic animals.

  3. Importin β Can Bind Hepatitis B Virus Core Protein and Empty Core-Like Particles and Induce Structural Changes

    PubMed Central

    Pierson, Elizabeth E.; Keifer, David Z.; Delaleau, Mildred; Gallucci, Lara; Cazenave, Christian; Kann, Michael; Jarrold, Martin F.; Zlotnick, Adam

    2016-01-01

    Hepatitis B virus (HBV) capsids are found in many forms: immature single-stranded RNA-filled cores, single-stranded DNA-filled replication intermediates, mature cores with relaxed circular double-stranded DNA, and empty capsids. A capsid, the protein shell of the core, is a complex of 240 copies of core protein. Mature cores are transported to the nucleus by a complex that includes both importin α and importin β (Impα and Impβ), which bind to the core protein’s C-terminal domains (CTDs). Here we have investigated the interactions of HBV core protein with importins in vitro. Strikingly, empty capsids and free core protein can bind Impβ without Impα. Cryo-EM image reconstructions show that the CTDs, which are located inside the capsid, can extrude through the capsid to be bound by Impβ. Impβ density localized on the capsid exterior near the quasi-sixfold vertices, suggested a maximum of 30 Impβ per capsid. However, examination of complexes using single molecule charge-detection mass spectrometry indicate that some complexes include over 90 Impβ molecules. Cryo-EM of capsids incubated with excess Impβ shows a population of damaged particles and a population of “dark” particles with internal density, suggesting that Impβ is effectively swallowed by the capsids, which implies that the capsids transiently open and close and can be destabilized by Impβ. Though the in vitro complexes with great excess of Impβ are not biological, these results have implications for trafficking of empty capsids and free core protein; activities that affect the basis of chronic HBV infection. PMID:27518410

  4. Multi-satellite observations of plasmoids - IMP 8 and ISEE 3

    NASA Technical Reports Server (NTRS)

    Moldwin, Mark B.; Hughes, W. J.

    1992-01-01

    An examination of IMP 8 and ISEE 3 magnetotail data during the 1983 Geotail Mission yielded one plasmoid event which was observed by both satellites and two other possible cases. These are the first multisatellite observations of plasoids. These observations provide a unique opportunity to examine how plasmoid characteristics change as plasmoids propagate downtail and they show that plasmoids are very stable structures.

  5. First report of Klebsiella oxytoca strain coproducing KPC-2 and IMP-8 carbapenemases.

    PubMed

    Li, Bin; Sun, Jing-Yong; Liu, Qing-Zhong; Han, Li-Zhong; Huang, Xin-Hong; Ni, Yu-Xing

    2011-06-01

    The study shows for the first time the presence of the Klebsiella oxytoca strain fp10 coproducing plasmid-mediated KPC-2 and IMP-8 carbapenemases. The strain was obtained from the fecal sample of an inpatient and showed high-level resistance to imipenem and ertapenem (MICs > 32 μg/ml). Conjugation experiments demonstrated the transferability of the carbapenem-resistant determinants. The results of plasmid analysis and Southern hybridization revealed that the bla(KPC-2) gene was located on transferable plasmid pFP10-1 (∼54 kb), whereas the bla(IMP-8) gene was on transferable plasmid pFP10-2 (∼180 kb). Analysis of the genetic environment of these two genes has demonstrated that ISKpn6 and ISKpn8 are involved in the spread of the bla(KPC-2) gene, while the transposable elements IS26, intI1, and tniC might contribute to the dissemination of the bla(IMP-8) gene. The chimera of several transposon-associated elements indicated a novel genetic environment of IMP-type metallo-β-lactamase gene in Enterobacteriaceae from China.

  6. Flexibility in targeting and insertion during bacterial membrane protein biogenesis

    SciTech Connect

    Bloois, Edwin van; Hagen-Jongman, Corinne M. ten; Luirink, Joen

    2007-10-26

    The biogenesis of Escherichia coli inner membrane proteins (IMPs) is assisted by targeting and insertion factors such as the signal recognition particle (SRP), the Sec-translocon and YidC with translocation of (large) periplasmic domains energized by SecA and the proton motive force (pmf). The use of these factors and forces is probably primarily determined by specific structural features of an IMP. To analyze these features we have engineered a set of model IMPs based on endogenous E. coli IMPs known to follow distinct targeting and insertion pathways. The modified model IMPs were analyzed for altered routing using an in vivo protease mapping approach. The data suggest a facultative use of different combinations of factors.

  7. Integral Membrane Protein Expression in Saccharomyces cerevisiae.

    PubMed

    Boswell-Casteel, Rebba C; Johnson, Jennifer M; Stroud, Robert M; Hays, Franklin A

    2016-01-01

    Eukaryotic integral membrane proteins are challenging targets for crystallography or functional characterization in a purified state. Since expression is often a limiting factor when studying this difficult class of biological macromolecules, the intent of this chapter is to focus on the expression of eukaryotic integral membrane proteins (IMPs) using the model organism Saccharomyces cerevisiae. S. cerevisiae is a prime candidate for the expression of eukaryotic IMPs because it offers the convenience of using episomal expression plasmids, selection of positive transformants, posttranslational modifications, and it can properly fold and target IMPs. Here we present a generalized protocol and insights based on our collective knowledge as an aid to overcoming the challenges faced when expressing eukaryotic IMPs in S. cerevisiae.

  8. Immunogenicity and protective efficacy of an Eimeria vaccine candidate based on Eimeria tenella immune mapped protein 1 and chicken CD40 ligand.

    PubMed

    Yin, Guangwen; Lin, Qian; Qiu, Jianhan; Qin, Mei; Tang, Xinming; Suo, Xun; Huang, Zhijian; Liu, Xianyong

    2015-05-30

    The CD40 ligand (CD40L) has shown potential as a powerful immunological adjuvant in various studies. Here, the efficacy of a chimeric subunit vaccine, consisting of Eimeria tenella immune mapped protein 1 (EtIMP1) and chicken CD40L, was evaluated against E. tenella infection. The recombinant EtIMP1-CD40L was purified from E. coli over-expressing this protein. Chickens were vaccinated with EtIMP1-CD40L without adjuvant or EtIMP1 with Freund's adjuvant. Immunization of chickens with EtIMP1-CD40L fusion protein resulted in stronger IFN-γ secretion and IgA response than that with only recombinant EtIMP1 with Freund's adjuvant. The clinical effect (cecal lesions, body weights gain, and oocysts shedding) of the EtIMP1-CD40L without adjuvant was also better than that of the EtIMP1 with adjuvant, as evidenced by the difference between the two groups in the oocyst output of E. tenella-challenged chickens. The results suggest that the EtIMP1-CD40L fusion protein can be used as an effective immunogen in the development of subunit vaccines against Eimeria infection.

  9. An Eimeria vaccine candidate based on Eimeria tenella immune mapped protein 1 and the TLR-5 agonist Salmonella typhimurium FliC flagellin

    SciTech Connect

    Yin, Guangwen; Qin, Mei; Liu, Xianyong; Suo, Jingxia; Tang, Xinming; Tao, Geru; Han, Qian; Suo, Xun; Wu, Wenxue

    2013-10-25

    Highlights: •We found a new protective protein – (IMPI) in Eimeria tenella. •EtIMP1-flagellin fusion protein is an effective immunogen against Eimeria infection. •Flagellin can be as an apicomplexan parasite vaccine adjuvant in chickens. -- Abstract: Immune mapped protein-1 (IMP1) is a new protective protein in apicomplexan parasites, and exits in Eimeria tenella. But its structure and immunogenicity in E. tenella are still unknown. In this study, IMPI in E. tenella was predicted to be a membrane protein. To evaluate immunogenicity of IMPI in E. tenella, a chimeric subunit vaccine consisting of E. tenella IMP1 (EtIMP1) and a molecular adjuvant (a truncated flagellin, FliC) was constructed and over-expressed in Escherichia coli and its efficacy against E. tenella infection was evaluated. Three-week-old AA broiler chickens were vaccinated with the recombinant EtIMP1-truncated FliC without adjuvant or EtIMP1 with Freund’s Complete Adjuvant. Immunization of chickens with the recombinant EtIMP1-truncated FliC fusion protein resulted in stronger cellular immune responses than immunization with only recombinant EtIMP1 with adjuvant. The clinical effect of the EtIMP1-truncated FliC without adjuvant was also greater than that of the EtIMP1 with adjuvant, which was evidenced by the differences between the two groups in body weight gain, oocyst output and caecal lesions of E. tenella-challenged chickens. The results suggested that the EtIMP1-flagellin fusion protein can be used as an effective immunogen in the development of subunit vaccines against Eimeria infection. This is the first demonstration of antigen-specific protective immunity against avian coccidiosis using a recombinant flagellin as an apicomplexan parasite vaccine adjuvant in chickens.

  10. IMP 8 observations of a poleward plasma circulation: Evidence of entry into the plasma mantle?

    NASA Astrophysics Data System (ADS)

    Kolpak, M. A.; Paularena, K. I.; Richardson, J. D.; Siscoe, G. L.

    Plasma data from IMP 8 are used to map the spatial structure of plasma flow in Earth's magnetosheath. Plasma and magnetic field data from instruments on ISEE-3 and WIND are used to normalize the IMP 8 magnetosheath data to upstream solar wind conditions. For the majority of the data, the magnitude and direction of plasma flow inside the magnetosheath agree well with gas-dynamic models. About 8% of the ISEE-3-normalized velocity vectors and 3% of the WIND-normalized velocity vectors exhibit a poleward circulation in the YZ plane. The observed circulation is consistent with predictions for flow within the plasma mantle. The occurrence frequency of these poleward flows increases further down the tail, consistent with predictions that the mantle width increases tailward. Densities are lower where this flow is observed, consistent with expectations for the plasma mantle, but temperatures are higher and the magnetic field magnitudes lower, the opposite of theoretical expectations.

  11. Diagnosis of Alzheimer's disease and multiple infarct dementia by tomographic imaging of iodine-123 IMP

    SciTech Connect

    Cohen, M.B.; Graham, L.S.; Lake, R.; Metter, E.J.; Fitten, J.; Kulkarni, M.K.; Sevrin, R.; Yamada, L.; Chang, C.C.; Woodruff, N.

    1986-06-01

    Tomographic imaging of the brain was performed using a rotating slant hole collimator and (/sup 123/I)N-isopropyl p-iodoamphetamine (IMP) in normal subjects (n = 6) and patients with either Alzheimer's disease (n = 5) or multiple infarct dementia (n = 3). Four blinded observers were asked to make a diagnosis from the images. Normal subjects and patients with multiple infarct dementia were correctly identified. Alzheimer's disease was diagnosed in three of the five patients with this disease. One patient with early Alzheimer's disease was classified as normal by two of the four observers. Another patient with Alzheimer's disease had an asymmetric distribution of IMP and was incorrectly diagnosed as multiple infarct dementia by all four observers. Limited angle tomography of the cerebral distribution of /sup 123/I appears to be a useful technique for the evaluation of demented patients.

  12. Decreased iodine-123 IMP caudate nucleus uptake in patients with Huntington's disease

    SciTech Connect

    Nagel, J.S.; Johnson, K.A.; Ichise, M.; English, R.J.; Walshe, T.M.; Morris, J.H.; Holman, B.L.

    1988-07-01

    To determine whether I-123 isopropyl iodoamphetamine (IMP) uptake is reduced in the basal ganglia of patients with Huntington's disease compared with that in aged-matched normal and abnormal control subjects, a caudate ratio was defined that compared the average separation (in pixel units) between the midline and the left and right caudate heads to the width of the brain as measured on transaxial cross-sections of I-123 IMP SPECT brain images. For six patients with Huntington's disease, the average caudate ratio was 29.0% (SD +/- 2.7%), significantly higher than that for 12 normal volunteer subjects (average caudate ratio, 19.1% +/- 3.5%; p less than 0.001) and 13 patients with a variety of other neurologic disorders (average caudate ratio, 19.3 +/- 2.2%; p less than 0.001).

  13. IMS/Satellite Situation Center report: Predicted orbit plots for IMP-J-1976

    NASA Technical Reports Server (NTRS)

    1975-01-01

    Predicted orbit plots for the IMP-J satellite were given for the time period January-December 1976. These plots are shown in three projections. The time period covered by each set of projections is 12 days and 6 hours, corresponding approximately to the period of IMP-J. The three coordinate systems used are the Geocentric Solar Ecliptic system (GSE), the Geocentric Solar Magnetospheric system (GSM), and the Solar Magnetic system (SM). For each of the three projections, time ticks and codes are given on the satellite trajectories. The codes are interpreted in the table at the base of each plot. Time is given in the table as year/day/decimal hour, and the total time covered by each plot is shown at the bottom of each table.

  14. Differential diagnosis of bilateral parietal abnormalities in I-123 IMP SPECT imaging

    SciTech Connect

    Kuwabara, Y.; Ichiya, Y.; Otsuka, M.; Tahara, T.; Fukumura, T.; Gunasekera, R.; Masuda, K. )

    1990-12-01

    This report discusses the clinical significance of bilateral parietal abnormalities on I-123 IMP SPECT imaging in 158 patients with cerebral disorders. This pattern was seen in 15 out of 21 patients with Alzheimer's disease; it was also seen in 4 out of 5 patients with Parkinson's disease with dementia, in 3 out of 17 patients with vascular dementia, in 1 out of 36 patients with cerebral infarction without dementia, in 1 out of 2 patients with hypoglycemia, and in 1 out of 2 patients with CO intoxication. Detection of bilateral parietal abnormalities is a useful finding in the diagnosis of Alzheimer's disease, but one should keep in mind that other cerebral disorders may also show a similar pattern with I-123 IMP SPECT imaging.

  15. Solar wind plasma periodicities observed at 1 AU by IMP 8

    NASA Technical Reports Server (NTRS)

    Paularena, K. I.; Szabo, A.; Lazarus, A. J.

    1995-01-01

    The IMP 8 spacecraft has been in Earth orbit since 1973, gathering plasma data over one complete 22-year solar cycle. These data are being examined to look for periodicities at time scales ranging from several hours to the entire span of the data set. A 1.3-year periodicity in the radial speed observed by IMP 8 and Voyager 2 has already been reported for the years from 1987 to 1993. The periodogram method, useful for unevenly sampled data such as the IMP 8 plasma data, has been used to search for other periods. It is interesting to note that the 13-year period is not present in the out-of-the-ecliptic component of the velocity (Vz), although a 1-year period is very obvious both visually and on the periodogram. Both components show a very strong peak associated with the 11-year solar cycle variation. This work will be extended to the thermal speed (a measure of the wind's temperature) and density, although the frequent correlations between these parameters and the velocity are expected to cause similar results. Additionally, the fine resolution data will be examined for shorter time periods than are visible using the hourly average data which are appropriate for longer periods. A comparison with periods observed at other spacecraft may also be made.

  16. Template properties of oligocytidylates formed in the montmorillonite catalyzed condensation of ImpC. [Abstract only

    NASA Technical Reports Server (NTRS)

    Ferris, James P.; Ertem, Goezen

    1994-01-01

    In an attempt to investigate the prebiotic formation of phosphodiester bond in RNA, we have studied the self condensation of 5'-phosphorimidazolide of adenosine (ImpA), in aqueous solutions containing 0.2 M sodium chloride and 0.075 M magnesium chloride at pH 8 using clay minerals as catalyst. In the presence of certain montmorillonites, oligomers containing up to ten monomer units in their chain were formed, while in control experiments, where no catalyst was added, the major product was 5',5'-diadenosine diphosphate, A(sup 5')ppA. In reactions carried out with ImpA: A(sup 5')ppA mixtures at 9:1 mole ratio, oligomers of the type A(sup 5')p(pA)(sub n) and (A(sup 5')p)(sub n)A(sup 5')ppA(pA)(sub n) formed at the expense of (pA)(sub n) type oligomers. Addition of A(sup 5')ppA to the reaction mixture increased the regiospecifity of 3',5'-link formation from 67% to 79%. The condensation of the 5'-phosphorimidazolide of cytidine, ImpC, was also carried out in the presence and absence of A(sup 5')ppA under the same conditions and oligomers containing up to twelve monomer units were obtained.

  17. A novel cofactor-binding mode in bacterial IMP dehydrogenases explains inhibitor selectivity

    DOE PAGES

    Makowska-Grzyska, Magdalena; Kim, Youngchang; Maltseva, Natalia; ...

    2015-01-09

    The steadily rising frequency of emerging diseases and antibiotic resistance creates an urgent need for new drugs and targets. Inosine 5'-monophosphate dehydrogenase (IMP dehydrogenase or IMPDH) is a promising target for the development of new antimicrobial agents. IMPDH catalyzes the oxidation of IMP to XMP with the concomitant reduction of NAD+, which is the pivotal step in the biosynthesis of guanine nucleotides. Potent inhibitors of bacterial IMPDHs have been identified that bind in a structurally distinct pocket that is absent in eukaryotic IMPDHs. The physiological role of this pocket was not understood. Here, we report the structures of complexes withmore » different classes of inhibitors of Bacillus anthracis, Campylobacter jejuni, and Clostridium perfringens IMPDHs. These structures in combination with inhibition studies provide important insights into the interactions that modulate selectivity and potency. We also present two structures of the Vibrio cholerae IMPDH in complex with IMP/NAD+ and XMP/NAD+. In both structures, the cofactor assumes a dramatically different conformation than reported previously for eukaryotic IMPDHs and other dehydrogenases, with the major change observed for the position of the NAD+ adenosine moiety. More importantly, this new NAD+-binding site involves the same pocket that is utilized by the inhibitors. Thus, the bacterial IMPDH-specific NAD+-binding mode helps to rationalize the conformation adopted by several classes of prokaryotic IMPDH inhibitors. As a result, these findings offer a potential strategy for further ligand optimization.« less

  18. Portosystemic shunting in portal hypertension: evaluation with portal scintigraphy with transrectally administered I-123 IMP

    SciTech Connect

    Kashiwagi, T.; Azuma, M.; Ikawa, T.; Takehara, T.; Matsuda, H.; Yoshioka, H.; Mitsutani, N.; Koizumi, T.; Kimura, K.

    1988-10-01

    Portosystemic shunting was evaluated with rectal administration of iodine-123 iodoamphetamine (IMP) in seven patients without liver disease and 53 patients with liver cirrhosis. IMP (2-3 mCi (74-111 MBq)) was administered to the rectum through a catheter. Images of the chest and abdomen were obtained for up to 60 minutes with a scintillation camera interfaced with a computer. In all patients, images of the liver and/or lungs were observed within 5-10 minutes and became clear with time. In patients without liver disease, only liver images could be obtained, whereas the lung was visualized with or without the liver in all patients with liver cirrhosis. The portosystemic shunt index was calculated by dividing counts of lungs by counts of liver and lung. These values were significantly higher in liver cirrhosis, especially in the decompensated stage. Transrectal portal scintigraphy with IMP appears to be a useful method for noninvasive and quantitative evaluation of portosystemic shunting in portal hypertension.

  19. A Novel Cofactor-binding Mode in Bacterial IMP Dehydrogenases Explains Inhibitor Selectivity*

    PubMed Central

    Makowska-Grzyska, Magdalena; Kim, Youngchang; Maltseva, Natalia; Osipiuk, Jerzy; Gu, Minyi; Zhang, Minjia; Mandapati, Kavitha; Gollapalli, Deviprasad R.; Gorla, Suresh Kumar; Hedstrom, Lizbeth; Joachimiak, Andrzej

    2015-01-01

    The steadily rising frequency of emerging diseases and antibiotic resistance creates an urgent need for new drugs and targets. Inosine 5′-monophosphate dehydrogenase (IMP dehydrogenase or IMPDH) is a promising target for the development of new antimicrobial agents. IMPDH catalyzes the oxidation of IMP to XMP with the concomitant reduction of NAD+, which is the pivotal step in the biosynthesis of guanine nucleotides. Potent inhibitors of bacterial IMPDHs have been identified that bind in a structurally distinct pocket that is absent in eukaryotic IMPDHs. The physiological role of this pocket was not understood. Here, we report the structures of complexes with different classes of inhibitors of Bacillus anthracis, Campylobacter jejuni, and Clostridium perfringens IMPDHs. These structures in combination with inhibition studies provide important insights into the interactions that modulate selectivity and potency. We also present two structures of the Vibrio cholerae IMPDH in complex with IMP/NAD+ and XMP/NAD+. In both structures, the cofactor assumes a dramatically different conformation than reported previously for eukaryotic IMPDHs and other dehydrogenases, with the major change observed for the position of the NAD+ adenosine moiety. More importantly, this new NAD+-binding site involves the same pocket that is utilized by the inhibitors. Thus, the bacterial IMPDH-specific NAD+-binding mode helps to rationalize the conformation adopted by several classes of prokaryotic IMPDH inhibitors. These findings offer a potential strategy for further ligand optimization. PMID:25572472

  20. Quantitative I-123-IMP brain SPECT and neuropsychological testing in AIDS dementia

    SciTech Connect

    Kuni, C.C.; Rhame, F.S.; Meier, M.J.; Foehse, M.C.; Loewenson, R.B.; Lee, B.C.; Boudreau, R.J.; duCret, R.P. )

    1991-03-01

    We performed I-123-IMP SPECT brain imaging on seven mildly demented AIDS patients and seven normal subjects. In an attempt to detect and quantitate regions of decreased I-123-IMP uptake, pixel intensity histograms of normalized SPECT images at the basal ganglia level were analyzed for the fraction of pixels in the lowest quartile of the intensity range. This fraction (F) averaged 17.5% (S.D. = 4.6) in the AIDS group and 12.6% (S.D. = 5.1) in the normal group (p less than .05). Six of the AIDS patients underwent neuropsychological testing (NPT). NPT showed the patients to have a variety of mild abnormalities. Regression analysis of NPT scores versus F yielded a correlation coefficient of .80 (p less than .05). We conclude that analysis of I-123-IMP SPECT image pixel intensity distribution is potentially sensitive in detecting abnormalities associated with AIDS dementia and may correlate with the severity of dementia as measured by NPT.

  1. Micro-scale NMR Experiments for Monitoring the Optimization of Membrane Protein Solutions for Structural Biology.

    PubMed

    Horst, Reto; Wüthrich, Kurt

    2015-07-20

    Reconstitution of integral membrane proteins (IMP) in aqueous solutions of detergent micelles has been extensively used in structural biology, using either X-ray crystallography or NMR in solution. Further progress could be achieved by establishing a rational basis for the selection of detergent and buffer conditions, since the stringent bottleneck that slows down the structural biology of IMPs is the preparation of diffracting crystals or concentrated solutions of stable isotope labeled IMPs. Here, we describe procedures to monitor the quality of aqueous solutions of [(2)H, (15)N]-labeled IMPs reconstituted in detergent micelles. This approach has been developed for studies of β-barrel IMPs, where it was successfully applied for numerous NMR structure determinations, and it has also been adapted for use with α-helical IMPs, in particular GPCRs, in guiding crystallization trials and optimizing samples for NMR studies (Horst et al., 2013). 2D [(15)N, (1)H]-correlation maps are used as "fingerprints" to assess the foldedness of the IMP in solution. For promising samples, these "inexpensive" data are then supplemented with measurements of the translational and rotational diffusion coefficients, which give information on the shape and size of the IMP/detergent mixed micelles. Using microcoil equipment for these NMR experiments enables data collection with only micrograms of protein and detergent. This makes serial screens of variable solution conditions viable, enabling the optimization of parameters such as the detergent concentration, sample temperature, pH and the composition of the buffer.

  2. Micro-scale NMR Experiments for Monitoring the Optimization of Membrane Protein Solutions for Structural Biology

    PubMed Central

    Horst, Reto; Wüthrich, Kurt

    2016-01-01

    Reconstitution of integral membrane proteins (IMP) in aqueous solutions of detergent micelles has been extensively used in structural biology, using either X-ray crystallography or NMR in solution. Further progress could be achieved by establishing a rational basis for the selection of detergent and buffer conditions, since the stringent bottleneck that slows down the structural biology of IMPs is the preparation of diffracting crystals or concentrated solutions of stable isotope labeled IMPs. Here, we describe procedures to monitor the quality of aqueous solutions of [2H, 15N]-labeled IMPs reconstituted in detergent micelles. This approach has been developed for studies of β-barrel IMPs, where it was successfully applied for numerous NMR structure determinations, and it has also been adapted for use with α-helical IMPs, in particular GPCRs, in guiding crystallization trials and optimizing samples for NMR studies (Horst et al., 2013). 2D [15N, 1H]-correlation maps are used as “fingerprints” to assess the foldedness of the IMP in solution. For promising samples, these “inexpensive” data are then supplemented with measurements of the translational and rotational diffusion coefficients, which give information on the shape and size of the IMP/detergent mixed micelles. Using microcoil equipment for these NMR experiments enables data collection with only micrograms of protein and detergent. This makes serial screens of variable solution conditions viable, enabling the optimization of parameters such as the detergent concentration, sample temperature, pH and the composition of the buffer. PMID:27077076

  3. A novel cofactor-binding mode in bacterial IMP dehydrogenases explains inhibitor selectivity

    SciTech Connect

    Makowska-Grzyska, Magdalena; Kim, Youngchang; Maltseva, Natalia; Osipiuk, Jerzy; Gu, Minyi; Zhang, Minjia; Mandapati, Kavitha; Gollapalli, Deviprasad R.; Gorla, Suresh Kumar; Hedstrom, Lizbeth; Joachimiak, Andrzej

    2015-01-09

    The steadily rising frequency of emerging diseases and antibiotic resistance creates an urgent need for new drugs and targets. Inosine 5'-monophosphate dehydrogenase (IMP dehydrogenase or IMPDH) is a promising target for the development of new antimicrobial agents. IMPDH catalyzes the oxidation of IMP to XMP with the concomitant reduction of NAD+, which is the pivotal step in the biosynthesis of guanine nucleotides. Potent inhibitors of bacterial IMPDHs have been identified that bind in a structurally distinct pocket that is absent in eukaryotic IMPDHs. The physiological role of this pocket was not understood. Here, we report the structures of complexes with different classes of inhibitors of Bacillus anthracis, Campylobacter jejuni, and Clostridium perfringens IMPDHs. These structures in combination with inhibition studies provide important insights into the interactions that modulate selectivity and potency. We also present two structures of the Vibrio cholerae IMPDH in complex with IMP/NAD+ and XMP/NAD+. In both structures, the cofactor assumes a dramatically different conformation than reported previously for eukaryotic IMPDHs and other dehydrogenases, with the major change observed for the position of the NAD+ adenosine moiety. More importantly, this new NAD+-binding site involves the same pocket that is utilized by the inhibitors. Thus, the bacterial IMPDH-specific NAD+-binding mode helps to rationalize the conformation adopted by several classes of prokaryotic IMPDH inhibitors. As a result, these findings offer a potential strategy for further ligand optimization.

  4. Genetic polymorphisms of the AMPD1 gene and their correlations with IMP contents in Fast Partridge and Lingshan chickens.

    PubMed

    Hu, Jin; Yu, Ping; Ding, Xiaoling; Xu, Minglong; Guo, Baoping; Xu, Yinxue

    2015-12-15

    The object of this study was to evaluate associations between the adenosine monophosphate deaminase 1 (AMPD1) gene polymorphisms and inosine monophosphate acid (IMP) contents of chicken to provide a molecular marker for breeding. Three single nucleotide polymorphisms (SNPs), g.4064G/A, g.5573A/G and g.6805G/A were detected in exons IV, VI, and VIII of the AMPD1 gene in Fast Partridge and Lingshan chickens, respectively. All were purine conversion and caused no alteration in amino acid sequence. Statistical analysis revealed that Lingshan chicken with the homozygous genotype AA at position 4064 and 6805 had a significantly greater IMP content than those with the GG genotype (P<0.05). Fast Partridge chicken with the genotype GG at position 6805 had a significantly greater IMP content compared with those with the AA genotype (P<0.05). In conclusion, the polymorphism at g.6805A/G was correlated with IMP content (P<0.05) in both Fast Partridge and Lingshan chickens. The results in our study suggest that SNP 6805A/G can be used as a possible candidate marker of IMP content of chicken.

  5. Characterization of a novel Klebsiella pneumoniae sequence type 476 carrying both bla KPC-2 and bla IMP-4.

    PubMed

    Wang, Y; Cao, W; Zhu, X; Chen, Z; Li, L; Zhang, B; Wang, B; Tian, L; Wang, F; Liu, C; Sun, Z

    2012-08-01

    Carbapenemase-producing Klebsiella pneumoniae has recently spread rapidly throughout China. In this study, we characterized a carbapenem-resistant K. pneumoniae isolate that produced both KPC-2 and IMP-4 type carbapenemases. A clinical isolate of K. pneumoniae, resistant to both meropenem and imipenem, was recovered from a urine sample. Antibiotic susceptibility was determined using the broth microdilution method and Etest (bioMérieux, France). Pulsed-field gel electrophoresis and multilocus sequence typing (MLST) were used for gene type analysis. bla (KPC) and the encoding genes of ESBLs and plasmid-mediated AmpC enzymes were polymerase chain reaction (PCR) amplified and sequenced. Plasmids were analyzed by transformation, enzyme restriction and Southern blot. PCR analysis revealed that the isolate was simultaneously carrying bla (KPC-2), bla (IMP-4), bla (TEM-1), and bla (OKP-B) genes. MLST assigned the isolate to a novel sequence type, ST476. bla (KPC-2)-harbouring plasmids of the isolate and comparative strains had similar EcoRI and HindIII restriction maps, while IMP-4-harbouring plasmids had variable HindIII restriction maps. Coexistence of bla (KPC-2) and bla (IMP-4) was probably due to bla (IMP-4)-harbouring plasmid transmission into KPC-2-producing K. pneumoniae (ST476). The concomitant presence of these genes is alarming and poses both therapeutic and infection control problems.

  6. An Eimeria vaccine candidate based on Eimeria tenella immune mapped protein 1 and the TLR-5 agonist Salmonella typhimurium FliC flagellin.

    PubMed

    Yin, Guangwen; Qin, Mei; Liu, Xianyong; Suo, Jingxia; Tang, Xinming; Tao, Geru; Han, Qian; Suo, Xun; Wu, Wenxue

    2013-10-25

    Immune mapped protein-1 (IMP1) is a new protective protein in apicomplexan parasites, and exits in Eimeria tenella. But its structure and immunogenicity in E. tenella are still unknown. In this study, IMPI in E. tenella was predicted to be a membrane protein. To evaluate immunogenicity of IMPI in E. tenella, a chimeric subunit vaccine consisting of E. tenella IMP1 (EtIMP1) and a molecular adjuvant (a truncated flagellin, FliC) was constructed and over-expressed in Escherichia coli and its efficacy against E. tenella infection was evaluated. Three-week-old AA broiler chickens were vaccinated with the recombinant EtIMP1-truncated FliC without adjuvant or EtIMP1 with Freund's Complete Adjuvant. Immunization of chickens with the recombinant EtIMP1-truncated FliC fusion protein resulted in stronger cellular immune responses than immunization with only recombinant EtIMP1 with adjuvant. The clinical effect of the EtIMP1-truncated FliC without adjuvant was also greater than that of the EtIMP1 with adjuvant, which was evidenced by the differences between the two groups in body weight gain, oocyst output and caecal lesions of E. tenella-challenged chickens. The results suggested that the EtIMP1-flagellin fusion protein can be used as an effective immunogen in the development of subunit vaccines against Eimeria infection. This is the first demonstration of antigen-specific protective immunity against avian coccidiosis using a recombinant flagellin as an apicomplexan parasite vaccine adjuvant in chickens.

  7. Investigation of VIM, IMP, NDM-1, KPC AND OXA-48 enzymes in Enterobacteriaceae strains.

    PubMed

    Demir, Yelda; Zer, Yasemin; Karaoglan, Ilkay

    2015-05-01

    Gram-negative bacteria especially Enterobacteriaceae species have become an increasing etiologic agent of nosocomial infections. The development of resistance to carbapenems have become an increasing problem in the treatment of nosocomial infections. Especially carbapenamases are common for Enterobacteriaceae strains. This study was performed to detect the types of carbapenemases in Enterobacteriaceae strains isolated from various clinical samples. Enterobacteriaceae species were isolated from urine, blood, tracheal aspirates, wound, and other respiratory samples. Susceptibility of isolates to imipenem, meropenem and ertapenem was tested. Carbapenemase genes were studied using HyplexSuperBug ID kit. VIM (1-13), IMP (1-22), NDM-1, KPC(1-10) and OXA-48 genes were investigated. Ninety-five isolates of Enterobacteriaceae spp. were included in the study. Sixty isolates were resistant to imipenem, meropenem and ertapenem and 20 isolates were found resistant to imipenem or ertapenem while 15 were susceptible to all carbapenems. Among the isolates with carbapenem resistance, 57 were positive for one carbapenemase gene and susceptible isolates did not have carbapenemase gene. OXA-48 was found in 49 of the isolates (86%), NDM-1 in 6 (10.5%) isolates, VIM in 2 isolates. IMP and KPC gene loci were not identified. Carbapenemase genes play a crucial role in the development and spread of resistant strains.

  8. Regional cerebral blood flow study with 123I-IMP in patients with degenerative dementia

    SciTech Connect

    Ohnishi, T.; Hoshi, H.; Nagamachi, S.; Jinnouchi, S.; Futami, S.; Watanabe, K.; Mitsuyama, Y. )

    1991-05-01

    Regional cerebral blood flow was evaluated by single-photon emission CT (SPECT) with 123I-N-isopropyl-p-iodoamphetamine (123I-IMP) in 11 patients with dementia of the Alzheimer type, three patients with progressive dementia and motor neuron disease, and eight healthy control subjects. Regional blood flow measurements in the bilateral frontal, parietal association, and temporal cortices were lower in the Alzheimer dementia patients than in controls. Flow deficits in the parietal association cortex were demonstrated in all patients with Alzheimer-type dementia; these deficits were correlated with the severity of disease. Lateral hemispheric asymmetry was seen in nine of 11 patients with Alzheimer-type dementia. In all three patients with progressive dementia and motor neuron disease, flow deficits were demonstrated in the bilateral frontal and temporal cortices, but no flow deficits were seen in the parietal association cortex. Brain SPECT with 123I-IMP may be useful in the differential diagnosis and evaluation of the severity of degenerative dementia.

  9. Inverse mirror plasma experimental device (IMPED) - a magnetized linear plasma device for wave studies

    NASA Astrophysics Data System (ADS)

    Bose, Sayak; Chattopadhyay, P. K.; Ghosh, J.; Sengupta, S.; Saxena, Y. C.; Pal, R.

    2015-04-01

    In a quasineutral plasma, electrons undergo collective oscillations, known as plasma oscillations, when perturbed locally. The oscillations propagate due to finite temperature effects. However, the wave can lose the phase coherence between constituting oscillators in an inhomogeneous plasma (phase mixing) because of the dependence of plasma oscillation frequency on plasma density. The longitudinal electric field associated with the wave may be used to accelerate electrons to high energies by exciting large amplitude wave. However when the maximum amplitude of the wave is reached that plasma can sustain, the wave breaks. The phenomena of wave breaking and phase mixing have applications in plasma heating and particle acceleration. For detailed experimental investigation of these phenomena a new device, inverse mirror plasma experimental device (IMPED), has been designed and fabricated. The detailed considerations taken before designing the device, so that different aspects of these phenomena can be studied in a controlled manner, are described. Specifications of different components of the IMPED machine and their flexibility aspects in upgrading, if necessary, are discussed. Initial results meeting the prerequisite condition of the plasma for such study, such as a quiescent, collisionless and uniform plasma, are presented. The machine produces δnnoise/n <= 1%, Luniform ~ 120 cm at argon filling pressure of ~10-4 mbar and axial magnetic field of B = 1090 G.

  10. IMP-1 encoded by a novel Tn402-like class 1 integron in clinical Achromobacter xylosoxidans, China

    PubMed Central

    Chen, Zhenhong; Fang, Haihong; Wang, Li; Sun, Fengjun; Wang, Yong; Yin, Zhe; Yang, Huiying; Yang, Wenhui; Wang, Jie; Xia, Peiyuan; Zhou, Dongsheng; Liu, Changting

    2014-01-01

    Achromobacter xylosoxidans strain A22732 is isolated from a pneumonia patient in China and produces carbapenemases OXA-114e and IMP-1, which are encoded by chromosome and plasmid, respectively, and confer resistance to multiple ß-lactam antibiotics including carbapenems. The blaIMP-1 gene together with aacA7 and orfE is captured by a novel Tn402-like class 1 integron in a conjugative IncP-1ß plasmid. In addition to the intrinsic integron promoter PcW, there is still a blaIMP-1 gene cassette-specific promoter. This is the first report of carbapenemase-encoding IncP-1ß plasmid in clinical bacterial isolate. PMID:25428613

  11. Lessons Learned from the Design, Certification, and Operation of the Space Shuttle Integrated Main Propulsion System (IMPS)

    NASA Technical Reports Server (NTRS)

    Martinez, Hugo E.; Albright, John D.; D'Amico, Stephen J.; Brewer, John M.; Melcher, John C., IV

    2011-01-01

    The Space Shuttle Integrated Main Propulsion System (IMPS) consists of the External Tank (ET), Orbiter Main Propulsion System (MPS), and Space Shuttle Main Engines (SSMEs). The IMPS is tasked with the storage, conditioning, distribution, and combustion of cryogenic liquid hydrogen (LH2) and liquid oxygen (LO2) propellants to provide first and second stage thrust for achieving orbital velocity. The design, certification, and operation of the associated IMPS hardware have produced many lessons learned over the course of the Space Shuttle Program (SSP). A subset of these items will be discussed in this paper for consideration when designing, building, and operating future spacecraft propulsion systems. This paper will focus on lessons learned related to Orbiter MPS and is the first of a planned series to address the subject matter.

  12. Evaporation level of the condensate droplets on a shock wave in the IMP PAN nozzle depending on the inlet conditions

    NASA Astrophysics Data System (ADS)

    Kornet, S.; Badur, J.

    2016-10-01

    In the present paper we have focused on the phenomena of condensate reevaporation in the shock wave zone. Having observed the finishing of a foggy flow within the shock wave, according to Puzyrewski's observations, we would like to analyse the critical inlet conditions which cause total evaporation of condensate droplets on the shock in the IMP PAN nozzle. In the paper some original mechanistic model of droplet evaporation is involved, numerically implemented and compared with the IMP PAN experiment. The single continuum model of wet steam with a special microstructure growing up during phase transitions was validated on IMP PAN experiment performed for inlet conditions close to the saturation line. The present work includes simulations results of total and partial evaporation liquid phase on the shock wave for different boundary conditions.

  13. Molecular and Epidemiological Characterization of IMP-Type Metallo-β-Lactamase-Producing Enterobacter cloacae in a Large Tertiary Care Hospital in Japan

    PubMed Central

    Miyoshi-Akiyama, Tohru; Kirikae, Teruo; Nagamatsu, Maki; Shimada, Kayo; Mezaki, Kazuhisa; Sugiki, Yuko; Kuroda, Emi; Kubota, Shiho; Takeshita, Nozomi; Kutsuna, Satoshi; Tojo, Masayoshi; Ohmagari, Norio

    2014-01-01

    IMP-type metallo-β-lactamase enzymes have been reported in different geographical areas and in various Gram-negative bacteria. However, the risk factors and epidemiology pertaining to IMP-type metallo-β-lactamase-producing Enterobacter cloacae (IMP-producing E. cloacae) have not been systematically evaluated. We conducted a retrospective, matched case-control study of patients from whom IMP-producing E. cloacae isolates were obtained, in addition to performing thorough molecular analyses of the clinically obtained IMP-producing E. cloacae isolates. Unique cases with IMP-producing E. cloacae isolation were included. Patients with IMP-producing E. cloacae were matched to uninfected controls at a ratio of 1 to 3. Fifteen IMP-producing E. cloacae cases were identified, with five of the isolates being obtained from blood, and they were matched to 45 uninfected controls. All (100%) patients from whom IMP-producing E. cloacae isolates were obtained had indwelling devices at the time of isolation, compared with one (2.2%) uninfected control. Independent predictors for isolation of IMP-producing E. cloacae were identified as cephalosporin exposure and invasive procedures within 3 months. Although in-hospital mortality rates were similar between cases and controls (14.3% versus 13.3%), the in-hospital mortality of patients with IMP-producing E. cloacae-caused bacteremia was significantly higher (40%) than the rate in controls. IMP-producing E. cloacae isolates were frequently positive for other resistance determinants. The MICs of meropenem and imipenem were not elevated; 10 (67%) and 12 (80%) of the 15 IMP-producing E. cloacae isolates had a MIC of ≤1 μg/ml. A phylogenetic tree showed a close relationship among the IMP-producing E. cloacae samples. Indwelling devices, exposure to cephalosporin, and a history of invasive procedures were associated with isolation of IMP-producing E. cloacae. Screening for carbapenemase production is important in order to apply

  14. Coproduction of KPC-2 and IMP-10 in Carbapenem-Resistant Serratia marcescens Isolates from an Outbreak in a Brazilian Teaching Hospital

    PubMed Central

    Silva, Kesia Esther; Cayô, Rodrigo; Carvalhaes, Cecilia Godoy; Patussi Correia Sacchi, Flávia; Rodrigues-Costa, Fernanda; Ramos da Silva, Ana Carolina; Croda, Julio; Gales, Ana Cristina

    2015-01-01

    We describe an outbreak caused by KPC-2- and IMP-10-producing Serratia marcescens isolates in a Brazilian teaching hospital. Tigecycline was the only active antimicrobial agent tested. The blaIMP-10 gene was located in a new class 1 integron, named In990, carried by a nonconjugative plasmid, in contrast to blaKPC-2. PMID:25878341

  15. Development of an immunochromatographic assay for diagnosing the production of IMP-type metallo-β-lactamases that mediate carbapenem resistance in Pseudomonas.

    PubMed

    Kitao, Tomoe; Miyoshi-Akiyama, Tohru; Tanaka, Masashi; Narahara, Kenji; Shimojima, Masahiro; Kirikae, Teruo

    2011-12-01

    Rapid and reliable detection of carbapenem-resistant bacteria is an important infection-control measure and a crucial aspect of antimicrobial chemotherapy. IMP-type metallo-β-lactamase (MBL) is an emzyme that mediate carbapenem resistance in bacteria. Here, an immunochromatographic assay was newly developed using novel monoclonal antibodies (mAbs) recognizing IMP-type MBL. Epitope mapping of mAbs and mutational analysis of the epitope region in IMP antigen suggested that the mAbs could react to all known subtypes of IMP-type MBL. Evaluation of the assay using Pseudomonas aeruginosa strains (n=248) showed that the results of the immunochromatographic detection of the IMP-type MBLs were fully consistent with those of the PCR analysis for bla(IMP) genes, showing false positives and negatives. All positive strains were resistant to carbapenem (MIC ≥ 16 μg/ml). The assay also accurately distinguished the production of IMP-type MBLs in Pseudomonas putida, Acinetobacter baumannii, and Alcaligenes xylosoxidans. The detection limit of the assay was 5.7×10(4)cfu per test. Taken together, these data suggest that the developed assay can be used for rapid and reliable diagnosis of the production of IMP-type MBLs in Gram-negative bacteria.

  16. The Twin Peaks in 3-D, as Viewed by the Mars Pathfinder IMP Camera

    NASA Technical Reports Server (NTRS)

    1997-01-01

    The Twin Peaks are modest-size hills to the southwest of the Mars Pathfinder landing site. They were discovered on the first panoramas taken by the IMP camera on the 4th of July, 1997, and subsequently identified in Viking Orbiter images taken over 20 years ago. The peaks are approximately 30-35 meters (-100 feet) tall. North Twin is approximately 860 meters (2800 feet) from the lander, and South Twin is about a kilometer away (3300 feet). The scene includes bouldery ridges and swales or 'hummocks' of flood debris that range from a few tens of meters away from the lander to the distance of the South Twin Peak. The large rock at the right edge of the scene is nicknamed 'Hippo'. This rock is about a meter (3 feet) across and 25 meters (80 feet) distant.

    This view of the Twin Peaks was produced by combining 4 individual 'Superpan' scenes from the left and right eyes of the IMP camera to cover both peaks. Each frame consists of 8 individual frames (left eye) and 7 frames (right eye) taken with different color filters that were enlarged by 500% and then co-added using Adobe Photoshop to produce, in effect, a super-resolution pancromatic frame that is sharper than an individual frame would be.

    The anaglyph view of the Twin Peaks was produced by combining the left and right eye mosaics (above) by assigning the left eye view to the red color plane and the right eye view to the green and blue color planes (cyan), to produce a stereo anaglyph mosaic. This mosaic can be viewed in 3-D on your computer monitor or in color print form by wearing red-blue 3-D glasses.

    Mars Pathfinder is the second in NASA's Discovery program of low-cost spacecraft with highly focused science goals. The Jet Propulsion Laboratory, Pasadena, CA, developed and manages the Mars Pathfinder mission for NASA's Office of Space Science, Washington, D.C. JPL is a division of the California Institute of Technology (Caltech). The IMP was developed by the University of Arizona Lunar and Planetary

  17. First detection in Europe of the metallo-β-lactamase IMP-15 in clinical strains of Pseudomonas putida and Pseudomonas aeruginosa.

    PubMed

    Gilarranz, R; Juan, C; Castillo-Vera, J; Chamizo, F J; Artiles, F; Álamo, I; Oliver, A

    2013-09-01

    In a prospective study (2009-2011) in healthcare institutions from the Canary Islands (Spain), 6 out of 298 carbapenem non-susceptible Pseudomonas aeruginosa isolates produced a metallo-β-lactamase: four IMP-15, two VIM-2 (including one IMP-15-positive isolate) and one VIM-1. Multilocus sequence typing identified the single VIM-1-producing isolate as clone ST111 and two IMP-15-producing isolates as ST606, but, strikingly, bacterial re-identification revealed that the other three isolates (producing IMP-15 and/or VIM-2) were actually Pseudomonas putida. Further retrospective analysis revealed a very high prevalence (close to 50%) of carbapenem resistance in this environmental species. Hence, we report the simultaneous emergence in hospitals on the Canary Islands of P. putida and P. aeruginosa strains producing IMP-15, a metallo-β-lactamase not previously detected in Europe, and suggest an underestimated role of P. putida as a nosocomial reservoir of worrying transferable resistance determinants.

  18. Brain imaging with sup 123 I-IMP-SPECT in migraine between attacks

    SciTech Connect

    Schlake, H.P.; Boettger, I.G.G.; Grotemeyer, K.H.; Husstedt, I.W.

    1989-06-01

    {sup 123}I-IMP-SPECT brain imaging was performed in patients with classic migraine (n = 5) and migraine accompagnee (n = 18) during the headache-free interval. A regional reduction of tracer uptake into brain was observed in all patients with migraine accompagnee, while in patients with classic migraine only one case showed an area of decreased activity. The most marked alteration was found in a patient with persisting neurological symptoms (complicated migraine). In most cases the areas of decreased tracer uptake corresponded to headache localization as well as to topography of neurologic symptoms during migraine attacks. It may be concluded that migraine attacks occur in connection with exacerbations of preexisting changes of cerebral autoregulation due to endogenous or exogenous factors.

  19. Solar bus regulator and battery charger for IMP's H, I, and J

    NASA Technical Reports Server (NTRS)

    Paulkovich, J.

    1972-01-01

    Interplanetary Monitoring Probe (IMP) spacecrafts H, I, and J utilize a direct energy transfer (DET) type of power system operating from a solar array source. A shunt type of regulator prevents the bus voltage from exceeding a preset voltage level. The power system utilizes a single differential amplifier with dual outputs to control the battery charge/shunt regulator and the discharge regulator. A two-voltage level, current limited, series charger and a current sensor control battery state of charge of the silver-cadmium battery pack. Premature termination of the battery charge is prevented by a power available gate that also initiates charge current to the battery upon availability of excess power.

  20. Determination of the Ionic Charge States of SEPs Using the University of Chicago IMP-8 Instrument

    NASA Astrophysics Data System (ADS)

    Dietrich, W.

    We use a new method to calculate the mean ionization charge state of solar energetic particles (SEPs) observed with the University of Chicago Cosmic Ray Nuclear Composition experiment on the IMP-8 satellite. The method, using the time to maximum flux, is demonstrated for several gradual SEP events, including the events on 29 September 1989, 19 October 1989, 24 October 1989, and 6 November 1997. Mean ionic charge states are deduced for heavy ions with energies in the range ~10- 500 MeV/nucleon. The ionic charge determination is made only during the onset of the SEP events. These mean charge states agree well with previous measurements for SEP events both at low energy (~0.5-4 MeV/nucleon reported by ISEE-3) and at higher energies (~200-500 MeV/nucleon reported by LDEF). The mean ionic charge states are then used to determine an average temperature and source region for these particles.

  1. Formulation procedures, rationale, and preliminary IMP-H flight data for silicone paints with improved stability

    NASA Technical Reports Server (NTRS)

    Schutt, J. B.; Shai, C. M.

    1973-01-01

    Results are given of a class of silicone paints undergoing space qualification on IMP-H. In addition to ultraviolet irradiation, samples are presently reclining about 10 to the 16th power solar wind protons per year. Preliminary data, covering the time span of the first anniversary, give incremental solar absorptances of 0.03 for two white paints, and 0.01 for leafing aluminum and a green tinted white paint. Complementing these data are complete descriptions of techniques used in making these paints, stabilizing the zinc oxide pigment, and choosing a solvent. Outgassing characteristics of finished coatings are also included. An attempt toward unification of these various aspects of the aerospace paint problem is provided through documented photochemical reactions, and a generalized band representation of the problem and its solutions.

  2. High prevalence of Salmonella and IMP-4-producing Enterobacteriaceae in the silver gull on Five Islands, Australia

    PubMed Central

    Dolejska, Monika; Masarikova, Martina; Dobiasova, Hana; Jamborova, Ivana; Karpiskova, Renata; Havlicek, Martin; Carlile, Nicholas; Priddel, David; Cizek, Alois; Literak, Ivan

    2016-01-01

    Objectives The objective of this study was to investigate the silver gull as an indicator of environmental contamination by salmonellae and carbapenemase-producing Enterobacteriaceae (CPE) in south-east Australia. Methods A total of 504 cloacal samples were collected from gull chicks at three nesting colonies in New South Wales, Australia [White Bay (n = 144), Five Islands (n = 200) and Montague Island (n = 160)] and were examined for salmonellae and CPE. Isolates were tested for carbapenemase genes and susceptibility to 14 antibiotics. Clonality was determined by PFGE and MLST. Genetic context and conjugative transfer of the carbapenemase gene were determined. Results A total of 120 CPE of 10 species, mainly Escherichia coli (n = 85), carrying the gene blaIMP-4, blaIMP-38 or blaIMP-26 were obtained from 80 (40%) gulls from Five Islands. Thirty percent of birds from this colony were colonized by salmonellae. Most isolates contained the gene within a class 1 integron showing a blaIMP-4-qacG-aacA4-catB3 array. The blaIMP gene was carried by conjugative plasmids of variable sizes (80–400 kb) and diverse replicons, including HI2-N (n = 30), HI2 (11), A/C (17), A/C-Y (2), L/M (5), I1 (1) and non-typeable (6). Despite the overall high genetic variability, common clones and plasmid types were shared by different birds and bacterial isolates, respectively. Conclusions Our data demonstrate a large-scale transmission of carbapenemase-producing bacteria into wildlife, likely as a result of the feeding habits of the birds at a local waste depot. The isolates from gulls showed significant similarities with clinical isolates from Australia, suggesting the human origin of the isolates. The sources of CPE for gulls on Five Islands should be explored and proper measures applied to stop the transmission into the environment. PMID:26472769

  3. Overexpression of an outer membrane protein associated with decreased susceptibility to carbapenems in Proteus mirabilis.

    PubMed

    Tsai, Yi-Lin; Wang, Min-Cheng; Hsueh, Po-Ren; Liu, Ming-Che; Hu, Rouh-Mei; Wu, Yue-Jin; Liaw, Shwu-Jen

    2015-01-01

    Proteus mirabilis isolates commonly have decreased susceptibility to imipenem. Previously, we found P. mirabilis hfq mutant was more resistant to imipenem and an outer membrane protein (OMP) could be involved. Therefore, we investigated the role of this OMP in carbapenem susceptibility. By SDS-PAGE we found this OMP (named ImpR) was increased in hfq mutant and LC-MS/MS revealed it to be the homologue of Salmonella YbfM, which is a porin for chitobiose and subject to MicM (a small RNA) regulation. We demonstrated that ImpR overexpression resulted in increased carbapenem MICs in the laboratory strain and clinical isolates. Chitobiose induced expression of chb (a chitobiose utilization operon). Real-time RT-PCR and SDS-PAGE were performed to elucidate the relationship of hfq, impR, chb and MicM in P. mirabilis. We found MicM RNA was decreased in hfq mutant and chbBC-intergenic region (chbBC-IGR) overexpression strain (chbIGRov), while impR mRNA was increased in hfq mutant, micM mutant and chbIGRov strain. In addition, mutation of hfq or micM and overexpression of chbBC-IGR increased ImpR protein level. Accordingly, chitobiose made wild-type have higher levels of ImpR protein and are more resistant to carbapenems. Hfq- and MicM-complemented strains restored wild-type MICs. Mutation of both impR and hfq eliminated the increase in carbapenem MICs observed in hfq mutant and ImpR-complementation of hfq/impR double mutant resulted in MICs as hfq mutant, indicating that the ImpR-dependent decreased carbapenem susceptibility of hfq mutant. These indicate MicM was antisense to impR mRNA and was negatively-regulated by chbBC-IGR. Together, overexpression of ImpR contributed to the decreased carbapenem susceptibility in P. mirabilis.

  4. The novel anthraquinone derivative IMP1338 induces death of human cancer cells by p53-independent S and G2/M cell cycle arrest.

    PubMed

    Choi, Hyun Kyung; Ryu, Hwani; Son, A-Rang; Seo, Bitna; Hwang, Sang-Gu; Song, Jie-Young; Ahn, Jiyeon

    2016-04-01

    To identify novel small molecules that induce selective cancer cell death, we screened a chemical library containing 1040 compounds in HT29 colon cancer and CCD18-Co normal colon cells, using a phenotypic cell-based viability assay system with the Cell Counting Kit-8 (CCK-8). We discovered a novel anthraquinone derivative, N-(4-[{(9,10-dioxo-9,10-dihydro-1-anthracenyl)sulfonyl}amino]phenyl)-N-methylacetamide (IMP1338), which was cytotoxic against the human colon cancer cells tested. The MTT cell viability assay showed that treatment with IMP1338 selectively inhibited HCT116, HCT116 p53(-/-), HT29, and A549 cancer cell proliferation compared to that of Beas2B normal epithelial cells. To elucidate the cellular mechanism underlying the cytotoxicity of IMP1338, we examined the effect of IMP1338 on the cell cycle distribution and death of cancer cells. IMP1338 treatment significantly arrested the cell cycle at S and G2/M phases by DNA damage and led to apoptotic cell death, which was determined using FACS analysis with Annexin V/PI double staining. Furthermore, IMP1338 increased caspase-3 cleavage in wild-type p53, p53 knockout HCT116, and HT29 cells as determined using immunoblotting. In addition, IMP1338 markedly induced the phosphorylation of histone H2AX and Chk1 in both cell lines while the combination of 5-fluorouracil (5-FU) and radiation inhibited the viability of HCT116, HCT116 p53(-/-), and HT29 cells compared to 5-FU or radiation alone. Our findings indicated that IMP1338 induced p53-independent cell death through S and G2/M phase arrest as well as DNA damage. These results provide a basis for future investigations assessing the promising anticancer properties of IMP1338.

