Sample records for mrna-binding proteins imps

  1. IMP1, an mRNA binding protein that reduces the metastatic potential of breast cancer in a mouse model

    PubMed Central

    Nwokafor, Chiso U.; Sellers, Rani S.; Singer, Robert H.


    Cells that are able to localize β-actin mRNA efficiently have decreased metastatic potential. Invasive carcinoma cells derived from primary mammary tumors have reduced levels of an RNA binding protein IMP1/ZBP1/IGF2BP1, required for β-actin mRNA localization. We showed previously that in human breast carcinoma cells in vitro, this protein suppresses invasion. In this work we examined whether its re-expression can suppress breast cancer metastasis in a breast cancer mouse model. We developed a mouse conditionally expressing IMP1-GFP (hereinafter referred to as the IMP1 transgene) specifically in the mammary gland of a PYMT breast cancer mouse. We found that mice conditionally expressing the IMP1 transgene showed little or no metastases to the lungs from the primary tumor in contrast to PYMT mice not expressing IMP1, which uniformly develop metastases at an early stage. PMID:27655671

  2. High-throughput fluorescence anisotropy screen for inhibitors of the oncogenic mRNA binding protein, IMP-1.


    Mahapatra, Lily; Mao, Chengjian; Andruska, Neal; Zhang, Chen; Shapiro, David J


    Cancer cell proliferation is regulated by oncogenes, such as c-Myc. An alternative approach to directly targeting individual oncogenes is to target IMP-1, an oncofetal protein that binds to and stabilizes messenger RNAs (mRNAs), leading to elevated expression of c-Myc and other oncogenes. Expression of IMP-1 is tightly correlated with a poor prognosis and reduced survival in ovarian, lung, and colon cancer. Small-molecule inhibitors of IMP-1 have not been reported. We established a fluorescence anisotropy/polarization microplate assay (FAMA) for analyzing binding of IMP-1 to a fluorescein-labeled 93 nucleotide c-Myc mRNA target (flMyc), developed the assay as a highly robust (Z' factor = 0.60) FAMA-based high-throughput screen for inhibitors of binding of IMP-1 to flMyc, and carried out a successful pilot screen of 17,600 small molecules. Our studies support rapidly filtering out toxic nonspecific inhibitors using an early cell-based assay in control cells lacking the target protein. The physiologic importance of verified hits from the in vitro high-throughput screen was demonstrated by identification of the first small-molecule IMP-1 inhibitor, a lead compound that selectively inhibits proliferation of IMP-1-positive cancer cells with very little or no effect on proliferation of IMP-1-negative cells.

  3. Insulin-like growth factor mRNA binding protein 3 (IMP3) is differentially expressed in benign and malignant follicular patterned thyroid tumors.


    Slosar, Magdalena; Vohra, Poonam; Prasad, Manju; Fischer, Andrew; Quinlan, Robert; Khan, Ashraf


    Insulin-like growth factor mRNA binding protein 3 (IMP3) is an mRNA-binding protein that regulates transcription of insulin-like growth factor II affecting cell proliferation during embryogenesis. It is highly expressed in carcinomas of the pancreas, stomach, colon, rectum, kidneys, uterine cervix, lung, and ovary. The purpose of our study was to evaluate IMP3 expression in thyroid follicular lesions, to determine whether it has a role in differentiating among these lesions, and to understand their biological relationships. We immunostained 219 thyroid lesions selected from our surgical pathology archives including 14 hyperplastic colloid nodules (CN), 19 Hashimoto's thyroiditis (HT), two Graves disease (GD), ten Hürthle cell adenoma (HCA), 20 follicular adenoma (FA), 37 conventional papillary thyroid carcinoma (PTC), 60 follicular variant of papillary carcinoma (FVPC), 19 Hürthle cell carcinoma (HCC), 32 follicular carcinoma (FC), and six poorly differentiated/anaplastic carcinoma. Immunohistochemistry was performed on formalin-fixed sections using monoclonal antibody to IMP3. Clinicopathological data were also reviewed. In all cases, residual thyroid tissue, CN, HT, GD, HCA, and FA were completely negative for IMP3 staining. Of the 60 FVPC, 23 tumors (38%) were positive for IMP3, with 13 of these (22%) showing very strong staining (3+). Of the 32 FC, 22 tumors (69%) were positive, with seven (22%) showing very strong staining (3+). Furthermore, 33 out of 37 cases (89%) of PTC were negative for IMP3. In all four PTC cases that did stain positive, staining was weak-moderate (1-2+). Similarly, 15 out of 19 cases (79%) of HCC were negative. No significant correlation was found between pathologic tumor characteristics and IMP3 expression in differentiated follicular pattern thyroid carcinoma. With 100% specificity and 69% sensitivity for FC as compared to FA and 100% specificity for FVPC, again compared to FA, IMP3 has the potential to be diagnostically useful in

  4. Prognostic value of insulin-like growth factor II mRNA binding protein 3 in patients treated with radical prostatectomy.


    Chromecki, Thomas F; Cha, Eugene K; Pummer, Karl; Scherr, Douglas S; Tewari, Ashutosh K; Sun, Maxine; Fajkovic, Harun; Roehrborn, Claus G; Ashfaq, Raheela; Karakiewicz, Pierre I; Shariat, Shahrokh F


    Study Type - Prognosis (case series) Level of Evidence 4 What's known on the subject? and What does the study add? Insulin-like growth factor II mRNA binding protein 3 (IMP3) is associated with poor outcomes in a variety of malignancies. The role of IMP3 in protate cancer remains poorly understood. IMP3 expression was associated with features of aggressive biology and aggressive prostate cancer recurrence after surgery. Although IMP3 is differentially expressed in patients with features of biologically aggressive prostate cancer, it does not have independent prognostic value in patients treated with RP. To evaluate the association of insulin-like growth factor II mRNA binding protein 3 (IMP3) with pathological features and outcomes in patients treated with radical prostatectomy (RP). Immunohistochemical staining for IMP3 was performed on archival tissue microarray specimens from 232 consecutive patients treated with RP for clinically localized disease. None of the patients received neoadjuvant or adjuvant radiation or hormone therapy. IMP3 expression was histologically categorized as normal or abnormal. Disease recurrence was classified as aggressive if metastases were present, post-recurrence prostate-specific antigen (PSA) doubling time was less than 10 months, or if the patients failed to respond to salvage local radiation therapy. The median follow-up was 69.8 months (interquartile range [IQR]: 40.1-99.5). IMP3 expression was abnormal in 42 (18.1%) of 232 patients. IMP3 expression was associated with extracapsular extension (P= 0.020), seminal vesicle invasion (P= 0.024), lymphovascular invasion (P= 0.036) and a high pathological Gleason score (P= 0.009). The 5-year PSA recurrence-free survival for IMP3-negative patients was 83% (standard error [SE]= 3) vs 67% (SE = 8) in IMP3-positive patients (log-rank test, P= 0.015). In a multivariable analysis that adjusted for the effects of surgical margins, extracapsular extension and seminal vesicle invasion, PSA

  5. Ribosomes lacking protein S20 are defective in mRNA binding and subunit association.


    Tobin, Christina; Mandava, Chandra Sekhar; Ehrenberg, Måns; Andersson, Dan I; Sanyal, Suparna


    The functional significance of ribosomal proteins is still relatively unclear. Here, we examined the role of small subunit protein S20 in translation using both in vivo and in vitro techniques. By means of lambda red recombineering, the rpsT gene, encoding S20, was removed from the chromosome of Salmonella enterica var. Typhimurium LT2 to produce a DeltaS20 strain that grew markedly slower than the wild type while maintaining a wild-type rate of peptide elongation. Removal of S20 conferred a significant reduction in growth rate that was eliminated upon expression of the rpsT gene on a high-copy-number plasmid. The in vitro phenotype of mutant ribosomes was investigated using a translation system composed of highly active, purified components from Escherichia coli. Deletion of S20 conferred two types of initiation defects to the 30S subunit: (i) a significant reduction in the rate of mRNA binding and (ii) a drastic decrease in the yield of 70S complexes caused by an impairment in association with the 50S subunit. Both of these impairments were partially relieved by an extended incubation time with mRNA, fMet-tRNA(fMet), and initiation factors, indicating that absence of S20 disturbs the structural integrity of 30S subunits. Considering the topographical location of S20 in complete 30S subunits, the molecular mechanism by which it affects mRNA binding and subunit docking is not entirely obvious. We speculate that its interaction with helix 44 of the 16S ribosomal RNA is crucial for optimal ribosome function. Copyright 2010 Elsevier Ltd. All rights reserved.

  6. Engineered proteins with Pumilio/fem-3 mRNA binding factor scaffold to manipulate RNA metabolism.


    Wang, Yang; Wang, Zefeng; Tanaka Hall, Traci M


    Pumilio/fem-3 mRNA binding factor proteins are characterized by a sequence-specific RNA-binding domain. This unique single-stranded RNA recognition module, whose sequence specificity can be reprogrammed, has been fused with functional modules to engineer protein factors with various functions. We summarize the advances made with respect to developing RNA regulatory tools, as well as opportunities for the future.

  7. Cytoplasmic-nuclear shuttling of the urokinase mRNA binding protein regulates message stability.


    Shetty, Sreerama


    Treatment of small airway epithelial (SAEC) cells or lung epithelial (Beas2B) cells with TNF-alpha or PMA induces urokinase-type plasminogen activator (uPA) expression. Treatment of these cells with TNF-alpha, PMA or cycloheximide but not TGF-beta increased steady-state expression of uPAmRNA. TNF-alpha, PMA or cycloheximide caused 8-10 fold extensions of the uPAmRNA half-life in SAEC or Beas2B cells treated with DRB, a transcriptional inhibitor. These findings suggest that uPA gene expression involves a post-transcriptional regulatory mechanism. Using gel mobility shift and UV cross-linking assays, we identified a 30 kDa uPA mRNA binding protein (uPA mRNABp) that selectively binds to a 66 nt protein binding fragment of uPA mRNA containing regulatory information for message stabilization. Binding of cytoplasmic uPA mRNABp to uPA mRNA was abolished after treatment with TNF-alpha but not TGF-beta. In addition, we found the accumulation of 30 kDa uPAmRNABp in the nuclear extracts of TNF-alpha but not TGF-beta treated cells. The uPA mRNABp starts moving to the nucleus from the cytoplasmic compartment as early as three hours after TNF-alpha treatment. Complete translocation is achieved between 12-24 h, which coincides with the maximal expression of uPA protein effected by cytokine stimulation. Treatment of Beas2B cells with NaF inhibited TNF-alpha-mediated translocation of uPA mRNABp from the cytoplasm to the nucleus and concomitant inhibition of uPA expression. TNF-alpha stabilizes uPA mRNA by translocating the uPA mRNABp from the cytoplasm to the nucleus. Our results demonstrate a novel mechanism governing uPA mRNA stability through shuttling of uPA mRNABp between the nucleus and cytoplasm. This newly identified pathway may have evolved to regulate uPA-mediated functions of the lung epithelium in inflamation or neoplasia.

  8. Different forms of soluble cytoplasmic mRNA binding proteins and particles in Xenopus laevis oocytes and embryos

    PubMed Central


    To gain insight into the mechanisms involved in the formation of maternally stored mRNPs during Xenopus laevis development, we searched for soluble cytoplasmic proteins of the oocyte that are able to selectively bind mRNAs, using as substrate radiolabeled mRNA. In vitro mRNP assembly in solution was followed by UV-cross-linking and RNase digestion, resulting in covalent tagging of polypeptides by nucleotide transfer. Five polypeptides of approximately 54, 56 60, 70, and 100 kD (p54, p56, p60, p70, and p100) have been found to selectively bind mRNA and assemble into mRNPs. These polypeptides, which correspond to previously described native mRNP components, occur in three different particle classes of approximately 4.5S, approximately 6S, and approximately 15S, as also determined by their reactions with antibodies against p54 and p56. Whereas the approximately 4.5S class contains p42, p60, and p70, probably each in the form of individual molecules or small complexes, the approximately 6S particles appears to consist only of p54 and p56, which occur in a near-stoichiometric ratio suggestive of a heterodimer complex. The approximately 15S particles contain, in addition to p54 and p56, p60 and p100 and this is the single occurring form of RNA-binding p100. We have also observed changes in the in vitro mRNA binding properties of these polypeptides during oogenesis and early embryonic development, in relation to their phosphorylation state and to the activity of an approximately 15S particle-associated protein kinase, suggesting that these proteins are involved in the developmental translational regulation of maternal mRNAs. PMID:1670777

  9. Characterization of the Eimeria maxima sporozoite surface protein IMP1.


    Jenkins, M C; Fetterer, R; Miska, K; Tuo, W; Kwok, O; Dubey, J P


    The purpose of this study was to characterize Eimeria maxima immune-mapped protein 1 (IMP1) that is hypothesized to play a role in eliciting protective immunity against E. maxima infection in chickens. RT-PCR analysis of RNA from unsporulated and sporulating E. maxima oocysts revealed highest transcription levels at 6-12h of sporulation with a considerable downregulation thereafter. Alignment of IMP1 coding sequence from Houghton, Weybridge, and APU-1 strains of E. maxima revealed single nucleotide polymorphisms that in some instances led to amino acid changes in the encoded protein sequence. The E. maxima (APU-1) IMP1 cDNA sequence was cloned and expressed in 2 different polyHis Escherichia coli expression vectors. Regardless of expression vector, recombinant E. maxima IMP1 (rEmaxIMP1) was fairly unstable in non-denaturing buffer, which is consistent with stability analysis of the primary amino acid sequence. Antisera specific for rEmaxIMP1 identified a single 72 kDa protein or a 61 kDa protein by non-reducing or reducing SDS-PAGE/immunoblotting. Immunofluorescence staining with anti-rEmaxIMP1, revealed intense surface staining of E. maxima sporozoites, with negligible staining of merozoite stages. Immuno-histochemical staining of E. maxima-infected chicken intestinal tissue revealed staining of E. maxima developmental stages in the lamnia propia and crypts at both 24 and 48 h post-infection, and negligible staining thereafter. The expression of IMP1 during early stages of in vivo development and its location on the sporozoite surface may explain in part the immunoprotective effect of this protein against E. maxima infection.

  10. Characterization of the Eimeria maxima sporozoite surface protein IMP1

    USDA-ARS?s Scientific Manuscript database

    The purpose of this study was to characterize Eimeria maxima immunoprotective protein IMP1 that is hypothesized to play a role in eliciting protective immunity against E. maxima infection in chickens. RT-PCR analysis of RNA from unsporulated and sporulating E. maxima oocysts revealed highest transc...

  11. Involvement of the mRNA binding protein CRD-BP in the regulation of metastatic melanoma cell proliferation and invasion by hypoxia.


    Craig, Evisabel A; Weber, Jonathan D; Spiegelman, Vladimir S


    We have previously shown that the mRNA binding protein CRD-BP is overexpressed in human melanomas, where it promotes cell survival and resistance to chemotherapy. The present study investigates the role of hypoxia, a common characteristic of the tumor microenvironment, in the regulation of CRD-BP expression and melanoma cell responses. We found that hypoxia increases CRD-BP levels in metastatic melanoma cell lines but not in melanocytes or primary melanoma cells. Hypoxic stimulation transcriptionally regulates CRD-BP by facilitating the acetylation of histones within the CRD-BP gene and by modulating the extent of HIF1α binding to the CRD-BP promoter. Hypoxia significantly enhances the proliferative and invasive potential of metastatic melanoma cells but not that of normal or primary melanoma cells. Furthermore, inhibition of CRD-BP impairs the ability of metastatic cells to proliferate and invade in response to hypoxia. These findings identify CRD-BP as a novel effector of hypoxic responses that is relevant for the selection of metastatic cells. This work also describes a previously unknown role for CRD-BP in the regulation of melanoma cell invasion and highlights the importance of the hypoxic microenvironment in determining cell fate.

  12. Oncofetal protein, IMP-3, a potential marker for prediction of postoperative peritoneal dissemination in gastric adenocarcinoma.


    Okada, Kaoru; Fujiwara, Yoshiyuki; Nakamura, Yurika; Takiguchi, Shuji; Nakajima, Kiyokazu; Miyata, Hiroshi; Yamasaki, Makoto; Kurokawa, Yukinori; Takahashi, Tsuyoshi; Mori, Masaki; Doki, Yuichiro


    The aim of this study was to determine the expression of insulin-like growth factor-II messenger RNA (mRNA)-binding protein-3 (IMP-3) and its clinical significance in gastric cancers, as well the prognostic value of its expression in the peritoneal lavage fluid after surgery. IMP-3 expression was examined by immunohistochemistry in 96 primary gastric tumors. IMP-3 mRNA expression in peritoneal lavage fluid obtained at laparotomy was determine by real-time quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). Positive staining for IMP-3 was observed in 74% (71/96) of the tumors. IMP-3 expression in gastric tumors correlated significantly with worst overall survival (OS) and recurrence-free survival. Multivariate analyses identified pathological N stage and IMP-3 expression as significant independent prognostic factors for disease-free survival. Eight (28%) of 36 peritoneal lavage samples were cytologically negative but positive for IMP-3 mRNA expression by RT-PCR. The OS of patients with IMP-3-positive peritoneal lavage was significantly worse than of those with negative expression. IMP-3 expression in primary gastric tumors was an independent poor prognostic factor. IMP-3 mRNA expression in peritoneal lavage fluid was a predictor of recurrence after surgery in gastric cancer and a marker of poor prognosis. Copyright © 2011 Wiley Periodicals, Inc.

  13. IMP3 protein promotes chemoresistance in breast cancer cells by regulating breast cancer resistance protein (ABCG2) expression.


    Samanta, Sanjoy; Pursell, Bryan; Mercurio, Arthur M


    IMP3, a member of a family of insulin-like growth factor II (IGF-II) mRNA-binding proteins (IMPs), is expressed preferentially in triple-negative breast cancers, which are resistant to many chemotherapeutics. However, the mechanisms by which it impacts breast cancer have not been elucidated. We hypothesized a role for IMP3 in chemoresistance based on these observations. Depletion of IMP3 expression in triple-negative breast cancer cells increased their sensitivity to doxorubicin and mitoxantrone significantly but not to taxol. Given that doxorubicin and mitoxantrone are effluxed by breast cancer resistance protein (BCRP), we assessed whether IMP3 regulates BCRP. The data obtained demonstrate that IMP3 binds to BCRP mRNA and regulates BCRP expression. These findings are significant because they provide insight into the mechanism by which IMP3 contributes to aggressive cancers, and they highlight the potential for targeting this mRNA-binding protein for the clinical management of cancer.

  14. Role of the RNA-Binding Protein IMP-2 in Muscle Cell Motility▿ †

    PubMed Central

    Boudoukha, Selim; Cuvellier, Sylvain; Polesskaya, Anna


    Insulin-like growth factor 2 (IGF-2) mRNA-binding proteins (IMPs) are a family of posttranscriptional regulatory factors with well-understood roles in embryonic development and cancer but with poorly characterized functions in normal adult cells and tissues. We now show that IMP-2, the most ubiquitously expressed member of the family, is abundant in human and mouse adult skeletal myoblasts, where it is indispensable for cell motility and for stabilization of microtubules. To explore the functions of IMP-2, we analyzed the transcripts that were differentially regulated in IMP-2-depleted myoblasts and bound to IMP-2 in normal myoblasts. Among them were the mRNAs of PINCH-2, an important mediator of cell adhesion and motility, and MURF-3, a microtubule-stabilizing protein. By gain- and loss-of-function assays and gel shift experiments, we show that IMP-2 regulates the expression of PINCH-2 and MURF-3 proteins via direct binding to their mRNAs. Upregulation of PINCH-2 in IMP-2-depleted myoblasts is the key event responsible for their decreased motility. Our data reveal how the posttranscriptional regulation of gene expression by IMP-2 contributes to the control of adhesion structures and stable microtubules and demonstrate an important function for IMP-2 in cellular motility. PMID:20956565

  15. Role of the RNA-binding protein IMP-2 in muscle cell motility.


    Boudoukha, Selim; Cuvellier, Sylvain; Polesskaya, Anna


    Insulin-like growth factor 2 (IGF-2) mRNA-binding proteins (IMPs) are a family of posttranscriptional regulatory factors with well-understood roles in embryonic development and cancer but with poorly characterized functions in normal adult cells and tissues. We now show that IMP-2, the most ubiquitously expressed member of the family, is abundant in human and mouse adult skeletal myoblasts, where it is indispensable for cell motility and for stabilization of microtubules. To explore the functions of IMP-2, we analyzed the transcripts that were differentially regulated in IMP-2-depleted myoblasts and bound to IMP-2 in normal myoblasts. Among them were the mRNAs of PINCH-2, an important mediator of cell adhesion and motility, and MURF-3, a microtubule-stabilizing protein. By gain- and loss-of-function assays and gel shift experiments, we show that IMP-2 regulates the expression of PINCH-2 and MURF-3 proteins via direct binding to their mRNAs. Upregulation of PINCH-2 in IMP-2-depleted myoblasts is the key event responsible for their decreased motility. Our data reveal how the posttranscriptional regulation of gene expression by IMP-2 contributes to the control of adhesion structures and stable microtubules and demonstrate an important function for IMP-2 in cellular motility.

  16. CircRNA-protein complexes: IMP3 protein component defines subfamily of circRNPs

    PubMed Central

    Schneider, Tim; Hung, Lee-Hsueh; Schreiner, Silke; Starke, Stefan; Eckhof , Heinrich; Rossbach, Oliver; Reich, Stefan; Medenbach, Jan; Bindereif , Albrecht


    Circular RNAs (circRNAs) constitute a new class of noncoding RNAs in higher eukaryotes generated from pre-mRNAs by alternative splicing. Here we investigated in mammalian cells the association of circRNAs with proteins. Using glycerol gradient centrifugation, we characterized in cell lysates circRNA-protein complexes (circRNPs) of distinct sizes. By polysome-gradient fractionation we found no evidence for efficient translation of a set of abundant circRNAs in HeLa cells. To identify circRNPs with a specific protein component, we focused on IMP3 (IGF2BP3, insulin-like growth factor 2 binding protein 3), a known tumor marker and RNA-binding protein. Combining RNA-seq analysis of IMP3-co-immunoprecipitated RNA and filtering for circular-junction reads identified a set of IMP3-associated circRNAs, which were validated and characterized. In sum, our data suggest that specific circRNP families exist defined by a common protein component. In addition, this provides a general approach to identify circRNPs with a given protein component. PMID:27510448

  17. An immunodominant membrane protein (Imp) of 'Candidatus Phytoplasma mali' binds to plant actin.


    Boonrod, K; Munteanu, B; Jarausch, B; Jarausch, W; Krczal, G


    The phytopathogenic, cell-wall-less phytoplasmas exhibit a dual life cycle: they multiply in the phloem of their host plant and in the body of their insect vector. Their membrane proteins are in direct contact with both hosts and are supposed to play a crucial role in the phytoplasma spread within the plant as well as by the insect vector. Three types of nonhomologous but highly abundant and immunodominant membrane proteins (IDP) have been identified within the phytoplasmas: Amp, IdpA, and Imp. Although recent results indicate that Amp is involved in vector specificity interacting with insect proteins such as actin, little is known about the interaction of IDP with the plant. We could demonstrate that transiently expressed Imp of 'Candidatus Phytoplasma mali' as well as the Imp without transmembrane domain (Imp▴Tm) bind with plant actins in vivo. Moreover, in vitro co-sediment and binding assays showed that Escherichia coli-expressed recombinant Imp▴Tm-His binds to both G- and F-actins isolated from rabbit muscle. Transgenic plants expressing Imp- or Imp▴Tm-green fluorescent protein did not exhibit any remarkable change of phenotype compared with the wild-type plant. These results indicate that Imp specifically binds to plant actin and a role of Imp-actin binding in phytoplasma motility is hypothesized.

  18. The oncofetal protein IMP3: a novel biomarker for endometrial serous carcinoma.


    Zheng, Wenxin; Yi, Xiaofang; Fadare, Oluwole; Liang, Sharon X; Martel, Maritza; Schwartz, Peter E; Jiang, Zhong


    Insulin-like growth factor II mRNA-binding protein 3 (IMP3) is an oncofetal protein highly expressed in fetal tissue and malignant tumors but rarely found in adult benign tissues. The aim of this study is to determine the expression of IMP3 in benign endometrium, endometrial cancer, and its precursor lesions, trying to see whether IMP3 has any diagnostic usage. Two hundred ninety-eight endometrial samples were examined for IMP3 expression by immunohistochemistry. These included benign endometrium (n=68), atypical hyperplasia or endometrial intraepithelial neoplasia (n=35), endometrial glandular dysplasia (n=21), endometrial intraepithelial carcinoma (n=18), endometrioid carcinoma (n=70), mucinous carcinoma (n=8), serous carcinoma (n=51), clear cell carcinoma (n=12), and other malignancies (n=15). Maturational patterns in the 68 benign endometrial samples included atrophic (n=12), proliferative (n=18), secretory (n=14), menstrual (n=8), and gestational (n=16). Most of the carcinomas were histologically pure; where mixed, the second component constituted <10% of the total tumor volume. The extent and intensity of IMP3 expression was semiquantitatively determined and scored for all samples. A renal cell carcinoma with known IMP3 expression was used as positive control for each immunohistochemistry run. Among the malignant cases, IMP3 expression was predominantly found in endometrial serous carcinoma and its putative precursor lesions, with 3 (14%) of 21 endometrial glandular dysplasia, 16 (89%) of 18 serous endometrial intraepithelial carcinoma, and 48 (94%) of 51 serous carcinomas (P<0.001). In contrast, the frequency of IMP3 expression was significantly lesser in nonserous malignancies with 0 (0%) of 35, 5 (7%) of 70, 0 (0%) of 8, 3 (25%) of 12, and 5 (33%) of 15 positive expression rates in atypical hyperplasia or endometrial intraepithelial neoplasia, endometrioid, mucinous, clear cell carcinomas, and other malignancies, respectively. The IMP3 staining was

  19. Imp and Syp RNA-binding proteins govern decommissioning of Drosophila neural stem cells.


    Yang, Ching-Po; Samuels, Tamsin J; Huang, Yaling; Yang, Lu; Ish-Horowicz, David; Davis, Ilan; Lee, Tzumin


    The termination of the proliferation of Drosophila neural stem cells, also known as neuroblasts (NBs), requires a 'decommissioning' phase that is controlled in a lineage-specific manner. Most NBs, with the exception of those of the mushroom body (MB), are decommissioned by the ecdysone receptor and mediator complex, causing them to shrink during metamorphosis, followed by nuclear accumulation of Prospero and cell cycle exit. Here, we demonstrate that the levels of Imp and Syp RNA-binding proteins regulate NB decommissioning. Descending Imp and ascending Syp expression have been shown to regulate neuronal temporal fate. We show that Imp levels decline slower in the MB than in other central brain NBs. MB NBs continue to express Imp into pupation, and the presence of Imp prevents decommissioning partly by inhibiting the mediator complex. Late-larval induction of transgenic Imp prevents many non-MB NBs from decommissioning in early pupae. Moreover, the presence of abundant Syp in aged NBs permits Prospero accumulation that, in turn, promotes cell cycle exit. Together, our results reveal that progeny temporal fate and progenitor decommissioning are co-regulated in protracted neuronal lineages. © 2017. Published by The Company of Biologists Ltd.

  20. The U3 small nucleolar ribonucleoprotein component Imp4p is a telomeric DNA-binding protein

    PubMed Central

    Hsieh, Yi-Ching; Tu, Pei-Jung; Lee, Ying-Yuan; Kuo, Chun-Chen; Lin, Yi-Chien; Wu, Chi-Fang; Lin, Jing-Jer


    Imp4p is a component of U3 snoRNP (small nucleolar ribonucleoprotein) involved in the maturation of 18S rRNA. We have shown that Imp4p interacts with Cdc13p, a single-stranded telomere-binding protein involved in telomere maintenance. To understand the role of Imp4p in telomeres, we purified recombinant Imp4p protein and tested its binding activity towards telomeric DNA using electrophoretic mobility-shift assays. Our results showed that Imp4p bound specifically to single-stranded telomeric DNA in vitro. The interaction of Imp4p to telomeres in vivo was also demonstrated by chromatin immunoprecipitation experiments. Significantly, the binding of Imp4p to telomeres was not limited to yeast proteins, since the hImp4 (human Imp4) also bound to vertebrate single-stranded telomeric DNA. Thus we conclude that Imp4p is a novel telomeric DNA-binding protein that, in addition to its role in rRNA processing, might participate in telomere function. PMID:17803460

  1. Expression of progesterone receptor membrane component 1, serpine mRNA binding protein 1 and nuclear progesterone receptor isoforms A and B in the bovine myometrium during the estrous cycle and early pregnancy.


    Slonina, Dominika; Kowalik, Magdalena K; Kotwica, Jan


    The aim of this study was to investigate the (1) expression of progesterone membrane component 1 (PGRMC1), serpine mRNA binding protein 1 (SERBP1) and progesterone receptor (PR) mRNA and (2) protein expression levels of PGRMC1, SERBP1 and PR isoforms A and B in the bovine myometrium during the estrous cycle and early pregnancy. Uteri from cows on days 1-5, 6-10, 11-16 and 17-21 of the estrous cycle and weeks 3-5, 6-8 and 9-12 of pregnancy were used (n=5-6 per period). There were no changes (P>0.05) in PGRMC1 mRNA expression during the estrous cycle, while expression of SERBP1 and PR mRNA was the lowest (P<0.05) on days 11-16 relative to other days of the cycle. The highest mRNA expression of PGRMC1, SERBP1 and PR was found during pregnancy. There were no changes (P>0.05) in SERBP1 protein expression in cycling and pregnant cows, while the highest (P<0.05) PGRMC1 protein expression was found during weeks 3-5 of pregnancy. Similar protein expression profiles for PRA and PRB were found, and protein levels were highest on days 1-5 of the estrous cycle. From day 6 of the cycle, PRA and PRB protein expression decreased and were maintained at this lower level during pregnancy. In conclusion, our study assessed mRNA and protein expression levels of PGRMC1, SERBP1 and PR in the bovine myometrium during the estrous cycle and the first trimester of pregnancy. It is possible that progesterone (P4) affects myometrial function in a genomic and nongenomic manner.

  2. An IcmF family protein, ImpLM, is an integral inner membrane protein interacting with ImpKL, and its walker a motif is required for type VI secretion system-mediated Hcp secretion in Agrobacterium tumefaciens.


    Ma, Lay-Sun; Lin, Jer-Sheng; Lai, Erh-Min


    An intracellular multiplication F (IcmF) family protein is a conserved component of a newly identified type VI secretion system (T6SS) encoded in many animal and plant-associated Proteobacteria. We have previously identified ImpL(M), an IcmF family protein that is required for the secretion of the T6SS substrate hemolysin-coregulated protein (Hcp) from the plant-pathogenic bacterium Agrobacterium tumefaciens. In this study, we characterized the topology of ImpL(M) and the importance of its nucleotide-binding Walker A motif involved in Hcp secretion from A. tumefaciens. A combination of beta-lactamase-green fluorescent protein fusion and biochemical fractionation analyses revealed that ImpL(M) is an integral polytopic inner membrane protein comprising three transmembrane domains bordered by an N-terminal domain facing the cytoplasm and a C-terminal domain exposed to the periplasm. impL(M) mutants with substitutions or deletions in the Walker A motif failed to complement the impL(M) deletion mutant for Hcp secretion, which provided evidence that ImpL(M) may bind and/or hydrolyze nucleoside triphosphates to mediate T6SS machine assembly and/or substrate secretion. Protein-protein interaction and protein stability analyses indicated that there is a physical interaction between ImpL(M) and another essential T6SS component, ImpK(L). Topology and biochemical fractionation analyses suggested that ImpK(L) is an integral bitopic inner membrane protein with an N-terminal domain facing the cytoplasm and a C-terminal OmpA-like domain exposed to the periplasm. Further comprehensive yeast two-hybrid assays dissecting ImpL(M)-ImpK(L) interaction domains suggested that ImpL(M) interacts with ImpK(L) via the N-terminal cytoplasmic domains of the proteins. In conclusion, ImpL(M) interacts with ImpK(L), and its Walker A motif is required for its function in mediation of Hcp secretion from A. tumefaciens.

  3. Expression and localization of progesterone receptor membrane component 1 and 2 and serpine mRNA binding protein 1 in the bovine corpus luteum during the estrous cycle and the first trimester of pregnancy.


    Kowalik, Magdalena K; Rekawiecki, Robert; Kotwica, Jan


    The aim of this study was to evaluate the mRNA and protein expression and the localization of progesterone receptor membrane component 1 (PGRMC1), PGRMC2, and the PGRMC1 partner serpine mRNA binding protein 1 (SERBP1) in the bovine CL on Days 2 to 5, 6 to 10, 11 to 16, and 17 to 20 of the estrous cycle as well as during Weeks 3 to 5, 6 to 8, and 9 to 12 of pregnancy (n = 5-6 per each period). The highest levels of PGRMC1 and PGRMC2 mRNA expression were found on Days 6 to 16 (P < 0.05) and 11 to 16, respectively, of the estrous cycle and during pregnancy (P < 0.001). The level of PGRMC1 protein was the highest (P < 0.05) on Days 11 to 16 of the estrous cycle compared with the other stages of the estrous cycle and pregnancy, whereas PGRMC2 protein expression (P < 0.001) was the highest on Days 17 to 20 and also during pregnancy. The mRNA expression of SERBP1 was increased (P < 0.05) on Days 11 to 16, whereas the level of its protein product was decreased (P < 0.05) on Days 6 to 10 of the estrous cycle and was at its lowest (P < 0.001) on Days 17 to 20. In pregnant cows, the patterns of SERBP1 mRNA and protein expression remained constant and were comparable with those observed during the estrous cycle. Progesterone receptor membrane component 1 and PGRMC2 localized to both large and small luteal cells, whereas SERBP1 was observed mainly in small luteal cells and much less frequently in large luteal cells. All proteins were also localized in the endothelial cells of blood vessels. The data obtained indicate the variable expression of PGRMC1, PGRMC2, and SERBP1 mRNA and protein in the bovine CL and suggest that progesterone may regulate CL function via its membrane receptors during both the estrous cycle and pregnancy. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. High-Throughput Fluorescence Anisotropy Screen for Inhibitors of the Oncogenic mRNA-binding Protein, IMP-1

    PubMed Central

    Mahapatra, Lily; Mao, Chengjian; Andruska, Neal; Zhang, Chen; Shapiro, David J.


    Cancer cell proliferation is regulated by oncogenes, such as c-Myc. An alternative approach to directly targeting individual oncogenes is to target IMP-1, an oncofetal protein that binds to and stabilizes mRNAs, leading to elevated expression of c-Myc and other oncogenes. Expression of IMP-1 is tightly correlated with a poor prognosis and reduced survival in ovarian, lung and colon cancer. Small molecule inhibitors of IMP-1 have not been reported. We established a fluorescence anisotropy/polarization microplate assay (FAMA) for analyzing binding of IMP-1 to a fluorescein-labeled 93 nucleotide c-Myc mRNA target (flMyc), developed the assay as a highly robust (Z’ factor = 0.60) FAMA-based high throughput screen for inhibitors of binding of IMP-1 to flMyc, and carried out a successful pilot screen of 17,600 small molecules. Our studies support rapidly filtering out toxic non-specific inhibitors using an early cell-based assay in control cells lacking the target protein. The physiologic importance of verified hits from the in vitro high throughput screen was demonstrated by identification of the first small molecule IMP-1 inhibitor; a lead compound that selectively inhibits proliferation of IMP-1 positive cancer cells with very little or no effect on proliferation of IMP-1 negative cells. PMID:24108120

  5. Expression of IMP1 enhances production of murine leukemia virus vector by facilitating viral genomic RNA packaging.


    Mai, Yun; Gao, Guangxia


    Murine leukemia virus (MLV)-based retroviral vector is widely used for gene transfer. Efficient packaging of the genomic RNA is critical for production of high-titer virus. Here, we report that expression of the insulin-like growth factor II mRNA binding protein 1 (IMP1) enhanced the production of infectious MLV vector. Overexpression of IMP1 increased the stability of viral genomic RNA in virus producer cells and packaging of the RNA into progeny virus in a dose-dependent manner. Downregulation of IMP1 in virus producer cells resulted in reduced production of the retroviral vector. These results indicate that IMP1 plays a role in regulating the packaging of MLV genomic RNA and can be used for improving production of retroviral vectors.

  6. IMP-3 is differentially expressed in normal and neoplastic lymphoid tissue.


    King, Rebecca L; Pasha, Theresa; Roullet, Michele R; Zhang, Paul J; Bagg, Adam


    IMP-3 is a member of the insulin-like growth factor II mRNA binding protein (IMP) family of proteins that play a role in RNA trafficking and stabilization and cell growth and migration during embryogenesis but which are down-regulated in adult tissue. However, IMP-3 has recently been shown to be overexpressed in several epithelial malignancies, with increased expression correlating with aggressive behavior. To our knowledge, there is no published literature evaluating IMP-3 in lymphoid tissue. Accordingly, we immunohistochemically evaluated IMP-3 expression in normal lymphoid tissue and 141 lymphoid neoplasms. Physiologically, IMP-3 expression was restricted to germinal center B cells. Among lymphoid neoplasms, Hodgkin lymphoma demonstrated the highest percentage of positive cases (26/26, 100%) often with bright staining. Burkitt lymphoma was positive in 10 (83%) of 12 cases with moderate to bright staining. Although follicular lymphoma was also positive in a high percentage of cases (12/15, 80%), the intensity was exclusively weak to moderate. Although 22 (85%) of 26 of diffuse large B-cell lymphomas were positive for IMP-3, there was wide variability in staining intensity, which did not correlate with classification into activated B cell versus germinal center B origin. By contrast, lower proportions (8%-20%) of other non-germinal center B lymphoma subtypes were IMP-3-positive. In conclusion, although IMP-3 expression is seemingly restricted to physiologic germinal center B cells, its expression in lymphomas of germinal center B origin is less robust. However, there does appear to be some association with the latter group of lymphomas, which may prove to have diagnostic or therapeutic relevance as the biologic role of IMP-3 is further elucidated.

  7. IMP3 Is Strongly Expressed in Malignant Phyllodes Tumors of the Breast: An Immunohistochemical Study.


    Bellezza, Guido; Prosperi, Enrico; Del Sordo, Rachele; Colella, Renato; Rulli, Antonio; Sidoni, Angelo


    Phyllodes tumors (PTs) of the breast are rare biphasic neoplasms and are classified as benign, borderline, or malignant. Many biological markers have been studied to discriminate between different grades of PTs. IMP3 is a member of the insulin-like growth factor II mRNA binding protein (IMP) family and is expressed in developing tissues during embryogenesis, whereas in adult tissues it is found only at low or undetectable levels. IMP3 is considered a marker of biological aggressiveness in many cancers, including breast and lung. The aim of this study was to evaluate the immunohistochemical expression of IMP3 in a series of PTs and to determine its association with histological grade and clinical outcome. We reviewed retrospectively 62 cases of PTs including their recurrences and 20 cases of fibroadenoma. PTs have been classified as benign in 40 cases, borderline in 13 cases, and malignant in 9 cases. There were significant differences in IMP3 expression: in malignant PTs IMP3 expression was higher (56% of cases) than in borderline (15%) and benign cases (5%), (P = .001). Fibroadenoma showed no expression for IMP3. IMP3 expression was different in cases with recurrence than cases without recurrence. Furthermore, 3 of the recurrences had a higher histological grade with a positive IMP3 expression compared with the primary tumor. This is the first study evaluating the IMP3 immunohistochemical expression in PTs. Its expression correlates with histological grade and could be used in the differential diagnosis of fibroepithelial tumors and in predicting a more aggressive behavior. © The Author(s) 2015.

  8. Local requirement of the Drosophila insulin binding protein imp-L2 in coordinating developmental progression with nutritional conditions.


    Sarraf-Zadeh, Ladan; Christen, Stefan; Sauer, Uwe; Cognigni, Paola; Miguel-Aliaga, Irene; Stocker, Hugo; Köhler, Katja; Hafen, Ernst


    In Drosophila, growth takes place during the larval stages until the formation of the pupa. Starvation delays pupariation to allow prolonged feeding, ensuring that the animal reaches an appropriate size to form a fertile adult. Pupariation is induced by a peak of the steroid hormone ecdysone produced by the prothoracic gland (PG) after larvae have reached a certain body mass. Local downregulation of the insulin/insulin-like growth factor signaling (IIS) activity in the PG interferes with ecdysone production, indicating that IIS activity in the PG couples the nutritional state to development. However, the underlying mechanism is not well understood. In this study we show that the secreted Imaginal morphogenesis protein-Late 2 (Imp-L2), a growth inhibitor in Drosophila, is involved in this process. Imp-L2 inhibits the activity of the Drosophila insulin-like peptides by direct binding and is expressed by specific cells in the brain, the ring gland, the gut and the fat body. We demonstrate that Imp-L2 is required to regulate and adapt developmental timing to nutritional conditions by regulating IIS activity in the PG. Increasing Imp-L2 expression at its endogenous sites using an Imp-L2-Gal4 driver delays pupariation, while Imp-L2 mutants exhibit a slight acceleration of development. These effects are strongly enhanced by starvation and are accompanied by massive alterations of ecdysone production resulting most likely from increased Imp-L2 production by neurons directly contacting the PG and not from elevated Imp-L2 levels in the hemolymph. Taken together our results suggest that Imp-L2-expressing neurons sense the nutritional state of Drosophila larvae and coordinate dietary information and ecdysone production to adjust developmental timing under starvation conditions.

  9. Protein Variants Form a System of Networks: Microdiversity of IMP Metallo-Beta-Lactamases

    PubMed Central

    Widmann, Michael; Pleiss, Jürgen


    Genome and metagenome sequencing projects support the view that only a tiny portion of the total protein microdiversity in the biosphere has been sequenced yet, while the vast majority of existing protein variants is still unknown. By using a network approach, the microdiversity of 42 metallo-β-lactamases of the IMP family was investigated. In the networks, the nodes are formed by the variants, while the edges correspond to single mutations between pairs of variants. The 42 variants were assigned to 7 separate networks. By analyzing the networks and their relationships, the structure of sequence space was studied and existing, but still unknown, functional variants were predicted. The largest network consists of 10 variants with IMP-1 in its center and includes two ubiquitous mutations, V67F and S262G. By relating the corresponding pairs of variants, the networks were integrated into a single system of networks. The largest network also included a quartet of variants: IMP-1, two single mutants, and the respective double mutant. The existence of quartets indicates that if two mutations resulted in functional enzymes, the double mutant may also be active and stable. Therefore, quartet construction from triplets was applied to predict 15 functional variants. Further functional mutants were predicted by applying the two ubiquitous mutations in all networks. In addition, since the networks are separated from each other by 10–15 mutations on average, it is expected that a subset of the theoretical intermediates are functional, and therefore are supposed to exist in the biosphere. Finally, the network analysis helps to distinguish between epistatic and additive effects of mutations; while the presence of correlated mutations indicates a strong interdependency between the respective positions, the mutations V67F and S262G are ubiquitous and therefore background independent. PMID:25013948

  10. Dynamics of survival of motor neuron (SMN) protein interaction with the mRNA-binding protein IMP1 facilitates its trafficking into motor neuron axons.


    Fallini, Claudia; Rouanet, Jeremy P; Donlin-Asp, Paul G; Guo, Peng; Zhang, Honglai; Singer, Robert H; Rossoll, Wilfried; Bassell, Gary J


    Spinal muscular atrophy (SMA) is a lethal neurodegenerative disease specifically affecting spinal motor neurons. SMA is caused by the homozygous deletion or mutation of the survival of motor neuron 1 (SMN1) gene. The SMN protein plays an essential role in the assembly of spliceosomal ribonucleoproteins. However, it is still unclear how low levels of the ubiquitously expressed SMN protein lead to the selective degeneration of motor neurons. An additional role for SMN in the regulation of the axonal transport of mRNA-binding proteins (mRBPs) and their target mRNAs has been proposed. Indeed, several mRBPs have been shown to interact with SMN, and the axonal levels of few mRNAs, such as the β-actin mRNA, are reduced in SMA motor neurons. In this study we have identified the β-actin mRNA-binding protein IMP1/ZBP1 as a novel SMN-interacting protein. Using a combination of biochemical assays and quantitative imaging techniques in primary motor neurons, we show that IMP1 associates with SMN in individual granules that are actively transported in motor neuron axons. Furthermore, we demonstrate that IMP1 axonal localization depends on SMN levels, and that SMN deficiency in SMA motor neurons leads to a dramatic reduction of IMP1 protein levels. In contrast, no difference in IMP1 protein levels was detected in whole brain lysates from SMA mice, further suggesting neuron specific roles of SMN in IMP1 expression and localization. Taken together, our data support a role for SMN in the regulation of mRNA localization and axonal transport through its interaction with mRBPs such as IMP1. Copyright © 2013 Wiley Periodicals, Inc.

  11. IMP3 expression in lesions of the biliary tract: a marker for high-grade dysplasia and an independent prognostic factor in bile duct carcinomas.


    Riener, Marc-Oliver; Fritzsche, Florian R; Clavien, Pierre-Alain; Pestalozzi, Bernhard C; Probst-Hensch, Nicole; Jochum, Wolfram; Kristiansen, Glen


    The oncofetal protein IMP3 (insulin-like growth factor II mRNA binding protein 3) is expressed during embryogenesis and carcinogenesis. Various tumor types have been analyzed for IMP3 expression, which was exclusively found in tumor cells and correlated with increased tumor aggressiveness and reduced overall survival. To our knowledge, IMP3 expression has not been investigated in bile duct carcinomas. Using large tissue sections from resection specimens of the extrahepatic biliary tract, we analyzed IMP3 in normal bile ducts (n = 36), bile ducts with acute inflammation and reactive epithelial changes (n = 26), low-grade dysplasia (n = 9), and high-grade dysplasia (n = 11). Furthermore, IMP3 expression was assessed in bile duct carcinoma (n = 115) using clinically well-characterized tissue microarrays. The findings were correlated with clinical-pathologic parameters including survival. High-grade dysplasia was strongly positive for IMP3 in all cases studied compared with no or weak expression in normal, inflamed, and low-grade dysplastic bile ducts. Of the bile duct carcinomas 58.3% (67/115) were strongly positive for IMP3, which was associated with a higher proliferation rate (P = .004) and p53 positivity (P = .022). Patients with strong IMP3 expression had significantly reduced overall survival (P = .037) similarly to the subgroup of pT3 carcinomas (P = .007). In multivariate analysis, IMP3 expression was an independent prognostic factor for overall survival (P = .040, RR = 1.809). This comprehensive study shows that IMP3 is an independent prognostic biomarker in bile duct carcinoma. In addition, it may be a marker for high-grade dysplasia in the extrahepatic biliary tract.

  12. impA, a Gene Coding for an Inner Membrane Protein, Influences Colonial Morphology of Actinobacillus actinomycetemcomitans

    PubMed Central

    Mintz, Keith P.; Fives-Taylor, Paula M.


    Directed mutagenesis of a gene coding for a membrane protein of the periodontopathogen Actinobacillus actinomycetemcomitans was achieved by conjugation. The gene was disrupted by insertion of an antibiotic cassette into a unique endonuclease restriction sequence engineered by inverse PCR. The disrupted gene was cloned into a conjugative plasmid and transferred from Escherichia coli to A. actinomycetemcomitans. The allelic replacement mutation resulted in the loss of a 22-kDa inner membrane protein. The loss of this protein (ImpA) resulted in changes in the outer membrane protein composition of the bacterium. Concurrent with the mutation in impA was a change in the pattern of growth of the mutant bacteria in broth cultures. The progenitor bacteria grew as a homogeneous suspension of cells compared to a granular, autoaggregating adherent cell population described for the mutant bacteria. These data suggest that ImpA may play a regulatory role or be directly involved in protein(s) that are exported and associated with colony variations in A. actinomycetemcomitans. PMID:11083768

  13. IMP-3 protects the mRNAs of cyclins D1 and D3 from GW182/AGO2-dependent translational repression.


    Deforzh, Evgeny; Vargas, Thaiz Rivera; Kropp, Jeremie; Vandamme, Marie; Pinna, Guillaume; Polesskaya, Anna


    IGF-2 mRNA binding protein 3 (IGF2BP3, IMP-3) is a well-known post-transcriptional regulatory factor of gene expression, mainly involved in embryonic development and oncogenesis. We have previously demonstrated that a subset of IMP-3 targets, such as the mRNAs of cyclins D1, D3 and G1, are positively regulated by IMP-3, and that this regulation depends on nuclear localization of IMP-3. In the present study, we show that as a first step following a knock-down of IMP-3, the protein levels of the cyclins rapidly decrease, while their mRNAs remain stable and associated with the polyribosomes, though not translated. We have elucidated the molecular mechanisms of this regulation, demonstrating that IMP-3 and its protein partners ILF3/NF90 and PTBP1 bind to the 3'UTRs of the cyclin mRNAs and protect them from the translational repression induced by miRNA-dependent recruitment of AGO2/GW182 complex in human cancer cells.

  14. IMP-1 displays cross-talk with K-Ras and modulates colon cancer cell survival through the novel proapoptotic protein CYFIP2.


    Mongroo, Perry S; Noubissi, Felicite K; Cuatrecasas, Miriam; Kalabis, Jiri; King, Catrina E; Johnstone, Cameron N; Bowser, Mark J; Castells, Antoni; Spiegelman, Vladimir S; Rustgi, Anil K


    Insulin-like growth factor 2 mRNA-binding protein-1 (IMP-1) is an oncofetal protein that binds directly to and stabilizes oncogenic c-Myc and regulates, in turn, its posttranscriptional expression and translation. In contrast to normal adult tissue, IMP-1 is reexpressed and/or overexpressed in human cancers. We show that knockdown of c-Myc in human colon cancer cell lines increases the expression of mature let-7 miRNA family members and downregulates several of its mRNA targets: IMP-1, Cdc34, and K-Ras. We further show that loss of IMP-1 inhibits Cdc34, Lin-28B, and K-Ras, suppresses SW-480 cell proliferation and anchorage-independent growth, and promotes caspase- and lamin-mediated cell death. We also found that IMP-1 binds to the coding region and 3'UTR of K-Ras mRNA. RNA microarray profiling and validation by reverse transcription PCR reveals that the p53-inducible proapoptotic protein CYFIP2 is upregulated in IMP-1 knockdown SW480 cells, a novel finding. We also show that overexpression of IMP-1 increases c-Myc and K-Ras expression and LIM2405 cell proliferation. Furthermore, we show that loss of IMP-1 induces Caspase-3- and PARP-mediated apoptosis, and inhibits K-Ras expression in SW480 cells, which is rescued by CYFIP2 knockdown. Importantly, analysis of 228 patients with colon cancers reveals that IMP-1 is significantly upregulated in differentiated colon tumors (P ≤ 0.0001) and correlates with K-Ras expression (r = 0.35, P ≤ 0.0001) relative to adjacent normal mucosa. These findings indicate that IMP-1, interrelated with c-Myc, acts upstream of K-Ras to promote survival through a novel mechanism that may be important in colon cancer pathogenesis. ©2011 AACR.

  15. Toward immunomodulation of witches broom disease of lime (WBDL) by targeting immunodominant membrane protein (IMP) of candidatus Phytoplasma aurantifolia.


    Shahryari, F; Safarnejad, M R; Shams-Bakhsh, M; Jouzani, G R Salehi


    The witches' broom disease of lime (WBDL) caused by Candidatus Phytoplasma aurantifolia is the most devastating disease of acidian lime in southern part of Iran as it destroy thousands of trees yearly throughout these regions. Traditional methods such as eradication of infected trees and insect vector control have shown limited effect on this case. Therefore, alternative approaches such as plantibody-mediated resistance, have been considered. Throughout present study we prepared sufficient amount of antigen that is required for generation of specific monoclonal recombinant antibodies against Immunodominant membrane protein (IMP) which will be exploited for plantibody-mediated resistance approach. The gene encoding IMP protein was obtained by PCR amplification using specific primers and DNA extracted from the infected plants. Amplified fragment was then inserted into T/A cloning vector. Intact clones containing the right sequence was selected after digestion, PCR amplification and subsequent sequencing analysis. IMP encoding region having the right sequence was sub-cloned into pET28a bacterial expression vector. Large scale expression of His tagged recombinant protein was performed in the BL21-de3 strain of E. coli and purification under native conditions was carried out through immobilized metal ion affinity chromatography (IMAC) in a column containing Ni-NTA agarose beads. Successful expression and purification steps were confirmed by SDS-PAGE and western blotting analyses. The results obtained indicated the successful production of about 18 mg purified recombinant IMP protein with a low level of contamination in one liter cultured medium. Finally the purified protein was dialyzed in phosphate saline buffer and applied for immunization of mice.

  16. Insulin-Like Growth Factor II mRNA-Binding Protein 3 (IMP3) as a Useful Immunohistochemical Marker for the Diagnosis of Adenocarcinoma of Small Intestine

    PubMed Central

    Daikuhara, Seiichi; Uehara, Takeshi; Higuchi, Kayoko; Hosaka, Noriko; Iwaya, Mai; Maruyama, Yasuhiro; Matsuda, Kazuyuki; Arakura, Norikazu; Tanaka, Eiji; Ota, Hiroyoshi


    The biological characteristics and roles of insulin-like growth factor II mRNA-binding protein 3 protein (IMP3) expression in small-intestinal adenocarcinoma were investigated. The value of IMP3 immunostaining in the diagnosis of small-intestinal epithelial lesions was also evaluated. Immunohistochemical expression of IMP3 in normal small-intestinal mucosa adjacent to adenoma and adenocarcinoma lesions, and inflamed duodenal and ileal mucosa was analyzed. Samples assessed were: duodenal ulcer (n=6), Crohn’s disease (n=5), low-grade small-intestinal adenoma (n=10), high-grade small-intestinal adenoma (n=13), small-intestinal adenocarcinoma (n=23), lymph node metastases (LNM; n=7), and preoperative biopsies of small-intestinal adenocarcinoma (n=6). Immunohistochemical expression of Ki-67 and p53 was also analyzed in adenoma and adenocarcinoma samples. IMP3 was not expressed in normal epithelium, but weakly expressed in reparative epithelium. Meanwhile, increased IMP3 expression was associated with a higher degree of dysplasia in adenomas, higher T classification, LNM, Ki-67 positivity, histological differentiation, and lower 5-year disease-free survival, but not p53 expression in adenocarcinoma. IMP3 expression appears to be a late event in the small-intestinal carcinogenesis. Assessing the IMP3 staining pattern can be useful in the diagnosis of small-intestinal epithelial lesions when used in conjunction with other histological criteria. PMID:26855452

  17. Expression of progesterone receptor membrane component (PGRMC) 1 and 2, serpine mRNA binding protein 1 (SERBP1) and nuclear progesterone receptor (PGR) in the bovine endometrium during the estrous cycle and the first trimester of pregnancy.


    Kowalik, Magdalena K; Slonina, Dominika; Rekawiecki, Robert; Kotwica, Jan


    Progesterone (P4) is involved in the regulation of essential reproductive functions affecting the target cells through both nuclear progesterone receptors (PGRs) and membrane progesterone receptors. The aim of this study was to determine the mRNA and protein expression for PGRMC1, PGRMC2, SERBP1 and PGR within the bovine endometrium during the estrous cycle and the first trimester of pregnancy. There were no changes in PGRMC1 and PGRMC2 mRNA and protein expression during the estrous cycle, however, mRNA levels of PGRMC1 and PGRMC2 were increased (P<0.001) in pregnant animals. SERBP1 mRNA expression was increased (P<0.05), while the level of this protein was decreased (P<0.05) on days 11-16 of the estrous cycle. The expression of PGR mRNA was higher (P<0.01) on days 17-20 compared to days 6-10 and 11-16 of the estrous cycle and pregnancy. PGR-A and PGR-B protein levels were elevated on days 1-5 and 17-20 of the estrous cycle as compared to other stages of the cycle and during pregnancy. In conclusion, our results indicate that P4 may influence endometrial cells through both genomic and nongenomic way. This mechanism may contribute to the regulation of the estrous cycle and provide protection during pregnancy. Copyright © 2013 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  18. IMP mission

    NASA Technical Reports Server (NTRS)


    The program requirements and operations requirements for the IMP mission are presented. The satellite configuration is described and the missions are analyzed. The support equipment, logistics, range facilities, and responsibilities of the launching organizations are defined. The systems for telemetry, communications, satellite tracking, and satellite control are identified.

  19. RNA-binding Protein Insulin-like Growth Factor mRNA-binding Protein 3 (IMP-3) Promotes Cell Survival via Insulin-like Growth Factor II Signaling after Ionizing Radiation*

    PubMed Central

    Liao, Baisong; Hu, Yan; Brewer, Gary


    Ionizing radiation (IR) induces proapoptotic gene expression programs that inhibit cell survival. These programs often involve RNA-binding proteins that associate with their mRNA targets to elicit changes in mRNA stability and/or translation. The RNA-binding protein IMP-3 is an oncofetal protein overexpressed in many human malignancies. IMP-3 abundance correlates with tumor aggressiveness and poor prognosis. As such, IMP-3 is proving to be a highly significant biomarker in surgical pathology. Among its many mRNA targets, IMP-3 binds to and promotes translation of insulin-like growth factor II (IGFII) mRNA. Our earlier studies showed that reducing IMP-3 abundance with siRNAs reduced proliferation of human K562 chronic myeloid leukemia cells because of reduced IGF-II biosynthesis. However, the role of IMP-3 in apoptosis is unknown. Here, we have used IR-induced apoptosis of K562 cells as a model to explore a role for IMP-3 in cell survival. Knockdown of IMP-3 with siRNA increased susceptibility of cells to IR-induced apoptosis and led to reduced IGF-II production. Gene reporter assays revealed that IMP-3 acts through the 5′ UTR of IGFII mRNA during apoptosis to promote translation. Finally, culture of IR-treated cells with recombinant IGF-II partially reversed the effects of IMP-3 knockdown on IR-induced apoptosis. Together, these results indicate that IMP-3 acts in part through the IGF-II pathway to promote cell survival in response to IR. Thus, IMP-3 might serve as a new drug target to increase sensitivity of CML cells or other cancers to IR therapy. PMID:21757716

  20. RNA-binding protein insulin-like growth factor mRNA-binding protein 3 (IMP-3) promotes cell survival via insulin-like growth factor II signaling after ionizing radiation.


    Liao, Baisong; Hu, Yan; Brewer, Gary


    Ionizing radiation (IR) induces proapoptotic gene expression programs that inhibit cell survival. These programs often involve RNA-binding proteins that associate with their mRNA targets to elicit changes in mRNA stability and/or translation. The RNA-binding protein IMP-3 is an oncofetal protein overexpressed in many human malignancies. IMP-3 abundance correlates with tumor aggressiveness and poor prognosis. As such, IMP-3 is proving to be a highly significant biomarker in surgical pathology. Among its many mRNA targets, IMP-3 binds to and promotes translation of insulin-like growth factor II (IGFII) mRNA. Our earlier studies showed that reducing IMP-3 abundance with siRNAs reduced proliferation of human K562 chronic myeloid leukemia cells because of reduced IGF-II biosynthesis. However, the role of IMP-3 in apoptosis is unknown. Here, we have used IR-induced apoptosis of K562 cells as a model to explore a role for IMP-3 in cell survival. Knockdown of IMP-3 with siRNA increased susceptibility of cells to IR-induced apoptosis and led to reduced IGF-II production. Gene reporter assays revealed that IMP-3 acts through the 5' UTR of IGFII mRNA during apoptosis to promote translation. Finally, culture of IR-treated cells with recombinant IGF-II partially reversed the effects of IMP-3 knockdown on IR-induced apoptosis. Together, these results indicate that IMP-3 acts in part through the IGF-II pathway to promote cell survival in response to IR. Thus, IMP-3 might serve as a new drug target to increase sensitivity of CML cells or other cancers to IR therapy.

  1. IMP3 and p16 expression in squamous cell carcinoma of the head and neck: A comparative immunohistochemical analysis

    PubMed Central

    Riener, Marc-Oliver; Hoegel, Josef; Iro, Heinrich; Hartmann, Arndt; Agaimy, Abbas


    Expression of p16 has been established as a good surrogate marker for high-risk human papillomavirus (HPV) infection in oropharyngeal squamous cell carcinoma (OPSCC) patients, and it has been associated with an improved prognosis, irrespective of the actual HPV status. Conversely, the human insulin-like growth factor II mRNA binding protein 3 (IMP3) has been related to aggressiveness in several types of tumors. The aim of the present study was to investigate and compare p16 and IMP3 as markers of favorable and unfavorable behavior, respectively, in head and neck SCC (HNSCC), with particular reference to the HPV status. Both markers were analyzed by immunohistochemical analysis of 156 HNSCC samples originating from the oropharynx (n=81), oral cavity (n=44), larynx (n=15), hypopharynx (n=10) and nasopharynx (n=6). The HPV status was examined in a randomly selected representative subcohort (n=38) using polymerase chain reaction. Of the 156 HNSCC samples, 81 (51.9%) and 54 (34.6%) were positive for IMP3 and p16, respectively. IMP3 expression (P=0.022), p16 expression (P<0.001) and the combination of these markers (P<0.001) were significantly associated with tumor site. In particular, 69/81 (85%) OPSCC samples were positive for either one or both markers compared with 36/75 (48%) SCC samples from other sites. p16 expression was significantly associated with HPV infection (P=0.017) and a trend towards a negative association between IMP3 expression and HPV infection was observed (P=0.053). The results of the present study suggested that IMP3 and p16 are more frequently expressed in OPSCC compared with other HNSCCs. The prognostic impact of IMP3 on OPSCC remains to be investigated in a larger series with an extended follow-up period. PMID:28789393

  2. IMP-1 displays crosstalk with K-Ras and modulates colon cancer cell survival through the novel pro-apoptotic protein CYFIP2

    PubMed Central

    Mongroo, Perry S.; Noubissi, Felicite K.; Cuatrecasas, Miriam; Kalabis, Jiri; King, Catrina E.; Johnstone, Cameron N.; Bowser, Mark J.; Castells, Antoni; Spiegelman, Vladimir S.; Rustgi, Anil K.