  5. First Report of blaIMP-14 on a Plasmid Harboring Multiple Drug Resistance Genes in Escherichia coli Sequence Type 131

    PubMed Central

    Sheppard, Anna E.; Peirano, Gisele; Sebra, Robert P.; Lynch, Tarah; Anson, Luke W.; Kasarskis, Andrew; Motyl, Mary R.; Crook, Derrick W.; Pitout, Johann D.

    2016-01-01

    The blaIMP-14 carbapenem resistance gene has largely previously been observed in Pseudomonas aeruginosa and Acinetobacter spp. As part of global surveillance and sequencing of carbapenem-resistant Escherichia coli, we identified a sequence type 131 strain harboring blaIMP-14 within a class 1 integron, itself nested within an ∼54-kb multidrug resistance region on an epidemic IncA/C2 plasmid. The emergence of blaIMP-14 in this context in the ST131 lineage is of potential clinical concern. PMID:27246777

  6. Two Novel Class I Integron Arrays Containing IMP-18 Metallo-β-Lactamase Gene in Pseudomonas aeruginosa Clinical Isolates from Puerto Rico

    PubMed Central

    Martínez, T.; Vazquez, G. J.; Aquino, E. E.; Goering, R. V.

    2012-01-01

    During a β-lactam resistance surveillance study, 12 IMP-18-positive Pseudomonas aeruginosa isolates belonging to 9 different pulsed-field gel electrophoresis groups were identified. In nine isolates, a class I integron with a novel gene array was identified that contained blaIMP-18 and blaOXA-224, while in two isolates the class I integron contained blaIMP-18 and blaOXA-2 but in a new arrangement. Our findings show the dissemination of two novel class I integrons in P. aeruginosa from different regions of Puerto Rico. PMID:22290962

  7. IMP-8 observations of traveling compression regions - New evidence for near-earth plasmoids and neutral lines

    NASA Technical Reports Server (NTRS)

    Slavin, J. A.; Lepping, R. P.; Baker, D. N.

    1990-01-01

    An examination of IMP-8 tail lobe magnetic field measurements has been conducted to determine whether the traveling compression region (TCR) phenomena detected by ISEE-3 in the distant geotail, and believed to be caused by tailward moving plasmoids, are present closer to the earth. The study produced 16 examples of TCRs at distances of X = -31 to -37 R(E). For two events considered in detail, TCRs were observed in close association with substorm growth phase signatures in the lobes. The lengths of these TCRs are estimated to be 8-12 R(E). The conclusion is that the IMP-8 TCR observations provide new evidence that small plasmoids and, hence, multiple reconnection neutral lines can sometimes exist earthward of X = -35 R(E).

  8. Regulation of IMP dehydrogenase gene expression by its end products, guanine nucleotides.

    PubMed Central

    Glesne, D A; Collart, F R; Huberman, E

    1991-01-01

    To study the regulation of IMP dehydrogenase (IMPDH), the rate-limiting enzyme of guanine nucleotide biosynthesis, we examined the effects of nucleosides, nucleotides, nucleotide analogs, or the IMPDH inhibitor mycophenolic acid (MPA) on the steady-state levels of IMPDH mRNA. The results indicated that IMPDH gene expression is regulated inversely by the intracellular level of guanine ribonucleotides. We have shown that treatment with guanosine increased the level of cellular guanine ribonucleotides and subsequently reduced IMPDH steady-state mRNA levels in a time- and dose-dependent manner. Conversely, MPA treatment diminished the level of guanine ribonucleotides and increased IMPDH mRNA levels. Both of these effects on the steady-state level of IMPDH mRNA could be negated by cotreatment with guanosine and MPA. The down regulation of IMPDH gene expression by guanosine or its up regulation by MPA was not due to major changes in transcriptional initiation and elongation or mRNA stability in the cytoplasm but rather was due to alterations in the levels of the IMPDH mRNA in the nucleus. These results suggest that IMPDH gene expression is regulated by a posttranscriptional, nuclear event in response to fluctuations in the intracellular level of guanine ribonucleotides. Images PMID:1717828

  9. Terrestrial kilometric radiation. III - Average spectral properties. [observations by IMP-6 and RAE-2 satellites

    NASA Technical Reports Server (NTRS)

    Kaiser, M. L.; Alexander, J. K.

    1977-01-01

    The spectral properties of terrestrial kilometric radiation (TKR) derived from observations made during radio-astronomy experiments on board the Imp 6 and Radio Astronomy Explorer 2 spacecraft are studied. As viewed from near the equatorial plane, TKR is most intense and most often observed in the 2100-2400 LT zone and is rarely seen in the 0900-1200 LT zone. The absolute flux levels in the 100- to 600-kHz TKR band increase significantly with increasing substorm activity as inferred from the auroral electrojet index (AE). In the late-evening sector the median power increases by about 3 orders of magnitude between quiet periods (AE less than 75 gammas) and disturbed periods (AE above 200 gammas). The peak flux density usually occurs near 250 kHz, although the frequency of the peak in the flux spectrum appears to vary inversely with AE from a maximum near 300 kHz during very quiet times to a minimum below 200 kHz during very disturbed times. The half-power bandwidth is typically 100% of the peak frequency. The variation of TKR flux density with apparent source altitude indicates that source strength decreases more rapidly than the inverse square of distance.

  10. Gas flow analysis during thermal vacuum test of a spacecraft. [self contamination of IMP spacecraft

    NASA Technical Reports Server (NTRS)

    Scialdone, J. J.

    1974-01-01

    The self-contamination of the IMP-H spacecraft, while it was undergoing thermal and solar vacuum tests, has been investigated in conjunction with the outgassing evaluation and detection of molecular flow anomalies occurring in the test chamber. The pressures indicated by two tubulated ionization gauges were used to calculate flow kinetics in the vacuum chamber. The fluxes of emitted molecules and chamber wall reflected molecules were monitored during the entire test. Representative equations and graphs are presented. Test results indicate that from 3 to 9 of every 100 emitted molecules returned to the spacecraft surface; that self-contamination by noncondensable gases was more severe than that by condensable gases; and that outgassing of the spacecraft was approximately 1.18 x 0.01 g/s after 10 hours and 1.18 x 0.001 after 90 hours of vacuum exposure. Testing deficiencies have been identified, and the type and location of instruments required to measure the outgassing, the degree of contamination, and return flow are discussed.

  11. [Quantitation of cerebral blood flow and partition coefficient using 123I-IMP dynamic SPECT with single arterial blood sampling].

    PubMed

    Mizumura, S; Kumita, S; Kumazaki, T

    1996-03-01

    A method base on the two-compartment model was developed to measure quantitative cerebral blood flow (CBF) and partition coefficient (lambda) of IMP from dynamic SPECT and single arterial blood sampling. In this method, the linear differential equation of two-compartment model, Yokoi proposed, was employed and quantitative CBF and lambda values were measured with the standard input function calibrated by single arterial sampling. The input function was derived from the standard input function scaled by a factor determined by the single arterial blood sample. This new technique was applied to 5 normal volunteers (Ages ranged from 25 to 29 yr., average 26 yr.). The optimal time to calibrate the standard input function in the individual study and optimal the period of the upper limit time to which input function is integrated from IMP administration for analysis of the equation were determined to minimize the difference between integration of the calibrated standard input function and of the individual input function. Minimization of the difference yields an optimal calibration time (4 to 10 min after IMP administration) and the period of the upper limit time (8 to 60 min after acquisition start). Comparison of CBF and lambda values obtained by the graphical method using the calibrated standard data and individual input function were performed. It should be noted that CBF values were in good agreement between the two methods, respectively (r = 0.92, P<0.01; r = 0.72, p = 0.01). This method is easy to estimate CBF and lambda by only single arterial blood sampling and IMP dynamic SPECT, and useful for routine studies.

  12. Mapping Rock and Soil Units in the MPF IMP SuperPan Using a Kohonen Self Organizing Map

    NASA Technical Reports Server (NTRS)

    Farrand, W.; Merenyi, E.; Murchie, S.; Barnouin-Jha, O.; Johnson, J.

    2004-01-01

    The 1997 Mars Pathfinder mission provided information on a site in the Ares Vallis floodplain. Initial analysis of multispectral data from the Imager for Mars Pathfinder (IMP) indicated the presence of only a single rock type, the 'gray rock' spectral class and various coated variants thereof (e.g., 'maroon rock'). Continued analysis of the IMP 'SuperPan' mosaic has confirmed multiple examples of a second 'black rock' spectral class existing as small cobbles in the near field and as boulders in the far field. These results are consistent with recent analysis of MGS Thermal Emission Spectrometer (TES) data which indicates that there is likely a mix of both 'Surface Type 1' (ST1) and 'Surface Type 2' (ST2) spectral classes at the MPF landing site. Nominally, the black rock spectral class would correspond to ST1 (basalts) and 'gray rock' would correspond to ST2 (andesites). Orbital remote sensing has also revealed the pervasive presence of layering on Mars. Recently it was suggested that there are extensive outcrops of the black rock spectral class in the SuperPan far field on the flanks of the Twin Peaks and on the rim of Big Crater. These authors suggested that these exposures represented outcrops of black rock from beneath a surficial, flood deposited layer. In this work, we have reexamined the MPF IMP SuperPan mosaic using an artificial neural network self organizing map (SOM) processing architecture in order to classify the distribution of spectral classes within the SuperPan. In this paper, we present initial results from that work and draw specific attention to a subset of the identified spectral classes in order to address questions relating to whether there are extensive exposures of black rock in the IMP far field, what other materials might be exposed in the far field, and what evidence there is for subsurface layering at the MPF landing site.

  13. Processing and analysis of data from the University of Chicago experiments on the IMP 4 and 5 spacecraft

    NASA Technical Reports Server (NTRS)

    Simpson, J. A.; Garcia-Munoz, M.

    1972-01-01

    Data from the Charged Particle Experiments of the IMP-4 and 5 spacecraft were processed and analyzed from launch through reentry. Approximately 95 percent of all data transmitted was recovered, processed, and analyzed. The computer programming and operational procedures which were developed to perform the processing and analysis of the data are discussed. The scientific results obtained from the analysis of the data are summarized. A bibliography of documents based on these experiments is included.

  14. Lactobacillus gasseri PA-3 Uses the Purines IMP, Inosine and Hypoxanthine and Reduces Their Absorption in Rats

    PubMed Central

    Yamada, Naruomi; Saito-Iwamoto, Chizuru; Nakamura, Marie; Soeda, Misato; Chiba, Yoshika; Kano, Hiroshi; Asami, Yukio

    2017-01-01

    Excessive intake of purine-rich foods elevates serum levels of uric acid. Animal and fish meats contain high amounts of inosine and its related purines, and the reduction of taking those purines is crucial for the improvement of serum uric acid levels. We previously showed that Lactobacillus gasseri PA-3 (PA-3) incorporates adenosine and its related purines and that oral treatment with PA-3 reduced adenosine absorption in rats. This study investigated whether PA-3 also incorporates IMP (inosine 5′-monophosphate), inosine, and hypoxanthine, and whether it reduces their absorption in rats. PA-3 was incubated in vitro with radioisotope (RI)-labeled IMP, inosine, and hypoxanthine, and the incorporation of these compounds by PA-3 was evaluated. In addition, rats were orally administered PA-3 along with RI-labeled inosine 5′-monophosphate, inosine, or hypoxanthine, and the ability of PA-3 to attenuate the absorption of these purines was determined. PA-3 incorporated all three purines and displayed greater proliferation in the presence than in the absence of these purines. Oral administration of PA-3 to rats reduced the absorption of IMP, inosine, and hypoxanthine. These results indicate that PA-3 reduces the absorption of purines contained in foods and it is expected that PA-3 contributes attenuation of the excessive intake of dietary purines. PMID:28282902

  15. Isotope Labeling for Solution and Solid-State NMR Spectroscopy of Membrane Proteins

    PubMed Central

    Verardi, Raffaello; Traaseth, Nathaniel J.; Masterson, Larry R.; Vostrikov, Vitaly V.; Veglia, Gianluigi

    2013-01-01

    In this chapter, we summarize the isotopic labeling strategies used to obtain high-quality solution and solid-state NMR spectra of biological samples, with emphasis on integral membrane proteins (IMPs). While solution NMR is used to study IMPs under fast tumbling conditions, such as in the presence of detergent micelles or isotropic bicelles, solid-state NMR is used to study the structure and orientation of IMPs in lipid vesicles and bilayers. In spite of the tremendous progress in biomolecular NMR spectroscopy, the homogeneity and overall quality of the sample is still a substantial obstacle to overcome. Isotopic labeling is a major avenue to simplify overlapped spectra by either diluting the NMR active nuclei or allowing the resonances to be separated in multiple dimensions. In the following we will discuss isotopic labeling approaches that have been successfully used in the study of IMPs by solution and solid-state NMR spectroscopy. PMID:23076578

  16. "Luxury perfusion" with 99mTc-HMPAO and 123I-IMP SPECT imaging during the subacute phase of stroke.

    PubMed

    Moretti, J L; Defer, G; Cinotti, L; Cesaro, P; Degos, J D; Vigneron, N; Ducassou, D; Holman, B L

    1990-01-01

    To compare the merits of 123I-isopropyl-iodoamphetamine (123I-IMP) and 99mTc-HMPAO in showing abnormal brain uptake distribution during cerebral ischemia, we studied ten patients during the subacute phase of their stroke, a period where metabolism and blood flow are frequently uncoupled. SPECT imaging was performed using both radiopharmaceuticals in the 10 patients from 48 h to 4 weeks after onset of symptoms. Two patients out of the 10 had similar defects with 123I-IMP and 99mTc-HMPAO SPECT, the location of the defects corresponding to the area of infarction observed on CT. Six patients had normal 99mTc-HMPAO SPECT and abnormal 123I-IMP SPECT with defects in the area of infarction shown by CT. The remaining 2 patients had hyperactive abnormalities on 99mTc-HMPAO in areas corresponding to defects on the 123I-IMP images. Two of the patients with SPECT mismatches were studied again more than 1 month after onset. On reexamination, 99mTc-HMPAO SPECT which was previously normal or hyperactive became hypoactive with a focal area of decreased activity corresponding to the defect on 123I-IMP. Crossed cerebellar diaschisis was found in 7 patients with 99mTc-HMPAO and was absent for both 123I-IMP and 99mTc-HMPAO in 3. We suggest that SPECT with 99mTc-HMPAO could show transient hyperemia not demonstrated by 123I-IMP whereas in some cases cerebral infarction would be more difficult to demonstrate with 99mTc-HMPAO than with 123I-IMP. SPECT with both tracers is recommended to follow the evolution of strokes in terms of regional cerebral blood flow and tissue metabolism.

  17. Metallo-β-Lactamase Gene blaIMP-15 in a Class 1 Integron, In95, from Pseudomonas aeruginosa Clinical Isolates from a Hospital in Mexico▿

    PubMed Central

    Garza-Ramos, U.; Morfin-Otero, R.; Sader, H. S.; Jones, R. N.; Hernández, E.; Rodriguez-Noriega, E.; Sanchez, A.; Carrillo, B.; Esparza-Ahumada, S.; Silva-Sanchez, J.

    2008-01-01

    During 2003, 40 carbapenem-resistant Pseudomonas aeruginosa clinical isolates collected in a Mexican tertiary-care hospital were screened for metallo-β-lactamase production. Thirteen isolates produced IMP-15, and 12 had a single pulsed-field gel electrophoresis pattern. The blaIMP-15 gene cassette was inserted in a plasmid-borne integron with a unique array of gene cassettes and was named In95. PMID:18490501

  18. Studies using IMP, Voyager and Pioneer cosmic ray data to determine the size of the heliosphere

    NASA Technical Reports Server (NTRS)

    Lockwood, John A. (Principal Investigator)

    1996-01-01

    The purpose of this project was to use the cosmic ray data from the IMP, Voyager and Pioneer spacecraft in the heliosphere out to approximately 65 AU to estimate the size of the heliosphere. We used several techniques to develop a consistent picture of the size of the heliosphere. The first method used a response function approach which determined the intensity as a function of time by scaling the modulation effect as they move outward and eventually reach the boundary of the heliosphere. In this model the effects of transient cosmic ray disturbances is included. A second approach using the perturbation method in which drifts are considered as a perturbation to the standard diffusion-convection modulation models was not fully developed. In a third approach the location of the modulation boundary beyond the termination shock was estimated using observations of the intensity and radial gradients between Voyager 2 and Pioneer 10 along with new estimates of the interstellar intensity of more than 70 MeV galactic cosmic rays. Using this method we found that for 7 years, from 1983 to 1990, the modulation boundary remained constant at 83 +/- 5 AU. We infer from these studies that a modulation boundary can be estimated only by extrapolating the observed radial gradients when the solar magnetic field polarity is such that cosmic-ray particles are drifting in the heliosphere inward toward the Earth along the neutral sheet. The boundary distance is larger than the estimates of the location of the termination shock at 67 +/- 5 AU using the same method. Two other studies partially supported by this grant are attached. The first deals with the recovery period of the greater than 70 MeV cosmic rays in the outer heliosphere from 1992-1995. In the second paper we compare the rigidity dependence of the 11-year cosmic ray variation at the Earth in two cycles of opposite solar magnetic field polarity.

  19. Hippocampal expression of the calcium sensor protein visinin-like protein-1 in schizophrenia.

    PubMed

    Bernstein, Hans-Gert; Braunewell, Karl-Heinz; Spilker, Christina; Danos, Peter; Baumann, Bruno; Funke, Sieglinde; Diekmann, Silvia; Gundelfinger, Eckart D; Bogerts, Bernhard

    2002-03-25

    Hippocampal cytoarchitectural abnormalities may be part of the cerebral substrate of schizophrenia. Amongst the chemical components being abnormal in brains of schizophrenics are altered calcium concentrations and reduced expression of the neurotrophin receptor, trkB. We studied by immunohistochemical methods the distribution of visinin-like protein-1 (VILIP-1), which is a calcium sensor protein and at the same time a trkB mRNA binding protein, in hippocampi of nine schizophrenic patients and nine matched control subjects. In normal hippocampi VILIP-1 immunoreactivity was found in multiple pyramidal cells and interneurons. A portion of VILIP-1 immunoreactive interneurons co-express calretinin (60%) and parvalbumin (<10%). In schizophrenics fewer pyramidal cells but more interneurons were immunostained. Our data point to an involvement of the protein in the altered hippocampal circuitry in schizophrenia.

  20. Outbreak of Infection with Multidrug-Resistant Klebsiella pneumoniae Carrying blaIMP-8 in a University Medical Center in Taiwan

    PubMed Central

    Yan, Jing-Jou; Ko, Wen-Chien; Tsai, Shu-Huei; Wu, Hsiu-Mei; Wu, Jiunn-Jong

    2001-01-01

    Klebsiella pneumoniae strains with the transferable carbapenem-hydrolyzing metallo-β-lactamases, which include IMP- and VIM-type enzymes, remain extremely rare. To investigate whether IMP- or VIM-producing K. pneumoniae isolates had spread at a university medical center in Taiwan, a total of 3,458 clinical isolates of K. pneumoniae consecutively collected in 1999 and 2000 were tested by the agar diffusion method, colony hybridization, PCR, and nucleotide sequencing. A total of 40 isolates (1.2%), or 17 nonrepetitive isolates, from 16 patients were found to carry blaIMP-8, a metallo-β-lactamase gene recently identified from a K. pneumoniae strain in Taiwan. Carriage of blaVIM or other blaIMP genes was detected in none of the remaining isolates. Of the 17 nonrepetitive blaIMP-8-positive isolates, 15 isolates (88.2%) appeared susceptible to imipenem (MICs, ≤4 μg/ml) and meropenem (MICs, ≤1 μg/ml), indicating the difficulty in detecting blaIMP-8 in K. pneumoniae by routine susceptibility tests; 14 isolates (82.4%) produced SHV-12 as well; and 14 isolates (82.4%) were also resistant to fluoroquinolones. The organisms caused wound infections in eight patients and bloodstream infections in three patients. They were not directly associated with the death of nine patients. Before the recovery of the blaIMP-8-positive isolates, all 16 patients had undergone various surgical procedures, and 15 patients had been admitted to the surgical intensive care unit, suggesting a nosocomial outbreak. Two major patterns were observed by pulsed-field gel electrophoresis for 14 of the 17 nonrepetitive isolates, indicating that the clonal spread was mainly responsible for the outbreak. PMID:11724857

  1. Predicting pupylation sites in prokaryotic proteins using semi-supervised self-training support vector machine algorithm.

    PubMed

    Ju, Zhe; Gu, Hong

    2016-08-15

    As one important post-translational modification of prokaryotic proteins, pupylation plays a key role in regulating various biological processes. The accurate identification of pupylation sites is crucial for understanding the underlying mechanisms of pupylation. Although several computational methods have been developed for the identification of pupylation sites, the prediction accuracy of them is still unsatisfactory. Here, a novel bioinformatics tool named IMP-PUP is proposed to improve the prediction of pupylation sites. IMP-PUP is constructed on the composition of k-spaced amino acid pairs and trained with a modified semi-supervised self-training support vector machine (SVM) algorithm. The proposed algorithm iteratively trains a series of support vector machine classifiers on both annotated and non-annotated pupylated proteins. Computational results show that IMP-PUP achieves the area under receiver operating characteristic curves of 0.91, 0.73, and 0.75 on our training set, Tung's testing set, and our testing set, respectively, which are better than those of the different error costs SVM algorithm and the original self-training SVM algorithm. Independent tests also show that IMP-PUP significantly outperforms three other existing pupylation site predictors: GPS-PUP, iPUP, and pbPUP. Therefore, IMP-PUP can be a useful tool for accurate prediction of pupylation sites. A MATLAB software package for IMP-PUP is available at https://juzhe1120.github.io/.

  2. A summary of the mechanical design, testing and performance of the IMP-H and J attitude control systems

    NASA Technical Reports Server (NTRS)

    Metzger, J. R.

    1974-01-01

    The main aspects of the attitude control system used on both the IMP-H and J spacecraft are presented. The mechanical configuration is described. Information on all the specific components comprising the flight system is provided. The acceptance and qualification testing of both individual components and the installed system are summarized. Functional information regarding the operation and performance in relation to the orbiting spacecraft and its mission is included. Related topics which are discussed are: (1) safety requirements, (2) servicing procedures, (3) anomalous behavior, and (4) pyrotechnic devices.

  3. Klebsiella oxytoca-producing IMP-1 Detected as the First Strain of Carbapenem-resistant Enterobacteriaceae in Our Hospital.

    PubMed

    Hagiya, Hideharu; Ogawa, Hiroko; Takahashi, Yusuke; Yamamoto, Akira; Otsuka, Fumio

    2015-01-01

    We herein report a case of Klebsiella oxytoca-producing IMP-1 that was detected as a first isolate of carbapenem-resistant Enterobacteriaceae (CRE) at our facility. Since K. oxytoca is an uncommon strain for CRE, we speculated that the resistant organism had already spread out inside the hospital. Metallo-β-lactamases promotes antibiotic resistance in Enterobacteriaceae, which potentially yields problematic issues in clinical settings. Active surveillance of antibiotic resistant strains is important and should be repeatedly highlighted. Furthermore, appropriate methods should be established to detect highly resistant strains.

  4. Development of a pipeline for automated, high-throughput analysis of paraspeckle proteins reveals specific roles for importin α proteins

    PubMed Central

    Major, Andrew T.; Miyamoto, Yoichi; Lo, Camden Y.; Jans, David A.; Loveland, Kate L.

    2017-01-01

    We developed a large-scale, unbiased analysis method to measure how functional variations in importin (IMP) α2, IMPα4 and IMPα6 each influence PSPC1 and SFPQ nuclear accumulation and their localization to paraspeckles. This addresses the hypothesis that individual IMP protein activities determine cargo nuclear access to influence cell fate outcomes. We previously demonstrated that modulating IMPα2 levels alters paraspeckle protein 1 (PSPC1) nuclear accumulation and affects its localization into a subnuclear domain that affects RNA metabolism and cell survival, the paraspeckle. An automated, high throughput, image analysis pipeline with customisable outputs was created using Imaris software coupled with Python and R scripts; this allowed non-subjective identification of nuclear foci, nuclei and cells. HeLa cells transfected to express exogenous full-length and transport-deficient IMPs were examined using SFPQ and PSPC1 as paraspeckle markers. Thousands of cells and >100,000 nuclear foci were analysed in samples with modulated IMPα functionality. This analysis scale enabled discrimination of significant differences between samples where paraspeckles inherently display broad biological variability. The relative abundance of paraspeckle cargo protein(s) and individual IMPs each influenced nuclear foci numbers and size. This method provides a generalizable high throughput analysis platform for investigating how regulated nuclear protein transport controls cellular activities. PMID:28240251

  5. Development of a pipeline for automated, high-throughput analysis of paraspeckle proteins reveals specific roles for importin α proteins.

    PubMed

    Major, Andrew T; Miyamoto, Yoichi; Lo, Camden Y; Jans, David A; Loveland, Kate L

    2017-02-27

    We developed a large-scale, unbiased analysis method to measure how functional variations in importin (IMP) α2, IMPα4 and IMPα6 each influence PSPC1 and SFPQ nuclear accumulation and their localization to paraspeckles. This addresses the hypothesis that individual IMP protein activities determine cargo nuclear access to influence cell fate outcomes. We previously demonstrated that modulating IMPα2 levels alters paraspeckle protein 1 (PSPC1) nuclear accumulation and affects its localization into a subnuclear domain that affects RNA metabolism and cell survival, the paraspeckle. An automated, high throughput, image analysis pipeline with customisable outputs was created using Imaris software coupled with Python and R scripts; this allowed non-subjective identification of nuclear foci, nuclei and cells. HeLa cells transfected to express exogenous full-length and transport-deficient IMPs were examined using SFPQ and PSPC1 as paraspeckle markers. Thousands of cells and >100,000 nuclear foci were analysed in samples with modulated IMPα functionality. This analysis scale enabled discrimination of significant differences between samples where paraspeckles inherently display broad biological variability. The relative abundance of paraspeckle cargo protein(s) and individual IMPs each influenced nuclear foci numbers and size. This method provides a generalizable high throughput analysis platform for investigating how regulated nuclear protein transport controls cellular activities.

  6. Metallo-β-Lactamase-Producing Pseudomonas spp. in Korea: High Prevalence of Isolates with VIM-2 Type and Emergence of Isolates with IMP-1 Type

    PubMed Central

    Lee, Kyungwon; Park, Ae Ja; Kim, Moon Yeun; Lee, Hee Joo; Cho, Ji-Hyun; Kang, Jung Oak; Yong, Dongeun

    2009-01-01

    Purpose Two Korean nationwide studies showed that metallo-β-lactamases (MBLs)-producing-Pseudomonas spp. are not rare. The aim of this study was to assess the trends of MBL-producing isolates among imipenem-resistant isolates of Pseudomonas spp. Materials and Methods Imipenem-resistant clinical isolates were collected from 23 hospitals and one commercial laboratory participating in the KONSAR program in 2005. Polymerase chain reaction (PCR) was used to detect MBL genes. Results Alleles of MBL genes were detected in 10.8% of 415 Pseudomonas aeruginosa and 66.7% of 12 P. putida isolates from 18 of 24 hospitals/laboratory. Among the 14 IMP-1-like and 39 VIM-2-like MBLs, emergence of IMP-6 was detected for the first time. Conclusion Prevalence of MBL-producing P. aeruginosa has not significantly increased, but IMP-6 emerged in P. aeruginosa. PMID:19568593

  7. Differentially expressed myo-inositol monophosphatase gene (CaIMP) in chickpea (Cicer arietinum L.) encodes a lithium-sensitive phosphatase enzyme with broad substrate specificity and improves seed germination and seedling growth under abiotic stresses.

    PubMed

    Saxena, Saurabh C; Salvi, Prafull; Kaur, Harmeet; Verma, Pooja; Petla, Bhanu Prakash; Rao, Venkateswara; Kamble, Nitin; Majee, Manoj

    2013-12-01

    myo-Inositol monophosphatase (IMP) is an essential enzyme in the myo-inositol metabolic pathway where it primarily dephosphorylates myo-inositol 1-phosphate to maintain the cellular inositol pool which is important for many metabolic and signalling pathways in plants. The stress-induced increased accumulation of inositol has been reported in a few plants including chickpea; however, the role and regulation of IMP is not well defined in response to stress. In this work, it has been shown that IMP activity is distributed in all organs in chickpea and was noticeably enhanced during environmental stresses. Subsequently, using degenerate oligonucleotides and RACE strategy, a full-length IMP cDNA (CaIMP) was cloned and sequenced. Biochemical study revealed that CaIMP encodes a lithium-sensitive phosphatase enzyme with broad substrate specificity, although maximum activity was observed with the myo-inositol 1-phosphate and l-galactose 1-phosphate substrates. Transcript analysis revealed that CaIMP is differentially expressed and regulated in different organs, stresses and phytohormones. Complementation analysis in Arabidopsis further confirmed the role of CaIMP in l-galactose 1-phosphate and myo-inositol 1-phosphate hydrolysis and its participation in myo-inositol and ascorbate biosynthesis. Moreover, Arabidopsis transgenic plants over-expressing CaIMP exhibited improved tolerance to stress during seed germination and seedling growth, while the VTC4/IMP loss-of-function mutants exhibited sensitivity to stress. Collectively, CaIMP links various metabolic pathways and plays an important role in improving seed germination and seedling growth, particularly under stressful environments.

  8. Antibiotic resistance pattern and evaluation of metallo-beta lactamase genes (VIM and IMP) in Pseudomonas aeruginosa strains producing MBL enzyme, isolated from patients with secondary immunodeficiency

    PubMed Central

    Shirani, Kiana; Ataei, Behrouz; Roshandel, Fardad

    2016-01-01

    Background: One of the most common causes of hospital-acquired secondary infections in hospitalized patients is Pseudomonas aeruginosa. The aim of this study is to evaluate the expression of IMP and VIM in Pseudomonas aeruginosa strains (carbapenem resistant and producer MBL enzyme) in patients with secondary immunodeficiency. Materials and Methods: In a cross sectional study, 96 patients with secondary immunodeficiency hospitalized in the Al-Zahra hospital were selected. Carbapenem resistant strains isolated and modified Hodge test was performed in order to confirm the presence of the metallo carbapenemase enzyme. Under the standard conditions they were sent to the central laboratory for investigating nosocomial infection Multiplex PCR. Results: Of 96 samples 28.1% were IMP positive, 5.2% VIM positive and 3.1% both VIM and IMP positive. The prevalence of multidrug resistance in the IMP and/or VIM negative samples was 29%, while all 5 VIM positive samples have had multidrug resistance. Also the prevalence of multi-drug resistance in IMP positive samples were 96.3% and in IMP and VIM positive samples were 100%. According to Fisher’s test, the prevalence of multi-drug resistance based on gene expression has significant difference (P < 0.001). Conclusion: Based on the results of this study it can be concluded that, a significant percentage of patients with secondary immunodeficiency that suffer nosocomial infections with multidrug resistance, especially Pseudomonas aeruginosa, are probably MBL-producing gene positive. Therefore the cause of infection should be considered in the hospital care system to identify their features, the presence of genes involved in the development of multi-drug resistance and antibiotic therapy. PMID:27563634

  9. Identification of human leukocyte antigen-A24-restricted epitope peptides derived from gene products upregulated in lung and esophageal cancers as novel targets for immunotherapy.

    PubMed

    Suda, Takako; Tsunoda, Takuya; Daigo, Yataro; Nakamura, Yusuke; Tahara, Hideaki

    2007-11-01

    For the development of cancer vaccine therapies, we have searched for possible epitope peptides that can elicit cytotoxic T lymphocytes (CTL) to the TTK protein kinase (TTK), lymphocyte antigen 6 complex locus K (LY6K) and insulin-like growth factor (IGF)-II mRNA binding protein 3 (IMP-3), which were previously identified to be transactivated in the majority of lung and esophageal cancers. We screened 31, 17 and 17 candidate human leukocyte antigen (HLA)-A*2402-binding peptides to parts of TTK, LY6K and IMP-3, respectively. As a result, we successfully established strong CTL clones stimulated by TTK-567 (SYRNEIAYL), LY6K-177 (RYCNLEGPPI) and IMP-3-508 (KTVNELQNL) that have specific cytotoxic activities against the HLA-A24-positive target cells pulsed with the candidate peptides. Subsequent analysis of the CTL clones also revealed their cytotoxic activities against lung and esophageal tumor cells that endogenously express TTK, LY6K or IMP-3. A cold target inhibition assay further confirmed that the CTL cell clones specifically recognized the MHC class I–peptide complex. Our results strongly imply that TTK, LY6K and IMP-3 are novel tumor-associated antigens recognized by CTL, and TTK-567 (SYRNEIAYL), LY6K-177 (RYCNLEGPPI) and IMP-3-508 (KTVNELQNL) are HLA-A24-restricted epitope peptides that can induce potent and specific immune responses against lung and esophageal cancer cells expressing TTK, LY6K and IMP-3.

  10. The 2-D Curvature of Large Angle Interplanetary MHD Discontinuity Surfaces: IMP-8 and WIND Observations

    NASA Astrophysics Data System (ADS)

    Lepping, R. P.; Wu, C.; McClernan, K.

    2002-12-01

    This study examines the degree of 2-D curvature of solar wind directional discontinuity (DD) surfaces at 1 AU using magnetic field, density, and velocity data from the WIND and IMP-8 spacecraft for a large number (N = 134) of carefully selected events having large ``discontinuity angles" of 90° or greater. The discontinuity angle (ω ) is measured in the DDs current sheet, the normal to which is estimated by field variance analysis. The fundamental analysis depends on estimates of these DD surface normals at the two spacecraft, and the DDs center-times and positions. On average, the transit time from one DD sighting to the other was 36 minutes, and the associated distance along the normal direction was 137 RE. The transition-interval lengths across the DDs are translated into thicknesses and examined for the amount of change between the two spacecraft observing points; average thickness is relatively large, 14 RE. All relevant quantities are examined statistically to establish their distributions, average, and degree of change. A weighted average of the radius of curvature is estimated to be 380 RE, but its most probably value is 290 RE. The average ω is 140° with a relatively large spread (σ =28°). The average direction of propagation is: longitude = 194° and latitude = 7° (but < ∣ lat∣ > = 27°). Various parameters are studied with respect to DD type, defined in terms the ratio of speed of propagation to net speed (``ratio") of the DD surface, (the RD ratio is high and the TD ratio is very low or zero). The results by this definition of type are favorably compared to those from the more conventional method, which depends on the absolute strength of the normal component of the magnetic field. There is little difference in any average parameter value according to type. However, the average ω appears to depend slightly on type with the < ω > for the RDs being smaller. A DDs type was shown to change in either direction between the two observation

  11. Two-dimensional curvature of large angle interplanetary MHD discontinuity surfaces: IMP-8 and WIND observations

    NASA Astrophysics Data System (ADS)

    Lepping, R. P.; Wu, C.-C.; McClernan, K.

    2003-07-01

    This study examines the degree of two-dimensional curvature of solar wind directional discontinuity (DD) surfaces at 1 AU using magnetic field, density, and velocity data from the WIND and IMP-8 spacecraft for a large number (N = 134) of carefully selected events having large "discontinuity angles" of 90° or greater. The discontinuity angle (ω) is measured in the DD's current sheet, the normal (n) to which is estimated by field variance analysis. The fundamental analysis depends on estimates of these DD surface normals at the two spacecraft and the DD's center-times and positions. On average, the transit time from one DD sighting to the other was 36 minutes, and the associated distance along the normal direction was 137 RE. The transition-interval lengths across the DDs are translated into thicknesses and examined for the amount of change between the two spacecraft observing points. The average thickness is relatively large, 14 RE.; the most probable thickness is ≈6 RE. All relevant quantities are examined statistically to establish their distributions, average, and degree of change. A weighted average of the radius of curvature is estimated to be 380 RE, but its most probable value is 290 RE. The average ω is 140° with a relatively large spread (σ = 28°). The average direction of propagation is: longitude (ϕn) = 194° and latitude (θn) = 7° (but <∣θn∣> = 27°), where ϕn = 0° is sunward and θn = 0° is the ecliptic plane. Various parameters are studied with respect to DD type, i.e., rotational or tangential discontinuity (RD or TD), defined in terms of the "ratio" (in percent) of speed of propagation to net speed of the DD surface, where the net speed is the sum of the convection velocity (along n) plus the propagation speed. The RD %-ratio is moderately small, but the TD ratio is very small or zero. The results by this definition of type are favorably compared to those from the more conventional method, which depends on the absolute strength of

  12. Proteins.

    ERIC Educational Resources Information Center

    Doolittle, Russell F.

    1985-01-01

    Examines proteins which give rise to structure and, by virtue of selective binding to other molecules, make genes. Binding sites, amino acids, protein evolution, and molecular paleontology are discussed. Work with encoding segments of deoxyribonucleic acid (exons) and noncoding stretches (introns) provides new information for hypotheses. (DH)

  13. Thermal iron ions in high speed solar wind streams Detection by the IMP 7/8 energetic particle experiments

    NASA Technical Reports Server (NTRS)

    Mitchell, D. G.; Roelof, E. C.

    1980-01-01

    The first measurements of the abundance of iron ions in high speed (greater than 600 km/s) solar wind streams have been made with the NOAA/JHU energetic particles experiments (EPE) on IMP 7/8. The identification of iron ions is quantitatively established using 4 years of observations and heavy ion accelerator calibrations of detectors similar to those flown on the spacecraft. Preliminary estimates of the Fe/H ratio are within a factor of 2 of the adopted coronal abundance (0.00005), and there is some evidence that Fe/H may remain approximately constant within a given stream. In the peaks of fast streams (700-800 km/s), about 50 iron ion counts are obtained every 20 s, offering the possibility of studying the Fe/H ratio with approximately 1 m time resolution in high speed streams throughout the decline of Solar Cycle 20 and the rise of Solar Cycle 21.

  14. IMS/Satellite Situation Center report. Predicted orbit plots for IMP-H-1976. [Explorer 47 satellite

    NASA Technical Reports Server (NTRS)

    1975-01-01

    Predicted orbit plots are shown in three projections. The time period covered by each set of projections is 12 days 6 hours, corresponding approximately to the period of IMP-H satellite. The three coordinate systems used are the Geocentric Solar Ecliptic system (GSE), the Geocentric Solar Magnetospheric system (GSM), and the Solar Magnetic system (SM). For each of the three projections, time ticks and codes are given on the satellite trajectories. The codes are interpreted in the table at the base of each plot. Time is given in the table as year/day/decimal hour. The total time covered by each plot is shown at the bottom of each table. An additional variable is given in the table for each time tick. For the GSM and SM projection this variable is the geocentric distance to the satellite in earth radii, and for the GSE projection the variable is satellite ecliptic latitude in degrees.

  15. The Intense Microwave Prototype (IMP) free electron laser, 140 gigahertz microwave system for the microwave tokamak experiment (MTX)

    NASA Astrophysics Data System (ADS)

    Felker, B.; Ferguson, S. W.

    1991-09-01

    This paper will present the design, construction, and magnetic test results of the Intense Microwave Prototype (IMP) Free Electron Laser and all of the Microwave System special hardware developed for operation as a plasma heating source for the Microwave Tokamak Experiment. The test results presented will not include electron beam data for the FEL. Those tests will begin in November 1991. The master oscillator for the FEL is a 140 GHz, 400 kW gyrotron. Microwave power will be transmitted to the entrance to the wiggler by waveguide, miter bends, a waveguide-to-free-space vlasov mode convertor, and aluminum quasi-optical mirrors. The electron beam of approx. 2.5 k amps up to 7.5 MeV, and greater than 10(exp 8) A/ sq m-rad brightness will be introduced colinear with the microwave beam into the FEL. The IMP FEL is tunable and made up to both permanent and electromagnets. It is 5.5 meters long with a 10 cm period between shaped steel pole tips. The electromagnets are water cooled, carry up to 140 amps continuously and can be adjusted to vary the wiggler fields from 600 to 5500 gauss. The spent electron beam will be dumped into a water cooled, lead shielded carbon dump. The microwave pulses, at up to 5 GW power levels, will be transmitted through a series of mirrors to the Microwave Tokamak Experiment. Another swinging mirror will reflect the microwave power into a microwave dump/calorimeter for accelerator and FEL conditioning.

  16. Digital photogrammetric analysis of the IMP camera images: Mapping the Mars Pathfinder landing site in three dimensions

    USGS Publications Warehouse

    Kirk, R.L.; Howington-Kraus, E.; Hare, T.; Dorrer, E.; Cook, D.; Becker, K.; Thompson, K.; Redding, B.; Blue, J.; Galuszka, D.; Lee, E.M.; Gaddis, L.R.; Johnson, J. R.; Soderblom, L.A.; Ward, A.W.; Smith, P.H.; Britt, D.T.

    1999-01-01

    This paper describes our photogrammetric analysis of the Imager for Mars Pathfinder data, part of a broader program of mapping the Mars Pathfinder landing site in support of geoscience investigations. This analysis, carried out primarily with a commercial digital photogrammetric system, supported by our in-house Integrated Software for Imagers and Spectrometers (ISIS), consists of three steps: (1) geometric control: simultaneous solution for refined estimates of camera positions and pointing plus three-dimensional (3-D) coordinates of ???103 features sitewide, based on the measured image coordinates of those features; (2) topographic modeling: identification of ???3 ?? 105 closely spaced points in the images and calculation (based on camera parameters from step 1) of their 3-D coordinates, yielding digital terrain models (DTMs); and (3) geometric manipulation of the data: combination of the DTMs from different stereo pairs into a sitewide model, and reprojection of image data to remove parallax between the different spectral filters in the two cameras and to provide an undistorted planimetric view of the site. These processes are described in detail and example products are shown. Plans for combining the photogrammetrically derived topographic data with spectrophotometry are also described. These include photometric modeling using surface orientations from the DTM to study surface microtextures and improve the accuracy of spectral measurements, and photoclinometry to refine the DTM to single-pixel resolution where photometric properties are sufficiently uniform. Finally, the inclusion of rover images in a joint photogrammetric analysis with IMP images is described. This challenging task will provide coverage of areas hidden to the IMP, but accurate ranging of distant features can be achieved only if the lander is also visible in the rover image used. Copyright 1999 by the American Geophysical Union.

  17. Protein

    MedlinePlus

    ... Search for: Harvard T.H. Chan School of Public Health Email People Departments Calendar Careers Give my.harvard ... Nutrition Source Harvard T.H. Chan School of Public Health > The Nutrition Source > What Should I Eat? > Protein ...

  18. Protein

    MedlinePlus

    ... Go lean with protein. • Choose lean meats and poultry. Lean beef cuts include round steaks (top loin, ... main dishes. • Use nuts to replace meat or poultry, not in addition to meat or poultry (i. ...

  19. A Family of Insulin-Like Growth Factor II mRNA-Binding Proteins Represses Translation in Late Development

    PubMed Central

    Nielsen, Jacob; Christiansen, Jan; Lykke-Andersen, Jens; Johnsen, Anders H.; Wewer, Ulla M.; Nielsen, Finn C.

    1999-01-01

    Insulin-like growth factor II (IGF-II) is a major fetal growth factor. The IGF-II gene generates multiple mRNAs with different 5′ untranslated regions (5′ UTRs) that are translated in a differential manner during development. We have identified a human family of three IGF-II mRNA-binding proteins (IMPs) that exhibit multiple attachments to the 5′ UTR from the translationally regulated IGF-II leader 3 mRNA but are unable to bind to the 5′ UTR from the constitutively translated IGF-II leader 4 mRNA. IMPs contain the unique combination of two RNA recognition motifs and four hnRNP K homology domains and are homologous to the Xenopus Vera and chicken zipcode-binding proteins. IMP localizes to subcytoplasmic domains in a growth-dependent and cell-specific manner and causes a dose-dependent translational repression of IGF-II leader 3 –luciferase mRNA. Mouse IMPs are produced in a burst at embryonic day 12.5 followed by a decline towards birth, and, similar to IGF-II, IMPs are especially expressed in developing epithelia, muscle, and placenta in both mouse and human embryos. The results imply that cytoplasmic 5′ UTR-binding proteins control IGF-II biosynthesis during late mammalian development. PMID:9891060

  20. The Tubulation Activity of a Fission Yeast F-BAR Protein Is Dispensable for Its Function in Cytokinesis.

    PubMed

    McDonald, Nathan A; Takizawa, Yoshimasa; Feoktistova, Anna; Xu, Ping; Ohi, Melanie D; Vander Kooi, Craig W; Gould, Kathleen L

    2016-01-26

    F-BAR proteins link cellular membranes to the actin cytoskeleton in many biological processes. Here we investigated the function of the Schizosaccharomyces pombe Imp2 F-BAR domain in cytokinesis and find that it is critical for Imp2's role in contractile ring constriction and disassembly. To understand mechanistically how the F-BAR domain functions, we determined its structure, elucidated how it interacts with membranes, and identified an interaction between dimers that allows helical oligomerization and membrane tubulation. Using mutations that block either membrane binding or tubulation, we find that membrane binding is required for Imp2's cytokinetic function but that oligomerization and tubulation, activities often deemed central to F-BAR protein function, are dispensable. Accordingly, F-BARs that do not have the capacity to tubulate membranes functionally substitute for the Imp2 F-BAR, establishing that its major role is as a cell-cycle-regulated bridge between the membrane and Imp2 protein partners, rather than as a driver of membrane curvature.

  1. [A technique for a rapid imaging of regional CBF and partition coefficient using dynamic SPECT and N-isopropyl-p-[123I]iodoamphetamine (123I-IMP)].

    PubMed

    Itoh, H; Iida, H; Murakami, M; Bloomfield, P M; Miura, S; Okudera, T; Inugami, A; Ogawa, T; Hatazawa, J; Fujita, H

    1993-01-01

    IMP is a flow tracer due to a large first pass extraction fraction and high affinity in the brain, but significant clearance from the brain causes change of distribution when the scan start time is delayed. The purpose of the present study is to develop a new method to rapidly calculate a quantitative CBF image by taking into account for the clearance effects. A dynamic SPECT scan was performed on 5 subjects (4 patients with cerebral infarction and 1 normal volunteer) following slow intravenous infusion of 123I-IMP. The arterial input function was obtained by frequent blood sampling and by measuring an octanol extraction ratio for each sample. Firstly, non-linear least square fitting (NLS) was performed to investigate the tracer kinetics of 123I-IMP. The 3 compartment model analysis yielded negligibly small k3 (retaining rate constant) (0.0056 +/- 0.0128 (ml/ml/min)), and consistent k1 (transport rate constant) with those determined by 2 compartment model (2CM) analysis (r = 0.96, p < 0.001). In addition, k1 was consistent with CBF measured by 15O water PET technique. These observations suggested validity of using 2CM for describing the IMP tracer kinetics. Secondly, a weighted integration (WI) technique has been implemented to calculate rapidly images of CBF and partition coefficient (Vd). The WI technique yielded values of CBF (k1) and Vd (k1/k2). They were confirmed to be consistent with those determined by NLS technique (CBF; r = 0.99, p < 0.001, Vd; r = 0.99, p < 0.001), and calculated k1 agreed well with PET CBF (r = 0.91, p < 0.001). We observed changed Vd in infarcted patients. This supports an importance for calculating of Vd image. Vd image will provide additional clinical information because 123I-IMP binding mechanism may be related to cell viability.

  2. Class 1 integrons in non-clonal multidrug-resistant Acinetobacter baumannii from Iran, description of the new blaIMP-55 allele in In1243.

    PubMed

    Azizi, Omid; Shakibaie, Mohammad Reza; Badmasti, Farzad; Modarresi, Farzan; Ramazanzadeh, Rashid; Mansouri, Shahla; Shahcheraghi, Fereshteh

    2016-09-01

    Infections and outbreaks caused by multidrug-resistant Acinetobacter baumannii (MDR-AB) are prevalent and have been reported worldwide over the past 20 or more years. Class 1 integron in MDR-AB plays an important role in the spread of antibiotic resistance in clinical settings. This study has been conducted to evaluate the detection of metallo-β-lactamase, characterization of class 1 integron and determination of clonal relatedness among A. baumannii hospital isolates. Sixty-five clinical isolates of MDR-AB were recovered from two Iranian hospital's intensive care units from February to August 2013. Integrase (intI1) and blaIMP genes were detected in 70.8 % (n=46/65) and 9.23 % (n=6/65) of the isolates using PCR assay, respectively. No other metallo-β-lactamase genes (blaVIM, blaSIM and blaNDM) were detected. PCR sequencing of integron gene cassette revealed the following arrays: blaOXA10-aacA4-blaIMP-55-cmlA5 (as a novel array was designated In1243), aacC1 and aadA1. Analysis of blaIMP gene revealed a new allele designated as blaIMP-55. Gene transfer experiment by conjugation showed the 36 kb conjugative plasmid harbouring In1243. The clonal assessment by repetitive extragenic palindromic PCR demonstrated a high-degree relatedness among the strains, but strains harbouring In1243 displayed a different repetitive extragenic palindromic PCR profile. In this study, we found that a novel class 1 integron (In1243) that encoded a new blaIMP allele resided on a transferable plasmid in non-clonal strains of MDR-AB.

  3. Evaluation of Zataria MultiFlora Boiss and Carum copticum antibacterial activity on IMP-type metallo-beta-lactamase-producing Pseudomonas aeruginosa

    PubMed Central

    Fallah, F.; Taherpour, A.; Borhan, R.S.; Hashemi, A.; Habibi, M.; Sajadi Nia, R.

    2013-01-01

    Summary Carbapenem resistance due to acquired metallo-beta-lactamases (MBLs) is considered to be more serious than other resistance mechanisms. The aim of this study was to evaluate the antibacterial activity of Zataria multiflora Boiss and Carum copticum plants on IMP-producing P.aeruginosa strains. This experimental study was carried out on hospitalized burn patients during 2011 and 2012. Antibiotics and extracts susceptibility tests were performed by disc diffusion and broth microdilution methods. MBL detection was performed by Combination Disk Diffusion Test (CDDT). The bla(VIM) and bla(IMP) genes were detected by PCR and sequencing methods. Using Combination Disk Diffusion test method, it was found that among 83 imipenem resistant P.aeruginosa strains, 48 (57.9%) were MBL producers. PCR and sequencing methods proved that these isolates were positive for blaIMP-1 genes, whereas none were positive for bla(VIM) genes. The mortality rate of hospitalized patients with MBL-producing Pseudomonas infection was 4/48 (8.3%). It was shown that Zataria multiflora and Carum copticum extracts had a high antibacterial effect on regular and IMP-producing P. aeruginosa strains in 6.25 mg/ml concentration. The incidence of MBL-producing P. aeruginosa in burn patients is very high. In our study, all MBL-producing isolates carry the blaIMP-1 gene. Therefore, detection of MBL-producing isolates is of great importance in identifying drug resistance patterns in P. aeruginosa, and in prevention and control of infections. In this study, it was shown that extracts of Z. multiflora and C. copticum have high antibacterial effects on ß-lactamase producing P. aeruginosa strains. PMID:24799849

  4. Detection and Genetic Characterization of Metallo-β-Lactamase IMP-1 and VIM-2 in Pseudomonas aeruginosa Strains From Different Hospitals in Kermanshah, Iran

    PubMed Central

    Abiri, Ramin; Mohammadi, Pantea; Shavani, Navid; Rezaei, Mansour

    2015-01-01

    Background: Pseudomonas aeruginosais a frequent nosocomial pathogen that causes severe diseases in many settings. Carbapenems, including meropenem and imipenem, are effective antibiotics against this organism. However, the use of carbapenems has been hampered by the emergence of strains resistant to carbapenemsvia different mechanisms such as the production of metallo-β-lactamases (MBLs), which hydrolyze all carbapenems. Several kinds of MBLs have been reported, among them VIM and IMP types being the most clinically significant carbapenemases. Objectives: We aimed to determine the distribution of blaVIM-2 and blaIMP-1 transferable genes encoding MBLs in P. aeruginosa isolated from three academic hospitals in Kermanshah. Patients and Methods: From 22nd June to 22nd September 2012, 225 isolates of P. aeruginosa were collected. These isolates were tested for antibiotic susceptibility with the Kirby-Bauer disk-diffusion method, and the MBLs were assessed using the imipenem-EDTA double-disk synergy test. The isolates were investigated for blaVIM-2 and blaIMP-1 genes using polymerase chain reaction. Results: Among the 225 isolates, 33.7% (76/225) and 18.1% (41/225) were resistant to imipenem and meropenem, respectively. Of the 76 imipenem-resistant P. aeruginosa strains, 45 (59.2%) were positive for MBLs, 34 (75%) strains carried the blaIMP-1 gene, and 1 (2.2%) strain carried the blaVIM-2 gene. Conclusions: Our results showed that there was a high frequency of IMP-1 positive P. aeruginosa in the different wards of the hospitals. PMID:26495110

  5. Evaluation of Zataria MultiFlora Boiss and Carum copticum antibacterial activity on IMP-type metallo-beta-lactamase-producing Pseudomonas aeruginosa.

    PubMed

    Fallah, F; Taherpour, A; Borhan, R S; Hashemi, A; Habibi, M; Sajadi Nia, R

    2013-12-31

    Carbapenem resistance due to acquired metallo-beta-lactamases (MBLs) is considered to be more serious than other resistance mechanisms. The aim of this study was to evaluate the antibacterial activity of Zataria multiflora Boiss and Carum copticum plants on IMP-producing P.aeruginosa strains. This experimental study was carried out on hospitalized burn patients during 2011 and 2012. Antibiotics and extracts susceptibility tests were performed by disc diffusion and broth microdilution methods. MBL detection was performed by Combination Disk Diffusion Test (CDDT). The bla(VIM) and bla(IMP) genes were detected by PCR and sequencing methods. Using Combination Disk Diffusion test method, it was found that among 83 imipenem resistant P.aeruginosa strains, 48 (57.9%) were MBL producers. PCR and sequencing methods proved that these isolates were positive for blaIMP-1 genes, whereas none were positive for bla(VIM) genes. The mortality rate of hospitalized patients with MBL-producing Pseudomonas infection was 4/48 (8.3%). It was shown that Zataria multiflora and Carum copticum extracts had a high antibacterial effect on regular and IMP-producing P. aeruginosa strains in 6.25 mg/ml concentration. The incidence of MBL-producing P. aeruginosa in burn patients is very high. In our study, all MBL-producing isolates carry the blaIMP-1 gene. Therefore, detection of MBL-producing isolates is of great importance in identifying drug resistance patterns in P. aeruginosa, and in prevention and control of infections. In this study, it was shown that extracts of Z. multiflora and C. copticum have high antibacterial effects on ß-lactamase producing P. aeruginosa strains.

  6. Two-gigawatt burst-mode operation of the intense microwave prototype (IMP) free-electron laser (FEL) for the microwave tokamak experiment (MTX)

    SciTech Connect

    Felker, B.; Allen, S.; Bell, H.

    1993-10-06

    The MTX explored the plasma heating effects of 140 GHz microwaves from both Gyrotrons and from the IMP FEL wiggler. The Gyrotron was long pulse length (0.5 seconds maximum) and the FEL produced short-pulse length, high-peak power, single and burst modes of 140 GHZ microwaves. Full-power operations of the IMP FEL wiggler were commenced in April of 1992 and continued into October of 1992. The Experimental Test Accelerator H (ETA-II) provided a 50-nanosecond, 6-MeV, 2--3 kAmp electron beam that was introduced co-linear into the IMP FEL with a 140 GHz Gyrotron master oscillator (MO). The FEL was able to amplify the MO signal from approximately 7 kW to peaks consistently in the range of 1--2 GW. This microwave pulse was transmitted into the MTX and allowed the exploration of the linear and non-linear effects of short pulse, intense power in the MTX plasma. Single pulses were used to explore and gain operating experience in the parameter space of the IMP FEL, and finally evaluate transmission and absorption in the MTX. Single-pulse operations were repeatable. After the MTX was shut down burst-mode operations were successful at 2 kHz. This paper will describe the IMP FEL, Microwave Transmission System to MTX, the diagnostics used for calorimetric measurements, and the operations of the entire Microwave system. A discussion of correlated and uncorrelated errors that affect FEL performance will be made Linear and non-linear absorption data of the microwaves in the MTX plasma will be presented.

  7. The Wor1-like protein Fgp1 regulates pathogenicity, toxin synthesis and reproduction in the phytopathogenic fungus Fusarium graminearum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    WOR1 is a gene for a conserved fungal regulatory protein controlling the dimorphic switch and pathogenicity in Candida albicans and its ortholog in the plant pathogen Fusarium oxysporum, called SGE1, is also required for pathogenicity and expression of plant effector proteins. F. graminearum, an imp...

  8. Predominance of carbapenem-resistant Pseudomonas aeruginosa isolates carrying blaIMP and blaVIM metallo-β-lactamases in a major hospital in Costa Rica.

    PubMed

    Toval, Francisco; Guzmán-Marte, Anel; Madriz, Vivian; Somogyi, Teresita; Rodríguez, César; García, Fernando

    2015-01-01

    This study aimed to assess the molecular basis of the resistance to carbapenems in clinical isolates of Pseudomonas aeruginosa recovered from a tertiary-level health facility in San José, Costa Rica. A total of 198 non-duplicated isolates were evaluated for their susceptibility to β-lactams, aminoglycosides and fluoroquinolones. The production of metallo-β-lactamases (MBLs), the presence of MBL encoding genes (blaIMP, blaVIM and blaGIM-1) and the occurrence of these genes within class 1 integrons were investigated. In addition, an ERIC2 PCR fingerprinting method was used to elucidate the distribution of the detected MBL genes within the strain collection. Of the 198 isolates tested, 125 (63.1 %) were categorized as carbapenem-resistant. The majority (88.8 %) of the carbapemen-resistant isolates also showed resistance to ceftazidime, cefepime, aztreonam, ticarcillin/clavulanic acid, amikacin, gentamicin, tobramycin, ciprofloxacin and gatifloxacin. Among the carbapenem-resistant isolates, 102 (81.6 %) showed MBL activity. Strikingly, both blaIMP and blaVIM genes were simultaneously detected in most (94.1 %) of the 102 MBL producers. Five carbapenem-resistant MBL producers were positive only for blaIMP genes. Almost 70 % of the isolates examined harboured the intI1 gene, accompanied by the sul1 and qacEΔ1 genes in 136 (99 %) and 122 (89 %) isolates, respectively. The majority (94.4 %) of the carbapenem-resistant isolates carried the intI1 gene, in contrast to 26 % of the carbapenem-susceptible isolates. Ninety-three out of 96 (96.9 %) isolates carrying both blaIMP and blaVIM genes also harboured the intI1, sul1 and qacEΔ1 genes. Gene cassettes from carbapenem-susceptible and MBL-negative carbapenem-resistant isolates encoded aminoglycoside-resistance enzymes (aadA2, aadA4 and aadA6) as well as orfD and qacF genes. RAPD analysis distributed 126 of the isolates in 29 clusters. Eighty of the 90 blaIMP (+) blaVIM (+) isolates were sorted into 16

  9. Growth responses of entire and immunocastrated male pigs to dietary protein with and without ractopamine hydrochloride.

    PubMed

    Needham, T; Hoffman, L C; Gous, R M

    2017-02-20

    The interaction between dietary balanced protein, ractopamine (RAC) and Improvac (IMP) on the growth response of 120 individually penned male PIC© pigs was evaluated. The pigs entered the trial at 16 weeks of age and were assigned to 12 treatments using a 2×2×3 factorial design. Three balanced protein diets, formulated with standard illeal digestible lysine levels of 7.50 (low), 9.79 (medium) and 12.07 g/kg (high), were fed from 20 weeks. Improvac was administered at 16 and 20 weeks, the booster being given 4 weeks before slaughter. Ractopamine was supplemented at 10 mg/kg to the applicable treatments from 20 weeks. Live weight, backfat depth and food intake were measured on a weekly basis. Primary vaccination had no influence on the parameters measured. Immunocastration, RAC and higher protein diet treatments increased weight gain, but food intake was increased only with the use of IMP. Although weight gain increased in IMP-treated males, the increased feed intake resulted in their feed conversion efficiencies (FCE) being inferior to the intact controls. Feeding RAC only benefitted FCE when a high or medium protein diet was fed. Immunocastrates deposited more backfat after the booster vaccination than did entire males. Thus the cost of using RAC, IMP and of increasing dietary protein content needs to be weighed up against the additional revenue generated through the use of these interventions.

  10. Endothelium-Dependent Contractions of Isolated Arteries to Thymoquinone Require Biased Activity of Soluble Guanylyl Cyclase with Subsequent Cyclic IMP Production.

    PubMed

    Detremmerie, Charlotte M; Chen, Zhengju; Li, Zhuoming; Alkharfy, Khalid M; Leung, Susan W S; Xu, Aimin; Gao, Yuansheng; Vanhoutte, Paul M

    2016-09-01

    Preliminary experiments on isolated rat arteries demonstrated that thymoquinone, a compound widely used for its antioxidant properties and believed to facilitate endothelium-dependent relaxations, as a matter of fact caused endothelium-dependent contractions. The present experiments were designed to determine the mechanisms underlying this unexpected response. Isometric tension was measured in rings (with and without endothelium) of rat mesenteric arteries and aortae and of porcine coronary arteries. Precontracted preparations were exposed to increasing concentrations of thymoquinone, which caused concentration-dependent, sustained further increases in tension (augmentations) that were prevented by endothelium removal, Nω-nitro-L-arginine methyl ester [L-NAME; nitric oxide (NO) synthase inhibitor], and 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ; soluble guanylyl cyclase [sGC] inhibitor). In L-NAME-treated rings, the NO-donor diethylenetriamine NONOate restored the thymoquinone-induced augmentations; 5-[1-(phenylmethyl)-1H-indazol-3-yl]-2-furanmethanol (sGC activator) and cyclic IMP (cIMP) caused similar restorations. By contrast, in ODQ-treated preparations, the cell-permeable cGMP analog did not restore the augmentation by thymoquinone. The compound augmented the content (measured with ultra-high performance liquid chromatography-tandem mass spectrometry) of cIMP, but not that of cGMP; these increases in cIMP content were prevented by endothelium removal, L-NAME, and ODQ. The augmentation of contractions caused by thymoquinone was prevented in porcine arteries, but not in rat arteries, by 1-(5-isoquinolinylsulfonyl)homopiperazine dihydrochloride and trans-4-[(1R)-1-aminoethyl]-N-4-pyridinylcyclohexanecarboxamide dihydrochloride (Rho-kinase inhibitors); in the latter, but not in the former, it was reduced by 3,5-dichloro-N-[[(1α,5α,6-exo,6α)-3-(3,3-dimethylbutyl)-3-azabicyclo[3.1.0]hex-6-yl]methyl]-benzamide hydrochloride (T-type calcium channel inhibitor

  11. Simulations of a Gradual Solar Energetic Particle Event Observed by Helios 1, Helios 2, and IMP 8

    NASA Astrophysics Data System (ADS)

    Qin, Gang; Wang, Yang

    2015-08-01

    In this work, a gradual solar energetic particle (SEP) event observed by multi-spacecraft has been simulated. The time profiles of SEP fluxes accelerated by an interplanetary shock in the three-dimensional interplanetary space are obtained by solving numerically the Fokker-Planck focused transport equation. The interplanetary shock is modeled as a moving source of energetic particles. By fitting the 1979 March 01 SEP fluxes observed by Helios 1, Helios 2, and IMP 8 with our simulations, we obtain the best parameters for the shock acceleration efficiency model. And we also find that the particle perpendicular diffusion coefficient with the level of ˜1%-3% of parallel diffusion coefficient at 1 AU should be included. The reservoir phenomenon is reproduced in the simulations, and the longitudinal gradient of SEP fluxes in the decay phase, which is observed by three spacecraft at different locations, is more sensitive to the shock acceleration efficiency parameters than that is to the perpendicular diffusion coefficient.

  12. SATNET Development and Operation. Pluribus Satellite IMP Development, Remote Site Maintenance. Internet Development. Mobile Access Terminal Network, TCP for the HP3000, TCP-TAC.

    DTIC Science & Technology

    1980-08-01

    Report No. 4474 [ AD A089025 [ Combined Quarterly Technical Report No. 18 SATNET Development and Operation Pluribus Satellite IMP DevelopmentI Remote...BECUUMTV CLASSIFICATION OF THIS PA6t (ug. 000£a0 Report No. 4474 Bolt Beranek and Newman Inc. COMBINED QUARTERLY TECHNICAL REParNOS 18 (P...I/0 Subsystem Figure 2 18 Report No. 4474 Bolt Beranek and Newman Inc. arrival rate. Assuming a preamble of p bits, the maximum burst arrival rate for

  13. Immersion mode material pocket dynamic mechanical analysis (IMP-DMA): a novel tool to study gelatinisation of purified starches and starch-containing plant materials.

    PubMed

    Warren, Frederick J; Royall, Paul G; Butterworth, Peter J; Ellis, Peter R

    2012-09-01

    There is a clear need for improved methods for the study of the physical changes that occur in slurries and sol-gel systems that have significant water content. In this paper a novel immersion mode material pocket form of dynamic mechanical analysis (IMP-DMA) has been designed, combining material pocket technology to provide physical support to a powdered sample within an immersion bath. IMP-DMA allows the mechanical response of a powder during heating to be monitored in excess water. IMP-DMA was evaluated using a range of starch samples loaded as a slurry into a solid steel pocket, the mechanical responses of these samples were monitored as a function of temperature, and values for modulus and tanδ peaks were found to correspond well with events occurring at both the onset and peak gelatinisation temperatures as measured by differential scanning calorimetry (DSC) (e.g. wheat starch has an onset and peak DSC temperature of 49.3 °C and 57.2 °C, respectively, and shows a peak in tanδ at 52.8 °C and a modulus peak at 57.7 °C). Some limitations were found in the ability of DMA to detect transitions in starches with low or high amylose contents. IMP-DMA was shown to be an effective tool for monitoring the changes in starch structure that occur during gelatinisation, both in purified starches and in more complex starch-containing food materials. Thus, a new hyphenated form of DMA is now available that permits the thermally induced transitions of particle water dispersions to be characterised.

  14. Quantifying regional cerebral blood flow by N-isopropyl-P-[I-123]iodoamphetamine (IMP) using a ring type single-photon emission computed tomography system

    SciTech Connect

    Takahashi, N.; Odano, I.; Ohkubo, M.

    1994-05-01

    We developed a more accurate quantitative measurement of regional cerebral blood flow (rCBF) with the microsphere model using N-isopropyl-p-[I-123] iodoamphetamine (IMP) and a ring type single photon emission computed tomography (SPECT) system. SPECT studies were performed in 17 patients with brain diseases. A dose of 222 MBq (6 mCi) of [I-123]IMP was injected i.v., at the same time a 5 min period of arterial blood withdrawal was begun. SPECT data were acquired from 25 min to 60 min after tracer injection. For obtaining the brain activity concentration at 5 min after IMP injection, total brain counts collections and one minute period short time SPECT studies were performed at 5, 20, and 60 min. Measurement of the values of rCBF was calculated using short time SPECT images at 5 min (rCBF), static SPECT images corrected with total cerebral counts (rCBF{sub Ct}.) and those corrected with reconstructed counts on short time SPECT images (rCBF{sub Cb}). There was a good relationship (r=0.69) between rCBF and rCBF{sub Ct}, however, rCBF{sub Ct} tends to be underestimated in high flow areas and overestimated in low flow areas. There was better relationship between rCBF and rCBF{sub Cb}(r=0.92). The overestimation and underestimation shown in rCBF{sub Ct} was considered to be due to the correction of reconstructed counts using a total cerebral time activity curve, because of the kinetic behavior of [I-123]IMP was different in each region. We concluded that more accurate rCBF values could be obtained using the regional time activity curves.

  15. Draft Genome Sequence of a Pseudomonas sp. Strain Carrying blaIMP-25 and blaVIM-2 Carbapenemase Genes from Hospital Sewage

    PubMed Central

    Hu, Yiyi; Wu, Wenjing; Feng, Yu; Zhang, Xiaoxia

    2016-01-01

    Pseudomonas strain WCHP16 recovered from hospital sewage in West China Hospital, Chengdu, China was found to carry two carbapenemase genes blaIMP-25 and blaVIM-2. Here, we report its 5.7-Mb draft genome sequence, comprising 141 contigs and an average 59.53% G+C content. The genome contained 5,504 coding sequences and 67 tRNA genes. PMID:27795238

  16. Testing multiple hypotheses through IMP weighted FDR based on a genetic functional network with application to a new zebrafish transcriptome study.

    PubMed

    Gui, Jiang; Greene, Casey S; Sullivan, Con; Taylor, Walter; Moore, Jason H; Kim, Carol

    2015-01-01

    In genome-wide studies, hundreds of thousands of hypothesis tests are performed simultaneously. Bonferroni correction and False Discovery Rate (FDR) can effectively control type I error but often yield a high false negative rate. We aim to develop a more powerful method to detect differentially expressed genes. We present a Weighted False Discovery Rate (WFDR) method that incorporate biological knowledge from genetic networks. We first identify weights using Integrative Multi-species Prediction (IMP) and then apply the weights in WFDR to identify differentially expressed genes through an IMP-WFDR algorithm. We performed a gene expression experiment to identify zebrafish genes that change expression in the presence of arsenic during a systemic Pseudomonas aeruginosa infection. Zebrafish were exposed to arsenic at 10 parts per billion and/or infected with P. aeruginosa. Appropriate controls were included. We then applied IMP-WFDR during the analysis of differentially expressed genes. We compared the mRNA expression for each group and found over 200 differentially expressed genes and several enriched pathways including defense response pathways, arsenic response pathways, and the Notch signaling pathway.

  17. Rapid detection of blaNDM, blaKPC, blaIMP, and blaVIM carbapenemase genes in bacteria by loop-mediated isothermal amplification.

    PubMed

    Cheng, Cancan; Zheng, Fen; Rui, Yongyu

    2014-12-01

    A loop-mediated isothermal amplification (LAMP) assay was developed and evaluated for rapid detection of blaKPC, blaNDM, blaIMP, and blaVIM carbapenemase genes. Six oligonucleotides, including outer, inner, and loop primers, were designed for eight distinct regions in each target gene. Two qualitative criteria were used to evaluate LAMP reactions: visual inspection of color change and real-time detection of fluorescence change. The lower detection limit was 10 colony forming units (CFU) per reaction for real-time detection and 100 CFU per reaction for visual inspection for each gene. Two hundred twenty-two carbapenem-resistant clinical isolates (including 100 Pseudomonas aeruginosa, 100 Acinetobacter sp., and 22 Enterobacteriaceae) were tested by LAMP assay. At the same time, these isolates were confirmed by conventional polymerase chain reaction (PCR) and sequencing analysis. In these clinical isolates, the results of 11 strains with blaNDM, 11 strains with blaKPC, 11 strains with blaVIM, and 2 strains with blaIMP obtained using LAMP assays were concordant with conventional PCR. The LAMP method reported here may be a useful and powerful tool for rapid detection of blaNDM, blaKPC, blaIMP, and blaVIM carbapenemase genes in bacteria.

  18. Antibiotic Resistance Pattern and Evaluation of Metallo-Beta Lactamase Genes Including bla- IMP and bla- VIM Types in Pseudomonas aeruginosa Isolated from Patients in Tehran Hospitals.

    PubMed

    Aghamiri, Samira; Amirmozafari, Nour; Fallah Mehrabadi, Jalil; Fouladtan, Babak; Samadi Kafil, Hossein

    2014-01-01

    Beta-lactamase producing strains of Pseudomonas aeruginosa are important etiological agents of hospital infections. Carbapenems are among the most effective antibiotics used against Pseudomonas infections, but they can be rendered infective by group B β -lactamase, commonly called metallo-beta lactamase. In this study, the antimicrobial sensitivity patterns of P. aeruginosa strains isolated from 9 different hospitals in Tehran, Iran, as well as the prevalence of MBLs genes (bla- VIM and bla- IMP ) were determined. A total of 212 strains of P. aeruginosa recovered from patients in hospitals in Tehran were confirmed by both biochemical methods and PCR. Their antimicrobial sensitivity patterns were determined by Kirby-Bauer disk diffusion method. Following MIC determination, imipenem resistant strains were selected by DDST method which was followed by PCR tests for determination of MBLs genes: bla- IMP and bla- VIM . The results indicated that, in the DDST phenotypic method, among the 100 imipenem resistant isolates, 75 strains were MBLs positive. The PCR test indicated that 70 strains (33%) carried bla- VIM gene and 20 strains (9%) harbored bla- IMP . The results indicated that the extent of antibiotic resistance among Pseudomonas aeruginosa is on the rise. This may be due to production of MBLs enzymes. Therefore, determination of antibiotic sensitivity patterns and MBLs production by these bacteria, can be important in control of clinical Pseudomonas infection.

  19. Comparative Study Between The Alternative Used By The IMP Type Pecussion Drills And The Version Using Fluid Elements Regarding The Supplying, Command And Automatic Adjustment Systems Of The Injection Water Pressure

    NASA Astrophysics Data System (ADS)

    Cotetiu, Adriana; Cotetiu, Radu; Ungureanu, Nicolae

    2015-12-01

    Starting from analyzing of an existing solution regarding the injection water feeding system for the pneumatic rotating and percussion drilling installations, which is included in the structure of the perforator installation (IMP-1or IMP-2), the paper presents part of a research regarding an original solution of the automatic command and regulate with monostable fluidic elements, with different physical nature jets. This solution is applicable to this drilling installations type, made in Romania.

  20. Cloning, characterization, and regulation of the human type II IMP dehydrogenase gene

    SciTech Connect

    Glesne, D.A.; Huberman, E. |

    1997-01-01

    Human type II inosine 5{prime}-monophosphate dehydrogenase (IMPDH, EC 1.1.1.205) is the rate-limiting enzyme in de novo guanine nucleotide biosynthesis. Regulated IMPDH activity is associated with cellular proliferation, transformation, and differentiation. The authors cloned and sequenced the entire gene for type II IMPDH and here provide details regarding the organization of the gene and the characterization of its promoter. The gene spans approximately 5 kb and is disrupted by 12 introns. The transcriptional start sites were determined by S1 nuclease mapping to be somewhat heterogeneous but predominated at 102 and 85 nucleotides from the translational initiation codon. Through the use of heterologous gene constructs and transient transfection assays, a minimal promoter from {minus}206 to {minus}85 was defined. This promoter is TATA-less and contains several transcription factor motifs including four potential Sp 1 binding sites. The minimal promoter is GC-rich (69%) and resembles a CpG island. Through the use of gel mobility shift assays, nuclear proteins were shown to specifically interact with this minimal promoter. Stable transfectants were used to demonstrate that the down-regulation of IMPDH gene expression in response to reduced cellular proliferation occurs by a transcriptional mechanism.

  1. Quantitative and regional measurement of retinal blood flow in rats using N-isopropyl-p-[14C]-iodoamphetamine ([14C]-IMP).

    PubMed

    Pouliot, Mylène; Deschênes, Micheline C; Hétu, Simon; Chemtob, Sylvain; Lesk, Mark R; Couture, Réjean; Vaucher, Elvire

    2009-12-01

    Quantitative and regional measurement of retinal blood flow in rodents is of prime interest for the investigation of regulatory mechanisms of ocular circulation in physiological and pathological conditions. In this study, a quantitative autoradiographic method using N-isopropyl-p-(14)C-iodoamphetamine ([(14)C]-IMP), a diffusible radioactive tracer, was evaluated for its ability to detect changes in retinal blood perfusion during hypercapnia. Findings were compared to cerebral blood flow values measured simultaneously. Hypercapnia was induced in awaken Wistar rats by inhalation of 5% or 8% CO(2) in medical air for 5 min. [(14)C]-IMP (100 microCi/kg) was injected in the femoral vein over a 30 s period and the rats were sacrificed 2 min later. Blood flow was calculated from whole-mount retinae and 20 microm thick brain sections in discrete regions of interest by quantitative autoradiography or from digested samples of retina and brain by liquid scintillation counting. Retinal blood flow values measured with quantitative and regional autoradiography were higher in the central (108 +/- 20 ml/100 g/min) than in peripheral (84 +/- 15 ml/100 g/min) retina. These values were within the same range as cortical blood flow values (97 +/- 4 ml/100 g/min). The retinal blood flow values obtained on whole-mount retinae were validated by the sampling method. Hypercapnia significantly increased overall blood flow in the retina (24-53%) with a maximal augmentation in the peripheral region and in the brain (22-142%). The changes were stronger in the brain compared to retina (p = 0.016). These results demonstrate that retinal blood flow can be quantified using [(14)C]-IMP and compared with cerebral blood flow. This technique is a powerful tool to study how retinal blood flow is regulated in different regions of the rat retina.

  2. Solar-cycle dependence of a model turbulence spectrum using IMP and ACE observations over 38 years

    NASA Astrophysics Data System (ADS)

    Burger, R. A.; Nel, A. E.; Engelbrecht, N. E.

    2014-12-01

    Ab initio modulation models require a number of turbulence quantities as input for any reasonable diffusion tensor. While turbulence transport models describe the radial evolution of such quantities, they in turn require observations in the inner heliosphere as input values. So far we have concentrated on solar minimum conditions (e.g. Engelbrecht and Burger 2013, ApJ), but are now looking at long-term modulation which requires turbulence data over at a least a solar magnetic cycle. As a start we analyzed 1-minute resolution data for the N-component of the magnetic field, from 1974 to 2012, covering about two solar magnetic cycles (initially using IMP and then ACE data). We assume a very simple three-stage power-law frequency spectrum, calculate the integral from the highest to the lowest frequency, and fit it to variances calculated with lags from 5 minutes to 80 hours. From the fit we then obtain not only the asymptotic variance at large lags, but also the spectral index of the inertial and the energy, as well as the breakpoint between the inertial and energy range (bendover scale) and between the energy and cutoff range (cutoff scale). All values given here are preliminary. The cutoff range is a constraint imposed in order to ensure a finite energy density; the spectrum is forced to be either flat or to decrease with decreasing frequency in this range. Given that cosmic rays sample magnetic fluctuations over long periods in their transport through the heliosphere, we average the spectra over at least 27 days. We find that the variance of the N-component has a clear solar cycle dependence, with smaller values (~6 nT2) during solar minimum and larger during solar maximum periods (~17 nT2), well correlated with the magnetic field magnitude (e.g. Smith et al. 2006, ApJ). Whereas the inertial range spectral index (-1.65 ± 0.06) does not show a significant solar cycle variation, the energy range index (-1.1 ± 0.3) seems to be anti-correlated with the variance

  3. Bidirectional MeV/n ion intervals - Observations from the Goddard Space Flight Center instruments on the ISEE 3/ICE, IMP 8, Helios 1 and Helios 2 spacecraft

    NASA Technical Reports Server (NTRS)

    Richardson, I. G.; Reames, D. V.

    1991-01-01

    A search is made for intervals of bidirectional energetic ion streaming in approximately 1 MeV data from the instruments on ISEE 3/ICE, IMP 8 and Helios 1 and 2 during 1973 to 1989. The longest duration intervals are found around solar maximum, consistent with the expected association with coronal mass ejections. The ISEE 3/ICE intervals are associated with previously identified bidirectional 35-1000 keV ions and solar-wind electron heat fluxes, though additional bidirectional intervals are found.

  4. Variability of the bla(IMP-15)-containing integrons, highly related to In95, on an endemic clone of Pseudomonas aeruginosa in Mexico.

    PubMed

    Garza-Ramos, Jesus Ulises; Sanchez-Martinez, Guillermina; Barajas, Juan Manuel; Suarez, Sandra; Sanchez-Perez, Alejandro; Rojas-Moreno, Teresa; Carrillo-Quiroz, Berta; Silva-Sanchez, Jesus

    2010-09-01

    The acquisition of β-lactamases, such as class B metallo-β-lactamases, in Pseudomonas aeruginosa is detrimental to antimicrobial therapy in hospitalized patients. In Mexico, metallo-β-lactamase IMP-15 has been found to be encoded on the In95 class 1 integron in a major clone of P. aeruginosa. In this work, we describe the variability of this class 1 integron in an epidemic clone of carbapenem-resistant P. aeruginosa clinical isolates highly related to isolates previously described in Mexico.

  5. [The group study of diagnostic efficacy of cerebro-vascular disease by I-123 IMP SPECT images obtained with ring type SPECT scanner--the ROC analysis on the diagnosis of perfusion defect and redistribution].

    PubMed

    Machida, K; Matsumoto, T; Honda, N; Mamiya, T; Takahashi, T; Takishima, T; Kamano, T; Tamaki, S; Iinuma, T A; Tateno, Y

    1991-11-01

    We performed two image reading experiments in order to investigate the diagnostic capability of I-123 IMP SPECT obtained by the ring type SPECT scanner in cerebro-vascular disease. Fourteen physicians diagnosed SPECT images of 55 cases with reference to clinical neurological informations, first without brain XCT images and second with XCT images. Each physician detected perfusion defects and redistributions of I-123 IMP and assigned a confidence level of abnormality for these SPECT findings by means of five rating method. From results obtained by ROC analysis, we concluded as follows: (1) Generally, I-123 IMP SPECT is a stable diagnostic modality in the diagnosis of cerebro-vascular disease and the image reading of XCT had no effects on the diagnosis of SPECT on the whole of physician, (2) However, there were unnegligible differences among individuals in the detectability of findings and the effect of XCT image reading, (3) Detectability of redistribution of I-123 IMP was lower than that of perfusion defect and inter-observer variation in the diagnostic performance for redistribution was larger than that of perfusion defect. The results suggest that it is necessary to standardize diagnostic criteria among physicians for redistribution of I-123 IMP.

  6. Detection of blaIMP4 and blaNDM1 harboring Klebsiella pneumoniae isolates in a university hospital in Malaysia

    PubMed Central

    Hamzan, Nurul Izzati; Yean, Chan Yean; Rahman, Rosliza Abdul; Hasan, Habsah; Rahman, Zaidah Abdul

    2015-01-01

    Background Antibiotic resistance among Enterobacteriaceae posts a great challenge to the health care service. The emergence of carbapenem-resistant Klebsiella pneumoniae (CRKP) is attracting significant attention due to its rapid and global dissemination. The infection is associated with significant morbidity and mortality, thus creating challenges for infection control and managing teams to curb the infection. In Southeast Asia, there have been limited reports and subsequent research regarding CRKP infections. Thus, the study was conducted to characterize CRKP that has been isolated in our setting. Methods A total of 321 K. pneumoniae were included in the study. Each isolate went through an identification process using an automated identification system. Phenotypic characterization was determined using disk diffusion, modified Hodge test, Epsilometer test, and inhibitor combined disk test. Further detection of carbapenemase genes was carried out using polymerase chain reaction and confirmed by gene sequence analysis. Results All together, 13 isolates (4.05%) were CRKP and the majority of them were resistant to tested antibiotics except colistin and tigercycline. Among seven different carbapenemase genes studied (bla KPC, bla IMP, bla SME, bla NDM, bla IMI, bla VIM, and bla OXA), only two, bla IMP4 (1.87%) and bla NDM1 (2.18%), were detected in our setting. Conclusion Evidence suggests that the prevalence of CRKP in our setting is low, and knowledge of Carbapenem-resistant Enterobacteriaceae and CRKP has improved and become available among clinicians. PMID:25765342

  7. Translational diffusion measurements by microcoil NMR in aqueous solutions of the Fos-10 detergent-solubilized membrane protein OmpX.

    PubMed

    Horst, Reto; Stanczak, Pawel; Serrano, Pedro; Wüthrich, Kurt

    2012-06-14

    Aqueous solutions of the detergent Fos-10 (n-decylphosphocholine) without and with addition of the integral membrane protein (IMP) OmpX (outer membrane protein X) have been characterized using pulsed field gradient-stimulated echo (PFG-STE) NMR experiments for measurements of translational diffusion coefficients. Effective diffusion coefficients for Fos-10 micelles in the absence of OmpX were obtained by observation of NMR signals from 10-bromodecan-1-ol that had been inserted into the micelles, and in the presence of OmpX by NMR observation of the protein. It is thus shown that solutions of Fos-10-reconstituted OmpX can be quantitatively described as a mixture of Fos-10 monomers, uniform Fos-10 micelles, and uniform OmpX-containing Fos-10 micelles, with Fos-10 monomers in fast exchange between the pools of these three species. This result establishes an avenue for efficient determination of the effective translational diffusion coefficients of IMP-containing detergent micelles based on observation of the intense detergent NMR signals, which is also applicable with unlabeled IMPs. This monitoring of the species present in a given IMP solution contributes to improved guidelines for rational selection of detergent and buffer conditions in structural studies of integral membrane proteins.

  8. Triton X-114 phase separation in the isolation and purification of mouse liver microsomal membrane proteins.

    PubMed

    Mathias, Rommel A; Chen, Yuan-Shou; Kapp, Eugene A; Greening, David W; Mathivanan, Suresh; Simpson, Richard J

    2011-08-01

    Integral membrane proteins (IMPs) mediate several cellular functions including cell adhesion, ion and nutrient transport, and cell signalling. IMPs are typically hard to isolate and purify due to their hydrophobic nature and low cellular abundance, however, microsomes are small lipid vesicles rich in IMPs, which form spontaneously when cells are mechanically disrupted. In this study, we have employed mouse liver microsomes as a model for optimising a method for IMP isolation and characterisation. Microsomes were collected by differential centrifugation, purified with sodium carbonate, and subjected to GeLC-MS/MS analysis. A total of 1124 proteins were identified in the microsome fraction, with 47% (524/1124) predicted by TMHMM to contain at least one transmembrane domain (TMD). The ability of phase partitioning using the detergent Triton X-114 (TX-114) to further enrich for membrane proteins was evaluated. Microsomes were subjected to successive rounds of solubility-based phase separation, with proteins partitioning into the aqueous phase, detergent phase, or TX-114-insoluble pellet fraction. GeLC-MS/MS analysis of the three TX-114 fractions identified 1212 proteins, of which 146 were not detected in the un-fractionated microsome sample. Conspicuously, IMPs partitioned to the detergent phase, with 56% (435/770) of proteins identified in that fraction containing at least one TMD. GO Slim characterisation of the microsome proteome revealed enrichment of proteins from the endoplasmic reticulum, mitochondria, Golgi apparatus, endosome, and cytoplasm. Further, enzymes including monooxygenases were well represented with 35 cytochrome P450 identifications (CYPs 1A2, 2A5, 2A12, 2B10, 2C29, 2C37, 2C39, 2C44, 2C50, 2C54. 2C67, 2C68, 2C70, 2D10, 2D11, 2D22, 2D26, 2D9, 2E1, 2F2, 2J5, 2U1, 3A11, 3A13, 3A25, 4A10, 4A12A, 4A12B, 4F13, 4F14, 4F15, 4V3, 51,7B1, and 8B1). Evaluation of biological processes showed enrichment of proteins involved in fatty acid biosynthesis and

  9. DAZ Family Proteins, Key Players for Germ Cell Development.

    PubMed

    Fu, Xia-Fei; Cheng, Shun-Feng; Wang, Lin-Qing; Yin, Shen; De Felici, Massimo; Shen, Wei

    2015-01-01

    DAZ family proteins are found almost exclusively in germ cells in distant animal species. Deletion or mutations of their encoding genes usually severely impair either oogenesis or spermatogenesis or both. The family includes Boule (or Boll), Dazl (or Dazla) and DAZ genes. Boule and Dazl are situated on autosomes while DAZ, exclusive of higher primates, is located on the Y chromosome. Deletion of DAZ gene is the most common causes of infertility in humans. These genes, encoding for RNA binding proteins, contain a highly conserved RNA recognition motif and at least one DAZ repeat encoding for a 24 amino acids sequence able to bind other mRNA binding proteins. Basically, Daz family proteins function as adaptors for target mRNA transport and activators of their translation. In some invertebrate species, BOULE protein play a pivotal role in germline specification and a conserved regulatory role in meiosis. Depending on the species, DAZL is expressed in primordial germ cells (PGCs) and/or pre-meiotic and meiotic germ cells of both sexes. Daz is found in fetal gonocytes, spermatogonia and spermatocytes of adult testes. Here we discuss DAZ family genes in a phylogenic perspective, focusing on the common and distinct features of these genes, and their pivotal roles during gametogenesis evolved during evolution.

  10. Bidirectional about 1 MeV/amu ion intervals in 1973-1991 observed by the Goddard Space Flight Center instruments on IMP 8 and ISEE 3/ICE

    NASA Technical Reports Server (NTRS)

    Richardson, I. G.; Reames, D. V.

    1993-01-01

    Bidirectional energetic ion flows (BIFs) in the solar wind at 1AU during 1973-1991 are examined on the basis of about 1 MeV/amu data from the Goddard Space Flight Center instruments on ISEE3/ICE and IMP 8. BIFs are observed more frequently around solar maximum, when they are observed about 12 percent of the time compared with about 5 percent at solar minimum. Intervals with durations greater than 4 hr are observed on average approximately every 3-4 d at solar maximum and every 2 wk at solar minimum, with about 33 percent of these intervals following within 2 d of an interplanetary shock. Various coronal mass ejection signatures and BIFs greater than 1 MeV/amu usually do not coincide exactly, and additional bidirectional ion events are identified.

  11. A catalogue of solar cosmic ray events: IMPS 4 and 5, May 1967 - December 1972. [analysis of data acquired during operation of Explorer 34 and 41 satellites

    NASA Technical Reports Server (NTRS)

    Vanhollebeke, M. A.; Wang, J. R.; Mcdonald, F. B.

    1974-01-01

    This catalogue of solar cosmic ray events has been prepared for the use of solar physicists and other interested scientists. It contains some 185 solar particle events detected by the Goddard Space Flight Center Cosmic Ray Experiments on IMP's IV and V (Explorer 34 and 41) for the period May 1967 - December 1972. The data is presented in the form of hourly averages for three proton energy intervals - 0.9 - 1.6 MeV; 6 - 20 MeV and 20 - 80 MeV. In addition the time histories of .5 - 1.1 MeV electrons are shown on a separate scale. To assist in the identification of related solar events, the onset time of the electron event is indicated. The details of the instrumentation and detector techniques are described. Further descriptions of data reduction procedure and on the time-history plots are given.

  12. Investigation of Solar Wind Correlations and Solar Wind Modifications Near Earth by Multi-Spacecraft Observations: IMP 8, WIND and INTERBALL-1

    NASA Technical Reports Server (NTRS)

    Paularena, Karolen I.; Richardson, John D.; Zastenker, Georgy N.

    2002-01-01

    The foundation of this Project is use of the opportunity available during the ISTP (International Solar-Terrestrial Physics) era to compare solar wind measurements obtained simultaneously by three spacecraft - IMP 8, WIND and INTERBALL-1 at wide-separated points. Using these data allows us to study three important topics: (1) the size and dynamics of near-Earth mid-scale (with dimension about 1-10 million km) and small-scale (with dimension about 10-100 thousand km) solar wind structures; (2) the reliability of the common assumption that solar wind conditions at the upstream Lagrangian (L1) point accurately predict the conditions affecting Earth's magnetosphere; (3) modification of the solar wind plasma and magnetic field in the regions near the Earth magnetosphere, the foreshock and the magnetosheath. Our Project was dedicated to these problems. Our research has made substantial contributions to the field and has lead others to undertake similar work.

  13. SATNET development and operation, pluribus satellite IMP development, remote site maintenance, internet operations and maintenance, mobile access terminal network, TCP for the HP3000, TCP for VAK-UNIX

    NASA Astrophysics Data System (ADS)

    Haverty, J. F.

    1982-08-01

    This Quarterly Technical Report describes work on the development of and experimentation with packet broadcast by satellite; on development of Pluribus Satellite IMPs (Interface Message Provision); on a study of the technology of Remote Site Maintenance; on Internetwork monitoring; on shipboard satellite communications; and on the development of Transmission control Protocols for the HP3000 and VAX-UNIX.

  14. SATNET development and operation, Pluribus Satellite IMP development, Remote Site maintenance, Internet operations and maintenance, Mobile Access Terminal Network, TCP for the HP3000, TCP for VAX-UNIX

    NASA Astrophysics Data System (ADS)

    Haverty, J. F.

    1982-05-01

    This Quarterly Technical Report describes work on the development of and experimentation with packet broadcast by satellite; on development of Pluribus Satellite IMPs; on a study of the technology of Remote Site Maintenance; on Internetwork monitoring; on shipboard satellite communications; and on the development of Transmission Control Protocols for the HP3000 and VAX-UNIX.

  15. SATNET development and operation. Pluribus satellite IMP development. Remote site maintenance. Internet development. Mobile access terminal network. TCP for the HP3000. TCP-TAC. TCP for VAX-UNIX

    NASA Astrophysics Data System (ADS)

    Bressler, R. D.

    1981-05-01

    This Quarterly Technical Report describes work on the development of and experimentation with packet broadcast by satellite; on development of Pluribus Satellite IMPs; on a study of the technology of Remote Site Maintenance; on the development of Inter-network monitoring; on shipboard satellite communications; and on the development of Transmission control protocols for the HP3000, TAC, and VAX-UNIX.

  16. Membrane protein stability can be compromised by detergent interactions with the extramembranous soluble domains

    PubMed Central

    Yang, Zhengrong; Wang, Chi; Zhou, Qingxian; An, Jianli; Hildebrandt, Ellen; Aleksandrov, Luba A; Kappes, John C; DeLucas, Lawrence J; Riordan, John R; Urbatsch, Ina L; Hunt, John F; Brouillette, Christie G

    2014-01-01

    Detergent interaction with extramembranous soluble domains (ESDs) is not commonly considered an important determinant of integral membrane protein (IMP) behavior during purification and crystallization, even though ESDs contribute to the stability of many IMPs. Here we demonstrate that some generally nondenaturing detergents critically destabilize a model ESD, the first nucleotide-binding domain (NBD1) from the human cystic fibrosis transmembrane conductance regulator (CFTR), a model IMP. Notably, the detergents show equivalent trends in their influence on the stability of isolated NBD1 and full-length CFTR. We used differential scanning calorimetry (DSC) and circular dichroism (CD) spectroscopy to monitor changes in NBD1 stability and secondary structure, respectively, during titration with a series of detergents. Their effective harshness in these assays mirrors that widely accepted for their interaction with IMPs, i.e., anionic > zwitterionic > nonionic. It is noteworthy that including lipids or nonionic detergents is shown to mitigate detergent harshness, as will limiting contact time. We infer three thermodynamic mechanisms from the observed thermal destabilization by monomer or micelle: (i) binding to the unfolded state with no change in the native structure (all detergent classes); (ii) native state binding that alters thermodynamic properties and perhaps conformation (nonionic detergents); and (iii) detergent binding that directly leads to denaturation of the native state (anionic and zwitterionic). These results demonstrate that the accepted model for the harshness of detergents applies to their interaction with an ESD. It is concluded that destabilization of extramembranous soluble domains by specific detergents will influence the stability of some IMPs during purification. PMID:24652590

  17. Membrane protein stability can be compromised by detergent interactions with the extramembranous soluble domains.

    PubMed

    Yang, Zhengrong; Wang, Chi; Zhou, Qingxian; An, Jianli; Hildebrandt, Ellen; Aleksandrov, Luba A; Kappes, John C; DeLucas, Lawrence J; Riordan, John R; Urbatsch, Ina L; Hunt, John F; Brouillette, Christie G

    2014-06-01

    Detergent interaction with extramembranous soluble domains (ESDs) is not commonly considered an important determinant of integral membrane protein (IMP) behavior during purification and crystallization, even though ESDs contribute to the stability of many IMPs. Here we demonstrate that some generally nondenaturing detergents critically destabilize a model ESD, the first nucleotide-binding domain (NBD1) from the human cystic fibrosis transmembrane conductance regulator (CFTR), a model IMP. Notably, the detergents show equivalent trends in their influence on the stability of isolated NBD1 and full-length CFTR. We used differential scanning calorimetry (DSC) and circular dichroism (CD) spectroscopy to monitor changes in NBD1 stability and secondary structure, respectively, during titration with a series of detergents. Their effective harshness in these assays mirrors that widely accepted for their interaction with IMPs, i.e., anionic > zwitterionic > nonionic. It is noteworthy that including lipids or nonionic detergents is shown to mitigate detergent harshness, as will limiting contact time. We infer three thermodynamic mechanisms from the observed thermal destabilization by monomer or micelle: (i) binding to the unfolded state with no change in the native structure (all detergent classes); (ii) native state binding that alters thermodynamic properties and perhaps conformation (nonionic detergents); and (iii) detergent binding that directly leads to denaturation of the native state (anionic and zwitterionic). These results demonstrate that the accepted model for the harshness of detergents applies to their interaction with an ESD. It is concluded that destabilization of extramembranous soluble domains by specific detergents will influence the stability of some IMPs during purification.

  18. A Guide to Differential Scanning Calorimetry of Membrane and Soluble Proteins in Detergents.

    PubMed

    Yang, Zhengrong; Brouillette, Christie G

    2016-01-01

    Differential scanning calorimetry (DSC) detects protein thermal unfolding by directly measuring the heat absorbed. Simple DSC experiments that require relatively small amounts of pure material can provide a wealth of information related to structure, especially with respect to domain architecture, without the need for a complete thermodynamic analysis. Thus, DSC is an ideal additional tool for membrane protein characterization and also offers several advantages over indirect thermal unfolding methods. Integral membrane proteins (IMPs) that comprise both large multitopic transmembrane domains (TMDs) and extramembranous domains (EMDs) are differentially affected by detergent interactions with both domains. In fact, in some cases, destabilization of the EMD by detergent may dominate overall IMP stability. This chapter will (1) provide a perspective on the advantages of DSC for membrane protein characterization and stability measurements, including numerous examples spanning decades of research; (2) introduce models for the interaction and destabilization of IMPs by detergents; (3) discuss two case studies from the authors' lab; and (4) offer practical advice for performing DSC in the presence of detergents.

  19. Interspecies Dissemination of a Mobilizable Plasmid Harboring blaIMP-19 and the Possibility of Horizontal Gene Transfer in a Single Patient

    PubMed Central

    Gomi, Ryota; Matsuda, Tomonari; Tanaka, Michio; Nagao, Miki; Takakura, Shunji; Uemoto, Shinji; Ichiyama, Satoshi

    2016-01-01

    Carbapenemase-producing Gram-negative bacilli have been a global concern over the past 2 decades because these organisms can cause severe infections with high mortality rates. Carbapenemase genes are often carried by mobile genetic elements, and resistance plasmids can be transferred through conjugation. We conducted whole-genome sequencing (WGS) to demonstrate that the same plasmid harboring a metallo-β-lactamase gene was detected in two different species isolated from a single patient. Metallo-β-lactamase-producing Achromobacter xylosoxidans (KUN4507), non-metallo-β-lactamase-producing Klebsiella pneumoniae (KUN4843), and metallo-β-lactamase-producing K. pneumoniae (KUN5033) were sequentially isolated from a single patient and then analyzed in this study. Antimicrobial susceptibility testing, molecular typing (pulsed-field gel electrophoresis and multilocus sequence typing), and conjugation analyses were performed by conventional methods. Phylogenetic and molecular clock analysis of K. pneumoniae isolates were performed with WGS, and the nucleotide sequences of plasmids detected from these isolates were determined using WGS. Conventional molecular typing revealed that KUN4843 and KUN5033 were identical, whereas the phylogenetic tree analysis revealed a slight difference. These two isolates were separated from the most recent common ancestor 0.74 years before they were isolated. The same resistance plasmid harboring blaIMP-19 was detected in metallo-β-lactamase-producing A. xylosoxidans and K. pneumoniae. Although this plasmid was not self-transferable, the conjugation of this plasmid from A. xylosoxidans to non-metallo-β-lactamase-producing K. pneumoniae was successfully performed. The susceptibility patterns for metallo-β-lactamase-producing K. pneumoniae and the transconjugant were similar. These findings supported the possibility of the horizontal transfer of plasmid-borne blaIMP-19 from A. xylosoxidans to K. pneumoniae in a single patient. PMID

  20. Difficult-to-detect carbapenem-resistant IMP13-producing P. aeruginosa: experience feedback concerning a cluster of urinary tract infections at a surgical clinic in France

    PubMed Central

    2013-01-01

    Background We report a carbapenem-resistant P. aeruginosa clone responsible for a cluster of urinary tract infections in elderly surgery patients, diagnosed during a three-month period in a 59-bed surgical clinic. Findings The clonal nature of the cluster was established by molecular study of the P. aeruginosa isolates (PFGE and MLST). Despite an MIC of imipenem in the susceptibility range for two isolates, all were metallo-β-lactamase-producers (IMP13-type, clone ST621). We conducted a review of the medical and surgical procedures. We tested water delivered into the clinic and urological devices for the presence of the epidemic strain. The hygiene nurse observed hygiene practices. A week after the implementation of barrier precautions around the fourth infected patient, we studied the extent to which the patients hospitalised were colonised to assess whether the spread of the epidemic strain had been controlled. Conclusions 1/ Our findings indicate the difficulties in the detection of the metallo-β-lactamase in this clone, that resulted in the alert being delayed. 2/ Unlike most investigations of UTI outbreaks described in urology wards, we did not detect any contaminated urological devices or water colonisation. 3/ Consistent with outbreaks involving the IMP-13 clone in critical care units, the observation of inadequate application of standard precautions argued for patient-to-patient transmission during urinary management of the urology patients. 4/ The implementation of barrier precautions around infected patients resulted in control of the spread of the epidemic clone. This report serves as an alert concerning a difficult-to-detect multidrug-resistant P. aeruginosa clone in elderly urology patients. PMID:23557539

  1. Integral membrane proteins in proteomics. How to break open the black box?

    PubMed

    Vit, O; Petrak, J

    2017-02-05

    Integral membrane proteins (IMPs) are coded by 20-30% of human genes and execute important functions - transmembrane transport, signal transduction, cell-cell communication, cell adhesion to the extracellular matrix, and many other processes. Due to their hydrophobicity, low expression and lack of trypsin cleavage sites in their transmembrane segments, IMPs have been generally under-represented in routine proteomic analyses. However, the field of membrane proteomics has changed markedly in the past decade, namely due to the introduction of filter assisted sample preparation (FASP), the establishment of cell surface capture (CSC) protocols, and the development of methods that enable analysis of the hydrophobic transmembrane segments. This review will summarize the recent developments in the field and outline the most successful strategies for the analysis of integral membrane proteins.

  2. Medium-throughput production of recombinant human proteins: protein production in insect cells.

    PubMed

    Mahajan, Pravin; Strain-Damerell, Claire; Gileadi, Opher; Burgess-Brown, Nicola A

    2014-01-01

    This chapter describes the step-by-step methods employed by the Structural Genomics Consortium (SGC) for screening and producing proteins in the baculovirus expression vector system (BEVS). This eukaryotic expression system was selected and a screening process established in 2007 as a measure to tackle the more challenging kinase, RNA-DNA processing and integral membrane protein families on our target list. Here, we discuss our platform for identifying soluble proteins from 3 ml of insect cell culture and describe the procedures involved in producing protein from liter-scale cultures. Although not discussed in this chapter, the same process can also be applied to integral membrane proteins (IMPs) with slight adaptations to the purification procedure.

  3. Role of p70S6K1-mediated phosphorylation of eIF4B and PDCD4 proteins in the regulation of protein synthesis.

    PubMed

    Dennis, Michael D; Jefferson, Leonard S; Kimball, Scot R

    2012-12-14

    Modulation of mRNA binding to the 40 S ribosomal subunit during translation initiation controls not only global rates of protein synthesis but also regulates the pattern of protein expression by allowing for selective inclusion, or exclusion, of mRNAs encoding particular proteins from polysomes. The mRNA binding step is modulated by signaling through a protein kinase known as the mechanistic target of rapamycin complex 1 (mTORC1). mTORC1 directly phosphorylates the translational repressors eIF4E binding proteins (4E-BP) 1 and 2, releasing them from the mRNA cap binding protein eIF4E, thereby promoting assembly of the eIF4E·eIF4G complex. mTORC1 also phosphorylates the 70-kDa ribosomal protein S6 kinase 1 (p70S6K1), which subsequently phosphorylates eIF4B, and programmed cell death 4 (PDCD4), which sequesters eIF4A from the eIF4E·eIF4G complex, resulting in repressed translation of mRNAs with highly structured 5'-untranslated regions. In the present study, we compared the role of the 4E-BPs in the regulation of global rates of protein synthesis to that of eIF4B and PDCD4. We found that maintenance of eIF4E interaction with eIF4G was not by itself sufficient to sustain global rates of protein synthesis in the absence of mTORC1 signaling to p70S6K1; phosphorylation of both eIF4B and PDCD4 was additionally required. We also found that the interaction of eIF4E with eIF4G was maintained in the liver of fasted rats as well as in serum-deprived mouse embryo fibroblasts lacking both 4E-BP1 and 4E-BP2, suggesting that the interaction of eIF4G with eIF4E is controlled primarily through the 4E-BPs.

  4. Empirical in operando analysis of the charge carrier dynamics in hematite photoanodes by PEIS, IMPS and IMVS† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c6cp04683e Click here for additional data file.

    PubMed Central

    Ellis, David Shai; Dotan, Hen

    2016-01-01

    In this Perspective, we introduce intensity modulated photocurrent/voltage spectroscopy (IMPS and IMVS) as powerful tools for the analysis of charge carrier dynamics in photoelectrochemical (PEC) cells for solar water splitting, taking hematite (α-Fe2O3) photoanodes as a case study. We complete the picture by including photoelectrochemical impedance spectroscopy (PEIS) and linking the trio of PEIS, IMPS and IMVS, introduced here as photoelectrochemical immittance triplets (PIT), both mathematically and phenomenologically, demonstrating what conclusions can be extracted from these measurements. A novel way of analyzing the results by an empirical approach with minimal presumptions is introduced, using the distribution of relaxation times (DRT) function. The DRT approach is compared to conventional analysis approaches that are based on physical models and therefore come with model presumptions. This work uses a thin film hematite photoanode as a model system, but the approach can be applied to other PEC systems as well. PMID:27524381

  5. Characterization of pKP-M1144, a Novel ColE1-Like Plasmid Encoding IMP-8, GES-5, and BEL-1 β-Lactamases, from a Klebsiella pneumoniae Sequence Type 252 Isolate.

    PubMed

    Papagiannitsis, Costas C; Dolejska, Monika; Izdebski, Radoslaw; Dobiasova, Hana; Studentova, Vendula; Esteves, Francisco J; Derde, Lennie P G; Bonten, Marc J M; Hrabák, Jaroslav; Gniadkowski, Marek

    2015-08-01

    IMP-8 metallo-β-lactamase was identified in Klebsiella pneumoniae sequence type 252 (ST252), isolated in a Portuguese hospital in 2009. blaIMP-8 was the first gene cassette of a novel class 3 integron, In1144, also carrying the blaGES-5, blaBEL-1, and aacA4 cassettes. In1144 was located on a ColE1-like plasmid, pKP-M1144 (12,029 bp), with a replication region of limited nucleotide similarity to those of other RNA-priming plasmids, such as pJHCMW1. In1144 and pKP-M1144 represent an interesting case of evolution of resistance determinants in Gram-negative bacteria.

  6. Divergence in the evolution of Paleolithic symbolic and technological systems: The shining bull and engraved tablets of Rocher de l'Impératrice.

    PubMed

    Naudinot, Nicolas; Bourdier, Camille; Laforge, Marine; Paris, Céline; Bellot-Gurlet, Ludovic; Beyries, Sylvie; Thery-Parisot, Isabelle; Le Goffic, Michel

    2017-01-01

    The development of the Azilian in Western Europe 14,000 years ago is considered a "revolution" in Upper Paleolithic Archaeology. One of the main elements of this rapid social restructuring is the abandonment of naturalistic figurative art on portable pieces or on cave walls in the Magdalenian in favor of abstract expression on small pebbles. Recent work shows that the transformation of human societies between the Magdalenian and the Azilian was more gradual. The discovery of a new Early Azilian site with decorated stones in France supports this hypothesis. While major changes in stone tool technology between the Magdalenian and Azilian clearly mark important adaptive changes, the discovery of 45 engraved schist tablets from archaeological layers at Le Rocher de l'Impératrice attests to iconographic continuity together with special valorization of aurochs as shown by a "shining" bull depiction. This evidence suggests that some cultural features such as iconography may lag far behind technological changes. We also argue that eventual change in symbolic expression, which includes the later disappearance of figurative art, provides new insight into the probable restructuring of the societies.

  7. A correlative study of simultaneously measured He(++) fluxes in the solar wind and in the magnetosphere utilizing Imp-1 and 1971-089A satellite data

    NASA Technical Reports Server (NTRS)

    Shelley, E. G.

    1975-01-01

    Simultaneously measured He(++) fluxes in the solar wind and in the magnetosphere were studied using data from the plasma spectrometer on the Imp I satellite and the energetic ion mass spectrometer on the low altitude polar orbiting satellite 1971-89A. A detailed comparison of the He(++) energy spectra measured simultaneously in the solar wind and in the low altitude dayside polar cusp on March 7, 1972 was made. The energy-per-unit-charge range of the energetic ion mass spectrometer on board the polar orbiting satellite was 700 eV to 12 keV. Within this range there was a clear maximum in the He(++) energy spectrum at approximately 1.5 keV/nucleon. There was not a clearly defined maximum in the H(+) spectrum, but the data were consistent with a peak between 0.7 and 1.0 keV/nucleon. Both spectra could be reasonably well fit with a convecting Maxwellian plus a high energy tail; however, the mean velocity for He(++) distribution was significantly greater than that for the H(+) distribution. The simultaneous solar wind measurements showed the mean velocities for both ion species to be approximately 600 km/sec. The discrepancies between the relative velocity distributions in the low altitude cusp and those in the solar wind are consistent with a potential difference of approximately 1.4 kV along their flow direction between the two points of observation.

  8. Divergence in the evolution of Paleolithic symbolic and technological systems: The shining bull and engraved tablets of Rocher de l'Impératrice

    PubMed Central

    Naudinot, Nicolas; Bourdier, Camille; Laforge, Marine; Paris, Céline; Bellot-Gurlet, Ludovic; Beyries, Sylvie; Thery-Parisot, Isabelle; Le Goffic, Michel

    2017-01-01

    The development of the Azilian in Western Europe 14,000 years ago is considered a “revolution” in Upper Paleolithic Archaeology. One of the main elements of this rapid social restructuring is the abandonment of naturalistic figurative art on portable pieces or on cave walls in the Magdalenian in favor of abstract expression on small pebbles. Recent work shows that the transformation of human societies between the Magdalenian and the Azilian was more gradual. The discovery of a new Early Azilian site with decorated stones in France supports this hypothesis. While major changes in stone tool technology between the Magdalenian and Azilian clearly mark important adaptive changes, the discovery of 45 engraved schist tablets from archaeological layers at Le Rocher de l’Impératrice attests to iconographic continuity together with special valorization of aurochs as shown by a “shining” bull depiction. This evidence suggests that some cultural features such as iconography may lag far behind technological changes. We also argue that eventual change in symbolic expression, which includes the later disappearance of figurative art, provides new insight into the probable restructuring of the societies. PMID:28257445

  9. Use of Imipenem To Detect KPC, NDM, OXA, IMP, and VIM Carbapenemase Activity from Gram-Negative Rods in 75 Minutes Using Liquid Chromatography-Tandem Mass Spectrometry

    PubMed Central

    Kulkarni, M. V.; Zurita, A. N.; Pyka, J. S.; Murray, T. S.; Hodsdon, M. E.