    Insulin-like growth factor 2 mRNA-binding protein-1 (IMP-1) is an oncofetal protein that binds directly to and stabilizes oncogenic c-Myc and regulates in turn its post-transcriptional expression and translation. In contrast to normal adult tissue, IMP-1 is re-expressed and/or overexpressed in human cancers. We demonstrate that knock-down of c-Myc in human colon cancer cell lines increases the expression of mature let-7 miRNA family members and downregulates several of its mRNA targets: IMP-1, Cdc34, and K-Ras. We further demonstrate that loss of IMP-1 inhibits Cdc34, Lin-28B, and K-Ras, and suppresses SW-480 cell proliferation and anchorage-independent growth, and promotes caspase and lamin-mediated cell death. We also found that IMP-1 binds to the coding region and 3′UTR of K-Ras mRNA. RNA microarray profiling and validation by reverse transcription PCR reveals that the p53-inducible pro-apoptotic protein, CYFIP2, is upregulated in IMP-1 knock-down SW480 cells, a novel finding. We also show that overexpression of IMP-1 increases c-Myc and K-Ras expression, and LIM2405 cell proliferation. Furthermore, we show that loss of IMP-1 induces Caspase-3 and Parp–mediated apoptosis, and inhibits K-Ras expression in SW480 cells, which is rescued by CYFIP2 knock-down. Importantly, analysis of 228 patients with colon cancers reveals that IMP-1 is significantly upregulated in differentiated colon tumors (p ≤ 0.0001) and correlates with K-Ras expression (r=0.35, p ≤ 0.0001) relative to adjacent normal mucosa. These findings indicate that IMP-1, interrelated with c-myc, acts upstream of K-Ras to promote survival through a novel mechanism that may be important in colon cancer pathogenesis. PMID:21252116

  3. Specific Cooperation Between Imp-α2 and Imp-β/Ketel in Spindle Assembly During Drosophila Early Nuclear Divisions.


    Virágh, Erika; Gorjánácz, Mátyás; Török, István; Eichhorn, Tolga; Kallakuri, Sowjanya; Szlanka, Tamás; Kiss, István; Mechler, Bernard M


    The multifunctional factors Imp-α and Imp-β are involved in nuclear protein import, mitotic spindle dynamics, and nuclear membrane formation. Furthermore, each of the three members of the Imp-α family exerts distinct tasks during development. In Drosophila melanogaster, the imp-α2 gene is critical during oogenesis for ring canal assembly; specific mutations, which allow oogenesis to proceed normally, were found to block early embryonic mitosis. Here, we show that imp-α2 and imp-β genetically interact during early embryonic development, and we characterize the pattern of defects affecting mitosis in embryos laid by heterozygous imp-α2(D14) and imp-β(KetRE34) females. Embryonic development is arrested in these embryos but is unaffected in combinations between imp-β(KetRE34) and null mutations in imp-α1 or imp-α3. Furthermore, the imp-α2(D14)/imp-β(KetRE34) interaction could only be rescued by an imp-α2 transgene, albeit not imp-α1 or imp-α3, showing the exclusive imp-α2 function with imp-β. Use of transgenes carrying modifications in the major Imp-α2 domains showed the critical requirement of the nuclear localization signal binding (NLSB) site in this process. In the mutant embryos, we found metaphase-arrested mitoses made of enlarged spindles, suggesting an unrestrained activity of factors promoting spindle assembly. In accordance with this, we found that Imp-β(KetRE34) and Imp-β(KetD) bind a high level of RanGTP/GDP, and a deletion decreasing RanGTP level suppresses the imp-β(KetRE34) phenotype. These data suggest that a fine balance among Imp-α2, Imp-β, RanGTP, and the NLS cargos is critical for mitotic progression during early embryonic development.

  4. Specific Cooperation Between Imp-α2 and Imp-β/Ketel in Spindle Assembly During Drosophila Early Nuclear Divisions

    PubMed Central

    Virágh, Erika; Gorjánácz, Mátyás; Török, István; Eichhorn, Tolga; Kallakuri, Sowjanya; Szlanka, Tamás; Kiss, István; Mechler, Bernard M.


    The multifunctional factors Imp-α and Imp-β are involved in nuclear protein import, mitotic spindle dynamics, and nuclear membrane formation. Furthermore, each of the three members of the Imp-α family exerts distinct tasks during development. In Drosophila melanogaster, the imp-α2 gene is critical during oogenesis for ring canal assembly; specific mutations, which allow oogenesis to proceed normally, were found to block early embryonic mitosis. Here, we show that imp-α2 and imp-β genetically interact during early embryonic development, and we characterize the pattern of defects affecting mitosis in embryos laid by heterozygous imp-α2D14 and imp-βKetRE34 females. Embryonic development is arrested in these embryos but is unaffected in combinations between imp-βKetRE34 and null mutations in imp-α1 or imp-α3. Furthermore, the imp-α2D14/imp-βKetRE34 interaction could only be rescued by an imp-α2 transgene, albeit not imp-α1 or imp-α3, showing the exclusive imp-α2 function with imp-β. Use of transgenes carrying modifications in the major Imp-α2 domains showed the critical requirement of the nuclear localization signal binding (NLSB) site in this process. In the mutant embryos, we found metaphase-arrested mitoses made of enlarged spindles, suggesting an unrestrained activity of factors promoting spindle assembly. In accordance with this, we found that Imp-βKetRE34 and Imp-βKetD bind a high level of RanGTP/GDP, and a deletion decreasing RanGTP level suppresses the imp-βKetRE34 phenotype. These data suggest that a fine balance among Imp-α2, Imp-β, RanGTP, and the NLS cargos is critical for mitotic progression during early embryonic development. PMID:22384376

  5. IMP-3 expression in melanocytic lesions.


    Yu, Limin; Xu, Haodong; Wasco, Matthew J; Bourne, Patricia A; Ma, Linglei


    Insulin-like growth factor-II mRNA-binding protein 3 (IMP-3 ), a member of the insulin-like growth factor mRNA-binding protein family, is expressed in several human malignancies, including melanomas. However, the expression of IMP-3 has not been explored in melanoma in situ, various histologic subtypes of invasive melanomas and atypical Spitz tumors. IMP-3 immunostain was performed in 157 melanocytic lesions. Nearly all benign (8/8), dysplastic (8/8) and Spitz nevi (8/9) were negative for IMP-3. Focal IMP-3 positivity was observed in 5/12 melanoma in situ and 4/15 superficial melanomas (Breslow depth 1 mm) and 25/52 metastatic melanomas demonstrated strong IMP-3 staining. IMP-3 expression differs significantly between non-desmoplastic melanomas (superficial and deep) and benign or dysplastic or Spitz nevi (p = 0.0427, respectively). Four of 23 desmoplastic melanomas expressed IMP-3 , which was significantly different from deep melanomas (p = 0.0109). IMP-3 stained 7 of 10 atypical Spitz tumors. The difference between atypical Spitz tumors and Spitz nevi was statistically significant (p = 0.0256). A malignant circumstance, such as non-desmoplastic melanoma or atypical Spitz tumor, can be inferred when IMP-3 is expressed, suggesting potential diagnostic value of IMP-3 in melanocytic lesions.

  6. MART-1 peptide vaccination plus IMP321 (LAG-3Ig fusion protein) in patients receiving autologous PBMCs after lymphodepletion: results of a Phase I trial.


    Romano, Emanuela; Michielin, Olivier; Voelter, Verena; Laurent, Julien; Bichat, Hélène; Stravodimou, Athina; Romero, Pedro; Speiser, Daniel E; Triebel, Frédéric; Leyvraz, Serge; Harari, Alexandre


    Immunotherapy offers a promising novel approach for the treatment of cancer and both adoptive T-cell transfer and immune modulation lead to regression of advanced melanoma. However, the potential synergy between these two strategies remains unclear. We investigated in 12 patients with advanced stage IV melanoma the effect of multiple MART-1 analog peptide vaccinations with (n = 6) or without (n = 6) IMP321 (LAG-3Ig fusion protein) as an adjuvant in combination with lymphodepleting chemotherapy and adoptive transfer of autologous PBMCs at day (D) 0 (Trial registration No: NCT00324623). All patients were selected on the basis of ex vivo detectable MART-1-specific CD8 T-cell responses and immunized at D0, 8, 15, 22, 28, 52, and 74 post-reinfusion. After immunization, a significant expansion of MART-1-specific CD8 T cells was measured in 83% (n = 5/6) and 17% (n = 1/6) of patients from the IMP321 and control groups, respectively (P < 0.02). Compared to the control group, the mean fold increase of MART-1-specific CD8 T cells in the IMP321 group was respectively >2-, >4- and >6-fold higher at D15, D30 and D60 (P < 0.02). Long-lasting MART-1-specific CD8 T-cell responses were significantly associated with IMP321 (P < 0.02). At the peak of the response, MART-1-specific CD8 T cells contained higher proportions of effector (CCR7⁻ CD45RA⁺/⁻) cells in the IMP321 group (P < 0.02) and showed no sign of exhaustion (i.e. were mostly PD1⁻CD160⁻TIM3⁻LAG3⁻2B4⁺/⁻). Moreover, IMP321 was associated with a significantly reduced expansion of regulatory T cells (P < 0.04); consistently, we observed a negative correlation between the relative expansion of MART-1-specific CD8 T cells and of regulatory T cells. Finally, although there were no confirmed responses as per RECIST criteria, a transient, 30-day partial response was observed in a patient from the IMP321 group. Vaccination with IMP321 as an adjuvant in combination with

  7. MART-1 peptide vaccination plus IMP321 (LAG-3Ig fusion protein) in patients receiving autologous PBMCs after lymphodepletion: results of a Phase I trial

    PubMed Central


    Background Immunotherapy offers a promising novel approach for the treatment of cancer and both adoptive T-cell transfer and immune modulation lead to regression of advanced melanoma. However, the potential synergy between these two strategies remains unclear. Methods We investigated in 12 patients with advanced stage IV melanoma the effect of multiple MART-1 analog peptide vaccinations with (n = 6) or without (n = 6) IMP321 (LAG-3Ig fusion protein) as an adjuvant in combination with lymphodepleting chemotherapy and adoptive transfer of autologous PBMCs at day (D) 0 (Trial registration No: NCT00324623). All patients were selected on the basis of ex vivo detectable MART-1-specific CD8 T-cell responses and immunized at D0, 8, 15, 22, 28, 52, and 74 post-reinfusion. Results After immunization, a significant expansion of MART-1-specific CD8 T cells was measured in 83% (n = 5/6) and 17% (n = 1/6) of patients from the IMP321 and control groups, respectively (P < 0.02). Compared to the control group, the mean fold increase of MART-1-specific CD8 T cells in the IMP321 group was respectively >2-, >4- and >6-fold higher at D15, D30 and D60 (P < 0.02). Long-lasting MART-1-specific CD8 T-cell responses were significantly associated with IMP321 (P < 0.02). At the peak of the response, MART-1-specific CD8 T cells contained higher proportions of effector (CCR7− CD45RA+/−) cells in the IMP321 group (P < 0.02) and showed no sign of exhaustion (i.e. were mostly PD1−CD160−TIM3−LAG3−2B4+/−). Moreover, IMP321 was associated with a significantly reduced expansion of regulatory T cells (P < 0.04); consistently, we observed a negative correlation between the relative expansion of MART-1-specific CD8 T cells and of regulatory T cells. Finally, although there were no confirmed responses as per RECIST criteria, a transient, 30-day partial response was observed in a patient from the IMP321 group. Conclusions Vaccination with IMP321 as an

  8. The Cdc15 and Imp2 SH3 domains cooperatively scaffold a network of proteins that redundantly ensure efficient cell division in fission yeast

    PubMed Central

    Ren, Liping; Willet, Alaina H.; Roberts-Galbraith, Rachel H.; McDonald, Nathan A.; Feoktistova, Anna; Chen, Jun-Song; Huang, Haiming; Guillen, Rodrigo; Boone, Charles; Sidhu, Sachdev S.; Beckley, Janel R.; Gould, Kathleen L.


    Schizosaccharomyces pombe cdc15 homology (PCH) family members participate in numerous biological processes, including cytokinesis, typically by bridging the plasma membrane via their F-BAR domains to the actin cytoskeleton. Two SH3 domain–containing PCH family members, Cdc15 and Imp2, play critical roles in S. pombe cytokinesis. Although both proteins localize to the contractile ring, with Cdc15 preceding Imp2, only cdc15 is an essential gene. Despite these distinct roles, the SH3 domains of Cdc15 and Imp2 cooperate in the essential process of recruiting other proteins to stabilize the contractile ring. To better understand the connectivity of this SH3 domain–based protein network at the CR and its function, we used a biochemical approach coupled to proteomics to identify additional proteins (Rgf3, Art1, Spa2, and Pos1) that are integrated into this network. Cell biological and genetic analyses of these SH3 partners implicate them in a range of activities that ensure the fidelity of cell division, including promoting cell wall metabolism and influencing cell morphogenesis. PMID:25428987

  9. IMP: a multi-species functional genomics portal for integration, visualization and prediction of protein functions and networks.


    Wong, Aaron K; Park, Christopher Y; Greene, Casey S; Bongo, Lars A; Guan, Yuanfang; Troyanskaya, Olga G


    Integrative multi-species prediction (IMP) is an interactive web server that enables molecular biologists to interpret experimental results and to generate hypotheses in the context of a large cross-organism compendium of functional predictions and networks. The system provides a framework for biologists to analyze their candidate gene sets in the context of functional networks, as they expand or focus these sets by mining functional relationships predicted from integrated high-throughput data. IMP integrates prior knowledge and data collections from multiple organisms in its analyses. Through flexible and interactive visualizations, researchers can compare functional contexts and interpret the behavior of their gene sets across organisms. Additionally, IMP identifies homologs with conserved functional roles for knowledge transfer, allowing for accurate function predictions even for biological processes that have very few experimental annotations in a given organism. IMP currently supports seven organisms (Homo sapiens, Mus musculus, Rattus novegicus, Drosophila melanogaster, Danio rerio, Caenorhabditis elegans and Saccharomyces cerevisiae), does not require any registration or installation and is freely available for use at

  10. IMP-8 Magnetometer Experiment

    NASA Technical Reports Server (NTRS)

    Szabo, Adam


    IMP-8 (IMP-J) was launched by NASA on October 26, 1973 to measure the magnetic fields, plasmas, and energetic charged particles (e.g., cosmic rays) of the Earth's magnetotail and magnetosheath and of the near-Earth solar wind. IMP-8, the last often IMP (Interplanetary Monitoring Platform) or AIMP (Anchored-IMP) spacecraft launched in 10 years, operated until October 7, 2006, in a near-circular, 35 Earth Radii, 12-day orbit. It was an important adjunct to the International Solar Terrestrial Physics program, provided in-ecliptic, one Astronomical Unit baseline data for the deep space Pioneer, Voyager and Ulysses missions, and built a long-time-series database useful in understanding long-term solar processes .

  11. BRCA-mutated Invasive Breast Carcinomas: Immunohistochemical Analysis of Insulin-like Growth Factor II mRNA-binding Protein (IMP3), Cytokeratin 8/18, and Cytokeratin 14.


    Mohanty, Sambit K; Lai, Jin-Ping; Gordon, Ora K; Pradhan, Dinesh; Bose, Shikha; Dadmanesh, Farnaz


    To evaluate the expression of insulin-like growth factor II mRNA-binding protein (IMP3), CK8/18, and CK14 in BRCA mutated and sporadic invasive breast carcinoma. Immunohistochemistry for IMP3, CK8/18, and CK14 was performed on 39 cases of invasive breast carcinomas with BRCA mutation (24 BRCA1, 14 BRCA2, and 1 dual BRCA1/BRCA2) and 54 cases of sporadic invasive breast carcinomas. The relationship between the IMP3, CK8/18, and CK14 and the tumor grade and molecular phenotypes were analyzed. IMP3, CK8/18, and CK14 positivity were present in 20 (51%), 22 (56%), and 14 (36%) of 39 BRCA-mutated breast carcinomas, and 11 (20%), 53 (98%), and 24 (44%) of 54 sporadic breast carcinomas respectively. The rates of IMP3 expression and absence of CK8/18 (44% versus 2%) in BRCA-mutated breast carcinomas was significantly higher than the sporadic breast carcinomas (p = 0.002 and p < 0.001). No significant difference was observed for CK14 among the two groups (p = 0.408). No significant difference was observed among BRCA1-related and BRCA2-related breast carcinomas in the immunoprofile for IMP3, CK8/18, and CK14. No significant correlation was identified between the expression of IMP3 and CK8/18 and the tumor grade in both BRCA-mutated and sporadic breast carcinomas (p > 0.05). In cases with luminal A and B phenotypes, the rates of expression of IMP3 and loss of CK8/18 were significantly higher in BRCA-mutated as compared to sporadic breast carcinoma (p < 0.001). In cases with basal-like phenotype, the absence of CK8/18 expression was significantly higher in BRCA-mutated breast carcinomas (54% versus 0%, p = 0.001), while no difference was observed for IMP3 expression (p = 0.435). Regardless of mutation type, histologic grade, or molecular phenotype, the absence of CK8/18 expression and presence of IMP3 expression are seen at much higher rate in BRCA mutated breast carcinomas.

  12. IMP3 expression in serous tumors of the ovary.


    Chisté, Marcela; Alexis, John; Recine, Monica


    Insulin-like growth factor II mRNA-binding protein (IMP3) is an oncofetal protein involved in embryogenesis, which is expressed in a variety of malignant neoplasms. It is rarely expressed in normal adult tissue and benign tumors. The aim of this study was to evaluate the expression of IMP3 in benign and malignant serous tumors of the ovary. Seventy-nine ovarian tumors were examined for IMP3 expression by immunohistochemical analysis, comprising 16 benign serous tumors, 19 borderline serous tumors, and 44 serous carcinomas. Positive staining was defined as brown staining in the cytoplasm. Negative staining was defined as absent staining or staining of <5% of tumor cells. The intensity of staining (weak, moderate, and strong) and percentage (0% to 100%) of neoplastic cells staining positive for cytoplasmic IMP3 staining were recorded in each case. Moderate to strong cytoplasmic staining for IMP3 was observed in 30 of 44 (68%) serous carcinomas of the ovary; in contrast, <5% of the borderline and benign serous tumors expressed IMP3 ranging from weak to strong cytoplasmic staining. Statistically, the difference in IMP3 expression between these groups of tumors was highly significant (P<0.0001). Our findings demonstrate moderate to strong expression of IMP3 in the majority of ovarian serous carcinomas as compared with benign/borderline serous tumors, which demonstrated weak to strong expression in a small minority (<5%) of the tumors. Thus, IMP3 may be a useful adjunctive tool in the pathologic evaluation of ovarian serous tumors.

  13. IMP series report/bibliography

    NASA Technical Reports Server (NTRS)

    King, J. H.


    The main characteristics of the IMP spacecraft and experiments are considered and the scientific knowledge gained is presented in the form of abstracts of scientific papers using IMP data. Spacecraft characteristics, including temporal and spatial coverages, are presented followed by an annotated bibliography. Experiments conducted on all IMP's (including prelaunch IMP's H and J) are described. Figures are presented showing the time histories, through the end of 1970, of magnetic field, plasma, and energetic particle experiments.

  14. IMP-1 Satellite

    NASA Technical Reports Server (NTRS)

    Alvarez, H.


    Computer programs and procedures developed to process type 3 burst data obtained by IMP-6 are given. Data are primarily concerned with bursts that drift down to 130 kHz or lower. Graphical methods devised fit models to data are also considered. Burst time of arrival as well as direction of arrival were determined for several frequencies.

  15. IMP3 Predicts Invasion and Prognosis in Human Lung Adenocarcinoma.


    Yan, Jinhai; Wei, Qingzhu; Jian, Wenjing; Qiu, Bo; Wen, Jing; Liu, Jianghuan; Fu, Bo; Zhou, Xinhua; Zhao, Tong


    Insulin-like growth factor II mRNA-binding protein 3 (IMP3) is an oncofetal protein associated with several aggressive and advanced cancers. Whether IMP3 can predict invasion, and prognosis in patients with human lung adenocarcinoma (LAC) remains unclear. Ninety-five LAC and 75 non-tumor lung tissue samples were included in a tissue microarray. IMP3 expression was assessed by immunohistochemical examination. Correlation between IMP3 expression levels, clinicopathological characteristics, and overall prognosis was evaluated. In a separate in vitro study, RNA interference method was applied for knockdown of IMP3 gene in human LAC cell lines. Invasive potential of LAC cells was then evaluated by transwell migration assay. IMP3 immunoreactivity was observed in 39 out of 95 (41.1 %) LAC patients, but not in non-tumor lung tissues. IMP3 expression levels were closely associated with histological grade (P = 0.037), TNM stage (P = 0.034), and lymph node metastasis (P = 0.011). Patients presenting with positive IMP3 expression (P = 0.000), an advanced TNM stage (P = 0.000), and lymph node metastasis (P = 0.001) had a worse overall survival, compared to those lacking these characteristics. Both IMP3 expression (hazard ratio [HR], 2.310; 95 % confidence interval [CI] 1.192-4.476; P = 0.013) and TNM stage (HR 2.338; 95 % CI 1.393-3.925; P = 0.001) were independent predictors of poor prognosis. The invasive potential of LAC cells was significantly inhibited by IMP3 knockdown. IMP3 appears to play an important role in tumor invasion in patients with LAC and may serve as a useful prognostic biomarker in these patients.

  16. IMP 2.0: a multi-species functional genomics portal for integration, visualization and prediction of protein functions and networks.


    Wong, Aaron K; Krishnan, Arjun; Yao, Victoria; Tadych, Alicja; Troyanskaya, Olga G


    IMP (Integrative Multi-species Prediction), originally released in 2012, is an interactive web server that enables molecular biologists to interpret experimental results and to generate hypotheses in the context of a large cross-organism compendium of functional predictions and networks. The system provides biologists with a framework to analyze their candidate gene sets in the context of functional networks, expanding or refining their sets using functional relationships predicted from integrated high-throughput data. IMP 2.0 integrates updated prior knowledge and data collections from the last three years in the seven supported organisms (Homo sapiens, Mus musculus, Rattus norvegicus, Drosophila melanogaster, Danio rerio, Caenorhabditis elegans, and Saccharomyces cerevisiae) and extends function prediction coverage to include human disease. IMP identifies homologs with conserved functional roles for disease knowledge transfer, allowing biologists to analyze disease contexts and predictions across all organisms. Additionally, IMP 2.0 implements a new flexible platform for experts to generate custom hypotheses about biological processes or diseases, making sophisticated data-driven methods easily accessible to researchers. IMP does not require any registration or installation and is freely available for use at


    NASA Technical Reports Server (NTRS)

    Dauro, V. A.


    IMP is a simulation language that is used to model missions around the Earth, Moon, Mars, or other planets. It has been used to model missions for the Saturn Program, Apollo Program, Space Transportation System, Space Exploration Initiative, and Space Station Freedom. IMP allows a user to control the mission being simulated through a large event/maneuver menu. Up to three spacecraft may be used: a main, a target and an observer. The simulation may begin at liftoff, suborbital, or orbital. IMP incorporates a Fehlberg seventh order, thirteen evaluation Runge-Kutta integrator with error and step-size control to numerically integrate the equations of motion. The user may choose oblate or spherical gravity for the central body (Earth, Mars, Moon or other) while a spherical model is used for the gravity of an additional perturbing body. Sun gravity and pressure and Moon gravity effects are user-selectable. Earth/Mars atmospheric effects can be included. The optimum thrust guidance parameters are calculated automatically. Events/maneuvers may involve many velocity changes, and these velocity changes may be impulsive or of finite duration. Aerobraking to orbit is also an option. Other simulation options include line-of-sight communication guidelines, a choice of propulsion systems, a soft landing on the Earth or Mars, and rendezvous with a target vehicle. The input/output is in metric units, with the exception of thrust and weight which are in English units. Input is read from the user's input file to minimize real-time keyboard input. Output includes vehicle state, orbital and guide parameters, event and total velocity changes, and propellant usage. The main output is to the user defined print file, but during execution, part of the input/output is also displayed on the screen. An included FORTRAN program, TEKPLOT, will display plots on the VDT as well as generating a graphic file suitable for output on most laser printers. The code is double precision. IMP is written in


    NASA Technical Reports Server (NTRS)

    Dauro, V. A.


    IMP is a simulation language that is used to model missions around the Earth, Moon, Mars, or other planets. It has been used to model missions for the Saturn Program, Apollo Program, Space Transportation System, Space Exploration Initiative, and Space Station Freedom. IMP allows a user to control the mission being simulated through a large event/maneuver menu. Up to three spacecraft may be used: a main, a target and an observer. The simulation may begin at liftoff, suborbital, or orbital. IMP incorporates a Fehlberg seventh order, thirteen evaluation Runge-Kutta integrator with error and step-size control to numerically integrate the equations of motion. The user may choose oblate or spherical gravity for the central body (Earth, Mars, Moon or other) while a spherical model is used for the gravity of an additional perturbing body. Sun gravity and pressure and Moon gravity effects are user-selectable. Earth/Mars atmospheric effects can be included. The optimum thrust guidance parameters are calculated automatically. Events/maneuvers may involve many velocity changes, and these velocity changes may be impulsive or of finite duration. Aerobraking to orbit is also an option. Other simulation options include line-of-sight communication guidelines, a choice of propulsion systems, a soft landing on the Earth or Mars, and rendezvous with a target vehicle. The input/output is in metric units, with the exception of thrust and weight which are in English units. Input is read from the user's input file to minimize real-time keyboard input. Output includes vehicle state, orbital and guide parameters, event and total velocity changes, and propellant usage. The main output is to the user defined print file, but during execution, part of the input/output is also displayed on the screen. An included FORTRAN program, TEKPLOT, will display plots on the VDT as well as generating a graphic file suitable for output on most laser printers. The code is double precision. IMP is written in

  19. Integrative structure modeling with IMP.


    Webb, Benjamin; Viswanath, Shruthi; Bonomi, Massimiliano; Pellarin, Riccardo; Greenberg, Charles H; Saltzberg, Daniel; Sali, Andrej


    Building models of a biological system that are consistent with the myriad data available is one of the key challenges in biology. Modeling the structure and dynamics of macromolecular assemblies, for example, can give insights into how biological systems work, evolved, might be controlled, and even designed. Integrative structure modeling casts the building of structural models as a computational optimization problem, for which information about the assembly is encoded into a scoring function that evaluates candidate models. Here, we describe our open source software suite for integrative structure modeling, Integrative Modeling Platform (IMP) (, and demonstrate its use. This article is protected by copyright. All rights reserved. © 2017 The Protein Society.

  20. Detection of a phylogenetically distinct IMP-type metallo-β-lactamase, IMP-35, in a CC235 Pseudomonas aeruginosa from the Dutch-German border region (Euregio).


    Pournaras, Spyros; Köck, Robin; Mossialos, Dimitris; Mellmann, Alexander; Sakellaris, Viktoras; Stathopoulos, Constantinos; Friedrich, Alexander W; Tsakris, Athanassios


    To characterize a highly divergent IMP-type metallo-β-lactamase (MBL) variant detected in a multidrug-resistant Pseudomonas aeruginosa clinical isolate. P. aeruginosa isolate 1876 was recovered from an anal swab of an inpatient at a German hospital in the Dutch-German border region (Euregio), where cross-border patient healthcare occurs. MICs were determined by agar dilution and phenotypic screening for MBL production by Etest MBL. Typing was performed by multilocus sequence typing (MLST). PCR assays and nucleotide sequencing were employed for identification of bla gene types. The class 1 integron carrying the blaIMP-type gene was characterized by PCR mapping and sequencing using a set of specific primers. A phylogenetic tree was constructed for the new blaIMP variant. Isolate 1876 was phenotypically positive for MBL production, exhibited resistance to carbapenems and harboured a new blaIMP-type gene, blaIMP-35. MLST showed that the allelic profile corresponded to ST622, which belongs to the prevalent international clonal complex CC235. The blaIMP-35 gene was located in a class 1 integron as the first gene cassette, followed by blaOXA-35, aacA6, qacEΔ1 and sul1, suggesting its recent integration. IMP-35 was highly divergent, possessing 33/246 (13.4%) different amino acid residues from its closest IMP variants (IMP-8 and IMP-12) and was phylogenetically distinct, representing a separate group in the phylogenetic tree of IMP proteins. The identification of this phylogenetically distinct IMP-type variant in a CC235 P. aeruginosa suggests the ongoing spread of new IMP-type carbapenemases as well as the potential of the blaIMP-35 gene to evolve in the hospital environment.

  1. IMP: A performance code

    NASA Technical Reports Server (NTRS)

    Dauro, Vincent A., Sr.


    IMP (Integrated Mission Program) is a simulation language and code used to model present and future Earth, Moon, or Mars missions. The profile is user controlled through selection from a large menu of events and maneuvers. A Fehlberg 7/13 Runge-Kutta integrator with error and step size control is used to numerically integrate the differential equations of motion (DEQ) of three spacecraft, a main, a target, and an observer. Through selection, the DEQ's include guided thrust, oblate gravity, atmosphere drag, solar pressure, and Moon gravity effects. Guide parameters for thrust events and performance parameters of velocity changes (Delta-V) and propellant usage (maximum of five systems) are developed as needed. Print, plot, summary, and debug files are output.

  2. An oncofetal antigen, IMP-3-derived long peptides induce immune responses of both helper T cells and CTLs

    PubMed Central

    Hirayama, Masatoshi; Tomita, Yusuke; Yuno, Akira; Tsukamoto, Hirotake; Senju, Satoru; Imamura, Yuya; Sayem, Mohammad Abu; Irie, Atsushi; Yoshitake, Yoshihiro; Fukuma, Daiki; Shinohara, Masanori; Hamada, Akinobu; Jono, Hirofumi; Yuba, Eiji; Kono, Kenji; Yoshida, Koji; Tsunoda, Takuya; Nakayama, Hideki; Nishimura, Yasuharu


    ABSTRACT Insulin-like growth factor II mRNA-binding protein 3 (IMP-3), an oncofetal antigen identified using genome-wide cDNA microarray analyses, is overexpressed in several malignancies. IMP-3-derived cytotoxic T lymphocyte (CTL) epitopes have been used for peptide-based immunotherapies against various cancers. In addition to CTLs, induction of tumor-associated antigen (TAA)-specific helper T (Th) cells is crucial for establishment of effective antitumor immunity. In this study, we aimed to identify IMP-3-derived long peptides (IMP-3-LPs) carrying CTL and promiscuous Th-cell epitopes for use in cancer immunotherapy. IMP-3-derived Th-cell epitopes that bind to multiple HLA-class II molecules were predicted by in silico analysis, and their immunogenicity was determined by utilizing human T cells. We identified two highly immunogenic IMP-3-LPs presented by multiple HLA-class II molecules. One of the IMP-3-LPs encompassed two CTL epitopes that have been used for peptide-vaccine immunotherapy in ongoing clinical trials. IMP-3-LPs-specific Th cells responded to autologous dendritic cells (DCs) loaded with the recombinant IMP-3 proteins, suggesting that these s (LPs) can be naturally processed and presented. The IMP-3-LPs and specific Th cells augmented the expansion of IMP-3-specific CTLs, which was further enhanced by programmed cell death-1 (PD-1) blockade. In addition, IMP-3-LP encapsulated in liposomes was efficiently cross-presented in vitro, and this LP successfully cross-primed CTLs in HLA-A2 transgenic mice (Tgm) in vivo. Furthermore, one of the IMP-3-LPs induced IMP-3-specific Th cells from peripheral blood mononuclear cells (PBMCs) of head-and-neck malignant tumor (HNMT) patients. These findings suggest the potential usefulness of IMP-3-LPs in propagating both Th cells and CTLs and may have implications for IMP-3-LPs-based cancer immunotherapy. PMID:27471607

  3. An oncofetal antigen, IMP-3-derived long peptides induce immune responses of both helper T cells and CTLs.


    Hirayama, Masatoshi; Tomita, Yusuke; Yuno, Akira; Tsukamoto, Hirotake; Senju, Satoru; Imamura, Yuya; Sayem, Mohammad Abu; Irie, Atsushi; Yoshitake, Yoshihiro; Fukuma, Daiki; Shinohara, Masanori; Hamada, Akinobu; Jono, Hirofumi; Yuba, Eiji; Kono, Kenji; Yoshida, Koji; Tsunoda, Takuya; Nakayama, Hideki; Nishimura, Yasuharu


    Insulin-like growth factor II mRNA-binding protein 3 (IMP-3), an oncofetal antigen identified using genome-wide cDNA microarray analyses, is overexpressed in several malignancies. IMP-3-derived cytotoxic T lymphocyte (CTL) epitopes have been used for peptide-based immunotherapies against various cancers. In addition to CTLs, induction of tumor-associated antigen (TAA)-specific helper T (Th) cells is crucial for establishment of effective antitumor immunity. In this study, we aimed to identify IMP-3-derived long peptides (IMP-3-LPs) carrying CTL and promiscuous Th-cell epitopes for use in cancer immunotherapy. IMP-3-derived Th-cell epitopes that bind to multiple HLA-class II molecules were predicted by in silico analysis, and their immunogenicity was determined by utilizing human T cells. We identified two highly immunogenic IMP-3-LPs presented by multiple HLA-class II molecules. One of the IMP-3-LPs encompassed two CTL epitopes that have been used for peptide-vaccine immunotherapy in ongoing clinical trials. IMP-3-LPs-specific Th cells responded to autologous dendritic cells (DCs) loaded with the recombinant IMP-3 proteins, suggesting that these s (LPs) can be naturally processed and presented. The IMP-3-LPs and specific Th cells augmented the expansion of IMP-3-specific CTLs, which was further enhanced by programmed cell death-1 (PD-1) blockade. In addition, IMP-3-LP encapsulated in liposomes was efficiently cross-presented in vitro, and this LP successfully cross-primed CTLs in HLA-A2 transgenic mice (Tgm) in vivo. Furthermore, one of the IMP-3-LPs induced IMP-3-specific Th cells from peripheral blood mononuclear cells (PBMCs) of head-and-neck malignant tumor (HNMT) patients. These findings suggest the potential usefulness of IMP-3-LPs in propagating both Th cells and CTLs and may have implications for IMP-3-LPs-based cancer immunotherapy.

  4. Male-specific splicing of the silkworm Imp gene is maintained by an autoregulatory mechanism.


    Suzuki, Masataka G; Kobayashi, Sayaka; Aoki, Fugaku


    Sexual differentiation in the silkworm Bombyx mori is controlled by sex-specific splicing of Bmdsx, in which exons 3 and 4 are skipped in males. B. mori insulin-like growth factor II mRNA-binding protein (Imp) is a factor involved in the male-specific splicing of Bmdsx. In this study, we found that the male-specific Imp mRNA is formed as a result of the inclusion of exon 8 and the promoter-distal poly(A) site choice, whereas non-sex-specific polyadenylation occurs at the promoter-proximal poly(A) site downstream of exon 7. Recent studies revealed that Drosophila Sxl, tra in several dipteran and hymenopteran insects, and fem in Apis mellifera, play a central role in sex determination and maintain their productive mode of expression via an autoregulatory function. To determine whether Imp protein is required for the maintenance of the male-specific splicing of its own pre-mRNA, we knocked down endogenous Imp in male cells and assessed the male-specific splicing of an exogenous Imp minigene. Knockdown of endogenous Imp inhibited the male-specific splicing of the Imp minigene transcript. In contrast, overexpression of Imp in female cells induced the male-specific splicing of the Imp minigene transcript. Moreover, deletion of adenine-rich (A-rich) sequences located downstream of the proximal poly(A) site repressed the male-specific splicing of the Imp minigene transcript. Finally, gel shift analysis demonstrated that Imp binds to the A-rich sequences. These data suggest that Imp binds to the A-rich sequences in its own pre-mRNA to induce the male-specific splicing of its pre-mRNA.

  5. IMP I, H, and J

    NASA Technical Reports Server (NTRS)


    The schedule for the IMP project for the eighth, ninth, and tenth satellites of the series is presented. A description of the spacecraft and the weekly summaries of the operations performed on the spacecraft are provided. The project planning, project problems, recommendations, and reports of launch operations are described. Drawings of the satellite structures are included.

  6. Insight into stereochemistry of a new IMP allelic variant (IMP-55) metallo-β-lactamase identified in a clinical strain of Acinetobacter baumannii.


    Shakibaie, Mohammad Reza; Azizi, Omid; Shahcheraghi, Fereshteh


    Metallo-β-lactamases (MBLs) such as IMPs are broad-spectrum β-lactamases that inactivate virtually all β-lactam antibiotics including carbapenems. In this study, we investigated the hydrolytic activity, phylogenetic relationship, three dimensional (3D) structure including zinc binding motif of a new IMP variant (IMP-55) identified in a clinical strain of Acinetobacter baumannii (AB). AB strain 56 was isolated from an adult ICU of a teaching hospital in Kerman, Iran. It exhibited MIC 32μg/ml to imipenem and showed MBL activity. Hydrolytic property of the MBL enzyme was measured phenotypically. Presence of blaIMP gene encoded by class 1 integrons was detected by PCR-sequencing. Phylogenetic tree of IMP protein was constructed using the Unweighted Pair Group Method with Arithmetic Mean (UPGMA) and 3D model including zinc binding motif was predicted by bioinformatics softwares. Analysis of IMP sequence led to the identification of a novel IMP-type designated as IMP-55 (GenBank: KU299753.1; UniprotKB: A0A0S2MTX2). Impact in term of hydrolytic activity compared to the closest variants suggested efficient imipenem hydrolysis by this enzyme. Evolutionary distance matrix assessment indicated that IMP-55 protein is not closely related to other A. baumannii IMPs, however, shared 98% homology with Escherichia coli IMP-30 (UniprotKB: A0A0C5PJR0) and Pseudomonas aeruginosa IMP-1 (UniprotKB: Q19KT1). It consisted of five α-helices, ten β-sheets and six loops. A monovalent zinc ion attached to core of enzyme via His95, His97, His157 and Cys176. Multiple amino acid sequence alignments and mutational trajectory with reported IMPs showed 4 amino acid substitutions at positions 12(Phe→Ile), 31(Asp→Glu), 172(Leu→Phe) and 185(Asn→Lys). We suggest that the pleiotropic effect of mutations due to frequent administration of imipenem is responsible for emergence of new IMP variant in our hospitals. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. The Sequence-Activity Relationship between Metallo-β-Lactamases IMP-1, IMP-6, and IMP-25 Suggests an Evolutionary Adaptation to Meropenem Exposure

    PubMed Central

    Liu, Eleanor M.; Pegg, Kevin M.


    Metallo-β-lactamases are important determinants of antibacterial resistance. In this study, we investigate the sequence-activity relationship between the closely related enzymes IMP-1, IMP-6, and IMP-25. While IMP-1 is the more efficient enzyme across the overall spectrum of tested β-lactam antibacterial agents, IMP-6 and IMP-25 seem to have evolved to specifically inactivate the newer carbapenem meropenem. Molecular modeling indicates that the G235S mutation distinguishing IMP-25 from IMP-1 and IMP-6 may affect enzyme activity via Asn233. PMID:23006757

  8. The sequence-activity relationship between metallo-β-lactamases IMP-1, IMP-6, and IMP-25 suggests an evolutionary adaptation to meropenem exposure.


    Liu, Eleanor M; Pegg, Kevin M; Oelschlaeger, Peter


    Metallo-β-lactamases are important determinants of antibacterial resistance. In this study, we investigate the sequence-activity relationship between the closely related enzymes IMP-1, IMP-6, and IMP-25. While IMP-1 is the more efficient enzyme across the overall spectrum of tested β-lactam antibacterial agents, IMP-6 and IMP-25 seem to have evolved to specifically inactivate the newer carbapenem meropenem. Molecular modeling indicates that the G235S mutation distinguishing IMP-25 from IMP-1 and IMP-6 may affect enzyme activity via Asn233.

  9. IMP-29, a novel IMP-type metallo-β-lactamase in Pseudomonas aeruginosa.


    Jeannot, Katy; Poirel, Laurent; Robert-Nicoud, Marjorie; Cholley, Pascal; Nordmann, Patrice; Plésiat, Patrick


    Analysis of two clonally related multiresistant Pseudomonas aeruginosa isolates led to the identification of a novel IMP-type metallo-β-lactamase. IMP-29 was significantly different from the other IMP variants (the closest variant being IMP-5 with 93% amino acid identity). The bla(IMP-29) gene cassette was carried by a class 1 integron in strain 10.298, while in strain 10.266 it was located in a rearranged DNA region on a 30-kb conjugative plasmid. Biochemical analysis confirmed that IMP-29 efficiently hydrolyzed carbapenems.

  10. Rapid discrimination of blaIMP-1, blaIMP-6, and blaIMP-34 using a multiplex PCR.


    Kayama, Shizuo; Ohge, Hiroki; Sugai, Motoyuki


    Stealth-type carbapenem-resistant Enterobacteriaceae that are resistant to almost all β-lactams except imipenem is emerging in Japan. This resistance is mediated by specific variants of the metallo-β-lactamases (blaIMP-6 or blaIMP-34) that differs by one amino acid from the common variant blaIMP-1. We developed an amplification refractory mutation system (ARMS) PCR assay enabling rapid, sequence independent, identification of these variants.

  11. Availability of IMP-7 and IMP-8 data for the IMS period

    NASA Technical Reports Server (NTRS)

    King, J. H.


    The relation of IMP-7 and IMP-8 data to the International Magnetospheric Study is discussed. Relevant spacecraft and experiment characteristics, and the nature and accessibility of data from each experiment, are identified. Finally the potential value of IMP data in IMS studies is illustrated with a few citations from the IMP Bibliography and with figures from a recent multiple-data-set magnetotail plasma sheet study.

  12. IMP2, a gene involved in the expression of glucose-repressible genes in Saccharomyces cerevisiae.


    Lodi, T; Goffrini, P; Ferrero, I; Donnini, C


    Two mutants carrying different deletions of the IMP2 coding sequence of Saccharomyces cerevisiae, delta T1, which encodes a protein lacking the last 26 C-terminal amino acids, and delta T2, which completely lacks the coding region, were analysed for derepression of glucose-repressible maltose, galactose, raffinose and ethanol utilization pathways in response to glucose limitation. The role of the IMP2 gene product in the regulation of carbon catabolite repressible enzymes maltase, invertase, alcohol dehydrogenase, NAD-dependent glutamate dehydrogenase (NAD-GDH) and L-lactate:ferricytochrome-c oxidoreductase (L-LCR) was also analysed. The IMP2 gene product is required for the rapid glucose derepression of all above-mentioned carbon source utilization pathways and of all the enzymes except for L-LCR. NAD-GDH is regulated by IMP2 in the opposite way and, in fact, this enzyme was released at higher levels in both imp2 mutants than in the wild-type strain. Therefore, the product of IMP2 appears to be involved in positive and negative regulation. Both deletions result in growth and catalytic defects; in some cases partial modification of the gene product yielded more dramatic effects than its complete absence. Moreover, evidence is provided that the IMP2 gene product regulates galactose- and maltose-inducible genes at the transcriptional level and is a positive regulator of maltase, maltose permease and galactose permease gene expression.

  13. Mode of IMP and pyrophosphate enhancement of myosin and actin extraction from porcine meat.


    Nakamura, Yukinobu; Migita, Koshiro; Okitani, Akihiro; Matsuishi, Masanori


    We examined the mode of IMP and pyrophosphate enhancement of myosin and actin extraction from porcine meat. Extractabilities were determined after homogenates, prepared by adding 9 volumes of 0.3, 0.4, or 0.5 M NaCl solutions containing 0 to 36 mM IMP and 0 to 9 mM tetrapotassium pyrophosphate (KPP) to minced pork, were incubated at 4 °C for 0 or 12 h. Irrespective of the NaCl concentrations, IMP-induced extraction of both proteins increased with increasing extraction time. In contrast, that of KPP did not. When 0.3 M NaCl solutions containing both IMP and KPP were used, the solutions with 1.5 mM KPP showed marked enhancement of IMP-induced myosin and actin extraction. Incorporating these results with our previously published data (Nakamura et al., Biosci. Biotechnol. Biochem., 76, 1611-1615 (2012)), we hypothesized that IMP and KPP have the ability to release thick and thin filaments from restraints in myofibrils, in addition to the ability to dissociate actomyosin into myosin and actin, and that the restraint-releasing ability of IMP is dependent on reaction time and NaCl concentration while that of KPP is not.

  14. Post-transcriptional regulation of cyclins D1, D3 and G1 and proliferation of human cancer cells depend on IMP-3 nuclear localization.


    Rivera Vargas, T; Boudoukha, S; Simon, A; Souidi, M; Cuvellier, S; Pinna, G; Polesskaya, A


    RNA-binding proteins of the IMP family (insulin-like growth factor 2 (IGF2) mRNA-binding proteins 1-3) are important post-transcriptional regulators of gene expression. Multiple studies have linked high expression of IMP proteins, and especially of IMP-3, to an unfavorable prognosis in numerous types of cancer. The specific importance of IMP-3 for cancer transformation remains poorly understood. We here show that all three IMPs can directly bind the mRNAs of cyclins D1, D3 and G1 (CCND1, D3 and G1) in vivo and in vitro, and yet only IMP-3 regulates the expression of these cyclins in a significant manner in six human cancer cell lines of different origins. In the absence of IMP-3, the levels of CCND1, D3 and G1 proteins fall dramatically, and the cells accumulate in the G1 phase of the cell cycle, leading to almost complete proliferation arrest. Our results show that, compared with IMP-1 and IMP-2, IMP-3 is enriched in the nucleus, where it binds the transcripts of CCND1, D3 and G1. The nuclear localization of IMP-3 depends on its protein partner HNRNPM and is indispensable for the post-transcriptional regulation of expression of the cyclins. Cytoplasmic retention of IMP-3 and HNRNPM in human cancer cells leads to significant drop in proliferation. In conclusion, a nuclear IMP-3-HNRNPM complex is important for the efficient synthesis of CCND1, D3 and G1 and for the proliferation of human cancer cells.

  15. Understanding the determinants of substrate specificity in IMP family metallo-β-lactamases: the importance of residue 262.


    Pegg, Kevin M; Liu, Eleanor M; George, Alex C; LaCuran, Alecander E; Bethel, Christopher R; Bonomo, Robert A; Oelschlaeger, Peter


    In Gram-negative bacteria, resistance to β-lactam antibacterials is largely due to β-lactamases and is a growing public health threat. One of the most concerning β-lactamases to evolve in bacteria are the Class B enzymes, the metallo-β-lactamases (MBLs). To date, penams and cephems resistant to hydrolysis by MBLs have not yet been found. As a result of this broad substrate specificity, a better understanding of the role of catalytically important amino acids in MBLs is necessary to design novel β-lactams and inhibitors. Two MBLs, the wild type IMP-1 with serine at position 262, and an engineered variant with valine at the same position (IMP-1-S262V), were previously found to exhibit very different substrate spectra. These findings compelled us to investigate the impact of a threonine at position 262 (IMP-1-S262T) on the substrate spectrum. Here, we explore MBL sequence-structure-activity relationships by predicting and experimentally validating the effect of the S262T substitution in IMP-1. Using site-directed mutagenesis, threonine was introduced at position 262, and the IMP-1-S262T enzyme, as well as the other two enzymes IMP-1 and IMP-1-S262V, were purified and kinetic constants were determined against a range of β-lactam antibacterials. Catalytic efficiencies (kcat /KM ) obtained with IMP-1-S262T and minimum inhibitory concentrations (MICs) observed with bacterial cells expressing the protein were intermediate or comparable to the corresponding values with IMP-1 and IMP-1-S262V, validating the role of this residue in catalysis. Our results reveal the important role of IMP residue 262 in β-lactam turnover and support this approach to predict activities of certain novel MBL variants. © 2014 The Protein Society.

  16. IMP-43 and IMP-44 Metallo-β-Lactamases with Increased Carbapenemase Activities in Multidrug-Resistant Pseudomonas aeruginosa

    PubMed Central

    Tada, Tatsuya; Miyoshi-Akiyama, Tohru; Shimada, Kayo; Shimojima, Masahiro


    Two novel IMP-type metallo-β-lactamase variants, IMP-43 and IMP-44, were identified in multidrug-resistant Pseudomonas aeruginosa isolates obtained in medical settings in Japan. Analysis of their predicted amino acid sequences revealed that IMP-43 had an amino acid substitution (Val67Phe) compared with IMP-7 and that IMP-44 had two substitutions (Val67Phe and Phe87Ser) compared with IMP-11. The amino acid residue at position 67 is located at the end of a loop close to the active site, consisting of residues 60 to 66 in IMP-1, and the amino acid residue at position 87 forms a hydrophobic patch close to the active site with other amino acids. An Escherichia coli strain expressing blaIMP-43 was more resistant to doripenem and meropenem but not to imipenem than one expressing blaIMP-7. An E. coli strain expressing blaIMP-44 was more resistant to doripenem, imipenem and meropenem than one expressing blaIMP-11. IMP-43 had more efficient catalytic activities against all three carbapenems than IMP-7, indicating that the Val67Phe substitution contributed to increased catalytic activities against carbapenems. IMP-44 had more efficient catalytic activities against all carbapenems tested than IMP-11, as well as increased activities compared with IMP-43, indicating that both the Val67Phe and Phe87Ser substitutions contributed to increased catalytic activities against carbapenems. PMID:23836174

  17. IMP-43 and IMP-44 metallo-β-lactamases with increased carbapenemase activities in multidrug-resistant Pseudomonas aeruginosa.


    Tada, Tatsuya; Miyoshi-Akiyama, Tohru; Shimada, Kayo; Shimojima, Masahiro; Kirikae, Teruo


    Two novel IMP-type metallo-β-lactamase variants, IMP-43 and IMP-44, were identified in multidrug-resistant Pseudomonas aeruginosa isolates obtained in medical settings in Japan. Analysis of their predicted amino acid sequences revealed that IMP-43 had an amino acid substitution (Val67Phe) compared with IMP-7 and that IMP-44 had two substitutions (Val67Phe and Phe87Ser) compared with IMP-11. The amino acid residue at position 67 is located at the end of a loop close to the active site, consisting of residues 60 to 66 in IMP-1, and the amino acid residue at position 87 forms a hydrophobic patch close to the active site with other amino acids. An Escherichia coli strain expressing blaIMP-43 was more resistant to doripenem and meropenem but not to imipenem than one expressing blaIMP-7. An E. coli strain expressing blaIMP-44 was more resistant to doripenem, imipenem and meropenem than one expressing blaIMP-11. IMP-43 had more efficient catalytic activities against all three carbapenems than IMP-7, indicating that the Val67Phe substitution contributed to increased catalytic activities against carbapenems. IMP-44 had more efficient catalytic activities against all carbapenems tested than IMP-11, as well as increased activities compared with IMP-43, indicating that both the Val67Phe and Phe87Ser substitutions contributed to increased catalytic activities against carbapenems.

  18. Diagnostic value of immunohistochemical IMP3 expression in core needle biopsies of pancreatic ductal adenocarcinoma.


    Wachter, David Lukas; Schlabrakowski, Anne; Hoegel, Josef; Kristiansen, Glen; Hartmann, Arndt; Riener, Marc-Oliver


    The oncofetal protein, insulin-like growth factor II messenger ribonucleic acid-binding protein 3 (IMP3), has been analyzed in many different tumors. Various studies have found that IMP3 is a marker for malignancy and is correlated with increased tumor aggressiveness and reduced overall survival. The diagnosis of pancreatic ductal adenocarcinoma (PDAC) in core needle biopsies can be challenging, and immunohistochemical markers are needed. We studied IMP3 expression in 177 core needle biopsies of the pancreas, including 112 PDACs, 55 cases with chronic sclerosing pancreatitis, and 10 biopsies with tumor-free pancreatic tissue without inflammation. An additional 18 biopsies of PDAC metastases (16 liver biopsies and 2 lymph node biopsies) were analyzed. To study IMP3 expression in large tissue sections, 45 pancreatic resection specimens (26 with PDAC and 19 with chronic sclerosing pancreatitis) were investigated. In contrast to normal or inflamed pancreatic tissue, which was negative in 47 of 65 (72.3%) cases and weakly positive in 15 of 65 (23.1%) cases, strong IMP3 expression was found in 99 of 112 (88.4%) PDACs. Therefore, sensitivity and specificity of IMP3 expression in the differential diagnosis of PDAC and chronic sclerosing pancreatitis using core needle biopsies were found to be 88.4% and 94.6%, respectively. These results were confirmed in the pancreas resection specimens. Furthermore, strong IMP3 expression was found in 17 of 18 (94.4%) of the PDAC metastases that were analyzed. Our study shows that IMP3 is an easy to use and potentially new immunohistochemical marker for the diagnosis of PDAC in core needle biopsies.

  19. Understanding the determinants of substrate specificity in IMP family metallo-β-lactamases: The importance of residue 262

    PubMed Central

    Pegg, Kevin M; Liu, Eleanor M; George, Alex C; LaCuran, Alecander E; Bethel, Christopher R; Bonomo, Robert A; Oelschlaeger, Peter


    In Gram-negative bacteria, resistance to β-lactam antibacterials is largely due to β-lactamases and is a growing public health threat. One of the most concerning β-lactamases to evolve in bacteria are the Class B enzymes, the metallo-β-lactamases (MBLs). To date, penams and cephems resistant to hydrolysis by MBLs have not yet been found. As a result of this broad substrate specificity, a better understanding of the role of catalytically important amino acids in MBLs is necessary to design novel β-lactams and inhibitors. Two MBLs, the wild type IMP-1 with serine at position 262, and an engineered variant with valine at the same position (IMP-1-S262V), were previously found to exhibit very different substrate spectra. These findings compelled us to investigate the impact of a threonine at position 262 (IMP-1-S262T) on the substrate spectrum. Here, we explore MBL sequence-structure-activity relationships by predicting and experimentally validating the effect of the S262T substitution in IMP-1. Using site-directed mutagenesis, threonine was introduced at position 262, and the IMP-1-S262T enzyme, as well as the other two enzymes IMP-1 and IMP-1-S262V, were purified and kinetic constants were determined against a range of β-lactam antibacterials. Catalytic efficiencies (kcat/KM) obtained with IMP-1-S262T and minimum inhibitory concentrations (MICs) observed with bacterial cells expressing the protein were intermediate or comparable to the corresponding values with IMP-1 and IMP-1-S262V, validating the role of this residue in catalysis. Our results reveal the important role of IMP residue 262 in β-lactam turnover and support this approach to predict activities of certain novel MBL variants. PMID:25131397

  20. IMp: The customizable LEGO® Pinned Insect Manipulator

    PubMed Central

    Dupont, Steen; Price, Benjamin; Blagoderov, Vladimir


    Abstract We present a pinned insect manipulator (IMp) constructed of LEGO® building bricks with two axes of movement and two axes of rotation. In addition we present three variants of the IMp to emphasise the modular design, which facilitates resizing to meet the full range of pinned insect specimens, is fully customizable, collapsible, affordable and does not require specialist tools or knowledge to assemble. PMID:25685035

  1. IMP-8. Volume 2: Scientific section. [Bibliography

    NASA Technical Reports Server (NTRS)


    Results of the analysis of the IMP-8 data, which was collected during the first six and one-half years after launch of the IMP-8 spacecraft are presented. The plasma wave experiment data were processed and are available in an easily accessible summary form. These data continue to provide a valuable source for comparative studies with plasma wave experiments on other spacecraft operating in the solar wind and within the Earth's magnetosphere.

  2. Differential expression of IMP3 between male and female mature teratomas--immunohistochemical evidence of malignant nature.


    Goodman, Steven; Zhang, Liping; Cheng, Liang; Jiang, Zhong


    Ovarian mature teratoma is a benign tumour, whereas mature teratoma in adult testicular germ cell tumours (TGCTs) is considered to be a malignant tumour. IMP3, an oncofetal protein, plays an important role in embryogenesis and carcinogenesis. IMP3 has been demonstrated to be a malignant biomarker that is mainly expressed in malignant neoplasms rather than benign tissues. The aim of this study was to analyse IMP3 expression in germ cell tumours, and compare its expression between male and female teratomas. One hundred and seventy-eight cases (62 TGCTs, 52 ovarian teratomas, 27 metastatic testicular teratomas, and 37 cases of normal testicular tissue) obtained from the archives of two large academic medical centres were examined for IMP3 expression. Of the 62 TGCTs, 30 had mature teratoma components. IMP3 expression was present in 100% (30/30) of testicular mature teratoma components, and in 96% (26/27) of metastatic testicular teratomas. Other TGCT components also expressed IMP3 in 99% of cases (78/79). IMP3 expression was negative in all female mature teratomas. We describe for the first time an immunostaining marker that has differential expression in male and female mature teratomas, indicating that their pathogenesis differs. High expression of IMP3 in adult mature testicular teratomas supports their malignant nature. © 2014 John Wiley & Sons Ltd.

  3. Imp2 regulates GBM progression by activating IGF2/PI3K/Akt pathway

    PubMed Central

    Mu, Qingchun; Wang, Lijun; Yu, Fengbo; Gao, Haijun; Lei, Ting; Li, Peiwen; Liu, Pengfei; Zheng, Xu; Hu, Xitong; Chen, Yong; Jiang, Zhenfeng; Sayari, Arash J; Shen, Jia; Huang, Haiyan


    Glioblastomas multiforme (GBM) are the most frequently occurring malignant brain cancers. Treatment for GBM consists of surgical resection and subsequent adjuvant radiation therapy and chemotherapy. Despite this, GBM patient survival is limited to 12–15 months, and researchers are continually trying to develop improved therapy options. Insulin-like growth factor 2 mRNA-binding protein 2 (Imp2) is known to be upregulated in many cancers and is known to regulate the signaling activity of insulin-like growth factor 2 (IGF2). However, relatively little is known about its role in malignant development of GBM. In this study, we first found Imp2 is upregulated in GBM tissues by using clinical samples and public database search. Studies with loss and gain of Imp2 expression in in vitro GBM cell culture system demonstrated the role of Imp2 in promoting GBM cell proliferation, migration, invasion and epithelial-to-mesenchymal transition (EMT). Additionally, our results show that Imp2 regulates the activity of IGF2, which further activates PI3K/Akt signaling, thereby to promote GBM malignancy. Inhibition of Imp2 was also found to sensitize GBM to temozolomide treatment. These observations add to the current knowledge of GBM biology, and may prove useful in development of more effective GBM therapy. PMID:25719943

  4. Imp2 regulates GBM progression by activating IGF2/PI3K/Akt pathway.


    Mu, Qingchun; Wang, Lijun; Yu, Fengbo; Gao, Haijun; Lei, Ting; Li, Peiwen; Liu, Pengfei; Zheng, Xu; Hu, Xitong; Chen, Yong; Jiang, Zhenfeng; Sayari, Arash J; Shen, Jia; Huang, Haiyan


    Glioblastomas multiforme (GBM) are the most frequently occurring malignant brain cancers. Treatment for GBM consists of surgical resection and subsequent adjuvant radiation therapy and chemotherapy. Despite this, GBM patient survival is limited to 12-15 months, and researchers are continually trying to develop improved therapy options. Insulin-like growth factor 2 mRNA-binding protein 2 (Imp2) is known to be upregulated in many cancers and is known to regulate the signaling activity of insulin-like growth factor 2 (IGF2). However, relatively little is known about its role in malignant development of GBM. In this study, we first found Imp2 is upregulated in GBM tissues by using clinical samples and public database search. Studies with loss and gain of Imp2 expression in in vitro GBM cell culture system demonstrated the role of Imp2 in promoting GBM cell proliferation, migration, invasion and epithelial-to-mesenchymal transition (EMT). Additionally, our results show that Imp2 regulates the activity of IGF2, which further activates PI3K/Akt signaling, thereby to promote GBM malignancy. Inhibition of Imp2 was also found to sensitize GBM to temozolomide treatment. These observations add to the current knowledge of GBM biology, and may prove useful in development of more effective GBM therapy.

  5. Imp2, the PSTPIP homolog in fission yeast, affects sensitivity to the immunosuppressant FK506 and membrane trafficking in fission yeast

    SciTech Connect

    Kita, Ayako; Higa, Mari; Doi, Akira; Satoh, Ryosuke; Sugiura, Reiko


    Cytokinesis is a highly ordered process that divides one cell into two cells, which is functionally linked to the dynamic remodeling of the plasma membrane coordinately with various events such as membrane trafficking. Calcineurin is a highly conserved serine/threonine protein phosphatase, which regulates multiple biological functions, such as membrane trafficking and cytokinesis. Here, we isolated imp2-c3, a mutant allele of the imp2{sup +} gene, encoding a homolog of the mouse PSTPIP1 (proline-serine-threonine phosphatase interacting protein 1), using a genetic screen for mutations that are synthetically lethal with calcineurin deletion in fission yeast. The imp2-c3 mutants showed a defect in cytokinesis with multi-septated phenotypes, which was further enhanced upon treatment with the calcineurin inhibitor FK506. Notably, electron micrographs revealed that the imp2-c3 mutant cells accumulated aberrant multi-lamella Golgi structures and putative post-Golgi secretory vesicles, and exhibited fragmented vacuoles in addition to thickened septa. Consistently, imp2-c3 mutants showed a reduced secretion of acid phosphatase and defects in vacuole fusion. The imp2-c3 mutant cells exhibited a weakened cell wall, similar to the membrane trafficking mutants identified in the same genetic screen such as ypt3-i5. These findings implicate the PSTPIP1 homolog Imp2 in Golgi/vacuole function, thereby affecting various cellular processes, including cytokinesis and cell integrity. - Highlights: • We isolated imp2-c3, in a synthetic lethal screen with calcineurin in fission yeast. • The imp2{sup +} gene encodes a component of the actin contractile ring similar to Cdc15. • The imp2-c3 mutants showed defects in cytokinesis, which were exacerbated by FK506. • The imp2-c3 mutants were defective in membrane trafficking and cell wall integrity. • Our study revealed a novel role for Imp2 in the Golgi/vacuolar membrane trafficking.

  6. Imp promotes axonal remodeling by regulating profilin mRNA during brain development.


    Medioni, Caroline; Ramialison, Mirana; Ephrussi, Anne; Besse, Florence


    Neuronal remodeling is essential for the refinement of neuronal circuits in response to developmental cues [1-4]. Although this process involves pruning or retraction of axonal projections followed by axonal regrowth and branching, how these steps are controlled is poorly understood. Drosophila mushroom body (MB) γ neurons provide a paradigm for the study of neuronal remodeling, as their larval axonal branches are pruned during metamorphosis and re-extend to form adult-specific branches [5]. Here, we identify the RNA binding protein Imp as a key regulator of axonal remodeling. Imp is the sole fly member of a conserved family of proteins that bind target mRNAs to promote their subcellular targeting [6-12]. We show that whereas Imp is dispensable for the initial growth of MB γ neuron axons, it is required for the regrowth and ramification of axonal branches that have undergone pruning. Furthermore, Imp is actively transported to axons undergoing developmental remodeling. Finally, we demonstrate that profilin mRNA is a direct and functional target of Imp that localizes to axons and controls axonal regrowth. Our study reveals that mRNA localization machineries are actively recruited to axons upon remodeling and suggests a role of mRNA transport in developmentally programmed rewiring of neuronal circuits during brain maturation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. The IMP-H ion composition experiment

    NASA Technical Reports Server (NTRS)

    Acuna, M. H.; Ogilvie, K. W.


    A compact mass energy spectrometer to be flown aboard the IMP-H spacecraft is described. Scientific aims include determination of the relative and absolute fluxes of He-4(2+), He-4 (+), 0(6+), and 0(7+), and He-3(2+).

  8. IMP-32--An Interactive Management Program.

    ERIC Educational Resources Information Center

    Hayes, L. Susan; Vogel, Judith A.


    Describes the development by Gould, Inc., S.E.L. Computer Systems Division, of an Information Management Package (IMP-32) for use in administration of the company's technical information center. Designing the system, the programs which are components of the system, and system functions are discussed. Included are eight figures illustrating system…

  9. Global Molecular Epidemiology of IMP-Producing Enterobacteriaceae.


    Matsumura, Yasufumi; Peirano, Gisele; Motyl, Mary R; Adams, Mark D; Chen, Liang; Kreiswirth, Barry; DeVinney, Rebekah; Pitout, Johann D D


    International data on the molecular epidemiology of Enterobacteriaceae with IMP carbapenemases are lacking. We performed short-read (Illumina) whole-genome sequencing on a global collection of 38 IMP-producing clinical Enterobacteriaceae (2008 to 2014). IMP-producing Enterobacteriaceae (7 varieties within 11 class 1 integrons) were mainly present in the South Pacific and Asia. Specific blaIMP-containing integrons (In809 with blaIMP-4, In722 with blaIMP-6, and In687 with blaIMP-14) were circulating among different bacteria in countries such as Australia, Japan, and Thailand. In1312 with blaIMP-1 was present in Klebsiella pneumoniae from Japan and Citrobacter freundii from Brazil. Klebsiella pneumoniae (n = 22) was the most common species; clonal complex 14 (CC14) from Philippines and Japan was the most common clone and contained In1310 with blaIMP-26 and In1321 with blaIMP-6 The Enterobacter cloacae complex (n = 9) consisted of Enterobacter hormaechei and E. cloacae cluster III. CC78 (from Taiwan) containing In73 with blaIMP-8 was the most common clone among the E. cloacae complex. This study highlights the importance of surveillance programs using the latest molecular techniques for providing insight into the characteristics and global distribution of Enterobacteriaceae with blaIMP genes.