    2014-01-01

    Resistance to extended-spectrum β-lactam antibiotics has led to a greater reliance upon carbapenems, but the expression of carbapenemases threatens to limit the utility of these drugs. Current methods to detect carbapenemase activity are suboptimal, requiring prolonged incubations during which ineffective therapy may be prescribed. We previously described a sensitive and specific assay for the detection of carbapenemase activity using ertapenem and liquid chromatography-tandem mass spectrometry (LC-MS/MS). In this study, we assessed 402 Gram-negative rods, including both Enterobacteriaceae and non-Enterobacteriaceae expressing IMP, VIM, KPC, NDM, and/or OXA carbapenemases, by using imipenem, meropenem, and ertapenem with LC-MS/MS assays. LC-MS/MS methods for the detection of intact and hydrolyzed carbapenems from an enrichment broth were developed. No ion suppression was observed, and the limits of detection for all three drugs were below 0.04 μg/ml. The sensitivity and specificity of meropenem and ertapenem for carbapenemase activity among non-Enterobacteriaceae were low, but imipenem demonstrated a sensitivity and specificity of 96% and 95%, respectively, among all Gram-negative rods (GNR) tested, including both Enterobacteriaceae and non-Enterobacteriaceae. LC-MS/MS allows for the analysis of more complex matrices, and this LC-MS/MS assay could easily be adapted for use with primary specimens requiring growth enrichment. PMID:24789180

  10. Polymer-based cell-free expression of ligand-binding family B G-protein coupled receptors without detergents

    PubMed Central

    Klammt, Christian; Perrin, Marilyn H; Maslennikov, Innokentiy; Renault, Ludovic; Krupa, Martin; Kwiatkowski, Witek; Stahlberg, Henning; Vale, Wylie; Choe, Senyon

    2011-01-01

    G-protein coupled receptors (GPCRs) constitute the largest family of intercellular signaling molecules and are estimated to be the target of more than 50% of all modern drugs. As with most integral membrane proteins (IMPs), a major bottleneck in the structural and biochemical analysis of GPCRs is their expression by conventional expression systems. Cell-free (CF) expression provides a relatively new and powerful tool for obtaining preparative amounts of IMPs. However, in the case of GPCRs, insufficient homogeneity of the targeted protein is a problem as the in vitro expression is mainly done with detergents, in which aggregation and solubilization difficulties, as well as problems with proper folding of hydrophilic domains, are common. Here, we report that using CF expression with the help of a fructose-based polymer, NV10 polymer (NVoy), we obtained preparative amounts of homogeneous GPCRs from the three GPCR families. We demonstrate that two GPCR B family members, corticotrophin-releasing factor receptors 1 and 2β are not only solubilized in NVoy but also have functional ligand-binding characteristics with different agonists and antagonists in a detergent-free environment as well. Our findings open new possibilities for functional and structural studies of GPCRs and IMPs in general. PMID:21465615

  11. RNA stabilizing proteins as molecular targets in cardiovascular pathologies

    PubMed Central

    Babu, Sahana Suresh; Joladarashi, Darukeshwara; Jeyabal, Prince; Thandavarayan, Rajarajan Amirthalingam; Krishnamurthy, Prasanna

    2015-01-01

    The stability of mRNA has emerged as a key step in the regulation of eukaryotic gene expression and function. RNA stabilizing proteins (RSPs) contain several RNA recognition motifs, and selectively bind to Adenylate- and uridylate- Rich Elements in the 3′ untranslated region of several mRNAs leading to altered processing, stability and translation. These post-transcriptional gene regulations play a critical role in cellular homeostasis; therefore act as molecular switch between ‘normal cell’ and ‘disease state’. Many mRNA binding proteins have been discovered to date, which either stabilize (HuR/HuA, HuB, HuC, HuD) or destabilize (AUF1, Tristetraprolin, KSRP) the target transcripts. Although the function of RSPs has been widely studied in cancer biology, its role in cardiovascular pathologies is only beginning to evolve. The current review provides an overall understanding of the potential role of RSP, specifically HuR-mediated mRNA stability in myocardial infarction, hypertension and hypertrophy. Also, the effect of RSPs on various cellular processes including inflammation, fibrosis, angiogenesis, cell-death and proliferation and its relevance to cardiovascular pathophysiological processes is presented. We also discuss the potential clinical implications of RSPs as therapeutic targets in cardiovascular diseases. PMID:25801788

  12. Detection of P. aeruginosa harboring bla CTX-M-2, bla GES-1 and bla GES-5, bla IMP-1 and bla SPM-1 causing infections in Brazilian tertiary-care hospital

    PubMed Central

    2012-01-01

    Background Nosocomial infections caused by Pseudomonas aeruginosa presenting resistance to beta-lactam drugs are one of the most challenging targets for antimicrobial therapy, leading to substantial increase in mortality rates in hospitals worldwide. In this context, P. aeruginosa harboring acquired mechanisms of resistance, such as production of metallo-beta-lactamase (MBLs) and extended-spectrum beta-lactamases (ESBLs) have the highest clinical impact. Hence, this study was designed to investigate the presence of genes codifying for MBLs and ESBLs among carbapenem resistant P. aeruginosa isolated in a Brazilian 720-bed teaching tertiary care hospital. Methods Fifty-six carbapenem-resistant P. aeruginosa strains were evaluated for the presence of MBL and ESBL genes. Strains presenting MBL and/or ESBL genes were submitted to pulsed-field gel electrophoresis for genetic similarity evaluation. Results Despite the carbapenem resistance, genes for MBLs (blaSPM-1 or blaIMP-1) were detected in only 26.7% of isolates. Genes encoding ESBLs were detected in 23.2% of isolates. The blaCTX-M-2 was the most prevalent ESBL gene (19.6%), followed by blaGES-1 and blaGES-5 detected in one isolate each. In all isolates presenting MBL phenotype by double-disc synergy test (DDST), the blaSPM-1 or blaIMP-1 genes were detected. In addition, blaIMP-1 was also detected in three isolates which did not display any MBL phenotype. These isolates also presented the blaCTX-M-2 gene. The co-existence of blaCTX-M-2 with blaIMP-1 is presently reported for the first time, as like as co-existence of blaGES-1 with blaIMP-1. Conclusions In this study MBLs production was not the major mechanism of resistance to carbapenems, suggesting the occurrence of multidrug efflux pumps, reduction in porin channels and production of other beta-lactamases. The detection of blaCTX-M-2,blaGES-1 and blaGES-5 reflects the recent emergence of ESBLs among antimicrobial resistant P. aeruginosa and the extraordinary

  13. First description of NDM-1-, KPC-2-, VIM-2- and IMP-4-producing Klebsiella pneumoniae strains in a single Chinese teaching hospital.

    PubMed

    Liu, Y; Wan, L-G; Deng, Q; Cao, X-W; Yu, Y; Xu, Q-F

    2015-01-01

    A total of 180 non-duplicate carbapenem-resistant Klebsiella pneumoniae isolates were recovered from patients hospitalized between December 2010 and January 2012 at a Chinese hospital. Eight KPC-2, four NDM-1, one VIM-2, and five KPC-2 plus IMP-4 producers were identified and all were multidrug resistant due to the presence of other resistance determinants, including extended-spectrum β-lactamases (CTX-M-15, SHV-12), 16S rRNA methylases (armA, rmtB) and plasmid-mediated quinolone-resistance determinants (qnrA, B, S, aac(6')-Ib-cr). Nine K. pneumoniae clones (Kpn-A1/ST395, Kpn-A3/ST11, Kpn-A2/ST134, Kpn-B/ST263, Kpn-C/ST37, Kpn-D/ST39, Kpn-E/ST1151, Kpn-F/ST890, Kpn-G/ST1153) were identified. bla KPC-2 was located on transferable ~65 kb IncL/M (ST395, ST11, ST134, ST39) and ~100 kb IncA/C (ST37, ST1153, ST890) plasmids, respectively. On the other hand, bla NDM-1 was associated with a ~70 kb IncA/C plasmid (ST263). However, non-typable plasmids of ~40 kb containing bla VIM-2 were detected in the ST1151 clone. This work reports the first co-occurrence of four diverse types of carbapenemase of K. pneumoniae clones from a single hospital in China. IncA/C, IncL/M, and other successful plasmids may be important for the dissemination of carbapenemases, producing a complex epidemiological picture.

  14. GLANCE - calculatinG heaLth impActs of atmospheric pollutioN in a Changing climatE

    NASA Astrophysics Data System (ADS)

    Vogel, Leif; Faria, Sérgio; Markandya, Anil

    2016-04-01

    Current annual global estimates of premature deaths from poor air quality are estimated in the range of 2.6-4.4 million, and 2050 projections are expected to double against 2010 levels. In Europe, annual economic burdens are estimated at around 750 bn €. Climate change will further exacerbate air pollution burdens; therefore, a better understanding of the economic impacts on human societies has become an area of intense investigation. European research efforts are being carried out within the MACC project series, which started in 2005. The outcome of this work has been integrated into a European capacity for Earth Observation, the Copernicus Atmospheric Monitoring Service (CAMS). In MACC/CAMS, key pollutant concentrations are computed at the European scale and globally by employing chemically-driven advanced transport models. The project GLANCE (calculatinG heaLth impActs of atmospheric pollutioN in a Changing climatE) aims at developing an integrated assessment model for calculating the health impacts and damage costs of air pollution at different physical scales. It combines MACC/CAMS (assimilated Earth Observations, an ensemble of chemical transport models and state of the art ECWMF weather forecasting) with downscaling based on in-situ network measurements. The strengthening of modelled projections through integration with empirical evidence reduces errors and uncertainties in the health impact projections and subsequent economic cost assessment. In addition, GLANCE will yield improved data accuracy at different time resolutions. This project is a multidisciplinary approach which brings together expertise from natural sciences and socio economic fields. Here, its general approach will be presented together with first results for the years 2007 - 2012 on the European scale. The results on health impacts and economic burdens are compared to existing assessments.

  15. Domain-specific phosphomimetic mutation allows dissection of different protein kinase C (PKC) isotype-triggered activities of the RNA binding protein HuR.

    PubMed

    Schulz, Sebastian; Doller, Anke; Pendini, Nicole R; Wilce, Jacqueline A; Pfeilschifter, Josef; Eberhardt, Wolfgang

    2013-12-01

    The ubiquitous mRNA binding protein human antigen R (HuR) participates in the post-transcriptional regulation of many AU-rich element (ARE)-bearing mRNAs. Previously, by using in vitro kinase assay, we have identified serines (Ser) 158, 221 and 318 as targets of protein kinase C (PKC)-triggered phosphorylation. In this study, we tested whether GFP- or GST-tagged HuR constructs bearing a phosphomimetic Ser (S)-to-Asp (D) substitution at the different PKC target sites, would affect different HuR functions including HuR nucleo-cytoplasmic redistribution and binding to different types of ARE-containing mRNAs. The phosphomimetic GFP-tagged HuR protein bearing a phosphomimetic substitution in the hinge region of HuR (HuR-S221D) showed an increased cytoplasmic abundance when compared to wild-type HuR. Conversely, data from in vitro kinase assay and electrophoretic mobility shift assay (EMSA), implicates that phosphorylation at Ser 221 is not relevant for mRNA binding of HuR. Quantification of in vitro binding affinities of GST-tagged wild-type HuR and corresponding HuR proteins bearing a phosphomimetic substitution in either RRM2 (HuR-S158D) or in RRM3 (HuR-S318D) by microscale thermophoresis (MST) indicates a specific binding of wild-type HuR to type I, II or type III-ARE-oligonucleotides in the high nanomolar range. Interestingly, phosphomimetic mutation at position 158 or 318 had a negative influence on HuR binding to type I- and type II-ARE-mRNAs whereas it significantly enhanced HuR affinity to a type III-ARE substrate. Our data suggest that differential phosphorylation of HuR by PKCs at different HuR domains coordinates subcellular HuR distribution and leads to a preferential binding to U-rich bearing target mRNA.

  16. N6-methyladenosine alters RNA structure to regulate binding of a low-complexity protein.

    PubMed

    Liu, Nian; Zhou, Katherine I; Parisien, Marc; Dai, Qing; Diatchenko, Luda; Pan, Tao

    2017-02-25

    N6-methyladenosine (m6A) is the most abundant internal modification in eukaryotic messenger RNA (mRNA), and affects almost every stage of the mRNA life cycle. The YTH-domain proteins can specifically recognize m6A modification to control mRNA maturation, translation and decay. m6A can also alter RNA structures to affect RNA-protein interactions in cells. Here, we show that m6A increases the accessibility of its surrounding RNA sequence to bind heterogeneous nuclear ribonucleoprotein G (HNRNPG). Furthermore, HNRNPG binds m6A-methylated RNAs through its C-terminal low-complexity region, which self-assembles into large particles in vitro. The Arg-Gly-Gly repeats within the low-complexity region are required for binding to the RNA motif exposed by m6A methylation. We identified 13,191 m6A sites in the transcriptome that regulate RNA-HNRNPG interaction and thereby alter the expression and alternative splicing pattern of target mRNAs. Low-complexity regions are pervasive among mRNA binding proteins. Our results show that m6A-dependent RNA structural alterations can promote direct binding of m6A-modified RNAs to low-complexity regions in RNA binding proteins.

  17. Cytochalasin releases mRNA from the cytoskeletal framework and inhibits protein synthesis.

    PubMed Central

    Ornelles, D A; Fey, E G; Penman, S

    1986-01-01

    Cytochalasin D was shown to be a reversible inhibitor of protein synthesis in HeLa cells. The inhibition was detectable at drug levels typically used to perturb cell structure and increased in a dose-dependent manner. The drug also released mRNA from the cytoskeletal framework in direct proportion to the inhibition of protein synthesis. The released mRNA was unaltered in its translatability as measured in vitro but was no longer translated in the cytochalasin-treated HeLa cells. The residual protein synthesis occurred on polyribosomes that were reduced in amount but displayed a normal sedimentation distribution. The results support the hypothesis that mRNA binding to the cytoskeletal framework is necessary although not sufficient for translation. Analysis of the cytoskeletal framework, which binds the polyribosomes, revealed no alterations in composition or amount of protein as a result of treatment with cytochalasin D. Electron microscopy with embedment-free sections shows the framework in great detail. The micrographs revealed the profound reorganization effected by the drug but did not indicate substantial disaggregation of the cytoskeletal elements. Images PMID:3785175

  18. A 40 kd protein binds specifically to the 5'-untranslated regions of yeast mitochondrial mRNAs.

    PubMed Central

    Papadopoulou, B; Dekker, P; Blom, J; Grivell, L A

    1990-01-01

    Using a gel mobility shift assay we show that a 40 kd protein (p40), present in extracts of yeast mitochondria, binds specifically to the 5'-untranslated leader of cytochrome c oxidase subunit II mRNA. Binding of p40 to coxII RNA protects an 8-10 nucleotide segment from diethylpyocarbonate modification, indicating that the protein interacts with only a restricted region of the 5'-leader. This segment is located at position -12 with respect to the initiation AUG. Deletion of 10 nucleotides encompassing this site completely abolishes protein binding. Nevertheless, Bal31 deletion analysis within the coxII leader shows that a major part of the leader is essential for p40 binding, suggesting that binding of the protein is also dependent on secondary structural features. p40 binds to other mitochondrial leader mRNAs including those for coxI, coxIII and cyt b. p40 is present in a cytoplasmic (rho0) petite mutant lacking mitochondrial protein synthesis. It is therefore presumably nuclear encoded. The possible biological function of the protein is discussed. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 8. Fig. 9. PMID:1701144

  19. Oxidative changes and weakened gelling ability of salt-extracted protein are responsible for textural losses in dumpling meat fillings during frozen storage.

    PubMed

    Huang, Li; Liu, Qian; Xia, Xiufang; Kong, Baohua; Xiong, Youling L

    2015-10-15

    The objective of the study was to investigate the contribution of oxidation and rheological behaviour of proteins present outside the meat particle (OMP) and those remaining inside the meat particle (IMP) in dumpling meat fillings. The -7 °C sample fillings stored for 180 d had a significantly lower breaking strength and water-holding capacity than those stored at -18 °C and -7 °C/-18 °C (P < 0.05). Microscopy of stained samples showed significant fat exudation in the high (-7 °C) and fluctuating (-7 °C/-18 °C) temperature treatments during storage, coinciding with decreased thermal stability of OMP. There was a more abundant carbonyl production in OMP than in IMP (P < 0.05). The storage modulus G' in OMP was significantly lower than that in IMP. Moreover, SDS-PAGE showed that -7 °C and -7 °C/-18 °C samples produced more insoluble protein aggregates. These findings indicate that oxidative damage and reduced gelling potential of OMP proteins led to reduced textural properties in frozen dumplings.

  20. Cold shock protein 1 chaperones mRNAs during translation in Arabidopsis thaliana.

    PubMed

    Juntawong, Piyada; Sorenson, Reed; Bailey-Serres, Julia

    2013-06-01

    RNA binding proteins (RBPs) function post-transcriptionally to fine-tune gene regulation. Arabidopsis thaliana has four Gly-rich, zinc finger-containing RBPs called cold shock proteins 1-4 (CSP1-CSP4), that possess an evolutionary conserved cold shock domain. Here, we determined that CSP1 associates with polyribosomes (polysomes) via an RNA-mediated interaction. Both the abundance and polysomal co-fractionation of CSP1 was enhanced in the cold (4°C), but did not influence global levels of polysomes, which were minimally perturbed by above freezing cold temperatures. Using a polyclonal antiserum, CSP1 was co-immunopurified with several hundred transcripts from rosettes of plants cultivated at 23°C or transferred to 4°C for 12 h. CSP1-associated mRNAs were characterized by G+C-rich 5' untranslated regions and gene ontologies related to cellular respiration, mRNA binding and translation. The majority of the CSP1-associated mRNAs were constitutively expressed and stable in the cold. CSP1 abundance was correlated with improved translation of ribosomal protein mRNAs during cold stress and improved maintenance of homeostasis and translation of mRNAs under water-deficit stress. In summary, CSP1 selectively chaperones mRNAs, providing translational enhancement during stress.

  1. An intein-mediated modulation of protein stability system and its application to study human cytomegalovirus essential gene function

    PubMed Central

    Pan, Deng; Xuan, Baoqin; Sun, Yamei; Huang, Shaowu; Xie, Maorong; Bai, Yadan; Xu, Wenjia; Qian, Zhikang

    2016-01-01

    Functional analysis of the essential proteins encoded by human cytomegalovirus (HCMV) is hindered by the lack of complementing systems. To overcome this difficulty, we have established a novel approach, termed the intein-mediated modulation of protein stability (imPS), in which a destabilizing domain and part of a split intein are fused to the essential protein. The growth of the mutant virus can then be regulated by the degradation and splicing of the protein. We found that an ultrafast gp41-1 split intein was able to rescue or degrade the protein of interest (POI) by removing or adding a strong degron through protein splicing. As a result, the function of the POI was turned on or off during the process. Using HCMV essential gene IE1/IE2, we confirmed that imPS worked remarkably well in conditionally regulating protein stability during viral infection. This conditional approach is likely to be applicable for dissecting the gene functions of HCMV or other viruses. PMID:27188239

  2. Neuronal response of the hippocampal formation to injury: blood flow, glucose metabolism, and protein synthesis

    SciTech Connect

    Kameyama, M.; Wasterlain, C.G.; Ackermann, R.F.; Finch, D.; Lear, J.; Kuhl, D.E.

    1983-02-01

    The reaction of the hippocampal formation to entorhinal lesions was studied from the viewpoints of cerebral blood flow ((/sup 123/I)isopropyl-iodoamphetamine(IMP))-glucose utilization ((/sup 14/C)2-deoxyglucose), and protein synthesis ((/sup 14/C)leucine), using single- and double-label autoradiography. Researchers' studies showed decreased glucose utilization in the inner part, and increased glucose utilization in the outer part of the molecular layer of the dentate gyrus, starting 3 days after the lesion; increased uptake of (/sup 123/I)IMP around the lesion from 1 to 3 days postlesion; and starting 3 days after the lesion, marked decrease in (/sup 14/C)leucine incorporation into proteins and cell loss in the dorsal CA1 and dorsal subiculum in about one-half of the rats. These changes were present only in animals with lesions which invaded the ventral hippocampal formation in which axons of CA1 cells travel. By contrast, transsection of the 3rd and 4th cranial nerves resulted, 3 to 9 days after injury, in a striking increase in protein synthesis in the oculomotor and trochlear nuclei. These results raise the possibility that in some neurons the failure of central regeneration may result from the cell's inability to increase its rate of protein synthesis in response to axonal injury.

  3. Ribosome-associated pentatricopeptide repeat proteins function as translational activators in mitochondria of trypanosomes

    PubMed Central

    Aphasizheva, Inna; Maslov, Dmitri A.; Qian, Yu; Huang, Lan; Wang, Qi; Costello, Catherine E.; Aphasizhev, Ruslan

    2016-01-01

    Summary Mitochondrial ribosomes of Trypanosoma brucei are composed of 9S and 12S rRNAs, eubacterial-type ribosomal proteins, polypeptides lacking discernible motifs and approximately 20 pentatricopeptide repeat (PPR) RNA binding proteins. Several PPRs also populate the polyadenylation complex; among these, KPAF1 and KPAF2 function as general mRNA 3′ adenylation/uridylation factors. The A/U-tail enables mRNA binding to the small ribosomal subunit and is essential for translation. The presence of A/U-tail also correlates with requirement for translation of certain mRNAs in mammalian and insect parasite stages. Here, we inquired whether additional PPRs activate translation of individual mRNAs. Proteomic analysis identified KRIPP1 and KRIPP8 as components of the small ribosomal subunit in mammalian and insect forms, but also revealed their association with the polyadenylation complex in the latter. RNAi knockdowns demonstrated essential functions of KRIPP1 and KRIPP8 in the actively respiring insect stage, but not in the mammalian stage. In the KRIPP1 knockdown, A/U-tailed mRNA encoding cytochrome c oxidase subunit 1 declined concomitantly with the de novo synthesis of this subunit whereas polyadenylation and translation of cyb mRNA were unaffected. In contrast, the KRIPP8 knockdown inhibited A/U-tailing and translation of both CO1 and cyb mRNAs. Our findings indicate that ribosome-associated PPRs may selectively activate mRNAs for translation. PMID:26713541

  4. Effect of mitochondrial complex I inhibition on Fe-S cluster protein activity

    SciTech Connect

    Mena, Natalia P.; Bulteau, Anne Laure; Salazar, Julio; Hirsch, Etienne C.; Nunez, Marco T.

    2011-06-03

    Highlights: {yields} Mitochondrial complex I inhibition resulted in decreased activity of Fe-S containing enzymes mitochondrial aconitase and cytoplasmic aconitase and xanthine oxidase. {yields} Complex I inhibition resulted in the loss of Fe-S clusters in cytoplasmic aconitase and of glutamine phosphoribosyl pyrophosphate amidotransferase. {yields} Consistent with loss of cytoplasmic aconitase activity, an increase in iron regulatory protein 1 activity was found. {yields} Complex I inhibition resulted in an increase in the labile cytoplasmic iron pool. -- Abstract: Iron-sulfur (Fe-S) clusters are small inorganic cofactors formed by tetrahedral coordination of iron atoms with sulfur groups. Present in numerous proteins, these clusters are involved in key biological processes such as electron transfer, metabolic and regulatory processes, DNA synthesis and repair and protein structure stabilization. Fe-S clusters are synthesized mainly in the mitochondrion, where they are directly incorporated into mitochondrial Fe-S cluster-containing proteins or exported for cytoplasmic and nuclear cluster-protein assembly. In this study, we tested the hypothesis that inhibition of mitochondrial complex I by rotenone decreases Fe-S cluster synthesis and cluster content and activity of Fe-S cluster-containing enzymes. Inhibition of complex I resulted in decreased activity of three Fe-S cluster-containing enzymes: mitochondrial and cytosolic aconitases and xanthine oxidase. In addition, the Fe-S cluster content of glutamine phosphoribosyl pyrophosphate amidotransferase and mitochondrial aconitase was dramatically decreased. The reduction in cytosolic aconitase activity was associated with an increase in iron regulatory protein (IRP) mRNA binding activity and with an increase in the cytoplasmic labile iron pool. Since IRP activity post-transcriptionally regulates the expression of iron import proteins, Fe-S cluster inhibition may result in a false iron deficiency signal. Given that

  5. Validation of membrane protein topology models by oxidative labeling and mass spectrometry.

    PubMed

    Pan, Yan; Ruan, Xiang; Valvano, Miguel A; Konermann, Lars

    2012-05-01

    Computer-assisted topology predictions are widely used to build low-resolution structural models of integral membrane proteins (IMPs). Experimental validation of these models by traditional methods is labor intensive and requires modifications that might alter the IMP native conformation. This work employs oxidative labeling coupled with mass spectrometry (MS) as a validation tool for computer-generated topology models. ·OH exposure introduces oxidative modifications in solvent-accessible regions, whereas buried segments (e.g., transmembrane helices) are non-oxidizable. The Escherichia coli protein WaaL (O-antigen ligase) is predicted to have 12 transmembrane helices and a large extramembrane domain (Pérez et al., Mol. Microbiol. 2008, 70, 1424). Tryptic digestion and LC-MS/MS were used to map the oxidative labeling behavior of WaaL. Met and Cys exhibit high intrinsic reactivities with ·OH, making them sensitive probes for solvent accessibility assays. Overall, the oxidation pattern of these residues is consistent with the originally proposed WaaL topology. One residue (M151), however, undergoes partial oxidation despite being predicted to reside within a transmembrane helix. Using an improved computer algorithm, a slightly modified topology model was generated that places M151 closer to the membrane interface. On the basis of the labeling data, it is concluded that the refined model more accurately reflects the actual topology of WaaL. We propose that the combination of oxidative labeling and MS represents a useful strategy for assessing the accuracy of IMP topology predictions, supplementing data obtained in traditional biochemical assays. In the future, it might be possible to incorporate oxidative labeling data directly as constraints in topology prediction algorithms.

  6. Validation of Membrane Protein Topology Models by Oxidative Labeling and Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Pan, Yan; Ruan, Xiang; Valvano, Miguel A.; Konermann, Lars

    2012-05-01

    Computer-assisted topology predictions are widely used to build low-resolution structural models of integral membrane proteins (IMPs). Experimental validation of these models by traditional methods is labor intensive and requires modifications that might alter the IMP native conformation. This work employs oxidative labeling coupled with mass spectrometry (MS) as a validation tool for computer-generated topology models. ṡOH exposure introduces oxidative modifications in solvent-accessible regions, whereas buried segments (e.g., transmembrane helices) are non-oxidizable. The Escherichia coli protein WaaL (O-antigen ligase) is predicted to have 12 transmembrane helices and a large extramembrane domain (Pérez et al., Mol. Microbiol. 2008, 70, 1424). Tryptic digestion and LC-MS/MS were used to map the oxidative labeling behavior of WaaL. Met and Cys exhibit high intrinsic reactivities with ṡOH, making them sensitive probes for solvent accessibility assays. Overall, the oxidation pattern of these residues is consistent with the originally proposed WaaL topology. One residue (M151), however, undergoes partial oxidation despite being predicted to reside within a transmembrane helix. Using an improved computer algorithm, a slightly modified topology model was generated that places M151 closer to the membrane interface. On the basis of the labeling data, it is concluded that the refined model more accurately reflects the actual topology of WaaL. We propose that the combination of oxidative labeling and MS represents a useful strategy for assessing the accuracy of IMP topology predictions, supplementing data obtained in traditional biochemical assays. In the future, it might be possible to incorporate oxidative labeling data directly as constraints in topology prediction algorithms.

  7. A facile and sensitive method for quantification of cyclic nucleotide monophosphates in mammalian organs: basal levels of eight cNMPs and identification of 2',3'-cIMP.

    PubMed

    Jia, Xin; Fontaine, Benjamin M; Strobel, Fred; Weinert, Emily E

    2014-12-12

    A sensitive, versatile and economical method to extract and quantify cyclic nucleotide monophosphates (cNMPs) using LC-MS/MS, including both 3',5'-cNMPs and 2',3'-cNMPs, in mammalian tissues and cellular systems has been developed. Problems, such as matrix effects from complex biological samples, are addressed and have been optimized. This protocol allows for comparison of multiple cNMPs in the same system and was used to examine the relationship between tissue levels of cNMPs in a panel of rat organs. In addition, the study reports the first identification and quantification of 2',3'-cIMP. The developed method will allow for quantification of cNMPs levels in cells and tissues with varying disease states, which will provide insight into the role(s) and interplay of cNMP signalling pathways.

  8. A Facile and Sensitive Method for Quantification of Cyclic Nucleotide Monophosphates in Mammalian Organs: Basal Levels of Eight cNMPs and Identification of 2',3'-cIMP

    PubMed Central

    Jia, Xin; Fontaine, Benjamin M.; Strobel, Fred; Weinert, Emily E.

    2014-01-01

    A sensitive, versatile and economical method to extract and quantify cyclic nucleotide monophosphates (cNMPs) using LC-MS/MS, including both 3',5'-cNMPs and 2',3'-cNMPs, in mammalian tissues and cellular systems has been developed. Problems, such as matrix effects from complex biological samples, are addressed and have been optimized. This protocol allows for comparison of multiple cNMPs in the same system and was used to examine the relationship between tissue levels of cNMPs in a panel of rat organs. In addition, the study reports the first identification and quantification of 2',3'-cIMP. The developed method will allow for quantification of cNMPs levels in cells and tissues with varying disease states, which will provide insight into the role(s) and interplay of cNMP signalling pathways. PMID:25513747

  9. Calcul de l'impédance d'un inducteur circulaire plat par conjonction des méthodes intégrales de frontière et éléments finis

    NASA Astrophysics Data System (ADS)

    Fouladgar, J.; Develey, G.

    1992-11-01

    The knowledge of the impedance of the whole inductor-load has a great importance for the design of the generators used in the induction heating technology. In this paper, we study the case of a plannar circular inductor fed by a voltage u of a variable frequency up to 30 kHz. To calculate the impedance, one should resolve the diffusion equation in a axisymetric configuration. Here we propose a mixed method, using the finit elements method in the volume of the inductor and load and a boundary elements method at their surfaces. La connaissance de l'impédance de l'ensemble inducteur-charge revêt une grande importance pour la conception des générateurs utilisés dans la technique du chauffage par induction. Dans cet article, nous étudions le cas d'un inducteur plat circulaire alimenté sous une tension fixe u, de fréquence variable jusqu'à 30 kHz. Le calcul de l'impédance passe par la résolution de l'équation de diffusion dans un système axisymétrique. Nous proposons ici une méthode mixte utilisant la méthode d'éléments finis dans le volume de la charge et de l'inducteur et la méthode d'intégrales de frontière à leur surface.

  10. Persistence and epidemic propagation of a Pseudomonas aeruginosa sequence type 235 clone harboring an IS26 composite transposon carrying the blaIMP-1 integron in Hiroshima, Japan, 2005 to 2012.

    PubMed

    Shimizu, Wataru; Kayama, Shizuo; Kouda, Shuntaro; Ogura, Yoshitoshi; Kobayashi, Kanao; Shigemoto, Norifumi; Shimada, Norimitsu; Yano, Raita; Hisatsune, Junzo; Kato, Fuminori; Hayashi, Tetsuya; Sueda, Taijiro; Ohge, Hiroki; Sugai, Motoyuki

    2015-05-01

    A 9-year surveillance for multidrug-resistant (MDR) Pseudomonas aeruginosa in the Hiroshima region showed that the number of isolates harboring the metallo-β-lactamase gene bla(IMP-1) abruptly increased after 2004, recorded the highest peak in 2006, and showed a tendency to decline afterwards, indicating a history of an epidemic. PCR mapping of the variable regions of the integrons showed that this epidemic was caused by the clonal persistence and propagation of an MDR P. aeruginosa strain harboring the bla(IMP-1) gene and an aminoglycoside 6'-N-acetyltransferase gene, aac(6')-Iae in a class I integron (In113), whose integrase gene intl1 was disrupted by an IS26 insertion. Sequence analysis of the representative strain PA058447 resistance element containing the In113-derived gene cassette array showed that the element forms an IS26 transposon embedded in the chromosome. It has a Tn21 backbone and is composed of two segments sandwiched by three IS26s. In Japan, clonal nationwide expansion of an MDR P. aeruginosa NCGM2.S1 harboring chromosomally encoded In113 with intact intl1 is reported. Multilocus sequence typing and genomic comparison strongly suggest that PA058447 and NCGM2.S1 belong to the same clonal lineage. Moreover, the structures of the resistance element in the two strains are very similar, but the sites of insertion into the chromosome are different. Based on tagging information of the IS26 present in both resistance elements, we suggest that the MDR P. aeruginosa clone causing the epidemic in Hiroshima for the past 9 years originated from a common ancestor genome of PA058447 and NCGM2.S1 through an IS26 insertion into intl1 of In113 and through IS26-mediated genomic rearrangements.

  11. Regulation of neuronal excitability by interaction of fragile X mental retardation protein with slack potassium channels.

    PubMed

    Zhang, Yalan; Brown, Maile R; Hyland, Callen; Chen, Yi; Kronengold, Jack; Fleming, Matthew R; Kohn, Andrea B; Moroz, Leonid L; Kaczmarek, Leonard K

    2012-10-31

    Loss of the RNA-binding protein fragile X mental retardation protein (FMRP) represents the most common form of inherited intellectual disability. Studies with heterologous expression systems indicate that FMRP interacts directly with Slack Na(+)-activated K(+) channels (K(Na)), producing an enhancement of channel activity. We have now used Aplysia bag cell (BC) neurons, which regulate reproductive behaviors, to examine the effects of Slack and FMRP on excitability. FMRP and Slack immunoreactivity were colocalized at the periphery of isolated BC neurons, and the two proteins could be reciprocally coimmunoprecipitated. Intracellular injection of FMRP lacking its mRNA binding domain rapidly induced a biphasic outward current, with an early transient tetrodotoxin-sensitive component followed by a slowly activating sustained component. The properties of this current matched that of the native Slack potassium current, which was identified using an siRNA approach. Addition of FMRP to inside-out patches containing native Aplysia Slack channels increased channel opening and, in current-clamp recordings, produced narrowing of action potentials. Suppression of Slack expression did not alter the ability of BC neurons to undergo a characteristic prolonged discharge in response to synaptic stimulation, but prevented recovery from a prolonged inhibitory period that normally follows the discharge. Recovery from the inhibited period was also inhibited by the protein synthesis inhibitor anisomycin. Our studies indicate that, in BC neurons, Slack channels are required for prolonged changes in neuronal excitability that require new protein synthesis, and raise the possibility that channel-FMRP interactions may link changes in neuronal firing to changes in protein translation.

  12. The type VI protein secretion system contributes to biofilm formation and seed-to-seedling transmission of Acidovorax citrulli on melon.

    PubMed

    Tian, Yanli; Zhao, Yuqiang; Wu, Xinrong; Liu, Fengquan; Hu, Baishi; Walcott, Ronald R

    2015-01-01

    The type VI protein secretion system (T6SS) is essential for the virulence of several Gram-negative bacteria. In this study, we identified a T6SS gene cluster in Acidovorax citrulli, a plant-pathogenic bacterium that causes bacterial fruit blotch (BFB) of cucurbits. One T6SS cluster, of approximately 25 kb in length and comprising 17 genes, was found in the A. citrulli AAC00-1 genome. Seventeen A. citrulli mutants were generated, each with a deletion of a single T6SS core gene. There were significant differences in BFB seed-to-seedling transmission between wild-type A. citrulli strain, xjl12, and ΔvasD, ΔimpK, ΔimpJ and ΔimpF mutants (71.71%, 9.83%, 8.41%, 7.15% and 5.99% BFB disease index, respectively). In addition, we observed that these four mutants were reduced in melon seed colonization and biofilm formation; however, they were not affected in virulence when infiltrated into melon seedling tissues. There were no significant differences in BFB seed-to-seedling transmission, melon tissue colonization and biofilm formation between xjl12 and the other 13 T6SS mutants. Overall, our results indicate that T6SS plays a role in seed-to-seedling transmission of BFB on melon.

  13. Analysis of differential protein expression in normal and neoplastic human breast epithelial cell lines

    SciTech Connect

    Williams, K.; Chubb, C.; Huberman, E.; Giometti, C.S.

    1997-07-01

    High resolution two dimensional get electrophoresis (2DE) and database analysis was used to establish protein expression patterns for cultured normal human mammary epithelial cells and thirteen breast cancer cell lines. The Human Breast Epithelial Cell database contains the 2DE protein patterns, including relative protein abundances, for each cell line, plus a composite pattern that contains all the common and specifically expressed proteins from all the cell lines. Significant differences in protein expression, both qualitative and quantitative, were observed not only between normal cells and tumor cells, but also among the tumor cell lines. Eight percent of the consistently detected proteins were found in significantly (P < 0.001) variable levels among the cell lines. Using a combination of immunostaining, comigration with purified protein, subcellular fractionation, and amino-terminal protein sequencing, we identified a subset of the differentially expressed proteins. These identified proteins include the cytoskeletal proteins actin, tubulin, vimentin, and cytokeratins. The cell lines can be classified into four distinct groups based on their intermediate filament protein profile. We also identified heat shock proteins; hsp27, hsp60, and hsp70 varied in abundance and in some cases in the relative phosphorylation levels among the cell lines. Finally, we identified IMP dehydrogenase in each of the cell lines, and found the levels of this enzyme in the tumor cell lines elevated 2- to 20-fold relative to the levels in normal cells.

  14. Neofunctionalization of zona pellucida proteins enhances freeze-prevention in the eggs of Antarctic notothenioids

    NASA Astrophysics Data System (ADS)

    Cao, Lixue; Huang, Qiao; Wu, Zhichao; Cao, Dong-Dong; Ma, Zhanling; Xu, Qianghua; Hu, Peng; Fu, Yanxia; Shen, Yu; Chan, Jiulin; Zhou, Cong-Zhao; Zhai, Wanying; Chen, Liangbiao

    2016-10-01

    The mechanisms by which the eggs of the Antarctic notothenioid fishes avoid freezing are not fully understood. Zona pellucida proteins (ZPs) are constituents of the chorion which forms a protective matrix surrounding the egg. Here we report occurrence of freezing temperature-related gene expansion and acquisition of unusual ice melting-promoting (IMP) activity in a family of Antarctic notothenioid ZPs (AnnotoZPs). Members of AnnotoZPs are shown to bind with ice and non-colligatively depress the melting point of a solution in a range of 0.26 to 0.65 °C at a moderate concentration. Eggs of zebrafishes expressing an AnnotoZP transgene show improved melting point depression and enhanced survival in freezing conditions. Mutational analyses in a representative AnnotoZP indicate the ZP domain and patches of acidic residues are essential structures for the IMP activity. AnnotoZPs, therefore, represent a group of macromolecules that prevent freezing by a unique ZP-ice interaction mechanism distinct from the known antifreeze proteins.

  15. Neofunctionalization of zona pellucida proteins enhances freeze-prevention in the eggs of Antarctic notothenioids

    PubMed Central

    Cao, Lixue; Huang, Qiao; Wu, Zhichao; Cao, Dong-dong; Ma, Zhanling; Xu, Qianghua; Hu, Peng; Fu, Yanxia; Shen, Yu; Chan, Jiulin; Zhou, Cong-zhao; Zhai, Wanying; Chen, Liangbiao

    2016-01-01

    The mechanisms by which the eggs of the Antarctic notothenioid fishes avoid freezing are not fully understood. Zona pellucida proteins (ZPs) are constituents of the chorion which forms a protective matrix surrounding the egg. Here we report occurrence of freezing temperature-related gene expansion and acquisition of unusual ice melting-promoting (IMP) activity in a family of Antarctic notothenioid ZPs (AnnotoZPs). Members of AnnotoZPs are shown to bind with ice and non-colligatively depress the melting point of a solution in a range of 0.26 to 0.65 °C at a moderate concentration. Eggs of zebrafishes expressing an AnnotoZP transgene show improved melting point depression and enhanced survival in freezing conditions. Mutational analyses in a representative AnnotoZP indicate the ZP domain and patches of acidic residues are essential structures for the IMP activity. AnnotoZPs, therefore, represent a group of macromolecules that prevent freezing by a unique ZP–ice interaction mechanism distinct from the known antifreeze proteins. PMID:27698404

  16. Neofunctionalization of zona pellucida proteins enhances freeze-prevention in the eggs of Antarctic notothenioids.

    PubMed

    Cao, Lixue; Huang, Qiao; Wu, Zhichao; Cao, Dong-Dong; Ma, Zhanling; Xu, Qianghua; Hu, Peng; Fu, Yanxia; Shen, Yu; Chan, Jiulin; Zhou, Cong-Zhao; Zhai, Wanying; Chen, Liangbiao

    2016-10-04

    The mechanisms by which the eggs of the Antarctic notothenioid fishes avoid freezing are not fully understood. Zona pellucida proteins (ZPs) are constituents of the chorion which forms a protective matrix surrounding the egg. Here we report occurrence of freezing temperature-related gene expansion and acquisition of unusual ice melting-promoting (IMP) activity in a family of Antarctic notothenioid ZPs (AnnotoZPs). Members of AnnotoZPs are shown to bind with ice and non-colligatively depress the melting point of a solution in a range of 0.26 to 0.65 °C at a moderate concentration. Eggs of zebrafishes expressing an AnnotoZP transgene show improved melting point depression and enhanced survival in freezing conditions. Mutational analyses in a representative AnnotoZP indicate the ZP domain and patches of acidic residues are essential structures for the IMP activity. AnnotoZPs, therefore, represent a group of macromolecules that prevent freezing by a unique ZP-ice interaction mechanism distinct from the known antifreeze proteins.

  17. Identification of inducers of the Yersinia enterocolitica phage shock protein system and comparison to the regulation of the RpoE and Cpx extracytoplasmic stress responses.

    PubMed

    Maxson, Michelle E; Darwin, Andrew J

    2004-07-01

    Known inducers of the phage shock protein (Psp) system suggest that it is an extracytoplasmic stress response, as are the well-studied RpoE and Cpx systems. However, a random approach to identify conditions and proteins that induce the Psp system has not been attempted. It is also unknown whether the proteins or mutations that induce Psp are specific or if they also activate the RpoE and Cpx systems. This study addressed these issues for the Yersinia enterocolitica Psp system. Random transposon mutagenesis identified null mutations and overexpression mutations that increase Phi(pspA-lacZ) operon fusion expression. The results suggest that Psp may respond exclusively to extracytoplasmic stress. Null mutations affected glucosamine-6-phosphate synthetase (glmS), which plays a role in cell envelope biosynthesis, and the F0F1 ATPase (atp operon). The screen also revealed that in addition to several secretins, the overexpression of three novel putative inner membrane proteins (IMPs) induced the Psp response. We also compared induction of the Y. enterocolitica Psp, RpoE, and Cpx responses. Overexpression of secretins or the three IMPs or the presence of an atpB null mutation only induced the Psp response. Similarly, known inducers of the RpoE and Cpx responses did not significantly induce the Psp response. Only the glmS null mutation induced all three responses. Therefore, Psp is induced distinctly from the RpoE and Cpx systems. The specific IMP inducers may be valuable tools to probe specific signal transduction events of the Psp response in future studies.

  18. Selective regulation of YB-1 mRNA translation by the mTOR signaling pathway is not mediated by 4E-binding protein

    PubMed Central

    Lyabin, D. N.; Ovchinnikov, L. P.

    2016-01-01

    The Y-box binding protein 1 (YB-1) is a key regulator of gene expression at the level of both translation and transcription. The mode of its action on cellular events depends on its subcellular distribution and the amount in the cell. So far, the regulatory mechanisms of YB-1 synthesis have not been adequately studied. Our previous finding was that selective inhibition of YB-1 mRNA translation was caused by suppression of activity of the mTOR signaling pathway. It was suggested that this event may be mediated by phosphorylation of the 4E-binding protein (4E-BP). Here, we report that 4E-BP alone can only slightly inhibit YB-1 synthesis both in the cell and in vitro, although it essentially decreases binding of the 4F-group translation initiation factors to mRNA. With inhibited mTOR kinase, the level of mRNA binding to the eIF4F-group factors was decreased, while that to 4E-BP1 was increased, as was observed for both mTOR kinase-sensitive mRNAs and those showing low sensitivity. This suggests that selective inhibition of translation of YB-1 mRNA, and probably some other mRNAs as well, by mTOR kinase inhibitors is not mediated by the action of the 4E-binding protein upon functions of the 4F-group translation initiation factors. PMID:26931209

  19. Selective regulation of YB-1 mRNA translation by the mTOR signaling pathway is not mediated by 4E-binding protein.

    PubMed

    Lyabin, D N; Ovchinnikov, L P

    2016-03-02

    The Y-box binding protein 1 (YB-1) is a key regulator of gene expression at the level of both translation and transcription. The mode of its action on cellular events depends on its subcellular distribution and the amount in the cell. So far, the regulatory mechanisms of YB-1 synthesis have not been adequately studied. Our previous finding was that selective inhibition of YB-1 mRNA translation was caused by suppression of activity of the mTOR signaling pathway. It was suggested that this event may be mediated by phosphorylation of the 4E-binding protein (4E-BP). Here, we report that 4E-BP alone can only slightly inhibit YB-1 synthesis both in the cell and in vitro, although it essentially decreases binding of the 4F-group translation initiation factors to mRNA. With inhibited mTOR kinase, the level of mRNA binding to the eIF4F-group factors was decreased, while that to 4E-BP1 was increased, as was observed for both mTOR kinase-sensitive mRNAs and those showing low sensitivity. This suggests that selective inhibition of translation of YB-1 mRNA, and probably some other mRNAs as well, by mTOR kinase inhibitors is not mediated by the action of the 4E-binding protein upon functions of the 4F-group translation initiation factors.

  20. Modélisation des propriétés diélectriques de milieux hétérogènes liquides par un réseau d'impédances a trois dimensions

    NASA Astrophysics Data System (ADS)

    Balana, A.; Ellison, W.; Vicq, G.

    1994-11-01

    The object of our work is to describe the dielectric behaviour of a heterogeneous medium in terms of the electric interactions between its constituants. The problem is formulated in terms of an electric impedance network and a numerical solution of the equations is developed. As an application, we studied Maxwell-Wagner relaxations and effects of concentration on liquids. Le but de notre travail est de décrire le comporternent diélectrique de milieux hétérogènes à partir d'une modélisation des interactions électriques entre chaque constituant. Le problème fait appel à un réseau d'impédances électriques à trois dimensions et une méthode de résolution des équations qui en découlent est développée. Nous avons appliqué cette approche à l'étude de la relaxation Maxwell-Wagner et à l'effet de la variation de la concentration des constituants sur des milieux liquides.

  1. Towards Complete Sets of Farnesylated and Geranylgeranylated Proteins

    PubMed Central

    Maurer-Stroh, Sebastian; Koranda, Manfred; Benetka, Wolfgang; Schneider, Georg; Sirota, Fernanda L; Eisenhaber, Frank

    2007-01-01

    Three different prenyltransferases attach isoprenyl anchors to C-terminal motifs in substrate proteins. These lipid anchors serve for membrane attachment or protein–protein interactions in many pathways. Although well-tolerated selective prenyltransferase inhibitors are clinically available, their mode of action remains unclear since the known substrate sets of the various prenyltransferases are incomplete. The Prenylation Prediction Suite (PrePS) has been applied for large-scale predictions of prenylated proteins. To prioritize targets for experimental verification, we rank the predictions by their functional importance estimated by evolutionary conservation of the prenylation motifs within protein families. The ranked lists of predictions are accessible as PRENbase (http://mendel.imp.univie.ac.at/sat/PrePS/PRENbase) and can be queried for verification status, type of modifying enzymes (anchor type), and taxonomic distribution. Our results highlight a large group of plant metal-binding chaperones as well as several newly predicted proteins involved in ubiquitin-mediated protein degradation, enriching the known functional repertoire of prenylated proteins. Furthermore, we identify two possibly prenylated proteins in Mimivirus. The section HumanPRENbase provides complete lists of predicted prenylated human proteins—for example, the list of farnesyltransferase targets that cannot become substrates of geranylgeranyltransferase 1 and, therefore, are especially affected by farnesyltransferase inhibitors (FTIs) used in cancer and anti-parasite therapy. We report direct experimental evidence verifying the prediction of the human proteins Prickle1, Prickle2, the BRO1 domain–containing FLJ32421 (termed BROFTI), and Rab28 (short isoform) as exclusive farnesyltransferase targets. We introduce PRENbase, a database of large-scale predictions of protein prenylation substrates ranked by evolutionary conservation of the motif. Experimental evidence is presented for the

  2. Protein Condensation

    NASA Astrophysics Data System (ADS)

    Gunton, James D.; Shiryayev, Andrey; Pagan, Daniel L.

    2007-09-01

    Preface; 1. Introduction; 2. Globular protein structure; 3. Experimental methods; 4. Thermodynamics and statistical mechanics; 5. Protein-protein interactions; 6. Theoretical studies of equilibrium; 7. Nucleation theory; 8. Experimental studies of nucleation; 9. Lysozyme; 10. Some other globular proteins; 11. Membrane proteins; 12. Crystallins and cataracts; 13. Sickle hemoglobin and sickle cell anemia; 14, Alzheimer's disease; Index.

  3. Protein Condensation

    NASA Astrophysics Data System (ADS)

    Gunton, James D.; Shiryayev, Andrey; Pagan, Daniel L.

    2014-07-01

    Preface; 1. Introduction; 2. Globular protein structure; 3. Experimental methods; 4. Thermodynamics and statistical mechanics; 5. Protein-protein interactions; 6. Theoretical studies of equilibrium; 7. Nucleation theory; 8. Experimental studies of nucleation; 9. Lysozyme; 10. Some other globular proteins; 11. Membrane proteins; 12. Crystallins and cataracts; 13. Sickle hemoglobin and sickle cell anemia; 14, Alzheimer's disease; Index.

  4. Eukaryote-specific motif of ribosomal protein S15 neighbors A site codon during elongation and termination of translation.

    PubMed

    Khairulina, Julia; Graifer, Dmitri; Bulygin, Konstantin; Ven'yaminova, Aliya; Frolova, Ludmila; Karpova, Galina

    2010-07-01

    The eukaryotic ribosomal protein S15 is a key component of the decoding site in contrast to its prokaryotic counterpart, S19p, which is located away from the mRNA binding track on the ribosome. Here, we determined the oligopeptide of S15 neighboring the A site mRNA codon on the human 80S ribosome with the use of mRNA analogues bearing perfluorophenyl azide-modified nucleotides in the sense or stop codon targeted to the 80S ribosomal A site. The protein was cross-linked to mRNA analogues in specific ribosomal complexes that were obtained in the presence of eRF1 in the experiments with mRNAs bearing stop codon. Digestion of modified S15 with various specific proteolytic agents followed by identification of the resulting modified oligopeptides showed that cross-link was in C-terminal fragment in positions 131-145, most probably, in decapeptide 131-PGIGATHSSR-140. The position of cross-linking site on the S15 protein did not depend on the nature of the A site-bound codon (sense or stop codon) and on the presence of polypeptide chain release factor eRF1 in the ribosomal complexes with mRNA analogues bearing a stop codon. The results indicate an involvement of the mentioned decapeptide in the formation of the ribosomal decoding site during elongation and termination of translation. Alignment of amino acid sequences of eukaryotic S15 and its prokaryotic counterpart, S19p from eubacteria and archaea, revealed that decapeptide PGIGATHSSR in positions 131-140 is strongly conserved in eukaryotes and has minor variations in archaea but has no homology with any sequence in C-terminal part of eubacterial S19p, which suggests involvement of the decapeptide in the translation process in a eukaryote-specific manner.

  5. La-related Protein 1 (LARP1) Represses Terminal Oligopyrimidine (TOP) mRNA Translation Downstream of mTOR Complex 1 (mTORC1).

    PubMed

    Fonseca, Bruno D; Zakaria, Chadi; Jia, Jian-Jun; Graber, Tyson E; Svitkin, Yuri; Tahmasebi, Soroush; Healy, Danielle; Hoang, Huy-Dung; Jensen, Jacob M; Diao, Ilo T; Lussier, Alexandre; Dajadian, Christopher; Padmanabhan, Niranjan; Wang, Walter; Matta-Camacho, Edna; Hearnden, Jaclyn; Smith, Ewan M; Tsukumo, Yoshinori; Yanagiya, Akiko; Morita, Masahiro; Petroulakis, Emmanuel; González, Jose L; Hernández, Greco; Alain, Tommy; Damgaard, Christian K

    2015-06-26

    The mammalian target of rapamycin complex 1 (mTORC1) is a critical regulator of protein synthesis. The best studied targets of mTORC1 in translation are the eukaryotic initiation factor-binding protein 1 (4E-BP1) and ribosomal protein S6 kinase 1 (S6K1). In this study, we identify the La-related protein 1 (LARP1) as a key novel target of mTORC1 with a fundamental role in terminal oligopyrimidine (TOP) mRNA translation. Recent genome-wide studies indicate that TOP and TOP-like mRNAs compose a large portion of the mTORC1 translatome, but the mechanism by which mTORC1 controls TOP mRNA translation is incompletely understood. Here, we report that LARP1 functions as a key repressor of TOP mRNA translation downstream of mTORC1. Our data show the following: (i) LARP1 associates with mTORC1 via RAPTOR; (ii) LARP1 interacts with TOP mRNAs in an mTORC1-dependent manner; (iii) LARP1 binds the 5'TOP motif to repress TOP mRNA translation; and (iv) LARP1 competes with the eukaryotic initiation factor (eIF) 4G for TOP mRNA binding. Importantly, from a drug resistance standpoint, our data also show that reducing LARP1 protein levels by RNA interference attenuates the inhibitory effect of rapamycin, Torin1, and amino acid deprivation on TOP mRNA translation. Collectively, our findings demonstrate that LARP1 functions as an important repressor of TOP mRNA translation downstream of mTORC1.

  6. PARP1 promotes gene expression at the post-transcriptional level by modulating the RNA-binding protein HuR

    PubMed Central

    Ke, Yueshuang; Han, Yanlong; Guo, Xiaolan; Wen, Jitao; Wang, Ke; Jiang, Xue; Tian, Xue; Ba, Xueqing; Boldogh, Istvan; Zeng, Xianlu

    2017-01-01

    Poly(ADP-ribosyl)ation (PARylation) is mainly catalysed by poly-ADP-ribose polymerase 1 (PARP1), whose role in gene transcription modulation has been well established. Here we show that, in response to LPS exposure, PARP1 interacts with the adenylateuridylate-rich element-binding protein embryonic lethal abnormal vision-like 1 (Elavl1)/human antigen R (HuR), resulting in its PARylation, primarily at site D226. PARP inhibition and the D226 mutation impair HuR's PARylation, nucleocytoplasmic shuttling and mRNA binding. Increases in mRNA level or stability of pro-inflammatory cytokines/chemokines are abolished by PARP1 ablation or inhibition, or blocked in D226A HuR-expressing cells. The present study demonstrates a mechanism to regulate gene expression at the post-transcriptional level, and suggests that blocking the interaction of PARP1 with HuR could be a strategy to treat inflammation-related diseases that involve increased mRNA stability. PMID:28272405

  7. Imager for Mars Pathfinder (IMP) image calibration

    USGS Publications Warehouse

    Reid, R.J.; Smith, P.H.; Lemmon, M.; Tanner, R.; Burkland, M.; Wegryn, E.; Weinberg, J.; Marcialis, R.; Britt, D.T.; Thomas, N.; Kramm, R.; Dummel, A.; Crowe, D.; Bos, B.J.; Bell, J.F.; Rueffer, P.; Gliem, F.; Johnson, J. R.; Maki, J.N.; Herkenhoff, K. E.; Singer, Robert B.