  10. IMP-3 promotes migration and invasion of melanoma cells by modulating the expression of HMGA2 and predicts poor prognosis in melanoma.


    Sheen, Yi-Shuan; Liao, Yi-Hua; Lin, Ming-Hsien; Chu, Chia-Ying; Ho, Bing-Ying; Hsieh, Meng-Chen; Chen, Pin-Chun; Cha, Shih-Ting; Jeng, Yung-Ming; Chang, Cheng-Chi; Chiu, Hsien-Ching; Jee, Shiou-Hwa; Kuo, Min-Liang; Chu, Chia-Yu


    IGF II mRNA-binding protein 3 (IMP-3) has been reported to be a marker of melanoma progression. However, the mechanisms by which it impacts melanoma are incompletely understood. In this study, we investigate the clinical significance of IMP-3 in melanoma progression and also its underlying mechanisms. We found that IMP-3 expression was much higher in advanced-stage/metastatic melanomas and that it was associated with a poor prognosis (P=0.001). Univariate analysis showed that IMP-3 expression was associated with stage III/IV melanomas (odds ratio=5.40, P=0.031) and the acral lentiginous subtype (odds ratio=3.93, P=0.0034). MeWo cells with overexpression of IMP-3 showed enhanced proliferation and migration and significantly increased tumorigenesis and metastatic ability in nude mice. We further demonstrated that IMP-3 could bind and enhance the stability of the mRNA of high mobility group AT-hook 2 (HMGA2). It was also confirmed that IMP-3 had an important role in melanoma invasion and metastasis through regulating HMGA2 mRNA expression. IMP-3 expression was positively correlated with HMGA2 expression in melanoma cells and also in melanoma tissues. Our results show that IMP-3 expression is a strong prognostic factor for melanoma, especially acral lentiginous melanoma.

  11. Crystal structure of IMP-2 metallo-β-lactamase from Acinetobacter spp.: comparison of active-site loop structures between IMP-1 and IMP-2.


    Yamaguchi, Yoshihiro; Matsueda, Satoshi; Matsunaga, Kazuyo; Takashio, Nobutoshi; Toma-Fukai, Sachiko; Yamagata, Yuriko; Shibata, Naohiro; Wachino, Jun-Ichi; Shibayama, Keigo; Arakawa, Yoshichika; Kurosaki, Hiromasa


    IMP-2, a subclass B1 metallo-β-lactamase (MBL), is a Zn(II)-containing hydrolase. This hydrolase, involved in antibiotic resistance, catalyzes the hydrolysis of the C-N bond of the β-lactam ring in β-lactam antibiotics such as benzylpenicillin and imipenem. The crystal structure of IMP-2 MBL from Acinetobacter spp. was determined at 2.3 Å resolution. This structure is analogous to that of subclass B1 MBLs such as IMP-1 and VIM-2. Comparison of the structures of IMP-1 and IMP-2, which have an 85% amino acid identity, suggests that the amino acid substitution at position 68 on a β-strand (β3) (Pro in IMP-1 versus Ser in IMP-2) may be a staple factor affecting the flexibility of loop 1 (comprising residues at positions 60-66; EVNGWGV). In the IMP-1 structure, loop 1 adopts an open, disordered conformation. On the other hand, loop 1 of IMP-2 forms a closed conformation in which the side chain of Trp64, involved in substrate binding, is oriented so as to cover the active site, even though there is an acetate ion in the active site of both IMP-1 and IMP-2. Loop 1 of IMP-2 has a more flexible structure in comparison to IMP-1 due to having a Ser residue instead of the Pro residue at position 68, indicating that this difference in sequence may be a trigger to induce a more flexible conformation in loop 1.

  12. Characteristics and management of Enterobacteriaceae harboring IMP-4 or IMP-8 carbapenemase in a tertiary hospital.


    Pang, Feng; Jia, Xiu-Qin; Song, Zhen-Zhu; Li, Yan-Hua; Wang, Bin; Zhao, Qi-Gang; Wang, Chuan-Xin; Zhang, Yi; Wang, Le-Xin


    The emergence of Enterobacteriaceae harboring IMP-4 or IMP-8 carbapenemases is rare. We report an occurrence of Enterobacteriaceae harboring IMP-4 or IMP-8 carbapenemases in a Chinese tertiary care hospital from November 2010 to December 2012. The clinical characteristics of 30 patients were described. The genetic relationship of isolates was determined by pulsed-field gel electrophoresis (PFGE). Carbapenemases were detected by modified Hodge test (MHT) and polymerase chain reactions (PCRs). Amplicons were sequenced and blasted to determine the genotype. Most infected patients were from intensive care unit and had complex and serious underlying illnesses requiring mechanical ventilation. PFGE revealed that Klebsiella pneumoniae showed two major PFGE types. Two Klebsiella oxytoca had an indistinguishable PFGE pattern, while four Enterobacter cloacae were different strains. The sequencing studies showed Enterobacteriaceae harboring IMP-4 or IMP-8 carbapenemase in the 23 infected patients. The majority of patients had infections with the carbapenemase-producing Enterobacteriaceae (CPE) strain, most were successfully treated with a range of antibiotics and discharged. It is important to maintain a high index of suspicion to screen for carbapenemase-producing Enterobacteriaceae strains. Rapid identification of these strains and implementation of stringent procedures are the key to prevent major outbreaks in a hospital setting.

  13. Drosophila Imp iCLIP identifies an RNA assemblage coordinating F-actin formation.


    Hansen, Heidi Theil; Rasmussen, Simon Horskjær; Adolph, Sidsel Kramshøj; Plass, Mireya; Krogh, Anders; Sanford, Jeremy; Nielsen, Finn Cilius; Christiansen, Jan


    Post-transcriptional RNA regulons ensure coordinated expression of monocistronic mRNAs encoding functionally related proteins. In this study, we employ a combination of RIP-seq and short- and long-wave individual-nucleotide resolution crosslinking and immunoprecipitation (iCLIP) technologies in Drosophila cells to identify transcripts associated with cytoplasmic ribonucleoproteins (RNPs) containing the RNA-binding protein Imp. We find extensive binding of Imp to 3' UTRs of transcripts that are involved in F-actin formation. A common denominator of the RNA-protein interface is the presence of multiple motifs with a central UA-rich element flanked by CA-rich elements. Experiments in single cells and intact flies reveal compromised actin cytoskeletal dynamics associated with low Imp levels. The former shows reduced F-actin formation and the latter exhibits abnormal neuronal patterning. This demonstrates a physiological significance of the defined RNA regulon. Our data imply that Drosophila Imp RNPs may function as cytoplasmic mRNA assemblages that encode proteins which participate in actin cytoskeletal remodeling. Thus, they may facilitate coordinated protein expression in sub-cytoplasmic locations such as growth cones.



    Chokoeva, A A; Ananiev, J; Wollina, U; Tana, C; Lotti, T; Cardoso, J C; Tchernev, G


    IMP-3 is generally considered as an oncofetal protein, which plays a critical role in regulation of cell proliferation via an IGF-II-dependent pathway in K562 leukemia cells. IMP-3 expression has been detected in malignancies with various origins, while its appearance in adult tissue is generally considered abnormal, with some exceptions. IMP3 is also considered a prognostic biomarker in patients with renal cell carcinoma and clear-cell type ovarian carcinoma, hepatocellular carcinoma, pancreatic ductal adenocarcinoma and in patients with poorly differentiated thyroid carcinoma and uterine cervical carcinomas, testicular cancer and malignant melanoma. To our knowledge, no more than 4 PubMed-indexed studies have investigated the expression of IMP-3 in melanocytic lesions, namely its role in the differentiation between benign and malignant neoplasms. We investigated the expression of IMP-3 in a small series of benign melanocytic lesions, dysplastic nevi and melanomas, aiming to establish its significance as a marker for their distinction, comparing the results with those from the literature. IMP- 3 immunostaining was performed in 30 melanocytic lesions: 10 malignant melanomas, 10 dysplastic nevi and 10 benign melanocytic nevi. Our results revealed expression in 20% of dysplastic lesions and 40% of melanoma cases, while none of the benign nevi showed positive expression. These data contradict some of the results from other studies and raise some questions regarding the correlation between IMP- 3 and the degree of dysplasia of melanocytic nevi, as well as its potential relationship with prognostic parameters in melanoma, including tumor thickness and mitotic rate. Our results suggest that IMP-3 expression could be only an auxiliary marker for differentiation between dysplastic nevi and benign nevi, since although it is not expressed in all dysplastic lesions, staining correlates with the degree of dysplasia/atypia. It seems that IMP-3 expression is not a useful

  15. Imp3p and Imp4p mediate formation of essential U3–precursor rRNA (pre-rRNA) duplexes, possibly to recruit the small subunit processome to the pre-rRNA

    PubMed Central

    Gérczei, Tímea; Correll, Carl C.


    In eukaryotes, formation of short duplexes between the U3 small nucleolar RNA (snoRNA) and the precursor rRNA (pre-rRNA) at multiple sites is a prerequisite for three endonucleolytic cleavages that initiate small subunit biogenesis by releasing the 18S rRNA precursor from the pre-rRNA. The most likely role of these RNA duplexes is to guide the U3 snoRNA and its associated proteins, designated the small subunit processome, to the target cleavage sites on the pre-rRNA. Studies by others in Saccharomyces cerevisiae have identified the proteins Mpp10p, Imp3p, and Imp4p as candidates to mediate U3–pre-rRNA interactions. We report here that Imp3p and Imp4p appear to stabilize an otherwise unstable duplex between the U3 snoRNA hinge region and complementary bases in the external transcribed spacer of the pre-rRNA. In addition, Imp4p, but not Imp3p, seems to rearrange the U3 box A stem structure to expose the site that base-pairs with the 5′ end of the 18S rRNA, thereby mediating duplex formation at a second site. By mediating formation of both essential U3–pre-rRNA duplexes, Imp3p and Imp4p may help the small subunit processome to dock onto the pre-rRNA, an event indispensable for ribosome biogenesis and hence for cell growth. PMID:15489263

  16. Interspecies Transfer of blaIMP-4 in a Patient with Prolonged Colonization by IMP-4-Producing Enterobacteriaceae

    PubMed Central

    Heney, Claire; George, Narelle M.; Nimmo, Graeme R.; Paterson, David L.


    A patient was colonized by IMP-4-producing Enterobacter cloacae and Escherichia coli strains for 7 months. IMP-4-producing E. cloacae strains were first and last isolated at day 33 and at 8 months after admission, respectively. IMP-4-producing E. coli strains were first and last isolated at days 88 and 181 after admission, respectively. The E. cloacae and E. coli isolates shared identical genetic features in terms of blaIMP-4, blaTEM-1, qnrB2, aacA4, HI2 plasmids, and ISCR1. This study shows the first prolonged colonization with in vivo interspecies transfer of blaIMP-4. PMID:25056334

  17. Benchmark of different CFL conditions for IMPES

    NASA Astrophysics Data System (ADS)

    Franc, Jacques; Horgue, Pierre; Guibert, Romain; Debenest, Gerald


    The IMplicit Pressure Explicit Saturation (IMPES) method is a prevalent way to simulate multiphase flows in porous media. The numerical stability of this sequential method implies limitations on the time step, which may depend on the flow regime studied. In this note, three stability criteria related to the IMPES method, that differ in their construction on the observed variables, are compared on homogeneous and heterogeneous configurations for different two-phase flow regimes (viscous/capillary/gravitational). This highlights that there is no single optimal criterion always ensuring stability and efficiency. For capillary dominated flows, the Todd's condition is the most efficient one, while the standard Coat condition should be preferred for viscous flows. When gravity effects are present, Coat's condition must be restricted, but remains more efficient than the Todd's condition. xml:lang="fr"

  18. Recent Development of IMP ECR Ion Sources

    SciTech Connect

    Zhao, H.W.; Zhang, Z.M.; Sun, L.T.; Cao, Y.; He, W.; Zhang, X.Z.; Guo, X.H.; Ma, L.; Yuan, P.; Song, M.T.; Zhan, W.L.; Wei, B.W.


    Great efforts have been made to develop highly charged ECR ion sources for application of heavy ion accelerator and atomic physics research at IMP in the past few years. The latest development of ECR ion sources at IMP is briefly reviewed. Intense beams with high and intermediate charge states have been produced from IMP LECR3 by optimization of the ion source conditions including rf frequency extended up to 18GHz. 1.1 emA of Ar8+ and 325 e{mu} A of Ar11+ were produced. Dependence of beam emittance on those key parameters of ECR ion source, beam extraction and space charge compensation were experimentally studied at LECR3. Furthermore, an advanced superconducting ECR ion source named SECRAL is being constructed. SECRAL is designed to operate at rf frequency 18-28GHz with axial mirror magnetic fields 3.6-4.0 Tesla at injection, 2.2 Tesla at extraction and sextupole field 2.0 Tesla at the wall. The superconducting magnet with sextupole and three solenoids was tested in a test-cryostat and 95% of designed fields were reached. Construction status and planed schedule of SECRAL are presented.

  19. IMP2 expression distinguishes endometrioid from serous endometrial adenocarcinomas.


    Zhang, Liping; Liu, Yuxin; Hao, Suyang; Woda, Bruce A; Lu, Di


    Among various endometrial adenocarcinomas, endometrioid carcinoma can be very difficult to separate from serous carcinomas. Various biomarkers have been studied with proven value, including p53, Ki-67, and p16. In this study, we present data on another biomarker, IMP2, which we believe is sensitive and specific. Using 320 endometrial biopsy cases, we demonstrate that IMP2 is normally expressed in all proliferative and inactive endometrial glandular cells. The pattern of such expression is unchanged in serous carcinomas. IMP2 expression is, however, lost in all cases of endometrioid carcinomas by at least 25% to >95% of tumor cell populations. Therefore, loss of IMP2 expression can differentiate endometrioid from serous carcinomas. Such finding of IMP2 expression remained the same in mixed endometrioid and serous carcinomas; IMP2 expression is lost in all endometrioid components by at least 25% of tumor cell population, whereas it remained diffuse and strong in all serous components of carcinomas.

  20. ISEE-3/IMP-8 observations of simultaneous upstream proton events

    NASA Technical Reports Server (NTRS)

    Sanderson, T. R.; Reinhard, R.; Wenzel, K.-P.; Mitchell, D. G.; Roelof, E. C.


    Upstream 50-200 keV proton events were observed simultaneously by the low energy proton detectors on ISEE-3 and IMP-8, and the gradient from the spin averaged fluxes at the two spacecraft was calculated. The dependence of that gradient upon the angular distributions at IMP-8 was investigated as well as the distance from IMP-8 to the bow shock. The pitch angle distributions are narrow at ISEE-3 and wide and often pancake-shaped at IMP-8 with a peak near 90 degrees. This implies the existence of a weak scattering region about 5-15 earth radii upstream of the earth's bow shock.

  1. Adaption of a corrector module to the IMP dynamics program

    NASA Technical Reports Server (NTRS)


    The corrector module of the RAEIOS program and the IMP dynamics computer program were combined to achieve a date-fitting capability with the more general spacecraft dynamics models of the IMP program. The IMP dynamics program presents models of spacecraft dynamics for satellites with long, flexible booms. The properties of the corrector are discussed and a description is presented of the performance criteria and search logic for parameter estimation. A description is also given of the modifications made to add the corrector to the IMP program. This includes subroutine descriptions, common definitions, definition of input, and a description of output.

  2. Method To Identify Specific Inhibiutors Of Imp Dehydrogenase


    Collart, Frank R.; Huberman, Eliezer


    This invention relates to methods to identify specific inhibitors of the purine nucleotide synthesis enzyme, IMP dehydrogenase (IMPDH). IMPDH is an essential enzyme found in all free-living organisms from humans to bacteria and is an important therapeutic target. The invention allows the identification of specific inhibitors of any IMPDH enzyme which can be expressed in a functional form in a recombinant host cell. A variety of eukaryotic or prokaryotic host systems commonly used for the expression of recombinant proteins are suitable for the practice of the invention. The methods are amenable to high throughput systems for the screening of inhibitors generated by combinatorial chemistry or other methods such as antisense molecule production. Utilization of exogenous guanosine as a control component of the methods allows for the identification of inhibitors specific for IMPDH rather than other causes of decreased cell proliferation.

  3. Surface science capabilities from IMP spectral imaging

    NASA Technical Reports Server (NTRS)

    Singer, Robert B.


    The Imager for Mars Pathfinder (IMP) had a single 12-position filter wheel for one of its two 'eyes'. Originally eight, and then nine, of these filters were optimized for surface science, and three narrow-band filters for atmospheric science. Because of some design revisions we will now have filter wheels on both sides. The wheels for right and left eyes are identical, 12 filter positions each, and rigidly linked to the same rotation shaft. There are now 13 surface filters, in addition to 5 for atmospheric observations. Details of all the filter positions are tabulated and approximate gaussian bandpasses for the 13 surface filters are shown.

  4. Protective immunity against Eimeria tenella infection in chickens induced by immunization with a recombinant C-terminal derivative of EtIMP1.


    Yin, Guangwen; Lin, Qian; Wei, Wenjun; Qin, Mei; Liu, Xianyong; Suo, Xun; Huang, Zhijian


    Immune mapped protein-1 (IMP1) is a new protective protein in apicomplexan parasites, and exits in Eimeria tenella. Cloning and sequence analysis has predicted the antigen to be a novel membrane protein of apicomplexan parasites. In order to assess the immunogenicity of EtIMP1, a C-terminal derivative of EtIMP1 was expressed in a bacterial host system and was used to immunize chickens. The protective efficacy against a homologous challenge was evaluated by body weight gains, lesion scores and fecal oocyst shedding. The results showed that the subunit vaccine can improve weight gains, reduced cecal pathology and lower oocyst fecal shedding compared with non immunized controls. The results suggested that the C-terminal derivative of EtIMP1 might be considered as a candidate in the development of subunit vaccines against Eimeria infection.

  5. Sequence-specific bacterial growth inhibition by peptide nucleic acid targeted to the mRNA binding site of 16S rRNA.


    Hatamoto, Masashi; Nakai, Kazufumi; Ohashi, Akiyoshi; Imachi, Hiroyuki


    Peptide nucleic acid (PNA) targeted to the functional domains of 23S rRNA can inhibit translation and cell growth. However, effective inhibition of translation and cell growth using 16S rRNA-targeted PNA has still not been achieved. Here, we report that PNA targeted to the functional site of 16S rRNA could inhibit both gene expression in vitro and bacterial growth in pure culture with sequence specificity. We used 10-mer PNAs conjugated with a cell-penetrating peptide, which targeted the mRNA binding site at the 3' end of 16S rRNA. Using 0.6 microM of the peptide-PNAs, cell-free ss-galactosidase production decreased by 50%, whereas peptide-PNAs with one or two mismatches to the target sequence showed much weaker inhibition effects. To determine the growth inhibition and bactericidal effects of the peptide-PNA conjugate, we performed OD measurement and viable cell counting. We observed dose- and sequence-dependent inhibition of cell growth and bactericidal effects. These growth inhibitory effects are observed both in the Gram-negative bacterium of Escherichia coli and the Gram-positive bacteria Bacillus subtilis and Corynebacterium efficiens, although inhibitory concentrations were different for each bacterial species. These results present possibilities for 16S rRNA sequence-based specific bacterial growth inhibition using a peptide-PNA conjugate.

  6. Synergistic effect of imp/ostA and msbA in hydrophobic drug resistance of Helicobacter pylori.


    Chiu, Hung-Chuan; Lin, Tzu-Lung; Yang, Jyh-Chin; Wang, Jin-Town


    Contamination of endoscopy equipment by Helicobacter pylori (H. pylori) frequently occurs after endoscopic examination of H. pylori-infected patients. In the hospital, manual pre-cleaning and soaking in glutaraldehyde is an important process to disinfect endoscopes. However, this might not be sufficient to remove H. pylori completely, and some glutaraldehyde-resistant bacteria might survive and be passed to the next patient undergoing endoscopic examination through unidentified mechanisms. We identified an Imp/OstA protein associated with glutaraldehyde resistance in a clinical strain, NTUH-C1, from our previous study. To better understand and manage the problem of glutaraldehyde resistance, we further investigated its mechanism. The minimal inhibitory concentrations (MICs) of glutaraldehyde andexpression of imp/ostA RNA in 11 clinical isolates from the National Taiwan University Hospital were determined. After glutaraldehyde treatment, RNA expression in the strains with the MICs of 4-10 microg/ml was higher than that in strains with the MICs of 1-3 microg/ml. We examined the full-genome expression of strain NTUH-S1 after glutaraldehyde treatment using a microarray and found that 40 genes were upregulated and 31 genes were downregulated. Among the upregulated genes, imp/ostA and msbA, two putative lipopolysaccharide biogenesis genes, were selected for further characterization. The sensitivity to glutaraldehyde or hydrophobic drugs increased in both of imp/ostA and msbA single mutants. The imp/ostA and msbA double mutant was also hypersensitive to these chemicals. The lipopolysaccharide contents decreased in individual imp/ostA and msbA mutants and dramatically reduced in the imp/ostA and msbA double mutant. Outer membrane permeability assay demonstrated that the imp/ostA and msbA double mutation resulted in the increase of outer membrane permeability. Ethidium bromide accumulation assay demonstrated that MsbA was involved in efflux of hydrophobic drugs. The

  7. Biomedical research with heavy ions at the IMP accelerators

    NASA Astrophysics Data System (ADS)

    Li, Qiang

    The main ion-beam acceleration facilities and research activities at the Institute of Modern Physics (IMP), Chinese Academy of Sciences are briefly introduced. Some of the biomedical research with heavy ions such as heavy-ion biological effect, basic research related to heavy-ion cancer therapy and radiation breeding at the IMP accelerators are presented.

  8. Accumulation of I-123 IMP in hepatic cell adenoma

    SciTech Connect

    Suto, Yuji; Kodama, Fumiko; Kato, Takashi


    I-123 IMP is now widely used as a radioactive material for cerebral blood flow scintigraphy. It is also known that this substance will accumulate in certain types of tumors. The authors present a case of a 47-year-old woman who showed accumulation of I-123 IMP in hepatic cell adenoma. 6 refs., 3 figs.

  9. Identification of bla(IMP-22) in Pseudomonas spp. in urban wastewater and nosocomial environments: biochemical characterization of a new IMP metallo-enzyme variant and its genetic location.


    Pellegrini, Cristina; Mercuri, Paola Sandra; Celenza, Giuseppe; Galleni, Moreno; Segatore, Bernardetta; Sacchetti, Elisa; Volpe, Roberto; Amicosante, Gianfranco; Perilli, Mariagrazia


    The aim of the study was the biochemical characterization of a new variant of the metallo-beta-lactamase, IMP-22. Moreover, the genetic environment of the bla(IMP-22) gene was investigated in Pseudomonas fluorescens and Pseudomonas aeruginosa collected from urban wastewater and a teaching hospital in L'Aquila, Italy. Molecular characterization of genetic elements was carried out by PCR and DNA sequencing methods. The new enzyme was purified from recombinant Escherichia coli BL21(DE)Rosetta/pBC-SK/IMP-22. Steady-state kinetic parameters (K(m) and V(max)) were determined for a large pattern of substrates. A new IMP metallo-beta-lactamase gene was found in a class 1 integron and in one case, in a plasmid of Pseudomonas spp. The bla(IMP-22) encodes for a pre-protein of 246 amino acids and the N-terminus of the mature beta-lactamase (NH(2)-PDLK) was also determined. The molecular mass and pI were 24 930 Da and 6.2, respectively. On the basis of the kinetic parameters calculated (K(m) and V(max)), IMP-22 was found to hydrolyse narrow- and extended-spectrum beta-lactams. Enzyme activity was found to be inhibited by metal chelators such as EDTA, 1,10-o-phenathroline and dipicolinic acid with an IC(50) of 800, 750 and 300 microM, respectively. The finding of the bla(IMP-22) gene in P. fluorescens environmental strains and P. aeruginosa clinical isolate suggests the ongoing spread of bla(MBL) genes in several bacterial species and in different environments.

  10. IMP dehydrogenase from Pneumocystis carinii as a potential drug target.

    PubMed Central

    O'Gara, M J; Lee, C H; Weinberg, G A; Nott, J M; Queener, S F


    Mycophenolic acid, a specific inhibitor of IMP dehydrogenase (IMPDH; EC, is a potent inhibitor of Pneumocystis carinii growth in culture, suggesting that IMPDH may be a sensitive target for chemotherapy in this organism. The IMPDH gene was cloned as a first step to characterizing the enzyme and developing selective inhibitors. A 1.3-kb fragment containing a portion of the P. carinii IMPDH gene was amplified by PCR with two degenerate oligonucleotides based on conserved sequences in IMPDH from humans and four different microorganisms. Northern hybridization analysis showed the P. carinii IMPDH mRNA to be approximately 1.6 kb. The entire cDNA encoding P. carinii IMPDH was isolated and cloned. The deduced amino acid sequence of P. carinii IMPDH shared homology with bacterial (31 to 38%), protozoal (48 to 59%), mammalian (60 to 62%), and fungal (62%) IMPDH enzymes. The IMPDH cDNA was expressed by using a T7 expression system in an IMPDH-deficient strain of Escherichia coli (strain S phi 1101). E. coli S phi 1101 cells containing the P. carinii IMPDH gene were able to grow on medium lacking guanine, implying that the protein expressed in vivo was functional. Extracts of these E. coli cells contained IMPDH activity that had an apparent Km for IMP of 21.7 +/- 0.3 microM and an apparent Km for NAD of 314 +/- 84 microM (mean +/- standard error of the mean; n = 3), and the activity was inhibited by mycophenolic acid (50% inhibitory concentration, 24 microM; n = 2). PMID:8980752

  11. Dissemination of IMP-4-encoding pIMP-HZ1-related plasmids among Klebsiella pneumoniae and Pseudomonas aeruginosa in a Chinese teaching hospital.


    Feng, Wei; Zhou, Dongsheng; Wang, Qian; Luo, Wenbo; Zhang, Defu; Sun, Qiang; Tong, Yigang; Chen, Weijun; Sun, Fengjun; Xia, Peiyuan


    A total of 26 blaIMP-4-carrying strains of Pseudomonas aeruginosa and Klebsiella pneumoniae were isolated from 2009 to 2013 in a Chinese teaching hospital, and these strains can be assigned into multiple sequence types or allelic profiles as determined by multilocus sequence typing. Of these strains, P. aeruginosa P378 and K. pneumoniae 1220 harbor the IMP-4-encoding plasmids pP378-IMP and p1220-IMP, respectively, whose complete nucleotide sequences are determined to be genetically closely related to the IncN1-type plasmid pIMP-HZ1. pP378-IMP/p1220-IMP-like plasmids are hinted to be present in all the other blaIMP-4-carrying strains, indicating the dissemination of pIMP-HZ1-related plasmids among K. pneumoniae or P. aeruginosa of different genotypes in this hospital. pP378-IMP carries two distinct accessory resistance regions, a blaIMP-4-carrying class 1 integron In823b, and a truncated Tn3-family unit transposon ΔTn6292-3' harboring the quinolone resistance gene qnrS1. Massive fragmentation and rearrangement of these accessory genetic contents occur among p1220-IMP and IMP-HZ1 relative to pP378-IMP. blaIMP-4 is also present in the In823b remnants from p1220-IMP and IMP-HZ1, while qnrS1 is located in a Tn6292-derive fragment from pIMP-HZ1 but not found in p1220-IMP. pP378-IMP represents the first fully sequenced IncN-type plasmid from P. aeruginosa.

  12. Dissemination of IMP-4-encoding pIMP-HZ1-related plasmids among Klebsiella pneumoniae and Pseudomonas aeruginosa in a Chinese teaching hospital

    PubMed Central

    Feng, Wei; Zhou, Dongsheng; Wang, Qian; Luo, Wenbo; Zhang, Defu; Sun, Qiang; Tong, Yigang; Chen, Weijun; Sun, Fengjun; Xia, Peiyuan


    A total of 26 blaIMP-4-carrying strains of Pseudomonas aeruginosa and Klebsiella pneumoniae were isolated from 2009 to 2013 in a Chinese teaching hospital, and these strains can be assigned into multiple sequence types or allelic profiles as determined by multilocus sequence typing. Of these strains, P. aeruginosa P378 and K. pneumoniae 1220 harbor the IMP-4-encoding plasmids pP378-IMP and p1220-IMP, respectively, whose complete nucleotide sequences are determined to be genetically closely related to the IncN1-type plasmid pIMP-HZ1. pP378-IMP/p1220-IMP-like plasmids are hinted to be present in all the other blaIMP-4-carrying strains, indicating the dissemination of pIMP-HZ1-related plasmids among K. pneumoniae or P. aeruginosa of different genotypes in this hospital. pP378-IMP carries two distinct accessory resistance regions, a blaIMP-4-carrying class 1 integron In823b, and a truncated Tn3-family unit transposon ΔTn6292-3′ harboring the quinolone resistance gene qnrS1. Massive fragmentation and rearrangement of these accessory genetic contents occur among p1220-IMP and IMP-HZ1 relative to pP378-IMP. blaIMP-4 is also present in the In823b remnants from p1220-IMP and IMP-HZ1, while qnrS1 is located in a Tn6292-derive fragment from pIMP-HZ1 but not found in p1220-IMP. pP378-IMP represents the first fully sequenced IncN-type plasmid from P. aeruginosa. PMID:27641711

  13. Functional invadopodia formation through stabilization of the PDPN transcript by IMP-3 and cancer-stromal crosstalk for PDPN expression.


    Hwang, Young Sun; Xianglan, Zhang; Park, Kwang-Kyun; Chung, Won-Yoon


    We previously reported that insulin-like growth factor-II mRNA-binding protein-3 (IMP-3) depletion (IMP-3(Δ)) was shown to inhibit invadopodia formation and extracellular matrix degradation capacity in oral squamous cell carcinoma (OSCC) cells. In this study, we found that IMP-3(Δ) cells significantly downregulated the podoplanin (PDPN) level, which resulted in a loss of extracellular matrix degradation activity, although invadopodia was still thriving. From RNA in situ hybridization using a digoxigenin-labeled 3'UTR recognition probe of PDPN and reporter assay with 3'UTR of the PDPN gene cloned downstream from the luciferase reporter gene, we revealed that IMP-3 depletion was shown to be downregulated, which most probably lowered PDPN gene expression by reducing mRNA stabilization. In a xenograft model, PDPN depletion was the cause of a decrease in tumor volume and regional infiltration into nearby stroma. Taken together, transforming growth factor beta 1 increased PDPN expression, which potentiated cancer invasion through increased invadopodia formation and extracellular matrix degradation in the low invasive OSCC cell line. Reciprocally, interleukin-1 beta secreted by OSCC cells, stimulated transforming growth factor beta 1 secretion from stromal fibroblasts to induce PDPN expression in OSCC cells. In addition, a retrospective investigation of OSCC patients found that IMP-3 and PDPN expression significantly correlated with lymph node metastasis of OSCC patients. Moreover, co-expression of IMP-3 and PDPN were frequently detected both in primary and lymph nodes metastatic OSCC cells using immunohistochemical dual staining. Thus, the IMP-3-PDPN axis may be a sensitive target molecule in anti-invadopodia therapy for the treatment of metastatic cancers.

  14. Solar flare accelerated isotopes of hydrogen and helium. [observed by IMP-4 and IMP-5

    NASA Technical Reports Server (NTRS)

    Anglin, J. D.; Dietrich, W. F.; Simpson, J. A.


    Measurements of solar flare hydrogen, deuterium, tritium, helium-3, and helium-4 in the energy range approximately 10 to 50 MeV per nucleon obtained with instrumentation on the IMP-4 and IMP-5 satellites are reported and studies based on these results which place several constraints on theories of solar flare particle acceleration are discussed. A brief review of previous work and the difficulties in studying the rare isotopes of hydrogen and helium is also included. Particular emphasis is placed on the fact that the information to be obtained from the solar flare products of high energy interactions is not available through either solar wind observations where both the acceleration mechanism and the coronal source of the nuclear species are different, or optical measurements of solar active regions.

  15. Interspecies transfer of blaIMP-4 in a patient with prolonged colonization by IMP-4-producing Enterobacteriaceae.


    Sidjabat, Hanna E; Heney, Claire; George, Narelle M; Nimmo, Graeme R; Paterson, David L


    A patient was colonized by IMP-4-producing Enterobacter cloacae and Escherichia coli strains for 7 months. IMP-4-producing E. cloacae strains were first and last isolated at day 33 and at 8 months after admission, respectively. IMP-4-producing E. coli strains were first and last isolated at days 88 and 181 after admission, respectively. The E. cloacae and E. coli isolates shared identical genetic features in terms of blaIMP-4, blaTEM-1, qnrB2, aacA4, HI2 plasmids, and ISCR1. This study shows the first prolonged colonization with in vivo interspecies transfer of blaIMP-4. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  16. IMP 8. Volume 1: EM field experiment

    NASA Technical Reports Server (NTRS)


    The electromagnetic fields experiment on IMP-J used two electric dipole antennas and a triaxial search coil magnetic antenna to sense the electric and magnetic field of plasma waves in space. The electric dipole antennas consisted of a fine wire, 0.021 inches in diameter, with a nominal extended tip-to-tip length of 400 ft. The outermost 50 ft. of each element was conducting and the rest of the antenna was covered with an insulating coating. The search coil antennas each consisted of a high mu core with two separate windings of 40,000 turns each to sense ac magnetic fields. The search coils had a length of 18 inches tip-to-tip and are mounted on the end of a boom. The axes of the x prime and y prime search coil antennas were parallel to the x prime and y prime electric antenna axes.

  17. Let-7 modulates acquired resistance of ovarian cancer to Taxanes via IMP-1-mediated stabilization of MDR1

    PubMed Central

    Boyerinas, Benjamin; Park, Sun-Mi; Murmann, Andrea E.; Gwin, Katja; Montag, Anton G.; Zillardt, Marion R.; Hua, You-Jia; Lengyel, Ernst; Peter, Marcus E.


    Summary Ovarian cancer patients frequently develop resistance to chemotherapy regiments utilizing Taxol and carboplatin. One of the resistance factors that protects cancer cells from Taxol-based therapy is multi-drug resistance 1 (MDR1). micro(mi)RNAs are small noncoding RNAs that negatively regulate protein expression. Members of the let-7 family of miRNAs are downregulated in many human cancers, and low let-7 expression has been correlated with resistance to microtubule targeting drugs (Taxanes), although little is known that would explain this activity. We now provide evidence that, while let-7 is not a universal sensitizer of cancer cells to Taxanes, it affects acquired resistance of cells to this class of drugs by targeting IMP-1, resulting in de-stabilization of the mRNA of MDR1. Introducing let-7g into ADR-RES cells expressing both IMP-1 and MDR1 reduced expression of both proteins rendering the cells more sensitive to treatment with either Taxol or vinblastine without affecting the sensitivity of the cells to carboplatin, a non-MDR1 substrate. This effect could be reversed by reintroducing IMP-1 into let-7g high/MDR1 low cells causing MDR1 to again become stabilized. Consistently, many relapsed ovarian cancer patients tested before and after chemotherapy were found to downregulate let-7 and to co-upregulate IMP-1 and MDR1, and the increase in the expression levels of both proteins after chemotherapy negatively correlated with disease-free time before recurrence. Our data point at IMP-1 and MDR1 as indicators for response to therapy, and at IMP-1 as a novel therapeutic target for overcoming multidrug resistance of ovarian cancer. PMID:21618519

  18. Let-7 modulates acquired resistance of ovarian cancer to Taxanes via IMP-1-mediated stabilization of multidrug resistance 1.


    Boyerinas, Benjamin; Park, Sun-Mi; Murmann, Andrea E; Gwin, Katja; Montag, Anton G; Zillhardt, Marion; Hua, You-Jia; Lengyel, Ernst; Peter, Marcus E


    Ovarian cancer patients frequently develop resistance to chemotherapy regiments using Taxol and carboplatin. One of the resistance factors that protects cancer cells from Taxol-based therapy is multidrug resistance 1 (MDR1). micro(mi)RNAs are small noncoding RNAs that negatively regulate protein expression. Members of the let-7 family of miRNAs are downregulated in many human cancers, and low let-7 expression has been correlated with resistance to microtubule targeting drugs (Taxanes), although little is known that would explain this activity. We now provide evidence that, although let-7 is not a universal sensitizer of cancer cells to Taxanes, it affects acquired resistance of cells to this class of drugs by targeting IMP-1, resulting in destabilization of the mRNA of MDR1. Introducing let-7g into ADR-RES cells expressing both IMP-1 and MDR1 reduced expression of both proteins rendering the cells more sensitive to treatment with either Taxol or vinblastine without affecting the sensitivity of the cells to carboplatin, a non-MDR1 substrate. This effect could be reversed by reintroducing IMP-1 into let-7g high/MDR1 low cells causing MDR1 to again become stabilized. Consistently, many relapsed ovarian cancer patients tested before and after chemotherapy were found to downregulate let-7 and to co-upregulate IMP-1 and MDR1, and the increase in the expression levels of both proteins after chemotherapy negatively correlated with disease-free time before recurrence. Our data point at IMP-1 and MDR1 as indicators for response to therapy, and at IMP-1 as a novel therapeutic target for overcoming multidrug resistance of ovarian cancer. Copyright © 2011 UICC.

  19. [Simultaneous determination of sivelestat and its metabolite XW-IMP-A in human plasma using HPLC-MS/MS].


    Wang, Jing; Dai, Xiao-jian; Zhang, Yi-fan; Zhong, Da-fang; Wu, Yu-lin; Chen, Xiao-yan


    A simple and rapid method was developed based on high performance liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) to determine sivelestat and its metabolite XW-IMP-A in human plasma. After a simple protein precipitation, the samples and internal standards were analyzed on a C18 column by a gradient elution program. The mobile phase consisted of 30% acetonitrile in methanol and 5 mmol · L(-1) ammonium acetate at a flow rate of 0.7 mL · min(-1). The mass spectrometric data was collected in multiple reaction monitoring mode (MRM) in the negative electrospray ionization. The standard curves were linear in the range of 10.0-15,000 ng · mL(-1) for sivelestat, and 2.50-1000 ng · mL(-1) for XW-IMP-A. The low limits of quantitation were identified at 10.0 and 2.50 ng · mL for sivelestat and XW-IMP-A, respectively. The intra- and inter-day precision were within 11.3% and 13.1% for sivelestat and XW-IMP-A, and accuracy was 0.3% and 0.6% for sivelestat and XW-IMP-A, within the acceptable limits across all concentrations. The method was successfully validated in the pharmacokinetic study of sivelestat in healthy Chinese volunteers.

  20. Effects of RNAi-mediated knockdown of histone methyltransferases on the sex-specific mRNA expression of Imp in the silkworm Bombyx mori.


    Suzuki, Masataka G; Ito, Haruka; Aoki, Fugaku


    Sexual differentiation in Bombyx mori is controlled by sex-specific splicing of Bmdsx, which results in the omission of exons 3 and 4 in a male-specific manner. In B. mori, insulin-like growth factor II mRNA-binding protein (Imp) is a male-specific factor involved in male-specific splicing of Bmdsx. Male-specific Imp mRNA results from the male-specific inclusion of exon 8. To verify the link between histone methylation and alternative RNA processing in Imp, we examined the effects of RNAi-mediated knockdown of several histone methyltransferases on the sex-specific mRNA expression of Imp. As a result, male-specific expression of Imp mRNA was completely abolished when expression of the H3K79 methyltransferase DOT1L was repressed to <10% of that in control males. Chromatin immunoprecipitation-quantitative PCR analysis revealed a higher distribution of H3K79me2 in normal males than in normal females across Imp. RNA polymerase II (RNAP II) processivity assays indicated that RNAi knockdown of DOT1L in males caused a twofold decrease in RNAP II processivity compared to that in control males, with almost equivalent levels to those observed in normal females. Inhibition of RNAP II-mediated elongation in male cells repressed the male-specific splicing of Imp. Our data suggest the possibility that H3K79me2 accumulation along Imp is associated with the male-specific alternative processing of Imp mRNA that results from increased RNAP II processivity.

  1. Effects of RNAi-Mediated Knockdown of Histone Methyltransferases on the Sex-Specific mRNA Expression of Imp in the Silkworm Bombyx mori

    PubMed Central

    Suzuki, Masataka G.; Ito, Haruka; Aoki, Fugaku


    Sexual differentiation in Bombyx mori is controlled by sex-specific splicing of Bmdsx, which results in the omission of exons 3 and 4 in a male-specific manner. In B. mori, insulin-like growth factor II mRNA-binding protein (Imp) is a male-specific factor involved in male-specific splicing of Bmdsx. Male-specific Imp mRNA results from the male-specific inclusion of exon 8. To verify the link between histone methylation and alternative RNA processing in Imp, we examined the effects of RNAi-mediated knockdown of several histone methyltransferases on the sex-specific mRNA expression of Imp. As a result, male-specific expression of Imp mRNA was completely abolished when expression of the H3K79 methyltransferase DOT1L was repressed to <10% of that in control males. Chromatin immunoprecipitation-quantitative PCR analysis revealed a higher distribution of H3K79me2 in normal males than in normal females across Imp. RNA polymerase II (RNAP II) processivity assays indicated that RNAi knockdown of DOT1L in males caused a twofold decrease in RNAP II processivity compared to that in control males, with almost equivalent levels to those observed in normal females. Inhibition of RNAP II-mediated elongation in male cells repressed the male-specific splicing of Imp. Our data suggest the possibility that H3K79me2 accumulation along Imp is associated with the male-specific alternative processing of Imp mRNA that results from increased RNAP II processivity. PMID:24758924

  2. ISEE/IMP Observations of simultaneous upstream ion events

    SciTech Connect

    Mitchel, D.G.; Roelof, E.C.; Sanderson, T.R.; Reinhard, R.; Wenzel, K.


    Propagation of upstream energetic (50--200 keV) ions is analyzed in sixteen events observed simulataneously by solid state detectors on ISEE 3 at approx.200 R/sub E/ and on IMP 8 at approx.35 R/sub E/ from the earth. Conclusions are based on comparisons of the pitch angle distributions observed at the two spacecraft and transformed into the solar wind frame. They are beamlike at ISEE 3 and are confined to the outward hemisphere. When IMP 8 is furtherest from the bow shock, they are also usually beamlike, or hemispheric. However, when IMP 8 is closer to the bow shock, pancakelike distributions are observed. This systematic variation in the IMP 8 pitch angle distributions delimits a scattering region l< or approx. =14 R/sub E/ upstream of the earth's bow shock (l measured along the interplanetary magnetic field) that dominates ion propagation, influences the global distribution of fluxes in the foreshock, and may play a role in acceleration of the ions. When IMP 8 is beyond lapprox.15 R/sub E/, the propagation appears to be essentially scatter-free between IMP 8 and ISEE 3; this is deduced from the absence of earthward fluxes at IMP 8 as well as the tendency for the spin-averaged fluxes to be comparable at the two spacecraft.

  3. ISEE/IMP observations of simultaneous upstream ion events

    NASA Technical Reports Server (NTRS)

    Mitchell, D. G.; Roelof, E. C.; Sanderson, T. R.; Reinhard, R.; Wenzel, K.-P.


    Propagation of upstream energetic (50-200 keV) ions is analyzed in sixteen events observed simultaneously by solid state detectors on ISEE 3 at about 200 earth radii and on IMP 8 at about 35 earth radii from the earth. Conclusions are based on comparisons of the pitch angle distributions observed at the two spacecraft and transformed into the solar wind frame. They are beamlike at ISEE 3 and are confined to the outward hemisphere. When IMP 8 is furthest from the bow shock, they are also usually beamlike, or hemispheric. However, when IMP 8 is closer to the bow shock, pancakelike distributions are observed. This systematic variation in the IMP 8 pitch angle distributions delimits a scattering region l less than about 15 earth radii upstream of the earth's bow shock (l measured along the interplanetary magnetic field) that dominates ion propagation, influences the global distribution of fluxes in the foreshock, and may play a role in acceleration of the ions. When IMP 8 is beyond l of about 15 earth radii the propagation appears to be essentially scatter-free between IMP 8 and ISEE 3; this is deduced from the absence of earthward fluxes at IMP 8 as well as the tendency for the spin-averaged fluxes to be comparable at the two spacecraft.

  4. Structure of Cryptosporidium IMP dehydrogenase bound to an inhibitor with in vivo antiparasitic activity

    SciTech Connect

    Kim, Youngchang; Makowska-Grzyska, Magdalena Maria; Gorla, Suresh; Gollapalli, Deviprasad R; Cuny, Gregory D.; Joachimiak, Andrzej; Hedstrom, Lizbeth


    Inosine 5'-monophosphate dehydrogenase (IMPDH) is a promising target for the treatment of Cryptosporidium infections. Here, the structure of C. parvum IMPDH (CpIMPDH) in complex with inosine 5'-monophosphate (IMP) and P131, an inhibitor with in vivo anticryptosporidial activity, is reported. P131 contains two aromatic groups, one of which interacts with the hypoxanthine ring of IMP, while the second interacts with the aromatic ring of a tyrosine in the adjacent subunit. In addition, the amine and NO2 moieties bind in hydrated cavities, forming water-mediated hydrogen bonds to the protein. The design of compounds to replace these water molecules is a new strategy for the further optimization of C. parvum inhibitors for both antiparasitic and antibacterial applications.

  5. Structure of Cryptosporidium IMP dehydrogenase bound to an inhibitor with in vivo antiparasitic activity.


    Kim, Youngchang; Makowska-Grzyska, Magdalena; Gorla, Suresh Kumar; Gollapalli, Deviprasad R; Cuny, Gregory D; Joachimiak, Andrzej; Hedstrom, Lizbeth


    Inosine 5'-monophosphate dehydrogenase (IMPDH) is a promising target for the treatment of Cryptosporidium infections. Here, the structure of C. parvum IMPDH (CpIMPDH) in complex with inosine 5'-monophosphate (IMP) and P131, an inhibitor with in vivo anticryptosporidial activity, is reported. P131 contains two aromatic groups, one of which interacts with the hypoxanthine ring of IMP, while the second interacts with the aromatic ring of a tyrosine in the adjacent subunit. In addition, the amine and NO2 moieties bind in hydrated cavities, forming water-mediated hydrogen bonds to the protein. The design of compounds to replace these water molecules is a new strategy for the further optimization of C. parvum inhibitors for both antiparasitic and antibacterial applications.

  6. Structure of Cryptosporidium IMP dehydrogenase bound to an inhibitor with in vivo antiparasitic activity


    Kim, Youngchang; Makowska-Grzyska, Magdalena; Gorla, Suresh Kumar; ...


    Inosine 5´-monophosphate dehydrogenase (IMPDH) is a promising target for the treatment of Cryptosporidium infections. Here, the structure of C. parvum IMPDH (CpIMPDH) in complex with inosine 5´-monophosphate (IMP) and P131, an inhibitor with in vivo anticryptosporidial activity, is reported. P131 contains two aromatic groups, one of which interacts with the hypoxanthine ring of IMP, while the second interacts with the aromatic ring of a tyrosine in the adjacent subunit. In addition, the amine and NO2 moieties bind in hydrated cavities, forming water-mediated hydrogen bonds to the protein. The design of compounds to replace these water molecules is a new strategymore » for the further optimization of C. parvum inhibitors for both antiparasitic and antibacterial applications.« less

  7. Purification, crystallization and preliminary X-ray diffraction analysis of Imp3 in complex with an Mpp10 peptide involved in yeast ribosome biogenesis

    PubMed Central

    Zheng, Sanduo; Ye, Keqiong


    Eukaryotic ribosome synthesis requires a vast number of transiently associated factors. Mpp10, Imp3 and Imp4 form a protein complex in the 90S pre-ribosomal particle that conducts early processing of 18S rRNA. Here, a short fragment of Mpp10 was identified to associate with and increase the solubility of Imp3. An Imp3–Mpp10 complex was co-expressed, co-purified and co-crystallized. Preliminary X-ray diffraction analysis revealed that the crystal diffracted to 2.1 Å resolution and belonged to space group P212121, with unit-cell parameters a = 51.6, b = 86.9, c = 88.7 Å. PMID:25005089

  8. Wind and IMP 8 Solar Wind, Magnetosheath and Shock Data

    NASA Technical Reports Server (NTRS)


    The purpose of this project was to provide the community access to magnetosheath data near Earth. We provided 27 years of IMP 8 magnetosheath proton velocities, densities, and temperatures with our best (usually 1-min.) time resolution. IMP 8 crosses the magnetosheath twice each 125 day orbit, and we provided magnetosheath data for the roughly 27 years of data for which magnetometer data are also available (which are needed to reliably pick boundaries). We provided this 27 years of IMP 8 magnetosheath data to the NSSDC; this data is now integrated with the IMP 8 solar wind data with flags indicating whether each data point is in the solar wind, magnetosheath, or at the boundary between the two regions. The plasma speed, density, and temperature are provided for each magnetosheath point. These data are also available on the MIT web site ftp://space We provide ASCII time-ordered rows of data giving the observation time, the spacecraft position in GSE, the velocity is GSE, the density and temperature for protons. We also have analyzed and archived on our web site the Wind magnetosheath plasma parameters. These consist of ascii files of the proton and alpha densities, speeds, and thermal speeds. These data are available at These are the two products promised in the work statement and they have been completed in full.

  9. Wind and IMP 8 Solar Wind, Magnetosheath and Shock Data

    NASA Technical Reports Server (NTRS)


    The purpose of this project was to provide the community access to magnetosheath data near Earth. We provided 27 years of IMP 8 magnetosheath proton velocities, densities, and temperatures with our best (usually 1-min.) time resolution. IMP 8 crosses the magnetosheath twice each 125 day orbit, and we provided magnetosheath data for the roughly 27 years of data for which magnetometer data are also available (which are needed to reliably pick boundaries). We provided this 27 years of IMP 8 magnetosheath data to the NSSDC; this data is now integrated with the IMP 8 solar wind data with flags indicating whether each data point is in the solar wind, magnetosheath, or at the boundary between the two regions. The plasma speed, density, and temperature are provided for each magnetosheath point. These data are also available on the MIT web site ftp://space We provide ASCII time-ordered rows of data giving the observation time, the spacecraft position in GSE, the velocity is GSE, the density and temperature for protons. We also have analyzed and archived on our web site the Wind magnetosheath plasma parameters. These consist of ascii files of the proton and alpha densities, speeds, and thermal speeds. These data are available at These are the two products promised in the work statement and they have been completed in full.

  10. EGF enhances low-invasive cancer cell invasion by promoting IMP-3 expression.


    Zhang, Xianglan; Jung, Im-Hee; Hwang, Young Sun


    The initiation and progression of cancer is closely associated with the tumor microenvironment. The overexpression of oncogenes during tumor growth and progression by stromal stimuli can affect the aggressiveness of the cancer. In this study, in vitro and in vivo studies were performed to examine the role of stromal epidermal growth factor (EGF) in enhancing the invasive potential of in low-invasive cancer. EGF was tested in order to elucidate the specific molecules that participate in increasing the invasive potential of low-invasive cancer cells. EGF stimulation enhanced cancer invasion in an EGF receptor (EGFR)-dependent manner. EGF induced insulin-like growth factor-II mRNA-binding protein-3 (IMP-3) and podoplanin (PDPN) expression, which play an important role in oral squamous cell carcinoma (OSCC) cell invasion. An apparent tumor mass was not observed in the mouse xenograft; however, multiple tumor microfoci were seen in mice injected with IMP-3-overexpressing cells. These results show that EGF stimulates IMP-3 expression, thereby increasing cancer invasion and tumor progression.

  11. Imp3 unfolds stem structures in pre-rRNA and U3 snoRNA to form a duplex essential for small subunit processing

    PubMed Central

    Shah, Binal N.; Liu, Xin; Correll, Carl C.


    Eukaryotic ribosome biogenesis requires rapid hybridization between the U3 snoRNA and the pre-rRNA to direct cleavages at the A0, A1, and A2 sites in pre-rRNA that liberate the small subunit precursor. The bases involved in hybridization of one of the three duplexes that U3 makes with pre-rRNA, designated the U3-18S duplex, are buried in conserved structures: box A/A′ stem–loop in U3 snoRNA and helix 1 (H1) in the 18S region of the pre-rRNA. These conserved structures must be unfolded to permit the necessary hybridization. Previously, we reported that Imp3 and Imp4 promote U3-18S hybridization in vitro, but the mechanism by which these proteins facilitate U3-18S duplex formation remained unclear. Here, we directly addressed this question by probing base accessibility with chemical modification and backbone accessibility with ribonuclease activity of U3 and pre-rRNA fragments that mimic the secondary structure observed in vivo. Our results demonstrate that U3-18S hybridization requires only Imp3. Binding to each RNA by Imp3 provides sufficient energy to unfold both the 18S H1 and the U3 box A/A′ stem structures. The Imp3 unfolding activity also increases accessibility at the U3-dependent A0 and A1 sites, perhaps signaling cleavage at these sites to generate the 5′ mature end of 18S. Imp4 destabilizes the U3-18S duplex to aid U3 release, thus differentiating the roles of these proteins. Protein-dependent unfolding of these structures may serve as a switch to block U3-pre-rRNA interactions until recruitment of Imp3, thereby preventing premature and inaccurate U3-dependent pre-rRNA cleavage and folding events in eukaryotic ribosome biogenesis. PMID:23980203

  12. IMP-51, a novel IMP-type metallo-β-lactamase with increased doripenem- and meropenem-hydrolyzing activities, in a carbapenem-resistant Pseudomonas aeruginosa clinical isolate.


    Tada, Tatsuya; Nhung, Pham Hong; Miyoshi-Akiyama, Tohru; Shimada, Kayo; Phuong, Doan Mai; Anh, Nguyen Quoc; Ohmagari, Norio; Kirikae, Teruo


    A meropenem-resistant Pseudomonas aeruginosa isolate was obtained from a patient in a medical setting in Hanoi, Vietnam. The isolate was found to have a novel IMP-type metallo-β-lactamase, IMP-51, which differed from IMP-7 by an amino acid substitution (Ser262Gly). Escherichia coli expressing blaIMP-51 showed greater resistance to cefoxitin, meropenem, and moxalactam than E. coli expressing blaIMP-7. The amino acid residue at position 262 was located near the active site, proximal to the H263 Zn(II) ligand. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Relative to the Caltech Electron/Isotope Spectrometer-IMP

    NASA Technical Reports Server (NTRS)


    The Electron Isotope Spectrometers (EIS) on IMP-8 was designed to provide measurements of low energy isotopes from H to O (1 less than or equal to Z less than or equal to 8) over the energy range from approx. 2 to approx. 40 MeV/nuc, as well as low energy electrons from approx. 0.2 to approx. 6 MeV. These measurements supported studies of the acceleration and transport of energetic particles originating on the Sun, in interplanetary space, in the Galaxy, and in Earth's and Jupiter's magnetosphere. IMP-8 was launched in October 1973 and still continues to provide key particles and fields measurements from orbit about the Earth. The IMP-8 EIS continued to operate flawlessly until 8/3/92, when a partial failure was suffered in a bias supply, which reduced the ability of the instrument to measure high energy particles. The EIS was subsequently turned off in 1995. A nearly identical instrument was flown on IMP-7 from 10/92 to 7/96, and many studies combined results from both instruments. For completeness, this report summarizes scientific results and publications from the entire IMP-7&8 effort, not just from the period covered by NAG5-727.

  14. The last enzyme of the de novo purine synthesis pathway 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC) plays a central role in insulin signaling and the Golgi/endosomes protein network.


    Boutchueng-Djidjou, Martial; Collard-Simard, Gabriel; Fortier, Suzanne; Hébert, Sébastien S; Kelly, Isabelle; Landry, Christian R; Faure, Robert L


    Insulin is internalized with its cognate receptor into the endosomal apparatus rapidly after binding to hepatocytes. We performed a bioinformatic screen of Golgi/endosome hepatic protein fractions and found that ATIC, which is a rate-limiting enzyme in the de novo purine biosynthesis pathway, and PTPLAD1 are associated with insulin receptor (IR) internalization. The IR interactome (IRGEN) connects ATIC to AMPK within the Golgi/endosome protein network (GEN). Forty-five percent of the IR Golgi/endosome protein network have common heritable variants associated with type 2 diabetes, including ATIC and AMPK. We show that PTPLAD1 and AMPK are rapidly compartmentalized within the plasma membrane (PM) and Golgi/endosome fractions after insulin stimulation and that ATIC later accumulates in the Golgi/endosome fraction. Using an in vitro reconstitution system and siRNA-mediated partial knockdown of ATIC and PTPLAD1 in HEK293 cells, we show that both ATIC and PTPLAD1 affect IR tyrosine phosphorylation and endocytosis. We further show that insulin stimulation and ATIC knockdown readily increase the level of AMPK-Thr172 phosphorylation in IR complexes. We observed that IR internalization was markedly decreased after AMPKα2 knockdown, and treatment with the ATIC substrate AICAR, which is an allosteric activator of AMPK, increased IR endocytosis in cultured cells and in the liver. These results suggest the presence of a signaling mechanism that senses adenylate synthesis, ATP levels, and IR activation states and that acts in regulating IR autophosphorylation and endocytosis.

  15. The Last Enzyme of the De Novo Purine Synthesis Pathway 5-aminoimidazole-4-carboxamide Ribonucleotide Formyltransferase/IMP Cyclohydrolase (ATIC) Plays a Central Role in Insulin Signaling and the Golgi/Endosomes Protein Network*

    PubMed Central

    Boutchueng-Djidjou, Martial; Collard-Simard, Gabriel; Fortier, Suzanne; Hébert, Sébastien S.; Kelly, Isabelle; Landry, Christian R.; Faure, Robert L.


    Insulin is internalized with its cognate receptor into the endosomal apparatus rapidly after binding to hepatocytes. We performed a bioinformatic screen of Golgi/endosome hepatic protein fractions and found that ATIC, which is a rate-limiting enzyme in the de novo purine biosynthesis pathway, and PTPLAD1 are associated with insulin receptor (IR) internalization. The IR interactome (IRGEN) connects ATIC to AMPK within the Golgi/endosome protein network (GEN). Forty-five percent of the IR Golgi/endosome protein network have common heritable variants associated with type 2 diabetes, including ATIC and AMPK. We show that PTPLAD1 and AMPK are rapidly compartmentalized within the plasma membrane (PM) and Golgi/endosome fractions after insulin stimulation and that ATIC later accumulates in the Golgi/endosome fraction. Using an in vitro reconstitution system and siRNA-mediated partial knockdown of ATIC and PTPLAD1 in HEK293 cells, we show that both ATIC and PTPLAD1 affect IR tyrosine phosphorylation and endocytosis. We further show that insulin stimulation and ATIC knockdown readily increase the level of AMPK-Thr172 phosphorylation in IR complexes. We observed that IR internalization was markedly decreased after AMPKα2 knockdown, and treatment with the ATIC substrate AICAR, which is an allosteric activator of AMPK, increased IR endocytosis in cultured cells and in the liver. These results suggest the presence of a signaling mechanism that senses adenylate synthesis, ATP levels, and IR activation states and that acts in regulating IR autophosphorylation and endocytosis. PMID:25687571

  16. The let-7–Imp axis regulates ageing of the Drosophila testis stem-cell niche

    PubMed Central

    Toledano, Hila; D’Alterio, Cecilia; Czech, Benjamin; Levine, Erel; Jones, D. Leanne


    Adult stem cells support tissue homeostasis and repair throughout the life of an individual. During ageing, numerous intrinsic and extrinsic changes occur that result in altered stem-cell behaviour and reduced tissue maintenance and regeneration. In the Drosophila testis, ageing results in a marked decrease in the self-renewal factor Unpaired (Upd), leading to a concomitant loss of germline stem cells. Here we demonstrate that IGF-II messenger RNA binding protein (Imp) counteracts endogenous small interfering RNAs to stabilize upd (also known as os) RNA. However, similar to upd, Imp expression decreases in the hub cells of older males, which is due to the targeting of Imp by the heterochronic microRNA let-7. In the absence of Imp, upd mRNA therefore becomes unprotected and susceptible to degradation. Understanding the mechanistic basis for ageing-related changes in stem-cell behaviour will lead to the development of strategies to treat age-onset diseases and facilitate stem-cell-based therapies in older individuals. PMID:22660319

  17. Extendible-retractable electric field measurement antenna for IMP J

    NASA Technical Reports Server (NTRS)

    Larrick, W.


    An antenna dispenser mechanism for the IMP J spacecraft was designed, fabricated, and tested. Upon command the mechanism deploys or retracts a conductor for use as a receiving antenna for an electric field measurement experiment. Five identical units were fabricated and tested to the IMP H & J environmental test specification. Of these, four are designated for flight on the IMP J spacecraft and one as a prototype flight spare. The testing program was successfully completed although certain design modifications were required as problems were uncovered by the testing; particularly thermal vacuum operation. The antenna mechanism functions well under the expected environmental and loading conditions. The wear life and load capability of the dry molybdenum disulphide lubricant originally used on the heavily loaded worm and gear pair were disappointing and a substitute material was applied. The lubricant finally applied performed well; although other problems were generated.

  18. ISTP observations of plasmoid ejection: IMP 8 and Geotail

    SciTech Connect

    Slavin, J.A.; Fairfield, D.H.; Kuznetsova, M.M.; Lepping, R.P. Owen, C.J. Taguchi, S.; Saito, Y.; Yamamoto, T. Kokubun, S. Lui, A.T.Y. Reeves, G.D.


    IMP 8 and Geotail observations of traveling compression regions (TCRs) and plasmoids, respectively, are used to investigate plasmoid formation and ejection. One year of IMP 8 magnetometer measurements taken during the distant tail phase of the Geotail mission were searched for TCRs, which signal the release of plasmoids down the tail. A total of 10 such intervals were identified. Examination of the Geotail measurements showed that this spacecraft was in the magnetotail for only three of the events. However, in all three cases, clear plasmoid signatures were observed at Geotail. These plasmoids were observed at distances of X={minus}170 to {minus}197 R{sub E}. The in situ plasma velocities in these plasmoids are found to exceed the time-of-flight speeds between IMP 8 and Geotail suggesting that some further acceleration may have taken place following release. The inferred lengths of these plasmoids, {approximately}27{endash}40 R{sub E}, are comparable to the downtail distance of IMP 8. This indicates that TCR at IMP 8 can be caused by plasmoids forming not only earthward but also adjacent to or just tailward of the spacecraft. The closeness of IMP 8 to the point of plasmoid formation is confirmed by the small, {approximately}0{endash}3min, time delays between the TCR perturbation and substorm onset. In two of the plasmoid events, high-speed earthward plasma flows and streaming energetic particles were measured in the plasma sheet boundary layer surrounding the plasmoid along with large positive B{sub z} at the leading edge of the plasmoid suggesting that the core of the plasmoid was {open_quotes}snow plowing{close_quotes} into flux tubes recently closed at an active distant neutral line. In summary, these unique two-point measurements clearly show plasmoid ejection near substorm onset, their rapid movement to the distant tail and their further evolution as they encounter preexisting X lines in the distant tail. {copyright} 1998 American Geophysical Union

  19. IMPS albedo and diameter for Asteroid 243 Ida

    NASA Technical Reports Server (NTRS)

    Veeder, G. J.; Tedesco, E. F.