    1999-01-01

    The Imager for Mars Pathfinder returned over 16,000 high-quality images from the surface of Mars. The camera was well-calibrated in the laboratory, with <5% radiometric uncertainty. The photometric properties of two radiometric targets were also measured with 3% uncertainty. Several data sets acquired during the cruise and on Mars confirm that the system operated nominally throughout the course of the mission. Image calibration algorithms were developed for landed operations to correct instrumental sources of noise and to calibrate images relative to observations of the radiometric targets. The uncertainties associated with these algorithms as well as current improvements to image calibration are discussed. Copyright 1999 by the American Geophysical Union.

  8. IMPETUS III, OPERATION IMP-I.

    ERIC Educational Resources Information Center

    JOSEPH, JOSEPH M.

    A GENERAL DESCRIPTION OF ACTIVITIES AND SERVICES FOR A READING PROGRAM TAUGHT BY MEANS OF THE "TALKING TYPEWRITER" IS PRESENTED. THE TALKING TYPEWRITER IS LOCATED IN A SOUNDPROOF BOOTH. THE STUDENT SITS IN FRONT OF A TYPEWRITER AND RESPONDS, REACTS, AND INTERACTS TO DIRECTIONS VOICED BY A COMPUTERIZED, MAGNETIZED PROGRAMED SYSTEM. THE CRITERIA FOR…

  9. IMP: The LRDC Integrated Macro Package.

    ERIC Educational Resources Information Center

    Fitzhugh, Robert J.; Chadwick, Martin M.

    The Learning Research and Development Center Time-Sharing System (LRDC/TSS) supports numerous non-standard devices and terminals and provides a variety of powerful programing options, enabling the researcher to maintain close control over the experimental environment. To achieve this degree of flexibility, it was necessary to write programs…

  10. Rethinking Mobile Telephony with the IMP

    DTIC Science & Technology

    2011-01-01

    Hellman [3] key exchange for each conversational session. We note in passing that Diffie - Hellman key exchange requires no external method of key...list of IP addresses is retrieved and the system is then ready to send or receive voice calls. In either the caller or callee mode, Diffie - Hellman ...it is an encrypted call, the Diffie - Hellman protocol is used to negotiate a secret key for the duration of the call. The software is then

  11. An in vivo imaging-based assay for detecting protein interactions over a wide range of binding affinities

    SciTech Connect

    Fowlkes, Jason Davidson; Owens, Elizabeth T; Standaert, Robert F; Pelletier, Dale A; Hurst, Gregory {Greg} B; Doktycz, Mitchel John; Morrell-Falvey, Jennifer L; Billings, Amanda N

    2009-01-01

    Identifying and characterizing protein interactions are fundamental steps towards understanding and modeling biological networks. Methods that detect protein interactions in intact cells rather than buffered solutions are likely more relevant to natural systems since molecular crowding events in the cytosol can influence the diffusion and reactivity of individual proteins. One in vivo, imaging-based method relies on the co-localization of two proteins of interest fused to DivIVA, a cell division protein from Bacillus subtilis, and green fluorescent protein (GFP). We have modified this imaging-based assay to facilitate rapid cloning by constructing new vectors encoding N- and C-terminal DivIVA or GFP molecular tag fusions based on site-specific recombination technology. The sensitivity of the assay was defined using a well-characterized protein interaction system involving the eukaryotic nuclear import receptor subunit, Importin (Imp ) and variant nuclear localization signals (NLS) representing a range of binding affinities. These data demonstrate that the modified co-localization assay is sensitive enough to detect protein interactions with Kd values that span over four orders of magnitude (1nM to 15 M). Lastly, this assay was used to confirm numerous protein interactions identified from mass spectrometry-based analyses of affinity isolates as part of an interactome mapping project in Rhodopseudomonas palustris

  12. NDR proteins

    PubMed Central

    Jones, Alan M

    2010-01-01

    N-myc downregulated (NDR) genes were discovered more than fifteen years ago. Indirect evidence support a role in tumor progression and cellular differentiation, but their biochemical function is still unknown. Our detailed analyses on Arabidopsis NDR proteins (deisgnated NDR-like, NDL) show their involvement in altering auxin transport, local auxin gradients and expression level of auxin transport proteins. Animal NDL proteins may be involved in membrane recycling of E-cadherin and effector for the small GTPase. In light of these findings, we hypothesize that NDL proteins regulate vesicular trafficking of auxin transport facilitator PIN proteins by biochemically alterating the local lipid environment of PIN proteins. PMID:20724844

  13. Intense and specialized dendritic localization of the fragile X mental retardation protein in binaural brainstem neurons: a comparative study in the alligator, chicken, gerbil, and human.

    PubMed

    Wang, Yuan; Sakano, Hitomi; Beebe, Karisa; Brown, Maile R; de Laat, Rian; Bothwell, Mark; Kulesza, Randy J; Rubel, Edwin W

    2014-06-15

    Neuronal dendrites are structurally and functionally dynamic in response to changes in afferent activity. The fragile X mental retardation protein (FMRP) is an mRNA binding protein that regulates activity-dependent protein synthesis and morphological dynamics of dendrites. Loss and abnormal expression of FMRP occur in fragile X syndrome (FXS) and some forms of autism spectrum disorders. To provide further understanding of how FMRP signaling regulates dendritic dynamics, we examined dendritic expression and localization of FMRP in the reptilian and avian nucleus laminaris (NL) and its mammalian analogue, the medial superior olive (MSO), in rodents and humans. NL/MSO neurons are specialized for temporal processing of low-frequency sounds for binaural hearing, which is impaired in FXS. Protein BLAST analyses first demonstrate that the FMRP amino acid sequences in the alligator and chicken are highly similar to human FMRP with identical mRNA-binding and phosphorylation sites, suggesting that FMRP functions similarly across vertebrates. Immunocytochemistry further reveals that NL/MSO neurons have very high levels of dendritic FMRP in low-frequency hearing vertebrates including alligator, chicken, gerbil, and human. Remarkably, dendritic FMRP in NL/MSO neurons often accumulates at branch points and enlarged distal tips, loci known to be critical for branch-specific dendritic arbor dynamics. These observations support an important role for FMRP in regulating dendritic properties of binaural neurons that are essential for low-frequency sound localization and auditory scene segregation, and support the relevance of studying this regulation in nonhuman vertebrates that use low frequencies in order to further understand human auditory processing disorders.

  14. Proteins (image)

    MedlinePlus

    ... is an important nutrient that builds muscles and bones and provides energy. Protein can help with weight control because it helps you feel full and satisfied from your meals. The healthiest proteins are the leanest. This means ...

  15. Protein Structure

    ERIC Educational Resources Information Center

    Asmus, Elaine Garbarino

    2007-01-01

    Individual students model specific amino acids and then, through dehydration synthesis, a class of students models a protein. The students clearly learn amino acid structure, primary, secondary, tertiary, and quaternary structure in proteins and the nature of the bonds maintaining a protein's shape. This activity is fun, concrete, inexpensive and…

  16. The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

    PubMed

    Root-Bernstein, Robert; Root-Bernstein, Meredith

    2016-05-21

    We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their

  17. Therapeutic proteins.

    PubMed

    Dimitrov, Dimiter S

    2012-01-01

    Protein-based therapeutics are highly successful in clinic and currently enjoy unprecedented recognition of their potential. More than 100 genuine and similar number of modified therapeutic proteins are approved for clinical use in the European Union and the USA with 2010 sales of US$108 bln; monoclonal antibodies (mAbs) accounted for almost half (48%) of the sales. Based on their pharmacological activity, they can be divided into five groups: (a) replacing a protein that is deficient or abnormal; (b) augmenting an existing pathway; (c) providing a novel function or activity; (d) interfering with a molecule or organism; and (e) delivering other compounds or proteins, such as a radionuclide, cytotoxic drug, or effector proteins. Therapeutic proteins can also be grouped based on their molecular types that include antibody-based drugs, Fc fusion proteins, anticoagulants, blood factors, bone morphogenetic proteins, engineered protein scaffolds, enzymes, growth factors, hormones, interferons, interleukins, and thrombolytics. They can also be classified based on their molecular mechanism of activity as (a) binding non-covalently to target, e.g., mAbs; (b) affecting covalent bonds, e.g., enzymes; and (c) exerting activity without specific interactions, e.g., serum albumin. Most protein therapeutics currently on the market are recombinant and hundreds of them are in clinical trials for therapy of cancers, immune disorders, infections, and other diseases. New engineered proteins, including bispecific mAbs and multispecific fusion proteins, mAbs conjugated with small molecule drugs, and proteins with optimized pharmacokinetics, are currently under development. However, in the last several decades, there are no conceptually new methodological developments comparable, e.g., to genetic engineering leading to the development of recombinant therapeutic proteins. It appears that a paradigm change in methodologies and understanding of mechanisms is needed to overcome major

  18. Developmentally regulated HEART STOPPER, a mitochondrially targeted L18 ribosomal protein gene, is required for cell division, differentiation, and seed development in Arabidopsis

    PubMed Central

    Zhang, Hongyu; Luo, Ming; Day, Robert C.; Talbot, Mark J.; Ivanova, Aneta; Ashton, Anthony R.; Chaudhury, Abed M.; Macknight, Richard C.; Hrmova, Maria; Koltunow, Anna M.

    2015-01-01

    Evidence is presented for the role of a mitochondrial ribosomal (mitoribosomal) L18 protein in cell division, differentiation, and seed development after the characterization of a recessive mutant, heart stopper (hes). The hes mutant produced uncellularized endosperm and embryos arrested at the late globular stage. The mutant embryos differentiated partially on rescue medium with some forming callus. HES (At1g08845) encodes a mitochondrially targeted member of a highly diverged L18 ribosomal protein family. The substitution of a conserved amino residue in the hes mutant potentially perturbs mitoribosomal function via altered binding of 5S rRNA and/or influences the stability of the 50S ribosomal subunit, affecting mRNA binding and translation. Consistent with this, marker genes for mitochondrial dysfunction were up-regulated in the mutant. The slow growth of the endosperm and embryo indicates a defect in cell cycle progression, which is evidenced by the down-regulation of cell cycle genes. The down-regulation of other genes such as EMBRYO DEFECTIVE genes links the mitochondria to the regulation of many aspects of seed development. HES expression is developmentally regulated, being preferentially expressed in tissues with active cell division and differentiation, including developing embryos and the root tips. The divergence of the L18 family, the tissue type restricted expression of HES, and the failure of other L18 members to complement the hes phenotype suggest that the L18 proteins are involved in modulating development. This is likely via heterogeneous mitoribosomes containing different L18 members, which may result in differential mitochondrial functions in response to different physiological situations during development. PMID:26105995

  19. Whole genome sequencing identifies a deletion in protein phosphatase 2A that affects its stability and localization in Chlamydomonas reinhardtii.

    PubMed

    Lin, Huawen; Miller, Michelle L; Granas, David M; Dutcher, Susan K

    2013-01-01

    Whole genome sequencing is a powerful tool in the discovery of single nucleotide polymorphisms (SNPs) and small insertions/deletions (indels) among mutant strains, which simplifies forward genetics approaches. However, identification of the causative mutation among a large number of non-causative SNPs in a mutant strain remains a big challenge. In the unicellular biflagellate green alga Chlamydomonas reinhardtii, we generated a SNP/indel library that contains over 2 million polymorphisms from four wild-type strains, one highly polymorphic strain that is frequently used in meiotic mapping, ten mutant strains that have flagellar assembly or motility defects, and one mutant strain, imp3, which has a mating defect. A comparison of polymorphisms in the imp3 strain and the other 15 strains allowed us to identify a deletion of the last three amino acids, Y313F314L315, in a protein phosphatase 2A catalytic subunit (PP2A3) in the imp3 strain. Introduction of a wild-type HA-tagged PP2A3 rescues the mutant phenotype, but mutant HA-PP2A3 at Y313 or L315 fail to rescue. Our immunoprecipitation results indicate that the Y313, L315, or YFLΔ mutations do not affect the binding of PP2A3 to the scaffold subunit, PP2A-2r. In contrast, the Y313, L315, or YFLΔ mutations affect both the stability and the localization of PP2A3. The PP2A3 protein is less abundant in these mutants and fails to accumulate in the basal body area as observed in transformants with either wild-type HA-PP2A3 or a HA-PP2A3 with a V310T change. The accumulation of HA-PP2A3 in the basal body region disappears in mated dikaryons, which suggests that the localization of PP2A3 may be essential to the mating process. Overall, our results demonstrate that the terminal YFL tail of PP2A3 is important in the regulation on Chlamydomonas mating.

  20. Whey Protein

    MedlinePlus

    ... inflammation (polymyalgia rheumatica). Taking whey protein in a dairy product twice daily for 8 weeks does not improve muscle function, walking speed, or other movement tests in people with polymyalgia rheumatica. Other conditions. More evidence is needed to rate whey protein for these uses.

  1. Study on the resistance mechanism via outer membrane protein OprD2 and metal β-lactamase expression in the cell wall of Pseudomonas aeruginosa.

    PubMed

    Cai, Shuangqi; Chen, Yiqiang; Song, Dezhi; Kong, Jinliang; Wu, Yanbin; Lu, Huasong

    2016-11-01

    The aim of the present study was to evaluate the imipenem-resistant mechanism via the outer membrane protein (OMP) OprD2 and metal β-lactamase expression in the cell wall of Pseudomonas aeruginosa. The Pseudomonas aeruginosa was clinically separated and validated by VITEK-2 full-automatic bacteria analyzer. Drug resistance, sensitive antibiotics and minimum inhibitory concentration (MIC) were tested using the drug sensitivity analysis system. The phenotype positive strains of MBL genes were screened using the Kirby-Bauer diffusion method by adding metal ion-chelating agent EDTA on the imipenem susceptibility paper. IMP-1, VIM-1 and SPM metaloenzyme genes were tested by polymerase chain reaction (PCR)-telomeric repeat amplification protocol (TRAP). The OMP OprD2 genes were tested by PCR-TRAP, and the protein expression was tested using western blot analysis. The location of OMP OprD2 was confirmed using the sodium salicylate inhibition test. The results showed that 80 portions (40%) of MBL-positive strains were screened out of 200 specimens. Imipenem-resistant Pseudomonas aeruginosa (IRPA) and MIC values were significantly higher than quality control bacteria and control bacteria (P<0.05). A total of 35 cases with IMP-1 positive, 20 with VIM-1 positive, 16 with SPM positive, 5 with 2 positive genes and 4 with 3 positive genes were screened among MBL positive strains. A total of 150 portions (75%) of OprD2 deficiencies were screened from 200 specimens. The standard strains and sensitive strains showed OprD2 protein bands at 45 kDa while no OprD2 protein bands appeared in OprD2 deficiency strains. It was in accordance with gene detection. In conclusion, OMP OprD2 deficiency and MBL phenotype positivity may be important mechanisms of IRPA.

  2. Evolution of the Global Aurora During Positive IMP Bz and Varying IMP By Conditions

    NASA Technical Reports Server (NTRS)

    Cumnock, J. A.; Sharber, J. R.; Heelis. R. A.; Hairston, M. R.; Carven, J. D.

    1997-01-01

    The DE 1 imaging instrumentation provides a full view of the entire auroral oval every 12 min for several hours during each orbit. We examined five examples of global evolution of the aurora that occurred during the northern hemisphere winter of 1981-1982 when the z component of the interplanetary magnetic field was positive and the y component was changing sign. Evolution of an expanded auroral emission region into a theta aurora appears to require a change in the sign of By during northward interplanetary magnetic field (IMF). Theta aurora are formed both from expanded duskside emission regions (By changes from positive to negative) and dawnside emission regions (By changes from negative to positive), however the dawnside-originating and duskside-originating evolutions are not mirror images. The persistence of a theta aurora after its formation suggests that there may be no clear relationship between the theta aurora pattern and the instantaneous configuration of the IMF.

  3. Analyse de l'effet des courants induits sur l'impédance d'un système électromagnétique alimenté en tension BF ou HF. Utilisation de la méthode des circuits couplés

    NASA Astrophysics Data System (ADS)

    Maouche, B.; Feliachi, M.

    1997-10-01

    In this paper, a study of the interaction between the inductor and the load of an axisymmetrical induction device is proposed. This interaction concerns the effect of the eddy current on both the excitation current and on the system impedance. A half analytical model, based on a numerical discretization of the electromagnetic solution domain, is used. In each cell of the numerical discretization, an analytical calculation using the Moment Method (MM) is considered. In the case of strong skin effect (High Frequency: HF), the formulation makes use of the Impedance Boundary Condition (IBC); in the contrary case (Low Frequency: LF), the interior domain is discretized. Dans cet article nous proposons l'étude de l'influence d'une charge (induit) conductrice sur la répartition du courant inducteur ainsi que sur l'impédance du système. L'inducteur est à géométrie axisymétrique de forme solénoïdale ou pancake destiné au chauffage par induction. Une méthode semi-analytique, basée sur une discrétisation du domaine en mailles élémentaires auxquelles s'applique une formulation intégrale (Méthode des Circuits Couplés : MCC) des grandeurs électromagnétiques, est utilisée. Dans le cas où l'effet de peau est important (Haute Fréquence:HF), la formulation associe la Condition d'Impédance de Surface; dans le cas contraire (Basse Fréquence : BF), un maillage du domaine interne est pratiqué.

  4. Total protein

    MedlinePlus

    ... 2016:chap 215. Read More Agammaglobulinemia Albumin - blood (serum) test Amino acids Antibody Burns Chronic Congenital nephrotic syndrome Fibrinogen blood test Glomerulonephritis Hemoglobin Liver disease Malabsorption Multiple myeloma Polycythemia vera Protein in diet ...

  5. Change of protein profiles in the induction of the viable but nonculturable state of Vibrio parahaemolyticus.

    PubMed

    Lai, Chiou-Jour; Chen, Shau-Yan; Lin, I-Hsuan; Chang, Chuan-Hsiung; Wong, Hin-Chung

    2009-10-31

    This work reports on the metabolic response in the induction of the viable but nonculturable (VBNC) state of the seafood enteropathogen Vibrio parahaemolyticus, as determined by analyzing the corresponding change in protein profiles. V. parahaemolyticus ST550 was incubated at 4 degrees C in the Morita mineral salt-0.5% NaCl medium to induce the VBNC state in six weeks. Starving the cells by incubation at 25 degrees C for 24 h prior to 4 degrees C incubation inhibited the cells from entering VBNC state. Protein profiles were determined by two-dimensional polyacrylamide gel electrophoresis and the proteins which were enhanced in the VBNC induction/VBNC state or strongly down-regulated in the starved cells were identified by mass spectrophotometry. The 13 up-regulated proteins are known to be associated with transcription (two homologues of alpha subunit DNA-directed RNA polymerase, phosphoribosylaminoimidazole carboxamide formyltransferase/IMP cyclohydrolase), translation (ribosomal protein S1, two homologues of elongation factor TU, elongation factor EF-G), ATP synthase (F1 alpha subunit), gluconeogenesis-related metabolism (dihydrolipoamide acetyltransferase, glyceraldehyde 3-phosphate dehydrogenase), antioxidants (2 homologues of peroxiredoxins, AhpC/Tsa family) and a conserved hypothetical protein with unknown function. Expressions of the genes encoding four of these proteins were at high levels in the second week of VBNC induction; declined afterwards, and were down-regulated in the starved cells. These proteins may play important roles in the induction or maintenance of VBNC V. parahaemolyticus. The results of this investigation improve our understanding of the metabolic activities in the VBNC state of bacteria.

  6. The binding site for ribosomal protein S8 in 16S rRNA and spc mRNA from Escherichia coli: minimum structural requirements and the effects of single bulged bases on S8-RNA interaction.

    PubMed Central

    Wu, H; Jiang, L; Zimmermann, R A

    1994-01-01

    Through specific interactions with rRNA and mRNA, ribosomal protein S8 of Escherichia coli plays a central role in both assembly of the 30S ribosomal subunit and translational regulation of spc operon expression. To better understand S8-RNA association, we have measured the affinity of S8 for a number of variants of its rRNA and mRNA binding sites prepared by in vitro transcription or chemical synthesis. With the aid of site-directed deletions, we demonstrate that an imperfect, 33-nucleotide helical stem encompassing nucleotides 588-603 and 635-651 possesses all of the structural information necessary for specific binding of S8 to the 16S rRNA. This segment consists of two short duplexes that enclose a conserved, asymmetric internal loop which contains features crucial for protein recognition. The S8 binding site in spc operon mRNA is very similar in both primary and secondary structure to that in 16S rRNA except for the presence of two single bulged bases in one of the duplex segments. In addition, the apparent association constant for the S8-mRNA interaction is approximately fivefold less than that for the S8-rRNA interaction. We show that the difference in affinity can be attributed to the effects of the bulged bases. Deletion of the bulged bases from the mRNA site increases its affinity for S8 to a level similar to that of the rRNA, whereas insertion of single-base bulges at equivalent positions within the rRNA site reduces its affinity for S8 to a value typical of the mRNA. Single-base bulges in the proximity of essential recognition features are therefore capable of modulating the strength of protein-RNA interactions. PMID:7515489

  7. Protein Crystallizability.

    PubMed

    Smialowski, Pawel; Wong, Philip

    2016-01-01

    Obtaining diffracting quality crystals remains a major challenge in protein structure research. We summarize and compare methods for selecting the best protein targets for crystallization, construct optimization and crystallization condition design. Target selection methods are divided into algorithms predicting the chance of successful progression through all stages of structural determination (from cloning to solving the structure) and those focusing only on the crystallization step. We tried to highlight pros and cons of different approaches examining the following aspects: data size, redundancy and representativeness, overfitting during model construction, and results evaluation. In summary, although in recent years progress was made and several sequence properties were reported to be relevant for crystallization, the successful prediction of protein crystallization behavior and selection of corresponding crystallization conditions continue to challenge structural researchers.

  8. Protein Crystallization

    NASA Technical Reports Server (NTRS)

    Chernov, Alexander A.

    2005-01-01

    Nucleation, growth and perfection of protein crystals will be overviewed along with crystal mechanical properties. The knowledge is based on experiments using optical and force crystals behave similar to inorganic crystals, though with a difference in orders of magnitude in growing parameters. For example, the low incorporation rate of large biomolecules requires up to 100 times larger supersaturation to grow protein, rather than inorganic crystals. Nucleation is often poorly reproducible, partly because of turbulence accompanying the mixing of precipitant with protein solution. Light scattering reveals fluctuations of molecular cluster size, its growth, surface energies and increased clustering as protein ages. Growth most often occurs layer-by-layer resulting in faceted crystals. New molecular layer on crystal face is terminated by a step where molecular incorporation occurs. Quantitative data on the incorporation rate will be discussed. Rounded crystals with molecularly disordered interfaces will be explained. Defects in crystals compromise the x-ray diffraction resolution crucially needed to find the 3D atomic structure of biomolecules. The defects are immobile so that birth defects stay forever. All lattice defects known for inorganics are revealed in protein crystals. Contribution of molecular conformations to lattice disorder is important, but not studied. This contribution may be enhanced by stress field from other defects. Homologous impurities (e.g., dimers, acetylated molecules) are trapped more willingly by a growing crystal than foreign protein impurities. The trapped impurities induce internal stress eliminated in crystals exceeding a critical size (part of mni for ferritin, lysozyme). Lesser impurities are trapped from stagnant, as compared to the flowing, solution. Freezing may induce much more defects unless quickly amorphysizing intracrystalline water.

  9. The enzymatic activity of 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase is enhanced by NPM-ALK: new insights in ALK-mediated pathogenesis and the treatment of ALCL.

    PubMed

    Boccalatte, Francesco E; Voena, Claudia; Riganti, Chiara; Bosia, Amalia; D'Amico, Lucia; Riera, Ludovica; Cheng, Mangeng; Ruggeri, Bruce; Jensen, Ole N; Goss, Valerie L; Lee, Kimberly; Nardone, Julie; Rush, John; Polakiewicz, Roberto D; Comb, Michael J; Chiarle, Roberto; Inghirami, Giorgio

    2009-03-19

    Anaplastic large cell lymphoma represents a subset of neoplasms caused by translocations that juxtapose the anaplastic lymphoma kinase (ALK) to dimerization partners. The constitutive activation of ALK fusion proteins leads to cellular transformation through a complex signaling network. To elucidate the ALK pathways sustaining lymphomagenesis and tumor maintenance, we analyzed the tyrosine-kinase protein profiles of ALK-positive cell lines using 2 complementary proteomic-based approaches, taking advantage of a specific ALK RNA interference (RNAi) or cell-permeable inhibitors. A well-defined set of ALK-associated tyrosine phosphopeptides, including metabolic enzymes, kinases, ribosomal and cytoskeletal proteins, was identified. Validation studies confirmed that vasodilator-stimulated phosphoprotein and 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/inosine monophosphate cyclohydrolase (ATIC) associated with nucleophosmin (NPM)-ALK, and their phosphorylation required ALK activity. ATIC phosphorylation was documented in cell lines and primary tumors carrying ALK proteins and other tyrosine kinases, including TPR-Met and wild type c-Met. Functional analyses revealed that ALK-mediated ATIC phosphorylation enhanced its enzymatic activity, dampening the methotrexate-mediated transformylase activity inhibition. These findings demonstrate that proteomic approaches in well-controlled experimental settings allow the definition of informative proteomic profiles and the discovery of novel ALK downstream players that contribute to the maintenance of the neoplastic phenotype. Prediction of tumor responses to methotrexate may justify specific molecular-based chemotherapy.

  10. High prevalence of OXA-143 and alteration of outer membrane proteins in carbapenem-resistant Acinetobacter spp. isolates in Brazil.

    PubMed

    Mostachio, Anna Karina; Levin, Anna Sara; Rizek, Camila; Rossi, Flavia; Zerbini, Jessika; Costa, Silvia Figueiredo

    2012-05-01

    Carbapenem resistance amongst Acinetobacter spp. has been increasing in the last decade. This study evaluated the outer membrane protein (OMP) profile and production of carbapenemases in 50 carbapenem-resistant Acinetobacter spp. isolates from bloodstream infections. Isolates were identified by API20NE. Minimum inhibitory concentrations (MICs) for carbapenems were determined by broth microdilution. Carbapenemases were studied by phenotypic tests, detection of their encoding gene by polymerase chain reaction (PCR) amplification, and imipenem hydrolysis. Nucleotide sequencing confirming the enzyme gene type was performed using MegaBACE 1000. The presence of OMPs was studied by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and PCR. Molecular typing was performed using pulsed-field gel electrophoresis (PFGE). All isolates were resistant to carbapenems. Moreover, 98% of the isolates were positive for the gene encoding the enzyme OXA-51-like, 18% were positive for OXA-23-like (only one isolate did not show the presence of the insertion sequence ISAba1 adjacent to this gene) and 76% were positive for OXA-143 enzyme. Five isolates (10%) showed the presence of the IMP-1 gene. Imipenem hydrolysing activity was detected in only three strains containing carbapenemase genes, comprising two isolates containing the bla(IMP) gene and one containing the bla(OXA-51/OXA-23-like) gene. The OMP of 43 kDa was altered in 17 of 25 strains studied, and this alteration was associated with a high meropenem MIC (256 μg/mL) in 5 of 7 strains without 43 kDa OMP. On the other hand, decreased OMP 33-36 kDa was found in five strains. The high prevalence of OXA-143 and alteration of OMPs might have been associated with a high level of carbapenem resistance.

  11. Recombinant protein production technology

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recombinant protein production is an important technology for antibody production, biochemical activity study, and structural determination during the post-genomic era. Limiting factors in recombinant protein production include low-level protein expression, protein precipitation, and loss of protein...

  12. Amyotrophic lateral sclerosis-linked mutant SOD1 sequesters Hu antigen R (HuR) and TIA-1-related protein (TIAR): implications for impaired post-transcriptional regulation of vascular endothelial growth factor.

    PubMed

    Lu, Liang; Wang, Shuying; Zheng, Lei; Li, Xuelin; Suswam, Esther A; Zhang, Xiaowen; Wheeler, Crystal G; Nabors, L B; Filippova, Natalia; King, Peter H

    2009-12-04

    Down-regulation of vascular endothelial growth factor (VEGF) in the mouse leads to progressive and selective degeneration of motor neurons similar to amyotrophic lateral sclerosis (ALS). In mice expressing ALS-associated mutant superoxide dismutase 1 (SOD1), VEGF mRNA expression in the spinal cord declines significantly prior to the onset of clinical manifestations. In vitro models suggest that dysregulation of VEGF mRNA stability contributes to that decline. Here, we show that the major RNA stabilizer, Hu Antigen R (HuR), and TIA-1-related protein (TIAR) colocalize with mutant SOD1 in mouse spinal cord extracts and cultured glioma cells. The colocalization was markedly reduced or abolished by RNase treatment. Immunoanalysis of transfected cells indicated that colocalization occurred in insoluble aggregates and inclusions. RNA immunoprecipitation showed a significant loss of VEGF mRNA binding to HuR and TIAR in mutant SOD1 cells, and there was marked depletion of HuR from polysomes. Ectopic expression of HuR in mutant SOD1 cells more than doubled the mRNA half-life of VEGF and significantly increased expression to that of wild-type SOD1 control. Cellular effects produced by mutant SOD1, including impaired mitochondrial function and oxidative stress-induced apoptosis, were reversed by HuR in a gene dose-dependent pattern. In summary, our findings indicate that mutant SOD1 impairs post-transcriptional regulation by sequestering key regulatory RNA-binding proteins. The rescue effect of HuR suggests that this impairment, whether related to VEGF or other potential mRNA targets, contributes to cytotoxicity in ALS.

  13. Protein inference: A protein quantification perspective.

    PubMed

    He, Zengyou; Huang, Ting; Liu, Xiaoqing; Zhu, Peijun; Teng, Ben; Deng, Shengchun

    2016-08-01

    In mass spectrometry-based shotgun proteomics, protein quantification and protein identification are two major computational problems. To quantify the protein abundance, a list of proteins must be firstly inferred from the raw data. Then the relative or absolute protein abundance is estimated with quantification methods, such as spectral counting. Until now, most researchers have been dealing with these two processes separately. In fact, the protein inference problem can be regarded as a special protein quantification problem in the sense that truly present proteins are those proteins whose abundance values are not zero. Some recent published papers have conceptually discussed this possibility. However, there is still a lack of rigorous experimental studies to test this hypothesis. In this paper, we investigate the feasibility of using protein quantification methods to solve the protein inference problem. Protein inference methods aim to determine whether each candidate protein is present in the sample or not. Protein quantification methods estimate the abundance value of each inferred protein. Naturally, the abundance value of an absent protein should be zero. Thus, we argue that the protein inference problem can be viewed as a special protein quantification problem in which one protein is considered to be present if its abundance is not zero. Based on this idea, our paper tries to use three simple protein quantification methods to solve the protein inference problem effectively. The experimental results on six data sets show that these three methods are competitive with previous protein inference algorithms. This demonstrates that it is plausible to model the protein inference problem as a special protein quantification task, which opens the door of devising more effective protein inference algorithms from a quantification perspective. The source codes of our methods are available at: http://code.google.com/p/protein-inference/.

  14. Learning about Proteins

    MedlinePlus

    ... What Happens in the Operating Room? Learning About Proteins KidsHealth > For Kids > Learning About Proteins A A ... the foods you eat. continue Different Kinds of Protein Protein from animal sources, such as meat and ...

  15. Protein Microarray Technology

    PubMed Central

    Hall, David A.; Ptacek, Jason

    2007-01-01

    Protein chips have emerged as a promising approach for a wide variety of applications including the identification of protein-protein interactions, protein-phospholipid interactions, small molecule targets, and substrates of proteins kinases. They can also be used for clinical diagnostics and monitoring disease states. This article reviews current methods in the generation and applications of protein microarrays. PMID:17126887

  16. Length, protein protein interactions, and complexity

    NASA Astrophysics Data System (ADS)

    Tan, Taison; Frenkel, Daan; Gupta, Vishal; Deem, Michael W.

    2005-05-01

    The evolutionary reason for the increase in gene length from archaea to prokaryotes to eukaryotes observed in large-scale genome sequencing efforts has been unclear. We propose here that the increasing complexity of protein-protein interactions has driven the selection of longer proteins, as they are more able to distinguish among a larger number of distinct interactions due to their greater average surface area. Annotated protein sequences available from the SWISS-PROT database were analyzed for 13 eukaryotes, eight bacteria, and two archaea species. The number of subcellular locations to which each protein is associated is used as a measure of the number of interactions to which a protein participates. Two databases of yeast protein-protein interactions were used as another measure of the number of interactions to which each S. cerevisiae protein participates. Protein length is shown to correlate with both number of subcellular locations to which a protein is associated and number of interactions as measured by yeast two-hybrid experiments. Protein length is also shown to correlate with the probability that the protein is encoded by an essential gene. Interestingly, average protein length and number of subcellular locations are not significantly different between all human proteins and protein targets of known, marketed drugs. Increased protein length appears to be a significant mechanism by which the increasing complexity of protein-protein interaction networks is accommodated within the natural evolution of species. Consideration of protein length may be a valuable tool in drug design, one that predicts different strategies for inhibiting interactions in aberrant and normal pathways.

  17. EDITORIAL: Precision proteins Precision proteins

    NASA Astrophysics Data System (ADS)

    Demming, Anna

    2010-06-01

    Since the birth of modern day medicine, during the times of Hippocrates in ancient Greece, the profession has developed from the rudimentary classification of disease into a rigorous science with an inspiring capability to treat and cure. Scientific methodology has distilled clinical diagnostic tools from the early arts of prognosis, which used to rely as much on revelation and prophecy, as intuition and judgement [1]. Over the past decade, research into the interactions between proteins and nanosystems has provided some ingenious and apt techniques for delving into the intricacies of anatomical systems. In vivo biosensing has emerged as a vibrant field of research, as much of medical diagnosis relies on the detection of substances or an imbalance in the chemicals in the body. The inherent properties of nanoscale structures, such as cantilevers, make them well suited to biosensing applications that demand the detection of molecules at very low concentrations. Measurable deflections in cantilevers functionalised with antibodies provide quantitative indicators of the presence of specific antigens when the two react. Such developments have roused mounting interest in the interactions of proteins with nanostructures, such as carbon nanotubes [3], which have demonstrated great potential as generic biomarkers. Plasmonic properties are also being exploited in sensing applications, such as the molecular sentinel recently devised by researchers in the US. The device uses the plasmonic properties of a silver nanoparticle linked to a Raman labelled hairpin DNA probe to signal changes in the probe geometry resulting from interactions with substances in the environment. Success stories so far include the detection of two specific genes associated with breast cancer [4]. A greater understanding of how RNA interference regulates gene expression has highlighted the potential of using this natural process as another agent for combating disease in personalized medicine. However, the

  18. Plant inositol monophosphatase is a lithium-sensitive enzyme encoded by a multigene family.

    PubMed Central

    Gillaspy, G E; Keddie, J S; Oda, K; Gruissem, W

    1995-01-01

    myo-Inositol monophosphatase (IMP) is a soluble, Li(+)-sensitive protein that catalyzes the removal of a phosphate from myo-inositol phosphate substrates. IMP is required for de novo inositol synthesis from glucose 6-phosphate and for breakdown of inositol trisphosphate, a second messenger generated by the phosphatidylinositol signaling pathway. We cloned the IMP gene from tomato (LeIMP) and show that the plant enzyme is encoded by a small gene family. Three different LeIMP cDNAs encode distinct but highly conserved IMP enzymes that are catalytically active in vitro. Similar to the single IMP from animals, the activities of all three LeIMPs are inhibited by low concentrations of LiCl. LeIMP mRNA levels are developmentally regulated in seedlings and fruit and in response to light. Immunoblot analysis detected three proteins of distinct molecular masses (30, 29, and 28 kD) in tomato; these correspond to the predicted molecular masses of the LeIMPs encoded by the genes. Immunoreactive proteins in the same size range are also present in several other plants. Immunolocalization studies indicated that many cell types within seedlings accumulate LeIMP proteins. In particular, cells associated with the vasculature express high levels of LeIMP protein; this may indicate a coordinate regulation between phloem transport and synthesis of inositol. The presence of three distinct enzymes in tomato most likely reflects the complexity of inositol utilization in higher plants. PMID:8718627

  19. Shotgun protein sequencing.

    SciTech Connect

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.

    2009-06-01

    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  20. Protein Crystal Based Nanomaterials

    NASA Technical Reports Server (NTRS)

    Bell, Jeffrey A.; VanRoey, Patrick

    2001-01-01

    This is the final report on a NASA Grant. It concerns a description of work done, which includes: (1) Protein crystals cross-linked to form fibers; (2) Engineering of protein to favor crystallization; (3) Better knowledge-based potentials for protein-protein contacts; (4) Simulation of protein crystallization.

  1. Protein-losing enteropathy

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/007338.htm Protein-losing enteropathy To use the sharing features on this page, please enable JavaScript. Protein-losing enteropathy is an abnormal loss of protein ...

  2. Protein in diet

    MedlinePlus

    ... basic structure of protein is a chain of amino acids. You need protein in your diet to help ... Protein foods are broken down into parts called amino acids during digestion. The human body needs a number ...

  3. Enhanced Adhesion of Campylobacter jejuni to Abiotic Surfaces Is Mediated by Membrane Proteins in Oxygen-Enriched Conditions

    PubMed Central

    Sulaeman, Sheiam; Hernould, Mathieu; Schaumann, Annick; Coquet, Laurent; Bolla, Jean-Michel; Dé, Emmanuelle; Tresse, Odile

    2012-01-01

    Campylobacter jejuni is responsible for the major foodborne bacterial enteritis in humans. In contradiction with its fastidious growth requirements, this microaerobic pathogen can survive in aerobic food environments, suggesting that it must employ a variety of protection mechanisms to resist oxidative stress. For the first time, C. jejuni 81–176 inner and outer membrane subproteomes were analyzed separately using two-dimensional protein electrophoresis (2-DE) of oxygen-acclimated cells and microaerobically grown cells. LC-MS/MS analyses successfully identified 42 and 25 spots which exhibited a significantly altered abundance in the IMP-enriched fraction and in the OMP-enriched fraction, respectively, in response to oxidative conditions. These spots corresponded to 38 membrane proteins that could be grouped into different functional classes: (i) transporters, (ii) chaperones, (iii) fatty acid metabolism, (iv) adhesion/virulence and (v) other metabolisms. Some of these proteins were up-regulated at the transcriptional level in oxygen-acclimated cells as confirmed by qRT-PCR. Downstream analyses revealed that adhesion of C. jejuni to inert surfaces and swarming motility were enhanced in oxygen-acclimated cells or paraquat-stressed cells, which could be explained by the higher abundance of membrane proteins involved in adhesion and biofilm formation. The virulence factor CadF, over-expressed in the outer membrane of oxygen-acclimated cells, contributes to the complex process of C. jejuni adhesion to inert surfaces as revealed by a reduction in the capability of C. jejuni 81–176 ΔCadF cells compared to the isogenic strain. Taken together, these data demonstrate that oxygen-enriched conditions promote the over-expression of membrane proteins involved in both the biofilm initiation and virulence of C. jejuni. PMID:23029510

  4. Protein splicing: selfish genes invade cellular proteins.

    PubMed

    Neff, N F

    1993-12-01

    Protein splicing is a series of enzymatic events involving intramolecular protein breakage, rejoining and intron homing, in which introns are able to promote the recombinative transposition of their own coding sequences. Eukaryotic and prokaryotic spliced proteins have conserved similar gene structure, but little amino acid identity. The genes coding for these spliced proteins contain internal in-frame introns that encode polypeptides that apparently self-excise from the resulting host protein sequences. Excision of the 'protein intron' is coupled with joining of the two flanking protein regions encoded by exons of the host gene. Some introns of this type encode DNA endonucleases, related to Group I RNA intron gene products, that stimulate gene conversion and self-transmission.

  5. PREFACE: Protein protein interactions: principles and predictions

    NASA Astrophysics Data System (ADS)

    Nussinov, Ruth; Tsai, Chung-Jung

    2005-06-01

    Proteins are the `workhorses' of the cell. Their roles span functions as diverse as being molecular machines and signalling. They carry out catalytic reactions, transport, form viral capsids, traverse membranes and form regulated channels, transmit information from DNA to RNA, making possible the synthesis of new proteins, and they are responsible for the degradation of unnecessary proteins and nucleic acids. They are the vehicles of the immune response and are responsible for viral entry into the cell. Given their importance, considerable effort has been centered on the prediction of protein function. A prime way to do this is through identification of binding partners. If the function of at least one of the components with which the protein interacts is known, that should let us assign its function(s) and the pathway(s) in which it plays a role. This holds since the vast majority of their chores in the living cell involve protein-protein interactions. Hence, through the intricate network of these interactions we can map cellular pathways, their interconnectivities and their dynamic regulation. Their identification is at the heart of functional genomics; their prediction is crucial for drug discovery. Knowledge of the pathway, its topology, length, and dynamics may provide useful information for forecasting side effects. The goal of predicting protein-protein interactions is daunting. Some associations are obligatory, others are continuously forming and dissociating. In principle, from the physical standpoint, any two proteins can interact, but under what conditions and at which strength? The principles of protein-protein interactions are general: the non-covalent interactions of two proteins are largely the outcome of the hydrophobic effect, which drives the interactions. In addition, hydrogen bonds and electrostatic interactions play important roles. Thus, many of the interactions observed in vitro are the outcome of experimental overexpression. Protein disorder

  6. Protein sequence comparison and protein evolution

    SciTech Connect

    Pearson, W.R.

    1995-12-31

    This tutorial was one of eight tutorials selected to be presented at the Third International Conference on Intelligent Systems for Molecular Biology which was held in the United Kingdom from July 16 to 19, 1995. This tutorial examines how the information conserved during the evolution of a protein molecule can be used to infer reliably homology, and thus a shared proteinfold and possibly a shared active site or function. The authors start by reviewing a geological/evolutionary time scale. Next they look at the evolution of several protein families. During the tutorial, these families will be used to demonstrate that homologous protein ancestry can be inferred with confidence. They also examine different modes of protein evolution and consider some hypotheses that have been presented to explain the very earliest events in protein evolution. The next part of the tutorial will examine the technical aspects of protein sequence comparison. Both optimal and heuristic algorithms and their associated parameters that are used to characterize protein sequence similarities are discussed. Perhaps more importantly, they survey the statistics of local similarity scores, and how these statistics can both be used to improve the selectivity of a search and to evaluate the significance of a match. They them examine distantly related members of three protein families, the serine proteases, the glutathione transferases, and the G-protein-coupled receptors (GCRs). Finally, the discuss how sequence similarity can be used to examine internal repeated or mosaic structures in proteins.

  7. Whey protein fractionation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Concentrated whey protein products from cheese whey, such as whey protein concentrate (WPC) and whey protein isolate (WPI), contain more than seven different types of proteins: alpha-lactalbumin (alpha-LA), beta-lactoglobulin (beta-LG), bovine serum albumin (BSA), immunoglobulins (Igs), lactoferrin ...

  8. Protein- protein interaction detection system using fluorescent protein microdomains

    DOEpatents

    Waldo, Geoffrey S.; Cabantous, Stephanie

    2010-02-23

    The invention provides a protein labeling and interaction detection system based on engineered fragments of fluorescent and chromophoric proteins that require fused interacting polypeptides to drive the association of the fragments, and further are soluble and stable, and do not change the solubility of polypeptides to which they are fused. In one embodiment, a test protein X is fused to a sixteen amino acid fragment of GFP (.beta.-strand 10, amino acids 198-214), engineered to not perturb fusion protein solubility. A second test protein Y is fused to a sixteen amino acid fragment of GFP (.beta.-strand 11, amino acids 215-230), engineered to not perturb fusion protein solubility. When X and Y interact, they bring the GFP strands into proximity, and are detected by complementation with a third GFP fragment consisting of GFP amino acids 1-198 (strands 1-9). When GFP strands 10 and 11 are held together by interaction of protein X and Y, they spontaneous association with GFP strands 1-9, resulting in structural complementation, folding, and concomitant GFP fluorescence.

  9. Metabolism of the novel IMP dehydrogenase inhibitor benzamide riboside.

    PubMed

    Jäger, Walter; Salamon, Alexandra; Szekeres, Thomas

    2002-04-01

    Benzamide riboside (BR) is a novel anticancer agent exhibiting pronounced activity against several human tumor cell lines via the inhibition of inosine 5'-monophosphate dehydrogenase (IMPDH) that catalyzes the formation of xanthine 5'-monophosphate from inosine 5'-monophosphate and nicotinamide adenine dinucleotide, thereby restricting the biosynthesis of guanylates. Phosphorylation of BR to its 5'-monophosphate derivative appears to be ubiquitous in most cells catalyzed by the enzymes, adenosine kinase, nicotinamide nucleoside kinase and 5' nucleotidase. BR 5'-monophosphate is then converted to the active metabolite benzamide adenine dinucleotide (BAD) by NMN adenylyltransferase, the rate-limiting enzyme in the biosynthesis of NAD. As BAD is more potent in the inhibition of IMPDH than BR and BR 5'-monophosphate, cytotoxicity of BR is closely connected with intercellular metabolism to BAD. However, intracellular BAD level is also affected by BADase activity, a phosphodiesterase which hydrolyzes BAD to BR-5'-monophosphate and AMP. A recent study demonstrates enzymatic deamination of BR to non-cytotoxic benzene carboxylic acid (BR-COOH) as the main hepatic BR biotransformation product in rat liver. As the IMPDH inhibitors tiazofurin and ribavirin exhibit predominant accumulation and biotransformation in liver, hepatic metabolism may be an important factor also for BR activation and inactivation and should be considered in human liver during cancer therapy when BR is used as a single drug or in combination with other anticancer agents.

  10. Interactions Measurement Payload for Shuttle (IMPS) Definition Phase Study.

    DTIC Science & Technology

    1984-12-15

    affected by the high density ionospheric plasma at Shuttle altitudes, and, potentially, by spacecraft charging during auroral arc passage...observations. Thus, based on the IRI model environment alone, spacecraft charging is not a * concern (note: the high plasma density will encourage...Summary .. ........................ 5-8 *5.2 THE AURORAL/POLAR CAP ENVIRONMENT AND ITS IMPACT ON SPACECRAFT PLASMA INTERACONSN... ............. 5-9

  11. IMP Dehydrogenase: Structural Schizophrenia and an Unusual Base

    SciTech Connect

    Hedstrom,L.; Gan, L.

    2006-01-01

    Textbooks describe enzymes as relatively rigid templates for the transition state of a chemical reaction, and indeed an enzyme such as chymotrypsin, which catalyzes a relatively simple hydrolysis reaction, is reasonably well described by this model. Inosine monophosphate dehydrogenase (IMPDH) undergoes a remarkable array of conformational transitions in the course of a complicated catalytic cycle, offering a dramatic counterexample to this view. IMPDH displays several other unusual mechanistic features, including an Arg residue that may act as a general base catalyst and a dynamic monovalent cation site. Further, IMPDH appears to be involved in 'moon-lighting' functions that may require additional conformational states. How the balance between conformational states is maintained and how the various conformational states interconvert is only beginning to be understood.

  12. IMP: Interactive mass properties program. Volume 1: Program description

    NASA Technical Reports Server (NTRS)

    Stewart, W. A.

    1976-01-01

    A method of computing a weights and center of gravity analysis of a flight vehicle using interactive graphical capabilities of the Adage 340 computer is described. The equations used to calculate area, volume, and mass properties are based on elemental surface characteristics. The input/output methods employ the graphic support of the Adage computer. Several interactive program options are available for analyzing the mass properties of a vehicle. These options are explained.

  13. IMP-J attitude control prelaunch analysis and operations plan

    NASA Technical Reports Server (NTRS)

    Hooper, H. L.; Mckendrew, J. B.; Repass, G. D.

    1973-01-01

    A description of the attitude control support being supplied for the Explorer 50 mission is given. Included in the document are descriptions of the computer programs being used to support attitude determination, prediction, and control for the mission and descriptions of the operating procedures that will be used to accomplish mission objectives.

  14. Molecular modelling of protein-protein/protein-solvent interactions

    NASA Astrophysics Data System (ADS)

    Luchko, Tyler

    The inner workings of individual cells are based on intricate networks of protein-protein interactions. However, each of these individual protein interactions requires a complex physical interaction between proteins and their aqueous environment at the atomic scale. In this thesis, molecular dynamics simulations are used in three theoretical studies to gain insight at the atomic scale about protein hydration, protein structure and tubulin-tubulin (protein-protein) interactions, as found in microtubules. Also presented, in a fourth project, is a molecular model of solvation coupled with the Amber molecular modelling package, to facilitate further studies without the need of explicitly modelled water. Basic properties of a minimally solvated protein were calculated through an extended study of myoglobin hydration with explicit solvent, directly investigating water and protein polarization. Results indicate a close correlation between polarization of both water and protein and the onset of protein function. The methodology of explicit solvent molecular dynamics was further used to study tubulin and microtubules. Extensive conformational sampling of the carboxy-terminal tails of 8-tubulin was performed via replica exchange molecular dynamics, allowing the characterisation of the flexibility, secondary structure and binding domains of the C-terminal tails through statistical analysis methods. Mechanical properties of tubulin and microtubules were calculated with adaptive biasing force molecular dynamics. The function of the M-loop in microtubule stability was demonstrated in these simulations. The flexibility of this loop allowed constant contacts between the protofilaments to be maintained during simulations while the smooth deformation provided a spring-like restoring force. Additionally, calculating the free energy profile between the straight and bent tubulin configurations was used to test the proposed conformational change in tubulin, thought to cause microtubule

  15. A New Membrane Protein Sbg1 Links the Contractile Ring Apparatus and Septum Synthesis Machinery in Fission Yeast

    PubMed Central

    Sethi, Kriti; Palani, Saravanan; Cortés, Juan C. G.; Sato, Mamiko; Sevugan, Mayalagu; Ramos, Mariona; Vijaykumar, Shruthi; Osumi, Masako; Naqvi, Naweed I.; Ribas, Juan Carlos; Balasubramanian, Mohan

    2016-01-01

    Cytokinesis in many organisms requires a plasma membrane anchored actomyosin ring, whose contraction facilitates cell division. In yeast and fungi, actomyosin ring constriction is also coordinated with division septum assembly. How the actomyosin ring interacts with the plasma membrane and the plasma membrane-localized septum synthesizing machinery remains poorly understood. In Schizosaccharomyces pombe, an attractive model organism to study cytokinesis, the β-1,3-glucan synthase Cps1p / Bgs1p, an integral membrane protein, localizes to the plasma membrane overlying the actomyosin ring and is required for primary septum synthesis. Through a high-dosage suppressor screen we identified an essential gene, sbg1+ (suppressor of beta glucan synthase 1), which suppressed the colony formation defect of Bgs1-defective cps1-191 mutant at higher temperatures. Sbg1p, an integral membrane protein, localizes to the cell ends and to the division site. Sbg1p and Bgs1p physically interact and are dependent on each other to localize to the division site. Loss of Sbg1p results in an unstable actomyosin ring that unravels and slides, leading to an inability to deposit a single contiguous division septum and an important reduction of the β-1,3-glucan proportion in the cell wall, coincident with that observed in the cps1-191 mutant. Sbg1p shows genetic and / or physical interaction with Rga7p, Imp2p, Cdc15p, and Pxl1p, proteins known to be required for actomyosin ring integrity and efficient septum synthesis. This study establishes Sbg1p as a key member of a group of proteins that link the plasma membrane, the actomyosin ring, and the division septum assembly machinery in fission yeast. PMID:27749909

  16. Surface Mediated Protein Disaggregation

    NASA Astrophysics Data System (ADS)

    Radhakrishna, Mithun; Kumar, Sanat K.

    2014-03-01

    Preventing protein aggregation is of both biological and industrial importance. Biologically these aggregates are known to cause amyloid type diseases like Alzheimer's and Parkinson's disease. Protein aggregation leads to reduced activity of the enzymes in industrial applications. Inter-protein interactions between the hydrophobic residues of the protein are known to be the major driving force for protein aggregation. In the current paper we show how surface chemistry and curvature can be tuned to mitigate these inter-protein interactions. Our results calculated in the framework of the Hydrophobic-Polar (HP) lattice model show that, inter-protein interactions can be drastically reduced by increasing the surface hydrophobicity to a critical value corresponding to the adsorption transition of the protein. At this value of surface hydrophobicity, proteins lose inter-protein contacts to gain surface contacts and thus the surface helps in reducing the inter-protein interactions. Further, we show that the adsorption of the proteins inside hydrophobic pores of optimal sizes are most efficient both in reducing inter-protein contacts and simultaneously retaining most of the native-contacts due to strong protein-surface interactions coupled with stabilization due to the confinement. Department of Energy (Grant No DE-FG02-11ER46811).

  17. Physics of protein motility and motor proteins

    NASA Astrophysics Data System (ADS)

    Kolomeisky, Anatoly B.

    2013-09-01

    Motor proteins are enzymatic molecules that transform chemical energy into mechanical motion and work. They are critically important for supporting various cellular activities and functions. In the last 15 years significant progress in understanding the functioning of motor proteins has been achieved due to revolutionary breakthroughs in single-molecule experimental techniques and strong advances in theoretical modelling. However, microscopic mechanisms of protein motility are still not well explained, and the collective efforts of many scientists are needed in order to solve these complex problems. In this special section the reader will find the latest advances on the difficult road to mapping motor proteins dynamics in various systems. Recent experimental developments have allowed researchers to monitor and to influence the activity of single motor proteins with a high spatial and temporal resolution. It has stimulated significant theoretical efforts to understand the non-equilibrium nature of protein motility phenomena. The latest results from all these advances are presented and discussed in this special section. We would like to thank the scientists from all over the world who have reported their latest research results for this special section. We are also grateful to the staff and editors of Journal of Physics: Condensed Matter for their invaluable help in handling all the administrative and refereeing activities. The field of motor proteins and protein motility is fast moving, and we hope that this collection of articles will be a useful source of information in this highly interdisciplinary area. Physics of protein motility and motor proteins contents Physics of protein motility and motor proteinsAnatoly B Kolomeisky Identification of unique interactions between the flexible linker and the RecA-like domains of DEAD-box helicase Mss116 Yuan Zhang, Mirkó Palla, Andrew Sun and Jung-Chi Liao The load dependence of the physical properties of a molecular motor

  18. Protein C blood test

    MedlinePlus

    ... a normal substance in the body that prevents blood clotting. A blood test can be done to see ... history of blood clots. Protein C helps control blood clotting. A lack of this protein or problem with ...

  19. Protein S blood test

    MedlinePlus

    ... a normal substance in your body that prevents blood clotting. A blood test can be done to see ... family history of blood clots. Protein S helps control blood clotting. A lack of this protein or problem with ...

  20. Learning about Proteins

    MedlinePlus

    ... body, and protecting you from disease. All About Amino Acids When you eat foods that contain protein, the ... called amino (say: uh-MEE-no) acids. The amino acids then can be reused to make the proteins ...