    243 Ida is the second asteroid target of the Galileo mission. The Infrared Astronomical Satellite (IRAS) detected Ida several times during its 1983 sky survey. The IRAS Minor Planet Survey (IMPS) yields a total of 13 usable observations during 6 sightings of Ida. These data result in a geometric visual albedo of 0.24 and a mean diameter of 28 km for Ida. The IMPS catalog updates and extends the IRAS Asteroid and Comet Survey through asteroid number 4679. File versions of IMPS final products will be available from the National Space Science Data Center (NSSDC). The input for IMPS processing includes updated visual absolute magnitudes and orbital elements for each asteroid. H and G are 9.94 and 0.15 for Ida. IMPS also includes a correction for low flux densities (less than approximately 1 Jansky). In the case of Ida, 3 observations at 12 microns, 6 at 25 microns, and 4 at 60 microns were considered acceptable for analysis. Most of these do have flux densities less than 1 Jansky with a value of approximately 5 for their estimated SNR. The 25 microns observations as plotted in the figure are consistent with the variation expected for the cross section of Ida with rotation. Ida is a main belt asteroid with an S taxonomic classification. The spectra of S asteroids tend to be dominated by pyroxene with visual albedos from 0.1 to 0.3. The IMPS average albedo of 0.24 (plus or minus 0.07) for 243 Ida is in the upper range observed for S asteroids.

  20. Status of the laser ion source at IMP

    SciTech Connect

    Sha, S.; Zhao, H. W.; Guo, X. H.; Fang, X.; Guo, J. W.; Zhang, W. H.; Ma, H. Y.; Lin, S. H.; Li, X. X.; Ma, B. H.; Wang, H.; Wu, Q.; Li, J. Y.; Feng, Y. C.; Zhao, H. Y.; Zhu, Y. H.; Sun, L. T.; Zhang, X. Z.; Xie, D. Z.; Zhang, Z. L.; and others


    A laser (Nd:YAG laser, 3 J, 1064 nm, 8-10 ns) ion source has been built and under development at IMP to provide pulsed high-charge-state heavy ion beams to a radio frequency quadrupole (RFQ) for upgrading the IMP accelerators with a new low-energy beam injector. The laser ion source currently operates in a direct plasma injection scheme to inject the high charge state ions produced from a solid target into the RFQ. The maximum power density on the target was about 8.4 x 10{sup 12} W/cm{sup 2}. The preliminary experimental results will be presented and discussed in this paper.

  1. Metabotropic glutamate receptors are involved in the detection of IMP and L-amino acids by mouse taste sensory cells.


    Pal Choudhuri, S; Delay, R J; Delay, E R


    G-protein-coupled receptors are thought to be involved in the detection of umami and L-amino acid taste. These include the heterodimer taste receptor type 1 member 1 (T1r1)+taste receptor type 1 member 3 (T1r3), taste and brain variants of mGluR4 and mGluR1, and calcium sensors. While several studies suggest T1r1+T1r3 is a broadly tuned lLamino acid receptor, little is known about the function of metabotropic glutamate receptors (mGluRs) in L-amino acid taste transduction. Calcium imaging of isolated taste sensory cells (TSCs) of T1r3-GFP and T1r3 knock-out (T1r3 KO) mice was performed using the ratiometric dye Fura 2 AM to investigate the role of different mGluRs in detecting various L-amino acids and inosine 5' monophosphate (IMP). Using agonists selective for various mGluRs such as (RS)-3,5-dihydroxyphenylglycine (DHPG) (an mGluR1 agonist) and L-(+)-2-amino-4-phosphonobutyric acid (l-AP4) (an mGluR4 agonist), we evaluated TSCs to determine if they might respond to these agonists, IMP, and three L-amino acids (monopotassium L-glutamate, L-serine and L-arginine). Additionally, we used selective antagonists against different mGluRs such as (RS)-L-aminoindan-1,5-dicarboxylic acid (AIDA) (an mGluR1 antagonist), and (RS)-α-methylserine-O-phosphate (MSOP) (an mGluR4 antagonist) to determine if they can block responses elicited by these L-amino acids and IMP. We found that L-amino acid- and IMP-responsive cells also responded to each agonist. Antagonists for mGluR4 and mGluR1 significantly blocked the responses elicited by IMP and each of the L-amino acids. Collectively, these data provide evidence for the involvement of taste and brain variants of mGluR1 and mGluR4 in L-amino acid and IMP taste responses in mice, and support the concept that multiple receptors contribute to IMP and L-amino acid taste.

  2. Emergence of Citrobacter freundii carrying IMP-8 metallo-β-lactamase in Germany.


    Peter, S; Wolz, C; Kaase, M; Marschal, M; Schulte, B; Vogel, W; Autenrieth, I; Willmann, M


    Metallo-β-lactamases (MBLs) in Enterobacteriaceae are an increasing problem worldwide. This report describes the isolation of Citrobacter freundii carrying IMP-8 MBL from three patients during the period from March 2012 until March 2013 in Germany. The bla IMP-8 enzyme is predominantly found in Asia, where IMP-8 has spread to various enterobacterial species causing serious infections. To our best knowledge, this is the first report of bla IMP-8 habouring Enterobacteriaceae in Europe.

  3. Hemimegalencephaly: Clinical, EEG, neuroimaging, and IMP-SPECT correlation

    SciTech Connect

    Konkol, R.J.; Maister, B.H.; Wells, R.G.; Sty, J.R. )


    Iofetamine-single photon emission computed tomography (IMP-SPECT) was performed on 2 girls (5 1/2 and 6 years of age) with histories of intractable seizures, developmental delay, and unilateral hemiparesis secondary to hemimegalencephaly. Electroencephalography (EEG) revealed frequent focal discharges in 1 patient, while a nearly continuous burst suppression pattern over the malformed hemisphere was recorded in the other. IMP-SPECT demonstrated a good correlation with neuroimaging studies. In spite of the different EEG patterns, which had been proposed to predict contrasting clinical outcomes, both IMP-SPECT scans disclosed a similar decrease in tracer uptake in the malformed hemisphere. These results are consistent with the pattern of decreased tracer uptake found in other interictal studies of focal seizures without cerebral malformations. In view of recent recommendations for hemispherectomy in these patients, we suggest that the IMP-SPECT scan be used to compliment EEG as a method to define the extent of abnormality which may be more relevant to long-term prognosis than EEG alone.

  4. Delta-90 Interplanetary Monitoring Platform-H (IMP-H)

    NASA Technical Reports Server (NTRS)


    The operations summary for the IMP-H spacecraft is presented. The subjects discussed are: (1) mission objective, (2) description of launch vehicle and spacecraft, (3) mission plan, (4) flight plan, and (5) post launch operations. Details of the mission are presented in drawings and tables of data.

  5. Support of Data Access for the IMP-8 UMD Experiment

    NASA Technical Reports Server (NTRS)

    Ipavich, F. M.; Gloeckler, G.


    This grant report provides information on data from the Interplanetary Monitoring Platform-8 (IMP-8). Topics covered include: (1) the science involved in the project; (2) the collection of data; (3) the processing of data; (4) the submission of data to other facilities; (5) the availability of data on the world wide web (WWW). Graphs are also included of data on the interstellar medium.

  6. A search for charged massive particles in IMP 8 data

    NASA Technical Reports Server (NTRS)

    Snowden-Ifft, D. P.; Barwick, S. W.; Price, P. B.


    Data from the IMP 8 satellite are used here to rule out charged massive particles (CHAMPs) with masses between 2.4 and 56,000 TeV as the source of the dark matter in the Galactic halo. This limit is achieved under the assumption that CHAMPs are virialized.

  7. Draft Genome Sequence of an IMP-7-Producing Pseudomonas aeruginosa Bloodstream Infection Isolate from Australia

    PubMed Central

    Jennison, A.; Wailan, A. M.; Paterson, D. L.


    ABSTRACT IMP-7 is one of the two IMP-type carbapenemases that in Pseudomonas aeruginosa are not limited to a geographic area, but it has not been previously reported in the Australian setting. We report here the draft genome sequence of an Australian P. aeruginosa bloodstream infection isolate that contains IMP-7. PMID:28684579

  8. 7 CFR 772.11 - Transfer and assumption-IMP loans.

    Code of Federal Regulations, 2014 CFR


    ... 7 Agriculture 7 2014-01-01 2014-01-01 false Transfer and assumption-IMP loans. 772.11 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.11 Transfer and assumption—IMP loans. Transfers and assumptions for IMP loans are processed in accordance with 7 CFR part 765. Any...

  9. 7 CFR 772.11 - Transfer and assumption-IMP loans.

    Code of Federal Regulations, 2013 CFR


    ... 7 Agriculture 7 2013-01-01 2013-01-01 false Transfer and assumption-IMP loans. 772.11 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.11 Transfer and assumption—IMP loans. Transfers and assumptions for IMP loans are processed in accordance with 7 CFR part 765. Any...

  10. 7 CFR 772.11 - Transfer and assumption-IMP loans.

    Code of Federal Regulations, 2010 CFR


    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Transfer and assumption-IMP loans. 772.11 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.11 Transfer and assumption—IMP loans. Transfers and assumptions for IMP loans are processed in accordance with 7 CFR part 765. Any...

  11. 7 CFR 772.11 - Transfer and assumption-IMP loans.

    Code of Federal Regulations, 2011 CFR


    ... 7 Agriculture 7 2011-01-01 2011-01-01 false Transfer and assumption-IMP loans. 772.11 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.11 Transfer and assumption—IMP loans. Transfers and assumptions for IMP loans are processed in accordance with 7 CFR part 765. Any...

  12. Draft Genome Sequence of an IMP-7-Producing Pseudomonas aeruginosa Bloodstream Infection Isolate from Australia.


    McCarthy, K L; Jennison, A; Wailan, A M; Paterson, D L


    IMP-7 is one of the two IMP-type carbapenemases that in Pseudomonas aeruginosa are not limited to a geographic area, but it has not been previously reported in the Australian setting. We report here the draft genome sequence of an Australian P. aeruginosa bloodstream infection isolate that contains IMP-7. Copyright © 2017 McCarthy et al.

  13. 7 CFR 772.11 - Transfer and assumption-IMP loans.

    Code of Federal Regulations, 2012 CFR


    ... 7 Agriculture 7 2012-01-01 2012-01-01 false Transfer and assumption-IMP loans. 772.11 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.11 Transfer and assumption—IMP loans. Transfers and assumptions for IMP loans are processed in accordance with 7 CFR part 765. Any...

  14. Control of an outbreak due to orthopedic infections caused by Enterobacteriaceae producing IMP-4 or IMP-8 carbapenemases.


    Pang, F; Jia, X-Q; Wang, B; Li, Y-H; Zhao, Q-G


    To investigate control of an outbreak due to orthopedic infections caused by Enterobacteriaceae producing IMP carbapenemases. The sporadic orthopedic infections with Enterobacteriaceae producing carbapenemase (CPE) were retrospectively analyzed in a Chinese tertiary care hospital from November 2010 to September 2012. The CPE were isolated from four distinct orthopedic patients, three patients infected with Enterobacter cloacae while the other with Klebsiella oxytoca. All strains were resistant to almost all the conventional antimicrobial. The strains produced IMP-4 type detected in the two early patients, while other strains could produce IMP-8 type. All of the four patients had ever undergoing invasive surgical procedure, and three of them were given fluoroquinolones for anti-infection treatment while the other patients was treated with meropenem. Ultimately, all patients were cured and discharged, without outbreak of nosocomial infection caused by CPE. Our study shows that strict infection control plays an important role in limiting dissemination of Enterobacteriaceae producing IMP carbapenemase. In addition, reasonable supporting treatment and disinfection protection seems to be more effective for the infection of strains. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  15. Protein Translation and Signaling in Human Eosinophils

    PubMed Central

    Esnault, Stephane; Shen, Zhong-Jian; Malter, James S.


    We have recently reported that, unlike IL-5 and GM-CSF, IL-3 induces increased translation of a subset of mRNAs. In addition, we have demonstrated that Pin1 controls the activity of mRNA binding proteins, leading to enhanced mRNA stability, GM-CSF protein production and prolonged eosinophil (EOS) survival. In this review, discussion will include an overview of cap-dependent protein translation and its regulation by intracellular signaling pathways. We will address the more general process of mRNA post-transcriptional regulation, especially regarding mRNA binding proteins, which are critical effectors of protein translation. Furthermore, we will focus on (1) the roles of IL-3-driven sustained signaling on enhanced protein translation in EOS, (2) the mechanisms regulating mRNA binding proteins activity in EOS, and (3) the potential targeting of IL-3 signaling and the signaling leading to mRNA binding activity changes to identify therapeutic targets to treat EOS-associated diseases. PMID:28971096

  16. Transcriptional Switch of the dia1 and impA Promoter during the Growth/Differentiation Transition

    PubMed Central

    Hirose, Shigenori; Mayanagi, Taira; Pears, Catherine; Amagai, Aiko; Loomis, William F.; Maeda, Yasuo


    When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition. PMID:16087752

  17. Significance of IMP3, nucleophosmin, and Ki-67 expression in papillary thyroid carcinoma.


    Yorukoglu, Aygun; Yalcin, Nagihan; Avci, Arzu; Cakalagaoglu, Fulya; Yaylali, Guzin; Akin, Fulya; Haciyanli, Mehmet; Ozden, Akin


    The purpose of our study was to investigate the diagnostic value of expression of IMP3, nucleophosmin, and correlation of these markers with Ki-67 proliferation index in papillary thyroid carcinoma and benign neoplasms of thyroid gland. The aim was also to investigate whether there is a difference between papillary and micropapillary carcinomas with regard to clinicopathologic parameters beside IMP3, nucleophosmin, and Ki-67 proliferation index. It was concluded that IMP3 and nucleophosmin cannot be a routine diagnostic marker for discrimination of papillary carcinomas and benign lesions. IMP3 positive staining was quite scarce in IMP3 positive papillary carcinomas although specifity of IMP3 is 100%. A statistically significant correlation was not detected between nucleophosmin, IMP-3, and Ki-67 proliferation index. A statistically significant correlation was found between tumor size, lymphovascular embolism, and Ki-67 proliferation index. There was also significant correlation between tumor size and lymphovascular embolism. © The Author(s) 2014.

  18. IMP-GMP 5'-nucleotidase in reptiles: occurrence in a turtle, a tortoise and three species of snakes.


    Itoh, Roichi; Kimura, Kayoko


    IMP-hydrolyzing activity, which is reactive with goose anti-pig lung IMP-GMP 5'-nucleotidase (c-N-II: EC. serum, was detected in extracts from liver, heart, kidney, spleen, stomach, skeletal muscle and lung from several species of reptiles: The values found in liver (U/mg protein) of one animal were: 4.5 for an ammono-ureotelic turtle (Trionyx sinensis japonicus); 3.7 for an ureo-uricotelic tortoise (Testudo elegans); 13-23 for three species of uricotelic snakes: Elaphe quadrivirgata, Elaphe conspicillata and Elaphe climacophora. These findings suggest that in the liver of snakes, c-N-II may participate in the production of uric acid as an end product of amino acid metabolism.

  19. [Compartment analysis of 123I-IMP brain SPECT].


    Higano, S; Shishido, F; Aizawa, Y; Miura, S; Murakami, M; Inugami, A; Kanno, I; Fujita, H; Uemura, K


    To clarify the kinetics of N-isopropyl [123I]p-iodoamphetamine (IMP) in the brain, 2-compartment analysis was applied for brain SPECT with 57-minute dynamic scan in 9 subjects. The model consisted of blood component and brain tissue component. Two transfer rate constants were defined; k1 showed the rate from the blood to the brain tissue, and k2 was that of back diffusion. The late scan was performed 210 minutes after the tracer injection. Suitable k values best fitting to the dynamic data were determined for all regions of interest. Predicted regional cerebral activity at 210 minutes using 57-minute dynamic data was well agreed with measured activity. These showed the kinetics of IMP in the brain was well described by the 2-compartment model. The partition coefficient (k1/k2 ratio) was as large as about 35, and almost constant in the various brain structures including hypoperfused areas. These findings indicated that the initial IMP images reflected the reasonable CBF distribution, which gave relatively reliable CBF values even if using microsphere model.

  20. Report on final recommendations for IMPS engineering-science payload

    NASA Technical Reports Server (NTRS)

    Garrett, H. B.


    Six general categories of key scientific and engineering concerns for the interactions measurements payload for shuttle (IMPS) mission are addressed: (1) dielectric charging; (2) material property changes; (3) electromagnetic interference, plasma interactions, and plasma wake effects associated with high-voltage solar arrays and large space structures; (4) radio frequency distortion and nonlinearities due to the enhanced plasma in the shuttle ram/wake; (5) shuttle glow and contamination; and (6) plasma interactions with the space-based radar. Lesser concerns are the interactions associated with EVA; the radiation and SEU effects peculiar to the auroral/polar cap environments; and space debris. The measurements needed to address the concerns associated with the general categories are described and a list of generic investigations capable of making the required measurements, emphasizing the spectrum of measurements necessary to quantize the interactions in the auroral/polar environments are included. A suggested ground-test plan for the IMPS project, a description of proposed follow-on IMPS missions, and a detailed bibliography for each of the interactions discussed are included.

  1. Energetic particles experiment instrumentation packaging program for IMP-F (Explorer 34) and IMP-G (Explorer 41) NASA Interplanetary Monitoring Platform program

    NASA Technical Reports Server (NTRS)


    The package design and assembly techniques for the IMP-F and IMP-G space-physics experiments, provided for the NASA Interplanetary Monitoring Platform Program are described. Thin-film, hybrid, integrated circuits used in these instruments to increase component density and reliability, and special procedures and precautions for the fabrication of space hardware are described.

  2. Detection of a variant metallo-beta-lactamase, IMP-10, from two unrelated strains of Pseudomonas aeruginosa and an alcaligenes xylosoxidans strain.


    Iyobe, Shizuko; Kusadokoro, Haruko; Takahashi, Ayako; Yomoda, Sachie; Okubo, Toyoji; Nakamura, Akio; O'Hara, Koji


    The gene bla(IMP-10) of a variant metallo-beta-lactamase, IMP-10, had a single base replacement of G by T at nucleotide 145, which led to an amino acid alteration of Val49 to Phe compared to the IMP-1 enzyme, indicating that IMP-10 was a point mutation derivative of IMP-1. Highly purified enzymes revealed that IMP-10 was different from IMP-1 in its extremely low hydrolyzing activities for penicillins, such as benzylpenicillin, ampicillin, and piperacillin.

  3. Regulation of Transfer Functions by the imp Locus of the Streptomyces coelicolor Plasmidogenic Element SLP1

    PubMed Central

    Hagege, Juliette M.; Brasch, Michael A.; Cohen, Stanley N.


    SLP1int is a 17.2-kb genetic element that normally is integrated site specifically into the chromosome of Streptomyces coelicolor A3(2). The imp operon within SLP1int represses replication of both chromosomally integrated and extrachromosomal SLP1. During mating with S. lividans, SLP1int can excise, delete part of imp, and form a family of autonomously replicating conjugative plasmids. Earlier work has shown that impA and impC gene products act in concert to control plasmid maintenance and regulate their own transcription. Here we report that these imp genes act also on a second promoter, Popimp (promoter opposite imp), located adjacent to, and initiating transcription divergent from, imp to regulate loci involved in the intramycelial transfer of SLP1 plasmids. spdB1 and spdB2, two overlapping genes immediately 3′ to Popimp and directly regulated by imp, are shown by Tn5 mutagenesis to control transfer-associated growth inhibition (i.e., pocking). Additional genes resembling transfer genes of other Streptomyces spp. plasmids and required for SLP1 transfer and/or postconjugal intramycelial spread are located more distally to Popimp. Expression of impA and impC in an otherwise competent recipient strain prevented SLP1-mediated gene transfer of chromosomal and plasmid genes but not plasmid-independent chromosome-mobilizing activity, suggesting that information transduced to recipients after the formation of mating pairs affects imp activity. Taken together with earlier evidence that the imp operon regulates SLP1 DNA replication, the results reported here implicate imp in the overall regulation of functions related to the extrachromosomal state of SLP1. PMID:10498709

  4. Molecular characterization of IMP-type metallo-β-lactamases among multidrug-resistant Achromobacter xylosoxidans.


    Yamamoto, Masaki; Nagao, Miki; Hotta, Gou; Matsumura, Yasufumi; Matsushima, Aki; Ito, Yutaka; Takakura, Shunji; Ichiyama, Satoshi


    To analyse the metallo-β-lactamase (MBL) genes and their genetic environments in clinical isolates of Achromobacter xylosoxidans. From January 2004 to December 2010, four MBL-producing, multidrug-resistant (MDR) A. xylosoxidans strains were isolated and analysed at a tertiary care university hospital in Japan. Species-level identification was confirmed by 16S ribosomal RNA gene sequencing. Molecular typing was performed using PFGE, the presence of MBL genes was detected using PCR, and integron gene cassettes were examined by cloning and sequence analysis of integron PCR products. The plasmids obtained from individual isolates were analysed based on EcoRI restriction patterns, Southern hybridizations using digoxigenin-labelled probes for bla(IMP-1) and bla(IMP-19) as well as conjugation and transformation experiments. No clonal relationship was found among the four A. xylosoxidans isolates. Three isolates harboured bla(IMP-1) and one isolate harboured bla(IMP-19). These MBL genes were carried on class 1 integrons. Four different class 1 integron gene cassette arrays were found, including orf1-bla(IMP-1)-aacA4, bla(IMP-1)-bla(IMP-1)-nit1/nit2-catB3-bla(IMP-1)-bla(IMP-1), aacA4-bla(IMP-1) and bla(IMP-19). The restriction pattern of the plasmid DNA obtained from each isolate was unique and the hybridization analyses revealed the presence of each MBL gene within a plasmid. Moreover, all of the plasmids carrying an MBL gene could be transformed into Escherichia coli HST08. This study provides genetic evidence for the existence of IMP-type MBL genes in MDR A. xylosoxidans isolates. Moreover, the present findings provide evidence that A. xylosoxidans can receive IMP-type MBL genes via plasmid-mediated transfer, which contributes to their carbapenem resistance.

  5. Irregular Mare Patches (IMPs): 100 Ma or 3 Ga?

    NASA Astrophysics Data System (ADS)

    Stopar, J.; Robinson, M. S.; van der Bogert, C. H.; Giguere, T.; Lawrence, S. J.; Ostrach, L. R.; Clegg-Watkins, R. N.


    IMPs exhibit a perplexing combination of characteristics that are consistent with either a 100 Ma or 3 Ga formation. Dozens of small-area IMPs have crisp morphologies and crater size-frequency distributions (SFDs) that denote relatively recent geologic activity (<100 Ma); however, the apparently well-developed regolith on portions of the IMPs are in conflict with such a young age [1]. To test possible formation hypotheses (e.g., [1-5]), which range from ancient volcanism to contemporary outgassing, we examined IMP morphology at the meter-scale with LROC NAC images and derived elevation models. We focused on the largest IMPs (Ina, Sosigenes, Cauchy, Maskelyne, and Nubium), where contacts between deposits are best developed. Most of our observations are consistent with multiple generations of inflation and breakouts (or squeeze-ups) of basaltic lavas that were affected by local slopes. Some of the extrusions coalesced into larger mounds or filled pre-existing craters. We did not observe evidence of large-scale void space (e.g., fissures, fractures, linear depressions, or pits) within or beneath the mounds or rougher deposits (e.g., [5]). But, small-scale voids may be signified by isolated pitted textures. We also did not detect evidence of the cooling fractures or lava plates expected in young lava flows and observed in lunar impact melt deposits. The smooth texture of the mounds is enigmatic. Block-less craters suggest at least 5 m of friable or poorly-cohesive material (such as regolith), yet mound margins exhibit slopes > 30° requiring significant material strength. Blocks are not common on the mounds, but are sometimes excavated by impacts (usually excavated from beneath the mounds). The uneven deposits are equally enigmatic and texturally varied (blocky, pitted, and crenulated). They are deficient in superposed craters compared to the mounds. If the mounds are indeed of similar age to the rougher units, then their different superposed crater morphologies and

  6. Irregular Mare Patches (IMPs): 100 Ma or 3 Ga?

    NASA Technical Reports Server (NTRS)

    Stopar, Julie; Robinson, Mark Southwick; van der Bogert, Carolyn H.; Giguere, Thomas; Lawrence, Samuel J.; Ostrach, Lillian Rose; Clegg-Watkins, Ryan N.


    IMPs exhibit a perplexing combination of characteristics that are consistent with either an approximately 100 Ma or 3 Ga formation. Dozens of small-area IMPs have crisp morphologies and crater size-frequency distributions (SFDs) that denote relatively recent geologic activity (less than 100 Ma); however, the apparently well-developed regolith on portions of the IMPs are in conflict with such a young age [1]. To test possible formation hypotheses (e.g., [1-5]), which range from ancient volcanism to contemporary outgassing, we examined IMP morphology at the meter-scale with LROC NAC images and derived elevation models. We focused on the largest IMPs (Ina, Sosigenes, Cauchy, Maskelyne, and Nubium), where contacts between deposits are best developed. Most of our observations are consistent with multiple generations of inflation and breakouts (or squeeze-ups) of basaltic lavas that were affected by local slopes. Some of the extrusions coalesced into larger mounds or filled pre-existing craters. We did not observe evidence of large-scale void space (e.g., fissures, fractures, linear depressions, or pits) within or beneath the mounds or rougher deposits (e.g., [5]). But, small-scale voids may be signified by isolated pitted textures. We also did not detect evidence of the cooling fractures or lava plates expected in young lava flows and observed in lunar impact melt deposits. The smooth texture of the mounds is enigmatic. Block-less craters suggest at least 5 m of friable or poorly-cohesive material (such as regolith), yet mound margins exhibit slopes greater than 30 deg requiring significant material strength. Blocks are not common on the mounds, but are sometimes excavated by impacts (usually excavated from beneath the mounds). The uneven deposits are equally enigmatic and texturally varied (blocky, pitted, and crenulated). They are deficient in superposed craters compared to the mounds. If the mounds are indeed of similar age to the rougher units, then their different

  7. IMP: a pipeline for reproducible reference-independent integrated metagenomic and metatranscriptomic analyses.


    Narayanasamy, Shaman; Jarosz, Yohan; Muller, Emilie E L; Heintz-Buschart, Anna; Herold, Malte; Kaysen, Anne; Laczny, Cédric C; Pinel, Nicolás; May, Patrick; Wilmes, Paul


    Existing workflows for the analysis of multi-omic microbiome datasets are lab-specific and often result in sub-optimal data usage. Here we present IMP, a reproducible and modular pipeline for the integrated and reference-independent analysis of coupled metagenomic and metatranscriptomic data. IMP incorporates robust read preprocessing, iterative co-assembly, analyses of microbial community structure and function, automated binning, as well as genomic signature-based visualizations. The IMP-based data integration strategy enhances data usage, output volume, and output quality as demonstrated using relevant use-cases. Finally, IMP is encapsulated within a user-friendly implementation using Python and Docker. IMP is available at (MIT license).

  8. Different motif requirements for the localization zipcode element of β-actin mRNA binding by HuD and ZBP1

    PubMed Central

    Kim, Hak Hee; Lee, Seung Joon; Gardiner, Amy S.; Perrone-Bizzozero, Nora I.; Yoo, Soonmoon


    Interactions of RNA-binding proteins (RBPs) with their target transcripts are essential for regulating gene expression at the posttranscriptional level including mRNA export/localization, stability, and translation. ZBP1 and HuD are RBPs that play pivotal roles in mRNA transport and local translational control in neuronal processes. While HuD possesses three RNA recognition motifs (RRMs), ZBP1 contains two RRMs and four K homology (KH) domains that either increase target specificity or provide a multi-target binding capability. Here we used isolated cis-element sequences of the target mRNA to examine directly protein-RNA interactions in cell-free systems. We found that both ZBP1 and HuD bind the zipcode element in rat β-actin mRNA's 3′ UTR. Differences between HuD and ZBP1 were observed in their binding preference to the element. HuD showed a binding preference for U-rich sequence. In contrast, ZBP1 binding to the zipcode RNA depended more on the structural level, as it required the proper spatial organization of a stem-loop that is mainly determined by the U-rich element juxtaposed to the 3′ end of a 5′-ACACCC-3′ motif. On the basis of this work, we propose that ZBP1 and HuD bind to overlapping sites in the β-actin zipcode, but they recognize different features of this target sequence. PMID:26152301

  9. IMP-27, a Unique Metallo-β-Lactamase Identified in Geographically Distinct Isolates of Proteus mirabilis.


    Dixon, Nyssa; Fowler, Randal C; Yoshizumi, A; Horiyama, Tsukasa; Ishii, Y; Harrison, Lucas; Geyer, Chelsie N; Moland, Ellen Smith; Thomson, Kenneth; Hanson, Nancy D


    A novel metallo-β-lactamase gene, blaIMP-27, was identified in unrelated Proteus mirabilis isolates from two geographically distinct locations in the United States. Both isolates harbor blaIMP-27 as part of the first gene cassette in a class 2 integron. Antimicrobial susceptibility testing indicated susceptibility to aztreonam, piperacillin-tazobactam, and ceftazidime but resistance to ertapenem. However, hydrolysis assays indicated that ceftazidime was a substrate for IMP-27. Copyright © 2016 Dixon et al.

  10. Sequential sup 123 I-IMP-SPECT in acute infantile hemiplegia

    SciTech Connect

    Shirasaka, Y.; Ito, M.; Okuno, T.; Fujii, T.; Mikawa, H. )


    Sequential {sup 123}I-N-isopropyl-p-iodoamphetamine (IMP) single-photon emission computed tomography (SPECT) was performed in 2 patients with acute infantile hemiplegia. In both patients, low uptake of IMP was detected in the targeted abnormal hemisphere. The {sup 123}I-IMP-SPECT findings indicative of a pathologic condition persisted even when the clinical findings and electroencephalographic abnormalities improved. Because of its sensitivity, noninvasiveness, and accurate reflection of the cerebral blood flow distribution, {sup 123}I-IMP-SPECT is useful in the examination of acute infantile hemiplegia and in the evaluation of prognosis.

  11. Structural and Mutagenic Analysis of Metallo-β-Lactamase IMP-18.


    Furuyama, Takamitsu; Nonomura, Haruka; Ishii, Yoshikazu; Hanson, Nancy D; Shimizu-Ibuka, Akiko


    IMP-type metallo-β-lactamases (MBLs) are exogenous zinc metalloenzymes that hydrolyze a broad range of β-lactams, including carbapenems. Here we report the crystal structure of IMP-18, an MBL cloned from Pseudomonas aeruginosa, at 2.0-Å resolution. The overall structure of IMP-18 resembles that of IMP-1, with an αβ/βα "folded sandwich" configuration, but the loop that covers the active site has a distinct conformation. The relationship between IMP-18's loop conformation and its kinetic properties was investigated by replacing the amino acid residues that can affect the loop conformation (Lys44, Thr50, and Ile69) in IMP-18 with those occupying the corresponding positions in the well-described enzyme IMP-1. The replacement of Thr50 with Pro considerably modified IMP-18's kinetic properties, specifically those pertaining to meropenem, with the kcat/Km value increased by an order of magnitude. The results indicate that this is a key residue that defines the kinetic properties of IMP-type β-lactamases. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. Structural and Mutagenic Analysis of Metallo-β-Lactamase IMP-18

    PubMed Central

    Furuyama, Takamitsu; Nonomura, Haruka; Ishii, Yoshikazu; Hanson, Nancy D.


    IMP-type metallo-β-lactamases (MBLs) are exogenous zinc metalloenzymes that hydrolyze a broad range of β-lactams, including carbapenems. Here we report the crystal structure of IMP-18, an MBL cloned from Pseudomonas aeruginosa, at 2.0-Å resolution. The overall structure of IMP-18 resembles that of IMP-1, with an αβ/βα “folded sandwich” configuration, but the loop that covers the active site has a distinct conformation. The relationship between IMP-18's loop conformation and its kinetic properties was investigated by replacing the amino acid residues that can affect the loop conformation (Lys44, Thr50, and Ile69) in IMP-18 with those occupying the corresponding positions in the well-described enzyme IMP-1. The replacement of Thr50 with Pro considerably modified IMP-18's kinetic properties, specifically those pertaining to meropenem, with the kcat/Km value increased by an order of magnitude. The results indicate that this is a key residue that defines the kinetic properties of IMP-type β-lactamases. PMID:27381398

  13. Structure of human IFIT1 with capped RNA reveals adaptable mRNA binding and mechanisms for sensing N1 and N2 ribose 2'-O methylations.


    Abbas, Yazan M; Laudenbach, Beatrice Theres; Martínez-Montero, Saúl; Cencic, Regina; Habjan, Matthias; Pichlmair, Andreas; Damha, Masad J; Pelletier, Jerry; Nagar, Bhushan


    IFIT1 (IFN-induced protein with tetratricopeptide repeats-1) is an effector of the host innate immune antiviral response that prevents propagation of virus infection by selectively inhibiting translation of viral mRNA. It relies on its ability to compete with the translation initiation factor eIF4F to specifically recognize foreign capped mRNAs, while remaining inactive against host mRNAs marked by ribose 2'-O methylation at the first cap-proximal nucleotide (N1). We report here several crystal structures of RNA-bound human IFIT1, including a 1.6-Å complex with capped RNA. IFIT1 forms a water-filled, positively charged RNA-binding tunnel with a separate hydrophobic extension that unexpectedly engages the cap in multiple conformations (syn and anti) giving rise to a relatively plastic and nonspecific mode of binding, in stark contrast to eIF4E. Cap-proximal nucleotides encircled by the tunnel provide affinity to compete with eIF4F while allowing IFIT1 to select against N1 methylated mRNA. Gel-shift binding assays confirm that N1 methylation interferes with IFIT1 binding, but in an RNA-dependent manner, whereas translation assays reveal that N1 methylation alone is not sufficient to prevent mRNA recognition at high IFIT1 concentrations. Structural and functional analysis show that 2'-O methylation at N2, another abundant mRNA modification, is also detrimental for RNA binding, thus revealing a potentially synergistic role for it in self- versus nonself-mRNA discernment. Finally, structure-guided mutational analysis confirms the importance of RNA binding for IFIT1 restriction of a human coronavirus mutant lacking viral N1 methylation. Our structural and biochemical analysis sheds new light on the molecular basis for IFIT1 translational inhibition of capped viral RNA.

  14. Influence of the environment and phototoxicity of the live cell imaging system at IMP microbeam facility

    NASA Astrophysics Data System (ADS)

    Liu, Wenjing; Du, Guanghua; Guo, Jinlong; Wu, Ruqun; Wei, Junzhe; Chen, Hao; Li, Yaning; Zhao, Jing; Li, Xiaoyue


    To investigate the spatiotemporal dynamics of DNA damage and repair after the ion irradiation, an online live cell imaging system has been established based on the microbeam facility at Institute of Modern Physics (IMP). The system could provide a sterile and physiological environment by making use of heating plate and live cell imaging solution. The phototoxicity was investigated through the evaluation of DNA repair protein XRCC1 foci formed in HT1080-RFP cells during the imaging exposure. The intensity of the foci induced by phototoxicity was much lower compared with that of the foci induced by heavy ion hits. The results showed that although spontaneous foci were formed due to RFP exposure during live cell imaging, they had little impact on the analysis of the recruitment kinetics of XRCC1 in the foci induced by the ion irradiation.

  15. Thermal design of the IMP-I and H spacecraft

    NASA Technical Reports Server (NTRS)

    Hoffman, R. H.


    A description of the thermal subsystem of the IMP-I and H spacecraft is presented. These two spacecraft were of a larger and more advanced type in the Explorer series and were successfully launched in March 1971 and September 1972. The thermal requirements, analysis, and design of each spacecraft are described including several specific designs for individual experiments. Techniques for obtaining varying degrees of thermal isolation and contact are presented. The thermal control coatings including the spaceflight performance of silver-coated FEP Teflon are discussed. Predicted performance is compared to measured flight data. The good agreement between them verifies the validity of the thermal model and the selection of coatings.

  16. Interplanetary acceleration of relativistic electrons observed with IMP 7

    NASA Technical Reports Server (NTRS)

    Armstrong, T. P.; Krimigis, S. M.


    The intensities of 0.22- to 0.5-MeV and 0.5- to 0.8-MeV electrons in interplanetary space following the Oct. 29, 1972, solar particle event have been observed by the IMP 7 satellite. Intensity variations associated with the SSC disturbance of 1655 UT on October 31 are interpreted as suggesting interplanetary acceleration. The results are consistent with an energy-dependent acceleration process which is most effective for electrons of about 0.4 MeV. This is the first reported interplanetary-shock-wave acceleration of relativistic electrons of which the authors are aware.

  17. IMP 8 GME Particle Observations Over Three Solar Cycles

    NASA Technical Reports Server (NTRS)

    Richardson, Ian; Cane, Hilary; Von Rosenvinge, Tycho; McGuire, Robert


    The Goddard Medium Energy experiment on the IMP 8 spacecraft has made nearly continuous observations of the near-Earth energetic particle environment from its launch in October, 1973 until near present. We summarize several aspects of these observations, including solar energetic particle events, CIR-associated events, and cosmic ray modulations. In particular, we note that, as expected fiom the pattern of smaller recurrent (27 day) cosmic ray modulations seen in the mid 1980's A less than 0 solar minimum compared to the previous and following (A greater than 0) minima, recurrent modulations are again reduced in the current solar minimum.

  18. Reduction and Analysis of Data from the IMP 8 Spacecraft

    NASA Technical Reports Server (NTRS)


    The IMP 8 spacecraft was launched in 1973 and the MIT solar wind Faraday Cup experiment continues to produce excellent data except for a slightly increased noise level. Those data have been important for determining the solar wind interaction with Earth's magnetic field; studies of interplanetary shocks; studies of the correlation lengths of solar wind features through comparisons with other spacecraft; and more recently, especially important for determination of the regions in which the Wind spacecraft was taking data as it passed through Earth's magnetotail and for understanding the propagation of solar wind features from near 1 AU to the two Voyager spacecraft.

  19. Improvement of hydrophobic integral membrane protein identification by mild performic acid oxidation-assisted digestion.


    Cao, Rui; Liu, Yisong; Chen, Ping; Lv, Rong; Song, Qin; Sheng, Tingting; He, Quanyuan; Wang, Yin; Wang, Xianchun; Liang, Songping


    Integral membrane proteins (IMPs) are critical for the maintenance of biological systems and represent important targets for the treatment of disease. The hydrophobicity and low abundance of IMPs make them difficult to analyze. In proteomic analyses, hydrophobic peptides including transmembrane domains are often underrepresented, and this reduces the sequence coverage and reliability of the identified IMPs. Here we report a new strategy, mild performic acid oxidation treatment (mPAOT), for improvement of IMP identification. In the mPAOT strategy, the hydrophobicity of IMPs is significantly decreased by oxidizing their methionine and cysteine residues with performic acid, thereby improving the solubility and enzymolysis of these proteins. The application of the mPAOT strategy to the analysis of IMPs from human nasopharyngeal carcinoma CNE1 cell line demonstrated that many IMPs, including those with high hydrophobicity, could be reliably identified.

  20. Combination of IMP-4 metallo-beta-lactamase production and porin deficiency causes carbapenem resistance in a Klebsiella oxytoca clinical isolate.


    Chen, Li-Rong; Zhou, Hong-Wei; Cai, Jia-Chang; Zhang, Rong; Chen, Gong-Xiang


    This study shows for the first time the mechanism of carbapenem resistance of a Klebsiella oxytoca clinical isolate ZC101 recovered from a Zhejiang University Hospital in Hangzhou, China. MIC values of imipenem, meropenem, and ertapenem for K. oxytoca ZC101 were 16, 16, and 128 microg/mL, respectively. Conjugation experiments demonstrated the transferability of a resistance determinant from K. oxytoca ZC101 to Escherichia coli EC600. Results from isoelectric focusing, polymerase chain reactions, and DNA sequencing confirmed that K. oxytoca ZC101 produced IMP-4 metallo-beta-lactamase (MBL) and CTX-M-14 extended-spectrum beta-lactamase, whereas E. coli transconjugant only produced the IMP-4. Amplification of integron revealed that bla(IMP-4) gene is located within a class I integron that was carried in a plasmid approximately 55 kb in size. Sodium dodecyl sulfate polyacrylamide gel electrophoresis profiling of outer membrane proteins of K. oxytoca ZC101 indicated lack of expression of the OmpK36 porin. DNA sequence analysis of ompK36 gene of K. oxytoca ZC101 showed the gene was disrupted by an insertion sequence IS5. In all, the results show that plasmid-mediated IMP-4 MBL production combined with the loss of OmpK36 porin caused the resistance in K. oxytoca ZC101 to carbapenems.

  1. IMP3 expression in biopsy specimens of colorectal cancer predicts lymph node metastasis and TNM stage.


    Wei, Qingzhu; Huang, Xiaoping; Fu, Bo; Liu, Jianghuan; Zhong, Ling; Yang, Qiao; Zhao, Tong


    IMP3 is associated with lymph node metastasis and TNM stage and is a good independent prognostic biomarker for colorectal cancer (CRC). However, the expression status and clinical implication of IMP3 in biopsy specimens have not yet been studied. We aim to address whether the presence of IMP3 expression in preoperative biopsies of CRC could predict lymph node metastasis and TNM stage. In this study, we examined IMP3 expression in paired biopsy and resection specimens of 71 CRC and analyzed the correlation of IMP3 expression with clinicopathological parameters. In the biopsy specimens, IMP3 positive expression was observed in 56 of 71 cases (78.9%) whereas negative expression was observed in 15 of 71 cases (21.1%). In the resection specimens, IMP3 positive expression was detected in 83.1% cases (59/71) whereas negative expression was detected in 16.9% cases (12/71). The absolute concordance rate between biopsy and resection specimens was 90.1% (64/71). The Spearman correlation test documented the existence of a strong linear correlation between the percentage of IMP3-positive cells in the biopsy and resection specimen (r = 0.629; P < 0.001). IMP3 expression in resection specimens was significantly related to histological grade (P = 0.043), T classification (P = 0.035), lymph node metastasis (P = 0.023), TNM stage (P = 0.007), tumor border (P = 0.049) and tumor budding (P = 0.012). IMP3 expression in biopsy specimens was significantly related to lymph node metastasis (P = 0.004), TNM stage (P = 0.005) and tumor budding (P = 0.001). In conclusion, IMP3 expression in biopsy specimens could be used to predict lymph node metastasis and TNM stage in CRC patients.

  2. Reduction and analysis of data from the plasma wave instruments on the IMP-6 and IMP-8 spacecraft

    NASA Technical Reports Server (NTRS)

    Gurnett, D. A.; Anderson, R. R.


    The primary data reduction effort during the reporting period was to process summary plots of the IMP 8 plasma wave data and to submit these data to the National Space Science Data Center. Features of the electrostatic noise are compared with simultaneous observations of the magnetic field, plasma and energetic electrons. Spectral characteristics of the noise and the results of this comparison both suggest that in its high frequency part at least the noise does not belong to normal modes of plasma waves but represents either quasi-thermal noise in the non-Maxwellian plasma or artificial noise generated by spacecraft interaction with the medium.

  3. The first interdisciplinary experiments at the IMP high energy microbeam

    NASA Astrophysics Data System (ADS)

    Du, Guanghua; Guo, Jinlong; Wu, Ruqun; Guo, Na; Liu, Wenjing; Ye, Fei; Sheng, Lina; Li, Qiang; Li, Huiyun


    The high energy beam of tens to hundred MeV/u ions possesses mm-to-cm penetration depth in materials and can be easily extracted into air without significant energy loss and beam scattering. Combination of high energy ions and microbeam technology facilitates the microprobe application to many practical studies in large scale samples. The IMP heavy ion microbeam facility has recently been integrated with microscopic positioning and targeting irradiation system. This paper introduced the first interdisciplinary experiments performed at the IMP microbeam facility using the beam of 80.5 MeV/u carbon ions. Bystander effect induction via medium transferring was not found in the micro-irradiation study using HeLa cells. The mouse irradiation experiment demonstrated that carbon irradiation of 10 Gy dose to its tuberomammillary nucleus did not impair the sleep nerve system. The fault injection attack on RSA (Rivest-Shamir-Adleman) decryption proved that the commercial field-programmable gate array chip is vulnerable in single event effect to low linear-energy-transfer carbon irradiation, and the attack can cause the leakage of RSA private key. This work demonstrates the potential of high energy microbeam in its application to biology, biomedical, radiation hardness, and information security studies.

  4. TRW plasma wave experiment for the IMP-H mission

    NASA Technical Reports Server (NTRS)

    Virobik, P. F.; Scarf, F. L.


    The IMP-H plasma wave experiment is designed to extend knowledge of wave-particle interactions in the disturbed cislunar region, the distant geomagnetic tail, the upstream solar wind, and the flanks of the magnetosheath-shock interface. It is expected to identify plasma instabilities, study particle acceleration and heating at collisionless shocks and other discontinuities, analyze turbulent conductivity and field line merging, and provide new information on dissipation processes for suprathermal particles. Instrumentation for the plasma wave experiment is designed to measure local electric and magnetic field oscillations over the frequency range 10 Hz to 100 kHz. A 24 inch electric dipole, a 7 inch diameter air core search coil, and the associated preamplifiers are mounted on a spacecraft counterweight boom. The frequency range of 10 Hz to 100 kHz for both E and B is processed using an eight-channel spectrum analyzer located in the instrument main-body package (a standard IMP trapezoidal module, 3 inches high). Electric fields as small as 10-100 microvolts/meter and magnetic signals as small as 1-3 milligamma will be detected.

  5. pIMP-PH114 carrying bla IMP-4 in a Klebsiella pneumoniae strain is closely related to other multidrug-resistant IncA/C2 plasmids.


    Ho, Pak-Leung; Lo, Wai-U; Chan, Jane; Cheung, Yuk-Yam; Chow, Kin-Hung; Yam, Wing-Cheong; Lin, Chi-Ho; Que, Tak-Lun


    The IncA/C plasmids are broad host-range vehicles which have been associated with wide dissemination of CMY-2 among Enterobacteriaceae of human and animal origins. Acquired metallo-β-lactamases (MBLs) such as the IMP-type enzymes are increasingly reported in multidrug-resistant Gram-negative bacteria worldwide, particularly in Enterobacteriaceae. We described the complete sequence of the first IMP-4-encoding IncA/C2 plasmid, pIMP-PH114 (151,885 bp), from a sequence type 1 Klebsiella pneumoniae strain that was recovered from a patient who was hospitalized in the Philippines. pIMP-PH114 consists of a backbone from the IncA/C2 plasmids, with the insertion of a novel Tn21-like class 1 integron composite structure (containing the cassette array bla IMP-4-qacG-aacA4-catB3, followed by a class C β-lactamase bla DHA-1 and the mercury resistance operon, merRTPCADE) and a sul2-floR encoding region. Phylogenetic analysis of the IncA/C repA sequences showed that pIMP-PH114 formed a subgroup with other IncA/C plasmids involved in the international spread of CMY-2, TEM-24 and NDM-1. Identical bla IMP-4 arrays have been described among different Enterobacteriaceae and Acinetobacter spp. in China, Singapore and Australia but the genetic context is different. The broad host range of IncA/C plasmids may have facilitated dissemination of the bla IMP-4 arrays among different diverse groups of bacteria.

  6. Increased IMP dehydrogenase gene expression in solid tumor tissues and tumor cell lines

    SciTech Connect

    Collart, F.R.; Chubb, C.B.; Mirkin, B.L.; Huberman, E.


    IMP dehydrogenase, a regulatory enzyme of guanine nucleotide biosynthesis, may play a role in cell proliferation and malignancy. To assess this possibility, we examined IMP dehydrogenase expression in a series of human solid tumor tissues and tumor cell lines in comparison with their normal counterparts. Increased IMP dehydrogenase gene expression was observed in brain tumors relative to normal brain tissue and in sarcoma cells relative to normal fibroblasts. Similarly, in several B- and T-lymphoid leukemia cell lines, elevated levels of IMP dehydrogenase mRNA and cellular enzyme were observed in comparison with the levels in peripheral blood lymphocytes. These results are consistent with an association between increased IMP dehydrogenase expression and either enhanced cell proliferation or malignant transformation.

  7. Detection of the novel IMP-38 among carbapenemase-producing Enterobacteriaceae in a university hospital, China.


    Jian, Zijuan; Li, Yanming; Liu, Wenen; Li, Hongling; Zhang, Yunli; Li, Yanbing; Gu, Xiumei; Peng, Wanchan


    This study set out to investigate the molecular epidemiology of carbapenemase-producing Enterobacteriaceae isolates collected from Xiang Ya Hospital, Hunan, China. The carbapenemase genes from Enterobacteriaceae isolates were determined by PCR and sequencing. Relatedness of Klebsiella pneumoniae isolates was evaluated by pulsed-field gel electrophoresis. Twenty-four out of 738 non-repetitive Enterobacteriaceae isolates harbored carbapenemase genes including IMP-38, a novel IMP-type metallo-enzyme. Nine IMP-38-producing isolates were shown to originate from the same clone and caused a small outbreak in the neonatal ward. IMP-38, a novel IMP-type metallo-enzyme, was one of the predominant types of carbapenemase in the clinical carbapenem-resistant Enterobacteriaceae isolates in our hospital.

  8. Diagnostic usefulness of EMA, IMP3, and GLUT-1 for the immunocytochemical distinction of malignant cells from reactive mesothelial cells in effusion cytology using cytospin preparations.


    Ikeda, Katsuhide; Tate, Genshu; Suzuki, Takao; Kitamura, Takashi; Mitsuya, Toshiyuki


    To differentiate reactive mesothelial cells (RMs) from metastatic carcinoma and malignant mesothelioma (MM) in effusion cytology is crucial for the cytologic diagnosis and the management of the patients. In the present study, the immunocytochemical staining profile of the epithelial membrane antigen (EMA), the insulin-like growth factor-II mRNA-binding protein 3 (IMP3), and the glucose transporter-1 (GLUT-1) was examined to distinguish RMs from malignant cells. A total of 171 pleural (n = 87) and peritoneal (n = 84) effusion specimens, including 50 benign effusions with RMs, 11 MM effusions, and 110 metastatic malignant effusions, were evaluated for immunocytochemistry. EMA, IMP3, monoclonal GLUT-1, and polyclonal GLUT-1 immunoreactivity were observed in 26.0%, 6.0%, 20.0%, and 18.0% of RMs, respectively. In contrast to RMs, the immunoreactivity in MM was 100%, 36.4%, 100%, and 90.9%; adenocarcinoma (AC) was 100%, 80.8%, 81.7%, and 72.1%; squamous-cell carcinoma was 83.3%, 83.3%, 83.3%, and 66.7%. EMA, IMP3, mGLUT-1, and pGLUT-1 expressions were observed in 98.4%, 65.6%, 88.5%, and 75.4% in the pleural effusion with malignant cells, and 100%, 88.3%, 78.3%, and 71.7% in ascites containing malignant cells, respectively. The findings of the present study indicate that the immunocytochemical staining for EMA, IMP3, and GLUT-1 is a useful diagnostic tool for distinguishing effusions containing malignant cells from those that contain benign cells, and in particular, we suggest that the combination of mGLUT-1 and EMA, and IMP3 and EMA are extremely useful in pleural effusion and in ascites, respectively.

  9. Facile backbone structure determination of human membrane proteins by NMR spectroscopy

    PubMed Central

    Klammt, Christian; Maslennikov, Innokentiy; Bayrhuber, Monika; Eichmann, Cédric; Vajpai, Navratna; Chiu, Ellis Jeremy Chua; Blain, Katherine Y; Esquivies, Luis; Kwon, June Hyun Jung; Balana, Bartosz; Pieper, Ursula; Sali, Andrej; Slesinger, Paul A; Kwiatkowski, Witek; Riek, Roland; Choe, Senyon


    Although nearly half of today’s major pharmaceutical drugs target human integral membrane proteins (hIMPs), only 30 hIMP structures are currently available in the Protein Data Bank, largely owing to inefficiencies in protein production. Here we describe a strategy for the rapid structure determination of hIMPs, using solution NMR spectroscopy with systematically labeled proteins produced via cell-free expression. We report new backbone structures of six hIMPs, solved in only 18 months from 15 initial targets. Application of our protocols to an additional 135 hIMPs with molecular weight <30 kDa yielded 38 hIMPs suitable for structural characterization by solution NMR spectroscopy without additional optimization. PMID:22609626

  10. Quantitative iodine-123 IMP imaging of brain perfusion in schizophrenia

    SciTech Connect

    Cohen, M.B.; Lake, R.R.; Graham, L.S.; King, M.A.; Kling, A.S.; Fitten, L.J.; O'Rear, J.; Bronca, G.A.; Gan, M.; Servrin, R. )


    Decreased perfusion in the frontal lobes of patients with chronic schizophrenia has been reported by multiple observes using a variety of techniques. Other observers have been unable to confirm this finding using similar techniques. In this study quantitative single photon emission computed tomography brain imaging was performed using p,5n ({sup 123}I)IMP in five normal subjects and ten chronically medicated patients with schizophrenia. The acquisition data were preprocessed with an image dependent Metz filter and reconstructed using a ramp filtered back projection technique. The uptake in each of 50 regions of interest in each subject was normalized to the uptake in the cerebellum. There were no significant confirmed differences in the comparable ratios of normal subjects and patients with schizophrenia even at the p = 0.15 level. Hypofrontality was not observed.

  11. Magnetospheric substorms in the distant magnetotail observed by Imp 3.

    NASA Technical Reports Server (NTRS)

    Meng, C. I.; Akasofu, S.; Kawasaki, K.; Hones, E. W., Jr.


    Study of variations of the magnetic field and plasma sheet in the distant magnetotail (20 to 40 earth radii) during magnetospheric substorms on the basis of the Imp 3 magnetic-field and particle data. Depending on the locations of the satellite with respect to the boundary of the plasma sheet, the variations differ greatly. However, the present results and the results of other workers give a clear indication of an increase of the magnitude of the field outside the plasma sheet and of the simultaneous ?thinning' of the plasma sheet during an early phase of substorms. At about the maximum epoch or during the recovery phase of substorms, the plasma sheet expands and appears to be inflated to at least the presubstorm level. Furthermore, a large excessive flux of the magnetic (approximately equal to Z component) field, as compared with the flux of the original dipole field, appears across the neutral sheet.

  12. Studies of the interplanetary magnetic field: IMP's to Voyager

    NASA Technical Reports Server (NTRS)

    Ness, Norman F.


    During the last two decades, spacecraft projects and individual experiments for which Frank McDonald was a leader have contributed very significantly to the current understanding of the structure of interplanetary space and the correlation between solar and interplanetary disturbances. Studies on the IMP, HELIOS, and Pioneer spin-stabilized spacecraft and the larger attitude-stabilized Voyager spacecraft have provided data sets from which the modern view of the heliosphere has evolved. That concept in which the inner solar system is shown to be dominated by individual streams associated with specific source regions on the Sun is illustrated. As these high-speed streams overtake the preexisting solar plasma, they coalesce and modify the characteristics so that at larger heliocentric distances, these disturbances appear as radially propagating concentric shells of compressed magnetic fields and enhanced fluctuations

  13. Imp 6 measurements in the distant polar cusp during substorms

    NASA Technical Reports Server (NTRS)

    Fairfield, D. H.; Hones, E. W., Jr.


    High time-resolution data from the magnetic field, plasma, energetic particle, and VLF wave experiments performed aboard Imp 6 in a study of the distant dayside cusp during substorms are described. The cusp was studied when its location was slightly equatorward of its normal location and the geomagnetic dipole was tilted in the appropriate direction. The data support both reconnection and diffusion as methods of particle entry to the magnetosphere. The evidence (1) indicates an acceleration process to explain enhancements of 400 to 600-km/sec protons above their magnetosheath intensities, and (2) suggests convection of field lines over the polar cap as a means of explaining the lack of low-energy protons near the low-latitude boundary of the cusp. Magnetic field fluctuations, a perturbation vector, ion cyclotron waves, and an abrupt change in the intensity of both whistler waves and electrostatic waves are characterized.

  14. Simultaneous measurements of magnetotail dynamics by IMP spacecraft

    NASA Technical Reports Server (NTRS)

    Fairfield, D. H.; Lepping, R. P.; Hones, E. W., Jr.; Bame, S. J.; Asbridge, J. R.


    Pressure in the magnetotail is investigated using observations obtained by IMP spacecraft. Using combined field and plasma data, the approximate balance of pressure between the high beta plasma sheet and the low beta tail lobes is demonstrated. The changes in this pressure during substorms and the characteristics of the plasma and field that produce it are discussed. A distance of about 15 earth radii separates an inner region where the plasma sheet thins during the hour before substorm onset from an outer region where the plasma sheet thins within 5 or 10 min of the time of onset. Substorm onset and plasma sheet expansion in the inner region are simultaneous if the spacecraft is near the equatorial plane. This expansion may be delayed as much as a few tens of minutes if the spacecraft is at high latitudes.

  15. Interplanetary Alfven waves and auroral (substorm) activity - IMP 8

    NASA Technical Reports Server (NTRS)

    Tsurutani, Bruce T.; Gould, Tom; Goldstein, Bruce E.; Gonzalez, Walter D.; Sugiura, Masahisa


    Almost 1 year of IMP 8 interplanetary magnetic field and plasma data (days 1-312, 1979) have been examined to determine the interplanetary causes of geomagnetic AE activity. The nature of the interplanetary medium (Alfvenic or non-Alfvenic) and the B(s) correlation with AE were examined over 12-hour increments throughout the study. It is found that Alfvenic wave intervals are present over 60 percent of the time, and the southward component of the Alfven waves is well correlated with AE (average peak correlation coefficient 0.62), with a median lag of 43 min. From this statistical study, no major differences in the magnetospheric response to Alfvenic and non-Alfvenic intervals were obvious. The high-intensity long-duration continuous AE activity (HILDCAA) events discussed previously by Tsurutani and Gonzales (1987) are demonstrated to be caused by the southward components of the Alfven waves, presumably through the process of magnetic reconnection.

  16. Magnetospheric substorms in the distant magnetotail observed by Imp 3.

    NASA Technical Reports Server (NTRS)

    Meng, C. I.; Akasofu, S.; Kawasaki, K.; Hones, E. W., Jr.


    Study of variations of the magnetic field and plasma sheet in the distant magnetotail (20 to 40 earth radii) during magnetospheric substorms on the basis of the Imp 3 magnetic-field and particle data. Depending on the locations of the satellite with respect to the boundary of the plasma sheet, the variations differ greatly. However, the present results and the results of other workers give a clear indication of an increase of the magnitude of the field outside the plasma sheet and of the simultaneous ?thinning' of the plasma sheet during an early phase of substorms. At about the maximum epoch or during the recovery phase of substorms, the plasma sheet expands and appears to be inflated to at least the presubstorm level. Furthermore, a large excessive flux of the magnetic (approximately equal to Z component) field, as compared with the flux of the original dipole field, appears across the neutral sheet.

  17. Isolation and plasmid characterization of carbapenemase (IMP-4) producing Salmonella enterica Typhimurium from cats

    PubMed Central

    Abraham, Sam; O’Dea, Mark; Trott, Darren J.; Abraham, Rebecca J.; Hughes, David; Pang, Stanley; McKew, Genevieve; Cheong, Elaine Y. L.; Merlino, John; Saputra, Sugiyono; Malik, Richard; Gottlieb, Thomas


    Carbapenem-resistant Enterobacteriaceae (CRE) are a pressing public health issue due to limited therapeutic options to treat such infections. CREs have been predominantly isolated from humans and environmental samples and they are rarely reported among companion animals. In this study we report on the isolation and plasmid characterization of carbapenemase (IMP-4) producing Salmonella enterica Typhimurium from a companion animal. Carbapenemase-producing S. enterica Typhimurium carrying blaIMP-4 was identified from a systemically unwell (index) cat and three additional cats at an animal shelter. All isolates were identical and belonged to ST19. Genome sequencing revealed the acquisition of a multidrug-resistant IncHI2 plasmid (pIMP4-SEM1) that encoded resistance to nine antimicrobial classes including carbapenems and carried the blaIMP-4-qacG-aacA4-catB3 cassette array. The plasmid also encoded resistance to arsenic (MIC-150 mM). Comparative analysis revealed that the plasmid pIMP4-SEM1 showed greatest similarity to two blaIMP-8 carrying IncHI2 plasmids from Enterobacter spp. isolated from humans in China. This is the first report of CRE carrying a blaIMP-4 gene causing a clinical infection in a companion animal, with presumed nosocomial spread. This study illustrates the broader community risk entailed in escalating CRE transmission within a zoonotic species such as Salmonella, and in a cycle that encompasses humans, animals and the environment. PMID:27767038

  18. Isolation and plasmid characterization of carbapenemase (IMP-4) producing Salmonella enterica Typhimurium from cats.


    Abraham, Sam; O'Dea, Mark; Trott, Darren J; Abraham, Rebecca J; Hughes, David; Pang, Stanley; McKew, Genevieve; Cheong, Elaine Y L; Merlino, John; Saputra, Sugiyono; Malik, Richard; Gottlieb, Thomas


    Carbapenem-resistant Enterobacteriaceae (CRE) are a pressing public health issue due to limited therapeutic options to treat such infections. CREs have been predominantly isolated from humans and environmental samples and they are rarely reported among companion animals. In this study we report on the isolation and plasmid characterization of carbapenemase (IMP-4) producing Salmonella enterica Typhimurium from a companion animal. Carbapenemase-producing S. enterica Typhimurium carrying blaIMP-4 was identified from a systemically unwell (index) cat and three additional cats at an animal shelter. All isolates were identical and belonged to ST19. Genome sequencing revealed the acquisition of a multidrug-resistant IncHI2 plasmid (pIMP4-SEM1) that encoded resistance to nine antimicrobial classes including carbapenems and carried the blaIMP-4-qacG-aacA4-catB3 cassette array. The plasmid also encoded resistance to arsenic (MIC-150 mM). Comparative analysis revealed that the plasmid pIMP4-SEM1 showed greatest similarity to two blaIMP-8 carrying IncHI2 plasmids from Enterobacter spp. isolated from humans in China. This is the first report of CRE carrying a blaIMP-4 gene causing a clinical infection in a companion animal, with presumed nosocomial spread. This study illustrates the broader community risk entailed in escalating CRE transmission within a zoonotic species such as Salmonella, and in a cycle that encompasses humans, animals and the environment.

  19. Structural and kinetic studies on metallo-β-lactamase IMP-1.


    Griffin, Dionne H; Richmond, Timothy K; Sanchez, Carlo; Moller, Abraham Jon; Breece, Robert M; Tierney, David L; Bennett, Brian; Crowder, Michael W


    In an effort to probe for metal binding to metallo-β-lactamase (MβL) IMP-1, the enzyme was overexpressed, purified, and characterized. The resulting enzyme was shown to bind 2 equiv of Zn(II), exhibit significant catalytic activity, and yield EXAFS results similar to crystallographic data previously reported. Rapid kinetic studies showed that IMP-1 does not stabilize a nitrocefin-derived reaction intermediate; rather, the enzyme follows a simple Michaelis mechanism to hydrolyze nitrocefin. Metal-substituted and metal-reconstituted analogues of IMP-1 were prepared by directly adding metal ion stocks to metal-free enzyme, which was generated by dialysis versus EDTA. UV-vis studies on IMP-1 containing 1 equiv of Co(II) showed a strong ligand-to-metal charge transition at 340 nm, and the intensity of this feature increased when the second equivalent of Co(II) was added to the enzyme. EXAFS fits on IMP-1 containing 1 equiv of Co(II) strongly suggest the presence of a metal-metal interaction, and EPR spectra of the IMP-1 containing 1 and 2 equiv of Co(II) are very similar. Taken together, steady-state kinetic and spectroscopic studies suggest that metal binding to metal-free IMP-1 follows a positive-cooperative mode.