  1. Modeling Protein Self Assembly

    ERIC Educational Resources Information Center

    Baker, William P.; Jones, Carleton Buck; Hull, Elizabeth

    2004-01-01

    Understanding the structure and function of proteins is an important part of the standards-based science curriculum. Proteins serve vital roles within the cell and malfunctions in protein self assembly are implicated in degenerative diseases. Experience indicates that this topic is a difficult one for many students. We have found that the concept…

  2. CSF total protein

    MedlinePlus

    CSF total protein is a test to determine the amount of protein in your spinal fluid, also called cerebrospinal fluid (CSF). ... The normal protein range varies from lab to lab, but is typically about 15 to 60 milligrams per deciliter (mg/dL) ...

  3. Modeling Protein Domain Function

    ERIC Educational Resources Information Center

    Baker, William P.; Jones, Carleton "Buck"; Hull, Elizabeth

    2007-01-01

    This simple but effective laboratory exercise helps students understand the concept of protein domain function. They use foam beads, Styrofoam craft balls, and pipe cleaners to explore how domains within protein active sites interact to form a functional protein. The activity allows students to gain content mastery and an understanding of the…

  4. Destabilized bioluminescent proteins

    DOEpatents

    Allen, Michael S.; Rakesh, Gupta; Gary, Sayler S.

    2007-07-31

    Purified nucleic acids, vectors and cells containing a gene cassette encoding at least one modified bioluminescent protein, wherein the modification includes the addition of a peptide sequence. The duration of bioluminescence emitted by the modified bioluminescent protein is shorter than the duration of bioluminescence emitted by an unmodified form of the bioluminescent protein.

  5. Texturized dairy proteins

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dairy proteins are amenable to structural modifications induced by high temperature, shear and moisture; in particular, whey proteins can change conformation to new unfolded states. The change in protein state is a basis for creating new foods. The dairy products, nonfat dried milk (NDM), whey prote...

  6. Overview of Protein Microarrays

    PubMed Central

    Reymond Sutandy, FX; Qian, Jiang; Chen, Chien-Sheng; Zhu, Heng

    2013-01-01

    Protein microarray is an emerging technology that provides a versatile platform for characterization of hundreds of thousands of proteins in a highly parallel and high-throughput way. Two major classes of protein microarrays are defined to describe their applications: analytical and functional protein microarrays. In addition, tissue or cell lysates can also be fractionated and spotted on a slide to form a reverse-phase protein microarray. While the fabrication technology is maturing, applications of protein microarrays, especially functional protein microarrays, have flourished during the past decade. Here, we will first review recent advances in the protein microarray technologies, and then present a series of examples to illustrate the applications of analytical and functional protein microarrays in both basic and clinical research. The research areas will include detection of various binding properties of proteins, study of protein posttranslational modifications, analysis of host-microbe interactions, profiling antibody specificity, and identification of biomarkers in autoimmune diseases. As a powerful technology platform, it would not be surprising if protein microarrays will become one of the leading technologies in proteomic and diagnostic fields in the next decade. PMID:23546620

  7. The E5 Proteins

    PubMed Central

    DiMaio, Daniel; Petti, Lisa

    2013-01-01

    The E5 proteins are short transmembrane proteins encoded by many animal and human papillomaviruses. These proteins display transforming activity in cultured cells and animals, and they presumably also play a role in the productive virus life cycle. The E5 proteins are thought to act by modulating the activity of cellular proteins. Here, we describe the biological activities of the best-studied E5 proteins and discuss the evidence implicating specific protein targets and pathways in mediating these activities. The primary target of the 44-amino acid BPV1 E5 is the PDGF β receptor, whereas the EGF receptor appears to be an important target of the 83-amino acid HPV16 E5 protein. Both E5 proteins also bind to the vacuolar ATPase and affect MHC class I expression and cell-cell communication. Continued studies of the E5 proteins will elucidate important aspects of transmembrane protein-protein interactions, cellular signal transduction, cell biology, virus replication, and tumorigenesis. PMID:23731971

  8. Protopia: a protein-protein interaction tool

    PubMed Central

    Real-Chicharro, Alejandro; Ruiz-Mostazo, Iván; Navas-Delgado, Ismael; Kerzazi, Amine; Chniber, Othmane; Sánchez-Jiménez, Francisca; Medina, Miguel Ángel; Aldana-Montes, José F

    2009-01-01

    Background Protein-protein interactions can be considered the basic skeleton for living organism self-organization and homeostasis. Impressive quantities of experimental data are being obtained and computational tools are essential to integrate and to organize this information. This paper presents Protopia, a biological tool that offers a way of searching for proteins and their interactions in different Protein Interaction Web Databases, as a part of a multidisciplinary initiative of our institution for the integration of biological data . Results The tool accesses the different Databases (at present, the free version of Transfac, DIP, Hprd, Int-Act and iHop), and results are expressed with biological protein names or databases codes and can be depicted as a vector or a matrix. They can be represented and handled interactively as an organic graph. Comparison among databases is carried out using the Uniprot codes annotated for each protein. Conclusion The tool locates and integrates the current information stored in the aforementioned databases, and redundancies among them are detected. Results are compatible with the most important network analysers, so that they can be compared and analysed by other world-wide known tools and platforms. The visualization possibilities help to attain this goal and they are especially interesting for handling multiple-step or complex networks. PMID:19828077

  9. Protein-protein interactions in multienzyme megasynthetases.

    PubMed

    Weissman, Kira J; Müller, Rolf

    2008-04-14

    The multienzyme polyketide synthases (PKSs), nonribosomal polypeptide synthetases (NRPSs), and their hybrids are responsible for the construction in bacteria of numerous natural products of clinical value. These systems generate high structural complexity by using a simple biosynthetic logic--that of the assembly line. Each of the individual steps in building the metabolites is designated to an independently folded domain within gigantic polypeptides. The domains are clustered into functional modules, and the modules are strung out along the proteins in the order in which they act. Every metabolite results, therefore, from the successive action of up to 100 individual catalysts. Despite the conceptual simplicity of this division-of-labor organization, we are only beginning to decipher the molecular details of the numerous protein-protein interactions that support assembly-line biosynthesis, and which are critical to attempts to re-engineer these systems as a tool in drug discovery. This review aims to summarize the state of knowledge about several aspects of protein-protein interactions, including current architectural models for PKS and NRPS systems, the central role of carrier proteins, and the structural basis for intersubunit recognition.

  10. Highly thermostable fluorescent proteins

    DOEpatents

    Bradbury, Andrew M [Santa Fe, NM; Waldo, Geoffrey S [Santa Fe, NM; Kiss, Csaba [Los Alamos, NM

    2012-05-01

    Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

  11. Highly thermostable fluorescent proteins

    DOEpatents

    Bradbury, Andrew M.; Waldo, Geoffrey S.; Kiss, Csaba

    2011-03-22

    Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

  12. Highly thermostable fluorescent proteins

    DOEpatents

    Bradbury, Andrew M [Santa Fe, NM; Waldo, Geoffrey S [Santa Fe, NM; Kiss, Csaba [Los Alamos, NM

    2011-11-29

    Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

  13. Protein crystallization with paper

    NASA Astrophysics Data System (ADS)

    Matsuoka, Miki; Kakinouchi, Keisuke; Adachi, Hiroaki; Maruyama, Mihoko; Sugiyama, Shigeru; Sano, Satoshi; Yoshikawa, Hiroshi Y.; Takahashi, Yoshinori; Yoshimura, Masashi; Matsumura, Hiroyoshi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Takano, Kazufumi

    2016-05-01

    We developed a new protein crystallization method that incorporates paper. A small piece of paper, such as facial tissue or KimWipes, was added to a drop of protein solution in the traditional sitting drop vapor diffusion technique, and protein crystals grew by incorporating paper. By this method, we achieved the growth of protein crystals with reducing osmotic shock. Because the technique is very simple and the materials are easy to obtain, this method will come into wide use for protein crystallization. In the future, it could be applied to nanoliter-scale crystallization screening on a paper sheet such as in inkjet printing.

  14. [Atypical ubiquitination of proteins].

    PubMed

    Buneeva, O A; Medvedev, A E

    2016-07-01

    Ubiquitination is a type of posttranslational modification of intracellular proteins characterized by covalent attachment of one (monoubiquitination) or several (polyubiquitination) of ubiquitin molecules to target proteins. In the case of polyubiquitination, linear or branched polyubiquitin chains are formed. Their formation involves various lysine residues of monomeric ubiquitin. The best studied is Lys48-polyubiquitination, which targets proteins for proteasomal degradation. In this review we have considered examples of so-called atypical polyubiquitination, which mainly involves other lysine residues (Lys6, Lys11, Lys27, Lys29, Lys33, Lys63) and also N-terminal methionine. The considered examples convincingly demonstrate that polyubiquitination of proteins not necessarily targets proteins for their proteolytic degradation in proteasomes. Atypically polyubiquitinated proteins are involved in regulation of various processes and altered polyubiquitination of certain proteins is crucial for development of serious diseases.

  15. Protein and vegetarian diets.

    PubMed

    Marsh, Kate A; Munn, Elizabeth A; Baines, Surinder K

    2013-08-19

    A vegetarian diet can easily meet human dietary protein requirements as long as energy needs are met and a variety of foods are eaten. Vegetarians should obtain protein from a variety of plant sources, including legumes, soy products, grains, nuts and seeds. Eggs and dairy products also provide protein for those following a lacto-ovo-vegetarian diet. There is no need to consciously combine different plant proteins at each meal as long as a variety of foods are eaten from day to day, because the human body maintains a pool of amino acids which can be used to complement dietary protein. The consumption of plant proteins rather than animal proteins by vegetarians may contribute to their reduced risk of chronic diseases such as diabetes and heart disease.

  16. Protein solubility modeling

    NASA Technical Reports Server (NTRS)

    Agena, S. M.; Pusey, M. L.; Bogle, I. D.

    1999-01-01

    A thermodynamic framework (UNIQUAC model with temperature dependent parameters) is applied to model the salt-induced protein crystallization equilibrium, i.e., protein solubility. The framework introduces a term for the solubility product describing protein transfer between the liquid and solid phase and a term for the solution behavior describing deviation from ideal solution. Protein solubility is modeled as a function of salt concentration and temperature for a four-component system consisting of a protein, pseudo solvent (water and buffer), cation, and anion (salt). Two different systems, lysozyme with sodium chloride and concanavalin A with ammonium sulfate, are investigated. Comparison of the modeled and experimental protein solubility data results in an average root mean square deviation of 5.8%, demonstrating that the model closely follows the experimental behavior. Model calculations and model parameters are reviewed to examine the model and protein crystallization process. Copyright 1999 John Wiley & Sons, Inc.

  17. MacB ABC transporter is a dimer whose ATPase activity and macrolide-binding capacity are regulated by the membrane fusion protein MacA.

    PubMed

    Lin, Hong Ting; Bavro, Vassiliy N; Barrera, Nelson P; Frankish, Helen M; Velamakanni, Saroj; van Veen, Hendrik W; Robinson, Carol V; Borges-Walmsley, M Inês; Walmsley, Adrian R

    2009-01-09

    Gram-negative bacteria utilize specialized machinery to translocate drugs and protein toxins across the inner and outer membranes, consisting of a tripartite complex composed of an inner membrane secondary or primary active transporter (IMP), a periplasmic membrane fusion protein, and an outer membrane channel. We have investigated the assembly and function of the MacAB/TolC system that confers resistance to macrolides in Escherichia coli. The membrane fusion protein MacA not only stabilizes the tripartite assembly by interacting with both the inner membrane protein MacB and the outer membrane protein TolC, but also has a role in regulating the function of MacB, apparently increasing its affinity for both erythromycin and ATP. Analysis of the kinetic behavior of ATP hydrolysis indicated that MacA promotes and stabilizes the ATP-binding form of the MacB transporter. For the first time, we have established unambiguously the dimeric nature of a noncanonic ABC transporter, MacB that has an N-terminal nucleotide binding domain, by means of nondissociating mass spectrometry, analytical ultracentrifugation, and atomic force microscopy. Structural studies of ABC transporters indicate that ATP is bound between a pair of nucleotide binding domains to stabilize a conformation in which the substrate-binding site is outward-facing. Consequently, our data suggest that in the presence of ATP the same conformation of MacB is promoted and stabilized by MacA. Thus, MacA would facilitate the delivery of drugs by MacB to TolC by enhancing the binding of drugs to it and inducing a conformation of MacB that is primed and competent for binding TolC. Our structural studies are an important first step in understanding how the tripartite complex is assembled.

  18. Predictions of Protein-Protein Interfaces within Membrane Protein Complexes

    PubMed Central

    Asadabadi, Ebrahim Barzegari; Abdolmaleki, Parviz

    2013-01-01

    Background Prediction of interaction sites within the membrane protein complexes using the sequence data is of a great importance, because it would find applications in modification of molecules transport through membrane, signaling pathways and drug targets of many diseases. Nevertheless, it has gained little attention from the protein structural bioinformatics community. Methods In this study, a wide variety of prediction and classification tools were applied to distinguish the residues at the interfaces of membrane proteins from those not in the interfaces. Results The tuned SVM model achieved the high accuracy of 86.95% and the AUC of 0.812 which outperforms the results of the only previous similar study. Nevertheless, prediction performances obtained using most employed models cannot be used in applied fields and needs more effort to improve. Conclusion Considering the variety of the applied tools in this study, the present investigation could be a good starting point to develop more efficient tools to predict the membrane protein interaction site residues. PMID:23919118

  19. E-Cadherin, CD44v6, and Insulin-Like Growth Factor-II mRNA-Binding Protein 3 Expressions in Different Stages of Hydatidiform Moles.

    PubMed

    Wang, Jiajun; Zhao, Min; Xiao, Jianping; Wu, Man; Song, Yaohua; Yin, Yongxiang

    2016-09-01

    E-cadherin, CD44v6, and IMP3 expression in partial, complete, and invasive hydatidiform moles (HMs) was evaluated. High E-cadherin expression with low CD44v6 expression was observed in partial, complete, and invasive HMs, as well as in normal placental tissues; and there was no significant difference in E-cadherin and CD44v6 expression among the four groups. However, IMP3 expression was gradually decreased in the order of normal placental tissues, partial HMs, complete HMs, and invasive HMs; wherein, invasive HMs had the lowest level. Low IMP3 expression may serve as a prognostic biomarker for HMs, and IMP3 may play a certain role in HMs progression.

  20. Modeling Protein Expression and Protein Signaling Pathways

    PubMed Central

    Telesca, Donatello; Müller, Peter; Kornblau, Steven M.; Suchard, Marc A.; Ji, Yuan

    2015-01-01

    High-throughput functional proteomic technologies provide a way to quantify the expression of proteins of interest. Statistical inference centers on identifying the activation state of proteins and their patterns of molecular interaction formalized as dependence structure. Inference on dependence structure is particularly important when proteins are selected because they are part of a common molecular pathway. In that case, inference on dependence structure reveals properties of the underlying pathway. We propose a probability model that represents molecular interactions at the level of hidden binary latent variables that can be interpreted as indicators for active versus inactive states of the proteins. The proposed approach exploits available expert knowledge about the target pathway to define an informative prior on the hidden conditional dependence structure. An important feature of this prior is that it provides an instrument to explicitly anchor the model space to a set of interactions of interest, favoring a local search approach to model determination. We apply our model to reverse-phase protein array data from a study on acute myeloid leukemia. Our inference identifies relevant subpathways in relation to the unfolding of the biological process under study. PMID:26246646

  1. Protein kinesis: The dynamics of protein trafficking and stability

    SciTech Connect

    1995-12-31

    The purpose of this conference is to provide a multidisciplinary forum for exchange of state-of-the-art information on protein kinesis. This volume contains abstracts of papers in the following areas: protein folding and modification in the endoplasmic reticulum; protein trafficking; protein translocation and folding; protein degradation; polarity; nuclear trafficking; membrane dynamics; and protein import into organelles.

  2. Protein flexibility as a biosignal.

    PubMed

    Zhao, Qinyi

    2010-01-01

    Dynamic properties of a protein are crucial for all protein functions, and those of signaling proteins are closely related to the biological function of living beings. The protein flexibility signal concept can be used to analyze this relationship. Protein flexibility controls the rate of protein conformational change and influences protein function. The modification of protein flexibility results in a change of protein activity. The logical nature of protein flexibility cannot be explained by applying the principles of protein three-dimensional structure theory or conformation concept. Signaling proteins show high protein flexibility. Many properties of signaling can be traced back to the dynamic natures of signaling protein. The action mechanism of volatile anesthetics and universal cellular reactions are related to flexibility in the change of signaling proteins. We conclude that protein dynamics is an enzyme-enhanced process, called dynamicase.

  3. Antimicrobial proteins: From old proteins, new tricks.

    PubMed

    Smith, Valerie J; Dyrynda, Elisabeth A

    2015-12-01

    This review describes the main types of antimicrobial peptides (AMPs) synthesised by crustaceans, primarily those identified in shrimp, crayfish, crab and lobster. It includes an overview of their range of microbicidal activities and the current landscape of our understanding of their gene expression patterns in different body tissues. It further summarises how their expression might change following various types of immune challenges. The review further considers proteins or protein fragments from crustaceans that have antimicrobial properties but are more usually associated with other biological functions, or are derived from such proteins. It discusses how these unconventional AMPs might be generated at, or delivered to, sites of infection and how they might contribute to crustacean host defence in vivo. It also highlights recent work that is starting to reveal the extent of multi-functionality displayed by some decapod AMPs, particularly their participation in other aspects of host protection. Examples of such activities include proteinase inhibition, phagocytosis, antiviral activity and haematopoiesis.

  4. Protein-protein Interactions using Radiolytic Footprinting

    SciTech Connect

    Takamoto,K.; Chance, M.

    2006-01-01

    Structural proteomics approaches using mass spectrometry are increasingly used in biology to examine the composition and structure of macromolecules. Hydroxyl radical-mediated protein footprinting using mass spectrometry has recently been developed to define structure, assembly, and conformational changes of macromolecules in solution based on measurements of reactivity of amino acid side chain groups with covalent modification reagents. Accurate measurements of side chain reactivity are achieved using quantitative liquid-chromatography-coupled mass spectrometry, whereas the side chain modification sites are identified using tandem mass spectrometry. In addition, the use of footprinting data in conjunction with computational modeling approaches is a powerful new method for testing and refining structural models of macromolecules and their complexes. In this review, we discuss the basic chemistry of hydroxyl radical reactions with peptides and proteins, highlight various approaches to map protein structure using radical oxidation methods, and describe state-of-the-art approaches to combine computational and footprinting data.

  5. Mechanisms Regulating Protein Localization.

    PubMed

    Bauer, Nicholas C; Doetsch, Paul W; Corbett, Anita H

    2015-10-01

    Cellular functions are dictated by protein content and activity. There are numerous strategies to regulate proteins varying from modulating gene expression to post-translational modifications. One commonly used mode of regulation in eukaryotes is targeted localization. By specifically redirecting the localization of a pool of existing protein, cells can achieve rapid changes in local protein function. Eukaryotic cells have evolved elegant targeting pathways to direct proteins to the appropriate cellular location or locations. Here, we provide a general overview of these localization pathways, with a focus on nuclear and mitochondrial transport, and present a survey of the evolutionarily conserved regulatory strategies identified thus far. We end with a description of several specific examples of proteins that exploit localization as an important mode of regulation.

  6. Mayaro virus proteins.

    PubMed

    Mezencio, J M; Rebello, M A

    1993-01-01

    Mayaro virus was grown in BHK-21 cells and purified by centrifugation in a potassium-tartrate gradient (5-50%). The electron microscopy analyses of the purified virus showed an homogeneous population of enveloped particles with 69 +/- 2.3 nm in diameter. Three structural virus proteins were identified and designated p1, p2 and p3. Their average molecular weight were p1, 54 KDa; p2, 50 KDa and p3, 34 KDa. In Mayaro virus infected Aedes albopictus cells and in BHK-21 infected cells we detected six viral proteins, in which three of them are the structural virus proteins and the other three were products from processing of precursors of viral proteins, whose molecular weights are 62 KDa, 64 KDa and 110 KDa. The 34 KDa protein was the first viral protein synthesized at 5 hours post-infection in both cell lines studied.

  7. TRIM proteins and diseases.

    PubMed

    Watanabe, Masashi; Hatakeyama, Shigetsugu

    2017-01-07

    Ubiquitination is one of the posttranslational modifications that regulates a number of intracellular events including signal transduction, protein quality control, transcription, cell cycle, apoptosis and development. The ubiquitin system functions as a garbage machine to degrade target proteins and as a regulator for several signalling pathways. Biochemical reaction of ubiquitination requires several enzymes including E1, E2 and E3, and E3 ubiquitin ligases play roles as receptors for recognizing target proteins. Most of the tripartite motif (TRIM) proteins are E3 ubiquitin ligases. Recent studies have shown that some TRIM proteins function as important regulators for a variety of diseases including cancer, inflammatory diseases, infectious diseases, neuropsychiatric disorders, chromosomal abnormalities and developmental diseases. In this review, we summarize the involvement of TRIM proteins in the aetiology of various diseases.

  8. Biofilm Matrix Proteins

    PubMed Central

    Fong, Jiunn N. C.; Yildiz, Fitnat H.

    2015-01-01

    Proteinaceous components of the biofilm matrix include secreted extracellular proteins, cell surface adhesins and protein subunits of cell appendages such as flagella and pili. Biofilm matrix proteins play diverse roles in biofilm formation and dissolution. They are involved in attaching cells to surfaces, stabilizing the biofilm matrix via interactions with exopolysaccharide and nucleic acid components, developing three-dimensional biofilm architectures, and dissolving biofilm matrix via enzymatic degradation of polysaccharides, proteins, and nucleic acids. In this chapter, we will review functions of matrix proteins in a selected set of microorganisms, studies of the matrix proteomes of Vibrio cholerae and Pseudomonas aeruginosa, and roles of outer membrane vesicles and of nucleoid-binding proteins in biofilm formation. PMID:26104709

  9. Protein oxidation and peroxidation

    PubMed Central

    Davies, Michael J.

    2016-01-01

    Proteins are major targets for radicals and two-electron oxidants in biological systems due to their abundance and high rate constants for reaction. With highly reactive radicals damage occurs at multiple side-chain and backbone sites. Less reactive species show greater selectivity with regard to the residues targeted and their spatial location. Modification can result in increased side-chain hydrophilicity, side-chain and backbone fragmentation, aggregation via covalent cross-linking or hydrophobic interactions, protein unfolding and altered conformation, altered interactions with biological partners and modified turnover. In the presence of O2, high yields of peroxyl radicals and peroxides (protein peroxidation) are formed; the latter account for up to 70% of the initial oxidant flux. Protein peroxides can oxidize both proteins and other targets. One-electron reduction results in additional radicals and chain reactions with alcohols and carbonyls as major products; the latter are commonly used markers of protein damage. Direct oxidation of cysteine (and less commonly) methionine residues is a major reaction; this is typically faster than with H2O2, and results in altered protein activity and function. Unlike H2O2, which is rapidly removed by protective enzymes, protein peroxides are only slowly removed, and catabolism is a major fate. Although turnover of modified proteins by proteasomal and lysosomal enzymes, and other proteases (e.g. mitochondrial Lon), can be efficient, protein hydroperoxides inhibit these pathways and this may contribute to the accumulation of modified proteins in cells. Available evidence supports an association between protein oxidation and multiple human pathologies, but whether this link is causal remains to be established. PMID:27026395

  10. Computer Models of Proteins

    NASA Technical Reports Server (NTRS)

    2000-01-01

    Dr. Marc Pusey (seated) and Dr. Craig Kundrot use computers to analyze x-ray maps and generate three-dimensional models of protein structures. With this information, scientists at Marshall Space Flight Center can learn how proteins are made and how they work. The computer screen depicts a proten structure as a ball-and-stick model. Other models depict the actual volume occupied by the atoms, or the ribbon-like structures that are crucial to a protein's function.

  11. Protein Crystal Quality Studies

    NASA Technical Reports Server (NTRS)

    1998-01-01

    Eddie Snell, Post-Doctoral Fellow the National Research Council (NRC) uses a reciprocal space mapping diffractometer for macromolecular crystal quality studies. The diffractometer is used in mapping the structure of macromolecules such as proteins to determine their structure and thus understand how they function with other proteins in the body. This is one of several analytical tools used on proteins crystallized on Earth and in space experiments. Photo credit: NASA/Marshall Space Flight Center (MSFC)

  12. Pressure cryocooling protein crystals

    DOEpatents

    Kim, Chae Un; Gruner, Sol M.

    2011-10-04

    Preparation of cryocooled protein crystal is provided by use of helium pressurizing and cryocooling to obtain cryocooled protein crystal allowing collection of high resolution data and by heavier noble gas (krypton or xenon) binding followed by helium pressurizing and cryocooling to obtain cryocooled protein crystal for collection of high resolution data and SAD phasing simultaneously. The helium pressurizing is carried out on crystal coated to prevent dehydration or on crystal grown in aqueous solution in a capillary.

  13. The Insulin-Like Proteins dILPs-2/5 Determine Diapause Inducibility in Drosophila

    PubMed Central

    Kyriacou, Charalambos P.; O’Connor, Michael B.; Costa, Rodolfo

    2016-01-01

    Diapause is an actively induced dormancy that has evolved in Metazoa to resist environmental stresses. In temperate regions, many diapausing insects overwinter at low temperatures by blocking embryonic, larval or adult development. Despite its Afro-tropical origin, Drosophila melanogaster migrated to temperate regions of Asia and Europe where females overwinter as adults by arresting gonadal development (reproductive diapause) at temperatures <13°C. Recent work in D. melanogaster has implicated the developmental hormones dILPs-2 and/or dILP3, and dILP5, homologues of vertebrate insulin/insulin-like growth factors (IGFs), in reproductive arrest. However, polymorphisms in timeless (tim) and couch potato (cpo) dramatically affect diapause inducibility and these dILP experiments could not exclude this common genetic variation contributing to the diapause phenotype. Here, we apply an extensive genetic dissection of the insulin signaling pathway which allows us to see both enhancements and reductions in egg development that are independent of tim and cpo variations. We show that a number of manipulations dramatically enhance diapause to ~100%. These include ablating, or reducing the excitability of the insulin-producing cells (IPCs) that express dILPs-2,3,5 employing the dilp2,3,5-/- triple mutant, desensitizing insulin signaling using a chico mutation, or inhibiting dILP2 and 5 in the hemolymph by over-expressing Imaginal Morphogenesis Protein-Late 2 (Imp-L2). In addition, triple mutant dilp2,3,5-/- females maintain high levels of diapause even when temperatures are raised in adulthood to 19°C. However at 22°C, these females all show egg development revealing that the effects are conditional on temperature and not a general female sterility. In contrast, over-expression of dilps-2/5 or enhancing IPC excitability, led to levels of ovarian arrest that approached zero, underscoring dILPs-2 and 5 as key antagonists of diapause. PMID:27689881

  14. Chemical Synthesis of Proteins

    PubMed Central

    Nilsson, Bradley L.; Soellner, Matthew B.; Raines, Ronald T.

    2010-01-01

    Proteins have become accessible targets for chemical synthesis. The basic strategy is to use native chemical ligation, Staudinger ligation, or other orthogonal chemical reactions to couple synthetic peptides. The ligation reactions are compatible with a variety of solvents and proceed in solution or on a solid support. Chemical synthesis enables a level of control on protein composition that greatly exceeds that attainable with ribosome-mediated biosynthesis. Accordingly, the chemical synthesis of proteins is providing previously unattainable insight into the structure and function of proteins. PMID:15869385

  15. PIC: Protein Interactions Calculator

    PubMed Central

    Tina, K. G.; Bhadra, R.; Srinivasan, N.

    2007-01-01

    Interactions within a protein structure and interactions between proteins in an assembly are essential considerations in understanding molecular basis of stability and functions of proteins and their complexes. There are several weak and strong interactions that render stability to a protein structure or an assembly. Protein Interactions Calculator (PIC) is a server which, given the coordinate set of 3D structure of a protein or an assembly, computes various interactions such as disulphide bonds, interactions between hydrophobic residues, ionic interactions, hydrogen bonds, aromatic–aromatic interactions, aromatic–sulphur interactions and cation–π interactions within a protein or between proteins in a complex. Interactions are calculated on the basis of standard, published criteria. The identified interactions between residues can be visualized using a RasMol and Jmol interface. The advantage with PIC server is the easy availability of inter-residue interaction calculations in a single site. It also determines the accessible surface area and residue-depth, which is the distance of a residue from the surface of the protein. User can also recognize specific kind of interactions, such as apolar–apolar residue interactions or ionic interactions, that are formed between buried or exposed residues or near the surface or deep inside. PMID:17584791

  16. PIC: Protein Interactions Calculator.

    PubMed

    Tina, K G; Bhadra, R; Srinivasan, N

    2007-07-01

    Interactions within a protein structure and interactions between proteins in an assembly are essential considerations in understanding molecular basis of stability and functions of proteins and their complexes. There are several weak and strong interactions that render stability to a protein structure or an assembly. Protein Interactions Calculator (PIC) is a server which, given the coordinate set of 3D structure of a protein or an assembly, computes various interactions such as disulphide bonds, interactions between hydrophobic residues, ionic interactions, hydrogen bonds, aromatic-aromatic interactions, aromatic-sulphur interactions and cation-pi interactions within a protein or between proteins in a complex. Interactions are calculated on the basis of standard, published criteria. The identified interactions between residues can be visualized using a RasMol and Jmol interface. The advantage with PIC server is the easy availability of inter-residue interaction calculations in a single site. It also determines the accessible surface area and residue-depth, which is the distance of a residue from the surface of the protein. User can also recognize specific kind of interactions, such as apolar-apolar residue interactions or ionic interactions, that are formed between buried or exposed residues or near the surface or deep inside.

  17. Dietary proteins and angiogenesis.

    PubMed

    Medina, Miguel Ángel; Quesada, Ana R

    2014-01-17

    Both defective and persistent angiogenesis are linked to pathological situations in the adult. Compounds able to modulate angiogenesis have a potential value for the treatment of such pathologies. Several small molecules present in the diet have been shown to have modulatory effects on angiogenesis. This review presents the current state of knowledge on the potential modulatory roles of dietary proteins on angiogenesis. There is currently limited available information on the topic. Milk contains at least three proteins for which modulatory effects on angiogenesis have been previously demonstrated. On the other hand, there is some scarce information on the potential of dietary lectins, edible plant proteins and high protein diets to modulate angiogenesis.

  18. Consensus protein design

    PubMed Central

    Porebski, Benjamin T.; Buckle, Ashley M.

    2016-01-01

    A popular and successful strategy in semi-rational design of protein stability is the use of evolutionary information encapsulated in homologous protein sequences. Consensus design is based on the hypothesis that at a given position, the respective consensus amino acid contributes more than average to the stability of the protein than non-conserved amino acids. Here, we review the consensus design approach, its theoretical underpinnings, successes, limitations and challenges, as well as providing a detailed guide to its application in protein engineering. PMID:27274091

  19. Human Mitochondrial Protein Database

    National Institute of Standards and Technology Data Gateway

    SRD 131 Human Mitochondrial Protein Database (Web, free access)   The Human Mitochondrial Protein Database (HMPDb) provides comprehensive data on mitochondrial and human nuclear encoded proteins involved in mitochondrial biogenesis and function. This database consolidates information from SwissProt, LocusLink, Protein Data Bank (PDB), GenBank, Genome Database (GDB), Online Mendelian Inheritance in Man (OMIM), Human Mitochondrial Genome Database (mtDB), MITOMAP, Neuromuscular Disease Center and Human 2-D PAGE Databases. This database is intended as a tool not only to aid in studying the mitochondrion but in studying the associated diseases.

  20. TRIM proteins in development.

    PubMed

    Petrera, Francesca; Meroni, Germana

    2012-01-01

    TRIM proteins play important roles in several patho-physiological processes. Their common activity within the ubiquitylation pathway makes them amenable to a number of diverse biological roles. Many of the TRIM genes are highly and sometimes specifically expressed during embryogenesis, it is therefore not surprising that several of them might be involved in developmental processes. Here, we primarily discuss the developmental implications of two subgroups of TRIM proteins that conserved domain composition and functions from their invertebrate ancestors. The two groups are: the TRIM-NHL proteins implicated in miRNA processing regulation and the TRIM-FN3 proteins involved in ventral midline development.

  1. Engineering therapeutic protein disaggregases

    PubMed Central

    Shorter, James

    2016-01-01

    Therapeutic agents are urgently required to cure several common and fatal neurodegenerative disorders caused by protein misfolding and aggregation, including amyotrophic lateral sclerosis (ALS), Parkinson’s disease (PD), and Alzheimer’s disease (AD). Protein disaggregases that reverse protein misfolding and restore proteins to native structure, function, and localization could mitigate neurodegeneration by simultaneously reversing 1) any toxic gain of function of the misfolded form and 2) any loss of function due to misfolding. Potentiated variants of Hsp104, a hexameric AAA+ ATPase and protein disaggregase from yeast, have been engineered to robustly disaggregate misfolded proteins connected with ALS (e.g., TDP-43 and FUS) and PD (e.g., α-synuclein). However, Hsp104 has no metazoan homologue. Metazoa possess protein disaggregase systems distinct from Hsp104, including Hsp110, Hsp70, and Hsp40, as well as HtrA1, which might be harnessed to reverse deleterious protein misfolding. Nevertheless, vicissitudes of aging, environment, or genetics conspire to negate these disaggregase systems in neurodegenerative disease. Thus, engineering potentiated human protein disaggregases or isolating small-molecule enhancers of their activity could yield transformative therapeutics for ALS, PD, and AD. PMID:27255695

  2. Acanthamoeba castellanii STAT Protein

    PubMed Central

    Kicinska, Anna; Leluk, Jacek; Jarmuszkiewicz, Wieslawa

    2014-01-01

    STAT (signal transducers and activators of transcription) proteins are one of the important mediators of phosphotyrosine-regulated signaling in metazoan cells. We described the presence of STAT protein in a unicellular, free-living amoebae with a simple life cycle, Acanthamoeba castellanii. A. castellanii is the only, studied to date, Amoebozoan that does not belong to Mycetozoa but possesses STATs. A sequence of the A. castellanii STAT protein includes domains similar to those of the Dictyostelium STAT proteins: a coiled coil (characteristic for Dictyostelium STAT coiled coil), a STAT DNA-binding domain and a Src-homology domain. The search for protein sequences homologous to A. castellanii STAT revealed 17 additional sequences from lower eukaryotes. Interestingly, all of these sequences come from Amoebozoa organisms that belong to either Mycetozoa (slime molds) or Centramoebida. We showed that there are four separated clades within the slime mold STAT proteins. The A. castellanii STAT protein branches next to a group of STATc proteins from Mycetozoa. We also demonstrate that Amoebozoa form a distinct monophyletic lineage within the STAT protein world that is well separated from the other groups. PMID:25338074

  3. Protein intakes in India.

    PubMed

    Swaminathan, Sumathi; Vaz, Mario; Kurpad, Anura V

    2012-08-01

    Indian diets derive almost 60 % of their protein from cereals with relatively low digestibility and quality. There have been several surveys of diets and protein intakes in India by the National Nutrition Monitoring Board (NNMB) over the last 25 years, in urban and rural, as well as in slum dwellers and tribal populations. Data of disadvantaged populations from slums, tribals and sedentary rural Indian populations show that the protein intake (mainly from cereals) is about 1 gm/kg/day. However, the protein intake looks less promising in terms of the protein digestibility corrected amino acid score (PDCAAS), using lysine as the first limiting amino acid, where all populations, particularly rural and tribal, appear to have an inadequate quality to their protein intake. The protein: energy (PE) ratio is a measure of dietary quality, and has been used in the 2007 WHO/FAO/UNU report to define reference requirement values with which the adequacy of diets can be evaluated in terms of a protein quality corrected PE ratio. It is likely that about one third of this sedentary rural population is at risk of not meeting their requirements. These levels of risk of deficiency are in a population with relatively low BMI populations, whose diets are also inadequate in fruits and vegetables. Therefore, while the burden of enhancing the quality of protein intake in rural India exists, the quality of the diet, in general, represents a challenge that must be met.

  4. Self assembling proteins

    DOEpatents

    Yeates, Todd O.; Padilla, Jennifer; Colovos, Chris

    2004-06-29

    Novel fusion proteins capable of self-assembling into regular structures, as well as nucleic acids encoding the same, are provided. The subject fusion proteins comprise at least two oligomerization domains rigidly linked together, e.g. through an alpha helical linking group. Also provided are regular structures comprising a plurality of self-assembled fusion proteins of the subject invention, and methods for producing the same. The subject fusion proteins find use in the preparation of a variety of nanostructures, where such structures include: cages, shells, double-layer rings, two-dimensional layers, three-dimensional crystals, filaments, and tubes.

  5. Ultrafiltration of pegylated proteins

    NASA Astrophysics Data System (ADS)

    Molek, Jessica R.

    There is considerable clinical interest in the use of "second-generation" therapeutics produced by conjugation of a native protein with various polymers including polyethylene glycol (PEG). PEG--protein conjugates, so-called PEGylated proteins, can exhibit enhanced stability, half-life, and bioavailability. One of the challenges in the commercial production of PEGylated proteins is the purification required to remove unreacted polymer, native protein, and in many cases PEGylated proteins with nonoptimal degrees of conjugation. The overall objective of this thesis was to examine the use of ultrafiltration for the purification of PEGylated proteins. This included: (1) analysis of size-based separation of PEGylated proteins using conventional ultrafiltration membranes, (2) use of electrically-charged membranes to exploit differences in electrostatic interactions, and (3) examination of the effects of PEGylation on protein fouling. The experimental results were analyzed using appropriate theoretical models, with the underlying physical properties of the PEGylated proteins evaluated using size exclusion chromatography, capillary electrophoresis, dynamic light scattering, and reverse phase chromatography. PEGylated proteins were produced by covalent attachment of activated PEG to a protein via primary amines on the lysine residues. A simple model was developed for the reaction kinetics, which was used to explore the effect of reaction conditions and mode of operation on the distribution of PEGylated products. The effective size of the PEGylated proteins was evaluated using size exclusion chromatography, with appropriate correlations developed for the size in terms of the molecular weight of the native protein and attached PEG. The electrophoretic mobility of the PEGylated proteins were evaluated by capillary electrophoresis with the data in good agreement with a simple model accounting for the increase in protein size and the reduction in the number of protonated amine

  6. Regulation of protein secretion by ... protein secretion?

    PubMed

    Atmakuri, Krishnamohan; Fortune, Sarah M

    2008-09-11

    Mycobacterium tuberculosis (Mtb) requires an alternative protein secretion system, ESX1, for virulence. Recently, Raghavan et al. (2008) reported a new regulatory circuit that may explain how ESX1 activity is controlled during infection. Mtb appears to regulate ESX1 by modulating transcription of associated genes rather than structural components of the secretion system itself.

  7. Human Plasma Protein C

    PubMed Central

    Kisiel, Walter

    1979-01-01

    Protein C is a vitamin K-dependent protein, which exists in bovine plasma as a precursor of a serine protease. In this study, protein C was isolated to homogeneity from human plasma by barium citrate adsorption and elution, ammonium sulfate fractionation, DEAE-Sephadex chromatography, dextran sulfate agarose chromatography, and preparative polyacrylamide gel electrophoresis. Human protein C (Mr = 62,000) contains 23% carbohydrate and is composed of a light chain (Mr = 21,000) and a heavy chain (Mr = 41,000) held together by a disulfide bond(s). The light chain has an amino-terminal sequence of Ala-Asn-Ser-Phe-Leu- and the heavy chain has an aminoterminal sequence of Asp-Pro-Glu-Asp-Gln. The residues that are identical to bovine protein C are underlined. Incubation of human protein C with human α-thrombin at an enzyme to substrate weight ratio of 1:50 resulted in the formation of activated protein C, an enzyme with serine amidase activity. In the activation reaction, the apparent molecular weight of the heavy chain decreased from 41,000 to 40,000 as determined by gel electrophoresis in the presence of sodium dodecyl sulfate. No apparent change in the molecular weight of the light chain was observed in the activation process. The heavy chain of human activated protein C also contains the active-site serine residue as evidenced by its ability to react with radiolabeled diisopropyl fluorophosphate. Human activated protein C markedly prolongs the kaolin-cephalin clotting time of human plasma, but not that of bovine plasma. The amidolytic and anticoagulant activities of human activated protein C were completely obviated by prior incubation of the enzyme with diisopropyl fluorophosphate. These results indicate that human protein C, like its bovine counterpart, exists in plasma as a zymogen and is converted to a serine protease by limited proteolysis with attendant anticoagulant activity. Images PMID:468991

  8. Deficiency of the Survival of Motor Neuron Protein Impairs mRNA Localization and Local Translation in the Growth Cone of Motor Neurons

    PubMed Central

    Fallini, Claudia; Donlin-Asp, Paul G.; Rouanet, Jeremy P.

    2016-01-01

    Spinal muscular atrophy (SMA) is a neurodegenerative disease primarily affecting spinal motor neurons. It is caused by reduced levels of the survival of motor neuron (SMN) protein, which plays an essential role in the biogenesis of spliceosomal small nuclear ribonucleoproteins in all tissues. The etiology of the specific defects in the motor circuitry in SMA is still unclear, but SMN has also been implicated in mediating the axonal localization of mRNA-protein complexes, which may contribute to the axonal degeneration observed in SMA. Here, we report that SMN deficiency severely disrupts local protein synthesis within neuronal growth cones. We also identify the cytoskeleton-associated growth-associated protein 43 (GAP43) mRNA as a new target of SMN and show that motor neurons from SMA mouse models have reduced levels of GAP43 mRNA and protein in axons and growth cones. Importantly, overexpression of two mRNA-binding proteins, HuD and IMP1, restores GAP43 mRNA and protein levels in growth cones and rescues axon outgrowth defects in SMA neurons. These findings demonstrate that SMN plays an important role in the localization and local translation of mRNAs with important axonal functions and suggest that disruption of this function may contribute to the axonal defects observed in SMA. SIGNIFICANCE STATEMENT The motor neuron disease spinal muscular atrophy (SMA) is caused by reduced levels of the survival of motor neuron (SMN) protein, which plays a key role in assembling RNA/protein complexes that are essential for mRNA splicing. It remains unclear whether defects in this well characterized housekeeping function cause the specific degeneration of spinal motor neurons observed in SMA. Here, we describe an additional role of SMN in regulating the axonal localization and local translation of the mRNA encoding growth-associated protein 43 (GAP43). This study supports a model whereby SMN deficiency impedes transport and local translation of mRNAs important for neurite

  9. Engineered Protein Polymers

    DTIC Science & Technology

    2010-05-31

    of each pure polymer, we plan to combine the various polymer solutions in different ratios to tune the composition and physico-chemical properties...protein materials as vehicles for storage and delivery of small molecules. Each protein polymer under concentrations for particle formation ( vida

  10. Multidomain proteins under force.

    PubMed

    Valle-Orero, Jessica; Rivas-Pardo, Jaime Andrés; Popa, Ionel

    2017-04-28

    Advancements in single-molecule force spectroscopy techniques such as atomic force microscopy and magnetic tweezers allow investigation of how domain folding under force can play a physiological role. Combining these techniques with protein engineering and HaloTag covalent attachment, we investigate similarities and differences between four model proteins: I10 and I91-two immunoglobulin-like domains from the muscle protein titin, and two α + β fold proteins-ubiquitin and protein L. These proteins show a different mechanical response and have unique extensions under force. Remarkably, when normalized to their contour length, the size of the unfolding and refolding steps as a function of force reduces to a single master curve. This curve can be described using standard models of polymer elasticity, explaining the entropic nature of the measured steps. We further validate our measurements with a simple energy landscape model, which combines protein folding with polymer physics and accounts for the complex nature of tandem domains under force. This model can become a useful tool to help in deciphering the complexity of multidomain proteins operating under force.

  11. Archaeal chromatin proteins.

    PubMed

    Zhang, ZhenFeng; Guo, Li; Huang, Li

    2012-05-01

    Archaea, along with Bacteria and Eukarya, are the three domains of life. In all living cells, chromatin proteins serve a crucial role in maintaining the integrity of the structure and function of the genome. An array of small, abundant and basic DNA-binding proteins, considered candidates for chromatin proteins, has been isolated from the Euryarchaeota and the Crenarchaeota, the two major phyla in Archaea. While most euryarchaea encode proteins resembling eukaryotic histones, crenarchaea appear to synthesize a number of unique DNA-binding proteins likely involved in chromosomal organization. Several of these proteins (e.g., archaeal histones, Sac10b homologs, Sul7d, Cren7, CC1, etc.) have been extensively studied. However, whether they are chromatin proteins and how they function in vivo remain to be fully understood. Future investigation of archaeal chromatin proteins will lead to a better understanding of chromosomal organization and gene expression in Archaea and provide valuable information on the evolution of DNA packaging in cellular life.

  12. Protein Attachment on Nanodiamonds.

    PubMed

    Lin, Chung-Lun; Lin, Cheng-Huang; Chang, Huan-Cheng; Su, Meng-Chih

    2015-07-16

    A recent advance in nanotechnology is the scale-up production of small and nonaggregated diamond nanoparticles suitable for biological applications. Using detonation nanodiamonds (NDs) with an average diameter of ∼4 nm as the adsorbents, we have studied the static attachment of three proteins (myoglobin, bovine serum albumin, and insulin) onto the nanoparticles by optical spectroscopy, mass spectrometry, and dynamic light scattering, and electrophoretic zeta potential measurements. Results show that the protein surface coverage is predominantly determined by the competition between protein-protein and protein-ND interactions, giving each protein a unique and characteristic structural configuration in its own complex. Specifically, both myoglobin and bovine serum albumin show a Langmuir-type adsorption behavior, forming 1:1 complexes at saturation, whereas insulin folds into a tightly bound multimer before adsorption. The markedly different adsorption patterns appear to be independent of the protein concentration and are closely related to the affinity of the individual proteins for the NDs. The present study provides a fundamental understanding for the use of NDs as a platform for nanomedical drug delivery.

  13. Poxviral Ankyrin Proteins

    PubMed Central

    Herbert, Michael H.; Squire, Christopher J.; Mercer, Andrew A

    2015-01-01

    Multiple repeats of the ankyrin motif (ANK) are ubiquitous throughout the kingdoms of life but are absent from most viruses. The main exception to this is the poxvirus family, and specifically the chordopoxviruses, with ANK repeat proteins present in all but three species from separate genera. The poxviral ANK repeat proteins belong to distinct orthologue groups spread over different species, and align well with the phylogeny of their genera. This distribution throughout the chordopoxviruses indicates these proteins were present in an ancestral vertebrate poxvirus, and have since undergone numerous duplication events. Most poxviral ANK repeat proteins contain an unusual topology of multiple ANK motifs starting at the N-terminus with a C-terminal poxviral homologue of the cellular F-box enabling interaction with the cellular SCF ubiquitin ligase complex. The subtle variations between ANK repeat proteins of individual poxviruses suggest an array of different substrates may be bound by these protein-protein interaction domains and, via the F-box, potentially directed to cellular ubiquitination pathways and possible degradation. Known interaction partners of several of these proteins indicate that the NF-κB coordinated anti-viral response is a key target, whilst some poxviral ANK repeat domains also have an F-box independent affect on viral host-range. PMID:25690795

  14. Protein Kinases and Addiction

    PubMed Central

    Lee, Anna M.; Messing, Robert O.

    2011-01-01

    Although drugs of abuse have different chemical structures and interact with different protein targets, all appear to usurp common neuronal systems that regulate reward and motivation. Addiction is a complex disease that is thought to involve drug-induced changes in synaptic plasticity due to alterations in cell signaling, gene transcription, and protein synthesis. Recent evidence suggests that drugs of abuse interact with and change a common network of signaling pathways that include a subset of specific protein kinases. The best studied of these kinases are reviewed here and include extracellular signal-regulated kinase, cAMP-dependent protein kinase, cyclin-dependent protein kinase 5, protein kinase C, calcium/calmodulin-dependent protein kinase II, and Fyn tyrosine kinase. These kinases have been implicated in various aspects of drug addiction including acute drug effects, drug self-administration, withdrawal, reinforcement, sensitization, and tolerance. Identifying protein kinase substrates and signaling pathways that contribute to the addicted state may provide novel approaches for new pharma-cotherapies to treat drug addiction. PMID:18991950

  15. Sac phosphatase domain proteins.

    PubMed Central

    Hughes, W E; Cooke, F T; Parker, P J

    2000-01-01

    Advances in our understanding of the roles of phosphatidylinositol phosphates in controlling cellular functions such as endocytosis, exocytosis and the actin cytoskeleton have included new insights into the phosphatases that are responsible for the interconversion of these lipids. One of these is an entirely novel class of phosphatase domain found in a number of well characterized proteins. Proteins containing this Sac phosphatase domain include the yeast Saccharomyces cerevisiae proteins Sac1p and Fig4p. The Sac phosphatase domain is also found within the mammalian phosphoinositide 5-phosphatase synaptojanin and the yeast synaptojanin homologues Inp51p, Inp52p and Inp53p. These proteins therefore contain both Sac phosphatase and 5-phosphatase domains. This review describes the Sac phosphatase domain-containing proteins and their actions, with particular reference to the genetic and biochemical insights provided by study of the yeast Saccharomyces cerevisiae. PMID:10947947

  16. Proteins in unexpected locations.

    PubMed Central

    Smalheiser, N R

    1996-01-01

    Members of all classes of proteins--cytoskeletal components, secreted growth factors, glycolytic enzymes, kinases, transcription factors, chaperones, transmembrane proteins, and extracellular matrix proteins--have been identified in cellular compartments other than their conventional sites of action. Some of these proteins are expressed as distinct compartment-specific isoforms, have novel mechanisms for intercompartmental translocation, have distinct endogenous biological actions within each compartment, and are regulated in a compartment-specific manner as a function of physiologic state. The possibility that many, if not most, proteins have distinct roles in more than one cellular compartment has implications for the evolution of cell organization and may be important for understanding pathological conditions such as Alzheimer's disease and cancer. PMID:8862516

  17. Structures of membrane proteins

    PubMed Central

    Vinothkumar, Kutti R.; Henderson, Richard

    2010-01-01

    In reviewing the structures of membrane proteins determined up to the end of 2009, we present in words and pictures the most informative examples from each family. We group the structures together according to their function and architecture to provide an overview of the major principles and variations on the most common themes. The first structures, determined 20 years ago, were those of naturally abundant proteins with limited conformational variability, and each membrane protein structure determined was a major landmark. With the advent of complete genome sequences and efficient expression systems, there has been an explosion in the rate of membrane protein structure determination, with many classes represented. New structures are published every month and more than 150 unique membrane protein structures have been determined. This review analyses the reasons for this success, discusses the challenges that still lie ahead, and presents a concise summary of the key achievements with illustrated examples selected from each class. PMID:20667175

  18. Transdermal delivery of proteins.

    PubMed

    Kalluri, Haripriya; Banga, Ajay K

    2011-03-01

    Transdermal delivery of peptides and proteins avoids the disadvantages associated with the invasive parenteral route of administration and other alternative routes such as the pulmonary and nasal routes. Since proteins have a large size and are hydrophilic in nature, they cannot permeate passively across the skin due to the stratum corneum which allows the transport of only small lipophilic drug molecules. Enhancement techniques such as chemical enhancers, iontophoresis, microneedles, electroporation, sonophoresis, thermal ablation, laser ablation, radiofrequency ablation and noninvasive jet injectors aid in the delivery of proteins by overcoming the skin barrier in different ways. In this review, these enhancement techniques that can enable the transdermal delivery of proteins are discussed, including a discussion of mechanisms, sterility requirements, and commercial development of products. Combination of enhancement techniques may result in a synergistic effect allowing increased protein delivery and these are also discussed.

  19. Protein crystallization in microgravity.

    PubMed

    Aibara, S; Shibata, K; Morita, Y

    1997-12-01

    A space experiment involving protein crystallization was conducted in a microgravity environment using the space shuttle "Endeavour" of STS-47, on a 9-day mission from September 12th to 20th in 1992. The crystallization was carried out according to a batch method, and 5 proteins were selected as flight samples for crystallization. Two of these proteins: hen egg-white lysozyme and co-amino acid: pyruvate aminotransferase from Pseudomonas sp. F-126, were obtained as single crystals of good diffraction quality. Since 1992 we have carried out several space experiments for protein crystallization aboard space shuttles and the space station MIR. Our experimental results obtained mainly from hen egg-white lysozyme are described below, focusing on the effects of microgravity on protein crystal growth.

  20. Protein expression-yeast.

    PubMed

    Nielsen, Klaus H

    2014-01-01

    Yeast is an excellent system for the expression of recombinant eukaryotic proteins. Both endogenous and heterologous proteins can be overexpressed in yeast (Phan et al., 2001; Ton and Rao, 2004). Because yeast is easy to manipulate genetically, a strain can be optimized for the expression of a specific protein. Many eukaryotic proteins contain posttranslational modifications that can be performed in yeast but not in bacterial expression systems. In comparison with mammalian cell culture expression systems, growing yeast is both faster and less expensive, and large-scale cultures can be performed using fermentation. While several different yeast expression systems exist, this chapter focuses on the budding yeast Saccharomyces cerevisiae and will briefly describe some options to consider when selecting vectors and tags to be used for protein expression. Throughout this chapter, the expression and purification of yeast eIF3 is shown as an example alongside a general scheme outline.

  1. Protein Unfolding and Alzheimer's

    NASA Astrophysics Data System (ADS)

    Cheng, Kelvin

    2012-10-01

    Early interaction events of beta-amyloid (Aβ) proteins with neurons have been associated with the pathogenesis of Alzheimer's disease. Knowledge pertaining to the role of lipid molecules, particularly cholesterol, in modulating the single Aβ interactions with neurons at the atomic length and picosecond time resolutions, remains unclear. In our research, we have used atomistic molecular dynamics simulations to explore early molecular events including protein insertion kinetics, protein unfolding, and protein-induced membrane disruption of Aβ in lipid domains that mimic the nanoscopic raft and non-raft regions of the neural membrane. In this talk, I will summarize our current work on investigating the role of cholesterol in regulating the Aβ interaction events with membranes at the molecular level. I will also explain how our results will provide new insights into understanding the pathogenesis of Alzheimer's disease associated with the Aβ proteins.

  2. Junin virus structural proteins.

    PubMed Central

    De Martínez Segovia, Z M; De Mitri, M I

    1977-01-01

    Polyacrylamide gel electrophoresis of purified Junin virus revealed six distinct structural polypeptides, two major and four minor ones. Four of these polypeptides appeared to be covalently linked with carbohydrate. The molecular weights of the six proteins, estimated by coelectrophoresis with marker proteins, ranged from 25,000 to 91,000. One of the two major components (number 3) was identified as a nucleoprotein and had a molecular weight of 64,000. It was the most prominent protein and was nonglycosylated. The other major protein (number 5), with a molecular weight of 38,000, was a glucoprotein and a component of the viral envelope. The location on the virion of three additional glycopeptides with molecular weights of 91,000, 72,000, and 52,000, together with a protein with a molecular weight of 25,000, was not well defined. PMID:189088

  3. Manipulating and Visualizing Proteins

    SciTech Connect

    Simon, Horst D.

    2003-12-05

    ProteinShop Gives Researchers a Hands-On Tool for Manipulating, Visualizing Protein Structures. The Human Genome Project and other biological research efforts are creating an avalanche of new data about the chemical makeup and genetic codes of living organisms. But in order to make sense of this raw data, researchers need software tools which let them explore and model data in a more intuitive fashion. With this in mind, researchers at Lawrence Berkeley National Laboratory and the University of California, Davis, have developed ProteinShop, a visualization and modeling program which allows researchers to manipulate protein structures with pinpoint control, guided in large part by their own biological and experimental instincts. Biologists have spent the last half century trying to unravel the ''protein folding problem,'' which refers to the way chains of amino acids physically fold themselves into three-dimensional proteins. This final shape, which resembles a crumpled ribbon or piece of origami, is what determines how the protein functions and translates genetic information. Understanding and modeling this geometrically complex formation is no easy matter. ProteinShop takes a given sequence of amino acids and uses visualization guides to help generate predictions about the secondary structures, identifying alpha helices and flat beta strands, and the coil regions that bind them. Once secondary structures are in place, researchers can twist and turn these pre-configurations until they come up with a number of possible tertiary structure conformations. In turn, these are fed into a computationally intensive optimization procedure that tries to find the final, three-dimensional protein structure. Most importantly, ProteinShop allows users to add human knowledge and intuition to the protein structure prediction process, thus bypassing bad configurations that would otherwise be fruitless for optimization. This saves compute cycles and accelerates the entire process, so

  4. Protein disulfide engineering.

    PubMed

    Dombkowski, Alan A; Sultana, Kazi Zakia; Craig, Douglas B

    2014-01-21

    Improving the stability of proteins is an important goal in many biomedical and industrial applications. A logical approach is to emulate stabilizing molecular interactions found in nature. Disulfide bonds are covalent interactions that provide substantial stability to many proteins and conform to well-defined geometric conformations, thus making them appealing candidates in protein engineering efforts. Disulfide engineering is the directed design of novel disulfide bonds into target proteins. This important biotechnological tool has achieved considerable success in a wide range of applications, yet the rules that govern the stabilizing effects of disulfide bonds are not fully characterized. Contrary to expectations, many designed disulfide bonds have resulted in decreased stability of the modified protein. We review progress in disulfide engineering, with an emphasis on the issue of stability and computational methods that facilitate engineering efforts.

  5. Proteins, fluctuations and complexity

    SciTech Connect

    Frauenfelder, Hans; Chen, Guo; Fenimore, Paul W

    2008-01-01

    Glasses, supercooled liquids, and proteins share common properties, in particular the existence of two different types of fluctuations, {alpha} and {beta}. While the effect of the {alpha} fluctuations on proteins has been known for a few years, the effect of {beta} fluctuations has not been understood. By comparing neutron scattering data on the protein myoglobin with the {beta} fluctuations in the hydration shell measured by dielectric spectroscopy we show that the internal protein motions are slaved to these fluctuations. We also show that there is no 'dynamic transition' in proteins near 200 K. The rapid increase in the mean square displacement with temperature in many neutron scattering experiments is quantitatively predicted by the {beta} fluctuations in the hydration shell.

  6. [Controversies around diet proteins].

    PubMed

    Cichosz, Grazyna; Czeczot, Hanna

    2013-12-01

    Critical theories regarding proteins of anima origin are still and still popularized, though they are ungrounded from scientific point of view. Predominance of soya proteins over the animal ones in relation to their influence on calcium metabolism, bone break risk or risk of osteoporosis morbidity has not been confirmed in any honest, reliable research experiment. Statement, that sulphur amino acids influence disadvantageously on calcium metabolism of human organism and bone status, is completely groundless, the more so as presence of sulphur amino acids in diet (animal proteins are their best source) is the condition of endogenic synthesis of glutathione, the key antioxidant of the organism, and taurine stimulating brain functioning. Deficiency of proteins in the diet produce weakness of intellectual effectiveness and immune response. There is no doubt that limitation of consumption of animal proteins of standard value is not good for health.

  7. Drugging Membrane Protein Interactions

    PubMed Central

    Yin, Hang; Flynn, Aaron D.

    2016-01-01

    The majority of therapeutics target membrane proteins, accessible on the surface of cells, to alter cellular signaling. Cells use membrane proteins to transduce signals into cells, transport ions and molecules, bind the cell to a surface or substrate, and catalyze reactions. Newly devised technologies allow us to drug conventionally “undruggable” regions of membrane proteins, enabling modulation of protein–protein, protein–lipid, and protein–nucleic acid interactions. In this review, we survey the state of the art in high-throughput screening and rational design in drug discovery, and we evaluate the advances in biological understanding and technological capacity that will drive pharmacotherapy forward against unorthodox membrane protein targets. PMID:26863923

  8. Protein crystal growth

    NASA Technical Reports Server (NTRS)

    Bugg, Charles E.

    1993-01-01

    Proteins account for 50% or more of the dry weight of most living systems and play a crucial role in virtually all biological processes. Since the specific functions of essentially all biological molecules are determined by their three-dimensional structures, it is obvious that a detailed understanding of the structural makeup of a protein is essential to any systematic research pertaining to it. At the present time, protein crystallography has no substitute, it is the only technique available for elucidating the atomic arrangements within complicated biological molecules. Most macromolecules are extremely difficult to crystallize, and many otherwise exciting and promising projects have terminated at the crystal growth stage. There is a pressing need to better understand protein crystal growth, and to develop new techniques that can be used to enhance the size and quality of protein crystals. There are several aspects of microgravity that might be exploited to enhance protein crystal growth. The major factor that might be expected to alter crystal growth processes in space is the elimination of density-driven convective flow. Another factor that can be readily controlled in the absence of gravity is the sedimentation of growing crystal in a gravitational field. Another potential advantage of microgravity for protein crystal growth is the option of doing containerless crystal growth. One can readily understand why the microgravity environment established by Earth-orbiting vehicles is perceived to offer unique opportunities for the protein crystallographer. The near term objectives of the Protein Crystal Growth in a Microgravity Environment (PCG/ME) project is to continue to improve the techniques, procedures, and hardware systems used to grow protein crystals in Earth orbit.

  9. Regulation of protein turnover by heat shock proteins.

    PubMed

    Bozaykut, Perinur; Ozer, Nesrin Kartal; Karademir, Betul

    2014-12-01

    Protein turnover reflects the balance between synthesis and degradation of proteins, and it is a crucial process for the maintenance of the cellular protein pool. The folding of proteins, refolding of misfolded proteins, and also degradation of misfolded and damaged proteins are involved in the protein quality control (PQC) system. Correct protein folding and degradation are controlled by many different factors, one of the most important of which is the heat shock protein family. Heat shock proteins (HSPs) are in the class of molecular chaperones, which may prevent the inappropriate interaction of proteins and induce correct folding. On the other hand, these proteins play significant roles in the degradation pathways, including endoplasmic reticulum-associated degradation (ERAD), the ubiquitin-proteasome system, and autophagy. This review focuses on the emerging role of HSPs in the regulation of protein turnover; the effects of HSPs on the degradation machineries ERAD, autophagy, and proteasome; as well as the role of posttranslational modifications in the PQC system.

  10. Purifying protein complexes for mass spectrometry: applications to protein translation.

    PubMed

    Link, Andrew J; Fleischer, Tracey C; Weaver, Connie M; Gerbasi, Vincent R; Jennings, Jennifer L

    2005-03-01

    Proteins control and mediate most of the biological activities in the cell. In most cases, proteins either interact with regulatory proteins or function in large molecular assemblies to carryout biological processes. Understanding the functions of individual proteins requires the identification of these interacting proteins. With its speed and sensitivity, mass spectrometry has become the dominant method for identifying components of protein complexes. This article reviews and discusses various approaches to purify protein complexes and analyze the proteins using mass spectrometry. As examples, methods to isolate and analyze protein complexes responsible for the translation of messenger RNAs into polypeptides are described.

  11. Prediction of protein-protein interactions: unifying evolution and structure at protein interfaces.

    PubMed

    Tuncbag, Nurcan; Gursoy, Attila; Keskin, Ozlem

    2011-06-01

    The vast majority of the chores in the living cell involve protein-protein interactions. Providing details of protein interactions at the residue level and incorporating them into protein interaction networks are crucial toward the elucidation of a dynamic picture of cells. Despite the rapid increase in the number of structurally known protein complexes, we are still far away from a complete network. Given experimental limitations, computational modeling of protein interactions is a prerequisite to proceed on the way to complete structural networks. In this work, we focus on the question 'how do proteins interact?' rather than 'which proteins interact?' and we review structure-based protein-protein interaction prediction approaches. As a sample approach for modeling protein interactions, PRISM is detailed which combines structural similarity and evolutionary conservation in protein interfaces to infer structures of complexes in the protein interaction network. This will ultimately help us to understand the role of protein interfaces in predicting bound conformations.

  12. NMCP/LINC proteins

    PubMed Central

    Ciska, Malgorzata; Moreno Díaz de la Espina, Susana

    2013-01-01

    Lamins are the main components of the metazoan lamina, and while the organization of the nuclear lamina of metazoans and plants is similar, there are apparently no genes encoding lamins or most lamin-binding proteins in plants. Thus, the plant lamina is not lamin-based and the proteins that form this structure are still to be characterized. Members of the plant NMCP/LINC/CRWN protein family share the typical tripartite structure of lamins, although the 2 exhibit no sequence similarity. However, given the many similarities between NMCP/LINC/CRWN proteins and lamins (structural organization, position of conserved regions, sub-nuclear distribution, solubility, and pattern of expression), these proteins are good candidates to carry out the functions of lamins in plants. Moreover, functional analysis of NMCP/LINC mutants has revealed their involvement in maintaining nuclear size and shape, another activity fulfilled by lamins. This review summarizes the current understanding of NMCP/LINC proteins and discusses future studies that will be required to demonstrate definitively that these proteins are plant analogs of lamins. PMID:24128696

  13. TRIM proteins in cancer.

    PubMed

    Cambiaghi, Valeria; Giuliani, Virginia; Lombardi, Sara; Marinelli, Cristiano; Toffalorio, Francesca; Pelicci, Pier Giuseppe

    2012-01-01

    Some members of the tripartite motif (TRIM/RBCC) protein family are thought to be important regulators of carcinogenesis. This is not surprising as the TRIM proteins are involved in several biological processes, such as cell growth, development and cellular differentiation and alteration of these proteins can affect transcriptional regulation, cell proliferation and apoptosis. In particular, four TRIM family genes are frequently translocated to other genes, generating fusion proteins implicated in cancer initiation and progression. Among these the most famous is the promyelocytic leukaemia gene PML, which encodes the protein TRIM19. PML is involved in the t(15;17) translocation that specifically occurs in Acute Promyelocytic Leukaemia (APL), resulting in a PML-retinoic acid receptor-alpha (PML-RARalpha) fusion protein. Other members of the TRIM family are linked to cancer development without being involved in chromosomal re-arrangements, possibly through ubiquitination or loss of tumour suppression functions. This chapter discusses the biological functions of TRIM proteins in cancer.

  14. Bacterial ice crystal controlling proteins.

    PubMed

    Lorv, Janet S H; Rose, David R; Glick, Bernard R

    2014-01-01

    Across the world, many ice active bacteria utilize ice crystal controlling proteins for aid in freezing tolerance at subzero temperatures. Ice crystal controlling proteins include both antifreeze and ice nucleation proteins. Antifreeze proteins minimize freezing damage by inhibiting growth of large ice crystals, while ice nucleation proteins induce formation of embryonic ice crystals. Although both protein classes have differing functions, these proteins use the same ice binding mechanisms. Rather than direct binding, it is probable that these protein classes create an ice surface prior to ice crystal surface adsorption. Function is differentiated by molecular size of the protein. This paper reviews the similar and different aspects of bacterial antifreeze and ice nucleation proteins, the role of these proteins in freezing tolerance, prevalence of these proteins in psychrophiles, and current mechanisms of protein-ice interactions.

  15. Bacterial Ice Crystal Controlling Proteins

    PubMed Central

    Lorv, Janet S. H.; Rose, David R.; Glick, Bernard R.

    2014-01-01

    Across the world, many ice active bacteria utilize ice crystal controlling proteins for aid in freezing tolerance at subzero temperatures. Ice crystal controlling proteins include both antifreeze and ice nucleation proteins. Antifreeze proteins minimize freezing damage by inhibiting growth of large ice crystals, while ice nucleation proteins induce formation of embryonic ice crystals. Although both protein classes have differing functions, these proteins use the same ice binding mechanisms. Rather than direct binding, it is probable that these protein classes create an ice surface prior to ice crystal surface adsorption. Function is differentiated by molecular size of the protein. This paper reviews the similar and different aspects of bacterial antifreeze and ice nucleation proteins, the role of these proteins in freezing tolerance, prevalence of these proteins in psychrophiles, and current mechanisms of protein-ice interactions. PMID:24579057

  16. Protein based Block Copolymers

    PubMed Central

    Rabotyagova, Olena S.; Cebe, Peggy; Kaplan, David L.

    2011-01-01

    Advances in genetic engineering have led to the synthesis of protein-based block copolymers with control of chemistry and molecular weight, resulting in unique physical and biological properties. The benefits from incorporating peptide blocks into copolymer designs arise from the fundamental properties of proteins to adopt ordered conformations and to undergo self-assembly, providing control over structure formation at various length scales when compared to conventional block copolymers. This review covers the synthesis, structure, assembly, properties, and applications of protein-based block copolymers. PMID:21235251

  17. Piezoelectric allostery of protein

    NASA Astrophysics Data System (ADS)

    Ohnuki, Jun; Sato, Takato; Takano, Mitsunori

    2016-07-01

    Allostery is indispensable for a protein to work, where a locally applied stimulus is transmitted to a distant part of the molecule. While the allostery due to chemical stimuli such as ligand binding has long been studied, the growing interest in mechanobiology prompts the study of the mechanically stimulated allostery, the physical mechanism of which has not been established. By molecular dynamics simulation of a motor protein myosin, we found that a locally applied mechanical stimulus induces electrostatic potential change at distant regions, just like the piezoelectricity. This novel allosteric mechanism, "piezoelectric allostery", should be of particularly high value for mechanosensor/transducer proteins.

  18. Proteins : paradigms of complexity /

    SciTech Connect

    Frauenfelder, Hans,

    2001-01-01

    Proteins are the working machines of living systems. Directed by the DNA, of the order of a few hundred building blocks, selected from twenty different amino acids, are covalently linked into a linear polypeptide chain. In the proper environment, the chain folds into the working protein, often a globule of linear dimensions of a few nanometers. The biologist considers proteins units from which living systems are built. Many physical scientists look at them as systems in which the laws of complexity can be studied better than anywhere else. Some of the results of such studies will be sketched.

  19. Protein crystallography prescreen kit

    DOEpatents

    Segelke, Brent W.; Krupka, Heike I.; Rupp, Bernhard

    2005-07-12

    A kit for prescreening protein concentration for crystallization includes a multiplicity of vials, a multiplicity of pre-selected reagents, and a multiplicity of sample plates. The reagents and a corresponding multiplicity of samples of the protein in solutions of varying concentrations are placed on sample plates. The sample plates containing the reagents and samples are incubated. After incubation the sample plates are examined to determine which of the sample concentrations are too low and which the sample concentrations are too high. The sample concentrations that are optimal for protein crystallization are selected and used.

  20. Protein crystallography prescreen kit

    DOEpatents

    Segelke, Brent W.; Krupka, Heike I.; Rupp, Bernhard

    2007-10-02

    A kit for prescreening protein concentration for crystallization includes a multiplicity of vials, a multiplicity of pre-selected reagents, and a multiplicity of sample plates. The reagents and a corresponding multiplicity of samples of the protein in solutions of varying concentrations are placed on sample plates. The sample plates containing the reagents and samples are incubated. After incubation the sample plates are examined to determine which of the sample concentrations are too low and which the sample concentrations are too high. The sample concentrations that are optimal for protein crystallization are selected and used.

  1. Protein Crystal Malic Enzyme

    NASA Technical Reports Server (NTRS)

    1992-01-01

    Malic Enzyme is a target protein for drug design because it is a key protein in the life cycle of intestinal parasites. After 2 years of effort on Earth, investigators were unable to produce any crystals that were of high enough quality and for this reason the structure of this important protein could not be determined. Crystals obtained from one STS-50 were of superior quality allowing the structure to be determined. This is just one example why access to space is so vital for these studies. Principal Investigator is Larry DeLucas.

  2. Protein Crystal Quality Studies

    NASA Technical Reports Server (NTRS)

    1998-01-01

    Eddie Snell (standing), Post-Doctoral Fellow the National Research Council (NRC),and Marc Pusey of Marshall Space Flight Center (MSFC) use a reciprocal space mapping diffractometer for marcromolecular crystal quality studies. The diffractometer is used in mapping the structure of marcromolecules such as proteins to determine their structure and thus understand how they function with other proteins in the body. This is one of several analytical tools used on proteins crystalized on Earth and in space experiments. Photo credit: NASA/Marshall Space Flight Center (MSFC)

  3. Emerging fluorescent protein technologies.

    PubMed

    Enterina, Jhon Ralph; Wu, Lanshi; Campbell, Robert E

    2015-08-01

    Fluorescent proteins (FPs), such as the Aequorea jellyfish green FP (GFP), are firmly established as fundamental tools that enable a wide variety of biological studies. Specifically, FPs can serve as versatile genetically encoded markers for tracking proteins, organelles, or whole cells, and as the basis for construction of biosensors that can be used to visualize a growing array of biochemical events in cells and tissues. In this review we will focus on emerging applications of FPs that represent unprecedented new directions for the field. These emerging applications include new strategies for using FPs in biosensing applications, and innovative ways of using FPs to manipulate protein function or gene expression.

  4. Evolution of proteins.

    NASA Technical Reports Server (NTRS)

    Dayhoff, M. O.

    1971-01-01

    The amino acid sequences of proteins from living organisms are dealt with. The structure of proteins is first discussed; the variation in this structure from one biological group to another is illustrated by the first halves of the sequences of cytochrome c, and a phylogenetic tree is derived from the cytochrome c data. The relative geological times associated with the events of this tree are discussed. Errors which occur in the duplication of cells during the evolutionary process are examined. Particular attention is given to evolution of mutant proteins, globins, ferredoxin, and transfer ribonucleic acids (tRNA's). Finally, a general outline of biological evolution is presented.

  5. [Phosphorylation of tau protein].

    PubMed

    Uchida, T; Ishiguro, K

    1990-05-01

    In aged human brain and particularly in Alzheimer's disease brain, paired helical filaments (PHFs) accumulate in the neuronal cell. Recently, it has been found that the highly phosphorylated tau protein, one of the microtubule-associated proteins (MAPs), is a component of PHF. The authors attempted to clarify the mechanism underlying the accumulation of PHF from the following two aspects; 1) What is the mechanism of phosphorylation of tau protein? 2) Is the highly phosphorylated tau protein capable of forming PHFs? From rat or bovine microtubule proteins we partially purified and characterized a novel protein kinase that specifically phosphorylated tau and MAP2 among many proteins in the brain extract, and which formed a PHF epitope on the phosphorylated human tau. This enzyme was one of the protein serine/threonine kinases and was independent of known second messengers. The phosphorylation of tau by this enzyme was stimulated by tubulin under the condition of microtubule formation, suggesting that the phosphorylation of tau could occur concomitantly with microtubule formation in the brain. Since this kinase was usually bound to tau but not directly to tubulin, the enzyme was associated with microtubules through tau. From these properties related to tau, this kinase is designated as tau protein kinase. The tau that been phosphorylated with this kinase using [gamma-32P]ATP as a phosphate donor, was digested by endoprotinase Lys-C to produce three labeled fragments, K1, K2 and K3. These three fragments were sequenced and the phosphorylation sites on tau by this kinase were identified. The K2 fragment overlapped with the tau-1 site known to be one of the phosphorylation site in PHF. This result strengthens the possibility that tau protein phosphorylated by tau protein kinase is incorporated into PHF. Tubulin binding sites on tau were located between K1 and K3 fragments, while K2 fragment was located in the neighboring to N-terminus of K1. No phosphorylated sites were

  6. Teaching resources. Protein phosphatases.

    PubMed

    Salton, Stephen R

    2005-03-01

    This Teaching Resource provides lecture notes and slides for a class covering the structure and function of protein phosphatases and is part of the course "Cell Signaling Systems: A Course for Graduate Students." The lecture begins with a discussion of the importance of phosphatases in physiology, recognized by the award of a Nobel Prize in 1992, and then proceeds to describe the two types of protein phosphatases: serine/threonine and tyrosine phosphatases. The information covered includes the structure, regulation, and substrate specificity of protein phosphatases, with an emphasis on their importance in disease and clinical settings.

  7. Electrochromatographic separation of proteins

    NASA Technical Reports Server (NTRS)

    Basak, S. K.; Velayudhan, A.; Kohlmann, K.; Ladisch, M. R.; Mitchell, C. A. (Principal Investigator)

    1995-01-01

    We have developed a modified electrochromatography system which minimizes Joule heating at electric field strengths up to 125 V/cm. A non-linear equilibrium model is described which incorporates electrophoretic mobility, hydrodynamic flow velocity, and an electrically induced concentration polarization at the surface of the stationary phase. This model is able to provide useful estimates of protein retention time and velocity in a column packed with Sephadex gel and subjected to an electric field. A correlation of electrophoretic mobility of peptide and proteins with respect to their charge, molecular mass, and asymmetry enables the selection of solute target molecules for electrochromatographic separations. Good separation of protein mixtures have been obtained.

  8. (PCG) Protein Crystal Growth Canavalin

    NASA Technical Reports Server (NTRS)

    1989-01-01

    (PCG) Protein Crystal Growth Canavalin. The major storage protein of leguminous plants and a major source of dietary protein for humans and domestic animals. It is studied in efforts to enhance nutritional value of proteins through protein engineerings. It is isolated from Jack Bean because of it's potential as a nutritional substance. Principal Investigator on STS-26 was Alex McPherson.

  9. Nuclear localization of the dystrophin-associated protein α-dystrobrevin through importin α2/β1 is critical for interaction with the nuclear lamina/maintenance of nuclear integrity.

    PubMed

    Aguilar, Areli; Wagstaff, Kylie M; Suárez-Sánchez, Rocío; Zinker, Samuel; Jans, David A; Cisneros, Bulmaro

    2015-05-01

    Although α-dystrobrevin (DB) is assembled into the dystrophin-associated protein complex, which is central to cytoskeletal organization, it has also been found in the nucleus. Here we delineate the nuclear import pathway responsible for nuclear targeting of α-DB for the first time, together with the importance of nuclear α-DB in determining nuclear morphology. We map key residues of the nuclear localization signal of α-DB within the zinc finger domain (ZZ) using various truncated versions of the protein, and site-directed mutagenesis. Pulldown, immunoprecipitation, and AlphaScreen assays showed that the importin (IMP) α2/β1 heterodimer interacts with high affinity with the ZZ domain of α-DB. In vitro nuclear import assays using antibodies to specific importins, as well as in vivo studies using siRNA or a dominant negative importin construct, confirmed the key role of IMPα2/β1 in α-DB nuclear translocation. Knockdown of α-DB expression perturbed cell cycle progression in C2C12 myoblasts, with decreased accumulation of cells in S phase and, significantly, altered localization of lamins A/C, B1, and B2 with accompanying gross nuclear morphology defects. Because α-DB interacts specifically with lamin B1 in vivo and in vitro, nuclear α-DB would appear to play a key role in nuclear shape maintenance through association with the nuclear lamina.

  10. Plant protein glycosylation

    PubMed Central

    Strasser, Richard

    2016-01-01

    Protein glycosylation is an essential co- and post-translational modification of secretory and membrane proteins in all eukaryotes. The initial steps of N-glycosylation and N-glycan processing are highly conserved between plants, mammals and yeast. In contrast, late N-glycan maturation steps in the Golgi differ significantly in plants giving rise to complex N-glycans with β1,2-linked xylose, core α1,3-linked fucose and Lewis A-type structures. While the essential role of N-glycan modifications on distinct mammalian glycoproteins is already well documented, we have only begun to decipher the biological function of this ubiquitous protein modification in different plant species. In this review, I focus on the biosynthesis and function of different protein N-linked glycans in plants. Special emphasis is given on glycan-mediated quality control processes in the ER and on the biological role of characteristic complex N-glycan structures. PMID:26911286

  11. Protein Model Database

    SciTech Connect

    Fidelis, K; Adzhubej, A; Kryshtafovych, A; Daniluk, P

    2005-02-23

    The phenomenal success of the genome sequencing projects reveals the power of completeness in revolutionizing biological science. Currently it is possible to sequence entire organisms at a time, allowing for a systemic rather than fractional view of their organization and the various genome-encoded functions. There is an international plan to move towards a similar goal in the area of protein structure. This will not be achieved by experiment alone, but rather by a combination of efforts in crystallography, NMR spectroscopy, and computational modeling. Only a small fraction of structures are expected to be identified experimentally, the remainder to be modeled. Presently there is no organized infrastructure to critically evaluate and present these data to the biological community. The goal of the Protein Model Database project is to create such infrastructure, including (1) public database of theoretically derived protein structures; (2) reliable annotation of protein model quality, (3) novel structure analysis tools, and (4) access to the highest quality modeling techniques available.

  12. Protein Colloidal Aggregation Project

    NASA Technical Reports Server (NTRS)

    Oliva-Buisson, Yvette J. (Compiler)

    2014-01-01

    To investigate the pathways and kinetics of protein aggregation to allow accurate predictive modeling of the process and evaluation of potential inhibitors to prevalent diseases including cataract formation, chronic traumatic encephalopathy, Alzheimer's Disease, Parkinson's Disease and others.

  13. Fully automated protein purification

    PubMed Central

    Camper, DeMarco V.; Viola, Ronald E.

    2009-01-01

    Obtaining highly purified proteins is essential to begin investigating their functional and structural properties. The steps that are typically involved in purifying proteins can include an initial capture, intermediate purification, and a final polishing step. Completing these steps can take several days and require frequent attention to ensure success. Our goal was to design automated protocols that will allow the purification of proteins with minimal operator intervention. Separate methods have been produced and tested that automate the sample loading, column washing, sample elution and peak collection steps for ion-exchange, metal affinity, hydrophobic interaction and gel filtration chromatography. These individual methods are designed to be coupled and run sequentially in any order to achieve a flexible and fully automated protein purification protocol. PMID:19595984

  14. Protein fabrication automation

    PubMed Central

    Cox, J. Colin; Lape, Janel; Sayed, Mahmood A.; Hellinga, Homme W.

    2007-01-01

    Facile “writing” of DNA fragments that encode entire gene sequences potentially has widespread applications in biological analysis and engineering. Rapid writing of open reading frames (ORFs) for expressed proteins could transform protein engineering and production for protein design, synthetic biology, and structural analysis. Here we present a process, protein fabrication automation (PFA), which facilitates the rapid de novo construction of any desired ORF from oligonucleotides with low effort, high speed, and little human interaction. PFA comprises software for sequence design, data management, and the generation of instruction sets for liquid-handling robotics, a liquid-handling robot, a robust PCR scheme for gene assembly from synthetic oligonucleotides, and a genetic selection system to enrich correctly assembled full-length synthetic ORFs. The process is robust and scalable. PMID:17242375

  15. Interactive protein manipulation

    SciTech Connect

    SNCrivelli@lbl.gov

    2003-07-01

    We describe an interactive visualization and modeling program for the creation of protein structures ''from scratch''. The input to our program is an amino acid sequence -decoded from a gene- and a sequence of predicted secondary structure types for each amino acid-provided by external structure prediction programs. Our program can be used in the set-up phase of a protein structure prediction process; the structures created with it serve as input for a subsequent global internal energy minimization, or another method of protein structure prediction. Our program supports basic visualization methods for protein structures, interactive manipulation based on inverse kinematics, and visualization guides to aid a user in creating ''good'' initial structures.

  16. Recombinant Collagenlike Proteins

    NASA Technical Reports Server (NTRS)

    Fertala, Andzej

    2007-01-01

    A group of collagenlike recombinant proteins containing high densities of biologically active sites has been invented. The method used to express these proteins is similar to a method of expressing recombinant procollagens and collagens described in U. S. Patent 5,593,859, "Synthesis of human procollagens and collagens in recombinant DNA systems." Customized collagenous proteins are needed for biomedical applications. In particular, fibrillar collagens are attractive for production of matrices needed for tissue engineering and drug delivery. Prior to this invention, there was no way of producing customized collagenous proteins for these and other applications. Heretofore, collagenous proteins have been produced by use of such biological systems as yeasts, bacteria, and transgenic animals and plants. These products are normal collagens that can also be extracted from such sources as tendons, bones, and hides. These products cannot be made to consist only of biologically active, specific amino acid sequences that may be needed for specific applications. Prior to this invention, it had been established that fibrillar collagens consist of domains that are responsible for such processes as interaction with cells, binding of growth factors, and interaction with a number of structural proteins present in the extracellular matrix. A normal collagen consists of a sequence of domains that can be represented by a corresponding sequence of labels, e.g., D1D2D3D4. A collagenlike protein of the present invention contains regions of collagen II that contain multiples of a single domain (e.g., D1D1D1D1 or D4D4D4D4) chosen for its specific biological activity. By virtue of the multiplicity of the chosen domain, the density of sites having that specific biological activity is greater than it is in a normal collagen. A collagenlike protein according to this invention can thus be made to have properties that are necessary for tissue engineering.

  17. Occupational protein contact dermatitis.

    PubMed

    Barbaud, Annick; Poreaux, Claire; Penven, Emmanuelle; Waton, Julie

    2015-01-01

    Occupational contact dermatitis is generally caused by haptens but can also be induced by proteins causing mainly immunological contact urticaria (ICU); chronic hand eczema in the context of protein contact dermatitis (PCD). In a monocentric retrospective study, from our database, only 31 (0.41%) of patients with contact dermatitis had positive skin tests with proteins: 22 had occupational PCD, 3 had non-occupational PCD, 5 occupational ICU and 1 cook had a neutrophilic fixed food eruption (NFFE) due to fish. From these results and analysis of literature, the characteristics of PCD can be summarized as follows. It is a chronic eczematous dermatitis, possibly exacerbated by work, suggestive if associated with inflammatory perionyxix and immediate erythema with pruritis, to be investigated when the patient resumes work after a period of interruption. Prick tests with the suspected protein-containing material are essential, as patch tests have negative results. In case of multisensitisation revealed by prick tests, it is advisable to analyse IgE against recombinant allergens. A history of atopy, found in 56 to 68% of the patients, has to be checked for. Most of the cases are observed among food-handlers but PCD can also be due to non-edible plants, latex, hydrolysed proteins or animal proteins. Occupational exposure to proteins can thus lead to the development of ICU. Reflecting hypersensitivity to very low concentrations of allergens, investigating ICU therefore requires caution and prick tests should be performed with a diluted form of the causative protein-containing product. Causes are food, especially fruit peel, non-edible plants, cosmetic products, latex, animals.

  18. Chirality and protein biosynthesis.

    PubMed

    Banik, Sindrila Dutta; Nandi, Nilashis

    2013-01-01

    Chirality is present at all levels of structural hierarchy of protein and plays a significant role in protein biosynthesis. The macromolecules involved in protein biosynthesis such as aminoacyl tRNA synthetase and ribosome have chiral subunits. Despite the omnipresence of chirality in the biosynthetic pathway, its origin, role in current pathway, and importance is far from understood. In this review we first present an introduction to biochirality and its relevance to protein biosynthesis. Major propositions about the prebiotic origin of biomolecules are presented with particular reference to proteins and nucleic acids. The problem of the origin of homochirality is unresolved at present. The chiral discrimination by enzymes involved in protein synthesis is essential for keeping the life process going. However, questions remained pertaining to the mechanism of chiral discrimination and concomitant retention of biochirality. We discuss the experimental evidence which shows that it is virtually impossible to incorporate D-amino acids in protein structures in present biosynthetic pathways via any of the two major steps of protein synthesis, namely aminoacylation and peptide bond formation reactions. Molecular level explanations of the stringent chiral specificity in each step are extended based on computational analysis. A detailed account of the current state of understanding of the mechanism of chiral discrimination during aminoacylation in the active site of aminoacyl tRNA synthetase and peptide bond formation in ribosomal peptidyl transferase center is presented. Finally, it is pointed out that the understanding of the mechanism of retention of enantiopurity has implications in developing novel enzyme mimetic systems and biocatalysts and might be useful in chiral drug design.

  19. Protein Nitrogen Determination

    NASA Astrophysics Data System (ADS)

    Nielsen, S. Suzanne

    The protein content of foods can be determined by numerous methods. The Kjeldahl method and the nitrogen combustion (Dumas) method for protein analysis are based on nitrogen determination. Both methods are official for the purposes of nutrition labeling of foods. While the Kjeldahl method has been used widely for over a hundred years, the recent availability of automated instrumentation for the Dumas method in many cases is replacing use of the Kjeldahl method.

  20. Colorimetric protein assay techniques.

    PubMed

    Sapan, C V; Lundblad, R L; Price, N C

    1999-04-01

    There has been an increase in the number of colorimetric assay techniques for the determination of protein concentration over the past 20 years. This has resulted in a perceived increase in sensitivity and accuracy with the advent of new techniques. The present review considers these advances with emphasis on the potential use of such technologies in the assay of biopharmaceuticals. The techniques reviewed include Coomassie Blue G-250 dye binding (the Bradford assay), the Lowry assay, the bicinchoninic acid assay and the biuret assay. It is shown that each assay has advantages and disadvantages relative to sensitivity, ease of performance, acceptance in the literature, accuracy and reproducibility/coefficient of variation/laboratory-to-laboratory variation. A comparison of the use of several assays with the same sample population is presented. It is suggested that the most critical issue in the use of a chromogenic protein assay for the characterization of a biopharmaceutical is the selection of a standard for the calibration of the assay; it is crucial that the standard be representative of the sample. If it is not possible to match the standard with the sample from the perspective of protein composition, then it is preferable to use an assay that is not sensitive to the composition of the protein such as a micro-Kjeldahl technique, quantitative amino acid analysis or the biuret assay. In a complex mixture it might be inappropriate to focus on a general method of protein determination and much more informative to use specific methods relating to the protein(s) of particular interest, using either specific assays or antibody-based methods. The key point is that whatever method is adopted as the 'gold standard' for a given protein, this method needs to be used routinely for calibration.

  1. Protein conducting nanopores

    NASA Astrophysics Data System (ADS)

    Harsman, Anke; Krüger, Vivien; Bartsch, Philipp; Honigmann, Alf; Schmidt, Oliver; Rao, Sanjana; Meisinger, Christof; Wagner, Richard

    2010-11-01

    About 50% of the cellular proteins have to be transported into or across cellular membranes. This transport is an essential step in the protein biosynthesis. In eukaryotic cells secretory proteins are transported into the endoplasmic reticulum before they are transported in vesicles to the plasma membrane. Almost all proteins of the endosymbiotic organelles chloroplasts and mitochondria are synthesized on cytosolic ribosomes and posttranslationally imported. Genetic, biochemical and biophysical approaches led to rather detailed knowledge on the composition of the translocon-complexes which catalyze the membrane transport of the preproteins. Comprehensive concepts on the targeting and membrane transport of polypeptides emerged, however little detail on the molecular nature and mechanisms of the protein translocation channels comprising nanopores has been achieved. In this paper we will highlight recent developments of the diverse protein translocation systems and focus particularly on the common biophysical properties and functions of the protein conducting nanopores. We also provide a first analysis of the interaction between the genuine protein conducting nanopore Tom40SC as well as a mutant Tom40SC (\\mathrm {S}_{54} \\to E ) containing an additional negative charge at the channel vestibule and one of its native substrates, CoxIV, a mitochondrial targeting peptide. The polypeptide induced a voltage-dependent increase in the frequency of channel closure of Tom40SC corresponding to a voltage-dependent association rate, which was even more pronounced for the Tom40SC S54E mutant. The corresponding dwelltime reflecting association/transport of the peptide could be determined with \\bar {t}_{\\mathrm {off}} \\cong 1.1 ms for the wildtype, whereas the mutant Tom40SC S54E displayed a biphasic dwelltime distribution (\\bar {t}_{\\mathrm {off}}^1 \\cong 0.4 ms \\bar {t}_{\\mathrm {off}}^2 \\cong 4.6 ms).

  2. Fast protein folding kinetics

    PubMed Central

    Gelman, Hannah; Gruebele, Martin

    2014-01-01

    Fast folding proteins have been a major focus of computational and experimental study because they are accessible to both techniques: they are small and fast enough to be reasonably simulated with current computational power, but have dynamics slow enough to be observed with specially developed experimental techniques. This coupled study of fast folding proteins has provided insight into the mechanisms which allow some proteins to find their native conformation well less than 1 ms and has uncovered examples of theoretically predicted phenomena such as downhill folding. The study of fast folders also informs our understanding of even “slow” folding processes: fast folders are small, relatively simple protein domains and the principles that govern their folding also govern the folding of more complex systems. This review summarizes the major theoretical and experimental techniques used to study fast folding proteins and provides an overview of the major findings of fast folding research. Finally, we examine the themes that have emerged from studying fast folders and briefly summarize their application to protein folding in general as well as some work that is left to do. PMID:24641816

  3. Motor proteins 1: kinesins.

    PubMed

    Bloom, G S; Endow, S A

    1995-01-01

    Progress regarding the kinesins is now being made at a rapid and accelerating rate. The in vivo-functions, and biophysical and enzymatic properties of kinesin itself are being explored at ever increasing levels of detail. The kinesin-related proteins now number several dozen, and although more is known about primary structure than function for most of the proteins, this trend is already reversing. For example, knowledge about the kinesin-related protein, ncd, is expanding rapidly, and more is already known about its three-dimensional structure than is known for kinesin heavy chain. This volume presents a comprehensive review of the major published works on kinesin and kinesin-related proteins. Hopefully, this manuscript will complement other recent review articles [17, 20, 25, 37, 60-62, 67, 69, 75, 85-88, 231, 233, 238, 244, 269-271, 281, 282, 292] or books [49, 227, 293] that have focused on more selective aspects of the kinesin family, or have been aimed more generally at MT motor proteins. In line with the stated purpose of the Protein Profile series, annual updates of the review on the kinesins are planned for at least the next few years.

  4. Protein phosphorylation and photorespiration.

    PubMed

    Hodges, M; Jossier, M; Boex-Fontvieille, E; Tcherkez, G

    2013-07-01

    Photorespiration allows the recycling of carbon atoms of 2-phosphoglycolate produced by ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) oxygenase activity, as well as the removal of potentially toxic metabolites. The photorespiratory pathway takes place in the light, encompasses four cellular compartments and interacts with several other metabolic pathways and functions. Therefore, the regulation of this cycle is probably of paramount importance to plant metabolism, however, our current knowledge is poor. To rapidly respond to changing conditions, proteins undergo a number of different post-translational modifications that include acetylation, methylation and ubiquitylation, but protein phosphorylation is probably the most common. The reversible covalent addition of a phosphate group to a specific amino acid residue allows the modulation of protein function, such as activity, subcellular localisation, capacity to interact with other proteins and stability. Recent data indicate that many photorespiratory enzymes can be phosphorylated, and thus it seems that the photorespiratory cycle is, in part, regulated by protein phosphorylation. In this review, the known phosphorylation sites of each Arabidopsis thaliana photorespiratory enzyme and several photorespiratory-associated proteins are described and discussed. A brief account of phosphoproteomic protocols is also given since the published data compiled in this review are the fruit of this approach.

  5. Disease specific protein corona

    NASA Astrophysics Data System (ADS)

    Rahman, M.; Mahmoudi, M.

    2015-03-01

    It is now well accepted that upon their entrance into the biological environments, the surface of nanomaterials would be covered by various biomacromolecules (e.g., proteins and lipids). The absorption of these biomolecules, so called `protein corona', onto the surface of (nano)biomaterials confers them a new `biological identity'. Although the formation of protein coronas on the surface of nanoparticles has been widely investigated, there are few reports on the effect of various diseases on the biological identity of nanoparticles. As the type of diseases may tremendously changes the composition of the protein source (e.g., human plasma/serum), one can expect that amount and composition of associated proteins in the corona composition may be varied, in disease type manner. Here, we show that corona coated silica and polystyrene nanoparticles (after interaction with in the plasma of the healthy individuals) could induce unfolding of fibrinogen, which promotes release of the inflammatory cytokines. However, no considerable releases of inflammatory cytokines were observed for corona coated graphene sheets. In contrast, the obtained corona coated silica and polystyrene nanoparticles from the hypofibrinogenemia patients could not induce inflammatory cytokine release where graphene sheets do. Therefore, one can expect that disease-specific protein coronas can provide a novel approach for applying nanomedicine to personalized medicine, improving diagnosis and treatment of different diseases tailored to the specific conditions and circumstances.

  6. Cotton and Protein Interactions

    SciTech Connect

    Goheen, Steven C.; Edwards, J. V.; Rayburn, Alfred R.; Gaither, Kari A.; Castro, Nathan J.

    2006-06-30

    The adsorbent properties of important wound fluid proteins and cotton cellulose are reviewed. This review focuses on the adsorption of albumin to cotton-based wound dressings and some chemically modified derivatives targeted for chronic wounds. Adsorption of elastase in the presence of albumin was examined as a model to understand the interactive properties of these wound fluid components with cotton fibers. In the chronic non-healing wound, elastase appears to be over-expressed, and it digests tissue and growth factors, interfering with the normal healing process. Albumin is the most prevalent protein in wound fluid, and in highly to moderately exudative wounds, it may bind significantly to the fibers of wound dressings. Thus, the relative binding properties of both elastase and albumin to wound dressing fibers are of interest in the design of more effective wound dressings. The present work examines the binding of albumin to two different derivatives of cotton, and quantifies the elastase binding to the same derivatives following exposure of albumin to the fiber surface. An HPLC adsorption technique was employed coupled with a colorimetric enzyme assay to quantify the relative binding properties of albumin and elastase to cotton. The results of wound protein binding are discussed in relation to the porosity and surface chemistry interactions of cotton and wound proteins. Studies are directed to understanding the implications of protein adsorption phenomena in terms of fiber-protein models that have implications for rationally designing dressings for chronic wounds.

  7. Food protein sources.

    PubMed

    Pirie, N W

    1976-07-01

    Work on food, planned by the U.M. (Use and Management) Section of the U.K. committe, was limited to sources of protein because we agreed that more problems calling for research were likely to arise in getting adequate supplies of protein than of other types of food. Deer meat can be produced on land too rough and exposed for sheep; parts of the work on their metabolism and food requirements necessitated building a mobile laboratory. The manner in which the nutritive value of maize is affected by changes in the ratios in which the component proteins are present, stimulated similar studies on barley and groundnut. There is good quality protein in coconuts and leaves but its use in human food is restricted by the presence of fibre. Methods for separating protein from fibre and other deleterious components were improved. In cooperation with scientists in India and Nigeria, the potential yield of protein-deficient foods. e.g. cassava, were 'ennobled' by growing micro-organisms on them with the addition of a cheap source of nitrogen.

  8. Protein-Protein Interfaces in Viral Capsids Are Structurally Unique.

    PubMed

    Cheng, Shanshan; Brooks, Charles L

    2015-11-06

    Viral capsids exhibit elaborate and symmetrical architectures of defined sizes and remarkable mechanical properties not seen with cellular macromolecular complexes. Given the uniqueness of the higher-order organization of viral capsid proteins in the virosphere, we explored the question of whether the patterns of protein-protein interactions within viral capsids are distinct from those in generic protein complexes. Our comparative analysis involving a non-redundant set of 551 inter-subunit interfaces in viral capsids from VIPERdb and 20,014 protein-protein interfaces in non-capsid protein complexes from the Protein Data Bank found 418 generic protein-protein interfaces that share similar physicochemical patterns with some protein-protein interfaces in the capsid set, using the program PCalign we developed for comparing protein-protein interfaces. This overlap in the structural space of protein-protein interfaces is significantly small, with a p-value <0.0001, based on a permutation test on the total set of protein-protein interfaces. Furthermore, the generic protein-protein interfaces that bear similarity in their spatial and chemical arrangement with capsid ones are mostly small in size with fewer than 20 interfacial residues, which results from the relatively limited choices of natural design for small interfaces rather than having significant biological implications in terms of functional relationships. We conclude based on this study that protein-protein interfaces in viral capsids are non-representative of patterns in the smaller, more compact cellular protein complexes. Our finding highlights the design principle of building large biological containers from repeated, self-assembling units and provides insights into specific targets for antiviral drug design for improved efficacy.

  9. Protein crystal growth in space

    NASA Technical Reports Server (NTRS)

    Bugg, C. E.; Clifford, D. W.

    1987-01-01

    The advantages of protein crystallization in space, and the applications of protein crystallography to drug design, protein engineering, and the design of synthetic vaccines are examined. The steps involved in using protein crystallography to determine the three-dimensional structure of a protein are discussed. The growth chamber design and the hand-held apparatus developed for protein crystal growth by vapor diffusion techniques (hanging-drop method) are described; the experimental data from the four Shuttle missions are utilized to develop hardware for protein crystal growth in space and to evaluate the effects of gravity on protein crystal growth.

  10. Parallel Computational Protein Design

    PubMed Central

    Zhou, Yichao; Donald, Bruce R.; Zeng, Jianyang

    2016-01-01

    Computational structure-based protein design (CSPD) is an important problem in computational biology, which aims to design or improve a prescribed protein function based on a protein structure template. It provides a practical tool for real-world protein engineering applications. A popular CSPD method that guarantees to find the global minimum energy solution (GMEC) is to combine both dead-end elimination (DEE) and A* tree search algorithms. However, in this framework, the A* search algorithm can run in exponential time in the worst case, which may become the computation bottleneck of large-scale computational protein design process. To address this issue, we extend and add a new module to the OSPREY program that was previously developed in the Donald lab [1] to implement a GPU-based massively parallel A* algorithm for improving protein design pipeline. By exploiting the modern GPU computational framework and optimizing the computation of the heuristic function for A* search, our new program, called gOSPREY, can provide up to four orders of magnitude speedups in large protein design cases with a small memory overhead comparing to the traditional A* search algorithm implementation, while still guaranteeing the optimality. In addition, gOSPREY can be configured to run in a bounded-memory mode to tackle the problems in which the conformation space is too large and the global optimal solution cannot be computed previously. Furthermore, the GPU-based A* algorithm implemented in the gOSPREY program can be combined with the state-of-the-art rotamer pruning algorithms such as iMinDEE [2] and DEEPer [3] to also consider continuous backbone and side-chain flexibility. PMID:27914056

  11. Modeling Mercury in Proteins

    SciTech Connect

    Smith, Jeremy C; Parks, Jerry M

    2016-01-01

    Mercury (Hg) is a naturally occurring element that is released into the biosphere both by natural processes and anthropogenic activities. Although its reduced, elemental form Hg(0) is relatively non-toxic, other forms such as Hg2+ and, in particular, its methylated form, methylmercury, are toxic, with deleterious effects on both ecosystems and humans. Microorganisms play important roles in the transformation of mercury in the environment. Inorganic Hg2+ can be methylated by certain bacteria and archaea to form methylmercury. Conversely, bacteria also demethylate methylmercury and reduce Hg2+ to relatively inert Hg(0). Transformations and toxicity occur as a result of mercury interacting with various proteins. Clearly, then, understanding the toxic effects of mercury and its cycling in the environment requires characterization of these interactions. Computational approaches are ideally suited to studies of mercury in proteins because they can provide a detailed picture and circumvent issues associated with toxicity. Here we describe computational methods for investigating and characterizing how mercury binds to proteins, how inter- and intra-protein transfer of mercury is orchestrated in biological systems, and how chemical reactions in proteins transform the metal. We describe quantum chemical analyses of aqueous Hg(II), which reveal critical factors that determine ligand binding propensities. We then provide a perspective on how we used chemical reasoning to discover how microorganisms methylate mercury. We also highlight our combined computational and experimental studies of the proteins and enzymes of the mer operon, a suite of genes that confers mercury resistance in many bacteria. Lastly, we place work on mercury in proteins in the context of what is needed for a comprehensive multi-scale model of environmental mercury cycling.

  12. Benchtop Detection of Proteins

    NASA Technical Reports Server (NTRS)

    Scardelletti, Maximilian C.; Varaljay, Vanessa

    2007-01-01

    A process, and a benchtop-scale apparatus for implementing the process, have been developed to detect proteins associated with specific microbes in water. The process and apparatus may also be useful for detection of proteins in other, more complex liquids. There may be numerous potential applications, including monitoring lakes and streams for contamination, testing of blood and other bodily fluids in medical laboratories, and testing for microbial contamination of liquids in restaurants and industrial food-processing facilities. A sample can be prepared and analyzed by use of this process and apparatus within minutes, whereas an equivalent analysis performed by use of other processes and equipment can often take hours to days. The process begins with the conjugation of near-infrared-fluorescent dyes to antibodies that are specific to a particular protein. Initially, the research has focused on using near-infrared dyes to detect antigens or associated proteins in solution, which has proven successful vs. microbial cells, and streamlining the technique in use for surface protein detection on microbes would theoretically render similar results. However, it is noted that additional work is needed to transition protein-based techniques to microbial cell detection. Consequently, multiple such dye/antibody pairs could be prepared to enable detection of multiple selected microbial species, using a different dye for each species. When excited by near-infrared light of a suitable wavelength, each dye fluoresces at a unique longer wavelength that differs from those of the other dyes, enabling discrimination among the various species. In initial tests, the dye/antibody pairs are mixed into a solution suspected of containing the selected proteins, causing the binding of the dye/antibody pairs to such suspect proteins that may be present. The solution is then run through a microcentrifuge that includes a membrane that acts as a filter in that it retains the dye/antibody/protein

  13. Purine inhibitors of protein kinases, G proteins and polymerases

    DOEpatents

    Gray, Nathanael S.; Schultz, Peter; Kim, Sung-Hou; Meijer, Laurent

    2001-07-03

    The present invention relates to purine analogs that inhibit, inter alia, protein kinases, G-proteins and polymerases. In addition, the present invention relates to methods of using such purine analogs to inhibit protein kinases, G-proteins, polymerases and other cellular processes and to treat cellular proliferative diseases.

  14. Heat Capacity in Proteins

    NASA Astrophysics Data System (ADS)

    Prabhu, Ninad V.; Sharp, Kim A.

    2005-05-01

    Heat capacity (Cp) is one of several major thermodynamic quantities commonly measured in proteins. With more than half a dozen definitions, it is the hardest of these quantities to understand in physical terms, but the richest in insight. There are many ramifications of observed Cp changes: The sign distinguishes apolar from polar solvation. It imparts a temperature (T) dependence to entropy and enthalpy that may change their signs and which of them dominate. Protein unfolding usually has a positive ΔCp, producing a maximum in stability and sometimes cold denaturation. There are two heat capacity contributions, from hydration and protein-protein interactions; which dominates in folding and binding is an open question. Theoretical work to date has dealt mostly with the hydration term and can account, at least semiquantitatively, for the major Cp-related features: the positive and negative Cp of hydration for apolar and polar groups, respectively; the convergence of apolar group hydration entropy at T ≈ 112°C; the decrease in apolar hydration Cp with increasing T; and the T-maximum in protein stability and cold denaturation.

  15. The ras superfamily proteins.

    PubMed

    Chardin, P

    1988-07-01

    Several recent discoveries indicate that the ras genes, frequently activated to a transforming potential in some human tumours, belong to a large family that can be divided into three main branches: the first branch represented by the ras, ral and rap genes; the second branch, by the rho genes; and the third branch, by the rab genes. The C-terminal end of the encoded proteins always includes a cystein, which may become fatty-acylated, suggesting a sub-membrane localization. The ras superfamily proteins share four regions of high homology corresponding to the GTP binding site; however, even in these regions, significant differences are found, suggesting that the various proteins may possess slightly different biochemical properties. Recent reports show that some of these proteins play an essential role in the control of physical processes such as cell motility, membrane ruffling, endocytosis and exocytosis. Nevertheless, the characterization of the proteins directly interacting with the ras or ras-related gene-products will be required to precisely understand their function.

  16. [Protein metabolism in vegans].

    PubMed

    Okuda, T; Miyoshi-Nishimura, H; Makita, T; Sugawa-Katayama, Y; Hazama, T; Simizu, T; Yamaguchi, Y

    1994-11-01

    To elucidate the mechanisms of adaptation to a low-energy and low-protein vegan diet, we carried out dietary surveys and nitrogen balance studies five times during one year on two women and a man who ate raw brown rice, raw green vegetables, three kinds of raw roots, fruit and salt daily. Individual subjects modified this vegan diet slightly. The mean daily energy intake of the subjects was 18, 14, and 32 kcal/kg, of body weight. The loss of body weight was about 10% of the initial level. The daily nitrogen balance was -32, -33, and -11 mg N/kg of body weight. In spite of the negative nitrogen balance, the results of routine clinical tests, initially normal, did not change with the vegan diet. Ten months after the start of the vegan diet, the subjects were given 15N urea orally. The incorporation of 15N into serum proteins suggested that these subjects could utilize urea nitrogen for body protein synthesis. The level of 15N in serum proteins was close to the level in other normal adult men on a low-protein diet with adequate energy for 2 weeks.

  17. Protein Dynamics in Enzymology

    NASA Astrophysics Data System (ADS)

    Brooks, , III

    2001-03-01

    Enzymes carry-out the chemical activity essential for living processes by providing particular structural arrangements of chemically functional moieties through the structure of their constituent proteins. They are suggested to be optimized through evolution to specifically bind the transition state for the chemical processes they participate in, thereby enhancing the rate of these chemical events by 6-12 orders of magnitude. However, proteins are malleable and fluctuating many-body systems and may also utilize coupling between motional processes with catalysis to regulate or promote these processes. Our studies are aimed at exploring the hypothesis that motions of the protein couple distant regions of the molecule to assist catalytic processes. We demonstrate, through the use of molecular simulations, that strongly coupled motions occur in regions of protein molecules distant in sequence and space from each other, and the enzyme’s active site, when the protein is in a reactant state. Further, we find that the presence of this coupling disappears in complexes no longer reactive-competent, i.e., for product configurations and mutant sequences. The implications of these findings and aspects of evolutionary relationships and mutational studies which support the coupling hypothesis will be discussed in the context of our work on dihydrofolate reductase.

  18. Protein folding and de novo protein design for biotechnological applications

    PubMed Central

    Khoury, George A.; Smadbeck, James; Kieslich, Chris A.; Floudas, Christodoulos A.

    2014-01-01

    In the post-genomic era, the medical/biological fields are advancing faster than ever. However, before the power of full-genome sequencing can be fully realized, the connection between amino acid sequence and protein structure, known as the protein folding problem, needs to be elucidated. The protein folding problem remains elusive, with significant difficulties still arising when modeling amino acid sequences lacking an identifiable template. Understanding protein folding will allow for unforeseen advances in protein design, often referred as the inverse protein folding problem. Despite challenges in protein folding, de novo protein design has recently demonstrated significant success via computational techniques. We review advances and challenges in protein structure prediction and de novo protein design, and highlight their interplay in successful biotechnological applications. PMID:24268901

  19. Matricellular proteins and biomaterials.

    PubMed

    Morris, Aaron H; Kyriakides, Themis R

    2014-07-01

    Biomaterials are essential to modern medicine as components of reconstructive implants, implantable sensors, and vehicles for localized drug delivery. Advances in biomaterials have led to progression from simply making implants that are nontoxic to making implants that are specifically designed to elicit particular functions within the host. The interaction of implants and the extracellular matrix during the foreign body response is a growing area of concern for the field of biomaterials, because it can lead to implant failure. Expression of matricellular proteins is modulated during the foreign body response and these proteins interact with biomaterials. The design of biomaterials to specifically alter the levels of matricellular proteins surrounding implants provides a new avenue for the design and fabrication of biomimetic biomaterials.