  20. Mutagenesis of Zinc Ligand Residue Cys221 Reveals Plasticity in the IMP-1 Metallo-β-Lactamase Active Site

    PubMed Central

    Horton, Lori B.; Shanker, Sreejesh; Mikulski, Rose; Brown, Nicholas G.; Phillips, Kevin J.; Lykissa, Ernest; Venkataram Prasad, B. V.


    Metallo-β-lactamases catalyze the hydrolysis of a broad range of β-lactam antibiotics and are a concern for the spread of drug resistance. To analyze the determinants of enzyme structure and function, the sequence requirements for the subclass B1 IMP-1 β-lactamase zinc binding residue Cys221 were tested by saturation mutagenesis and evaluated for protein expression, as well as hydrolysis of β-lactam substrates. The results indicated that most substitutions at position 221 destabilized the enzyme. Only the enzymes containing C221D and C221G substitutions were expressed well in Escherichia coli and exhibited catalytic activity toward β-lactam antibiotics. Despite the lack of a metal-chelating group at position 221, the C221G enzyme exhibited high levels of catalytic activity in the presence of exogenous zinc. Molecular modeling suggests the glycine substitution is unique among substitutions in that the complete removal of the cysteine side chain allows space for a water molecule to replace the thiol and coordinate zinc at the Zn2 zinc binding site to restore function. Multiple methods were used to estimate the C221G Zn2 binding constant to be 17 to 43 μM. Studies of enzyme function in vivo in E. coli grown on minimal medium showed that both IMP-1 and the C221G mutant exhibited compromised activity when zinc availability was low. Finally, substitutions at residue 121, which is the IMP-1 equivalent of the subclass B3 zinc-chelating position, failed to rescue C221G function, suggesting the coordination schemes of subclasses B1 and B3 are not interchangeable. PMID:22908171

  1. Occurrence of IMP-8, IMP-10, and IMP-13 metallo-β-lactamases located on class 1 integrons and other extended-spectrum β-lactamases in bacterial isolates from Tunisian rivers.


    Chouchani, Chedly; Marrakchi, Rim; Henriques, Isabel; Correia, António


    Antibiotic-resistant bacteria have been surveyed widely in water bodies, but few studies have determined the diversity of antibiotic-resistant bacteria in river waters. This study was undertaken to investigate the origin of resistance among polluted river bacterial isolates in Tunisia. In this study 128 isolates resistant to β-lactam antibiotics were obtained from 2 polluted rivers in the north of Tunisia. Isolates were identified using Phoenix phenotyping criteria. The occurrence of bla(TEM), bla(SHV), bla(CTX-M), bla(CMY), bla(VIM), and bla(IMP) was studied by polymerase chain reaction (PCR) amplification and sequencing, and the genetic relatedness of the 16 IMP-producing Klebsiella pneumoniae isolates was analyzed by comparison of XbaI pulsed-field gel electrophoresis (PFGE) profiles. Using Phoenix phenotyping criteria, diverse genera of bacteria were identified with different rates of prevalence and with different minimum inhibitory concentrations against different antibiotics. The occurrence of bla(TEM), bla(SHV), bla(CTXM), bla(CMY), bla(VIM), and bla(IMP) genes was confirmed. The DNA sequences upstream and downstream of bla(IMP) genes were determined, revealing that all IMP-encoding genes constituted the first cassette of class 1 integrons, followed by aacA gene cassettes encoding aminoglycoside resistance. Comparison of PFGE profiles showed that only 2 of the isolates were clonal, the other 14 displaying unique profiles. The bla(CTX-M) gene was the most dominant of the extended-spectrum β-lactamase (ESBL) genes, while the bla(TEM) gene was the second-most dominant. The discovery of highly diverse ESBL-producing bacteria and metallo-β-lactamases, particularly bla(IMP), in polluted river water raises alarms with regard to the potential dissemination of antibiotic-resistant bacteria in communities through river environments.

  2. Physiological Response to Membrane Protein Overexpression in E. coli*

    PubMed Central

    Gubellini, Francesca; Verdon, Grégory; Karpowich, Nathan K.; Luff, Jon D.; Boël, Grégory; Gauthier, Nils; Handelman, Samuel K.; Ades, Sarah E.; Hunt, John F.


    Overexpression represents a principal bottleneck in structural and functional studies of integral membrane proteins (IMPs). Although E. coli remains the leading organism for convenient and economical protein overexpression, many IMPs exhibit toxicity on induction in this host and give low yields of properly folded protein. Different mechanisms related to membrane biogenesis and IMP folding have been proposed to contribute to these problems, but there is limited understanding of the physical and physiological constraints on IMP overexpression and folding in vivo. Therefore, we used a variety of genetic, genomic, and microscopy techniques to characterize the physiological responses of Escherichia coli MG1655 cells to overexpression of a set of soluble proteins and IMPs, including constructs exhibiting different levels of toxicity and producing different levels of properly folded versus misfolded product on induction. Genetic marker studies coupled with transcriptomic results indicate only minor perturbations in many of the physiological systems implicated in previous studies of IMP biogenesis. Overexpression of either IMPs or soluble proteins tends to block execution of the standard stationary-phase transcriptional program, although these effects are consistently stronger for the IMPs included in our study. However, these perturbations are not an impediment to successful protein overexpression. We present evidence that, at least for the target proteins included in our study, there is no inherent obstacle to IMP overexpression in E. coli at moderate levels suitable for structural studies and that the biochemical and conformational properties of the proteins themselves are the major obstacles to success. Toxicity associated with target protein activity produces selective pressure leading to preferential growth of cells harboring expression-reducing and inactivating mutations, which can produce chemical heterogeneity in the target protein population, potentially

  3. Biochemical Characterization of IMP-30, a Metallo-β-Lactamase with Enhanced Activity toward Ceftazidime

    PubMed Central

    Pegg, Kevin M.; Liu, Eleanor M.; LaCuran, Alecander E.


    IMP-type enzymes constitute a clinically important family of metallo-β-lactamases that has grown dramatically in the past decade to its current 45 known members. Here, we report the biochemical characterization of IMP-30 in comparison to IMP-1, from which it deviates by a single E59K mutation. Kinetics, MIC assays, docking, and molecular dynamics simulations support a scenario in which Lys59 interacts with the ceftazidime R1 group, resulting in increased water access and enhanced turnover and MIC of ceftazidime. PMID:23836186

  4. IMP 7 (Explorer 47) trajectory, September 26, 1972 to September 25, 1978

    NASA Technical Reports Server (NTRS)

    Milligan, Pamela A.; Lazarus, Alan J.


    The trajectory plots for IMP 7 (Explorer 47) are contained. For each orbit the trajectory is shown in five panels on two pages; each panel is a different representation or projection. The trajectory parameters were obtained from the multi-coordinate ephemeris (MCE) tapes supplied to IMP experimenters by the IMP project. The plots on the right hand pages use a geocentric, solar-ecliptic coordinate system. Distances are in units of earth radii. The plots on the left hand pages use geocentric, solar magnetospheric coordinates with distances in earth radii.

  5. Emergence of Raoultella ornithinolytica Coproducing IMP-4 and KPC-2 Carbapenemases in China

    PubMed Central

    Zheng, Beiwen; Zhang, Jing; Ji, Jinru; Fang, Yunhui; Shen, Ping; Ying, Chaoqun; Lv, Jifang


    We report here the emergence of seven IMP-4-producing Raoultella ornithinolytica isolates obtained from one patient. All isolates carried the blaIMP-4 carbapenemase gene, five isolates also carried blaSHV-12, four contained blaTEM-1, and one contained blaOXA-1. Notably, the R. ornithinolytica isolate Ro25724 also expressed Klebsiella pneumoniae carbapenemase (KPC)-2. The blaKPC-2 gene was located on a Tn3-Tn4401 integration structure on a plasmid of ∼450 kb. This is the first description of the coexistence of blaKPC-2 and blaIMP-4 from the genus Raoultella. PMID:26282422

  6. Data reduction and analysis for the TRW IMP-7 plasma wave experiment

    NASA Technical Reports Server (NTRS)

    Scarf, F. L.


    Highlights from the IMP 7 plasma wave experiment are briefly outlined. The measurements in the tail revealed great complexities involving substorms and fireballs and provided insight into the overall dynamics of the magnetosphere. The low levels of magnetic turbulence may be of significance with respect to the development of tearing mode dissipation for reconnection events. The IMP wave observations in the distant magnetosphere boundary region showed that the boundaries were quite diffuse and frequently purely defined. Finally, nearly simultaneous IMP 7 and 8 comparisons were used to achieve an understanding of shock structure and propagation.

  7. Structure of Cryptosporidium IMP dehydrogenase bound to an inhibitor with in vivo antiparasitic activity

    SciTech Connect

    Kim, Youngchang; Makowska-Grzyska, Magdalena; Gorla, Suresh Kumar; Gollapalli, Deviprasad R.; Cuny, Gregory D.; Joachimiak, Andrzej; Hedstrom, Lizbeth


    Inosine 5´-monophosphate dehydrogenase (IMPDH) is a promising target for the treatment of Cryptosporidium infections. Here, the structure of C. parvum IMPDH (CpIMPDH) in complex with inosine 5´-monophosphate (IMP) and P131, an inhibitor with in vivo anticryptosporidial activity, is reported. P131 contains two aromatic groups, one of which interacts with the hypoxanthine ring of IMP, while the second interacts with the aromatic ring of a tyrosine in the adjacent subunit. In addition, the amine and NO2 moieties bind in hydrated cavities, forming water-mediated hydrogen bonds to the protein. The design of compounds to replace these water molecules is a new strategy for the further optimization of C. parvum inhibitors for both antiparasitic and antibacterial applications.

  8. Thermodynamic characterization of the exchange of detergents and amphipols at the surfaces of integral membrane proteins.


    Tribet, C; Diab, C; Dahmane, T; Zoonens, M; Popot, J-L; Winnik, F M


    The aggregation of integral membrane proteins (IMPs) in aqueous media is a significant concern for mechanistic investigations and pharmaceutical applications of this important class of proteins. Complexation of IMPs with amphiphiles, either detergents or short amphiphilic polymers known as amphipols (APols), renders IMPs water-soluble. It is common knowledge that IMP-detergent complexes are labile, while IMP-APol complexes are exceptionally stable and do not dissociate even under conditions of extreme dilution. To understand the thermodynamic origin of this difference in stability and to guide the design of new APols, we have studied by isothermal titration calorimetry (ITC) the heat exchanges during two reciprocal processes, the "trapping" of detergent-solubilized IMPs in APols and the "stripping" of IMP-APol complexes by detergents, using two IMPs (the transmembrane domain of porin OmpA from Escherichia coli and bacteriorhodopsin from Halobium salinarium), two APols [an anionic polymer derived from acrylic acid (A8-35) and a cationic phosphorylcholine-based polymer (C22-43)], and two neutral detergents [n-octyl thioglucoside (OTG) and n-octyltetraethylene glycol (C(8)E(4))]. In the presence of detergent, free APols and IMP-APol complexes form mixed particles, APol-detergent and IMP-APol-detergent, respectively, according to the regular mixing model. Diluting IMP-APol-detergent complexes below the critical micellar concentration (CMC) of the detergent triggers the dispersion of detergent molecules as monomers, a process characterized by an enthalpy of demicellization. The enthalpy of APol <--> detergent exchange on the hydrophobic surface of IMPs is negligibly small, an indication of the similarity of the molecular interactions of IMPs with the two types of amphiphiles. The enhanced stability against dilution of IMP-APol complexes, compared to IMP-detergent ones, originates from the difference in entropy gain achieved upon release in water of a few APol molecules

  9. Nosocomial Infections with IMP-19−Producing Pseudomonas aeruginosa Linked to Contaminated Sinks, France

    PubMed Central

    Amoureux, Lucie; Riedweg, Karena; Chapuis, Angélique; Bador, Julien; Siebor, Eliane; Péchinot, André; Chrétien, Marie-Lorraine; de Curraize, Claire


    We isolated IMP-19–producing Pseudomonas aeruginosa from 7 patients with nosocomial infections linked to contaminated sinks in France. We showed that blaIMP-19 was located on various class 1 integrons among 8 species of gram-negative bacilli detected in sinks: P. aeruginosa, Achromobacter xylosoxidans, A. aegrifaciens, P. putida, Stenotrophomonas maltophilia, P. mendocina, Comamonas testosteroni, and Sphingomonas sp. PMID:28098548

  10. Dominance of IMP-4-Producing Enterobacter cloacae among Carbapenemase-Producing Enterobacteriaceae in Australia

    PubMed Central

    Townell, Nicola; Nimmo, Graeme R.; George, Narelle M.; Robson, Jennifer; Vohra, Renu; Davis, Louise; Heney, Claire; Paterson, David L.


    The prevalence of carbapenemase-producing Enterobacteriaceae (CPE) has been increasing worldwide. blaIMP has been reported to be the predominant carbapenemase-encoding gene within Enterobacteriaceae in Australia. However, there are limited data currently available on CPE from Queensland, Australia. A total of 58 CPE isolates were isolated between July 2009 and March 2014 from Queensland hospitals. The clonality of isolates was determined by Diversilab repetitive sequence-based PCR. The isolates were investigated for the resistance mechanisms carbapenemase, extended-spectrum β-lactamase, and AmpC β-lactamase and for aminoglycoside resistance and plasmid-mediated quinolone resistance genes by PCR. The plasmid types associated with carbapenemase-encoding genes were characterized. The majority of the CPE were Enterobacter cloacae (n = 29). The majority of Queensland CPE isolates were IMP producers and comprised 11 species (n = 48). Nine NDM-producing Enterobacteriaceae were identified. One NDM-producing Klebsiella pneumoniae isolate coproduced OXA-48. One K. pneumoniae isolate was an OXA-181 producer. The incidence of IMP producers increased significantly in 2013. blaIMP-4 was found in all IMP-producing isolates. blaTEM, qnrB, and aacA4 were common among IMP-4 producers. The HI2 (67%) and L/M (21%) replicons were associated with blaIMP-4. All HI2 plasmids were of sequence type 1 (ST1). All but one of the NDM producers possessed blaCTX-M-15. The 16S rRNA methylase genes found among NDM producers were armA, rmtB, rmtC, and rmtF. The substantial increase in the prevalence of CPE in Queensland has been associated mainly with the emergence E. cloacae strains possessing HI2 plasmids carrying blaIMP-4 over the past 2 years. The importation of NDM producers and/or OXA-48-like producers in patients also contributed to the increased emergence of CPE. PMID:25918153

  11. Elucidating the Role of Residue 67 in IMP-Type Metallo-β-Lactamase Evolution.


    LaCuran, Alecander E; Pegg, Kevin M; Liu, Eleanor M; Bethel, Christopher R; Ai, Ni; Welsh, William J; Bonomo, Robert A; Oelschlaeger, Peter


    Antibiotic resistance in bacteria is ever changing and adapting, as once-novel β-lactam antibiotics are losing their efficacy, primarily due to the production of β-lactamases. Metallo-β-lactamases (MBLs) efficiently inactivate a broad range of β-lactam antibiotics, including carbapenems, and are often coexpressed with other antibacterial resistance factors. The rapid dissemination of MBLs and lack of novel antibacterials pose an imminent threat to global health. In an effort to better counter these resistance-conferring β-lactamases, an investigation of their natural evolution and resulting substrate specificity was employed. In this study, we elucidated the effects of different amino acid substitutions at position 67 in IMP-type MBLs on the ability to hydrolyze and confer resistance to a range of β-lactam antibiotics. Wild-type β-lactamases IMP-1 and IMP-10 and mutants IMP-1-V67A and IMP-1-V67I were characterized biophysically and biochemically, and MICs for Escherichia coli cells expressing these enzymes were determined. We found that all variants exhibited catalytic efficiencies (kcat/Km) equal to or higher than that of IMP-1 against all tested β-lactams except penicillins, against which IMP-1 and IMP-1-V67I showed the highest kcat/Km values. The substrate-specific effects of the different amino acid substitutions at position 67 are discussed in light of their side chain structures and possible interactions with the substrates. Docking calculations were employed to investigate interactions between different side chains and an inhibitor used as a β-lactam surrogate. The differences in binding affinities determined experimentally and computationally seem to be governed by hydrophobic interactions between residue 67 and the inhibitor and, by inference, the β-lactam substrates. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  12. Elucidating the Role of Residue 67 in IMP-Type Metallo-β-Lactamase Evolution

    PubMed Central

    LaCuran, Alecander E.; Pegg, Kevin M.; Liu, Eleanor M.; Bethel, Christopher R.; Ai, Ni; Welsh, William J.; Bonomo, Robert A.


    Antibiotic resistance in bacteria is ever changing and adapting, as once-novel β-lactam antibiotics are losing their efficacy, primarily due to the production of β-lactamases. Metallo-β-lactamases (MBLs) efficiently inactivate a broad range of β-lactam antibiotics, including carbapenems, and are often coexpressed with other antibacterial resistance factors. The rapid dissemination of MBLs and lack of novel antibacterials pose an imminent threat to global health. In an effort to better counter these resistance-conferring β-lactamases, an investigation of their natural evolution and resulting substrate specificity was employed. In this study, we elucidated the effects of different amino acid substitutions at position 67 in IMP-type MBLs on the ability to hydrolyze and confer resistance to a range of β-lactam antibiotics. Wild-type β-lactamases IMP-1 and IMP-10 and mutants IMP-1-V67A and IMP-1-V67I were characterized biophysically and biochemically, and MICs for Escherichia coli cells expressing these enzymes were determined. We found that all variants exhibited catalytic efficiencies (kcat/Km) equal to or higher than that of IMP-1 against all tested β-lactams except penicillins, against which IMP-1 and IMP-1-V67I showed the highest kcat/Km values. The substrate-specific effects of the different amino acid substitutions at position 67 are discussed in light of their side chain structures and possible interactions with the substrates. Docking calculations were employed to investigate interactions between different side chains and an inhibitor used as a β-lactam surrogate. The differences in binding affinities determined experimentally and computationally seem to be governed by hydrophobic interactions between residue 67 and the inhibitor and, by inference, the β-lactam substrates. PMID:26369960

  13. Integrated Micro-Power System (IMPS) Development at NASA Glenn Research Center

    NASA Technical Reports Server (NTRS)

    Wilt, David; Hepp, Aloysius; Moran, Matt; Jenkins, Phillip; Scheiman, David; Raffaelle, Ryne


    Glenn Research Center (GRC) has a long history of energy related technology developments for large space related power systems, including photovoltaics, thermo-mechanical energy conversion, electrochemical energy storage. mechanical energy storage, power management and distribution and power system design. Recently, many of these technologies have begun to be adapted for small, distributed power system applications or Integrated Micro-Power Systems (IMPS). This paper will describe the IMPS component and system demonstration efforts to date.

  14. Interactions of the human, rat, Saccharomyces cerevisiae and Escherichia coli 3-methyladenine-DNA glycosylases with DNA containing dIMP residues

    PubMed Central

    Saparbaev, Murat; Mani, Jean-Claude; Laval, Jacques


    In DNA, the deamination of dAMP generates 2′-deoxyinosine 5′-monophosphate (dIMP). Hypoxanthine (HX) residues are mutagenic since they give rise to A·T→G·C transition. They are excised, although with different efficiencies, by an activity of the 3-methyladenine (3-meAde)-DNA glycosylases from Escherichia coli (AlkA protein), human cells (ANPG protein), rat cells (APDG protein) and yeast (MAG protein). Comparison of the kinetic constants for the excision of HX residues by the four enzymes shows that the E.coli and yeast enzymes are quite inefficient, whereas for the ANPG and the APDG proteins they repair the HX residues with an efficiency comparable to that of alkylated bases, which are believed to be the primary substrates of these DNA glycosylases. Since the use of various substrates to monitor the activity of HX-DNA glycosylases has generated conflicting results, the efficacy of the four 3-meAde-DNA glycosylases of different origin was compared using three different substrates. Moreover, using oligonucleotides containing a single dIMP residue, we investigated a putative sequence specificity of the enzymes involving the bases next to the HX residue. We found up to 2–5-fold difference in the rates of HX excision between the various sequences of the oligonucleotides studied. When the dIMP residue was placed opposite to each of the four bases, a preferential recognition of dI:T over dI:dG, dI:dC and dI:dA mismatches was observed for both human (ANPG) and E.coli (AlkA) proteins. At variance, the yeast MAG protein removed more efficiently HX from a dI:dG over dI:dC, dI:T and dI:dA mismatches. PMID:10684927

  15. Comparison of I-123 IMP cerebral uptake and MR spectroscopy following experimental carotid occlusion

    SciTech Connect

    Holman, B.L.; Jolesz, F.A.; Polak, J.F.; Kronauge, J.F.; Adams, D.F.


    Both I-123 IMP scintigraphy and MRI have been suggested as sensitive detectors of changes shortly after acute cerebral infarction. We compared the uptake of N-isopropyl I-123 p-iodoamphetamine (IMP) and MR spectroscopy of the brain after internal carotid artery ligation. Thirteen gerbils were lightly anesthetized with ether. After neck dissection, an internal carotid artery was occluded. After 2.8 hours, 100 muCi I-123 IMP was injected intravenously into the 13 experimental animals plus three controls. Seven gerbils remained asymptomatic while six developed hemiparesis. At 3 hours after ligation, the animals were killed. The brains were bisected and T1 and T2 relaxation times were determined for the right and left hemispheres by MR spectroscopy immediately after dissection. I-123 IMP uptake was then determined in the samples. Interhemispheric differences in uptake for I-123 IMP were 0.1 +/- 1.7% (SEM) in the control, 33.5 +/- 10% in the asymptomatic and 54.6 +/- 9.7% in the symptomatic animals. Significant differences were seen with I-123 IMP in 6/7 asymptomatic and 6/6 symptomatic animals. In conclusion, I-123 is more sensitive than T1 or T2 relaxation times for the detection of cerebral perfusion abnormalities. Prolongation in T1 and T2 relaxation times correlates closely with increased brain tissue water content and the development of symptoms, indicators of structural brain damage and probable infarction.

  16. A Link Between Integral Membrane Protein Expression and Simulated Integration Efficiency

    PubMed Central

    Müller, Axel; Tiemann, Katrin; Saladi, Shyam M.; Galimidi, Rachel P.; Zhang, Bin; Clemons, William M.; Miller, Thomas F.


    Integral membrane proteins (IMP) control the flow of information and nutrients across cell membranes, yet IMP mechanistic studies are hindered by difficulties in expression. We investigate this issue by addressing the connection between IMP sequence and observed expression levels. For homologs of the IMP TatC, observed expression levels widely vary and are affected by small changes in protein sequence. The effect of sequence changes on experimentally observed expression levels strongly correlates with the simulated integration efficiency obtained from coarse-grained modeling, which is directly confirmed using an in vivo assay. Furthermore, mutations that improve the simulated integration efficiency likewise increase the experimentally observed expression levels. Demonstration of these trends in both Escherichia coli and Mycobacterium smegmatis suggests that the results are general to other expression systems. This work suggests that IMP integration is a determinant for successful expression, raising the possibility of controlling IMP expression via rational design. PMID:27524616

  17. Intramembrane particles and the organization of lymphocyte membrane proteins

    PubMed Central

    Kuby, JM; Wofsy, L


    An experimental system was developed in which the majority of all lymphocyte cell-surface proteins, regardless of antigenic specificity, could be cross-linked and redistributed in the membrane to determine whether this would induce a corresponding redistribution of intramembrane particles (IMP). Mouse spleen cells were treated with P-diazoniumphenyl- β-D-lactoside (lac) to modify all exposed cell-surface proteins. Extensive azo- coupling was achieved without significantly reducing cell viability or compromising cellular function in mitogen- or antigen-stimulated cultures. When the lac-modified cell- surface proteins were capped with a sandwich of rabbit antilactoside antibody and fluorescein-goat anti-rabbit Ig, freeze-fracture preparations obtained from these cells revealed no obvious redistribution of IMP on the majority of fracture faces. However, detailed analysis showed a statistically significant 35 percent decrease (P less than 0.01) in average IMP density in the E face of the lac-capped spleen cells compared with control cells, whereas a few E-face micrographs showed intense IMP aggregation. In contrast, there was no significant alteration of P-face IMP densities or distribution. Apparently, the majority of E-face IMP and virtually all P-face IMP densities or distribution. Apparently, the majority of E-face IMP and virtually all P-face IMP do not present accessible antigenic sites on the lymphocyte surface and do not associate in a stable manner with surface protein antigens. This finding suggests that IMP, as observed in freeze-fracture analysis, may not comprise a representative reflection of lymphocyte transmembrane protein molecules and complexes because other evidence establishes: (a) that at least some common lymphocyte surface antigens are indeed exposed portions of transmembrane proteins and (b) that the aggregation of molecules of any surface antigen results in altered organization of contractile proteins at the cytoplasmic face of the membrane

  18. Intramembrane particles and the organization of lymphocyte membrane proteins.


    Kuby, J M; Wofsy, L


    An experimental system was developed in which the majority of all lymphocyte cell-surface proteins, regardless of antigenic specificity, could be cross-linked and redistributed in the membrane to determine whether this would induce a corresponding redistribution of intramembrane particles (IMP). Mouse spleen cells were treated with P-diazoniumphenyl- beta-D-lactoside (lac) to modify all exposed cell-surface proteins. Extensive azo- coupling was achieved without significantly reducing cell viability or compromising cellular function in mitogen- or antigen-stimulated cultures. When the lac-modified cell- surface proteins were capped with a sandwich of rabbit antilactoside antibody and fluorescein-goat anti-rabbit Ig, freeze-fracture preparations obtained from these cells revealed no obvious redistribution of IMP on the majority of fracture faces. However, detailed analysis showed a statistically significant 35 percent decrease (P less than 0.01) in average IMP density in the E face of the lac-capped spleen cells compared with control cells, whereas a few E-face micrographs showed intense IMP aggregation. In contrast, there was no significant alteration of P-face IMP densities or distribution. Apparently, the majority of E-face IMP and virtually all P-face IMP densities or distribution. Apparently, the majority of E-face IMP and virtually all P-face IMP do not present accessible antigenic sites on the lymphocyte surface and do not associate in a stable manner with surface protein antigens. This finding suggests that IMP, as observed in freeze-fracture analysis, may not comprise a representative reflection of lymphocyte transmembrane protein molecules and complexes because other evidence establishes: (a) that at least some common lymphocyte surface antigens are indeed exposed portions of transmembrane proteins and (b) that the aggregation of molecules of any surface antigen results in altered organization of contractile proteins at the cytoplasmic face of the membrane.

  19. The role of IMP dehydrogenase 2 in Inauhzin-induced ribosomal stress.


    Zhang, Qi; Zhou, Xiang; Wu, RuiZhi; Mosley, Amber; Zeng, Shelya X; Xing, Zhen; Lu, Hua


    The 'ribosomal stress (RS)-p53 pathway' is triggered by any stressor or genetic alteration that disrupts ribosomal biogenesis, and mediated by several ribosomal proteins (RPs), such as RPL11 and RPL5, which inhibit MDM2 and activate p53. Inosine monophosphate (IMP) dehydrogenase 2 (IMPDH2) is a rate-limiting enzyme in de novo guanine nucleotide biosynthesis and crucial for maintaining cellular guanine deoxy- and ribonucleotide pools needed for DNA and RNA synthesis. It is highly expressed in many malignancies. We previously showed that inhibition of IMPDH2 leads to p53 activation by causing RS. Surprisingly, our current study reveals that Inauzhin (INZ), a novel non-genotoxic p53 activator by inhibiting SIRT1, can also inhibit cellular IMPDH2 activity, and reduce the levels of cellular GTP and GTP-binding nucleostemin that is essential for rRNA processing. Consequently, INZ induces RS and the RPL11/RPL5-MDM2 interaction, activating p53. These results support the new notion that INZ suppresses cancer cell growth by dually targeting SIRT1 and IMPDH2.

  20. Importin β Can Bind Hepatitis B Virus Core Protein and Empty Core-Like Particles and Induce Structural Changes.


    Chen, Chao; Wang, Joseph Che-Yen; Pierson, Elizabeth E; Keifer, David Z; Delaleau, Mildred; Gallucci, Lara; Cazenave, Christian; Kann, Michael; Jarrold, Martin F; Zlotnick, Adam


    Hepatitis B virus (HBV) capsids are found in many forms: immature single-stranded RNA-filled cores, single-stranded DNA-filled replication intermediates, mature cores with relaxed circular double-stranded DNA, and empty capsids. A capsid, the protein shell of the core, is a complex of 240 copies of core protein. Mature cores are transported to the nucleus by a complex that includes both importin α and importin β (Impα and Impβ), which bind to the core protein's C-terminal domains (CTDs). Here we have investigated the interactions of HBV core protein with importins in vitro. Strikingly, empty capsids and free core protein can bind Impβ without Impα. Cryo-EM image reconstructions show that the CTDs, which are located inside the capsid, can extrude through the capsid to be bound by Impβ. Impβ density localized on the capsid exterior near the quasi-sixfold vertices, suggested a maximum of 30 Impβ per capsid. However, examination of complexes using single molecule charge-detection mass spectrometry indicate that some complexes include over 90 Impβ molecules. Cryo-EM of capsids incubated with excess Impβ shows a population of damaged particles and a population of "dark" particles with internal density, suggesting that Impβ is effectively swallowed by the capsids, which implies that the capsids transiently open and close and can be destabilized by Impβ. Though the in vitro complexes with great excess of Impβ are not biological, these results have implications for trafficking of empty capsids and free core protein; activities that affect the basis of chronic HBV infection.

  1. Characterization of Protein Detergent Complexes by NMR, Light Scattering, and Analytical Ultracentrifugation

    PubMed Central

    Maslennikov, Innokentiy; Krupa, Martin; Dickson, Christopher; Esquivies, Luis; Blain, Katherine; Kefala, Georgia; Choe, Senyon; Kwiatkowski, Witek


    Bottlenecks in expression, solubilization, purification and crystallization hamper the structural study of integral membrane proteins (IMPs). Successful crystallization is critically dependent on the purity, stability and oligomeric homogeneity of an IMP sample. These characteristics are in turn strongly influenced by the type and concentration of the detergents used in IMP preparation. By utilizing the techniques and analytical tools we earlier developed for the characterization of protein-detergent complexes (PDCs) (Maslennikov et al., 2007), we demonstrate that for successful protein extraction from E. coli membrane fractions, the solubilizing detergent associates preferentially to IMPs rather than to membrane lipids. Notably, this result is contrary to the generally accepted mechanism of detergent-mediated IMP solubilization. We find that for one particular member of the family of proteins studied (E. coli receptor kinases, which is purified in mixed multimeric states and oligomerizes through its transmembrane region), the protein oligomeric composition is largely unaffected by a 10-fold increase in protein concentration, by alteration of micelle properties through addition of other detergents to the PDC sample, or by a 20-fold variation in the detergent concentration used for solubilization of the IMP from the membrane. We observed that the conditions used for expression of the IMP, which impact protein density in the membrane, has the greatest influence on the IMP oligomeric structure. Finally, we argue that for concentrating PDCs smaller than 30 kDa, stirred concentration cells are less prone to over-concentration of detergent and are therefore more effective than centrifugal ultrafiltration devices. PMID:19214777

  2. Modification to the MED and LED source-encoding circuitry for the IMP H and J spacecraft

    NASA Technical Reports Server (NTRS)

    Garrahan, N. M.


    The circuitry and fabrication changes made on the MED and LED electronics cards for the IMP H and J are reported. Except for the noted changes, the circuitry and module-matrix arrangement is essentially the same as the IMP-1 electronics cards described. In addition, analysis of the IMP-1 transmitted data indicated the desirability of incorporating additional coincident-event threshold detection levels to further discriminate between received particles.

  3. Role of cardiolipin in stability of integral membrane proteins.


    Musatov, Andrej; Sedlák, Erik


    Cardiolipin (CL) is a unique phospholipid with a dimeric structure having four acyl chains and two phosphate groups found almost exclusively in certain membranes of bacteria and of mitochondria of eukaryotes. CL interacts with numerous proteins and has been implicated in function and stabilization of several integral membrane proteins (IMPs). While both functional and stabilization roles of CL in IMPs has been generally acknowledged, there are, in fact, only limited number of quantitative analysis that support this function of CL. This is likely caused by relatively complex determination of parameters characterizing stability of IMPs and particularly intricate assessment of role of specific PLs such as CL in IMPs stability. This review aims to summarize quantitative findings regarding stabilization role of CL in IMPs reported up to now. Copyright © 2017 Elsevier B.V. and Societe Francaise de Biochimie et Biologie Moleculaire (SFBBM). All rights reserved.

  4. Characterization of a Novel IMP-28 Metallo-β-Lactamase from a Spanish Klebsiella oxytoca Clinical Isolate

    PubMed Central

    Pérez-Llarena, Francisco José; Fernández, Ana; Zamorano, Laura; Kerff, Frédéric; Beceiro, Alejandro; Aracil, Belén; Cercenado, Emilia; Miro, Elisenda; Oliver, Antonio; Oteo, Jesús; Navarro, Ferran


    An isolate of Klebsiella oxytoca carrying a novel IMP metallo-β-lactamase was discovered in Madrid, Spain. The blaIMP-28 gene is part of a chromosomally located class I integron. The IMP-28 kcat/Km values for ampicillin, ceftazidime, and cefepime and, to a lesser extent, imipenem and meropenem, are clearly lower than those of IMP-1. The His306Gln mutation may induce important modifications of the L3 loop and thus of substrate accessibility and hydrolysis and be the main reason for this behavior. PMID:22668859

  5. Characterization of a novel IMP-28 metallo-β-lactamase from a Spanish Klebsiella oxytoca clinical isolate.


    Pérez-Llarena, Francisco José; Fernández, Ana; Zamorano, Laura; Kerff, Frédéric; Beceiro, Alejandro; Aracil, Belén; Cercenado, Emilia; Miro, Elisenda; Oliver, Antonio; Oteo, Jesús; Navarro, Ferran; Bou, Germán


    An isolate of Klebsiella oxytoca carrying a novel IMP metallo-β-lactamase was discovered in Madrid, Spain. The bla(IMP-28) gene is part of a chromosomally located class I integron. The IMP-28 k(cat)/K(m) values for ampicillin, ceftazidime, and cefepime and, to a lesser extent, imipenem and meropenem, are clearly lower than those of IMP-1. The His306Gln mutation may induce important modifications of the L3 loop and thus of substrate accessibility and hydrolysis and be the main reason for this behavior.

  6. Importin β Can Bind Hepatitis B Virus Core Protein and Empty Core-Like Particles and Induce Structural Changes

    PubMed Central

    Pierson, Elizabeth E.; Keifer, David Z.; Delaleau, Mildred; Gallucci, Lara; Cazenave, Christian; Kann, Michael; Jarrold, Martin F.; Zlotnick, Adam


    Hepatitis B virus (HBV) capsids are found in many forms: immature single-stranded RNA-filled cores, single-stranded DNA-filled replication intermediates, mature cores with relaxed circular double-stranded DNA, and empty capsids. A capsid, the protein shell of the core, is a complex of 240 copies of core protein. Mature cores are transported to the nucleus by a complex that includes both importin α and importin β (Impα and Impβ), which bind to the core protein’s C-terminal domains (CTDs). Here we have investigated the interactions of HBV core protein with importins in vitro. Strikingly, empty capsids and free core protein can bind Impβ without Impα. Cryo-EM image reconstructions show that the CTDs, which are located inside the capsid, can extrude through the capsid to be bound by Impβ. Impβ density localized on the capsid exterior near the quasi-sixfold vertices, suggested a maximum of 30 Impβ per capsid. However, examination of complexes using single molecule charge-detection mass spectrometry indicate that some complexes include over 90 Impβ molecules. Cryo-EM of capsids incubated with excess Impβ shows a population of damaged particles and a population of “dark” particles with internal density, suggesting that Impβ is effectively swallowed by the capsids, which implies that the capsids transiently open and close and can be destabilized by Impβ. Though the in vitro complexes with great excess of Impβ are not biological, these results have implications for trafficking of empty capsids and free core protein; activities that affect the basis of chronic HBV infection. PMID:27518410

  7. Hypoxic Vasospasm Mediated by cIMP: When Soluble Guanylyl Cyclase Turns Bad

    PubMed Central

    Chen, Zhengju; Leung, Susan W. S.; Vanhoutte, Paul M.


    Abstract: In a number of isolated blood vessel types, hypoxia causes an acute contraction that is dependent on the presence of nitric oxide and activation of soluble guanylyl cyclase. It is more pronounced when the preparations are constricted and is therefore termed hypoxic augmentation of vasoconstriction. This hypoxic response is accompanied by increases in the intracellular level of inosine 5′-triphosphate and in the synthesis of inosine 3′,5′-cyclic monophosphate (cIMP) by soluble guanylyl cyclase. The administration of exogenous cIMP or inosine 5′-triphosphate causes augmented vasoconstriction to hypoxia. Furthermore, the vasoconstriction evoked by hypoxia and cIMP is associated with increased activity of Rho kinase (ROCK), indicating that cIMP may mediate the hypoxic effect by sensitizing the myofilaments to Ca2+ through ROCK. Hypoxia is implicated in exaggerated vasoconstriction in the pathogenesis of coronary artery disease, myocardial infarction, hypertension, and stroke. The newly found role of cIMP may help to identify unique therapeutic targets for certain cardiovascular disorders. PMID:25264755

  8. Emergence of Imipenem-Resistant Pseudomonas aeruginosa Clinical Isolates from Egypt Coharboring VIM and IMP Carbapenemases.


    El-Domany, Ramadan Ahmed; Emara, Mohamed; El-Magd, Mohammed A; Moustafa, Walaa H; Abdeltwab, Nesma M


    Pseudomonas aeruginosa is an important human pathogen and the leading cause of nosocomial infections. P. aeruginosa is characterized by massive intrinsic resistance to a multiple classes of antibiotics with carbapenems being the most potent inhibitor of P. aeruginosa and considered the first choice for its treatment. Therefore, it is crucial to investigate novel mechanisms of resistance of P. aeruginosa to carbapenems for achieving successful therapy. A total of 114 P. aeruginosa isolates from two university hospitals in Egypt were recruited in this study. Antimicrobial susceptibility testing revealed that 50 isolates (43.8%) exhibited multidrug-resistant (MDR) phenotype, of them 14 isolates (12.2%) were imipenem (IPM)-resistant. Of these 14 isolates, 13 isolates (11.4%) exhibited the metallo-β-lactamase (MBL) phenotype. MBLs encoding genes, VIM and IMP, were identified by PCR. PCR results revealed that four isolates harbored the VIM gene alone, one isolate harbored IMP gene alone, and four isolates harbored both genes. The correct size of PCR products of VIM and IMP genes (390 and 188 bp, respectively) were sequenced to confirm results of PCR and to look for any possible polymorphism among MBL genes of tested isolates. Data analysis of these sequences showed 100% identity of nucleotide sequences of MBL genes among tested Egyptian patients. To our knowledge, this is the first report of IMP carbapenemase-encoding gene in Africa and the first detection of the emergence of P. aeruginosa coproducing VIM and IMP genes in Egypt.

  9. Development of selective medium for IMP-type carbapenemase-producing Enterobacteriaceae in stool specimens.


    Yamamoto, Norihisa; Kawahara, Ryuji; Akeda, Yukihiro; Shanmugakani, Rathina Kumar; Yoshida, Hisao; Hagiya, Hideharu; Hara, Naohiro; Nishi, Isao; Yukawa, Satomi; Asada, Rumiko; Sasaki, Yumi; Maeda, Kazuhiro; Sakamoto, Noriko; Hamada, Shigeyuki; Tomono, Kazunori


    Identification of carbapenemase-producing Enterobacteriaceae (CPE) in faecal specimens is challenging. This fact is particularly critical because low-level carbapenem-resistant organisms such as IMP-producing CPE are most prevalent in Japan. We developed a modified selective medium more suitable for IMP-type CPE. Fifteen reference CPE strains producing different types of β-lactamases were used to evaluate the commercially available CHROMagar KPC and chromID CARBA as well as the newly prepared MC-ECC medium (CHROMagar ECC supplemented with meropenem, cloxacillin, and ZnSO4) and M-ECC medium (CHROMagar ECC supplemented with meropenem and ZnSO4). A total of 1035 clinical samples were then examined to detect CPE using chromID CARBA and M-ECC medium. All tested strains producing NDM-, KPC-, and OXA-48-carbapenemases were successfully cultured in the media employed. Although most of the IMP-positive strains did not grow in CHROMagar KPC, chromID CARBA, or MC-ECC, all tested strains grew on M-ECC. When faecal samples were applied to the media, M-ECC medium allowed the best growth of IMP-type CPE with a significantly higher sensitivity (99.3%) than that of chromID CARBA (13.9%). M-ECC medium was determined as the most favourable selective medium for the detection of IMP-type CPE as well as other types of CPE.

  10. Molecular characterization of clinical IMP-producing Klebsiella pneumoniae isolates from a Chinese Tertiary Hospital.


    Lai, Kaisheng; Ma, Yanning; Guo, Ling; An, Jingna; Ye, Liyan; Yang, Jiyong


    IMP-producing Klebsiella pneumoniae (IMPKpn) exhibits sporadic prevalence in China. The mechanisms related to the spread of IMPKpn remain unclear. Carbapenem non-susceptible K. pneumoniae isolates were collected from our hospital. The genetic relatedness, antimicrobial susceptibility, as well as sequence types (ST) were analyzed by pulsed-field gel electrophoresis (PFGE), VITEK 2 AST test Kit, and multilocus sequence typing (MLST), respectively. S1-PFGE, Southern blot analysis and multiple PCR amplification were used for plasmid profiling. Between October 2009 and June 2016, 25 non-repetitive IMPKpn isolates were identified. PFGE results showed that these isolates belonged to 20 genetically unrelated IMPKpn strains. Diverse STs were identified by MLST. Most strains carried bla IMP-4, followed by bla IMP-1. Four incompatibility types of bla IMP-carrying plasmids were identified, which included A/C (n = 2), B/O (n = 2), L/M (n = 1) and N (n = 14), while type of other one plasmid failed to be determined. The IMPKpn isolates exhibited sporadic prevalence in our hospital. IncN types of plasmids with various sizes have emerged as the main platform mediating the spread of the bla IMP genes in our hospital.

  11. Hypoxic Vasospasm Mediated by cIMP: When Soluble Guanylyl Cyclase Turns Bad.


    Gao, Yuansheng; Chen, Zhengju; Leung, Susan W S; Vanhoutte, Paul M


    In a number of isolated blood vessel types, hypoxia causes an acute contraction that is dependent on the presence of nitric oxide and activation of soluble guanylyl cyclase. It is more pronounced when the preparations are constricted and is therefore termed hypoxic augmentation of vasoconstriction. This hypoxic response is accompanied by increases in the intracellular level of inosine 5'-triphosphate and in the synthesis of inosine 3',5'-cyclic monophosphate (cIMP) by soluble guanylyl cyclase. The administration of exogenous cIMP or inosine 5'-triphosphate causes augmented vasoconstriction to hypoxia. Furthermore, the vasoconstriction evoked by hypoxia and cIMP is associated with increased activity of Rho kinase (ROCK), indicating that cIMP may mediate the hypoxic effect by sensitizing the myofilaments to Ca through ROCK. Hypoxia is implicated in exaggerated vasoconstriction in the pathogenesis of coronary artery disease, myocardial infarction, hypertension, and stroke. The newly found role of cIMP may help to identify unique therapeutic targets for certain cardiovascular disorders.

  12. Ciliary Entry of the Hedgehog Transcriptional Activator Gli2 Is Mediated by the Nuclear Import Machinery but Differs from Nuclear Transport in Being Imp-α/β1-Independent.


    Torrado, Belén; Graña, Martín; Badano, José L; Irigoín, Florencia


    Gli2 is the primary transcriptional activator of Hedgehog signalling in mammals. Upon stimulation of the pathway, Gli2 moves into the cilium before reaching the nucleus. However, the mechanisms underlying its entry into the cilium are not completely understood. Since several similarities have been reported between nuclear and ciliary import, we investigated if the nuclear import machinery participates in Gli2 ciliary entry. Here we show that while two conserved classical nuclear localization signals mediate Gli2 nuclear localization via importin (Imp)-α/β1, these sequences are not required for Gli2 ciliary import. However, blocking Imp-mediated transport through overexpression of GTP-locked Ran reduced the percentage of Gli2 positive cilia, an effect that was not explained by increased CRM1-dependent export of Gli2 from the cilium. We explored the participation of Imp-β2 in Gli2 ciliary traffic and observed that this transporter is involved in moving Gli2 into the cilium, as has been described for other ciliary proteins. In addition, our data indicate that Imp-β2 might also collaborate in Gli2 nuclear entry. How does Imp-β2 determine the final destination of a protein that can localize to two distinct subcellular compartments remains an open question. Therefore, our data shows that the nuclear-cytoplasmic shuttling machinery plays a critical role mediating the subcellular distribution of Gli2 and the activation of the pathway, but distinct importins likely play a differential role mediating its ciliary and nuclear translocation.

  13. Ciliary Entry of the Hedgehog Transcriptional Activator Gli2 Is Mediated by the Nuclear Import Machinery but Differs from Nuclear Transport in Being Imp-α/β1-Independent

    PubMed Central

    Torrado, Belén; Graña, Martín; Badano, José L.; Irigoín, Florencia


    Gli2 is the primary transcriptional activator of Hedgehog signalling in mammals. Upon stimulation of the pathway, Gli2 moves into the cilium before reaching the nucleus. However, the mechanisms underlying its entry into the cilium are not completely understood. Since several similarities have been reported between nuclear and ciliary import, we investigated if the nuclear import machinery participates in Gli2 ciliary entry. Here we show that while two conserved classical nuclear localization signals mediate Gli2 nuclear localization via importin (Imp)-α/β1, these sequences are not required for Gli2 ciliary import. However, blocking Imp-mediated transport through overexpression of GTP-locked Ran reduced the percentage of Gli2 positive cilia, an effect that was not explained by increased CRM1-dependent export of Gli2 from the cilium. We explored the participation of Imp-β2 in Gli2 ciliary traffic and observed that this transporter is involved in moving Gli2 into the cilium, as has been described for other ciliary proteins. In addition, our data indicate that Imp-β2 might also collaborate in Gli2 nuclear entry. How does Imp-β2 determine the final destination of a protein that can localize to two distinct subcellular compartments remains an open question. Therefore, our data shows that the nuclear-cytoplasmic shuttling machinery plays a critical role mediating the subcellular distribution of Gli2 and the activation of the pathway, but distinct importins likely play a differential role mediating its ciliary and nuclear translocation. PMID:27579771

  14. Magnetosphere boundary observations along the Imp 7 orbit. I - Boundary locations and wave level variations

    NASA Technical Reports Server (NTRS)

    Scarf, F. L.; Frank, L. A.; Lepping, R. P.


    The paper is concerned with magnetosphere boundary phenomena observed by the Imp 7 magnetic field, plasma, and plasma wave instruments in 1972 and 1973. Boundary locations for a 15-month period are surveyed, and the different types of crossings are described. The spacecraft crosses the dawn and dusk boundaries near 25 earth radii downstream, and the physical processes at the Imp 7 magnetopause appear to be intermediate between those observed over the poles and those observed at the lunar orbit. The Imp 7 orbit also traverses a downstream region near where 'fireball' phenomena occur. Electromagnetic wave modes detected in the broad low-frequency channel of the wave instrument are analyzed, and the interpretation of data of this type suggests that the broad low-frequency channel is sensitive to oscillations in the lower hybrid resonance region of the spectrum.

  15. Comparison of I-123 IMP uptake and NMR spectroscopy in the brain following experimental carotid occlusion

    SciTech Connect

    Holman, B.L.; Jolesz, F.; Polak, J.F.; Kronauge, J.; Adams, D.F.


    Both I-123 IMP scintigraphy and NMR have been suggested as sensitive detectors of changes shortly after acute cerebral infarction. The authors compared the uptake of N-isopropul I-123 p-iodoamphetamine (IMP) and NMR spectroscopy of the brain after internal carotid artery ligation. Thirteen gerbils were lightly anesthetized with ether. After neck dissection, an internal carotid artery was occluded. After 2.8 hours, 100 I-123 IMP was injected intravenously into the 13 experimental animals plus 3 controls. Seven gerbils remained asymptomatic while 6 developed hemiparesis. At 3 hours after ligation, the animals were killed. The brains were bisected and T/sub 1/ and T/sub 2/ relaxation times were determined for the right and left hemispheres by NMR spectroscopy immediately after dissection. I-123 IMP uptake was then determined in the samples. Interhemispheric differences in uptake for I-123 IMP uptake was 2.2% +- 0.5% in the control, 33.5% +- 9.6% in the asymptomatic and 54.6% +- 9.7% in the symptomatic animals. Significant differences were seen with I-123 IMP in 6/7 asymptomatic and 6/6 symptomatic animals. Significant differences in T/sub 1/ and T/sub 2/ were seen in 2/7 of the asymptomatic and 5/6 of the symptomatic animals. The authors conclude that I-123 is more sensitive than T/sub 1/ or T/sub 2/ for the detection of cerebral perfusion abnormalities while T/sub 1/ and T/sub 2/ more accurately separate symptomatic from asymptomatic animals.

  16. GeneImp: Fast Imputation to Large Reference Panels Using Genotype Likelihoods from Ultralow Coverage Sequencing.


    Spiliopoulou, Athina; Colombo, Marco; Orchard, Peter; Agakov, Felix; McKeigue, Paul


    We address the task of genotype imputation to a dense reference panel given genotype likelihoods computed from ultralow coverage sequencing as inputs. In this setting, the data have a high-level of missingness or uncertainty, and are thus more amenable to a probabilistic representation. Most existing imputation algorithms are not well suited for this situation, as they rely on prephasing for computational efficiency, and, without definite genotype calls, the prephasing task becomes computationally expensive. We describe GeneImp, a program for genotype imputation that does not require prephasing and is computationally tractable for whole-genome imputation. GeneImp does not explicitly model recombination, instead it capitalizes on the existence of large reference panels-comprising thousands of reference haplotypes-and assumes that the reference haplotypes can adequately represent the target haplotypes over short regions unaltered. We validate GeneImp based on data from ultralow coverage sequencing (0.5×), and compare its performance to the most recent version of BEAGLE that can perform this task. We show that GeneImp achieves imputation quality very close to that of BEAGLE, using one to two orders of magnitude less time, without an increase in memory complexity. Therefore, GeneImp is the first practical choice for whole-genome imputation to a dense reference panel when prephasing cannot be applied, for instance, in datasets produced via ultralow coverage sequencing. A related future application for GeneImp is whole-genome imputation based on the off-target reads from deep whole-exome sequencing. Copyright © 2017 by the Genetics Society of America.

  17. Dominance of IMP-4-producing enterobacter cloacae among carbapenemase-producing Enterobacteriaceae in Australia.


    Sidjabat, Hanna E; Townell, Nicola; Nimmo, Graeme R; George, Narelle M; Robson, Jennifer; Vohra, Renu; Davis, Louise; Heney, Claire; Paterson, David L


    The prevalence of carbapenemase-producing Enterobacteriaceae (CPE) has been increasing worldwide. blaIMP has been reported to be the predominant carbapenemase-encoding gene within Enterobacteriaceae in Australia. However, there are limited data currently available on CPE from Queensland, Australia. A total of 58 CPE isolates were isolated between July 2009 and March 2014 from Queensland hospitals. The clonality of isolates was determined by Diversilab repetitive sequence-based PCR. The isolates were investigated for the resistance mechanisms carbapenemase, extended-spectrum β-lactamase, and AmpC β-lactamase and for aminoglycoside resistance and plasmid-mediated quinolone resistance genes by PCR. The plasmid types associated with carbapenemase-encoding genes were characterized. The majority of the CPE were Enterobacter cloacae (n = 29). The majority of Queensland CPE isolates were IMP producers and comprised 11 species (n = 48). Nine NDM-producing Enterobacteriaceae were identified. One NDM-producing Klebsiella pneumoniae isolate coproduced OXA-48. One K. pneumoniae isolate was an OXA-181 producer. The incidence of IMP producers increased significantly in 2013. blaIMP-4 was found in all IMP-producing isolates. blaTEM, qnrB, and aacA4 were common among IMP-4 producers. The HI2 (67%) and L/M (21%) replicons were associated with blaIMP-4. All HI2 plasmids were of sequence type 1 (ST1). All but one of the NDM producers possessed blaCTX-M-15. The 16S rRNA methylase genes found among NDM producers were armA, rmtB, rmtC, and rmtF. The substantial increase in the prevalence of CPE in Queensland has been associated mainly with the emergence E. cloacae strains possessing HI2 plasmids carrying blaIMP-4 over the past 2 years. The importation of NDM producers and/or OXA-48-like producers in patients also contributed to the increased emergence of CPE. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Metabolic engineering of the purine biosynthetic pathway in Corynebacterium glutamicum results in increased intracellular pool sizes of IMP and hypoxanthine

    PubMed Central


    Background Purine nucleotides exhibit various functions in cellular metabolism. Besides serving as building blocks for nucleic acid synthesis, they participate in signaling pathways and energy metabolism. Further, IMP and GMP represent industrially relevant biotechnological products used as flavor enhancing additives in food industry. Therefore, this work aimed towards the accumulation of IMP applying targeted genetic engineering of Corynebacterium glutamicum. Results Blocking of the degrading reactions towards AMP and GMP lead to a 45-fold increased intracellular IMP pool of 22 μmol gCDW-1. Deletion of the pgi gene encoding glucose 6-phosphate isomerase in combination with the deactivated AMP and GMP generating reactions, however, resulted in significantly decreased IMP pools (13 μmol gCDW-1). Targeted metabolite profiling of the purine biosynthetic pathway further revealed a metabolite shift towards the formation of the corresponding nucleobase hypoxanthine (102 μmol gCDW-1) derived from IMP degradation. Conclusions The purine biosynthetic pathway is strongly interconnected with various parts of the central metabolism and therefore tightly controlled. However, deleting degrading reactions from IMP to AMP and GMP significantly increased intracellular IMP levels. Due to the complexity of this pathway further degradation from IMP to the corresponding nucleobase drastically increased suggesting additional targets for future strain optimization. PMID:23092390

  19. Nucleotide-amino acid interactions in the L-His-IMP.MeOH.H(2)O complex.


    Rlepokura, Katarzyna; Petrus, Rafał


    In the crystal structure of the methanol-solvated monohydrated complex of L-histidine (His) with inosine 5'-monophosphate (IMP), namely L-histidinium inosine-5'-phosphate methanol solvate monohydrate, C(6)H(10)N(3)O(2)(+).C(10)H(12)N(4)O(8)P(-).CH(3)OH.H(2)O, most of the interactions between IMP anions (anti/C3'-endo/gauche-gauche conformers) are realized between the riboses and hypoxanthine bases in a trans sugar-edge/sugar-edge geometry, and between the phosphate groups. The base Watson-Crick edge is involved in additional methanol-mediated IMP...MeOH...IMP contacts. Specific and nonspecific nucleotide-amino acid (IMP...His) interactions engage the Hoogsteen edges of the base and phosphate group, respectively. Additional stabilization of His...IMP contacts is provided by pi-pi stacking between the imidazolium ring of His and the hypoxanthine base of IMP. The results may indicate the possible recognition mechanism between His and IMP.

  20. Metabolic engineering of the purine biosynthetic pathway in Corynebacterium glutamicum results in increased intracellular pool sizes of IMP and hypoxanthine.


    Peifer, Susanne; Barduhn, Tobias; Zimmet, Sarah; Volmer, Dietrich A; Heinzle, Elmar; Schneider, Konstantin


    Purine nucleotides exhibit various functions in cellular metabolism. Besides serving as building blocks for nucleic acid synthesis, they participate in signaling pathways and energy metabolism. Further, IMP and GMP represent industrially relevant biotechnological products used as flavor enhancing additives in food industry. Therefore, this work aimed towards the accumulation of IMP applying targeted genetic engineering of Corynebacterium glutamicum. Blocking of the degrading reactions towards AMP and GMP lead to a 45-fold increased intracellular IMP pool of 22 μmol g(CDW)⁻¹. Deletion of the pgi gene encoding glucose 6-phosphate isomerase in combination with the deactivated AMP and GMP generating reactions, however, resulted in significantly decreased IMP pools (13 μmol g(CDW)⁻¹). Targeted metabolite profiling of the purine biosynthetic pathway further revealed a metabolite shift towards the formation of the corresponding nucleobase hypoxanthine (102 μmol g(CDW)⁻¹) derived from IMP degradation. The purine biosynthetic pathway is strongly interconnected with various parts of the central metabolism and therefore tightly controlled. However, deleting degrading reactions from IMP to AMP and GMP significantly increased intracellular IMP levels. Due to the complexity of this pathway further degradation from IMP to the corresponding nucleobase drastically increased suggesting additional targets for future strain optimization.

  1. Flexibility in targeting and insertion during bacterial membrane protein biogenesis

    SciTech Connect

    Bloois, Edwin van; Hagen-Jongman, Corinne M. ten; Luirink, Joen


    The biogenesis of Escherichia coli inner membrane proteins (IMPs) is assisted by targeting and insertion factors such as the signal recognition particle (SRP), the Sec-translocon and YidC with translocation of (large) periplasmic domains energized by SecA and the proton motive force (pmf). The use of these factors and forces is probably primarily determined by specific structural features of an IMP. To analyze these features we have engineered a set of model IMPs based on endogenous E. coli IMPs known to follow distinct targeting and insertion pathways. The modified model IMPs were analyzed for altered routing using an in vivo protease mapping approach. The data suggest a facultative use of different combinations of factors.

  2. Integral Membrane Protein Expression in Saccharomyces cerevisiae.


    Boswell-Casteel, Rebba C; Johnson, Jennifer M; Stroud, Robert M; Hays, Franklin A


    Eukaryotic integral membrane proteins are challenging targets for crystallography or functional characterization in a purified state. Since expression is often a limiting factor when studying this difficult class of biological macromolecules, the intent of this chapter is to focus on the expression of eukaryotic integral membrane proteins (IMPs) using the model organism Saccharomyces cerevisiae. S. cerevisiae is a prime candidate for the expression of eukaryotic IMPs because it offers the convenience of using episomal expression plasmids, selection of positive transformants, posttranslational modifications, and it can properly fold and target IMPs. Here we present a generalized protocol and insights based on our collective knowledge as an aid to overcoming the challenges faced when expressing eukaryotic IMPs in S. cerevisiae.

  3. Immunogenicity and protective efficacy of an Eimeria vaccine candidate based on Eimeria tenella immune mapped protein 1 and chicken CD40 ligand.


    Yin, Guangwen; Lin, Qian; Qiu, Jianhan; Qin, Mei; Tang, Xinming; Suo, Xun; Huang, Zhijian; Liu, Xianyong


    The CD40 ligand (CD40L) has shown potential as a powerful immunological adjuvant in various studies. Here, the efficacy of a chimeric subunit vaccine, consisting of Eimeria tenella immune mapped protein 1 (EtIMP1) and chicken CD40L, was evaluated against E. tenella infection. The recombinant EtIMP1-CD40L was purified from E. coli over-expressing this protein. Chickens were vaccinated with EtIMP1-CD40L without adjuvant or EtIMP1 with Freund's adjuvant. Immunization of chickens with EtIMP1-CD40L fusion protein resulted in stronger IFN-γ secretion and IgA response than that with only recombinant EtIMP1 with Freund's adjuvant. The clinical effect (cecal lesions, body weights gain, and oocysts shedding) of the EtIMP1-CD40L without adjuvant was also better than that of the EtIMP1 with adjuvant, as evidenced by the difference between the two groups in the oocyst output of E. tenella-challenged chickens. The results suggest that the EtIMP1-CD40L fusion protein can be used as an effective immunogen in the development of subunit vaccines against Eimeria infection.

  4. Multi-satellite observations of plasmoids - IMP 8 and ISEE 3

    NASA Technical Reports Server (NTRS)

    Moldwin, Mark B.; Hughes, W. J.


    An examination of IMP 8 and ISEE 3 magnetotail data during the 1983 Geotail Mission yielded one plasmoid event which was observed by both satellites and two other possible cases. These are the first multisatellite observations of plasoids. These observations provide a unique opportunity to examine how plasmoid characteristics change as plasmoids propagate downtail and they show that plasmoids are very stable structures.

  5. First report of Klebsiella oxytoca strain coproducing KPC-2 and IMP-8 carbapenemases.


    Li, Bin; Sun, Jing-Yong; Liu, Qing-Zhong; Han, Li-Zhong; Huang, Xin-Hong; Ni, Yu-Xing


    The study shows for the first time the presence of the Klebsiella oxytoca strain fp10 coproducing plasmid-mediated KPC-2 and IMP-8 carbapenemases. The strain was obtained from the fecal sample of an inpatient and showed high-level resistance to imipenem and ertapenem (MICs > 32 μg/ml). Conjugation experiments demonstrated the transferability of the carbapenem-resistant determinants. The results of plasmid analysis and Southern hybridization revealed that the bla(KPC-2) gene was located on transferable plasmid pFP10-1 (∼54 kb), whereas the bla(IMP-8) gene was on transferable plasmid pFP10-2 (∼180 kb). Analysis of the genetic environment of these two genes has demonstrated that ISKpn6 and ISKpn8 are involved in the spread of the bla(KPC-2) gene, while the transposable elements IS26, intI1, and tniC might contribute to the dissemination of the bla(IMP-8) gene. The chimera of several transposon-associated elements indicated a novel genetic environment of IMP-type metallo-β-lactamase gene in Enterobacteriaceae from China.

  6. 123I-IMP-SPECT in a patient with cerebral proliferative angiopathy: a case report.


    Kimiwada, Tomomi; Hayashi, Toshiaki; Shirane, Reizo; Tominaga, Teiji


    Cerebral proliferative angiopathy (CPA) is a new clinical entity demonstrating a diffuse network of densely enhanced vascular abnormalities with intermingled normal brain parenchyma and is distinguishable from classical arteriovenous malformations by specific clinical and imaging markers. However, the pathophysiological nature of this disease is unclear, and there is no consensus on the treatment. We describe cerebral perfusion abnormalities in a patient with CPA by using N-isopropyl-p-[123I] iodoamphetamine single-photon emission computed tomography (123I-IMP-SPECT) and perfusion-weighted magnetic resonance imaging. The patient, a 13-year-old boy, had reversible focal neurological deficits unrelated to cerebral hemorrhage. 123I-IMP-SPECT at resting state showed preserved uptake within the vascular lesion, yet lower uptake in the area adjacent to the lesion. In addition, acetazolamide-stressed 123I-IMP-SPECT exhibited severely impaired cerebrovascular reactivity over the affected hemisphere, suggesting that his focal neurological deficits were related to the cerebral ischemia. The perfusion abnormalities on 123I-IMP-SPECT in a CPA patient have never been previously reported. The concept of vascular malformation-related hypoperfusion is discussed. Copyright © 2013 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  7. Multi-satellite observations of plasmoids - IMP 8 and ISEE 3

    NASA Technical Reports Server (NTRS)

    Moldwin, Mark B.; Hughes, W. J.


    An examination of IMP 8 and ISEE 3 magnetotail data during the 1983 Geotail Mission yielded one plasmoid event which was observed by both satellites and two other possible cases. These are the first multisatellite observations of plasoids. These observations provide a unique opportunity to examine how plasmoid characteristics change as plasmoids propagate downtail and they show that plasmoids are very stable structures.

  8. IMP-6 Carbapenemase-Producing Enterobacteriaceae Bacteremia Successfully Treated with Amikacin-Meropenem in Two Patients.


    Nakakura, Ichiro; Ogawa, Yoshihiko; Sakakura, Kota; Imanishi, Kaori; Hirota, Kazuyuki; Shimatani, Yasuaki; Uehira, Tomoko; Nakamori, Shoji; Sako, Rumi; Doi, Toshiyuki; Yamazaki, Kunio


    Infections caused by carbapenemase-producing Enterobacteriaceae (CPE) are becoming increasingly common worldwide. Although CPE infections can be fatal, few reports in the literature have described effective and successful treatments for infectious diseases caused by several types of IMP CPE, and, to our knowledge, no reports have described the successful treatment of IMP-6 CPE infections. We describe two patients who developed bacteremia caused by IMP-6 CPE after surgery for cancer who were successfully treated with amikacin plus high-dose prolonged-infusion meropenem. Both patients were treated over a 2-week period using amikacin 15 mg/kg at various intervals based on therapeutic drug monitoring and meropenem 2000 mg infused over 3 hours every 12 hours. The dosages of amikacin and meropenem were determined based on the creatinine clearance of each patient. Both patients were cured of their bacteremia and did not experience any antibiotic-related adverse effects. Based on the outcomes of these patients, it appears that amikacin plus high-dose prolonged-infusion meropenem may be safe and effective for the treatment of bacteremia caused by IMP-6 CPE. © 2017 Pharmacotherapy Publications, Inc.

  9. Iron(III) located in the dinuclear metallo-β-lactamase IMP-1 by pseudocontact shifts.


    Carruthers, Thomas J; Carr, Paul D; Loh, Choy-Theng; Jackson, Colin J; Otting, Gottfried


    Heterodinuclear metalloenzymes are an important class of metalloproteins, but determining the location of the different metal ions can be difficult. Herein we present a new NMR spectroscopy method that uses pseudocontact shifts (PCS) to achieve this without assumptions about the coordinating ligands. The approach is illustrated with the dinuclear [FeZn] complex of IMP-1, which is a prototypical metallo-β-lactamase (MβL) that confers resistance to β-lactam antibiotics. Results from single-crystal X-ray diffraction were compromised by degradation during crystallization. With [GaZn]-IMP-1 as diamagnetic reference, the PCSs unambiguously identified the iron binding site in fresh samples of [FeZn]-IMP-1, even though the two metal centers are less than 3.8 Å apart and the iron is high-spin Fe(3+), which produces only small PCSs. [FeZn]-MβLs may be important drug targets, as [FeZn]-IMP-1 is enzymatically active and readily produced in the presence of small amounts of Fe(3+). © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. The Twin Peaks in 3-D, as Viewed by the Mars Pathfinder IMP Camera

    NASA Image and Video Library


    Twin Peaks are modest-size hills to the southwest of NASA Mars Pathfinder landing site. They were discovered on the first panoramas taken by the IMP camera on the 4th of July, 1997. 3D glasses are necessary to identify surface detail.

  11. Results from the IMP-J violet solar cell experiment and violet cell balloon flights

    NASA Technical Reports Server (NTRS)

    Gaddy, E. M.


    The IMP-J violet solar cell experiment was flown in an orbit with mild thermal cycling and low hard particle radiation. The results of the experiment show that violet cells degrade at about the same rate as conventional cells in such an orbit. Balloon flight measurements show that violet solar cells produce approximately 20% more power than conventional cells.

  12. An Eimeria vaccine candidate based on Eimeria tenella immune mapped protein 1 and the TLR-5 agonist Salmonella typhimurium FliC flagellin

    SciTech Connect

    Yin, Guangwen; Qin, Mei; Liu, Xianyong; Suo, Jingxia; Tang, Xinming; Tao, Geru; Han, Qian; Suo, Xun; Wu, Wenxue


    Highlights: •We found a new protective protein – (IMPI) in Eimeria tenella. •EtIMP1-flagellin fusion protein is an effective immunogen against Eimeria infection. •Flagellin can be as an apicomplexan parasite vaccine adjuvant in chickens. -- Abstract: Immune mapped protein-1 (IMP1) is a new protective protein in apicomplexan parasites, and exits in Eimeria tenella. But its structure and immunogenicity in E. tenella are still unknown. In this study, IMPI in E. tenella was predicted to be a membrane protein. To evaluate immunogenicity of IMPI in E. tenella, a chimeric subunit vaccine consisting of E. tenella IMP1 (EtIMP1) and a molecular adjuvant (a truncated flagellin, FliC) was constructed and over-expressed in Escherichia coli and its efficacy against E. tenella infection was evaluated. Three-week-old AA broiler chickens were vaccinated with the recombinant EtIMP1-truncated FliC without adjuvant or EtIMP1 with Freund’s Complete Adjuvant. Immunization of chickens with the recombinant EtIMP1-truncated FliC fusion protein resulted in stronger cellular immune responses than immunization with only recombinant EtIMP1 with adjuvant. The clinical effect of the EtIMP1-truncated FliC without adjuvant was also greater than that of the EtIMP1 with adjuvant, which was evidenced by the differences between the two groups in body weight gain, oocyst output and caecal lesions of E. tenella-challenged chickens. The results suggested that the EtIMP1-flagellin fusion protein can be used as an effective immunogen in the development of subunit vaccines against Eimeria infection. This is the first demonstration of antigen-specific protective immunity against avian coccidiosis using a recombinant flagellin as an apicomplexan parasite vaccine adjuvant in chickens.

  13. Multidrug-Resistant Sequence Type 235 Pseudomonas aeruginosa Clinical Isolates Producing IMP-26 with Increased Carbapenem-Hydrolyzing Activities in Vietnam

    PubMed Central

    Tada, Tatsuya; Nhung, Pham Hong; Miyoshi-Akiyama, Tohru; Shimada, Kayo; Tsuchiya, Mitsuhiro; Phuong, Doan Mai; Anh, Nguyen Quoc; Ohmagari, Norio


    Forty clinical isolates of multidrug-resistant Pseudomonas aeruginosa were obtained in a medical setting in Hanoi, Vietnam. Whole genomes of all 40 isolates were sequenced by MiSeq (Illumina), and phylogenic trees were constructed from the single nucleotide polymorphism concatemers. Of these 40 isolates, 24 (60.0%) harbored metallo-β-lactamase-encoding genes, including blaIMP-15, blaIMP-26, blaIMP-51, and/or blaNDM-1. Of these 24 isolates, 12 harbored blaIMP-26 and belonged to sequence type 235 (ST235). Escherichia coli expressing blaIMP-26 was significantly more resistant to doripenem and meropenem than E. coli expressing blaIMP-1 and blaIMP-15. IMP-26 showed higher catalytic activity against doripenem and meropenem than IMP-1 and against all carbapenems tested, including doripenem, imipenem, meropenem, and panipenem, than did IMP-15. These data suggest that clinical isolates of multidrug-resistant ST235 P. aeruginosa producing IMP-26 with increased carbapenem-hydrolyzing activities are spreading in medical settings in Vietnam. PMID:27600046

  14. Multidrug-Resistant Sequence Type 235 Pseudomonas aeruginosa Clinical Isolates Producing IMP-26 with Increased Carbapenem-Hydrolyzing Activities in Vietnam.


    Tada, Tatsuya; Nhung, Pham Hong; Miyoshi-Akiyama, Tohru; Shimada, Kayo; Tsuchiya, Mitsuhiro; Phuong, Doan Mai; Anh, Nguyen Quoc; Ohmagari, Norio; Kirikae, Teruo


    Forty clinical isolates of multidrug-resistant Pseudomonas aeruginosa were obtained in a medical setting in Hanoi, Vietnam. Whole genomes of all 40 isolates were sequenced by MiSeq (Illumina), and phylogenic trees were constructed from the single nucleotide polymorphism concatemers. Of these 40 isolates, 24 (60.0%) harbored metallo-β-lactamase-encoding genes, including blaIMP-15, blaIMP-26, blaIMP-51, and/or blaNDM-1 Of these 24 isolates, 12 harbored blaIMP-26 and belonged to sequence type 235 (ST235). Escherichia coli expressing blaIMP-26 was significantly more resistant to doripenem and meropenem than E. coli expressing blaIMP-1 and blaIMP-15 IMP-26 showed higher catalytic activity against doripenem and meropenem than IMP-1 and against all carbapenems tested, including doripenem, imipenem, meropenem, and panipenem, than did IMP-15. These data suggest that clinical isolates of multidrug-resistant ST235 P. aeruginosa producing IMP-26 with increased carbapenem-hydrolyzing activities are spreading in medical settings in Vietnam. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  15. Micro-scale NMR Experiments for Monitoring the Optimization of Membrane Protein Solutions for Structural Biology

    PubMed Central

    Horst, Reto; Wüthrich, Kurt


    Reconstitution of integral membrane proteins (IMP) in aqueous solutions of detergent micelles has been extensively used in structural biology, using either X-ray crystallography or NMR in solution. Further progress could be achieved by establishing a rational basis for the selection of detergent and buffer conditions, since the stringent bottleneck that slows down the structural biology of IMPs is the preparation of diffracting crystals or concentrated solutions of stable isotope labeled IMPs. Here, we describe procedures to monitor the quality of aqueous solutions of [2H, 15N]-labeled IMPs reconstituted in detergent micelles. This approach has been developed for studies of β-barrel IMPs, where it was successfully applied for numerous NMR structure determinations, and it has also been adapted for use with α-helical IMPs, in particular GPCRs, in guiding crystallization trials and optimizing samples for NMR studies (Horst et al., 2013). 2D [15N, 1H]-correlation maps are used as “fingerprints” to assess the foldedness of the IMP in solution. For promising samples, these “inexpensive” data are then supplemented with measurements of the translational and rotational diffusion coefficients, which give information on the shape and size of the IMP/detergent mixed micelles. Using microcoil equipment for these NMR experiments enables data collection with only micrograms of protein and detergent. This makes serial screens of variable solution conditions viable, enabling the optimization of parameters such as the detergent concentration, sample temperature, pH and the composition of the buffer. PMID:27077076

  16. Micro-scale NMR Experiments for Monitoring the Optimization of Membrane Protein Solutions for Structural Biology.


    Horst, Reto; Wüthrich, Kurt


    Reconstitution of integral membrane proteins (IMP) in aqueous solutions of detergent micelles has been extensively used in structural biology, using either X-ray crystallography or NMR in solution. Further progress could be achieved by establishing a rational basis for the selection of detergent and buffer conditions, since the stringent bottleneck that slows down the structural biology of IMPs is the preparation of diffracting crystals or concentrated solutions of stable isotope labeled IMPs. Here, we describe procedures to monitor the quality of aqueous solutions of [(2)H, (15)N]-labeled IMPs reconstituted in detergent micelles. This approach has been developed for studies of β-barrel IMPs, where it was successfully applied for numerous NMR structure determinations, and it has also been adapted for use with α-helical IMPs, in particular GPCRs, in guiding crystallization trials and optimizing samples for NMR studies (Horst et al., 2013). 2D [(15)N, (1)H]-correlation maps are used as "fingerprints" to assess the foldedness of the IMP in solution. For promising samples, these "inexpensive" data are then supplemented with measurements of the translational and rotational diffusion coefficients, which give information on the shape and size of the IMP/detergent mixed micelles. Using microcoil equipment for these NMR experiments enables data collection with only micrograms of protein and detergent. This makes serial screens of variable solution conditions viable, enabling the optimization of parameters such as the detergent concentration, sample temperature, pH and the composition of the buffer.

  17. Insulin-Like Growth Factor II mRNA-Binding Protein 3 Expression Correlates with Poor Prognosis in Acral Lentiginous Melanoma

    PubMed Central

    Sheen, Yi-Shuan; Liao, Yi-Hua; Lin, Ming-Hsien; Chiu, Hsien-Ching; Jee, Shiou-Hwa; Liau, Jau-Yu


    Insulin-like growth factor-II mRNA-binding protein 3 (IMP-3) is an RNA-binding protein expressed in multiple cancers, including melanomas. However, the expression of IMP-3 has not been investigated in acral lentiginous melanoma (ALM). This study sought to elucidate its prognostic value in ALMs. IMP-3 expression was studied in 93 patients diagnosed with ALM via immunohistochemistry. Univariate and multivariate analyses for survival were performed, according to clinical and histologic parameters, using the Cox proportional hazard model. Survival curves were graphed using the Kaplan-Meier method. IMP-3 was over-expressed in 70 out of 93 tumors (75.3%). IMP-3 expression correlated with thick and high-stage tumor and predicted poorer overall, melanoma-specific, recurrence-free and distant metastasis-free survivals (P = 0.002, 0.006, 0.008 and 0.012, respectively). Further analysis showed that patients with tumor thickness ≤ 4.0 mm and positive IMP-3 expression had a significantly worse melanoma-specific survival than those without IMP-3 expression (P = 0.048). IMP-3 (hazard ratio 3.67, 95% confidence intervals 1.35–9.97, P = 0.011) was confirmed to be an independent prognostic factor for melanoma-specific survival in multivariate survival analysis. Positive IMP-3 expression was an important prognostic factor for ALMs. PMID:26796627

  18. IMP 8 observations of a poleward plasma circulation: Evidence of entry into the plasma mantle?

    NASA Astrophysics Data System (ADS)

    Kolpak, M. A.; Paularena, K. I.; Richardson, J. D.; Siscoe, G. L.

    Plasma data from IMP 8 are used to map the spatial structure of plasma flow in Earth's magnetosheath. Plasma and magnetic field data from instruments on ISEE-3 and WIND are used to normalize the IMP 8 magnetosheath data to upstream solar wind conditions. For the majority of the data, the magnitude and direction of plasma flow inside the magnetosheath agree well with gas-dynamic models. About 8% of the ISEE-3-normalized velocity vectors and 3% of the WIND-normalized velocity vectors exhibit a poleward circulation in the YZ plane. The observed circulation is consistent with predictions for flow within the plasma mantle. The occurrence frequency of these poleward flows increases further down the tail, consistent with predictions that the mantle width increases tailward. Densities are lower where this flow is observed, consistent with expectations for the plasma mantle, but temperatures are higher and the magnetic field magnitudes lower, the opposite of theoretical expectations.

  19. Decreased iodine-123 IMP caudate nucleus uptake in patients with Huntington's disease

    SciTech Connect

    Nagel, J.S.; Johnson, K.A.; Ichise, M.; English, R.J.; Walshe, T.M.; Morris, J.H.; Holman, B.L.


    To determine whether I-123 isopropyl iodoamphetamine (IMP) uptake is reduced in the basal ganglia of patients with Huntington's disease compared with that in aged-matched normal and abnormal control subjects, a caudate ratio was defined that compared the average separation (in pixel units) between the midline and the left and right caudate heads to the width of the brain as measured on transaxial cross-sections of I-123 IMP SPECT brain images. For six patients with Huntington's disease, the average caudate ratio was 29.0% (SD +/- 2.7%), significantly higher than that for 12 normal volunteer subjects (average caudate ratio, 19.1% +/- 3.5%; p less than 0.001) and 13 patients with a variety of other neurologic disorders (average caudate ratio, 19.3 +/- 2.2%; p less than 0.001).

  20. Delta-90 Interplanetary Monitoring Platform-H (IMP-H) flash flight report

    NASA Technical Reports Server (NTRS)


    The Delta-90 launch vehicle and the IMP-H spacecraft were successfully launched from Pad B, Complex 17, Cape Kennedy Air Force Station, Florida, at 2120:00.559 EDT on September 22, 1972. The countdown proceeded smoothly to liftoff with no major difficulties or unscheduled holds. The Delta-90/IMP-H were launched on a pad azimuth of 115 degrees, the vehicle ten rolled to 95 degrees from the north placing the spacecraft in a highly elliptical transfer orbit. Firing the spacecraft kickmotor at 1136 EDT, September 25, 1972, injected the spacecraft into its final desirable near-circular orbit approximately half way between the planet earth and its moon. Vehicle performance of all stages appeared nominal with all sequenced events occurring at the expected times. Data acquisition from all range stations was very good. Damage to the launch pad caused by liftoff was nominal.

  1. Diagnosis of Alzheimer's disease and multiple infarct dementia by tomographic imaging of iodine-123 IMP

    SciTech Connect

    Cohen, M.B.; Graham, L.S.; Lake, R.; Metter, E.J.; Fitten, J.; Kulkarni, M.K.; Sevrin, R.; Yamada, L.; Chang, C.C.; Woodruff, N.


    Tomographic imaging of the brain was performed using a rotating slant hole collimator and (/sup 123/I)N-isopropyl p-iodoamphetamine (IMP) in normal subjects (n = 6) and patients with either Alzheimer's disease (n = 5) or multiple infarct dementia (n = 3). Four blinded observers were asked to make a diagnosis from the images. Normal subjects and patients with multiple infarct dementia were correctly identified. Alzheimer's disease was diagnosed in three of the five patients with this disease. One patient with early Alzheimer's disease was classified as normal by two of the four observers. Another patient with Alzheimer's disease had an asymmetric distribution of IMP and was incorrectly diagnosed as multiple infarct dementia by all four observers. Limited angle tomography of the cerebral distribution of /sup 123/I appears to be a useful technique for the evaluation of demented patients.

  2. Radial evolution of the solar wind from IMP 8 to Voyager 2

    NASA Technical Reports Server (NTRS)

    Richardson, John D.; Paularena, Karolen I.; Lazarus, Alan J.; Belcher, John W.


    Voyager 2 and Interplanetary Monitoring Platform (IMP) 8 data from 1977 through 1994 are presented and compared. Radial velocity and temperature structures remain intact over the distance from 1 to 43 AU, but density structures do not. Temperature and velocity changes are correlated and nearly in phase at 1 AU, but in the outer heliosphere temperature changes lead velocity changes by tens of days. Solar cycle variations are detected by both spacecraft, with minima in flux density and dynamic pressure near solar maxima. Differences between Voyager 2 and IMP 8 observations near the solar minimum in 1986-1987 are attributed to latitudinal gradients in solar wind properties. Solar rotation variations are often present even at 40 AU. The Voyager 2 temperature profile is best fit with a R(exp -0.49 +/- 0.01) decrease, much less steep than an adiabatic profile.

  3. Magnetosheath bursts of predominantly medium nuclei observed with Imp 8 on February 16, 1974

    NASA Technical Reports Server (NTRS)

    Armstrong, T. P.; Krimigis, S. M.; Lepping, R. P.


    This paper presents observations made with detectors aboard Imp 8 of a unique series of charged particle bursts that occurred on February 16, 1974, while the spacecraft was traversing the dawn magnetosheath region. This event was unlike any other observation of Imp 7 and 8 in 5.5 years of operation in orbit. The measurements are most directly interpreted as an intense (6000/(sq cm s sr MeV/nucleon)), highly collimated beam flowing in the antisolar direction composed of medium (carbon, nitrogen, or oxygen) nuclei. Both the degree of collimation in arrival direction and the composition are unique to this event. The event is possibly an important signature of terrestrial O(+) ions escaping from the magnetosphere.

  4. Cross calibration of NOAA GOES solar proton detectors using corrected NASA IMP-8/GME data

    NASA Astrophysics Data System (ADS)

    Sandberg, I.; Jiggens, P.; Heynderickx, D.; Daglis, I. A.


    Solar proton flux measurements onboard Geostationary Operational Environmental Satellites (GOES) are of great importance as they cover several solar cycles, increasingly contributing to the development of long-term solar proton models and to operational purposes such as now-casting and forecasting of space weather. A novel approach for the cross calibration of GOES solar proton detectors is developed using as reference energetic solar proton flux measurements of NASA IMP-8 Goddard Medium Energy Experiment (GME). The spurious behavior in a part of IMP-8/GME measurements is reduced through the derivation of a nonlinear intercalibration function. The effective energy values of GOES solar proton detectors lead to a significant reduction of the uncertainties in spectra and may be used to refine existing scientific results, available models, and data products based on measurements over the last three decades. The methods presented herein are generic and may be used for calibration processes of other data sets as well.

  5. Differential diagnosis of bilateral parietal abnormalities in I-123 IMP SPECT imaging

    SciTech Connect

    Kuwabara, Y.; Ichiya, Y.; Otsuka, M.; Tahara, T.; Fukumura, T.; Gunasekera, R.; Masuda, K. )


    This report discusses the clinical significance of bilateral parietal abnormalities on I-123 IMP SPECT imaging in 158 patients with cerebral disorders. This pattern was seen in 15 out of 21 patients with Alzheimer's disease; it was also seen in 4 out of 5 patients with Parkinson's disease with dementia, in 3 out of 17 patients with vascular dementia, in 1 out of 36 patients with cerebral infarction without dementia, in 1 out of 2 patients with hypoglycemia, and in 1 out of 2 patients with CO intoxication. Detection of bilateral parietal abnormalities is a useful finding in the diagnosis of Alzheimer's disease, but one should keep in mind that other cerebral disorders may also show a similar pattern with I-123 IMP SPECT imaging.

  6. IMS/Satellite Situation Center report: Predicted orbit plots for IMP-J-1976

    NASA Technical Reports Server (NTRS)


    Predicted orbit plots for the IMP-J satellite were given for the time period January-December 1976. These plots are shown in three projections. The time period covered by each set of projections is 12 days and 6 hours, corresponding approximately to the period of IMP-J. The three coordinate systems used are the Geocentric Solar Ecliptic system (GSE), the Geocentric Solar Magnetospheric system (GSM), and the Solar Magnetic system (SM). For each of the three projections, time ticks and codes are given on the satellite trajectories. The codes are interpreted in the table at the base of each plot. Time is given in the table as year/day/decimal hour, and the total time covered by each plot is shown at the bottom of each table.

  7. IMP-1 and a Novel Metallo-β-Lactamase, VIM-6, in Fluorescent Pseudomonads Isolated in Singapore

    PubMed Central

    Koh, Tse Hsien; Wang, Grace Chee Yeng; Sng, Li-Hwei


    Four carbapenem-resistant Pseudomonas spp. were isolated from patients in Singapore. One Pseudomonas putida isolate contained a blaIMP-1 identical to that first described in Japan. The sequence of a variant blaIMP-1 in Pseudomonas fluorescens contained four silent mutations compared with the original sequence. The remaining P. putida isolates contained blaVIM-6, a novel VIM gene variant. PMID:15155248

  8. Portosystemic shunting in portal hypertension: evaluation with portal scintigraphy with transrectally administered I-123 IMP

    SciTech Connect

    Kashiwagi, T.; Azuma, M.; Ikawa, T.; Takehara, T.; Matsuda, H.; Yoshioka, H.; Mitsutani, N.; Koizumi, T.; Kimura, K.


    Portosystemic shunting was evaluated with rectal administration of iodine-123 iodoamphetamine (IMP) in seven patients without liver disease and 53 patients with liver cirrhosis. IMP (2-3 mCi (74-111 MBq)) was administered to the rectum through a catheter. Images of the chest and abdomen were obtained for up to 60 minutes with a scintillation camera interfaced with a computer. In all patients, images of the liver and/or lungs were observed within 5-10 minutes and became clear with time. In patients without liver disease, only liver images could be obtained, whereas the lung was visualized with or without the liver in all patients with liver cirrhosis. The portosystemic shunt index was calculated by dividing counts of lungs by counts of liver and lung. These values were significantly higher in liver cirrhosis, especially in the decompensated stage. Transrectal portal scintigraphy with IMP appears to be a useful method for noninvasive and quantitative evaluation of portosystemic shunting in portal hypertension.

  9. Template properties of oligocytidylates formed in the montmorillonite catalyzed condensation of ImpC. [Abstract only

    NASA Technical Reports Server (NTRS)

    Ferris, James P.; Ertem, Goezen


    In an attempt to investigate the prebiotic formation of phosphodiester bond in RNA, we have studied the self condensation of 5'-phosphorimidazolide of adenosine (ImpA), in aqueous solutions containing 0.2 M sodium chloride and 0.075 M magnesium chloride at pH 8 using clay minerals as catalyst. In the presence of certain montmorillonites, oligomers containing up to ten monomer units in their chain were formed, while in control experiments, where no catalyst was added, the major product was 5',5'-diadenosine diphosphate, A(sup 5')ppA. In reactions carried out with ImpA: A(sup 5')ppA mixtures at 9:1 mole ratio, oligomers of the type A(sup 5')p(pA)(sub n) and (A(sup 5')p)(sub n)A(sup 5')ppA(pA)(sub n) formed at the expense of (pA)(sub n) type oligomers. Addition of A(sup 5')ppA to the reaction mixture increased the regiospecifity of 3',5'-link formation from 67% to 79%. The condensation of the 5'-phosphorimidazolide of cytidine, ImpC, was also carried out in the presence and absence of A(sup 5')ppA under the same conditions and oligomers containing up to twelve monomer units were obtained.

  10. A novel cofactor-binding mode in bacterial IMP dehydrogenases explains inhibitor selectivity


    Makowska-Grzyska, Magdalena; Kim, Youngchang; Maltseva, Natalia; ...


    The steadily rising frequency of emerging diseases and antibiotic resistance creates an urgent need for new drugs and targets. Inosine 5'-monophosphate dehydrogenase (IMP dehydrogenase or IMPDH) is a promising target for the development of new antimicrobial agents. IMPDH catalyzes the oxidation of IMP to XMP with the concomitant reduction of NAD+, which is the pivotal step in the biosynthesis of guanine nucleotides. Potent inhibitors of bacterial IMPDHs have been identified that bind in a structurally distinct pocket that is absent in eukaryotic IMPDHs. The physiological role of this pocket was not understood. Here, we report the structures of complexes withmore » different classes of inhibitors of Bacillus anthracis, Campylobacter jejuni, and Clostridium perfringens IMPDHs. These structures in combination with inhibition studies provide important insights into the interactions that modulate selectivity and potency. We also present two structures of the Vibrio cholerae IMPDH in complex with IMP/NAD+ and XMP/NAD+. In both structures, the cofactor assumes a dramatically different conformation than reported previously for eukaryotic IMPDHs and other dehydrogenases, with the major change observed for the position of the NAD+ adenosine moiety. More importantly, this new NAD+-binding site involves the same pocket that is utilized by the inhibitors. Thus, the bacterial IMPDH-specific NAD+-binding mode helps to rationalize the conformation adopted by several classes of prokaryotic IMPDH inhibitors. As a result, these findings offer a potential strategy for further ligand optimization.« less

  11. Solar wind plasma periodicities observed at 1 AU by IMP 8

    NASA Technical Reports Server (NTRS)

    Paularena, K. I.; Szabo, A.; Lazarus, A. J.


    The IMP 8 spacecraft has been in Earth orbit since 1973, gathering plasma data over one complete 22-year solar cycle. These data are being examined to look for periodicities at time scales ranging from several hours to the entire span of the data set. A 1.3-year periodicity in the radial speed observed by IMP 8 and Voyager 2 has already been reported for the years from 1987 to 1993. The periodogram method, useful for unevenly sampled data such as the IMP 8 plasma data, has been used to search for other periods. It is interesting to note that the 13-year period is not present in the out-of-the-ecliptic component of the velocity (Vz), although a 1-year period is very obvious both visually and on the periodogram. Both components show a very strong peak associated with the 11-year solar cycle variation. This work will be extended to the thermal speed (a measure of the wind's temperature) and density, although the frequent correlations between these parameters and the velocity are expected to cause similar results. Additionally, the fine resolution data will be examined for shorter time periods than are visible using the hourly average data which are appropriate for longer periods. A comparison with periods observed at other spacecraft may also be made.

  12. A novel cofactor-binding mode in bacterial IMP dehydrogenases explains inhibitor selectivity.


    Makowska-Grzyska, Magdalena; Kim, Youngchang; Maltseva, Natalia; Osipiuk, Jerzy; Gu, Minyi; Zhang, Minjia; Mandapati, Kavitha; Gollapalli, Deviprasad R; Gorla, Suresh Kumar; Hedstrom, Lizbeth; Joachimiak, Andrzej


    The steadily rising frequency of emerging diseases and antibiotic resistance creates an urgent need for new drugs and targets. Inosine 5'-monophosphate dehydrogenase (IMP dehydrogenase or IMPDH) is a promising target for the development of new antimicrobial agents. IMPDH catalyzes the oxidation of IMP to XMP with the concomitant reduction of NAD(+), which is the pivotal step in the biosynthesis of guanine nucleotides. Potent inhibitors of bacterial IMPDHs have been identified that bind in a structurally distinct pocket that is absent in eukaryotic IMPDHs. The physiological role of this pocket was not understood. Here, we report the structures of complexes with different classes of inhibitors of Bacillus anthracis, Campylobacter jejuni, and Clostridium perfringens IMPDHs. These structures in combination with inhibition studies provide important insights into the interactions that modulate selectivity and potency. We also present two structures of the Vibrio cholerae IMPDH in complex with IMP/NAD(+) and XMP/NAD(+). In both structures, the cofactor assumes a dramatically different conformation than reported previously for eukaryotic IMPDHs and other dehydrogenases, with the major change observed for the position of the NAD(+) adenosine moiety. More importantly, this new NAD(+)-binding site involves the same pocket that is utilized by the inhibitors. Thus, the bacterial IMPDH-specific NAD(+)-binding mode helps to rationalize the conformation adopted by several classes of prokaryotic IMPDH inhibitors. These findings offer a potential strategy for further ligand optimization. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Solar wind plasma periodicities observed at 1 AU by IMP 8

    NASA Technical Reports Server (NTRS)

    Paularena, K. I.; Szabo, A.; Lazarus, A. J.


    The IMP 8 spacecraft has been in Earth orbit since 1973, gathering plasma data over one complete 22-year solar cycle. These data are being examined to look for periodicities at time scales ranging from several hours to the entire span of the data set. A 1.3-year periodicity in the radial speed observed by IMP 8 and Voyager 2 has already been reported for the years from 1987 to 1993. The periodogram method, useful for unevenly sampled data such as the IMP 8 plasma data, has been used to search for other periods. It is interesting to note that the 13-year period is not present in the out-of-the-ecliptic component of the velocity (Vz), although a 1-year period is very obvious both visually and on the periodogram. Both components show a very strong peak associated with the 11-year solar cycle variation. This work will be extended to the thermal speed (a measure of the wind's temperature) and density, although the frequent correlations between these parameters and the velocity are expected to cause similar results. Additionally, the fine resolution data will be examined for shorter time periods than are visible using the hourly average data which are appropriate for longer periods. A comparison with periods observed at other spacecraft may also be made.

  14. Template properties of oligocytidylates formed in the montmorillonite catalyzed condensation of ImpC. [Abstract only

    NASA Technical Reports Server (NTRS)

    Ferris, James P.; Ertem, Goezen


    In an attempt to investigate the prebiotic formation of phosphodiester bond in RNA, we have studied the self condensation of 5'-phosphorimidazolide of adenosine (ImpA), in aqueous solutions containing 0.2 M sodium chloride and 0.075 M magnesium chloride at pH 8 using clay minerals as catalyst. In the presence of certain montmorillonites, oligomers containing up to ten monomer units in their chain were formed, while in control experiments, where no catalyst was added, the major product was 5',5'-diadenosine diphosphate, A(sup 5')ppA. In reactions carried out with ImpA: A(sup 5')ppA mixtures at 9:1 mole ratio, oligomers of the type A(sup 5')p(pA)(sub n) and (A(sup 5')p)(sub n)A(sup 5')ppA(pA)(sub n) formed at the expense of (pA)(sub n) type oligomers. Addition of A(sup 5')ppA to the reaction mixture increased the regiospecifity of 3',5'-link formation from 67% to 79%. The condensation of the 5'-phosphorimidazolide of cytidine, ImpC, was also carried out in the presence and absence of A(sup 5')ppA under the same conditions and oligomers containing up to twelve monomer units were obtained.

  15. A Novel Cofactor-binding Mode in Bacterial IMP Dehydrogenases Explains Inhibitor Selectivity*

    PubMed Central

    Makowska-Grzyska, Magdalena; Kim, Youngchang; Maltseva, Natalia; Osipiuk, Jerzy; Gu, Minyi; Zhang, Minjia; Mandapati, Kavitha; Gollapalli, Deviprasad R.; Gorla, Suresh Kumar; Hedstrom, Lizbeth; Joachimiak, Andrzej


    The steadily rising frequency of emerging diseases and antibiotic resistance creates an urgent need for new drugs and targets. Inosine 5′-monophosphate dehydrogenase (IMP dehydrogenase or IMPDH) is a promising target for the development of new antimicrobial agents. IMPDH catalyzes the oxidation of IMP to XMP with the concomitant reduction of NAD+, which is the pivotal step in the biosynthesis of guanine nucleotides. Potent inhibitors of bacterial IMPDHs have been identified that bind in a structurally distinct pocket that is absent in eukaryotic IMPDHs. The physiological role of this pocket was not understood. Here, we report the structures of complexes with different classes of inhibitors of Bacillus anthracis, Campylobacter jejuni, and Clostridium perfringens IMPDHs. These structures in combination with inhibition studies provide important insights into the interactions that modulate selectivity and potency. We also present two structures of the Vibrio cholerae IMPDH in complex with IMP/NAD+ and XMP/NAD+. In both structures, the cofactor assumes a dramatically different conformation than reported previously for eukaryotic IMPDHs and other dehydrogenases, with the major change observed for the position of the NAD+ adenosine moiety. More importantly, this new NAD+-binding site involves the same pocket that is utilized by the inhibitors. Thus, the bacterial IMPDH-specific NAD+-binding mode helps to rationalize the conformation adopted by several classes of prokaryotic IMPDH inhibitors. These findings offer a potential strategy for further ligand optimization. PMID:25572472

  16. Quantitative I-123-IMP brain SPECT and neuropsychological testing in AIDS dementia

    SciTech Connect

    Kuni, C.C.; Rhame, F.S.; Meier, M.J.; Foehse, M.C.; Loewenson, R.B.; Lee, B.C.; Boudreau, R.J.; duCret, R.P. )


    We performed I-123-IMP SPECT brain imaging on seven mildly demented AIDS patients and seven normal subjects. In an attempt to detect and quantitate regions of decreased I-123-IMP uptake, pixel intensity histograms of normalized SPECT images at the basal ganglia level were analyzed for the fraction of pixels in the lowest quartile of the intensity range. This fraction (F) averaged 17.5% (S.D. = 4.6) in the AIDS group and 12.6% (S.D. = 5.1) in the normal group (p less than .05). Six of the AIDS patients underwent neuropsychological testing (NPT). NPT showed the patients to have a variety of mild abnormalities. Regression analysis of NPT scores versus F yielded a correlation coefficient of .80 (p less than .05). We conclude that analysis of I-123-IMP SPECT image pixel intensity distribution is potentially sensitive in detecting abnormalities associated with AIDS dementia and may correlate with the severity of dementia as measured by NPT.

  17. Insulin-like growth factor II messenger RNA-binding protein-3 is an indicator of malignant phyllodes tumor of the breast.


    Takizawa, Katsumi; Yamamoto, Hidetaka; Taguchi, Kenichi; Ohno, Shinji; Tokunaga, Eriko; Yamashita, Nami; Kubo, Makoto; Nakamura, Masafumi; Oda, Yoshinao


    The aim of this study was to elucidate the clinicopathological and prognostic significance of the expressions of insulin-like growth factor II mRNA-binding protein-3 (IMP3) and epidermal growth factor receptor (EGFR) in phyllodes tumors (PTs). Immunohistochemical staining for IMP3 and EGFR was performed in 130 cases of primary PTs (83 benign, 28 borderline, 19 malignant), 34 recurrent/metastatic PTs, and 26 fibroadenomas (FAs). Among the primary tumors, a high expression of IMP3 was significantly more frequently present in malignant PTs (17/19, 89%) than in the FAs (0/26, 0%), benign PTs (0/83, 0%) and borderline PTs (3/28, 11%). The recurrent and metastatic lesions of malignant PTs also showed high IMP3 expression (3/5 [60%] and 6/6 [100%], respectively). Most malignant PTs showed strong IMP3 expression at the interductal area or more diffusely, whereas weak and focal (low) expression of IMP3 was limited to the periductal area in FAs and benign PTs. EGFR overexpression was significantly correlated with tumor grade and high IMP3 expression. Overexpressions of IMP3 and EGFR were significantly associated with shorter periods of metastasis-free and disease-free survival. The results suggest that high expressions of IMP3 and EGFR with a characteristic staining pattern may be helpful for both identifying malignant PT and predicting the prognosis of these tumors. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Comment on 'Magnetosheath burst of predominantly medium nuclei observed with Imp 8 on February 16, 1974' by T. P. Armstrong, S. M. Krimigis, and R. P. Lepping

    SciTech Connect

    Hovestadt, D.


    Armstrong et al. (1978) report the observation of a unique series of charged particle bursts with an unusually high content of Z>2 particles and a high degree of collimation from the direction of the sun. These bursts were observed only with their CPME (charged particle measurement experiment) instrument on Imp 8, while not with the CPME on Imp 7. No indication has been seen for heavy ion bursts comparable in intensity to those reported by Armstrong et al. (1978) with the ULET (ultralow energy telescope) instrument of the University of Maryland/Max-Planck-Institut experiment on Imp 8 at the same time. It is noted that the ULET counting rates observed on Imp 8 are fully compatible with the CPME rates observed on the Imp 7 spacecraft. We conclude that the CPME and the ULET data from IMP 8 during these periods do not agree, and this casts doubt on the correctness of the CPME results for these special events.

  19. Bloodstream infections caused by IMP-8-producing Enterobacteriaceae isolates: the need for clinical laboratory detection of metallo-β-lactamases?


    Yan, J J; Lee, N Y; Chen, H M; Wang, M C; Ko, W C; Tsai, L H; Wu, J J


    A retrospective study was conducted at a Taiwanese medical center to characterize bloodstream infections caused by IMP-8 metallo-β-lactamase (MBL)-producing Enterobacteriaceae isolates and to assess the need for laboratory detection of IMP producers. We analyzed 37 patients infected with IMP-8 producers (two Escherichia coli, nine Klebsiella pneumoniae, 25 Enterobacter cloacae, and one Citrobacter freundii) and 107 patients infected with non-IMP-8 producers (eight E. coli, 26 K. pneumoniae, 70 E. cloacae, and three C. freundii) that were interpreted as carbapenem-nonsusceptible based on the updated Clinical and Laboratory Standards Institute (CLSI) 2010 guidelines. Only 18 (48.6 %) of the IMP-8 producers were regarded as potential carbapenemase producers based on the CLSI 2012 guidelines. The production of extended-spectrum β-lactamases (ESBLs) was more common in the MBL group (73.0 %) than in the non-MBL group (41.1 %). There were no significant differences in carbapenem susceptibilities, clinical characteristics, carbapenem use for empirical and definitive treatment, and mortality rates between the two groups. Eighteen IMP-8 producers could be deemed as resistant to all carbapenems [minimum inhibitory concentration (MIC) of any carbapenem ≥2 μg/mL]; patients with these isolates had a lower, but non-significant, 28-day mortality rate (27.8 %) than patients infected with non-MBL producers having similar carbapenem MICs (39.0 %) (p = 0.41). A multivariate analysis revealed severity of acute illness as the single independent variable associated with both 7-day and 28-day mortality rates (p < 0.01) for infections caused by Enterobacteriaceae with decreased carbapenem susceptibilities. Our findings suggest that the clinical detection of IMP-producing Enterobacteriaceae is not required even when the "old" CLSI criteria are used.

  20. Dissemination of genetically related IMP-6-producing multidrug-resistant Pseudomonas aeruginosa ST235 in South Korea.


    Yoo, Jung Sik; Yang, Ji Woo; Kim, Hye Mee; Byeon, Jeongheum; Kim, Hwa Su; Yoo, Jae Il; Chung, Gyung Tae; Lee, Yeong Seon


    The present study aimed to describe the prevalence and molecular epidemiology of metallo-β-lactamase (MBL)-producing Pseudomonas aeruginosa isolates obtained from non-tertiary care hospitals and geriatric hospitals in South Korea. Of the 644 isolates, 224 were carbapenem-resistant, amongst which 41 (18.3%) were MBL-producers and the major MBL type was IMP-6 (35 isolates). IMP-6-producing isolates were multidrug-resistant and showed higher minimum inhibitory concentrations for meropenem than imipenem. All of the IMP-6-producing isolates had class 1 integrons with amplification sizes of 4.5 kb/5.5 kb (34 isolates) or 3.0 kb (1 isolate); 4.5 kb/5.5 kb integrons had bla(IMP-6)-qac-aacA4-bla(OXA-1)-aadA1 (5.5 kb) and aadB-cmlA-bla(OXA-10)-aadA1 (4.5 kb). Pulsed-field gel electrophoresis (PFGE) analysis indicated that all IMP-6-producing P. aeruginosa from various geographic areas had nearly identical patterns with >85% similarity. All IMP-6-producing isolates showed high genetic similarity to those obtained from tertiary care hospitals and had the same integron type, indicating the spread of these strains to the three types of hospitals nationwide. These data show the wide spreading of clonally related IMP-6-producing P. aeruginosa (sequence type 235) through tertiary, non-tertiary and geriatric hospitals in South Korea. Continuous monitoring and thorough infection control should be performed in all types of hospitals to prevent further spreading of MBL-producing P. aeruginosa. Copyright © 2012 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  1. Genetic context and biochemical characterization of the IMP-18 metallo-beta-lactamase identified in a Pseudomonas aeruginosa isolate from the United States.


    Borgianni, Luisa; Prandi, Silvia; Salden, Laurie; Santella, Gisela; Hanson, Nancy D; Rossolini, Gian Maria; Docquier, Jean-Denis


    The production of metallo-β-lactamase (MBL) is an important mechanism of resistance to β-lactam antibiotics, including carbapenems. Despite the discovery and emergence of many acquired metallo-β-lactamases, IMP-type determinants (now counting at least 27 variants) remain the most prevalent in some geographical areas. In Asian countries, and notably Japan, IMP-1 and its closely related variants are most widespread. Some other variants have been detected in other countries and show either an endemic (e.g., IMP-13 in Italy) or sporadic (e.g., IMP-12 in Italy or IMP-18 in the United States) occurrence. The IMP-18-producing Pseudomonas aeruginosa strain PS 297 from the southwestern United States carried at least two class 1 integrons. One was identical to In51, while the other, named In133 and carrying the bla(IMP-18) gene cassette in the third position, showed an original array of five gene cassettes, including aacA7, qacF, aadA1, and an unknown open reading frame (ORF). Interestingly. In133 differed significantly from In96, the bla(IMP-18)-carrying integron identified in a P. aeruginosa isolate from Mexico. The meropenem and ertapenem MIC values were much lower for Escherichia coli strains producing IMP-18 (0.06 and 0.12 μg/ml, respectively) than for strains producing IMP-1 (2 μg/ml for each). Kinetic data obtained with the purified enzyme revealed lower turnover rates of IMP-18 than of other IMP-type enzymes with most substrates.

  2. Detergents in Membrane Protein Purification and Crystallisation.


    Anandan, Anandhi; Vrielink, Alice


    Detergents play a significant role in structural and functional characterisation of integral membrane proteins (IMPs). IMPs reside in the biological membranes and exhibit a great variation in their structural and physical properties. For in vitro biophysical studies, structural and functional analyses, IMPs need to be extracted from the membrane lipid bilayer environment in which they are found and purified to homogeneity while maintaining a folded and functionally active state. Detergents are capable of successfully solubilising and extracting the IMPs from the membrane bilayers. A number of detergents with varying structure and physicochemical properties are commercially available and can be applied for this purpose. Nevertheless, it is important to choose a detergent that is not only able to extract the membrane protein but also provide an optimal environment while retaining the correct structural and physical properties of the protein molecule. Choosing the best detergent for this task can be made possible by understanding the physical and chemical properties of the different detergents and their interaction with the IMPs. In addition, understanding the mechanism of membrane solubilisation and protein extraction along with crystallisation requirements, if crystallographic studies are going to be undertaken, can help in choosing the best detergent for the purpose. This chapter aims to present the fundamental properties of detergents and highlight information relevant to IMP crystallisation. The first section of the chapter reviews the physicochemical properties of detergents and parameters essential for predicting their behaviour in solution. The second section covers the interaction of detergents with the biologic membranes and proteins followed by their role in membrane protein crystallisation. The last section will briefly cover the types of detergent and their properties focusing on custom designed detergents for membrane protein studies.

  3. An Eimeria vaccine candidate based on Eimeria tenella immune mapped protein 1 and the TLR-5 agonist Salmonella typhimurium FliC flagellin.


    Yin, Guangwen; Qin, Mei; Liu, Xianyong; Suo, Jingxia; Tang, Xinming; Tao, Geru; Han, Qian; Suo, Xun; Wu, Wenxue


    Immune mapped protein-1 (IMP1) is a new protective protein in apicomplexan parasites, and exits in Eimeria tenella. But its structure and immunogenicity in E. tenella are still unknown. In this study, IMPI in E. tenella was predicted to be a membrane protein. To evaluate immunogenicity of IMPI in E. tenella, a chimeric subunit vaccine consisting of E. tenella IMP1 (EtIMP1) and a molecular adjuvant (a truncated flagellin, FliC) was constructed and over-expressed in Escherichia coli and its efficacy against E. tenella infection was evaluated. Three-week-old AA broiler chickens were vaccinated with the recombinant EtIMP1-truncated FliC without adjuvant or EtIMP1 with Freund's Complete Adjuvant. Immunization of chickens with the recombinant EtIMP1-truncated FliC fusion protein resulted in stronger cellular immune responses than immunization with only recombinant EtIMP1 with adjuvant. The clinical effect of the EtIMP1-truncated FliC without adjuvant was also greater than that of the EtIMP1 with adjuvant, which was evidenced by the differences between the two groups in body weight gain, oocyst output and caecal lesions of E. tenella-challenged chickens. The results suggested that the EtIMP1-flagellin fusion protein can be used as an effective immunogen in the development of subunit vaccines against Eimeria infection. This is the first demonstration of antigen-specific protective immunity against avian coccidiosis using a recombinant flagellin as an apicomplexan parasite vaccine adjuvant in chickens.

  4. Structure of human IFIT1 with capped RNA reveals adaptable mRNA binding and mechanisms for sensing N1 and N2 ribose 2′-O methylations

    PubMed Central

    Laudenbach, Beatrice Theres; Martínez-Montero, Saúl; Cencic, Regina; Habjan, Matthias; Pichlmair, Andreas; Damha, Masad J.; Pelletier, Jerry; Nagar, Bhushan


    IFIT1 (IFN-induced protein with tetratricopeptide repeats-1) is an effector of the host innate immune antiviral response that prevents propagation of virus infection by selectively inhibiting translation of viral mRNA. It relies on its ability to compete with the translation initiation factor eIF4F to specifically recognize foreign capped mRNAs, while remaining inactive against host mRNAs marked by ribose 2′-O methylation at the first cap-proximal nucleotide (N1). We report here several crystal structures of RNA-bound human IFIT1, including a 1.6-Å complex with capped RNA. IFIT1 forms a water-filled, positively charged RNA-binding tunnel with a separate hydrophobic extension that unexpectedly engages the cap in multiple conformations (syn and anti) giving rise to a relatively plastic and nonspecific mode of binding, in stark contrast to eIF4E. Cap-proximal nucleotides encircled by the tunnel provide affinity to compete with eIF4F while allowing IFIT1 to select against N1 methylated mRNA. Gel-shift binding assays confirm that N1 methylation interferes with IFIT1 binding, but in an RNA-dependent manner, whereas translation assays reveal that N1 methylation alone is not sufficient to prevent mRNA recognition at high IFIT1 concentrations. Structural and functional analysis show that 2′-O methylation at N2, another abundant mRNA modification, is also detrimental for RNA binding, thus revealing a potentially synergistic role for it in self- versus nonself-mRNA discernment. Finally, structure-guided mutational analysis confirms the importance of RNA binding for IFIT1 restriction of a human coronavirus mutant lacking viral N1 methylation. Our structural and biochemical analysis sheds new light on the molecular basis for IFIT1 translational inhibition of capped viral RNA. PMID:28251928

  5. Comment on 'magnetosheath burst of predominantly medium nuclei observed with Imp 8 on February 16, 1974' by T. P. Armstrong, S. M. Krimigis, and R. P. Lepping

    NASA Technical Reports Server (NTRS)

    Hovestadt, D.


    Armstrong et al. (1978) have observed a unique series of bursts with an unusually high content of Z greater than 2 particles and a high degree of collimation from the direction of the sun. The bursts were observed only with the CPME (Charged Particle Measurement Instrument) on Imp 8, but not with the CPME on Imp 7 nor with the ULET (Ultralow Energy Telescope) on Imp 8, whose response characteristics matched those of the CPME on Imp 7. The present comparison of the measurements made with the CPME and ULET cast doubt on the correctness of the reported observations.

  6. A novel cofactor-binding mode in bacterial IMP dehydrogenases explains inhibitor selectivity

    SciTech Connect

    Makowska-Grzyska, Magdalena; Kim, Youngchang; Maltseva, Natalia; Osipiuk, Jerzy; Gu, Minyi; Zhang, Minjia; Mandapati, Kavitha; Gollapalli, Deviprasad R.; Gorla, Suresh Kumar; Hedstrom, Lizbeth; Joachimiak, Andrzej


    The steadily rising frequency of emerging diseases and antibiotic resistance creates an urgent need for new drugs and targets. Inosine 5'-monophosphate dehydrogenase (IMP dehydrogenase or IMPDH) is a promising target for the development of new antimicrobial agents. IMPDH catalyzes the oxidation of IMP to XMP with the concomitant reduction of NAD+, which is the pivotal step in the biosynthesis of guanine nucleotides. Potent inhibitors of bacterial IMPDHs have been identified that bind in a structurally distinct pocket that is absent in eukaryotic IMPDHs. The physiological role of this pocket was not understood. Here, we report the structures of complexes with different classes of inhibitors of Bacillus anthracis, Campylobacter jejuni, and Clostridium perfringens IMPDHs. These structures in combination with inhibition studies provide important insights into the interactions that modulate selectivity and potency. We also present two structures of the Vibrio cholerae IMPDH in complex with IMP/NAD+ and XMP/NAD+. In both structures, the cofactor assumes a dramatically different conformation than reported previously for eukaryotic IMPDHs and other dehydrogenases, with the major change observed for the position of the NAD+ adenosine moiety. More importantly, this new NAD+-binding site involves the same pocket that is utilized by the inhibitors. Thus, the bacterial IMPDH-specific NAD+-binding mode helps to rationalize the conformation adopted by several classes of prokaryotic IMPDH inhibitors. As a result, these findings offer a potential strategy for further ligand optimization.

  7. Genetic polymorphisms of the AMPD1 gene and their correlations with IMP contents in Fast Partridge and Lingshan chickens.


    Hu, Jin; Yu, Ping; Ding, Xiaoling; Xu, Minglong; Guo, Baoping; Xu, Yinxue


    The object of this study was to evaluate associations between the adenosine monophosphate deaminase 1 (AMPD1) gene polymorphisms and inosine monophosphate acid (IMP) contents of chicken to provide a molecular marker for breeding. Three single nucleotide polymorphisms (SNPs), g.4064G/A, g.5573A/G and g.6805G/A were detected in exons IV, VI, and VIII of the AMPD1 gene in Fast Partridge and Lingshan chickens, respectively. All were purine conversion and caused no alteration in amino acid sequence. Statistical analysis revealed that Lingshan chicken with the homozygous genotype AA at position 4064 and 6805 had a significantly greater IMP content than those with the GG genotype (P<0.05). Fast Partridge chicken with the genotype GG at position 6805 had a significantly greater IMP content compared with those with the AA genotype (P<0.05). In conclusion, the polymorphism at g.6805A/G was correlated with IMP content (P<0.05) in both Fast Partridge and Lingshan chickens. The results in our study suggest that SNP 6805A/G can be used as a possible candidate marker of IMP content of chicken.

  8. IMP improves water-holding capacity, physical and sensory properties of heat-induced gels from porcine meat.


    Nakamura, Yukinobu; Migita, Koshiro; Okitani, Akihiro; Matsuishi, Masanori


    Water-holding capacity (WHC) of heat-induced pork gels was examined. The heat-induced gels were obtained from meat homogenates prepared by adding nine volumes of 0.3-0.5 mol/L NaCl solutions containing 9-36 mmol/L disodium inosine-5'-monophosphate (IMP) or 9 mmol/L tetrapotassium pyrophosphate (KPP) to minced pork. IMP at 36 mmol/L enhanced the WHC to the same level as attained by KPP. Physical and sensory properties of heat-induced gels were also examined. The heat-induced gels were prepared from porcine meat homogenates containing 0.3 mol/L NaCl and 9-36 mmol/L IMP or 9 mmol/L KPP. IMP at 36 mmol/L enhanced the values of hardness, cohesiveness, gumminess and springiness, measured with a Tensipresser, and several organoleptic scores to the same level as the score attained by KPP. Thus, it is concluded that IMP is expected to be a practical substitute for pyrophosphates to improve the quality of sausages. © 2014 Japanese Society of Animal Science.

  9. Characterization of a novel Klebsiella pneumoniae sequence type 476 carrying both bla KPC-2 and bla IMP-4.


    Wang, Y; Cao, W; Zhu, X; Chen, Z; Li, L; Zhang, B; Wang, B; Tian, L; Wang, F; Liu, C; Sun, Z


    Carbapenemase-producing Klebsiella pneumoniae has recently spread rapidly throughout China. In this study, we characterized a carbapenem-resistant K. pneumoniae isolate that produced both KPC-2 and IMP-4 type carbapenemases. A clinical isolate of K. pneumoniae, resistant to both meropenem and imipenem, was recovered from a urine sample. Antibiotic susceptibility was determined using the broth microdilution method and Etest (bioMérieux, France). Pulsed-field gel electrophoresis and multilocus sequence typing (MLST) were used for gene type analysis. bla (KPC) and the encoding genes of ESBLs and plasmid-mediated AmpC enzymes were polymerase chain reaction (PCR) amplified and sequenced. Plasmids were analyzed by transformation, enzyme restriction and Southern blot. PCR analysis revealed that the isolate was simultaneously carrying bla (KPC-2), bla (IMP-4), bla (TEM-1), and bla (OKP-B) genes. MLST assigned the isolate to a novel sequence type, ST476. bla (KPC-2)-harbouring plasmids of the isolate and comparative strains had similar EcoRI and HindIII restriction maps, while IMP-4-harbouring plasmids had variable HindIII restriction maps. Coexistence of bla (KPC-2) and bla (IMP-4) was probably due to bla (IMP-4)-harbouring plasmid transmission into KPC-2-producing K. pneumoniae (ST476). The concomitant presence of these genes is alarming and poses both therapeutic and infection control problems.

  10. Recent Results of Nuclear Mass Measurements at Storage Ring in IMP

    NASA Astrophysics Data System (ADS)

    Xu, H. S.; Zhang, Y. H.


    Recent commissioning of the Cooler Storage Ring at the Heavy Ion Research Facility in Lanzhou (HIRFL-CSR) has allowed us for direct mass measurements at the Institute of Modern Physics in Lanzhou (IMP), Chinese Academy of Sciences. A series of isochronous mass measurements have been carried out in the past few years using 78Kr, 86Kr, 58Ni, and 112Sn beams. The main results and the present status are presented in this talk, and the implications of these results with respect to nuclear structures and nucleosynthesis in the rp-process of x-ray bursts are discussed.

  11. Reduction and analysis of data from experiment CAI on the IMP-8 mission

    NASA Technical Reports Server (NTRS)

    Stone, E. C.; Mewaldt, R. A.


    The Caltech Electron/Isotope Spectrometer (EIS) on the Interplanetary Monitoring Platform 8 (IMP-8) has provided precise measurements of the energy spectra and time variations of low energy electrons (0.16 to 6 MeV), the isotopes of hydrogen and helium (approximately 2 to 40 MeV/nucleon), and the elements from lithium through oxygen (approximately 5 to 50 MeV/nucleon) in energetic particle fluxes of solar, galactic, interplanetary, and magnetospheric origin since 1973. The accomplishments that have resulted from EIS measurements during the period March 24, 1980 to December 31, 1984 are summarized.

  12. Description of IMP-31, a novel metallo-β-lactamase found in an ST235 Pseudomonas aeruginosa strain in Western Germany.


    Pfennigwerth, Niels; Geis, Gabriele; Gatermann, Sören G; Kaase, Martin


    The objective of this study was to characterize a novel IMP-type metallo-β-lactamase (MBL) found in an MDR clinical isolate of Pseudomonas aeruginosa. The P. aeruginosa isolate NRZ-00156 was recovered from an inguinal swab from a patient hospitalized in Western Germany and showed high MICs of carbapenems. MBL production was analysed by Etest for MBLs, an EDTA combined disc test and an EDTA bioassay. Typing of the isolate was performed by MLST. Genetic characterization of the new blaIMP gene was performed by sequencing the PCR products. A phylogenetic tree was constructed. The novel blaIMP gene was expressed in Escherichia coli TOP10 and the enzyme was subjected to biochemical characterization. The P. aeruginosa isolate NRZ-00156 expressed the ST235 allelic profile and was resistant to all the β-lactams tested except aztreonam. The isolate was positive for MBL production and harboured a new IMP allele, blaIMP-31, located on a disrupted class I integron [also carrying the blaOXA-35, aac(6')-Ib, aac(3)-Ic and aphA15 genes]. Its closest relative was IMP-35, with 96.7% amino acid identity. Expression of blaIMP-31 demonstrated that E. coli TOP10 producing IMP-31 had elevated resistance to all the β-lactams tested except aztreonam. Kinetic data were obtained for both IMP-31 and IMP-1. In comparison with IMP-1, IMP-31 showed weaker hydrolytic activity against all the β-lactams tested, which resulted from lower kcat values. The characterization of the new IMP-type gene blaIMP-31 from an ST235 P. aeruginosa isolate indicates an ongoing spread of highly divergent IMP-type carbapenemases in clinical P. aeruginosa strains and highlights the continuous need for the prevention of nosocomial infections caused by MDR Gram-negative bacteria. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail:

  13. Molecular and epidemiological characterization of IMP-type metallo-β-lactamase-producing Enterobacter cloacae in a Large tertiary care hospital in Japan.


    Hayakawa, Kayoko; Miyoshi-Akiyama, Tohru; Kirikae, Teruo; Nagamatsu, Maki; Shimada, Kayo; Mezaki, Kazuhisa; Sugiki, Yuko; Kuroda, Emi; Kubota, Shiho; Takeshita, Nozomi; Kutsuna, Satoshi; Tojo, Masayoshi; Ohmagari, Norio


    IMP-type metallo-β-lactamase enzymes have been reported in different geographical areas and in various Gram-negative bacteria. However, the risk factors and epidemiology pertaining to IMP-type metallo-β-lactamase-producing Enterobacter cloacae (IMP-producing E. cloacae) have not been systematically evaluated. We conducted a retrospective, matched case-control study of patients from whom IMP-producing E. cloacae isolates were obtained, in addition to performing thorough molecular analyses of the clinically obtained IMP-producing E. cloacae isolates. Unique cases with IMP-producing E. cloacae isolation were included. Patients with IMP-producing E. cloacae were matched to uninfected controls at a ratio of 1 to 3. Fifteen IMP-producing E. cloacae cases were identified, with five of the isolates being obtained from blood, and they were matched to 45 uninfected controls. All (100%) patients from whom IMP-producing E. cloacae isolates were obtained had indwelling devices at the time of isolation, compared with one (2.2%) uninfected control. Independent predictors for isolation of IMP-producing E. cloacae were identified as cephalosporin exposure and invasive procedures within 3 months. Although in-hospital mortality rates were similar between cases and controls (14.3% versus 13.3%), the in-hospital mortality of patients with IMP-producing E. cloacae-caused bacteremia was significantly higher (40%) than the rate in controls. IMP-producing E. cloacae isolates were frequently positive for other resistance determinants. The MICs of meropenem and imipenem were not elevated; 10 (67%) and 12 (80%) of the 15 IMP-producing E. cloacae isolates had a MIC of ≤ 1 μg/ml. A phylogenetic tree showed a close relationship among the IMP-producing E. cloacae samples. Indwelling devices, exposure to cephalosporin, and a history of invasive procedures were associated with isolation of IMP-producing E. cloacae. Screening for carbapenemase production is important in order to apply

  14. Molecular and Epidemiological Characterization of IMP-Type Metallo-β-Lactamase-Producing Enterobacter cloacae in a Large Tertiary Care Hospital in Japan

    PubMed Central

    Miyoshi-Akiyama, Tohru; Kirikae, Teruo; Nagamatsu, Maki; Shimada, Kayo; Mezaki, Kazuhisa; Sugiki, Yuko; Kuroda, Emi; Kubota, Shiho; Takeshita, Nozomi; Kutsuna, Satoshi; Tojo, Masayoshi; Ohmagari, Norio


    IMP-type metallo-β-lactamase enzymes have been reported in different geographical areas and in various Gram-negative bacteria. However, the risk factors and epidemiology pertaining to IMP-type metallo-β-lactamase-producing Enterobacter cloacae (IMP-producing E. cloacae) have not been systematically evaluated. We conducted a retrospective, matched case-control study of patients from whom IMP-producing E. cloacae isolates were obtained, in addition to performing thorough molecular analyses of the clinically obtained IMP-producing E. cloacae isolates. Unique cases with IMP-producing E. cloacae isolation were included. Patients with IMP-producing E. cloacae were matched to uninfected controls at a ratio of 1 to 3. Fifteen IMP-producing E. cloacae cases were identified, with five of the isolates being obtained from blood, and they were matched to 45 uninfected controls. All (100%) patients from whom IMP-producing E. cloacae isolates were obtained had indwelling devices at the time of isolation, compared with one (2.2%) uninfected control. Independent predictors for isolation of IMP-producing E. cloacae were identified as cephalosporin exposure and invasive procedures within 3 months. Although in-hospital mortality rates were similar between cases and controls (14.3% versus 13.3%), the in-hospital mortality of patients with IMP-producing E. cloacae-caused bacteremia was significantly higher (40%) than the rate in controls. IMP-producing E. cloacae isolates were frequently positive for other resistance determinants. The MICs of meropenem and imipenem were not elevated; 10 (67%) and 12 (80%) of the 15 IMP-producing E. cloacae isolates had a MIC of ≤1 μg/ml. A phylogenetic tree showed a close relationship among the IMP-producing E. cloacae samples. Indwelling devices, exposure to cephalosporin, and a history of invasive procedures were associated with isolation of IMP-producing E. cloacae. Screening for carbapenemase production is important in order to apply

  15. Lessons Learned from the Design, Certification, and Operation of the Space Shuttle Integrated Main Propulsion System (IMPS)

    NASA Technical Reports Server (NTRS)

    Martinez, Hugo E.; Albright, John D.; D'Amico, Stephen J.; Brewer, John M.; Melcher, John C., IV


    The Space Shuttle Integrated Main Propulsion System (IMPS) consists of the External Tank (ET), Orbiter Main Propulsion System (MPS), and Space Shuttle Main Engines (SSMEs). The IMPS is tasked with the storage, conditioning, distribution, and combustion of cryogenic liquid hydrogen (LH2) and liquid oxygen (LO2) propellants to provide first and second stage thrust for achieving orbital velocity. The design, certification, and operation of the associated IMPS hardware have produced many lessons learned over the course of the Space Shuttle Program (SSP). A subset of these items will be discussed in this paper for consideration when designing, building, and operating future spacecraft propulsion systems. This paper will focus on lessons learned related to Orbiter MPS and is the first of a planned series to address the subject matter.