  20. Advanced protein formulations

    PubMed Central

    Wang, Wei

    2015-01-01

    It is well recognized that protein product development is far more challenging than that for small-molecule drugs. The major challenges include inherent sensitivity to different types of stresses during the drug product manufacturing process, high rate of physical and chemical degradation during long-term storage, and enhanced aggregation and/or viscosity at high protein concentrations. In the past decade, many novel formulation concepts and technologies have been or are being developed to address these product development challenges for proteins. These concepts and technologies include use of uncommon/combination of formulation stabilizers, conjugation or fusion with potential stabilizers, site-specific mutagenesis, and preparation of nontraditional types of dosage forms—semiaqueous solutions, nonfreeze-dried solid formulations, suspensions, and other emerging concepts. No one technology appears to be mature, ideal, and/or adequate to address all the challenges. These gaps will likely remain in the foreseeable future and need significant efforts for ultimate resolution. PMID:25858529

  1. Thermal hysteresis proteins.

    PubMed

    Barrett, J

    2001-02-01

    Extreme environments present a wealth of biochemical adaptations. Thermal hysteresis proteins (THPs) have been found in vertebrates, invertebrates, plants, bacteria and fungi and are able to depress the freezing point of water (in the presence of ice crystals) in a non-colligative manner by binding to the surface of nascent ice crystals. The THPs comprise a disparate group of proteins with a variety of tertiary structures and often no common sequence similarities or structural motifs. Different THPs bind to different faces of the ice crystal, and no single mechanism has been proposed to account for THP ice binding affinity and specificity. Experimentally THPs have been used in the cryopreservation of tissues and cells and to induce cold tolerance in freeze susceptible organisms. THPs represent a remarkable example of parallel and convergent evolution with different proteins being adapted for an anti-freeze role.

  2. Thermodynamics of Protein Aggregation

    NASA Astrophysics Data System (ADS)

    Osborne, Kenneth L.; Barz, Bogdan; Bachmann, Michael; Strodel, Birgit

    Amyloid protein aggregation characterizes many neurodegenerative disorders, including Alzheimer's, Parkinson's, and Creutz- feldt-Jakob disease. Evidence suggests that amyloid aggregates may share similar aggregation pathways, implying simulation of full-length amyloid proteins is not necessary for understanding amyloid formation. In this study we simulate GNNQQNY, the N-terminal prion-determining domain of the yeast protein Sup35 to investigate the thermodynamics of structural transitions during aggregation. We use a coarse-grained model with replica-exchange molecular dynamics to investigate the association of 3-, 6-, and 12-chain GNNQQNY systems and we determine the aggregation pathway by studying aggregation states of GN- NQQNY. We find that the aggregation of the hydrophilic GNNQQNY sequence is mainly driven by H-bond formation, leading to the formation of /3-sheets from the very beginning of the assembly process. Condensation (aggregation) and ordering take place simultaneously, which is underpinned by the occurrence of a single heat capacity peak only.

  3. Protein crystallization studies

    NASA Technical Reports Server (NTRS)

    Lyne, James Evans

    1996-01-01

    The Structural Biology laboratory at NASA Marshall Spaceflight Center uses x-ray crystallographic techniques to conduct research into the three-dimensional structure of a wide variety of proteins. A major effort in the laboratory involves an ongoing study of human serum albumin (the principal protein in human plasma) and its interaction with various endogenous substances and pharmaceutical agents. Another focus is on antigenic and functional proteins from several pathogenic organisms including the human immunodeficiency virus (HIV) and the widespread parasitic genus, Schistosoma. My efforts this summer have been twofold: first, to identify clinically significant drug interactions involving albumin binding displacement and to initiate studies of the three-dimensional structure of albumin complexed with these agents, and secondly, to establish collaborative efforts to extend the lab's work on human pathogens.

  4. Protein Crystal Serum Albumin

    NASA Technical Reports Server (NTRS)

    1998-01-01

    As the most abundant protein in the circulatory system albumin contributes 80% to colloid osmotic blood pressure. Albumin is also chiefly responsible for the maintenance of blood pH. It is located in every tissue and bodily secretion, with extracellular protein comprising 60% of total albumin. Perhaps the most outstanding property of albumin is its ability to bind reversibly to an incredible variety of ligands. It is widely accepted in the pharmaceutical industry that the overall distribution, metabolism, and efficiency of many drugs are rendered ineffective because of their unusually high affinity for this abundant protein. An understanding of the chemistry of the various classes of pharmaceutical interactions with albumin can suggest new approaches to drug therapy and design. Principal Investigator: Dan Carter/New Century Pharmaceuticals

  5. Tracking protein aggregate interactions

    PubMed Central

    Bartz, Jason C; Nilsson, K Peter R

    2011-01-01

    Amyloid fibrils share a structural motif consisting of highly ordered β-sheets aligned perpendicular to the fibril axis.1, 2 At each fibril end, β-sheets provide a template for recruiting and converting monomers.3 Different amyloid fibrils often co-occur in the same individual, yet whether a protein aggregate aids or inhibits the assembly of a heterologous protein is unclear. In prion disease, diverse prion aggregate structures, known as strains, are thought to be the basis of disparate disease phenotypes in the same species expressing identical prion protein sequences.4–7 Here we explore the interactions reported to occur when two distinct prion strains occur together in the central nervous system. PMID:21597336

  6. Bioinformatics and Moonlighting Proteins

    PubMed Central

    Hernández, Sergio; Franco, Luís; Calvo, Alejandra; Ferragut, Gabriela; Hermoso, Antoni; Amela, Isaac; Gómez, Antonio; Querol, Enrique; Cedano, Juan

    2015-01-01

    Multitasking or moonlighting is the capability of some proteins to execute two or more biochemical functions. Usually, moonlighting proteins are experimentally revealed by serendipity. For this reason, it would be helpful that Bioinformatics could predict this multifunctionality, especially because of the large amounts of sequences from genome projects. In the present work, we analyze and describe several approaches that use sequences, structures, interactomics, and current bioinformatics algorithms and programs to try to overcome this problem. Among these approaches are (a) remote homology searches using Psi-Blast, (b) detection of functional motifs and domains, (c) analysis of data from protein–protein interaction databases (PPIs), (d) match the query protein sequence to 3D databases (i.e., algorithms as PISITE), and (e) mutation correlation analysis between amino acids by algorithms as MISTIC. Programs designed to identify functional motif/domains detect mainly the canonical function but usually fail in the detection of the moonlighting one, Pfam and ProDom being the best methods. Remote homology search by Psi-Blast combined with data from interactomics databases (PPIs) has the best performance. Structural information and mutation correlation analysis can help us to map the functional sites. Mutation correlation analysis can only be used in very specific situations – it requires the existence of multialigned family protein sequences – but can suggest how the evolutionary process of second function acquisition took place. The multitasking protein database MultitaskProtDB (http://wallace.uab.es/multitask/), previously published by our group, has been used as a benchmark for the all of the analyses. PMID:26157797

  7. Antioxidants and protein oxidation.

    PubMed

    Griffiths, H R

    2000-11-01

    Proteins are susceptible to oxidation by reactive oxygen species, where the type of damage induced is characteristic of the denaturing species. The induction of protein carbonyls is a widely applied biomarker, arising from primary oxidative insult. However, when applied to complex biological and pathological conditions it can be subject to interference from lipid, carbohydrate and DNA oxidation products. More recently, interest has focused on the analysis of specific protein bound oxidised amino acids. Of the 22 amino acids, aromatic and sulphydryl containing residues have been regarded as being particularly susceptible to oxidative modification, with L-DOPA from tyrosine, ortho-tyrosine from phenylalanine; sulphoxides and disulphides from methionine and cysteine respectively; and kynurenines from tryptophan. Latterly, the identification of valine and leucine hydroxides, reduced from hydroperoxide intermediates, has been described and applied. In order to examine the nature of oxidative damage and protective efficacy of antioxidants the markers must be thoroughly evaluated for dosimetry in vitro following damage by specific radical species. Antioxidant protection against formation of the biomarker should be demonstrated in vitro. Quantification of biomarkers in proteins from normal subjects should be within the limits of detection of any analytical procedure. Further to this, the techniques for isolation and hydrolysis of specific proteins should demonstrate that in vitro oxidation is minimised. There is a need for the development of standards for quality assurance material to standardise procedures between laboratories. At present, antioxidant effects on protein oxidation in vivo are limited to animal studies, where dietary antioxidants have been reported to reduce dityrosine formation during rat exercise training. Two studies on humans have been reported last year. The further application of these methods to human studies is indicated, where the quality of the

  8. Discovery of binding proteins for a protein target using protein-protein docking-based virtual screening.

    PubMed

    Zhang, Changsheng; Tang, Bo; Wang, Qian; Lai, Luhua

    2014-10-01

    Target structure-based virtual screening, which employs protein-small molecule docking to identify potential ligands, has been widely used in small-molecule drug discovery. In the present study, we used a protein-protein docking program to identify proteins that bind to a specific target protein. In the testing phase, an all-to-all protein-protein docking run on a large dataset was performed. The three-dimensional rigid docking program SDOCK was used to examine protein-protein docking on all protein pairs in the dataset. Both the binding affinity and features of the binding energy landscape were considered in the scoring function in order to distinguish positive binding pairs from negative binding pairs. Thus, the lowest docking score, the average Z-score, and convergency of the low-score solutions were incorporated in the analysis. The hybrid scoring function was optimized in the all-to-all docking test. The docking method and the hybrid scoring function were then used to screen for proteins that bind to tumor necrosis factor-α (TNFα), which is a well-known therapeutic target for rheumatoid arthritis and other autoimmune diseases. A protein library containing 677 proteins was used for the screen. Proteins with scores among the top 20% were further examined. Sixteen proteins from the top-ranking 67 proteins were selected for experimental study. Two of these proteins showed significant binding to TNFα in an in vitro binding study. The results of the present study demonstrate the power and potential application of protein-protein docking for the discovery of novel binding proteins for specific protein targets.

  9. SAP family proteins.

    PubMed

    Fujita, A; Kurachi, Y

    2000-03-05

    Thus far, five members including Dlg, SAP97/hDlg, SAP90/PSD-95, SAP102, and PSD-93/chapsyn110 which belong to SAP family have been identified. Recent studies have revealed that these proteins play important roles in the localization and function of glutamate receptors and K(+) channels. Although most of them have been reported to be localized to the synapse, only one member, SAP97, is expressed also in the epithelial cells. In this review, we have summarized structural characters of SAP family proteins and discuss their functions in neurons and epithelial cells.

  10. Protein Biosynthesis in Mitochondria

    PubMed Central

    Kuzmenko, A. V.; Levitskii, S. A.; Vinogradova, E. N.; Atkinson, G. C.; Hauryliuk, V.; Zenkin, N.; Kamenski, P. A.

    2013-01-01

    Translation, that is biosynthesis of polypeptides in accordance with information encoded in the genome, is one of the most important processes in the living cell, and it has been in the spotlight of international research for many years. The mechanisms of protein biosynthesis in bacteria and in the eukaryotic cytoplasm are now understood in great detail. However, significantly less is known about translation in eukaryotic mitochondria, which is characterized by a number of unusual features. In this review, we summarize current knowledge about mitochondrial translation in different organisms while paying special attention to the aspects of this process that differ from cytoplasmic protein biosynthesis. PMID:24228873

  11. Congenital protein hypoglycosylation diseases

    PubMed Central

    Sparks, Susan E

    2012-01-01

    Glycosylation is an essential process by which sugars are attached to proteins and lipids. Complete lack of glycosylation is not compatible with life. Because of the widespread function of glycosylation, inherited disorders of glycosylation are multisystemic. Since the identification of the first defect on N-linked glycosylation in the 1980s, there are over 40 different congenital protein hypoglycosylation diseases. This review will include defects of N-linked glycosylation, O-linked glycosylation and disorders of combined N- and O-linked glycosylation. PMID:23776380

  12. [Protein-losing enteropathy].

    PubMed

    Parfenov, A I; Krums, L M

    2017-01-01

    Protein-losing enteropathy (PLE) is a rare complication of intestinal diseases. Its main manifestation is hypoproteinemic edema. The diagnosis of PLE is based on the verification of protein loss into the intestinal lumen, by determining fecal α1-antitrypsin concentration and clearance. The localization of the affected colonic segment is clarified using radiologic and endoscopic techniques. The mainstay of treatment for PLE is a fat-free diet enriched with medium-chain triglycerides. Surgical resection of the affected segment of the colon may be the treatment of choice for severe hypoproteinemia resistant to drug therapy.

  13. DELIVERY OF THERAPEUTIC PROTEINS

    PubMed Central

    Pisal, Dipak S.; Kosloski, Matthew P.; Balu-Iyer, Sathy V.

    2009-01-01

    The safety and efficacy of protein therapeutics are limited by three interrelated pharmaceutical issues, in vitro and in vivo instability, immunogenicity and shorter half-lives. Novel drug modifications for overcoming these issues are under investigation and include covalent attachment of poly(ethylene glycol) (PEG), polysialic acid, or glycolic acid, as well as developing new formulations containing nanoparticulate or colloidal systems (e.g. liposomes, polymeric microspheres, polymeric nanoparticles). Such strategies have the potential to develop as next generation protein therapeutics. This review includes a general discussion on these delivery approaches. PMID:20049941

  14. Protein biosynthesis in mitochondria.

    PubMed

    Kuzmenko, A V; Levitskii, S A; Vinogradova, E N; Atkinson, G C; Hauryliuk, V; Zenkin, N; Kamenski, P A

    2013-08-01

    Translation, that is biosynthesis of polypeptides in accordance with information encoded in the genome, is one of the most important processes in the living cell, and it has been in the spotlight of international research for many years. The mechanisms of protein biosynthesis in bacteria and in the eukaryotic cytoplasm are now understood in great detail. However, significantly less is known about translation in eukaryotic mitochondria, which is characterized by a number of unusual features. In this review, we summarize current knowledge about mitochondrial translation in different organisms while paying special attention to the aspects of this process that differ from cytoplasmic protein biosynthesis.

  15. Protein energy malnutrition.

    PubMed

    Grover, Zubin; Ee, Looi C

    2009-10-01

    Protein energy malnutrition (PEM) is a common problem worldwide and occurs in both developing and industrialized nations. In the developing world, it is frequently a result of socioeconomic, political, or environmental factors. In contrast, protein energy malnutrition in the developed world usually occurs in the context of chronic disease. There remains much variation in the criteria used to define malnutrition, with each method having its own limitations. Early recognition, prompt management, and robust follow up are critical for best outcomes in preventing and treating PEM.

  16. An introduction to protein moonlighting.

    PubMed

    Jeffery, Constance J

    2014-12-01

    Moonlighting proteins comprise a class of multifunctional proteins in which a single polypeptide chain performs multiple physiologically relevant biochemical or biophysical functions. Almost 300 proteins have been found to moonlight. The known examples of moonlighting proteins include diverse types of proteins, including receptors, enzymes, transcription factors, adhesins and scaffolds, and different combinations of functions are observed. Moonlighting proteins are expressed throughout the evolutionary tree and function in many different biochemical pathways. Some moonlighting proteins can perform both functions simultaneously, but for others, the protein's function changes in response to changes in the environment. The diverse examples of moonlighting proteins already identified, and the potential benefits moonlighting proteins might provide to the organism, such as through coordinating cellular activities, suggest that many more moonlighting proteins are likely to be found. Continuing studies of the structures and functions of moonlighting proteins will aid in predicting the functions of proteins identified through genome sequencing projects, in interpreting results from proteomics experiments, in understanding how different biochemical pathways interact in systems biology, in annotating protein sequence and structure databases, in studies of protein evolution and in the design of proteins with novel functions.

  17. Protein domain connectivity and essentiality

    NASA Astrophysics Data System (ADS)

    da F. Costa, L.; Rodrigues, F. A.; Travieso, G.

    2006-10-01

    Protein-protein interactions can be properly modeled as scale-free complex networks, while the lethality of proteins has been correlated with the node degrees, therefore defining a lethality-centrality rule. In this work the authors revisit this relevant problem by focusing attention not on proteins as a whole, but on their functional domains, which are ultimately responsible for their binding potential. Four networks are considered: the original protein-protein interaction network, its randomized version, and two domain networks assuming different lethality hypotheses. By using formal statistical analysis, they show that the correlation between connectivity and essentiality is higher for domains than for proteins.

  18. Conformation Distributions in Adsorbed Proteins.

    NASA Astrophysics Data System (ADS)

    Meuse, Curtis W.; Hubbard, Joseph B.; Vrettos, John S.; Smith, Jackson R.; Cicerone, Marcus T.

    2007-03-01

    While the structural basis of protein function is well understood in the biopharmaceutical and biotechnology industries, few methods for the characterization and comparison of protein conformation distributions are available. New methods capable of measuring the stability of protein conformations and the integrity of protein-protein, protein-ligand and protein-surface interactions both in solution and on surfaces are needed to help the development of protein-based products. We are developing infrared spectroscopy methods for the characterization and comparison of molecular conformation distributions in monolayers and in solutions. We have extracted an order parameter describing the orientational and conformational variations of protein functional groups around the average molecular values from a single polarized spectrum. We will discuss the development of these methods and compare them to amide hydrogen/deuterium exchange methods for albumin in solution and on different polymer surfaces to show that our order parameter is related to protein stability.

  19. Interactome of the inhibitory isoform of the nuclear transporter Importin 13.

    PubMed

    Fatima, Shadma; Wagstaff, Kylie M; Lieu, Kim G; Davies, Rebecca G; Tanaka, Satomi S; Yamaguchi, Yasuka L; Loveland, Kate L; Tam, Patrick P L; Jans, David A

    2017-03-01

    Importin 13 (Imp13) is a bidirectional nuclear transporter of proteins involved in a range of important cellular processes, with an N-terminally truncated inhibitory isoform (tImp13) specifically expressed in testis. To gain insight into tImp13 function, we performed a yeast-2-hybrid screen from a human testis cDNA library, identifying for the first time a suite of interactors with roles in diverse cellular process. We validated the interaction of tImp13 with Eukaryotic translation initiation factor 4γ2 (EIF4G2) and High mobility group containing protein 20A (HMG20A), benchmarking that with glucocorticoid receptor (GR), a known Imp13 interactor expressed in testis. Coimmunoprecipitation assays indicated association of both tImp13 and Imp13 with EIF4G2, HMG20A and GR. Quantitative confocal microscopic analysis revealed the ability of tImp13 to inhibit the nuclear localisation of EIF4G2, HMG20A and GR, as well as that of Imp13 to act as a nuclear exporter for both EIF4G2 and HMG20A, and as a nuclear importer for GR. The physiological relevance of these results was highlighted by the cytoplasmic localisation of EIF4G2, HMG20A and GR in pachytene spermatocytes/round spermatids in the murine testis where tImp13 is present at high levels, in contrast to the nuclear localisation of HMG20A and GR in spermatogonia, where tImp13 is largely absent. Interestingly, Imp13, EIF4G2, HMG20A and GR were found together in the acrosome vesicle of murine epididymal spermatozoa. Collectively, our findings show, for the first time, that tImp13 may have a functional role in the mature spermatozoa, in addition to that in the meiotic germ cells of the testis.

  20. NextGen protein design

    PubMed Central

    Regan, Lynne

    2014-01-01

    Protein engineering is at an exciting stage because designed protein–protein interactions are being used in many applications. For instance, three designed proteins are now in clinical trials. Although there have been many successes over the last decade, protein engineering still faces numerous challenges. Often, designs do not work as anticipated and they still require substantial redesign. The present review focuses on the successes, the challenges and the limitations of rational protein design today. PMID:24059497

  1. Conserved herpesvirus protein kinases

    PubMed Central

    Gershburg, Edward; Pagano, Joseph S.

    2008-01-01

    Conserved herpesviral protein kinases (CHPKs) are a group of enzymes conserved throughout all subfamilies of Herpesviridae. Members of this group are serine/threonine protein kinases that are likely to play a conserved role in viral infection by interacting with common host cellular and viral factors; however along with a conserved role, individual kinases may have unique functions in the context of viral infection in such a way that they are only partially replaceable even by close homologues. Recent studies demonstrated that CHPKs are crucial for viral infection and suggested their involvement in regulation of numerous processes at various infection steps (primary infection, nuclear egress, tegumentation), although the mechanisms of this regulation remain unknown. Notwithstanding, recent advances in discovery of new CHPK targets, and studies of CHPK knockout phenotypes have raised their attractiveness as targets for antiviral therapy. A number of compounds have been shown to inhibit the activity of human cytomegalovirus (HCMV)-encoded UL97 protein kinase and exhibit a pronounced antiviral effect, although the same compounds are inactive against Epstein-Barr Virus (EBV)-encoded protein kinase BGLF4, illustrating the fact that low homology between the members of this group complicates development of compounds targeting the whole group, and suggesting that individualized, structure-based inhibitor design will be more effective. Determination of CHPK structures will greatly facilitate this task. PMID:17881303

  2. Protein states and proteinquakes.

    PubMed Central

    Ansari, A; Berendzen, J; Bowne, S F; Frauenfelder, H; Iben, I E; Sauke, T B; Shyamsunder, E; Young, R D

    1985-01-01

    After photodissociation of carbon monoxide bound to myoglobin, the protein relaxes to the deoxy equilibrium structure in a quake-like motion. Investigation of the proteinquake and of related intramolecular equilibrium motions shows that states and motions have a hierarchical glass-like structure. PMID:3860839

  3. Dynamics of protein conformations

    NASA Astrophysics Data System (ADS)

    Stepanova, Maria

    2010-10-01

    A novel theoretical methodology is introduced to identify dynamic structural domains and analyze local flexibility in proteins. The methodology employs a multiscale approach combining identification of essential collective coordinates based on the covariance analysis of molecular dynamics trajectories, construction of the Mori projection operator with these essential coordinates, and analysis of the corresponding generalized Langevin equations [M.Stepanova, Phys.Rev.E 76(2007)051918]. Because the approach employs a rigorous theory, the outcomes are physically transparent: the dynamic domains are associated with regions of relative rigidity in the protein, whereas off-domain regions are relatively soft. This also allows scoring the flexibility in the macromolecule with atomic-level resolution [N.Blinov, M.Berjanskii, D.S.Wishart, and M.Stepanova, Biochemistry, 48(2009)1488]. The applications include the domain coarse-graining and characterization of conformational stability in protein G and prion proteins. The results are compared with published NMR experiments. Potential applications for structural biology, bioinformatics, and drug design are discussed.

  4. Proteins of Excitable Membranes

    PubMed Central

    Nachmansohn, David

    1969-01-01

    Excitable membranes have the special ability of changing rapidly and reversibly their permeability to ions, thereby controlling the ion movements that carry the electric currents propagating nerve impulses. Acetylcholine (ACh) is the specific signal which is released by excitation and is recognized by a specific protein, the ACh-receptor; it induces a conformational change, triggering off a sequence of reactions resulting in increased permeability. The hydrolysis of ACh by ACh-esterase restores the barrier to ions. The enzymes hydrolyzing and forming ACh and the receptor protein are present in the various types of excitable membranes. Properties of the two proteins directly associated with electrical activity, receptor and esterase, will be described in this and subsequent lectures. ACh-esterase has been shown to be located within the excitable membranes. Potent enzyme inhibitors block electrical activity demonstrating the essential role in this function. The enzyme has been recently crystallized and some protein properties will be described. The monocellular electroplax preparation offers a uniquely favorable material for analyzing the properties of the ACh-receptor and its relation to function. The essential role of the receptor in electrical activity has been demonstrated with specific receptor inhibitors. Recent data show the basically similar role of ACh in the axonal and junctional membranes; the differences of electrical events and pharmacological actions are due to variations of shape, structural organization, and environment. PMID:19873642

  5. Cellulose binding domain proteins

    SciTech Connect

    Shoseyov, Oded; Shpiegl, Itai; Goldstein, Marc; Doi, Roy

    1998-01-01

    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  6. Chaos in protein dynamics.

    PubMed

    Braxenthaler, M; Unger, R; Auerbach, D; Given, J A; Moult, J

    1997-12-01

    MD simulations, currently the most detailed description of the dynamic evolution of proteins, are based on the repeated solution of a set of differential equations implementing Newton's second law. Many such systems are known to exhibit chaotic behavior, i.e., very small changes in initial conditions are amplified exponentially and lead to vastly different, inherently unpredictable behavior. We have investigated the response of a protein fragment in an explicit solvent environment to very small perturbations of the atomic positions (10(-3)-10(-9) A). Independent of the starting conformation (native-like, compact, extended), perturbed dynamics trajectories deviated rapidly, leading to conformations that differ by approximately 1 A RMSD within 1-2 ps. Furthermore, introducing the perturbation more than 1-2 ps before a significant conformational transition leads to a loss of the transition in the perturbed trajectories. We present evidence that the observed chaotic behavior reflects physical properties of the system rather than numerical instabilities of the calculation and discuss the implications for models of protein folding and the use of MD as a tool to analyze protein folding pathways.

  7. Tuber Storage Proteins

    PubMed Central

    SHEWRY, PETER R.

    2003-01-01

    A wide range of plants are grown for their edible tubers, but five species together account for almost 90 % of the total world production. These are potato (Solanum tuberosum), cassava (Manihot esculenta), sweet potato (Ipomoea batatus), yams (Dioscorea spp.) and taro (Colocasia, Cyrtosperma and Xanthosoma spp.). All of these, except cassava, contain groups of storage proteins, but these differ in the biological properties and evolutionary relationships. Thus, patatin from potato exhibits activity as an acylhydrolase and esterase, sporamin from sweet potato is an inhibitor of trypsin, and dioscorin from yam is a carbonic anhydrase. Both sporamin and dioscorin also exhibit antioxidant and radical scavenging activity. Taro differs from the other three crops in that it contains two major types of storage protein: a trypsin inhibitor related to sporamin and a mannose‐binding lectin. These characteristics indicate that tuber storage proteins have evolved independently in different species, which contrasts with the highly conserved families of storage proteins present in seeds. Furthermore, all exhibit biological activities which could contribute to resistance to pests, pathogens or abiotic stresses, indicating that they may have dual roles in the tubers. PMID:12730067

  8. Tuber storage proteins.

    PubMed

    Shewry, Peter R

    2003-06-01

    A wide range of plants are grown for their edible tubers, but five species together account for almost 90 % of the total world production. These are potato (Solanum tuberosum), cassava (Manihot esculenta), sweet potato (Ipomoea batatus), yams (Dioscorea spp.) and taro (Colocasia, Cyrtosperma and Xanthosoma spp.). All of these, except cassava, contain groups of storage proteins, but these differ in the biological properties and evolutionary relationships. Thus, patatin from potato exhibits activity as an acylhydrolase and esterase, sporamin from sweet potato is an inhibitor of trypsin, and dioscorin from yam is a carbonic anhydrase. Both sporamin and dioscorin also exhibit antioxidant and radical scavenging activity. Taro differs from the other three crops in that it contains two major types of storage protein: a trypsin inhibitor related to sporamin and a mannose-binding lectin. These characteristics indicate that tuber storage proteins have evolved independently in different species, which contrasts with the highly conserved families of storage proteins present in seeds. Furthermore, all exhibit biological activities which could contribute to resistance to pests, pathogens or abiotic stresses, indicating that they may have dual roles in the tubers.

  9. Protein thin film machines.

    PubMed

    Federici, Stefania; Oliviero, Giulio; Hamad-Schifferli, Kimberly; Bergese, Paolo

    2010-12-01

    We report the first example of microcantilever beams that are reversibly driven by protein thin film machines fueled by cycling the salt concentration of the surrounding solution. We also show that upon the same salinity stimulus the drive can be completely reversed in its direction by introducing a surface coating ligand. Experimental results are throughout discussed within a general yet simple thermodynamic model.

  10. Protein Crystal Bovine Insulin

    NASA Technical Reports Server (NTRS)

    1991-01-01

    The comparison of protein crystal, Bovine Insulin space-grown (left) and earth-grown (right). Facilitates the incorporation of glucose into cells. In diabetics, there is either a decrease in or complete lack of insulin, thereby leading to several harmful complications. Principal Investigator is Larry DeLucas.

  11. 24-hour urine protein

    MedlinePlus

    ... your doctor may be able to order a test that is done on just one urine sample (protein-to-creatinine ratio). Normal Results The normal value is less than 100 milligrams per day or less than 10 milligrams per deciliter ... of these tests. Normal value ranges may vary slightly among different ...

  12. Protein Requirements during Aging

    PubMed Central

    Courtney-Martin, Glenda; Ball, Ronald O.; Pencharz, Paul B.; Elango, Rajavel

    2016-01-01

    Protein recommendations for elderly, both men and women, are based on nitrogen balance studies. They are set at 0.66 and 0.8 g/kg/day as the estimated average requirement (EAR) and recommended dietary allowance (RDA), respectively, similar to young adults. This recommendation is based on single linear regression of available nitrogen balance data obtained at test protein intakes close to or below zero balance. Using the indicator amino acid oxidation (IAAO) method, we estimated the protein requirement in young adults and in both elderly men and women to be 0.9 and 1.2 g/kg/day as the EAR and RDA, respectively. This suggests that there is no difference in requirement on a gender basis or on a per kg body weight basis between younger and older adults. The requirement estimates however are ~40% higher than the current protein recommendations on a body weight basis. They are also 40% higher than our estimates in young men when calculated on the basis of fat free mass. Thus, current recommendations may need to be re-assessed. Potential rationale for this difference includes a decreased sensitivity to dietary amino acids and increased insulin resistance in the elderly compared with younger individuals. PMID:27529275

  13. Cellulose binding domain proteins

    DOEpatents

    Shoseyov, O.; Shpiegl, I.; Goldstein, M.; Doi, R.

    1998-11-17

    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques. 16 figs.

  14. Protein crystal growth

    NASA Technical Reports Server (NTRS)

    2001-01-01

    Atomic force microscopy uses laser technology to reveal a defect, a double-screw dislocation, on the surface of this crystal of canavalin, a major source of dietary protein for humans and domestic animals. When a crystal grows, attachment kinetics and transport kinetics are competing for control of the molecules. As a molecule gets close to the crystal surface, it has to attach properly for the crystal to be usable. NASA has funded investigators to look at those attachment kinetics from a theoretical standpoint and an experimental standpoint. Dr. Alex McPherson of the University of California, Irvine, is one of those investigators. He uses X-ray diffraction and atomic force microscopy in his laboratory to answer some of the many questions about how protein crystals grow. Atomic force microscopy provides a means of looking at how individual molecules are added to the surface of growing protein crystals. This helps McPherson understand the kinetics of protein crystal growth. McPherson asks, How fast do crystals grow? What are the forces involved? Investigators funded by NASA have clearly shown that such factors as the level of supersaturation and the rate of growth all affect the habit [characteristic arrangement of facets] of the crystal and the defects that occur in the crystal.

  15. Protein specific polymeric immunomicrospheres

    NASA Technical Reports Server (NTRS)

    Rembaum, Alan (Inventor); Yen, Shiao-Ping S. (Inventor); Dreyer, William J. (Inventor)

    1980-01-01

    Small, round, bio-compatible microspheres capable of covalently bonding proteins and having a uniform diameter below about 3500 A are prepared by substantially instantaneously initiating polymerization of an aqueous emulsion containing no more than 35% total monomer including an acrylic monomer substituted with a covalently bondable group such as hydroxyl, amino or carboxyl and a minor amount of a cross-linking agent.

  16. Protein-protein interactions: methods for detection and analysis.

    PubMed Central

    Phizicky, E M; Fields, S

    1995-01-01

    The function and activity of a protein are often modulated by other proteins with which it interacts. This review is intended as a practical guide to the analysis of such protein-protein interactions. We discuss biochemical methods such as protein affinity chromatography, affinity blotting, coimmunoprecipitation, and cross-linking; molecular biological methods such as protein probing, the two-hybrid system, and phage display: and genetic methods such as the isolation of extragenic suppressors, synthetic mutants, and unlinked noncomplementing mutants. We next describe how binding affinities can be evaluated by techniques including protein affinity chromatography, sedimentation, gel filtration, fluorescence methods, solid-phase sampling of equilibrium solutions, and surface plasmon resonance. Finally, three examples of well-characterized domains involved in multiple protein-protein interactions are examined. The emphasis of the discussion is on variations in the approaches, concerns in evaluating the results, and advantages and disadvantages of the techniques. PMID:7708014

  17. Monobodies and other synthetic binding proteins for expanding protein science.

    PubMed

    Sha, Fern; Salzman, Gabriel; Gupta, Ankit; Koide, Shohei

    2017-03-01

    Synthetic binding proteins are constructed using nonantibody molecular scaffolds. Over the last two decades, in-depth structural and functional analyses of synthetic binding proteins have improved combinatorial library designs and selection strategies, which have resulted in potent platforms that consistently generate binding proteins to diverse targets with affinity and specificity that rival those of antibodies. Favorable attributes of synthetic binding proteins, such as small size, freedom from disulfide bond formation and ease of making fusion proteins, have enabled their unique applications in protein science, cell biology and beyond. Here, we review recent studies that illustrate how synthetic binding proteins are powerful probes that can directly link structure and function, often leading to new mechanistic insights. We propose that synthetic proteins will become powerful standard tools in diverse areas of protein science, biotechnology and medicine.

  18. Production of specific antibodies against protein A fusion proteins.

    PubMed Central

    Löwenadler, B; Nilsson, B; Abrahmsén, L; Moks, T; Ljungqvist, L; Holmgren, E; Paleus, S; Josephson, S; Philipson, L; Uhlén, M

    1986-01-01

    The gene for Staphylococcal protein A was fused to the coding sequence of bacterial beta-galactosidase, alkaline phosphatase and human insulin-like growth factor I (IGF-I). The fusion proteins, expressed in bacteria, were purified by affinity chromatography on IgG-Sepharose and antibodies were raised in rabbits. All three fusion proteins elicited specific antibodies against both the inserted protein sequences and the protein A moiety. In the case of IGF-I, the protein A moiety in the fusion protein may act as an adjuvant since native IGF-I alone is a poor immunogen. The results suggest that the protein A fusion system can be used for efficient antibody production against peptides or proteins expressed from cloned or synthetic genes. To facilitate such gene fusions a set of optimized vectors have been constructed. Images Fig. 2. Fig. 3. Fig. 4. Fig. 6. PMID:3096719

  19. Accessory proteins for heterotrimeric G-proteins in the kidney

    PubMed Central

    Park, Frank

    2015-01-01

    Heterotrimeric G-proteins play a fundamentally important role in regulating signal transduction pathways in the kidney. Accessory proteins are being identified as direct binding partners for heterotrimeric G-protein α or βγ subunits to promote more diverse mechanisms by which G-protein signaling is controlled. In some instances, accessory proteins can modulate the signaling magnitude, localization, and duration following the activation of cell membrane-associated receptors. Alternatively, accessory proteins complexed with their G-protein α or βγ subunits can promote non-canonical models of signaling activity within the cell. In this review, we will highlight the expression profile, localization and functional importance of these newly identified accessory proteins to control the function of select G-protein subunits under normal and various disease conditions observed in the kidney. PMID:26300785

  20. Exploring NMR ensembles of calcium binding proteins: Perspectives to design inhibitors of protein-protein interactions

    PubMed Central

    2011-01-01

    Background Disrupting protein-protein interactions by small organic molecules is nowadays a promising strategy employed to block protein targets involved in different pathologies. However, structural changes occurring at the binding interfaces make difficult drug discovery processes using structure-based drug design/virtual screening approaches. Here we focused on two homologous calcium binding proteins, calmodulin and human centrin 2, involved in different cellular functions via protein-protein interactions, and known to undergo important conformational changes upon ligand binding. Results In order to find suitable protein conformations of calmodulin and centrin for further structure-based drug design/virtual screening, we performed in silico structural/energetic analysis and molecular docking of terphenyl (a mimicking alpha-helical molecule known to inhibit protein-protein interactions of calmodulin) into X-ray and NMR ensembles of calmodulin and centrin. We employed several scoring methods in order to find the best protein conformations. Our results show that docking on NMR structures of calmodulin and centrin can be very helpful to take into account conformational changes occurring at protein-protein interfaces. Conclusions NMR structures of protein-protein complexes nowadays available could efficiently be exploited for further structure-based drug design/virtual screening processes employed to design small molecule inhibitors of protein-protein interactions. PMID:21569443

  1. Protein Molecular Structures, Protein SubFractions, and Protein Availability Affected by Heat Processing: A Review

    SciTech Connect

    Yu,P.

    2007-01-01

    The utilization and availability of protein depended on the types of protein and their specific susceptibility to enzymatic hydrolysis (inhibitory activities) in the gastrointestine and was highly associated with protein molecular structures. Studying internal protein structure and protein subfraction profiles leaded to an understanding of the components that make up a whole protein. An understanding of the molecular structure of the whole protein was often vital to understanding its digestive behavior and nutritive value in animals. In this review, recently obtained information on protein molecular structural effects of heat processing was reviewed, in relation to protein characteristics affecting digestive behavior and nutrient utilization and availability. The emphasis of this review was on (1) using the newly advanced synchrotron technology (S-FTIR) as a novel approach to reveal protein molecular chemistry affected by heat processing within intact plant tissues; (2) revealing the effects of heat processing on the profile changes of protein subfractions associated with digestive behaviors and kinetics manipulated by heat processing; (3) prediction of the changes of protein availability and supply after heat processing, using the advanced DVE/OEB and NRC-2001 models, and (4) obtaining information on optimal processing conditions of protein as intestinal protein source to achieve target values for potential high net absorbable protein in the small intestine. The information described in this article may give better insight in the mechanisms involved and the intrinsic protein molecular structural changes occurring upon processing.

  2. An evaluation of in vitro protein-protein interaction techniques: assessing contaminating background proteins.

    PubMed

    Howell, Jenika M; Winstone, Tara L; Coorssen, Jens R; Turner, Raymond J

    2006-04-01

    Determination of protein-protein interactions is an important component in assigning function and discerning the biological relevance of proteins within a broader cellular context. In vitro protein-protein interaction methodologies, including affinity chromatography, coimmunoprecipitation, and newer approaches such as protein chip arrays, hold much promise in the detection of protein interactions, particularly in well-characterized organisms with sequenced genomes. However, each of these approaches attracts certain background proteins that can thwart detection and identification of true interactors. In addition, recombinant proteins expressed in Escherichia coli are also extensively used to assess protein-protein interactions, and background proteins in these isolates can thus contaminate interaction studies. Rigorous validation of a true interaction thus requires not only that an interaction be found by alternate techniques, but more importantly that researchers be aware of and control for matrix/support dependence. Here, we evaluate these methods for proteins interacting with DmsD (an E. coli redox enzyme maturation protein chaperone), in vitro, using E. coli subcellular fractions as prey sources. We compare and contrast the various in vitro interaction methods to identify some of the background proteins and protein profiles that are inherent to each of the methods in an E. coli system.

  3. Direct Probing of Protein-Protein Interactions

    SciTech Connect

    Noy, A; Sulchek, T A; Friddle, R W

    2005-03-10

    This project aimed to establish feasibility of using experimental techniques based on direct measurements of interaction forces on the single molecule scale to characterize equilibrium interaction potentials between individual biological molecules. Such capability will impact several research areas, ranging from rapid interaction screening capabilities to providing verifiable inputs for computational models. It should be one of the enabling technologies for modern proteomics research. This study used a combination of Monte-Carlo simulations, theoretical considerations, and direct experimental measurements to investigate two model systems that represented typical experimental situations: force-induced melting of DNA rigidly attached to the tip, and force-induced unbinding of a protein-antibody pair connected to flexible tethers. Our results establish that for both systems researchers can use force spectroscopy measurements to extract reliable information about equilibrium interaction potentials. However, the approaches necessary to extract these potentials in each case--Jarzynski reconstruction and Dynamic Force Spectroscopy--are very different. We also show how the thermodynamics and kinetics of unbinding process dictates the choice between in each case.

  4. Septins: Regulators of Protein Stability

    PubMed Central

    Vagin, Olga; Beenhouwer, David O.

    2016-01-01

    Septins are small GTPases that play a role in several important cellular processes. In this review, we focus on the roles of septins in protein stabilization. Septins may regulate protein stability by: (1) interacting with proteins involved in degradation pathways, (2) regulating the interaction between transmembrane proteins and cytoskeletal proteins, (3) affecting the mobility of transmembrane proteins in lipid bilayers, and (4) modulating the interaction of proteins with their adaptor or signaling proteins. In this context, we discuss the role of septins in protecting four different proteins from degradation. First we consider botulinum neurotoxin serotype A (BoNT/A) and the contribution of septins to its extraordinarily long intracellular persistence. Next, we discuss the role of septins in stabilizing the receptor tyrosine kinases EGFR and ErbB2. Finally, we consider the contribution of septins in protecting hypoxia-inducible factor 1α (HIF-1α) from degradation. PMID:28066764

  5. The quality of microparticulated protein.

    PubMed

    Erdman, J W

    1990-08-01

    The purpose of this paper is to describe the effects of microparticulation upon the quality of microparticulated protein products and to confirm that microparticulation does not result in changes in protein structure or quality different from those that occur with cooking. Two products were tested: microparticulated egg white and skim milk proteins and microparticulated whey protein concentrate. Three approaches were used to monitor for changes in amino acid and protein value: amino acid analysis, protein efficiency ratio (PER) bioassay, and both one- and two-dimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis. Evaluation of the results of these tests indicates that no significant differences were found when comparing the premix before and after microparticulation. Significant differences also did not occur when the premix was cooked using conventional methods. Collectively, the data provide strong evidence that the protein microparticulation process used to prepare microparticulated protein products (e.g., Simplesse) does not alter the quality or nutritional value of protein in the final products.

  6. Dissecting protein-protein interactions using directed evolution.

    PubMed

    Bonsor, Daniel A; Sundberg, Eric J

    2011-04-05

    Protein-protein interactions are essential for life. They are responsible for most cellular functions and when they go awry often lead to disease. Proteins are inherently complex. They are flexible macromolecules whose constituent amino acid components act in combinatorial and networked ways when they engage one another in binding interactions. It is just this complexity that allows them to conduct such a broad array of biological functions. Despite decades of intense study of the molecular basis of protein-protein interactions, key gaps in our understanding remain, hindering our ability to accurately predict the specificities and affinities of their interactions. Until recently, most protein-protein investigations have been probed experimentally at the single-amino acid level, making them, by definition, incapable of capturing the combinatorial nature of, and networked communications between, the numerous residues within and outside of the protein-protein interface. This aspect of protein-protein interactions, however, is emerging as a major driving force for protein affinity and specificity. Understanding a combinatorial process necessarily requires a combinatorial experimental tool. Much like the organisms in which they reside, proteins naturally evolve over time, through a combinatorial process of mutagenesis and selection, to functionally associate. Elucidating the process by which proteins have evolved may be one of the keys to deciphering the molecular rules that govern their interactions with one another. Directed evolution is a technique performed in the laboratory that mimics natural evolution on a tractable time scale that has been utilized widely to engineer proteins with novel capabilities, including altered binding properties. In this review, we discuss directed evolution as an emerging tool for dissecting protein-protein interactions.

  7. 14-3-3 proteins: regulators of numerous eukaryotic proteins.

    PubMed

    van Heusden, G Paul H

    2005-09-01

    14-3-3 proteins form a family of highly conserved proteins capable of binding to more than 200 different mostly phosphorylated proteins. They are present in all eukaryotic organisms investigated, often in multiple isoforms, up to 13 in some plants. 14-3-3 binding partners are involved in almost every cellular process and 14-3-3 proteins play a key role in these processes. 14-3-3 proteins interact with products encoded by oncogenes, with filament forming proteins involved in Alzheimer'ss disease and many other proteins related to human diseases. Disturbance of the interactions with 14-3-3 proteins may lead to diseases like cancer and the neurological Miller-Dieker disease. The molecular consequences of 14-3-3 binding are diverse and only partly understood. Binding of a protein to a 14-3-3 protein may result in stabilization of the active or inactive phosphorylated form of the protein, to a conformational alteration leading to activation or inhibition, to a different subcellular localization or to the interaction with other proteins. Currently genome- and proteome-wide studies are contributing to a wider knowledge of this important family of proteins.

  8. Quantification of the Influence of Protein-Protein Interactions on Adsorbed Protein Structure and Bioactivity

    PubMed Central

    Wei, Yang; Thyparambil, Aby A.; Latour, Robert A.

    2013-01-01

    While protein-surface interactions have been widely studied, relatively little is understood at this time regarding how protein-surface interaction effects are influenced by protein-protein interactions and how these effects combine with the internal stability of a protein to influence its adsorbed-state structure and bioactivity. The objectives of this study were to develop a method to study these combined effects under widely varying protein-protein interaction conditions using hen egg-white lysozyme (HEWL) adsorbed on silica glass, poly(methyl methacrylate), and polyethylene as our model systems. In order to vary protein-protein interaction effects over a wide range, HEWL was first adsorbed to each surface type under widely varying protein solution concentrations for 2 h to saturate the surface, followed by immersion in pure buffer solution for 15 h to equilibrate the adsorbed protein layers in the absence of additionally adsorbing protein. Periodic measurements were made at selected time points of the areal density of the adsorbed protein layer as an indicator of the level of protein-protein interaction effects within the layer, and these values were then correlated with measurements of the adsorbed protein’s secondary structure and bioactivity. The results from these studies indicate that protein-protein interaction effects help stabilize the structure of HEWL adsorbed on silica glass, have little influence on the structural behavior of HEWL on HDPE, and actually serve to destabilize HEWL’s structure on PMMA. The bioactivity of HEWL on silica glass and HDPE was found to decrease in direct proportion to the degree of adsorption-induce protein unfolding. A direct correlation between bioactivity and the conformational state of adsorbed HEWL was less apparent on PMMA, thus suggesting that other factors influenced HEWL’s bioactivity on this surface, such as the accessibility of HEWL’s bioactive site being blocked by neighboring proteins or the surface

  9. Hydrogels Constructed from Engineered Proteins.

    PubMed

    Li, Hongbin; Kong, Na; Laver, Bryce; Liu, Junqiu

    2016-02-24

    Due to their various potential biomedical applications, hydrogels based on engineered proteins have attracted considerable interest. Benefitting from significant progress in recombinant DNA technology and protein engineering/design techniques, the field of protein hydrogels has made amazing progress. The latest progress of hydrogels constructed from engineered recombinant proteins are presented, mainly focused on biorecognition-driven physical hydrogels as well as chemically crosslinked hydrogels. The various bio-recognition based physical crosslinking strategies are discussed, as well as chemical crosslinking chemistries used to engineer protein hydrogels, and protein hydrogels' various biomedical applications. The future perspectives of this fast evolving field of biomaterials are also discussed.

  10. Protein misfolding disorders and macroautophagy

    PubMed Central

    Menzies, Fiona M; Moreau, Kevin; Rubinsztein, David C

    2011-01-01

    A large group of diseases, termed protein misfolding disorders, share the common feature of the accumulation of misfolded proteins. The possibility of a common mechanism underlying either the pathogenesis or therapy for these diseases is appealing. Thus, there is great interest in the role of protein degradation via autophagy in such conditions where the protein is found in the cytoplasm. Here we review the growing evidence supporting a role for autophagic dysregulation as a contributing factor to protein accumulation and cellular toxicity in certain protein misfolding disorders and discuss the available evidence that upregulation of autophagy may be a valuable therapeutic strategy. PMID:21087849

  11. Redox control of protein degradation

    PubMed Central

    Pajares, Marta; Jiménez-Moreno, Natalia; Dias, Irundika H.K.; Debelec, Bilge; Vucetic, Milica; Fladmark, Kari E.; Basaga, Huveyda; Ribaric, Samo; Milisav, Irina; Cuadrado, Antonio

    2015-01-01

    Intracellular proteolysis is critical to maintain timely degradation of altered proteins including oxidized proteins. This review attempts to summarize the most relevant findings about oxidant protein modification, as well as the impact of reactive oxygen species on the proteolytic systems that regulate cell response to an oxidant environment: the ubiquitin-proteasome system (UPS), autophagy and the unfolded protein response (UPR). In the presence of an oxidant environment, these systems are critical to ensure proteostasis and cell survival. An example of altered degradation of oxidized proteins in pathology is provided for neurodegenerative diseases. Future work will determine if protein oxidation is a valid target to combat proteinopathies. PMID:26381917

  12. Biological Applications of Protein Splicing

    PubMed Central

    Vila-Perelló, Miquel; Muir, Tom W.

    2010-01-01

    Protein splicing is a naturally-occurring process in which a protein editor, called an intein, performs a molecular disappearing act by cutting itself out of a host protein in a traceless manner. In the two decades since its discovery, protein splicing has been harnessed for the development of several protein-engineering methods. Collectively, these technologies help bridge the fields of chemistry and biology, allowing hitherto impossible manipulations of protein covalent structure. These tools and their application are the subject of this Primer. PMID:20946979

  13. Misfolded Proteins and Retinal Dystrophies

    PubMed Central

    Lin, Jonathan H.; LaVail, Matthew M.

    2010-01-01

    Many mutations associated with retinal degeneration lead to the production of misfolded proteins by cells of the retina. Emerging evidence suggests that these abnormal proteins cause cell death by activating the Unfolded Protein Response, a set of conserved intracellular signaling pathways that detect protein misfolding within the endoplasmic reticulum and control protective and proapoptotic signal transduction pathways. Here, we review the misfolded proteins associated with select types of retinitis pigmentosa, Stargadt-like macular degeneration, and Doyne Honeycomb Retinal Dystrophy and discuss the role that endoplasmic reticulum stress and UPR signaling play in their pathogenesis. Last, we review new therapies for these diseases based on preventing protein misfolding in the retina. PMID:20238009

  14. In vivo selection of Enterobacter aerogenes with reduced susceptibility to cefepime and carbapenems associated with decreased expression of a 40 kDa outer membrane protein and hyperproduction of AmpC beta-lactamase.

    PubMed

    Fernández-Cuenca, Felipe; Rodríguez-Martínez, Jose Manuel; Martínez-Martínez, Luis; Pascual, Alvaro

    2006-06-01

    The mechanism(s) of resistance or decreased susceptibility to cefepime (FEP) and/or imipenem (IMP) in three consecutive isolates of Enterobacter aerogenes (Ea1, Ea2 and Ea3) cultured from bronchial aspirates of the same patient after treatment with ceftriaxone and FEP were studied. Identification was performed with the VITEK 2 system. All three isolates showed identical pulsed-field gel electrophoresis patterns and were resistant (minimum inhibitory concentrations (MICs)) to cefoxitin (MIC, >1024 mg/L), cefotaxime (CTX; MIC, 32-128 mg/L) and ceftazidime (CAZ; MIC, 32-128 mg/L) but susceptible to meropenem (MIC, IMP were Glu. Three outer membrane proteins (OMPs) of 51 k

  15. Functionalizing Microporous Membranes for Protein Purification and Protein Digestion.

    PubMed

    Dong, Jinlan; Bruening, Merlin L

    2015-01-01

    This review examines advances in the functionalization of microporous membranes for protein purification and the development of protease-containing membranes for controlled protein digestion prior to mass spectrometry analysis. Recent studies confirm that membranes are superior to bead-based columns for rapid protein capture, presumably because convective mass transport in membrane pores rapidly brings proteins to binding sites. Modification of porous membranes with functional polymeric films or TiO₂ nanoparticles yields materials that selectively capture species ranging from phosphopeptides to His-tagged proteins, and protein-binding capacities often exceed those of commercial beads. Thin membranes also provide a convenient framework for creating enzyme-containing reactors that afford control over residence times. With millisecond residence times, reactors with immobilized proteases limit protein digestion to increase sequence coverage in mass spectrometry analysis and facilitate elucidation of protein structures. This review emphasizes the advantages of membrane-based techniques and concludes with some challenges for their practical application.

  16. Functionalizing Microporous Membranes for Protein Purification and Protein Digestion

    NASA Astrophysics Data System (ADS)

    Dong, Jinlan; Bruening, Merlin L.

    2015-07-01

    This review examines advances in the functionalization of microporous membranes for protein purification and the development of protease-containing membranes for controlled protein digestion prior to mass spectrometry analysis. Recent studies confirm that membranes are superior to bead-based columns for rapid protein capture, presumably because convective mass transport in membrane pores rapidly brings proteins to binding sites. Modification of porous membranes with functional polymeric films or TiO2 nanoparticles yields materials that selectively capture species ranging from phosphopeptides to His-tagged proteins, and protein-binding capacities often exceed those of commercial beads. Thin membranes also provide a convenient framework for creating enzyme-containing reactors that afford control over residence times. With millisecond residence times, reactors with immobilized proteases limit protein digestion to increase sequence coverage in mass spectrometry analysis and facilitate elucidation of protein structures. This review emphasizes the advantages of membrane-based techniques and concludes with some challenges for their practical application.

  17. Statistical analysis and prediction of protein-protein interfaces.

    PubMed

    Bordner, Andrew J; Abagyan, Ruben

    2005-08-15

    Predicting protein-protein interfaces from a three-dimensional structure is a key task of computational structural proteomics. In contrast to geometrically distinct small molecule binding sites, protein-protein interface are notoriously difficult to predict. We generated a large nonredundant data set of 1494 true protein-protein interfaces using biological symmetry annotation where necessary. The data set was carefully analyzed and a Support Vector Machine was trained on a combination of a new robust evolutionary conservation signal with the local surface properties to predict protein-protein interfaces. Fivefold cross validation verifies the high sensitivity and selectivity of the model. As much as 97% of the predicted patches had an overlap with the true interface patch while only 22% of the surface residues were included in an average predicted patch. The model allowed the identification of potential new interfaces and the correction of mislabeled oligomeric states.

  18. Mx proteins: antiviral proteins by chance or by necessity?

    PubMed

    Arnheiter, H; Meier, E

    1990-10-01

    The interferon-inducible Mx1 protein is responsible for inborn resistance of mice to influenza. It is now recognized that this protein is a member of a family of interferon-inducible, putative GTP-binding proteins found in many organisms. Thus, these proteins, called the Mx proteins, are found in species that are naturally infected with influenza virus, and also in species that are not. Some Mx proteins display a broader antiviral profile than the one observed for Mx1 in mice. Others, however, may not be antiviral. Two recently discovered GTP-binding proteins, Vps1p in yeast and dynamin in rat, are also related to Mx1. These proteins are synthesized constitutively and serve basic cellular functions.

  19. Collaborative protein filaments.

    PubMed

    Ghosal, Debnath; Löwe, Jan

    2015-09-14

    It is now well established that prokaryotic cells assemble diverse proteins into dynamic cytoskeletal filaments that perform essential cellular functions. Although most of the filaments assemble on their own to form higher order structures, growing evidence suggests that there are a number of prokaryotic proteins that polymerise only in the presence of a matrix such as DNA, lipid membrane or even another filament. Matrix-assisted filament systems are frequently nucleotide dependent and cytomotive but rarely considered as part of the bacterial cytoskeleton. Here, we categorise this family of filament-forming systems as collaborative filaments and introduce a simple nomenclature. Collaborative filaments are frequent in both eukaryotes and prokaryotes and are involved in vital cellular processes including chromosome segregation, DNA repair and maintenance, gene silencing and cytokinesis to mention a few. In this review, we highlight common principles underlying collaborative filaments and correlate these with known functions.

  20. Protein engineering of subtilisin.

    PubMed

    Bryan, P N

    2000-12-29

    The serine protease subtilisin is an important industrial enzyme as well as a model for understanding the enormous rate enhancements affected by enzymes. For these reasons along with the timely cloning of the gene, ease of expression and purification and availability of atomic resolution structures, subtilisin became a model system for protein engineering studies in the 1980s. Fifteen years later, mutations in well over 50% of the 275 amino acids of subtilisin have been reported in the scientific literature. Most subtilisin engineering has involved catalytic amino acids, substrate binding regions and stabilizing mutations. Stability has been the property of subtilisin which has been most amenable to enhancement, yet perhaps least understood. This review will give a brief overview of the subtilisin engineering field, critically review what has been learned about subtilisin stability from protein engineering experiments and conclude with some speculation about the prospects for future subtilisin engineering.