  16. IMP-1 encoded by a novel Tn402-like class 1 integron in clinical Achromobacter xylosoxidans, China.


    Chen, Zhenhong; Fang, Haihong; Wang, Li; Sun, Fengjun; Wang, Yong; Yin, Zhe; Yang, Huiying; Yang, Wenhui; Wang, Jie; Xia, Peiyuan; Zhou, Dongsheng; Liu, Changting


    Achromobacter xylosoxidans strain A22732 is isolated from a pneumonia patient in China and produces carbapenemases OXA-114e and IMP-1, which are encoded by chromosome and plasmid, respectively, and confer resistance to multiple ß-lactam antibiotics including carbapenems. The blaIMP-1 gene together with aacA7 and orfE is captured by a novel Tn402-like class 1 integron in a conjugative IncP-1ß plasmid. In addition to the intrinsic integron promoter PcW, there is still a blaIMP-1 gene cassette-specific promoter. This is the first report of carbapenemase-encoding IncP-1ß plasmid in clinical bacterial isolate.

  17. IMP-1 encoded by a novel Tn402-like class 1 integron in clinical Achromobacter xylosoxidans, China

    PubMed Central

    Chen, Zhenhong; Fang, Haihong; Wang, Li; Sun, Fengjun; Wang, Yong; Yin, Zhe; Yang, Huiying; Yang, Wenhui; Wang, Jie; Xia, Peiyuan; Zhou, Dongsheng; Liu, Changting


    Achromobacter xylosoxidans strain A22732 is isolated from a pneumonia patient in China and produces carbapenemases OXA-114e and IMP-1, which are encoded by chromosome and plasmid, respectively, and confer resistance to multiple ß-lactam antibiotics including carbapenems. The blaIMP-1 gene together with aacA7 and orfE is captured by a novel Tn402-like class 1 integron in a conjugative IncP-1ß plasmid. In addition to the intrinsic integron promoter PcW, there is still a blaIMP-1 gene cassette-specific promoter. This is the first report of carbapenemase-encoding IncP-1ß plasmid in clinical bacterial isolate. PMID:25428613

  18. Evaporation level of the condensate droplets on a shock wave in the IMP PAN nozzle depending on the inlet conditions

    NASA Astrophysics Data System (ADS)

    Kornet, S.; Badur, J.


    In the present paper we have focused on the phenomena of condensate reevaporation in the shock wave zone. Having observed the finishing of a foggy flow within the shock wave, according to Puzyrewski's observations, we would like to analyse the critical inlet conditions which cause total evaporation of condensate droplets on the shock in the IMP PAN nozzle. In the paper some original mechanistic model of droplet evaporation is involved, numerically implemented and compared with the IMP PAN experiment. The single continuum model of wet steam with a special microstructure growing up during phase transitions was validated on IMP PAN experiment performed for inlet conditions close to the saturation line. The present work includes simulations results of total and partial evaporation liquid phase on the shock wave for different boundary conditions.

  19. Regional cerebral blood flow study with 123I-IMP in patients with degenerative dementia

    SciTech Connect

    Ohnishi, T.; Hoshi, H.; Nagamachi, S.; Jinnouchi, S.; Futami, S.; Watanabe, K.; Mitsuyama, Y. )


    Regional cerebral blood flow was evaluated by single-photon emission CT (SPECT) with 123I-N-isopropyl-p-iodoamphetamine (123I-IMP) in 11 patients with dementia of the Alzheimer type, three patients with progressive dementia and motor neuron disease, and eight healthy control subjects. Regional blood flow measurements in the bilateral frontal, parietal association, and temporal cortices were lower in the Alzheimer dementia patients than in controls. Flow deficits in the parietal association cortex were demonstrated in all patients with Alzheimer-type dementia; these deficits were correlated with the severity of disease. Lateral hemispheric asymmetry was seen in nine of 11 patients with Alzheimer-type dementia. In all three patients with progressive dementia and motor neuron disease, flow deficits were demonstrated in the bilateral frontal and temporal cortices, but no flow deficits were seen in the parietal association cortex. Brain SPECT with 123I-IMP may be useful in the differential diagnosis and evaluation of the severity of degenerative dementia.

  20. Inverse mirror plasma experimental device (IMPED) - a magnetized linear plasma device for wave studies

    NASA Astrophysics Data System (ADS)

    Bose, Sayak; Chattopadhyay, P. K.; Ghosh, J.; Sengupta, S.; Saxena, Y. C.; Pal, R.


    In a quasineutral plasma, electrons undergo collective oscillations, known as plasma oscillations, when perturbed locally. The oscillations propagate due to finite temperature effects. However, the wave can lose the phase coherence between constituting oscillators in an inhomogeneous plasma (phase mixing) because of the dependence of plasma oscillation frequency on plasma density. The longitudinal electric field associated with the wave may be used to accelerate electrons to high energies by exciting large amplitude wave. However when the maximum amplitude of the wave is reached that plasma can sustain, the wave breaks. The phenomena of wave breaking and phase mixing have applications in plasma heating and particle acceleration. For detailed experimental investigation of these phenomena a new device, inverse mirror plasma experimental device (IMPED), has been designed and fabricated. The detailed considerations taken before designing the device, so that different aspects of these phenomena can be studied in a controlled manner, are described. Specifications of different components of the IMPED machine and their flexibility aspects in upgrading, if necessary, are discussed. Initial results meeting the prerequisite condition of the plasma for such study, such as a quiescent, collisionless and uniform plasma, are presented. The machine produces δnnoise/n <= 1%, Luniform ~ 120 cm at argon filling pressure of ~10-4 mbar and axial magnetic field of B = 1090 G.

  1. Investigation of VIM, IMP, NDM-1, KPC AND OXA-48 enzymes in Enterobacteriaceae strains.


    Demir, Yelda; Zer, Yasemin; Karaoglan, Ilkay


    Gram-negative bacteria especially Enterobacteriaceae species have become an increasing etiologic agent of nosocomial infections. The development of resistance to carbapenems have become an increasing problem in the treatment of nosocomial infections. Especially carbapenamases are common for Enterobacteriaceae strains. This study was performed to detect the types of carbapenemases in Enterobacteriaceae strains isolated from various clinical samples. Enterobacteriaceae species were isolated from urine, blood, tracheal aspirates, wound, and other respiratory samples. Susceptibility of isolates to imipenem, meropenem and ertapenem was tested. Carbapenemase genes were studied using HyplexSuperBug ID kit. VIM (1-13), IMP (1-22), NDM-1, KPC(1-10) and OXA-48 genes were investigated. Ninety-five isolates of Enterobacteriaceae spp. were included in the study. Sixty isolates were resistant to imipenem, meropenem and ertapenem and 20 isolates were found resistant to imipenem or ertapenem while 15 were susceptible to all carbapenems. Among the isolates with carbapenem resistance, 57 were positive for one carbapenemase gene and susceptible isolates did not have carbapenemase gene. OXA-48 was found in 49 of the isolates (86%), NDM-1 in 6 (10.5%) isolates, VIM in 2 isolates. IMP and KPC gene loci were not identified. Carbapenemase genes play a crucial role in the development and spread of resistant strains.

  2. An asymmetrical λ-foot of condensing steam flow in the IMP PAN nozzle

    NASA Astrophysics Data System (ADS)

    Kornet, S.; Badur, J.


    In the present paper we have focused on the precise prediction of the spontaneous condensation phenomena in wet steam flow. Novelty of our approach lies on modelling both the moment of initiation of a phase transition, as well as the moment of its reverse progress - called here re-vaporization of the condensate phase. The practical issue is to elaborate of a model of spontaneous condensation/vaporization of water steam flow under low-pressure conditions by using methodology of non-equilibrium thermodynamics [2]. The basic tests including comparison with an experimental data have been performed using the IMP PAN nozzle with the de Laval geometry [1]. Having observed the finishing of a foggy flow within the shock wave, according to Puzyrewski's postulate [1], we would like to analyse the topography of the shock wave pattern in the IMP PAN symmetric nozzle. This phenomenon, independently from a type of compressible fluid, has been observed to be the result of interaction between a normal shock wave and the boundary layer - it has been known as a λ - foot structure [3]. The asymmetry of the shock structure is measured by optical system and visible since the foggy flow can be easily observed. Our paper is a trial towards to an explanation of this problem.

  3. A latest developed all permanent magnet ECRIS for atomic physics research at IMP

    SciTech Connect

    Sun, L.T.; Zhao, H.W.; Zhang, Z.M.; Wang, H.; Ma, B.H.; Li, J.Y.; Zhang, X.Z.; Feng, Y.C.; Guo, X.H.; Li, X.X.; Ma, X.W.; Song, M.T.; Zhan, W.L.


    Electron cyclotron resonance (ECR) ion sources have been used for atomic physics research for a long time. With the development of atomic physics research in the Institute of Modern Physics (IMP), additional high performance experimental facilities are required. A 300 kV high voltage (HV) platform has been under construction since 2003, and an all permanent magnet ECR ion source is supposed to be put on the platform. Lanzhou all permanent magnet ECR ion source No. 2 (LAPECR2) is a latest developed all permanent magnet ECRIS. It is a 900 kg weight and null-set 650 mmx562 mm outer dimension (magnetic body) ion source. The injection magnetic field of the source is 1.28 T and the extraction magnetic field is 1.07 T. This source is designed to be running at 14.5 GHz. The high magnetic field inside the plasma chamber enables the source to give good performances at 14.5 GHz. LAPECR2 source is now under commissioning in IMP. In this article, the typical parameters of the source LAPECR2 are listed, and the typical results of the preliminary commissioning are presented.

  4. Estimation of ¹²³I-IMP arterial blood activity using ¹²³I-IMP acquisition data from the lungs and brain without any blood sampling: validation of its usefulness for quantification of regional cerebral blood flow.


    Abe, Shinji; Kato, Katsuhiko; Takahashi, Yoshitake; Fujita, Naotoshi; Yamashita, Masato; Shinoda, Masaki; Ikeda, Mitsuru; Ohta, Naotoshi; Kajita, Yasukazu; Naganawa, Shinji


    The conventional methods for the estimation of regional cerebral blood flow (rCBF) using ¹²³I-labeled N-isopropyl-p-iodoamphetamine (¹²³I IMP) autoradiography (ARG) require continuous or 1-point arterial blood sampling. Patients who need rCBF quantification benefit from the avoidance of arterial puncture. In this study, we attempted to develop a method without any blood sampling to estimate ¹²³I IMP activity in the arterial blood sample at 10 minutes after injection of ¹²³I IMP (Ca10) for the purpose of rCBF quantification. For the evaluation of validity of this method, the mean of rCBFs in various regions of the brain (mean CBF) calculated by ¹²³I IMP ARG method using the estimated Ca10 was compared with that calculated using the Ca10 directly measured with the actual arterial blood sample. Both groups of the mean CBF values were also compared with those measured by O-15 H₂O PET ARG method. I-123 IMP ARG study was applied to 23 patients, and O-15 H₂O PET ARG was applied to 20 patients of them. Dynamic images of the lungs, time series of static images of the brain, and brain SPECT images were acquired after injection of ¹²³I IMP. Arterial blood sampling was done 10 minutes after injection of ¹²³I IMP. Multiple regression analysis was used to estimate Ca10 using 5 parameters from the lung washout counts, time series of brain static counts, and brain SPECT average counts as the explanatory variables and the Ca10 directly measured with the actual arterial blood sample as the objective variable, and the regression equation was calculated. The regression equation was calculated by multiple regression analysis as follows: Estimated Ca10 = (2.09 × 10⁻² · LW3) - (2.29 × 10⁻⁴ · Cb5) - (9.87 × 10⁻³ · Cbpre-SPECT) + (1.06 · CbSPECTav) + (1.03 × 10⁻² · Cbpost-SPECT) + 165 (counts/s/g), where LW3: lung washout count at 3 minutes after injection, Cb5: brain count at 5 minutes, Cb pre-SPECT: brain count before SPECT, Cb SPECT av

  5. GMP and IMP Are Competitive Inhibitors of CMY-10, an Extended-Spectrum Class C β-Lactamase.


    Na, Jung-Hyun; An, Young Jun; Cha, Sun-Shin


    Nucleotides were effective in inhibiting the class C β-lactamase CMY-10. IMP was the most potent competitive inhibitor, with a Ki value of 16.2 μM. The crystal structure of CMY-10 complexed with GMP or IMP revealed that nucleotides fit into the R2 subsite of the active site with a unique vertical binding mode where the phosphate group at one terminus is deeply bound in the subsite and the base at the other terminus faces the solvent. Copyright © 2017 American Society for Microbiology.

  6. Energetic neutral atoms (E approximately 50 keV) from the ring current - IMP 7/8 and ISEE 1

    NASA Technical Reports Server (NTRS)

    Roelof, E. C.; Mitchell, D. G.; Williams, D. J.


    Energetic neutral atoms (ENA), emitted from the magnetosphere with energies of about 50 keV, have been measured with solid state detectors on the IMP 7/8 and ISEE 1 spacecraft; they are produced when singly charged trapped ions collide with the exosphere neutral hydrogen geocorona and the energetic ions are neutralized by charge exchange. ENA observations during the recovery phase of two moderate geomagnetic storms are analyzed: November 22-23, 1973, from IMP 8 at 33 earth radii and December 17, 1977, from ISEE 1 at 20 earth radii.

  7. Development of an immunochromatographic assay for diagnosing the production of IMP-type metallo-β-lactamases that mediate carbapenem resistance in Pseudomonas.


    Kitao, Tomoe; Miyoshi-Akiyama, Tohru; Tanaka, Masashi; Narahara, Kenji; Shimojima, Masahiro; Kirikae, Teruo


    Rapid and reliable detection of carbapenem-resistant bacteria is an important infection-control measure and a crucial aspect of antimicrobial chemotherapy. IMP-type metallo-β-lactamase (MBL) is an emzyme that mediate carbapenem resistance in bacteria. Here, an immunochromatographic assay was newly developed using novel monoclonal antibodies (mAbs) recognizing IMP-type MBL. Epitope mapping of mAbs and mutational analysis of the epitope region in IMP antigen suggested that the mAbs could react to all known subtypes of IMP-type MBL. Evaluation of the assay using Pseudomonas aeruginosa strains (n=248) showed that the results of the immunochromatographic detection of the IMP-type MBLs were fully consistent with those of the PCR analysis for bla(IMP) genes, showing false positives and negatives. All positive strains were resistant to carbapenem (MIC ≥ 16 μg/ml). The assay also accurately distinguished the production of IMP-type MBLs in Pseudomonas putida, Acinetobacter baumannii, and Alcaligenes xylosoxidans. The detection limit of the assay was 5.7×10(4)cfu per test. Taken together, these data suggest that the developed assay can be used for rapid and reliable diagnosis of the production of IMP-type MBLs in Gram-negative bacteria.

  8. Coproduction of KPC-2 and IMP-10 in Carbapenem-Resistant Serratia marcescens Isolates from an Outbreak in a Brazilian Teaching Hospital

    PubMed Central

    Silva, Kesia Esther; Cayô, Rodrigo; Carvalhaes, Cecilia Godoy; Patussi Correia Sacchi, Flávia; Rodrigues-Costa, Fernanda; Ramos da Silva, Ana Carolina; Croda, Julio; Gales, Ana Cristina


    We describe an outbreak caused by KPC-2- and IMP-10-producing Serratia marcescens isolates in a Brazilian teaching hospital. Tigecycline was the only active antimicrobial agent tested. The blaIMP-10 gene was located in a new class 1 integron, named In990, carried by a nonconjugative plasmid, in contrast to blaKPC-2. PMID:25878341

  9. First detection in Europe of the metallo-β-lactamase IMP-15 in clinical strains of Pseudomonas putida and Pseudomonas aeruginosa.


    Gilarranz, R; Juan, C; Castillo-Vera, J; Chamizo, F J; Artiles, F; Álamo, I; Oliver, A


    In a prospective study (2009-2011) in healthcare institutions from the Canary Islands (Spain), 6 out of 298 carbapenem non-susceptible Pseudomonas aeruginosa isolates produced a metallo-β-lactamase: four IMP-15, two VIM-2 (including one IMP-15-positive isolate) and one VIM-1. Multilocus sequence typing identified the single VIM-1-producing isolate as clone ST111 and two IMP-15-producing isolates as ST606, but, strikingly, bacterial re-identification revealed that the other three isolates (producing IMP-15 and/or VIM-2) were actually Pseudomonas putida. Further retrospective analysis revealed a very high prevalence (close to 50%) of carbapenem resistance in this environmental species. Hence, we report the simultaneous emergence in hospitals on the Canary Islands of P. putida and P. aeruginosa strains producing IMP-15, a metallo-β-lactamase not previously detected in Europe, and suggest an underestimated role of P. putida as a nosocomial reservoir of worrying transferable resistance determinants.

  10. Overexpression of an outer membrane protein associated with decreased susceptibility to carbapenems in Proteus mirabilis.


    Tsai, Yi-Lin; Wang, Min-Cheng; Hsueh, Po-Ren; Liu, Ming-Che; Hu, Rouh-Mei; Wu, Yue-Jin; Liaw, Shwu-Jen


    Proteus mirabilis isolates commonly have decreased susceptibility to imipenem. Previously, we found P. mirabilis hfq mutant was more resistant to imipenem and an outer membrane protein (OMP) could be involved. Therefore, we investigated the role of this OMP in carbapenem susceptibility. By SDS-PAGE we found this OMP (named ImpR) was increased in hfq mutant and LC-MS/MS revealed it to be the homologue of Salmonella YbfM, which is a porin for chitobiose and subject to MicM (a small RNA) regulation. We demonstrated that ImpR overexpression resulted in increased carbapenem MICs in the laboratory strain and clinical isolates. Chitobiose induced expression of chb (a chitobiose utilization operon). Real-time RT-PCR and SDS-PAGE were performed to elucidate the relationship of hfq, impR, chb and MicM in P. mirabilis. We found MicM RNA was decreased in hfq mutant and chbBC-intergenic region (chbBC-IGR) overexpression strain (chbIGRov), while impR mRNA was increased in hfq mutant, micM mutant and chbIGRov strain. In addition, mutation of hfq or micM and overexpression of chbBC-IGR increased ImpR protein level. Accordingly, chitobiose made wild-type have higher levels of ImpR protein and are more resistant to carbapenems. Hfq- and MicM-complemented strains restored wild-type MICs. Mutation of both impR and hfq eliminated the increase in carbapenem MICs observed in hfq mutant and ImpR-complementation of hfq/impR double mutant resulted in MICs as hfq mutant, indicating that the ImpR-dependent decreased carbapenem susceptibility of hfq mutant. These indicate MicM was antisense to impR mRNA and was negatively-regulated by chbBC-IGR. Together, overexpression of ImpR contributed to the decreased carbapenem susceptibility in P. mirabilis.

  11. Elucidation of the assembly events required for the recruitment of Utp20, Imp4 and Bms1 onto nascent pre-ribosomes

    PubMed Central

    Pérez-Fernández, Jorge; Martín-Marcos, Pilar; Dosil, Mercedes


    The 90S pre-ribosome, also known as the small subunit (SSU) processome, is a large multisubunit particle required for the production of the 18S rRNA from a pre-rRNA precursor. Recently, it has been shown that the formation of this particle entails the initial association of the tUTP subunit with the nascent pre-RNA and, subsequently, the binding of Rrp5/UTP-C and U3 snoRNP/UTP-B subunits in two independent assembly branches. However, the mode of assembly of other 90S pre-ribosome components remains obscure as yet. In this study, we have investigated the assembly of three proteins (Utp20, Imp4 and Bms1) previously regarded as potential nucleating factors of the 90S particle. Here, we demonstrate that the loading of those three proteins onto the pre-rRNA takes place independently of Rrp5/UTP-C and, instead, occurs downstream of the tUTP and U3/UTP-B subcomplexes. We also demonstrate that Bms1 and Utp20 are required for the recruitment of a subset of proteins to nascent pre-ribosomes. Finally, we show that proteins associated through secondary steps condition the stability of the two assembly branches in partially assembled pre-ribosomes. These results provide new information about the functional relationships among 90S particle components and the events that are required for their stepwise incorporation onto the primary pre-rRNA. PMID:21724601

  12. Detection of IMP metallo-β-lactamase in carbapenem-nonsusceptible Enterobacteriaceae and non-glucose-fermenting Gram-negative rods by immunochromatography assay.


    Notake, Shigeyuki; Matsuda, Mari; Tamai, Kiyoko; Yanagisawa, Hideji; Hiramatsu, Keiichi; Kikuchi, Ken


    Metallo-β-lactamases (MBLs) are transmissible carbapenemases of increasing prevalence in Gram-negative bacteria among health care facilities worldwide. Control of the further spread of these carbapenem-resistant bacteria relies on clinical microbiological laboratories correctly identifying and classifying the MBLs. In this study, we evaluated a simple and rapid method for detecting IMP, the most prevalent MBL in Japan. We used an immunochromatography (IC) assay for 181 carbapenem-nonsusceptible (CNS) (nonsusceptible to imipenem or meropenem) strains comprising 74 IMP-producing and 33 non-IMP-producing strains of non-glucose-fermenting Gram-negative rods (NFGNR), as well as 64 IMP-producing and 10 non-IMP-producing Enterobacteriaceae strains. The IC assay results were compared to those from the double-disk synergy test (DDST), the MBL Etest, and the modified Hodge test (MHT) (only for Enterobacteriaceae). The IMP type was confirmed by specific PCR and direct sequencing. The IC assay detected all of the IMP-type MBLs, including IMP-1, -2, -6, -7, -10, -11, -19, -20, and -22 and IMP-40, -41, and -42 (new types), with 100% specificity and sensitivity against all strains tested. Although the sensitivity and specificity values for the DDST and MHT were equivalent to those for the IC assay, the MBL Etest was positive for only 87% of NFGNR and 31% of Enterobacteriaceae due to the low MIC of imipenem, causing an indeterminate evaluation. These results indicated that the IC assay might be a useful alternative to PCR for IMP MBL detection screening.

  13. Detection of IMP Metallo-β-Lactamase in Carbapenem-Nonsusceptible Enterobacteriaceae and Non-Glucose-Fermenting Gram-Negative Rods by Immunochromatography Assay

    PubMed Central

    Notake, Shigeyuki; Matsuda, Mari; Tamai, Kiyoko; Yanagisawa, Hideji; Hiramatsu, Keiichi


    Metallo-β-lactamases (MBLs) are transmissible carbapenemases of increasing prevalence in Gram-negative bacteria among health care facilities worldwide. Control of the further spread of these carbapenem-resistant bacteria relies on clinical microbiological laboratories correctly identifying and classifying the MBLs. In this study, we evaluated a simple and rapid method for detecting IMP, the most prevalent MBL in Japan. We used an immunochromatography (IC) assay for 181 carbapenem-nonsusceptible (CNS) (nonsusceptible to imipenem or meropenem) strains comprising 74 IMP-producing and 33 non-IMP-producing strains of non-glucose-fermenting Gram-negative rods (NFGNR), as well as 64 IMP-producing and 10 non-IMP-producing Enterobacteriaceae strains. The IC assay results were compared to those from the double-disk synergy test (DDST), the MBL Etest, and the modified Hodge test (MHT) (only for Enterobacteriaceae). The IMP type was confirmed by specific PCR and direct sequencing. The IC assay detected all of the IMP-type MBLs, including IMP-1, -2, -6, -7, -10, -11, -19, -20, and -22 and IMP-40, -41, and -42 (new types), with 100% specificity and sensitivity against all strains tested. Although the sensitivity and specificity values for the DDST and MHT were equivalent to those for the IC assay, the MBL Etest was positive for only 87% of NFGNR and 31% of Enterobacteriaceae due to the low MIC of imipenem, causing an indeterminate evaluation. These results indicated that the IC assay might be a useful alternative to PCR for IMP MBL detection screening. PMID:23536409

  14. The Twin Peaks in 3-D, as Viewed by the Mars Pathfinder IMP Camera

    NASA Technical Reports Server (NTRS)


    The Twin Peaks are modest-size hills to the southwest of the Mars Pathfinder landing site. They were discovered on the first panoramas taken by the IMP camera on the 4th of July, 1997, and subsequently identified in Viking Orbiter images taken over 20 years ago. The peaks are approximately 30-35 meters (-100 feet) tall. North Twin is approximately 860 meters (2800 feet) from the lander, and South Twin is about a kilometer away (3300 feet). The scene includes bouldery ridges and swales or 'hummocks' of flood debris that range from a few tens of meters away from the lander to the distance of the South Twin Peak. The large rock at the right edge of the scene is nicknamed 'Hippo'. This rock is about a meter (3 feet) across and 25 meters (80 feet) distant.

    This view of the Twin Peaks was produced by combining 4 individual 'Superpan' scenes from the left and right eyes of the IMP camera to cover both peaks. Each frame consists of 8 individual frames (left eye) and 7 frames (right eye) taken with different color filters that were enlarged by 500% and then co-added using Adobe Photoshop to produce, in effect, a super-resolution pancromatic frame that is sharper than an individual frame would be.

    The anaglyph view of the Twin Peaks was produced by combining the left and right eye mosaics (above) by assigning the left eye view to the red color plane and the right eye view to the green and blue color planes (cyan), to produce a stereo anaglyph mosaic. This mosaic can be viewed in 3-D on your computer monitor or in color print form by wearing red-blue 3-D glasses.

    Mars Pathfinder is the second in NASA's Discovery program of low-cost spacecraft with highly focused science goals. The Jet Propulsion Laboratory, Pasadena, CA, developed and manages the Mars Pathfinder mission for NASA's Office of Space Science, Washington, D.C. JPL is a division of the California Institute of Technology (Caltech). The IMP was developed by the University of Arizona Lunar and Planetary

  15. The Twin Peaks in 3-D, as Viewed by the Mars Pathfinder IMP Camera

    NASA Technical Reports Server (NTRS)


    The Twin Peaks are modest-size hills to the southwest of the Mars Pathfinder landing site. They were discovered on the first panoramas taken by the IMP camera on the 4th of July, 1997, and subsequently identified in Viking Orbiter images taken over 20 years ago. The peaks are approximately 30-35 meters (-100 feet) tall. North Twin is approximately 860 meters (2800 feet) from the lander, and South Twin is about a kilometer away (3300 feet). The scene includes bouldery ridges and swales or 'hummocks' of flood debris that range from a few tens of meters away from the lander to the distance of the South Twin Peak. The large rock at the right edge of the scene is nicknamed 'Hippo'. This rock is about a meter (3 feet) across and 25 meters (80 feet) distant.

    This view of the Twin Peaks was produced by combining 4 individual 'Superpan' scenes from the left and right eyes of the IMP camera to cover both peaks. Each frame consists of 8 individual frames (left eye) and 7 frames (right eye) taken with different color filters that were enlarged by 500% and then co-added using Adobe Photoshop to produce, in effect, a super-resolution pancromatic frame that is sharper than an individual frame would be.

    The anaglyph view of the Twin Peaks was produced by combining the left and right eye mosaics (above) by assigning the left eye view to the red color plane and the right eye view to the green and blue color planes (cyan), to produce a stereo anaglyph mosaic. This mosaic can be viewed in 3-D on your computer monitor or in color print form by wearing red-blue 3-D glasses.

    Mars Pathfinder is the second in NASA's Discovery program of low-cost spacecraft with highly focused science goals. The Jet Propulsion Laboratory, Pasadena, CA, developed and manages the Mars Pathfinder mission for NASA's Office of Space Science, Washington, D.C. JPL is a division of the California Institute of Technology (Caltech). The IMP was developed by the University of Arizona Lunar and Planetary

  16. Solar bus regulator and battery charger for IMP's H, I, and J

    NASA Technical Reports Server (NTRS)

    Paulkovich, J.


    Interplanetary Monitoring Probe (IMP) spacecrafts H, I, and J utilize a direct energy transfer (DET) type of power system operating from a solar array source. A shunt type of regulator prevents the bus voltage from exceeding a preset voltage level. The power system utilizes a single differential amplifier with dual outputs to control the battery charge/shunt regulator and the discharge regulator. A two-voltage level, current limited, series charger and a current sensor control battery state of charge of the silver-cadmium battery pack. Premature termination of the battery charge is prevented by a power available gate that also initiates charge current to the battery upon availability of excess power.

  17. Determination of the Ionic Charge States of SEPs Using the University of Chicago IMP-8 Instrument

    NASA Astrophysics Data System (ADS)

    Dietrich, W.

    We use a new method to calculate the mean ionization charge state of solar energetic particles (SEPs) observed with the University of Chicago Cosmic Ray Nuclear Composition experiment on the IMP-8 satellite. The method, using the time to maximum flux, is demonstrated for several gradual SEP events, including the events on 29 September 1989, 19 October 1989, 24 October 1989, and 6 November 1997. Mean ionic charge states are deduced for heavy ions with energies in the range ~10- 500 MeV/nucleon. The ionic charge determination is made only during the onset of the SEP events. These mean charge states agree well with previous measurements for SEP events both at low energy (~0.5-4 MeV/nucleon reported by ISEE-3) and at higher energies (~200-500 MeV/nucleon reported by LDEF). The mean ionic charge states are then used to determine an average temperature and source region for these particles.

  18. IMP-Producing Carbapenem-Resistant Klebsiella pneumoniae in the United States ▿

    PubMed Central

    Limbago, Brandi M.; Rasheed, J. Kamile; Anderson, Karen F.; Zhu, Wenming; Kitchel, Brandon; Watz, Nancy; Munro, Susan; Gans, Hayley; Banaei, Niaz; Kallen, Alex J.


    The emergence and spread of carbapenem-resistant Enterobacteriaceae (CRE) producing acquired carbapenemases have created a global public health crisis. In the United States, CRE producing the Klebsiella pneumoniae carbapenemase (KPC) are increasingly common and are endemic in some regions. Metallo-β-lactamase (MBL)-producing CRE have recently been reported in the United States among patients who received medical care in countries where such organisms are common. Here, we describe three carbapenem-resistant K. pneumoniae isolates recovered from pediatric patients at a single U.S. health care facility, none of whom had a history of international travel. The isolates were resistant to carbapenems but susceptible to aztreonam, trimethoprim-sulfamethoxazole, and fluoroquinolones. The three isolates were closely related to each other by pulsed-field gel electrophoresis and contained a common plasmid. PCR and sequence analysis confirmed that these isolates produce IMP-4, an MBL carbapenemase not previously published as present among Enterobacteriaceae in the United States. PMID:21998425

  19. Formulation procedures, rationale, and preliminary IMP-H flight data for silicone paints with improved stability

    NASA Technical Reports Server (NTRS)

    Schutt, J. B.; Shai, C. M.


    Results are given of a class of silicone paints undergoing space qualification on IMP-H. In addition to ultraviolet irradiation, samples are presently reclining about 10 to the 16th power solar wind protons per year. Preliminary data, covering the time span of the first anniversary, give incremental solar absorptances of 0.03 for two white paints, and 0.01 for leafing aluminum and a green tinted white paint. Complementing these data are complete descriptions of techniques used in making these paints, stabilizing the zinc oxide pigment, and choosing a solvent. Outgassing characteristics of finished coatings are also included. An attempt toward unification of these various aspects of the aerospace paint problem is provided through documented photochemical reactions, and a generalized band representation of the problem and its solutions.

  20. Brain imaging with sup 123 I-IMP-SPECT in migraine between attacks

    SciTech Connect

    Schlake, H.P.; Boettger, I.G.G.; Grotemeyer, K.H.; Husstedt, I.W.


    {sup 123}I-IMP-SPECT brain imaging was performed in patients with classic migraine (n = 5) and migraine accompagnee (n = 18) during the headache-free interval. A regional reduction of tracer uptake into brain was observed in all patients with migraine accompagnee, while in patients with classic migraine only one case showed an area of decreased activity. The most marked alteration was found in a patient with persisting neurological symptoms (complicated migraine). In most cases the areas of decreased tracer uptake corresponded to headache localization as well as to topography of neurologic symptoms during migraine attacks. It may be concluded that migraine attacks occur in connection with exacerbations of preexisting changes of cerebral autoregulation due to endogenous or exogenous factors.

  1. Analysis of IMP-1 type metallo-β-lactamase-producing Acinetobacter radioresistens isolated from companion animals.


    Kimura, Yui; Miyamoto, Tadashi; Aoki, Kotaro; Ishii, Yoshikazu; Harada, Kazuki; Watarai, Masahisa; Hatoya, Shingo


    IMP-1 type metallo-β-lactamase-producing (MBL-producing) Acinetobacter radioresistens was isolated from a dog with cystitis and a cat with conjunctivitis. The MBL-producing A. radioresistens isolates were resistant to all of the β-lactam antibiotics used in the sensitivity tests, but were susceptible to gentamicin, amikacin, and minocycline. Also, one of the two strains of A. radioresistens was susceptible to ciprofloxacin and levofloxacin. These two cases were cured by administration of tetracyclines and fluoroquinolones, which elicited a positive result in the sensitivity tests. This report of the isolation of MBL-producing A. radioresistens in companion animals is the first in the world. To prevent the proliferation of MBL-producing bacteria, veterinary hospitals need to be aware of the behavior of MBL-producing organisms. Copyright © 2017 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  2. The structure of the inner heliosphere from Pioneer Venus and IMP observations

    NASA Technical Reports Server (NTRS)

    Gazis, P. R.; Barnes, A.; Mihalov, J. D.; Lazarus, A. J.


    The IMP 8 and Pioneer Venus Orbiter (PVO) spacecraft explore the region of heliographic latitudes between 8 deg N and 8 deg S. Solar wind observations from these spacecraft are used to construct synoptic maps of solar wind parameters in this region. These maps provide an explicit picture of the structure of high speed streams near 1 AU and how that structure varies with time. From 1982 until early 1985, solar wind parameters varied little with latitude. During the last solar minimum, the solar wind developed strong latitudinal structure; high speed streams were excluded from the vicinity of the solar equator. Synoptic maps of solar wind speed are compared with maps of the coronal source surface magnetic field. This comparison reveals the expected correlation between solar wind speed near 1 AU, the strength of the coronal magnetic field, and distance from the coronal neutral line.

  3. Long-term variations of selected solar wind properties - IMP 6, 7, and 8 results

    NASA Technical Reports Server (NTRS)

    Feldman, W. C.; Asbridge, J. R.; Bame, S. J.; Gosling, J. T.


    Studies of the variability of the solar wind are extended to include the minimum of solar cycle 20; attention is given to the He abundance, the relative He-H velocity difference, the He-H temperature ratio, the solar coronal proton density, speed, rms velocity variation, temperature and number flux, and the kinetic and total energy fluxes. The solar wind data are from observations conducted by the IMP-6, -7 and -8 satellites. A well-developed corotating stream structure appearing in January 1973 and disappearing in mid-1976 receives particular consideration. An increase in proton number and total energy fluxes after September 1972 may be due to areal expansion of both polar coronal holes, and may be associated with compression of the low-speed equatorial disk-shaped region postulated to surround the sun in interplanetary space.

  4. Pioneer Venus and IMP 8 observations of the latitude dependence of the solar wind

    NASA Technical Reports Server (NTRS)

    Gazis, P. R.


    Solar wind speeds and magnetic field data from the Pioneer Venus Orbiter (0.7 AU) and IMP 8 (1 AU) have been compared to infer the latitudinal structure of the solar wind in the inner heliosphere between 1984 and 1987. The solar wind in the inner heliosphere was found to exhibit an unusual structure during the last solar minimum (1986-1987). High-speed streams were excluded from the vicinity of the solar equator, and the solar wind at low heliographic latitudes (less than 3 deg) was characterized by low-speed solar wind with irregular fluctuations in velocity. At higher latitudes the solar wind had a conventional stream structure with two high-speed streams per solar rotation. While the velocities of these high-speed streams did not appear to vary significantly with latitude, the latitudinal gradients at the equatorward boundaries of high-speed streams were high.

  5. IMPS, A Static-Optics Application of Full-Stokes Spectropolarimetry to Search for Extraterrestrial Biosignatures

    NASA Astrophysics Data System (ADS)

    Telesco, C. M.; Sparks, W. B.; Zhao, B.; Varosi, F.; Schofield, S.; Germer, T. A.; Kolokolova, L.; Parenteau, M. N.; Cooper, G.; Grundy, W. M.; Guzmán, R.; Pantin, E.


    Optical spectropolarimetry holds great promise in the search for extraterrestrial life. In particular, the detection of circular polarization can indicate chirality, a signature of biological significance. We describe an on-going effort to implement the full-Stokes (I, Q, U, V), static-optics concept for optical spectropolarimetry described by Sparks et al. [App. Optics, 51, 5495 (2012)]. Our early breadboard embodiments of the concept demonstrate its simplicity and indicate its potential for space missions in which a compact design with no moving parts is crucial to achieve the mission goals. We describe the instrument, called the Integrated Miniature Polarimeter and Spectrograph (IMPS), and consider one example for its deployment: a mission to land on an outer solar system body such as Europa.

  6. In vivo radioactive metabolite analysis for individualized medicine: a basic study of a new method of CYP activity assay using (123)I-IMP.


    Nishi, Kodai; Mizutani, Asuka; Shikano, Naoto; Fujita, Ken-Ichi; Kobayashi, Masato; Ono, Masahiro; Nishii, Ryuichi; Sasaki, Yasutuna; Kinuya, Seigo; Kawai, Keiichi


    (123)I-N-isopropyl-p-iodoamphetamine ((123)I-IMP) is metabolized and converted to (123)I-p-iodoamphetamine ((123)I-PIA) by CYP2C19 in humans. Since variations in (123)I-PIA levels reflect variations in CYP2C19 activity, CYP2C19 activity can be estimated by quantitative analysis of (123)I-PIA levels. Thus, (123)I-IMP administration can provide diagnostic information not only regarding cerebral blood flow (rCBF) but also regarding metabolic function. The aim of the present study was to detect variations in CYP activity in mice using metabolite analysis. Metabolism of (125)I-IMP in pooled homogenates of mouse liver (MLH) was analyzed by high-performance liquid chromatography (HPLC) in the presence or absence of NADPH. The amount of (125)I-PIA generated was calculated as the normalized peak area of the chromatogram. Inhibition of (125)I-IMP metabolism was evaluated using the inhibitor SKF-525A. A biodistribution study of (125)I-IMP was performed to determine the organ distribution of (125)I-IMP/(125)I-IMP metabolites and the effect of SKF-525A. Variations in CYP activity in vivo were detected by administration of (123)I-IMP and/or SKF-525A to mice. The liver and the kidney were then excised, homogenized and analyzed using HPLC. (125)I-IMP was metabolized by MLH in the presence of NADPH, and the production of (125)I-PIA was inhibited by SKF-525A. SKF-525A did not greatly affect the biodistribution of (125)I-IMP/(125)I-IMP metabolites in vivo. Both (123)I-IMP and (123)I-PIA were detected in organs of control mice. However, (123)I-PIA was not detected in the livers or kidneys of mice treated with SKF-525A. CYP activity in vivo was inhibited by SKF-525A treatment. Variations in CYP activity could be detected in the blood, liver and kidney as changes in the peak area of (123)I-PIA. (123)I-IMP metabolite analysis has the potential to provide beneficial information for prediction of the effect of medicines, in addition to its contribution to more accurate rCBF diagnosis that

  7. High prevalence of Salmonella and IMP-4-producing Enterobacteriaceae in the silver gull on Five Islands, Australia

    PubMed Central

    Dolejska, Monika; Masarikova, Martina; Dobiasova, Hana; Jamborova, Ivana; Karpiskova, Renata; Havlicek, Martin; Carlile, Nicholas; Priddel, David; Cizek, Alois; Literak, Ivan


    Objectives The objective of this study was to investigate the silver gull as an indicator of environmental contamination by salmonellae and carbapenemase-producing Enterobacteriaceae (CPE) in south-east Australia. Methods A total of 504 cloacal samples were collected from gull chicks at three nesting colonies in New South Wales, Australia [White Bay (n = 144), Five Islands (n = 200) and Montague Island (n = 160)] and were examined for salmonellae and CPE. Isolates were tested for carbapenemase genes and susceptibility to 14 antibiotics. Clonality was determined by PFGE and MLST. Genetic context and conjugative transfer of the carbapenemase gene were determined. Results A total of 120 CPE of 10 species, mainly Escherichia coli (n = 85), carrying the gene blaIMP-4, blaIMP-38 or blaIMP-26 were obtained from 80 (40%) gulls from Five Islands. Thirty percent of birds from this colony were colonized by salmonellae. Most isolates contained the gene within a class 1 integron showing a blaIMP-4-qacG-aacA4-catB3 array. The blaIMP gene was carried by conjugative plasmids of variable sizes (80–400 kb) and diverse replicons, including HI2-N (n = 30), HI2 (11), A/C (17), A/C-Y (2), L/M (5), I1 (1) and non-typeable (6). Despite the overall high genetic variability, common clones and plasmid types were shared by different birds and bacterial isolates, respectively. Conclusions Our data demonstrate a large-scale transmission of carbapenemase-producing bacteria into wildlife, likely as a result of the feeding habits of the birds at a local waste depot. The isolates from gulls showed significant similarities with clinical isolates from Australia, suggesting the human origin of the isolates. The sources of CPE for gulls on Five Islands should be explored and proper measures applied to stop the transmission into the environment. PMID:26472769

  8. First Report of blaIMP-14 on a Plasmid Harboring Multiple Drug Resistance Genes in Escherichia coli Sequence Type 131.


    Stoesser, Nicole; Sheppard, Anna E; Peirano, Gisele; Sebra, Robert P; Lynch, Tarah; Anson, Luke W; Kasarskis, Andrew; Motyl, Mary R; Crook, Derrick W; Pitout, Johann D


    The blaIMP-14 carbapenem resistance gene has largely previously been observed in Pseudomonas aeruginosa and Acinetobacter spp. As part of global surveillance and sequencing of carbapenem-resistant Escherichia coli, we identified a sequence type 131 strain harboring blaIMP-14 within a class 1 integron, itself nested within an ∼54-kb multidrug resistance region on an epidemic IncA/C2 plasmid. The emergence of blaIMP-14 in this context in the ST131 lineage is of potential clinical concern. Copyright © 2016 Stoesser et al.

  9. First Report of blaIMP-14 on a Plasmid Harboring Multiple Drug Resistance Genes in Escherichia coli Sequence Type 131

    PubMed Central

    Sheppard, Anna E.; Peirano, Gisele; Sebra, Robert P.; Lynch, Tarah; Anson, Luke W.; Kasarskis, Andrew; Motyl, Mary R.; Crook, Derrick W.; Pitout, Johann D.


    The blaIMP-14 carbapenem resistance gene has largely previously been observed in Pseudomonas aeruginosa and Acinetobacter spp. As part of global surveillance and sequencing of carbapenem-resistant Escherichia coli, we identified a sequence type 131 strain harboring blaIMP-14 within a class 1 integron, itself nested within an ∼54-kb multidrug resistance region on an epidemic IncA/C2 plasmid. The emergence of blaIMP-14 in this context in the ST131 lineage is of potential clinical concern. PMID:27246777

  10. Two Novel Class I Integron Arrays Containing IMP-18 Metallo-β-Lactamase Gene in Pseudomonas aeruginosa Clinical Isolates from Puerto Rico

    PubMed Central

    Martínez, T.; Vazquez, G. J.; Aquino, E. E.; Goering, R. V.


    During a β-lactam resistance surveillance study, 12 IMP-18-positive Pseudomonas aeruginosa isolates belonging to 9 different pulsed-field gel electrophoresis groups were identified. In nine isolates, a class I integron with a novel gene array was identified that contained blaIMP-18 and blaOXA-224, while in two isolates the class I integron contained blaIMP-18 and blaOXA-2 but in a new arrangement. Our findings show the dissemination of two novel class I integrons in P. aeruginosa from different regions of Puerto Rico. PMID:22290962

  11. Isotope Labeling for Solution and Solid-State NMR Spectroscopy of Membrane Proteins

    PubMed Central

    Verardi, Raffaello; Traaseth, Nathaniel J.; Masterson, Larry R.; Vostrikov, Vitaly V.; Veglia, Gianluigi


    In this chapter, we summarize the isotopic labeling strategies used to obtain high-quality solution and solid-state NMR spectra of biological samples, with emphasis on integral membrane proteins (IMPs). While solution NMR is used to study IMPs under fast tumbling conditions, such as in the presence of detergent micelles or isotropic bicelles, solid-state NMR is used to study the structure and orientation of IMPs in lipid vesicles and bilayers. In spite of the tremendous progress in biomolecular NMR spectroscopy, the homogeneity and overall quality of the sample is still a substantial obstacle to overcome. Isotopic labeling is a major avenue to simplify overlapped spectra by either diluting the NMR active nuclei or allowing the resonances to be separated in multiple dimensions. In the following we will discuss isotopic labeling approaches that have been successfully used in the study of IMPs by solution and solid-state NMR spectroscopy. PMID:23076578

  12. Magnetotail views at 33R(sub E): IMP 8 magnetometer observations

    NASA Technical Reports Server (NTRS)

    Kaymaz, Zerefsan; Siscoe, George L.; Tsyganenko, Nikolai A.; Lepping, Ronald P.


    This paper presents magnetic field vector (B) maps, electric current vector (curl B) maps, magnetic force (JxB) contour maps, and total field contour maps covering the full tail cross section in the yz plane. The maps are based on 16 years of 5-min averages of Interplanetary Monitoring Platform (IMP) 8 magnetic field data. During this time, IMP 8 traversed the tail between -25R(sub E) and -40R(sub E) in the x direction. Its average x distance was -33R(sub E). For this average distance we show separate maps for low and high dipole tilts, corresponding to equinox and northern hemisphere summer seasons. The low-tilt (equinox) maps show symmetrical field and current patterns; the high-tilt (solstice) maps show the cross-tail current sheet arcing above the equatorial diagonal in the center and dipping below it on the flanks. The shape of warped current sheet fits Fairfield's (1980) displaced ellipse model fairly well. The distance at which the current sheet is hinged to the magnetic equator is found to be 9.88R(sub E) and is independent of Kp. The z profile of current density shows a central peak, 3R(sub E) full width at half maximum, and smaller, flanking shoulders. A Harris sheet profile with a 7R(sub E) thickness fits the B(sub x) profile. Though these are magnetic field data, the JxB maps clearly outline the plasma sheet. This approach also gives 7R(sub E) thickness. Many of the average field and current features inferred and demonstrated in earlier studies are confirmed here; some of them are seen for the first time in full cross-section view. Among new features revealed are a large current vortex in the winter hemisphere lobe, a dawn-dusk asymmetry in the JxB force in the plasma sheet (it is stronger on the duskside), and a separation of the cross-tail current sheet into core and wing parts.

  13. Empirical in operando analysis of the charge carrier dynamics in hematite photoanodes by PEIS, IMPS and IMVS.


    Klotz, Dino; Ellis, David Shai; Dotan, Hen; Rothschild, Avner


    In this Perspective, we introduce intensity modulated photocurrent/voltage spectroscopy (IMPS and IMVS) as powerful tools for the analysis of charge carrier dynamics in photoelectrochemical (PEC) cells for solar water splitting, taking hematite (α-Fe2O3) photoanodes as a case study. We complete the picture by including photoelectrochemical impedance spectroscopy (PEIS) and linking the trio of PEIS, IMPS and IMVS, introduced here as photoelectrochemical immittance triplets (PIT), both mathematically and phenomenologically, demonstrating what conclusions can be extracted from these measurements. A novel way of analyzing the results by an empirical approach with minimal presumptions is introduced, using the distribution of relaxation times (DRT) function. The DRT approach is compared to conventional analysis approaches that are based on physical models and therefore come with model presumptions. This work uses a thin film hematite photoanode as a model system, but the approach can be applied to other PEC systems as well.

  14. [Development Of 25-Year Imp 8 Bow Shock Crossing "List, Ingestion Of This List To Cdaweb, & Enhancement"

    NASA Technical Reports Server (NTRS)

    Merka, J.; Szabo, A.; Narock, T. W.; King, J. H.; Paularena, K. I.; Richardson, J. D.


    The MIT portion of this project was to use the plasma data from IMP 8 to identify bow shock crossings for construction of a bow shock data base. In collaboration with Goddard, we determined which shock parameters would be included in the catalog and developed a set of flags for characterizing the data. IMP 8 data from 1973-2001 were surveyed for bow shock crossings; the crossings apparent in the plasma data were compared to a list of crossing chosen in the magnetometer data by Goddard. Differences were reconciled to produce a single list. The data were then provided to the NSSDC for archiving. All the work ascribed to MIT in the proposal was completed.

  15. IMP-8 observations of traveling compression regions - New evidence for near-earth plasmoids and neutral lines

    NASA Technical Reports Server (NTRS)

    Slavin, J. A.; Lepping, R. P.; Baker, D. N.


    An examination of IMP-8 tail lobe magnetic field measurements has been conducted to determine whether the traveling compression region (TCR) phenomena detected by ISEE-3 in the distant geotail, and believed to be caused by tailward moving plasmoids, are present closer to the earth. The study produced 16 examples of TCRs at distances of X = -31 to -37 R(E). For two events considered in detail, TCRs were observed in close association with substorm growth phase signatures in the lobes. The lengths of these TCRs are estimated to be 8-12 R(E). The conclusion is that the IMP-8 TCR observations provide new evidence that small plasmoids and, hence, multiple reconnection neutral lines can sometimes exist earthward of X = -35 R(E).

  16. Radial gradient of cosmic ray intensity from a comparative study of data from Voyager 1 and 2 and IMP 8

    NASA Technical Reports Server (NTRS)

    Venkatesan, D.; Decker, R. B.; Krimigis, S. M.


    The IMP 8 satellite and Voyager 1 and 2 space probes obtained cosmic ray measurements during the late 1977 to mid-1982 period. Comparisons of 27-day averages of the data show that a positive radial intensity gradient existed on the average during this period, and that the cosmic ray intensity decrease toward solar maximum in 1980-1981 proceeds in a stepwise fashion. The cosmic ray minimum reached in late 1980/early 1981 appears almost simultaneously at 1 AU and at 10 AU, with and without propagation time delay effects, between IMP 8 and the Voyager spacecraft. These data are generally consistent with a heliolatitudinal gradient of 0 + or - 1 percent/deg. Attention is given to the implications of these results in the overall context of cosmic ray modulation theory.

  17. IMP-8 observations of traveling compression regions - New evidence for near-earth plasmoids and neutral lines

    NASA Technical Reports Server (NTRS)

    Slavin, J. A.; Lepping, R. P.; Baker, D. N.


    An examination of IMP-8 tail lobe magnetic field measurements has been conducted to determine whether the traveling compression region (TCR) phenomena detected by ISEE-3 in the distant geotail, and believed to be caused by tailward moving plasmoids, are present closer to the earth. The study produced 16 examples of TCRs at distances of X = -31 to -37 R(E). For two events considered in detail, TCRs were observed in close association with substorm growth phase signatures in the lobes. The lengths of these TCRs are estimated to be 8-12 R(E). The conclusion is that the IMP-8 TCR observations provide new evidence that small plasmoids and, hence, multiple reconnection neutral lines can sometimes exist earthward of X = -35 R(E).

  18. Solubilization of native integral membrane proteins in aqueous buffer by noncovalent chelation with monomethoxy poly(ethylene glycol) (mPEG) polymers.


    Janaratne, Thamara K; Okach, Linda; Brock, Ansgar; Lesley, Scott A


    Highly hydrophobic integral membrane proteins (IMPs)are typically purified in excess detergent media, often resulting in rapid inactivation and denaturation of the protein. One promising approach to solve this problem is to couple hydrophilic polymers, such as monomethoxypolyethylene glycol (mPEG) to IMPs under mild conditions in place of detergents. However, the broad application of this approach is hampered by poor reaction efficiencies, low tolerance of detergent stabilized membrane proteins to reaction conditions, and a lack of proper site-specific reversible approaches. Here, we have developed a straightforward, efficient, and mild approach to site-specific noncovalent binding of long-chain polymers to recombinant IMPs. This method uses the hexa-histidine tag (His-Tag) often used for purification of recombinant proteins as an attachment site for mPEGs. Solubility studies performed using five different IMPs confirmed that all tested mPEG-bound IMPs were completely soluble and stable in detergent free aqueous buffer compared to their precipitated native proteins under the identical circumstances. Activity assays and circular dichroism (CD) spectroscopy confirmed the structural integrity of modified IMPs.

  19. Solubilization of native integral membrane proteins in aqueous buffer by non-covalent chelation with monomethoxy polyethylene glycol (mPEG) polymers

    PubMed Central

    Janaratne, Thamara K.; Okach, Linda; Brock, Ansgar; Lesley, Scott A.


    Highly hydrophobic integral membrane proteins (IMPs) are typically purified in excess detergent media, often resulting in rapid inactivation and denaturation of the protein. One promising approach to solve this problem is to couple hydrophilic polymers, such as monomethoxypolyethylene glycol (mPEG) to IMPs under mild conditions in place of detergents. However, the broad application of this approach is hampered by poor reaction efficiencies, low tolerance of detergent stabilized membrane proteins to reaction conditions and a lack of proper site-specific reversible approaches. Here we have developed a straightforward, efficient and mild approach to site-specific non-covalent binding of long-chain polymers to recombinant IMPs. This method uses the hexa-histidine tag (His-Tag) often used for purification of recombinant proteins as an attachment site for mPEGs. Solubility studies performed using five different IMPs confirmed that all tested mPEG-bound IMPs were completely soluble and stable in detergent free aqueous buffer compared to their precipitated native proteins under the identical circumstances. Activity assays and circular dichroism (CD) spectroscopy confirmed the structural integrity of modified IMPs. PMID:21740061

  20. Mapping Rock and Soil Units in the MPF IMP SuperPan Using a Kohonen Self Organizing Map

    NASA Technical Reports Server (NTRS)

    Farrand, W.; Merenyi, E.; Murchie, S.; Barnouin-Jha, O.; Johnson, J.


    The 1997 Mars Pathfinder mission provided information on a site in the Ares Vallis floodplain. Initial analysis of multispectral data from the Imager for Mars Pathfinder (IMP) indicated the presence of only a single rock type, the 'gray rock' spectral class and various coated variants thereof (e.g., 'maroon rock'). Continued analysis of the IMP 'SuperPan' mosaic has confirmed multiple examples of a second 'black rock' spectral class existing as small cobbles in the near field and as boulders in the far field. These results are consistent with recent analysis of MGS Thermal Emission Spectrometer (TES) data which indicates that there is likely a mix of both 'Surface Type 1' (ST1) and 'Surface Type 2' (ST2) spectral classes at the MPF landing site. Nominally, the black rock spectral class would correspond to ST1 (basalts) and 'gray rock' would correspond to ST2 (andesites). Orbital remote sensing has also revealed the pervasive presence of layering on Mars. Recently it was suggested that there are extensive outcrops of the black rock spectral class in the SuperPan far field on the flanks of the Twin Peaks and on the rim of Big Crater. These authors suggested that these exposures represented outcrops of black rock from beneath a surficial, flood deposited layer. In this work, we have reexamined the MPF IMP SuperPan mosaic using an artificial neural network self organizing map (SOM) processing architecture in order to classify the distribution of spectral classes within the SuperPan. In this paper, we present initial results from that work and draw specific attention to a subset of the identified spectral classes in order to address questions relating to whether there are extensive exposures of black rock in the IMP far field, what other materials might be exposed in the far field, and what evidence there is for subsurface layering at the MPF landing site.

  1. Processing and analysis of data from the University of Chicago experiments on the IMP 4 and 5 spacecraft

    NASA Technical Reports Server (NTRS)

    Simpson, J. A.; Garcia-Munoz, M.


    Data from the Charged Particle Experiments of the IMP-4 and 5 spacecraft were processed and analyzed from launch through reentry. Approximately 95 percent of all data transmitted was recovered, processed, and analyzed. The computer programming and operational procedures which were developed to perform the processing and analysis of the data are discussed. The scientific results obtained from the analysis of the data are summarized. A bibliography of documents based on these experiments is included.

  2. [Quantitation of cerebral blood flow and partition coefficient using 123I-IMP dynamic SPECT with single arterial blood sampling].


    Mizumura, S; Kumita, S; Kumazaki, T


    A method base on the two-compartment model was developed to measure quantitative cerebral blood flow (CBF) and partition coefficient (lambda) of IMP from dynamic SPECT and single arterial blood sampling. In this method, the linear differential equation of two-compartment model, Yokoi proposed, was employed and quantitative CBF and lambda values were measured with the standard input function calibrated by single arterial sampling. The input function was derived from the standard input function scaled by a factor determined by the single arterial blood sample. This new technique was applied to 5 normal volunteers (Ages ranged from 25 to 29 yr., average 26 yr.). The optimal time to calibrate the standard input function in the individual study and optimal the period of the upper limit time to which input function is integrated from IMP administration for analysis of the equation were determined to minimize the difference between integration of the calibrated standard input function and of the individual input function. Minimization of the difference yields an optimal calibration time (4 to 10 min after IMP administration) and the period of the upper limit time (8 to 60 min after acquisition start). Comparison of CBF and lambda values obtained by the graphical method using the calibrated standard data and individual input function were performed. It should be noted that CBF values were in good agreement between the two methods, respectively (r = 0.92, P<0.01; r = 0.72, p = 0.01). This method is easy to estimate CBF and lambda by only single arterial blood sampling and IMP dynamic SPECT, and useful for routine studies.

  3. Dissemination of Pseudomonas aeruginosa producing bla IMP-1 and bla VIM-1 in Qazvin and Alborz educational hospitals, Iran.


    Peymani, Amir; Naserpour Farivar, Taghi; Mohammadi Ghanbarlou, Mahdi; Najafipour, Reza


    Pseudomonas aeruginosa is a frequent opportunistic pathogen in health care associated infections that is highly resistant to the majority of β-lactams. The aims of this study were to access the antimicrobial susceptibility pattern of P. aeruginosa isolated from educational hospitals of Qazvin and Alborz provinces, to determine the prevalence of metallo-β-lactamase (MBL) among carbapenem non-susceptible isolates by combined disk (CD) method, and to detect the bla IMP, bla VIM, bla SIM, bla GIM, bla SPM and bla NDM-1-MBL genes. In this cross-sectional study, 300 P. aeruginosa isolates were collected from different clinical specimens in two provinces of Qazvin and Alborz hospitals, Iran. After identification of isolates by standard laboratory methods, antimicrobial susceptibility was done against 17 antibiotics according to clinical and laboratory standards institute (CLSI) guideline. CD method was carried out for detection of MBLs and the presence of bla IMP, bla VIM, bla SIM, bla GIM, bla NDM-1 and bla SPM-genes was further assessed by PCR and sequencing methods. In this study, 107 (35.66%) isolates were non-susceptible to imipenem and/or meropenem among those 56 (52.3%) isolates were metallo-β-lactamase producer. Twenty-four of 56 (42.85%) MBL-positive isolates were confirmed to be positive for MBL-encoding genes in which 14 (25%) and 10 (17.85%) isolates carried bla IMP-1 and bla VIM-1 genes either alone or in combination. Three (5.35%) isolates carried bla IMP and bla VIM genes, simultaneously. Considering the moderate prevalence and clinical importance of MBL-producing isolates, rapid identification and use of appropriate infection control (IC) measures are necessary to prevent further spread of infections by these resistant organisms.

  4. Mapping Rock and Soil Units in the MPF IMP SuperPan Using a Kohonen Self Organizing Map

    NASA Technical Reports Server (NTRS)

    Farrand, W.; Merenyi, E.; Murchie, S.; Barnouin-Jha, O.; Johnson, J.


    The 1997 Mars Pathfinder mission provided information on a site in the Ares Vallis floodplain. Initial analysis of multispectral data from the Imager for Mars Pathfinder (IMP) indicated the presence of only a single rock type, the 'gray rock' spectral class and various coated variants thereof (e.g., 'maroon rock'). Continued analysis of the IMP 'SuperPan' mosaic has confirmed multiple examples of a second 'black rock' spectral class existing as small cobbles in the near field and as boulders in the far field. These results are consistent with recent analysis of MGS Thermal Emission Spectrometer (TES) data which indicates that there is likely a mix of both 'Surface Type 1' (ST1) and 'Surface Type 2' (ST2) spectral classes at the MPF landing site. Nominally, the black rock spectral class would correspond to ST1 (basalts) and 'gray rock' would correspond to ST2 (andesites). Orbital remote sensing has also revealed the pervasive presence of layering on Mars. Recently it was suggested that there are extensive outcrops of the black rock spectral class in the SuperPan far field on the flanks of the Twin Peaks and on the rim of Big Crater. These authors suggested that these exposures represented outcrops of black rock from beneath a surficial, flood deposited layer. In this work, we have reexamined the MPF IMP SuperPan mosaic using an artificial neural network self organizing map (SOM) processing architecture in order to classify the distribution of spectral classes within the SuperPan. In this paper, we present initial results from that work and draw specific attention to a subset of the identified spectral classes in order to address questions relating to whether there are extensive exposures of black rock in the IMP far field, what other materials might be exposed in the far field, and what evidence there is for subsurface layering at the MPF landing site.

  5. Metallo-β-Lactamase Gene blaIMP-15 in a Class 1 Integron, In95, from Pseudomonas aeruginosa Clinical Isolates from a Hospital in Mexico▿

    PubMed Central

    Garza-Ramos, U.; Morfin-Otero, R.; Sader, H. S.; Jones, R. N.; Hernández, E.; Rodriguez-Noriega, E.; Sanchez, A.; Carrillo, B.; Esparza-Ahumada, S.; Silva-Sanchez, J.


    During 2003, 40 carbapenem-resistant Pseudomonas aeruginosa clinical isolates collected in a Mexican tertiary-care hospital were screened for metallo-β-lactamase production. Thirteen isolates produced IMP-15, and 12 had a single pulsed-field gel electrophoresis pattern. The blaIMP-15 gene cassette was inserted in a plasmid-borne integron with a unique array of gene cassettes and was named In95. PMID:18490501

  6. "Luxury perfusion" with 99mTc-HMPAO and 123I-IMP SPECT imaging during the subacute phase of stroke.


    Moretti, J L; Defer, G; Cinotti, L; Cesaro, P; Degos, J D; Vigneron, N; Ducassou, D; Holman, B L


    To compare the merits of 123I-isopropyl-iodoamphetamine (123I-IMP) and 99mTc-HMPAO in showing abnormal brain uptake distribution during cerebral ischemia, we studied ten patients during the subacute phase of their stroke, a period where metabolism and blood flow are frequently uncoupled. SPECT imaging was performed using both radiopharmaceuticals in the 10 patients from 48 h to 4 weeks after onset of symptoms. Two patients out of the 10 had similar defects with 123I-IMP and 99mTc-HMPAO SPECT, the location of the defects corresponding to the area of infarction observed on CT. Six patients had normal 99mTc-HMPAO SPECT and abnormal 123I-IMP SPECT with defects in the area of infarction shown by CT. The remaining 2 patients had hyperactive abnormalities on 99mTc-HMPAO in areas corresponding to defects on the 123I-IMP images. Two of the patients with SPECT mismatches were studied again more than 1 month after onset. On reexamination, 99mTc-HMPAO SPECT which was previously normal or hyperactive became hypoactive with a focal area of decreased activity corresponding to the defect on 123I-IMP. Crossed cerebellar diaschisis was found in 7 patients with 99mTc-HMPAO and was absent for both 123I-IMP and 99mTc-HMPAO in 3. We suggest that SPECT with 99mTc-HMPAO could show transient hyperemia not demonstrated by 123I-IMP whereas in some cases cerebral infarction would be more difficult to demonstrate with 99mTc-HMPAO than with 123I-IMP. SPECT with both tracers is recommended to follow the evolution of strokes in terms of regional cerebral blood flow and tissue metabolism.

  7. Gas flow analysis during thermal vacuum test of a spacecraft. [self contamination of IMP spacecraft

    NASA Technical Reports Server (NTRS)

    Scialdone, J. J.


    The self-contamination of the IMP-H spacecraft, while it was undergoing thermal and solar vacuum tests, has been investigated in conjunction with the outgassing evaluation and detection of molecular flow anomalies occurring in the test chamber. The pressures indicated by two tubulated ionization gauges were used to calculate flow kinetics in the vacuum chamber. The fluxes of emitted molecules and chamber wall reflected molecules were monitored during the entire test. Representative equations and graphs are presented. Test results indicate that from 3 to 9 of every 100 emitted molecules returned to the spacecraft surface; that self-contamination by noncondensable gases was more severe than that by condensable gases; and that outgassing of the spacecraft was approximately 1.18 x 0.01 g/s after 10 hours and 1.18 x 0.001 after 90 hours of vacuum exposure. Testing deficiencies have been identified, and the type and location of instruments required to measure the outgassing, the degree of contamination, and return flow are discussed.

  8. Outbreak of IMP-producing carbapenem-resistant Enterobacter gergoviae among kidney transplant recipients.


    Freire, Maristela Pinheiro; de Oliveira Garcia, Doroti; Cury, Ana Paula; Spadão, Fernanda; Di Gioia, Thais S R; Francisco, Gabriela Rodrigues; Bueno, Maria Fernanda Campagnari; Tomaz, Mariama; de Paula, Flavio Jota; de Faro, Lorena Brito; Piovesan, Affonso C; Rossi, Flavia; Levin, Anna Sara; David Neto, Elias; Nahas, William C; Pierrotti, Ligia Camera


    The objective of this study was to investigate a prolonged outbreak of carbapenem-resistant Enterobacter gergoviae (CREG) involving kidney transplant recipients (KTRs) between 2009 and 2014. A case-control study was undertaken. Controls (n = 52) were selected from CREG-negative KTRs. Surveillance cultures for CREG were collected weekly. Colonization was defined as isolation of CREG from surveillance samples or from clinical specimens, with no evidence of infection. We also investigated infection control practices at the facility. Of 26 identified cases, 13 had had no known contact with another CREG-positive patient before the first positive culture. Seven patients (27%) developed infection. The site most often colonized was the urinary tract. During the study period two clusters were identified, one in 2009 and another in 2013-14. DNA sequencing revealed blaIMP-1 in all CREG tested. No environmental or hand cultures tested positive for CREG. An audit of infection control practices detected flaws in the handling and cleaning of urinary tract devices. Multivariate analysis identified advanced age, ureteral stent use, retransplantation and male gender as risk factors for CREG acquisition. An outbreak among KTRs caused by an unusual species of MDR bacteria may have resulted from a common source of contamination related to urinary tract devices. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail:

  9. Imager for Mars Pathfinder experiment (IMP): a multispectral stereo imaging system

    NASA Astrophysics Data System (ADS)

    Smith, Peter H.


    On Independence Day 1997 Mars Pathfinder bounced to a stop on the Ares-Tiu Vallis floodplain and began returning the first pictures from the surface of Mars in 20 years. The IMP camera took panoramas first in a stowed position (about seated height) and after day 2 from a deployed height of 1.85 m (about standing height). The eye separation of the stereoscopic camera (15 cm) allowed a humanistic view of the surrounding terrain. Months of calibration paid off in producing color images with the 5 visible filters; color was extended into the near IR with 10 additional filters three of which were doubled on each eye for stereo views. Because of low data rates from the direct transmission to Earth, the resolution was limited to 1 mrad/pixel and the FOV was fixed at 14 degrees square. The pointing motors allowed the camera to point in any direction and a complete panorama required 120 images per color. The mission lasted 83 sols (martian days of 24 hours and 39 minutes) and returned over 16,000 image frames. The science goals included contour mapping the site to study the geomorphology and multispectral imaging to sort out the mineralogy of the rocks and soils. In addition, the camera was used to help guide the Sojourner rover using virtual reality visualization techniques.

  10. Terrestrial kilometric radiation. III - Average spectral properties. [observations by IMP-6 and RAE-2 satellites

    NASA Technical Reports Server (NTRS)

    Kaiser, M. L.; Alexander, J. K.


    The spectral properties of terrestrial kilometric radiation (TKR) derived from observations made during radio-astronomy experiments on board the Imp 6 and Radio Astronomy Explorer 2 spacecraft are studied. As viewed from near the equatorial plane, TKR is most intense and most often observed in the 2100-2400 LT zone and is rarely seen in the 0900-1200 LT zone. The absolute flux levels in the 100- to 600-kHz TKR band increase significantly with increasing substorm activity as inferred from the auroral electrojet index (AE). In the late-evening sector the median power increases by about 3 orders of magnitude between quiet periods (AE less than 75 gammas) and disturbed periods (AE above 200 gammas). The peak flux density usually occurs near 250 kHz, although the frequency of the peak in the flux spectrum appears to vary inversely with AE from a maximum near 300 kHz during very quiet times to a minimum below 200 kHz during very disturbed times. The half-power bandwidth is typically 100% of the peak frequency. The variation of TKR flux density with apparent source altitude indicates that source strength decreases more rapidly than the inverse square of distance.

  11. Allosteric activation via kinetic control: Potassium accelerates a conformational change in IMP dehydrogenase†

    PubMed Central

    Riera, Thomas V.; Zheng, Lianqing; Josephine, Helen R.; Min, Donghong; Yang, Wei; Hedstrom, Lizbeth


    Allosteric activators are generally believed to shift the equilibrium distribution of enzyme conformations to favor a catalytically productive structure; the kinetics of conformational exchange is seldom addressed. Several observations suggested that the usual allosteric mechanism might not apply to the activation of IMP dehydrogenase (IMPDH) by monovalent cations. Therefore we investigated the mechanism of K+ activation in IMPDH by delineating the kinetic mechanism in the absence of monovalent cations. Surprisingly, the K+-dependence of kcat derives from the rate of flap closure, which increases by ≥65-fold in the presence of K+. We performed both alchemical free energy simulations and potential of mean force calculations using the orthogonal space random walk strategy to computationally analyze how K+ accelerates this conformational change. The simulations recapitulate the preference of IMPDH for K+, validating the computational models. When K+ is replaced with a dummy ion, the residues of the K+ binding site relax into ordered secondary structure, creating a barrier to conformational exchange. K+ mobilizes these residues by providing alternate interactions for the main chain carbonyls. Potential of mean force calculations indicate that K+ changes the shape of the energy well, shrinking the reaction coordinate by shifting the closed conformation toward the open state. This work suggests that allosteric regulation can be under kinetic as well as thermodynamic control. PMID:21870820

  12. Studies on low energy beam transport for high intensity high charged ions at IMP

    NASA Astrophysics Data System (ADS)

    Yang, Y.; Sun, L. T.; Hu, Q.; Cao, Y.; Lu, W.; Feng, Y. C.; Fang, X.; Zhang, X. Z.; Zhao, H. W.; Xie, D. Z.


    Superconducting Electron Cyclotron Resonance ion source with Advanced design in Lanzhou (SECRAL) is an advanced fully superconducting ECR ion source at IMP designed to be operational at the microwave frequency of 18-24 GHz. The existing SECRAL beam transmission line is composed of a solenoid lens and a 110° analyzing magnet. Simulations of particle tracking with 3D space charge effect and realistic 3D magnetic fields through the line were performed using particle-in-cell code. The results of the beam dynamics show that such a low energy beam is very sensitive to the space charge effect and significantly suffers from the second-order aberration of the analyzing magnet resulting in large emittance. However, the second-order aberration could be reduced by adding compensating sextupole components in the beam line. On this basis, a new 110° analyzing magnet with relatively larger acceptance and smaller aberration is designed and will be used in the design of low energy beam transport line for a new superconducting ECR ion source SECRAL-II. The features of the analyzer and the corresponding beam trajectory calculation will be detailed and discussed in this paper.

  13. Terrestrial kilometric radiation. III - Average spectral properties. [observations by IMP-6 and RAE-2 satellites

    NASA Technical Reports Server (NTRS)

    Kaiser, M. L.; Alexander, J. K.


    The spectral properties of terrestrial kilometric radiation (TKR) derived from observations made during radio-astronomy experiments on board the Imp 6 and Radio Astronomy Explorer 2 spacecraft are studied. As viewed from near the equatorial plane, TKR is most intense and most often observed in the 2100-2400 LT zone and is rarely seen in the 0900-1200 LT zone. The absolute flux levels in the 100- to 600-kHz TKR band increase significantly with increasing substorm activity as inferred from the auroral electrojet index (AE). In the late-evening sector the median power increases by about 3 orders of magnitude between quiet periods (AE less than 75 gammas) and disturbed periods (AE above 200 gammas). The peak flux density usually occurs near 250 kHz, although the frequency of the peak in the flux spectrum appears to vary inversely with AE from a maximum near 300 kHz during very quiet times to a minimum below 200 kHz during very disturbed times. The half-power bandwidth is typically 100% of the peak frequency. The variation of TKR flux density with apparent source altitude indicates that source strength decreases more rapidly than the inverse square of distance.

  14. Studies on low energy beam transport for high intensity high charged ions at IMP

    SciTech Connect

    Yang, Y. Lu, W.; Fang, X.; Sun, L. T.; Hu, Q.; Cao, Y.; Feng, Y. C.; Zhang, X. Z.; Zhao, H. W.; Xie, D. Z.


    Superconducting Electron Cyclotron Resonance ion source with Advanced design in Lanzhou (SECRAL) is an advanced fully superconducting ECR ion source at IMP designed to be operational at the microwave frequency of 18–24 GHz. The existing SECRAL beam transmission line is composed of a solenoid lens and a 110° analyzing magnet. Simulations of particle tracking with 3D space charge effect and realistic 3D magnetic fields through the line were performed using particle-in-cell code. The results of the beam dynamics show that such a low energy beam is very sensitive to the space charge effect and significantly suffers from the second-order aberration of the analyzing magnet resulting in large emittance. However, the second-order aberration could be reduced by adding compensating sextupole components in the beam line. On this basis, a new 110° analyzing magnet with relatively larger acceptance and smaller aberration is designed and will be used in the design of low energy beam transport line for a new superconducting ECR ion source SECRAL-II. The features of the analyzer and the corresponding beam trajectory calculation will be detailed and discussed in this paper.

  15. Development of single-event-effects analysis system at the IMP microbeam facility

    NASA Astrophysics Data System (ADS)

    Guo, Jinlong; Du, Guanghua; Bi, Jinshun; Liu, Wenjing; Wu, Ruqun; Chen, Hao; Wei, Junze; Li, Yaning; Sheng, Lina; Liu, Xiaojun; Ma, Shuyi


    Single-event-effects (SEEs) in integrated circuits (ICs) caused by galactic single ions are the major cause of anomalies for a spacecraft. The main strategies to decrease radiation failures for spacecraft are using SEEs less-sensitive devices and design radiation hardened ICs. High energy ion microbeam is one of the powerful tools to obtain spatial information of SEEs in ICs and to guide the radiation hardening design. The microbeam facility in the Institute of Modern Physics (IMP), Chinese Academy of Science (CAS) can meet both the liner energy transfer (LET) and ion range requirements for SEEs simulation experiments on ground. In order to study SEEs characteristics of ICs at this microbeam platform, a SEEs analysis system was developed. This system can target and irradiate ICs with single ions in micrometer-scale accuracy, meanwhile it acquires multi-channel SEE signals and maps the SEE sensitive regions online. A 4-Mbit NOR Flash memory was tested with this system using 2.2 GeV Kr ions, the radiation sensitive peripheral circuit regions for SEEs of 1 to 0 and 0 to 1 upset, multi-bit-upset and single event latchup have been obtained.

  16. Regulation of IMP dehydrogenase gene expression by its end products, guanine nucleotides.

    PubMed Central

    Glesne, D A; Collart, F R; Huberman, E


    To study the regulation of IMP dehydrogenase (IMPDH), the rate-limiting enzyme of guanine nucleotide biosynthesis, we examined the effects of nucleosides, nucleotides, nucleotide analogs, or the IMPDH inhibitor mycophenolic acid (MPA) on the steady-state levels of IMPDH mRNA. The results indicated that IMPDH gene expression is regulated inversely by the intracellular level of guanine ribonucleotides. We have shown that treatment with guanosine increased the level of cellular guanine ribonucleotides and subsequently reduced IMPDH steady-state mRNA levels in a time- and dose-dependent manner. Conversely, MPA treatment diminished the level of guanine ribonucleotides and increased IMPDH mRNA levels. Both of these effects on the steady-state level of IMPDH mRNA could be negated by cotreatment with guanosine and MPA. The down regulation of IMPDH gene expression by guanosine or its up regulation by MPA was not due to major changes in transcriptional initiation and elongation or mRNA stability in the cytoplasm but rather was due to alterations in the levels of the IMPDH mRNA in the nucleus. These results suggest that IMPDH gene expression is regulated by a posttranscriptional, nuclear event in response to fluctuations in the intracellular level of guanine ribonucleotides. Images PMID:1717828

  17. Lactobacillus gasseri PA-3 Uses the Purines IMP, Inosine and Hypoxanthine and Reduces their Absorption in Rats.


    Yamada, Naruomi; Saito-Iwamoto, Chizuru; Nakamura, Marie; Soeda, Misato; Chiba, Yoshika; Kano, Hiroshi; Asami, Yukio


    Excessive intake of purine-rich foods elevates serum levels of uric acid. Animal and fish meats contain high amounts of inosine and its related purines, and the reduction of taking those purines is crucial for the improvement of serum uric acid levels. We previously showed that Lactobacillus gasseri PA-3 (PA-3) incorporates adenosine and its related purines and that oral treatment with PA-3 reduced adenosine absorption in rats. This study investigated whether PA-3 also incorporates IMP (inosine 5'-monophosphate), inosine, and hypoxanthine, and whether it reduces their absorption in rats. PA-3 was incubated in vitro with radioisotope (RI)-labeled IMP, inosine, and hypoxanthine, and the incorporation of these compounds by PA-3 was evaluated. In addition, rats were orally administered PA-3 along with RI-labeled inosine 5'-monophosphate, inosine, or hypoxanthine, and the ability of PA-3 to attenuate the absorption of these purines was determined. PA-3 incorporated all three purines and displayed greater proliferation in the presence than in the absence of these purines. Oral administration of PA-3 to rats reduced the absorption of IMP, inosine, and hypoxanthine. These results indicate that PA-3 reduces the absorption of purines contained in foods and it is expected that PA-3 contributes attenuation of the excessive intake of dietary purines.

  18. Lactobacillus gasseri PA-3 Uses the Purines IMP, Inosine and Hypoxanthine and Reduces Their Absorption in Rats

    PubMed Central

    Yamada, Naruomi; Saito-Iwamoto, Chizuru; Nakamura, Marie; Soeda, Misato; Chiba, Yoshika; Kano, Hiroshi; Asami, Yukio


    Excessive intake of purine-rich foods elevates serum levels of uric acid. Animal and fish meats contain high amounts of inosine and its related purines, and the reduction of taking those purines is crucial for the improvement of serum uric acid levels. We previously showed that Lactobacillus gasseri PA-3 (PA-3) incorporates adenosine and its related purines and that oral treatment with PA-3 reduced adenosine absorption in rats. This study investigated whether PA-3 also incorporates IMP (inosine 5′-monophosphate), inosine, and hypoxanthine, and whether it reduces their absorption in rats. PA-3 was incubated in vitro with radioisotope (RI)-labeled IMP, inosine, and hypoxanthine, and the incorporation of these compounds by PA-3 was evaluated. In addition, rats were orally administered PA-3 along with RI-labeled inosine 5′-monophosphate, inosine, or hypoxanthine, and the ability of PA-3 to attenuate the absorption of these purines was determined. PA-3 incorporated all three purines and displayed greater proliferation in the presence than in the absence of these purines. Oral administration of PA-3 to rats reduced the absorption of IMP, inosine, and hypoxanthine. These results indicate that PA-3 reduces the absorption of purines contained in foods and it is expected that PA-3 contributes attenuation of the excessive intake of dietary purines. PMID:28282902

  19. Generation and expression in plants of a single-chain variable fragment antibody against the immunodominant membrane protein of Candidatus phytoplasma aurantifolia.


    Shahryari, F; Safarnejad, M R; Shams-Bakhsh, M; Schillberg, S; Nölke, G


    Witches' broom of lime is a disease caused by Candidatus Phytoplasma aurantifolia, which represents the most significant global threat to the production of lime trees (Citrus aurantifolia). Conventional disease management strategies have shown little success, and new approaches based on genetic engineering need to be considered. The expression of recombinant antibodies and fragments thereof in plant cells is a powerful approach that can be used to suppress plant pathogens. We have developed a single-chain variable fragment antibody (scFvIMP6) against the immunodominant membrane protein (IMP) of witches' broom phytoplasma and expressed it in different plant cell compartments. We isolated scFvIMP6 from a naïve scFv phage display library and expressed it in bacteria to demonstrate its binding activity against both recombinant IMP and intact phytoplasma cells. The expression of scFvIMP6 in plants was evaluated by transferring the scFvIMP6 cDNA to plant expression vectors featuring constitutive or phloem specific promoters in cassettes with or without secretion signals, therefore causing the protein to accumulate either in the cytosol or apoplast. All constructs were transiently expressed in Nicotiana benthamiana by agroinfiltration, and antibodies of the anticipated size were detected by immunoblotting. Plant-derived scFvIMP6 was purified by affinity chromatography, and specific binding to recombinant IMP was demonstrated by enzyme-linked immunosorbent assay. Our results indicate that scFvIMP6 binds with high activity and can be used for the detection of Ca. Phytoplasma aurantifolia and is also a suitable candidate for stable expression in lime trees to suppress witches' broom of lime.

  20. Molecular characterization of carbapenemase-producing Pseudomonas aeruginosa of Czech origin: evidence for clonal spread of extensively resistant ST357 expressing IMP-7 metallo-β-lactamase.


    Papagiannitsis, Costas C; Medvecky, Matej; Chudejova, Katerina; Skalova, Anna; Rotova, Veronika; Spanelova, Petra; Jakubu, Vladislav; Zemlickova, Helena; Hrabak, Jaroslav


    The objective of this study was to perform molecular surveillance for assessing the spread of carbapenemase-producing P. aeruginosa in Czech hospitals. One-hundred thirty-six carbapenemase-producing isolates were recovered from 22 hospitals, located throughout the country. ST357 dominated (n=120) among carbapenemase producers. One-hundred seventeen isolates produced IMP-type (IMP-7 [n=116] and IMP-1 [n=1]) metallo-β-lactamases (MβLs), fifteen produced the VIM-2 MβL, while the remaining isolates expressed the GES-5 enzyme. The blaIMP-like genes were located in three main integron types, with In-p110-like being the most prevalent (n=115). The two other IMP-encoding integrons (In1392 and In1393) have not been described previously. blaVIM-2-carrying integrons included In59-like, In56, and a novel element (In1391). blaGES-5 was carried by In717. Sequencing data showed that In-p110-like was associated with a Tn4380-like transposon inserted in genomic island LESGI-3, in P. aeruginosa chromosome. The other integrons were also integrated into P. aeruginosa chromosome. These findings indicated the clonal spread of ST357 P. aeruginosa, carrying the IMP-7-encoding integron In-p110, in Czech hospitals. Additionally, the sporadic emergence of P. aeruginosa producing different carbapenemase types, associated with divergent or novel integrons, punctuated the ongoing evolution of these bacteria. Copyright © 2017 American Society for Microbiology.

  1. Hippocampal expression of the calcium sensor protein visinin-like protein-1 in schizophrenia.


    Bernstein, Hans-Gert; Braunewell, Karl-Heinz; Spilker, Christina; Danos, Peter; Baumann, Bruno; Funke, Sieglinde; Diekmann, Silvia; Gundelfinger, Eckart D; Bogerts, Bernhard


    Hippocampal cytoarchitectural abnormalities may be part of the cerebral substrate of schizophrenia. Amongst the chemical components being abnormal in brains of schizophrenics are altered calcium concentrations and reduced expression of the neurotrophin receptor, trkB. We studied by immunohistochemical methods the distribution of visinin-like protein-1 (VILIP-1), which is a calcium sensor protein and at the same time a trkB mRNA binding protein, in hippocampi of nine schizophrenic patients and nine matched control subjects. In normal hippocampi VILIP-1 immunoreactivity was found in multiple pyramidal cells and interneurons. A portion of VILIP-1 immunoreactive interneurons co-express calretinin (60%) and parvalbumin (<10%). In schizophrenics fewer pyramidal cells but more interneurons were immunostained. Our data point to an involvement of the protein in the altered hippocampal circuitry in schizophrenia.

  2. Predicting pupylation sites in prokaryotic proteins using semi-supervised self-training support vector machine algorithm.


    Ju, Zhe; Gu, Hong


    As one important post-translational modification of prokaryotic proteins, pupylation plays a key role in regulating various biological processes. The accurate identification of pupylation sites is crucial for understanding the underlying mechanisms of pupylation. Although several computational methods have been developed for the identification of pupylation sites, the prediction accuracy of them is still unsatisfactory. Here, a novel bioinformatics tool named IMP-PUP is proposed to improve the prediction of pupylation sites. IMP-PUP is constructed on the composition of k-spaced amino acid pairs and trained with a modified semi-supervised self-training support vector machine (SVM) algorithm. The proposed algorithm iteratively trains a series of support vector machine classifiers on both annotated and non-annotated pupylated proteins. Computational results show that IMP-PUP achieves the area under receiver operating characteristic curves of 0.91, 0.73, and 0.75 on our training set, Tung's testing set, and our testing set, respectively, which are better than those of the different error costs SVM algorithm and the original self-training SVM algorithm. Independent tests also show that IMP-PUP significantly outperforms three other existing pupylation site predictors: GPS-PUP, iPUP, and pbPUP. Therefore, IMP-PUP can be a useful tool for accurate prediction of pupylation sites. A MATLAB software package for IMP-PUP is available at Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Studies using IMP, Voyager and Pioneer cosmic ray data to determine the size of the heliosphere

    NASA Technical Reports Server (NTRS)

    Lockwood, John A. (Principal Investigator)


    The purpose of this project was to use the cosmic ray data from the IMP, Voyager and Pioneer spacecraft in the heliosphere out to approximately 65 AU to estimate the size of the heliosphere. We used several techniques to develop a consistent picture of the size of the heliosphere. The first method used a response function approach which determined the intensity as a function of time by scaling the modulation effect as they move outward and eventually reach the boundary of the heliosphere. In this model the effects of transient cosmic ray disturbances is included. A second approach using the perturbation method in which drifts are considered as a perturbation to the standard diffusion-convection modulation models was not fully developed. In a third approach the location of the modulation boundary beyond the termination shock was estimated using observations of the intensity and radial gradients between Voyager 2 and Pioneer 10 along with new estimates of the interstellar intensity of more than 70 MeV galactic cosmic rays. Using this method we found that for 7 years, from 1983 to 1990, the modulation boundary remained constant at 83 +/- 5 AU. We infer from these studies that a modulation boundary can be estimated only by extrapolating the observed radial gradients when the solar magnetic field polarity is such that cosmic-ray particles are drifting in the heliosphere inward toward the Earth along the neutral sheet. The boundary distance is larger than the estimates of the location of the termination shock at 67 +/- 5 AU using the same method. Two other studies partially supported by this grant are attached. The first deals with the recovery period of the greater than 70 MeV cosmic rays in the outer heliosphere from 1992-1995. In the second paper we compare the rigidity dependence of the 11-year cosmic ray variation at the Earth in two cycles of opposite solar magnetic field polarity.

  4. Identification of Cargo Proteins Specific for Importin-β with Importin-α Applying a Stable Isotope Labeling by Amino Acids in Cell Culture (SILAC)-based in Vitro Transport System*

    PubMed Central

    Kimura, Makoto; Okumura, Nobuaki; Kose, Shingo; Takao, Toshifumi; Imamoto, Naoko


    The human importin (Imp)-β family consists of 21 nucleocytoplasmic transport carrier proteins, which transport thousands of proteins (cargoes) across the nuclear envelope through nuclear pores in specific directions. To understand the nucleocytoplasmic transport in a physiological context, the specificity of cargoes for their cognate carriers should be determined; however, only a limited number of nuclear proteins have been linked to specific carriers. To address this biological question, we recently developed a novel method to identify carrier-specific cargoes. This method includes the following three steps: (i) the cells are labeled by stable isotope labeling by amino acids in cell culture (SILAC); (ii) the labeled cells are permeabilized, and proteins in the unlabeled cell extracts are transported into the nuclei of the permeabilized cells by a particular carrier; and (iii) the proteins in the nuclei are quantitatively identified by LC-MS/MS. The effectiveness of this method was demonstrated by the identification of transportin (Trn)-specific cargoes. Here, we applied this method to identify cargo proteins specific for Imp-β, which is a predominant carrier that exclusively utilizes Imp-α as an adapter for cargo binding. We identified candidate cargoes, which included previously reported and potentially novel Imp-β cargoes. In in vitro binding assays, most of the candidate cargoes bound to Imp-β in one of three binding modes: directly, via Imp-α, or via other cargoes. Thus, our method is effective for identifying a variety of Imp-β cargoes. The identified Imp-β and Trn cargoes were compared, ensuring the carrier specificity of the method and illustrating the complexity of these transport pathways. PMID:23846694

  5. Development of a pipeline for automated, high-throughput analysis of paraspeckle proteins reveals specific roles for importin α proteins

    PubMed Central

    Major, Andrew T.; Miyamoto, Yoichi; Lo, Camden Y.; Jans, David A.; Loveland, Kate L.


    We developed a large-scale, unbiased analysis method to measure how functional variations in importin (IMP) α2, IMPα4 and IMPα6 each influence PSPC1 and SFPQ nuclear accumulation and their localization to paraspeckles. This addresses the hypothesis that individual IMP protein activities determine cargo nuclear access to influence cell fate outcomes. We previously demonstrated that modulating IMPα2 levels alters paraspeckle protein 1 (PSPC1) nuclear accumulation and affects its localization into a subnuclear domain that affects RNA metabolism and cell survival, the paraspeckle. An automated, high throughput, image analysis pipeline with customisable outputs was created using Imaris software coupled with Python and R scripts; this allowed non-subjective identification of nuclear foci, nuclei and cells. HeLa cells transfected to express exogenous full-length and transport-deficient IMPs were examined using SFPQ and PSPC1 as paraspeckle markers. Thousands of cells and >100,000 nuclear foci were analysed in samples with modulated IMPα functionality. This analysis scale enabled discrimination of significant differences between samples where paraspeckles inherently display broad biological variability. The relative abundance of paraspeckle cargo protein(s) and individual IMPs each influenced nuclear foci numbers and size. This method provides a generalizable high throughput analysis platform for investigating how regulated nuclear protein transport controls cellular activities. PMID:28240251

  6. Development of a pipeline for automated, high-throughput analysis of paraspeckle proteins reveals specific roles for importin α proteins.


    Major, Andrew T; Miyamoto, Yoichi; Lo, Camden Y; Jans, David A; Loveland, Kate L


    We developed a large-scale, unbiased analysis method to measure how functional variations in importin (IMP) α2, IMPα4 and IMPα6 each influence PSPC1 and SFPQ nuclear accumulation and their localization to paraspeckles. This addresses the hypothesis that individual IMP protein activities determine cargo nuclear access to influence cell fate outcomes. We previously demonstrated that modulating IMPα2 levels alters paraspeckle protein 1 (PSPC1) nuclear accumulation and affects its localization into a subnuclear domain that affects RNA metabolism and cell survival, the paraspeckle. An automated, high throughput, image analysis pipeline with customisable outputs was created using Imaris software coupled with Python and R scripts; this allowed non-subjective identification of nuclear foci, nuclei and cells. HeLa cells transfected to express exogenous full-length and transport-deficient IMPs were examined using SFPQ and PSPC1 as paraspeckle markers. Thousands of cells and >100,000 nuclear foci were analysed in samples with modulated IMPα functionality. This analysis scale enabled discrimination of significant differences between samples where paraspeckles inherently display broad biological variability. The relative abundance of paraspeckle cargo protein(s) and individual IMPs each influenced nuclear foci numbers and size. This method provides a generalizable high throughput analysis platform for investigating how regulated nuclear protein transport controls cellular activities.

  7. Outbreak of Infection with Multidrug-Resistant Klebsiella pneumoniae Carrying blaIMP-8 in a University Medical Center in Taiwan

    PubMed Central

    Yan, Jing-Jou; Ko, Wen-Chien; Tsai, Shu-Huei; Wu, Hsiu-Mei; Wu, Jiunn-Jong


    Klebsiella pneumoniae strains with the transferable carbapenem-hydrolyzing metallo-β-lactamases, which include IMP- and VIM-type enzymes, remain extremely rare. To investigate whether IMP- or VIM-producing K. pneumoniae isolates had spread at a university medical center in Taiwan, a total of 3,458 clinical isolates of K. pneumoniae consecutively collected in 1999 and 2000 were tested by the agar diffusion method, colony hybridization, PCR, and nucleotide sequencing. A total of 40 isolates (1.2%), or 17 nonrepetitive isolates, from 16 patients were found to carry blaIMP-8, a metallo-β-lactamase gene recently identified from a K. pneumoniae strain in Taiwan. Carriage of blaVIM or other blaIMP genes was detected in none of the remaining isolates. Of the 17 nonrepetitive blaIMP-8-positive isolates, 15 isolates (88.2%) appeared susceptible to imipenem (MICs, ≤4 μg/ml) and meropenem (MICs, ≤1 μg/ml), indicating the difficulty in detecting blaIMP-8 in K. pneumoniae by routine susceptibility tests; 14 isolates (82.4%) produced SHV-12 as well; and 14 isolates (82.4%) were also resistant to fluoroquinolones. The organisms caused wound infections in eight patients and bloodstream infections in three patients. They were not directly associated with the death of nine patients. Before the recovery of the blaIMP-8-positive isolates, all 16 patients had undergone various surgical procedures, and 15 patients had been admitted to the surgical intensive care unit, suggesting a nosocomial outbreak. Two major patterns were observed by pulsed-field gel electrophoresis for 14 of the 17 nonrepetitive isolates, indicating that the clonal spread was mainly responsible for the outbreak. PMID:11724857

  8. Increased prevalence and clonal dissemination of multidrug-resistant Pseudomonas aeruginosa with the blaIMP-1 gene cassette in Hiroshima.


    Kouda, Syuntaro; Ohara, Masaru; Onodera, Makoto; Fujiue, Yoshihiro; Sasaki, Megumi; Kohara, Tadahiro; Kashiyama, Seiya; Hayashida, Shizue; Harino, Toshie; Tsuji, Takahiro; Itaha, Hideyuki; Gotoh, Naomasa; Matsubara, Akio; Usui, Tsuguru; Sugai, Motoyuki


    The aim of this study was to evaluate the dissemination of metallo-beta-lactamase (MBL)-encoding genes among multidrug-resistant (MDR) Pseudomonas aeruginosa isolates recovered from major hospitals in the Hiroshima region. During July to December from 2004 to 2006, a surveillance of eight major hospitals in the Hiroshima region identified 387 non-duplicate isolates resistant to imipenem (MIC >or= 16 mg/L). They were screened for resistance to amikacin (MIC >or= 64 mg/L) and ciprofloxacin (MIC >or= 4 mg/L) and MBL-encoding genes. The structure of the variable regions of the integrons was determined using PCR mapping. Clonality was assessed using PFGE and multilocus sequence typing (MLST). The frequency of MBL-positive isolates in MDR P. aeruginosa isolates significantly increased from 42.3% in 2004 to 81.4% in 2006. Most of the MBL-positive isolates produced IMP-1 followed by VIM-2. The bla(IMP-1) and bla(VIM-2) genes were present in class 1 integrons. Characterization of the variable regions of the integron showed the presence of six different gene cassette arrays in bla(IMP-1) cassettes and a single array in bla(VIM-2) cassettes. The IMP-1 producers belonged to two clonal lineages using PFGE and MLST analyses and the integron variations correlated well with the clonal complexes. Among them, strains positive for a newly identified In113-derived bla(IMP-1) gene cassette array were most widely distributed in Hiroshima. This study shows a dramatic increase in MBL genes, primarily bla(IMP-1), in MDR P. aeruginosa isolates in Hiroshima during these 3 years. In addition, MDR P. aeruginosa with the newly discovered In113-derived bla(IMP-1) gene cassette array appears to be clonally expanding.

  9. Assessment of Hemodynamic Compromise Using Computed Tomography Perfusion in Combination with (123)I-IMP Single-Photon Emission Computed Tomography without Acetazolamide Challenge Test.


    Hashimoto, Atsumu; Mikami, Takeshi; Komatsu, Katsuya; Noshiro, Shouhei; Hirano, Tohru; Wanibuchi, Masahiko; Mikuni, Nobuhiro


    The acetazolamide challenge test in conjunction with (123)I-IMP single-photon emission computed tomography (SPECT) is a known method of assessing cerebrovascular reserve capacity. In this study, we investigated whether CT perfusion in combination with resting state (123)I-IMP SPECT could be used instead of the acetazolamide challenge test to evaluate hemodynamic compromise in patients with atherosclerotic occlusive disease. Twenty consecutive patients with unilateral internal carotid artery or middle cerebral artery steno-occlusive disease were enrolled. (123)I-IMP SPECT was performed with and without the acetazolamide challenge test, and with CT perfusion. Cerebral blood flow (CBF), cerebral blood volume, and mean transit time (MTT) obtained by CT perfusion were compared with CBF and cerebrovascular reactivity (CVR) obtained by (123)I-IMP SPECT. The asymmetry ratio of MTT as measured by CT perfusion showed a strong correlation with the CVR to acetazolamide as measured by (123)I-IMP SPECT (ρ = -.780, P <.001). Based on the CBF obtained through (123)I-IMP SPECT and the MTT obtained through CT perfusion, hemodynamic compromise was detected with high sensitivity (1.000) and specificity (.929), and a cutoff value of 30% was found to be suitable for the asymmetry ratio of MTT. MTT prolongation was significantly improved after revascularization surgery in hemodynamic compromise (P = .028). MTT as measured by CT perfusion in combination with CBF as measured by resting state (123)I-IMP SPECT may be useful for evaluating hemodynamic compromise as an alternative to the acetazolamide challenge test. Copyright © 2017 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  10. In169, a new class 1 integron that encoded bla(IMP-18) in a multidrug-resistant Pseudomonas aeruginosa isolate from Mexico.


    Sánchez-Martinez, Guillermina; Garza-Ramos, Ulises Jesús; Reyna-Flores, Fernando Luis; Gaytán-Martínez, Jesús; Lorenzo-Bautista, Isaí Guillermo; Silva-Sanchez, Jesús


    Carbapenem resistance in Pseudomonas aeruginosa may be due to the presence of metallo-beta-lactamases (MbetaL). The genes that encode these enzymes can be located in association with aminoglycoside-modifying enzymes on class 1 integrons. This study describes the bla(IMP-18) class 1 integron array (In169) from a carbapenem-resistant P. aeruginosa clinical isolate obtained at the Centro Medico Nacional La Raza (CMNR) in Mexico City and compares it to other bla(IMP)-type producers. Twenty six multiresistant P. aeruginosa clinical isolates were recovered between June and December 2004 and tested by MicroScan and CLSI agar dilution methods. The MbetaL production was screened by a disk approximation test and MbetaL Etest strips, whereas MbetaL genes and integrons were detected using PCR primers. DNA sequence analysis was carried out by BLAST, and epidemiological typing was performed by pulsed-field gel electrophoresis (PFGE). A Southern hybridization analysis was performed with a bla(IMP) specific DNA probe. Nine of 26 P. aeruginosa isolates were imipenem-resistant with unique PFGE patterns (no clonal relation), and only one strain (5106) was positive for MbetaL production, corresponding to the IMP-type. The class 1 integron encoding the MbetaL was characterized: it contained the IMP-18, two copies of aadA2 and OXA-2 genes, corresponding to a new class 1 integron array, denoted In169. P. aeruginosa isolate 5106 is genetically related to bla(IMP-18) positive P. aeruginosa isolate from a distant hospital (Hospital Infantil de Morelia). This report is the first to describe the bla(IMP-18) in two genetically related isolates from two different institutions. Copyright 2010 IMSS. Published by Elsevier Inc. All rights reserved.

  11. Development of a simple non-invasive microsphere quantification method for cerebral blood flow using I-123-IMP.


    Ofuji, Asato; Mimura, Hiroaki; Yamashita, Kosuke; Takaki, Akihiro; Sone, Teruki; Ito, Shigeki


    In clinical practice, measurement of the rCBF has mainly been conducted by I-123-N-isopropyl-p-iodoamphetamine ((123)I-IMP) SPECT using the microsphere (MS) method, with continuous arterial blood sampling. While several non-invasive (123)I-IMP quantification methods have been developed, their accuracy has been shown to be lower than that of the MS method. Therefore, a non-invasive quantification method for use in routine clinical practice is being sought. The purpose of this study was to develop a simple non-invasive (123)I-IMP quantification method (SIMS method) with a simple input function-determining protocol based on the MS method. The input function for the SIMS method was determined using the administered dose and the integrated lung washout ratio obtained by analyzing the count-time activity curve of the pulmonary artery and lung on dynamic chest images. The mean CBF (mCBF) and input function measured in 80 patients by the SIMS method was compared with those determined using the MS method. A good correlation was observed between the counts measured by continuous arterial blood sampling in the MS method and the estimated counts by image analysis in the new method (r = 0.94, p < 0.01). Similarly, a good correlation was observed between the mCBF values determined by the MS method and the SIMS method (r = 0.83, p < 0.01). The mCBF values determined by the SIMS method were closely consistent with the values obtained by the MS method. This finding indicates the possibility of use of the SIMS method for routine clinical study.

  12. Detection and Genetic Characterization of Metallo-β-Lactamase IMP-1 and VIM-2 in Pseudomonas aeruginosa Strains From Different Hospitals in Kermanshah, Iran.


    Abiri, Ramin; Mohammadi, Pantea; Shavani, Navid; Rezaei, Mansour


    Pseudomonas aeruginosais a frequent nosocomial pathogen that causes severe diseases in many settings. Carbapenems, including meropenem and imipenem, are effective antibiotics against this organism. However, the use of carbapenems has been hampered by the emergence of strains resistant to carbapenemsvia different mechanisms such as the production of metallo-β-lactamases (MBLs), which hydrolyze all carbapenems. Several kinds of MBLs have been reported, among them VIM and IMP types being the most clinically significant carbapenemases. We aimed to determine the distribution of bla VIM-2 and bla IMP-1 transferable genes encoding MBLs in P. aeruginosa isolated from three academic hospitals in Kermanshah. From 22nd June to 22nd September 2012, 225 isolates of P. aeruginosa were collected. These isolates were tested for antibiotic susceptibility with the Kirby-Bauer disk-diffusion method, and the MBLs were assessed using the imipenem-EDTA double-disk synergy test. The isolates were investigated for bla VIM - 2 and bla IMP-1 genes using polymerase chain reaction. Among the 225 isolates, 33.7% (76/225) and 18.1% (41/225) were resistant to imipenem and meropenem, respectively. Of the 76 imipenem-resistant P. aeruginosa strains, 45 (59.2%) were positive for MBLs, 34 (75%) strains carried the bla IMP-1 gene, and 1 (2.2%) strain carried the bla VIM - 2 gene. Our results showed that there was a high frequency of IMP-1 positive P. aeruginosa in the different wards of the hospitals.

  13. Early differential diagnosis between Alzheimer's disease and dementia with Lewy bodies: Comparison between (18)F-FDG PET and (123)I-IMP SPECT.


    Chiba, Yuhei; Iseki, Eizo; Fujishiro, Hiroshige; Ota, Kazumi; Kasanuki, Koji; Suzuki, Masaru; Hirayasu, Yoshio; Arai, Heii; Sato, Kiyoshi


    Both (18)F-fluorodeoxyglucose (FDG) positron emission tomography (PET) and (123)I-iodoamphetamine (IMP) single-photon emission computed tomography (SPECT) have been used for the differential diagnosis of Alzheimer's disease (AD) and dementia with Lewy bodies (DLB). Less information is available, however, regarding the differential diagnosis of mild cognitive impairment (MCI) due to AD and MCI due to DLB. We examined nine AD patients (AD group), nine DLB patients (DLB group), eight MCI due to AD patients (MCI-AD group), and nine MCI due to DLB patients (MCI-DLB group) with FDG PET and IMP SPECT using a well-characterized normal database and a stereotactic extraction estimation method. In the AD and DLB groups, receiver operating characteristic (ROC) analysis in the occipital regions showed significant accuracy of both FDG PET and IMP SPECT for the differential diagnosis. In the MCI-AD and MCI-DLB groups, ROC analysis showed significant accuracy of only FDG PET for the differential diagnosis. Both FDG PET and IMP SPECT would be useful for the differential diagnosis between AD and DLB. For the differential diagnosis of MCI-AD versus MCI-DLB, FDG PET would be more useful than IMP SPECT. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. A summary of the mechanical design, testing and performance of the IMP-H and J attitude control systems

    NASA Technical Reports Server (NTRS)

    Metzger, J. R.


    The main aspects of the attitude control system used on both the IMP-H and J spacecraft are presented. The mechanical configuration is described. Information on all the specific components comprising the flight system is provided. The acceptance and qualification testing of both individual components and the installed system are summarized. Functional information regarding the operation and performance in relation to the orbiting spacecraft and its mission is included. Related topics which are discussed are: (1) safety requirements, (2) servicing procedures, (3) anomalous behavior, and (4) pyrotechnic devices.

  15. Klebsiella oxytoca-producing IMP-1 Detected as the First Strain of Carbapenem-resistant Enterobacteriaceae in Our Hospital.


    Hagiya, Hideharu; Ogawa, Hiroko; Takahashi, Yusuke; Yamamoto, Akira; Otsuka, Fumio


    We herein report a case of Klebsiella oxytoca-producing IMP-1 that was detected as a first isolate of carbapenem-resistant Enterobacteriaceae (CRE) at our facility. Since K. oxytoca is an uncommon strain for CRE, we speculated that the resistant organism had already spread out inside the hospital. Metallo-β-lactamases promotes antibiotic resistance in Enterobacteriaceae, which potentially yields problematic issues in clinical settings. Active surveillance of antibiotic resistant strains is important and should be repeatedly highlighted. Furthermore, appropriate methods should be established to detect highly resistant strains.

  16. Solar wind deceleration and MHD turbulence in the earth's foreshock region - ISEE 1 and 2 and IMP 8 observations

    NASA Technical Reports Server (NTRS)

    Bonifazi, C.; Moreno, G.; Russell, C. T.; Lazarus, A. J.; Sullivan, J. D.


    The interaction of the solar wind with ions backstreaming from the earth's bow shock is investigated using plasma and magnetic field measurements on ISEE 1 and 2 and IMP 8 at widely separated positions in the earth's foreshock. This technique separates temporal and spatial variations within the foreshock. It is found that the solar wind acceleration associated with backstreaming ions is correlated with the amplitude of the MHD turbulence, and that the largest decelerations are seen close to the bow shock. The density of the backstreaming ion beam is strongly correlated with distance from the shock, and decreases by about a factor of three in a distance of about 3R(e).

  17. Antigenic definition of plasma membrane proteins of Bacillus Calmette-Guérin: predominant activation of human T cells by low-molecular-mass integral proteins.


    Mehrotra, J; Mittal, A; Rastogi, A K; Jaiswal, A K; Bhandari, N K; Sinha, S


    Mycobacterial plasma membrane proteins, in particular the detergent-soluble or 'integral' ones, comprise a class of mostly unexplored antigens capable of inducing potent activation of human T cells. Plasma membrane isolated from culture-grown Bacillus Calmette-Guérin (BCG; Indian vaccine; Danish strain) was subjected to a Triton X-114-based biphasic extraction procedure for isolation of peripheral (water-soluble) and integral proteins (PMP and IMP). A distinction between the two protein pools was evident from results of SDS-PAGE and immunoblotting using antisera raised in rabbits. An enzyme-linked immunosorbant assay with a panel of WHO-IMMYC monoclonal antibodies against various mycobacterial antigens revealed that three well-known antigens, 19 kDa, 33/36 kDa (proline rich) and 38 kDa (PstS homologue), were part of the IMP pool; and another such antigen, 14/16 kDa alpha-crystallin homologue, partly constituted the PMP pool. Apparently, antigenically distinct species of the immunomodulatory moiety lipoarabinomannan partitioned in aqueous and detergent phases. Human T-cell proliferation assays in donors comprising tuberculoid leprosy and pulmonary tuberculosis patients and healthy BCG vaccinees showed significantly greater potency of IMP over PMP and this immunodominance appeared to be directed towards CD4+ cells. IMP of < 56 kDa were resolved by 'continuous elution SDS-PAGE' into 15 fractions which, after extraction of SDS, were used in T-cell proliferation assays for the identification of immunodominant constituents. Proteins falling within three low-molecular-mass zones (all < 35 kDa) performed better than the rest, particularly a approximately 22 kDa fraction, which strongly stimulated T cells from all five donors. Partial overlap between IMP and secreted proteins, as noticed in this study, could provide clues to immunodominance of the latter. The apparent uniqueness and a high T-cell activating potency make mycobacterial IMP attractive candidates for designing

  18. Identification of human leukocyte antigen-A24-restricted epitope peptides derived from gene products upregulated in lung and esophageal cancers as novel targets for immunotherapy.


    Suda, Takako; Tsunoda, Takuya; Daigo, Yataro; Nakamura, Yusuke; Tahara, Hideaki


    For the development of cancer vaccine therapies, we have searched for possible epitope peptides that can elicit cytotoxic T lymphocytes (CTL) to the TTK protein kinase (TTK), lymphocyte antigen 6 complex locus K (LY6K) and insulin-like growth factor (IGF)-II mRNA binding protein 3 (IMP-3), which were previously identified to be transactivated in the majority of lung and esophageal cancers. We screened 31, 17 and 17 candidate human leukocyte antigen (HLA)-A*2402-binding peptides to parts of TTK, LY6K and IMP-3, respectively. As a result, we successfully established strong CTL clones stimulated by TTK-567 (SYRNEIAYL), LY6K-177 (RYCNLEGPPI) and IMP-3-508 (KTVNELQNL) that have specific cytotoxic activities against the HLA-A24-positive target cells pulsed with the candidate peptides. Subsequent analysis of the CTL clones also revealed their cytotoxic activities against lung and esophageal tumor cells that endogenously express TTK, LY6K or IMP-3. A cold target inhibition assay further confirmed that the CTL cell clones specifically recognized the MHC class I–peptide complex. Our results strongly imply that TTK, LY6K and IMP-3 are novel tumor-associated antigens recognized by CTL, and TTK-567 (SYRNEIAYL), LY6K-177 (RYCNLEGPPI) and IMP-3-508 (KTVNELQNL) are HLA-A24-restricted epitope peptides that can induce potent and specific immune responses against lung and esophageal cancer cells expressing TTK, LY6K and IMP-3.

  19. Differentially expressed myo-inositol monophosphatase gene (CaIMP) in chickpea (Cicer arietinum L.) encodes a lithium-sensitive phosphatase enzyme with broad substrate specificity and improves seed germination and seedling growth under abiotic stresses.


    Saxena, Saurabh C; Salvi, Prafull; Kaur, Harmeet; Verma, Pooja; Petla, Bhanu Prakash; Rao, Venkateswara; Kamble, Nitin; Majee, Manoj


    myo-Inositol monophosphatase (IMP) is an essential enzyme in the myo-inositol metabolic pathway where it primarily dephosphorylates myo-inositol 1-phosphate to maintain the cellular inositol pool which is important for many metabolic and signalling pathways in plants. The stress-induced increased accumulation of inositol has been reported in a few plants including chickpea; however, the role and regulation of IMP is not well defined in response to stress. In this work, it has been shown that IMP activity is distributed in all organs in chickpea and was noticeably enhanced during environmental stresses. Subsequently, using degenerate oligonucleotides and RACE strategy, a full-length IMP cDNA (CaIMP) was cloned and sequenced. Biochemical study revealed that CaIMP encodes a lithium-sensitive phosphatase enzyme with broad substrate specificity, although maximum activity was observed with the myo-inositol 1-phosphate and l-galactose 1-phosphate substrates. Transcript analysis revealed that CaIMP is differentially expressed and regulated in different organs, stresses and phytohormones. Complementation analysis in Arabidopsis further confirmed the role of CaIMP in l-galactose 1-phosphate and myo-inositol 1-phosphate hydrolysis and its participation in myo-inositol and ascorbate biosynthesis. Moreover, Arabidopsis transgenic plants over-expressing CaIMP exhibited improved tolerance to stress during seed germination and seedling growth, while the VTC4/IMP loss-of-function mutants exhibited sensitivity to stress. Collectively, CaIMP links various metabolic pathways and plays an important role in improving seed germination and seedling growth, particularly under stressful environments.

  20. Metallo-β-Lactamase-Producing Pseudomonas spp. in Korea: High Prevalence of Isolates with VIM-2 Type and Emergence of Isolates with IMP-1 Type

    PubMed Central

    Lee, Kyungwon; Park, Ae Ja; Kim, Moon Yeun; Lee, Hee Joo; Cho, Ji-Hyun; Kang, Jung Oak; Yong, Dongeun


    Purpose Two Korean nationwide studies showed that metallo-β-lactamases (MBLs)-producing-Pseudomonas spp. are not rare. The aim of this study was to assess the trends of MBL-producing isolates among imipenem-resistant isolates of Pseudomonas spp. Materials and Methods Imipenem-resistant clinical isolates were collected from 23 hospitals and one commercial laboratory participating in the KONSAR program in 2005. Polymerase chain reaction (PCR) was used to detect MBL genes. Results Alleles of MBL genes were detected in 10.8% of 415 Pseudomonas aeruginosa and 66.7% of 12 P. putida isolates from 18 of 24 hospitals/laboratory. Among the 14 IMP-1-like and 39 VIM-2-like MBLs, emergence of IMP-6 was detected for the first time. Conclusion Prevalence of MBL-producing P. aeruginosa has not significantly increased, but IMP-6 emerged in P. aeruginosa. PMID:19568593

  1. Antibiotic resistance pattern and evaluation of metallo-beta lactamase genes (VIM and IMP) in Pseudomonas aeruginosa strains producing MBL enzyme, isolated from patients with secondary immunodeficiency.


    Shirani, Kiana; Ataei, Behrouz; Roshandel, Fardad


    One of the most common causes of hospital-acquired secondary infections in hospitalized patients is Pseudomonas aeruginosa. The aim of this study is to evaluate the expression of IMP and VIM in Pseudomonas aeruginosa strains (carbapenem resistant and producer MBL enzyme) in patients with secondary immunodeficiency. In a cross sectional study, 96 patients with secondary immunodeficiency hospitalized in the Al-Zahra hospital were selected. Carbapenem resistant strains isolated and modified Hodge test was performed in order to confirm the presence of the metallo carbapenemase enzyme. Under the standard conditions they were sent to the central laboratory for investigating nosocomial infection Multiplex PCR. Of 96 samples 28.1% were IMP positive, 5.2% VIM positive and 3.1% both VIM and IMP positive. The prevalence of multidrug resistance in the IMP and/or VIM negative samples was 29%, while all 5 VIM positive samples have had multidrug resistance. Also the prevalence of multi-drug resistance in IMP positive samples were 96.3% and in IMP and VIM positive samples were 100%. According to Fisher's test, the prevalence of multi-drug resistance based on gene expression has significant difference (P < 0.001). Based on the results of this study it can be concluded that, a significant percentage of patients with secondary immunodeficiency that suffer nosocomial infections with multidrug resistance, especially Pseudomonas aeruginosa, are probably MBL-producing gene positive. Therefore the cause of infection should be considered in the hospital care system to identify their features, the presence of genes involved in the development of multi-drug resistance and antibiotic therapy.

  2. Antibiotic resistance pattern and evaluation of metallo-beta lactamase genes (VIM and IMP) in Pseudomonas aeruginosa strains producing MBL enzyme, isolated from patients with secondary immunodeficiency

    PubMed Central

    Shirani, Kiana; Ataei, Behrouz; Roshandel, Fardad


    Background: One of the most common causes of hospital-acquired secondary infections in hospitalized patients is Pseudomonas aeruginosa. The aim of this study is to evaluate the expression of IMP and VIM in Pseudomonas aeruginosa strains (carbapenem resistant and producer MBL enzyme) in patients with secondary immunodeficiency. Materials and Methods: In a cross sectional study, 96 patients with secondary immunodeficiency hospitalized in the Al-Zahra hospital were selected. Carbapenem resistant strains isolated and modified Hodge test was performed in order to confirm the presence of the metallo carbapenemase enzyme. Under the standard conditions they were sent to the central laboratory for investigating nosocomial infection Multiplex PCR. Results: Of 96 samples 28.1% were IMP positive, 5.2% VIM positive and 3.1% both VIM and IMP positive. The prevalence of multidrug resistance in the IMP and/or VIM negative samples was 29%, while all 5 VIM positive samples have had multidrug resistance. Also the prevalence of multi-drug resistance in IMP positive samples were 96.3% and in IMP and VIM positive samples were 100%. According to Fisher’s test, the prevalence of multi-drug resistance based on gene expression has significant difference (P < 0.001). Conclusion: Based on the results of this study it can be concluded that, a significant percentage of patients with secondary immunodeficiency that suffer nosocomial infections with multidrug resistance, especially Pseudomonas aeruginosa, are probably MBL-producing gene positive. Therefore the cause of infection should be considered in the hospital care system to identify their features, the presence of genes involved in the development of multi-drug resistance and antibiotic therapy. PMID:27563634

  3. Proteins.

    ERIC Educational Resources Information Center

    Doolittle, Russell F.


    Examines proteins which give rise to structure and, by virtue of selective binding to other molecules, make genes. Binding sites, amino acids, protein evolution, and molecular paleontology are discussed. Work with encoding segments of deoxyribonucleic acid (exons) and noncoding stretches (introns) provides new information for hypotheses. (DH)

  4. Proteins.

    ERIC Educational Resources Information Center

    Doolittle, Russell F.


    Examines proteins which give rise to structure and, by virtue of selective binding to other molecules, make genes. Binding sites, amino acids, protein evolution, and molecular paleontology are discussed. Work with encoding segments of deoxyribonucleic acid (exons) and noncoding stretches (introns) provides new information for hypotheses. (DH)

  5. Protein

    USDA-ARS?s Scientific Manuscript database

    Proteins are the major structural and functional components of all cells in the body. They are macromolecules that comprise 1 or more chains of amino acids that vary in their sequence and length and are folded into specific 3-dimensional structures. The sizes and conformations of proteins, therefor...

  6. The 2-D Curvature of Large Angle Interplanetary MHD Discontinuity Surfaces: IMP-8 and WIND Observations

    NASA Astrophysics Data System (ADS)

    Lepping, R. P.; Wu, C.; McClernan, K.


    This study examines the degree of 2-D curvature of solar wind directional discontinuity (DD) surfaces at 1 AU using magnetic field, density, and velocity data from the WIND and IMP-8 spacecraft for a large number (N = 134) of carefully selected events having large ``discontinuity angles" of 90° or greater. The discontinuity angle (ω ) is measured in the DDs current sheet, the normal to which is estimated by field variance analysis. The fundamental analysis depends on estimates of these DD surface normals at the two spacecraft, and the DDs center-times and positions. On average, the transit time from one DD sighting to the other was 36 minutes, and the associated distance along the normal direction was 137 RE. The transition-interval lengths across the DDs are translated into thicknesses and examined for the amount of change between the two spacecraft observing points; average thickness is relatively large, 14 RE. All relevant quantities are examined statistically to establish their distributions, average, and degree of change. A weighted average of the radius of curvature is estimated to be 380 RE, but its most probably value is 290 RE. The average ω is 140° with a relatively large spread (σ =28°). The average direction of propagation is: longitude = 194° and latitude = 7° (but < ∣ lat∣ > = 27°). Various parameters are studied with respect to DD type, defined in terms the ratio of speed of propagation to net speed (``ratio") of the DD surface, (the RD ratio is high and the TD ratio is very low or zero). The results by this definition of type are favorably compared to those from the more conventional method, which depends on the absolute strength of the normal component of the magnetic field. There is little difference in any average parameter value according to type. However, the average ω appears to depend slightly on type with the < ω > for the RDs being smaller. A DDs type was shown to change in either direction between the two observation

  7. Two-dimensional curvature of large angle interplanetary MHD discontinuity surfaces: IMP-8 and WIND observations

    NASA Astrophysics Data System (ADS)

    Lepping, R. P.; Wu, C.-C.; McClernan, K.


    This study examines the degree of two-dimensional curvature of solar wind directional discontinuity (DD) surfaces at 1 AU using magnetic field, density, and velocity data from the WIND and IMP-8 spacecraft for a large number (N = 134) of carefully selected events having large "discontinuity angles" of 90° or greater. The discontinuity angle (ω) is measured in the DD's current sheet, the normal (n) to which is estimated by field variance analysis. The fundamental analysis depends on estimates of these DD surface normals at the two spacecraft and the DD's center-times and positions. On average, the transit time from one DD sighting to the other was 36 minutes, and the associated distance along the normal direction was 137 RE. The transition-interval lengths across the DDs are translated into thicknesses and examined for the amount of change between the two spacecraft observing points. The average thickness is relatively large, 14 RE.; the most probable thickness is ≈6 RE. All relevant quantities are examined statistically to establish their distributions, average, and degree of change. A weighted average of the radius of curvature is estimated to be 380 RE, but its most probable value is 290 RE. The average ω is 140° with a relatively large spread (σ = 28°). The average direction of propagation is: longitude (ϕn) = 194° and latitude (θn) = 7° (but <∣θn∣> = 27°), where ϕn = 0° is sunward and θn = 0° is the ecliptic plane. Various parameters are studied with respect to DD type, i.e., rotational or tangential discontinuity (RD or TD), defined in terms of the "ratio" (in percent) of speed of propagation to net speed of the DD surface, where the net speed is the sum of the convection velocity (along n) plus the propagation speed. The RD %-ratio is moderately small, but the TD ratio is very small or zero. The results by this definition of type are favorably compared to those from the more conventional method, which depends on the absolute strength of

  8. The Tubulation Activity of a Fission Yeast F-BAR Protein Is Dispensable for Its Function in Cytokinesis.


    McDonald, Nathan A; Takizawa, Yoshimasa; Feoktistova, Anna; Xu, Ping; Ohi, Melanie D; Vander Kooi, Craig W; Gould, Kathleen L


    F-BAR proteins link cellular membranes to the actin cytoskeleton in many biological processes. Here we investigated the function of the Schizosaccharomyces pombe Imp2 F-BAR domain in cytokinesis and find that it is critical for Imp2's role in contractile ring constriction and disassembly. To understand mechanistically how the F-BAR domain functions, we determined its structure, elucidated how it interacts with membranes, and identified an interaction between dimers that allows helical oligomerization and membrane tubulation. Using mutations that block either membrane binding or tubulation, we find that membrane binding is required for Imp2's cytokinetic function but that oligomerization and tubulation, activities often deemed central to F-BAR protein function, are dispensable. Accordingly, F-BARs that do not have the capacity to tubulate membranes functionally substitute for the Imp2 F-BAR, establishing that its major role is as a cell-cycle-regulated bridge between the membrane and Imp2 protein partners, rather than as a driver of membrane curvature.

  9. A Family of Insulin-Like Growth Factor II mRNA-Binding Proteins Represses Translation in Late Development

    PubMed Central

    Nielsen, Jacob; Christiansen, Jan; Lykke-Andersen, Jens; Johnsen, Anders H.; Wewer, Ulla M.; Nielsen, Finn C.


    Insulin-like growth factor II (IGF-II) is a major fetal growth factor. The IGF-II gene generates multiple mRNAs with different 5′ untranslated regions (5′ UTRs) that are translated in a differential manner during development. We have identified a human family of three IGF-II mRNA-binding proteins (IMPs) that exhibit multiple attachments to the 5′ UTR from the translationally regulated IGF-II leader 3 mRNA but are unable to bind to the 5′ UTR from the constitutively translated IGF-II leader 4 mRNA. IMPs contain the unique combination of two RNA recognition motifs and four hnRNP K homology domains and are homologous to the Xenopus Vera and chicken zipcode-binding proteins. IMP localizes to subcytoplasmic domains in a growth-dependent and cell-specific manner and causes a dose-dependent translational repression of IGF-II leader 3 –luciferase mRNA. Mouse IMPs are produced in a burst at embryonic day 12.5 followed by a decline towards birth, and, similar to IGF-II, IMPs are especially expressed in developing epithelia, muscle, and placenta in both mouse and human embryos. The results imply that cytoplasmic 5′ UTR-binding proteins control IGF-II biosynthesis during late mammalian development. PMID:9891060

  10. Protein


    ... Search for: Harvard T.H. Chan School of Public Health Email People Departments Calendar Careers Give my.harvard ... Nutrition Source Harvard T.H. Chan School of Public Health > The Nutrition Source > What Should I Eat? > Protein ...

  11. The Wor1-like protein Fgp1 regulates pathogenicity, toxin synthesis and reproduction in the phytopathogenic fungus Fusarium graminearum

    USDA-ARS?s Scientific Manuscript database

    WOR1 is a gene for a conserved fungal regulatory protein controlling the dimorphic switch and pathogenicity in Candida albicans and its ortholog in the plant pathogen Fusarium oxysporum, called SGE1, is also required for pathogenicity and expression of plant effector proteins. F. graminearum, an imp...

  12. Comparison of xenon enhanced CT (XeCT) and I-123 iodoamphetamine (SPECT/IMP) techniques for measurement of regional cerebral blood flow (rCBF)

    SciTech Connect

    Hellman, R.S.; Collier, B.D.; Kilgor, D.P.; Walsh, P.R.; Daniels, D.L.; Haughton, V.M.; Williams, A.L.; Pojunas, K.W.; Tikofsky, R.S.; Isitman, A.T.


    An ongoing prospective study measuring rCBF by XeCT(20 patients) and SPECT/IMP (84 patients) to date includes 9 patients examined by both techniques. XeCT was done as 3 contiguous transaxial tomograms using a scanner (GE 9800) equipped with dynamic imaging capability and a gas delivery system for inspiring 30% Xenon. SPECT/IMP was done 20 minutes after injection of 3-5 mCi of IMP, obtaining 64 views over 360 degrees, 40 sec./view, with either a GE 400T or 400ACT. SPECT/IMP images obtained with the 400ACT camera (specially designed for head work) were superior to those obtained with the older camera. For all 9 cases, both techniques demonstrated flow abnormalities at all sites of infarction identified by conventional CT (TCT): 1 patient with normal TCT also had normal rCBF examinations. Furthermore, 8 of 9 cases showed evidence of ischemia (regions with normal TCT and abnormal rCBF measurements) by both techniques.

  13. The Development Of New Space Charge Compensation Methods For Multi-Components Ion Beam Extracted From ECR Ion Source at IMP

    SciTech Connect

    Ma, L.; Zhao, H.W.; Cao, Y.; Zhao, H.Y.; Song, T. M.; He, W.; Zhang, Z.M.


    Two new space charge compensation methods developed in IMP are discussed in this paper. There are negative high voltage electrode method (NHVEM) and electronegative charge gas method (EGM). Some valuable experimental data have been achieved, especially using electronegative gas method in O6+ and O7+ dramatic and stable increasing of ion current was observed.

  14. An Existence Proof: Successful Joint Implementation of the IMP Curriculum and a 4 x 4 Block Schedule at a Suburban U.S. High School

    ERIC Educational Resources Information Center

    Kramer, Steven L.; Keller, Regina


    This "Brief Report" summarizes results from a study that investigated joint effects of two innovations adopted at a high school in an affluent suburban community in the northeast United States: 4 x 4 block scheduling and the "Standards"-based curriculum, the Interactive Mathematics Program (IMP).

  15. The recovery of the cosmic ray flux from maximum solar modulation at IMP-8 (1 AU) and at Pioneer (R 30 AU)

    NASA Technical Reports Server (NTRS)

    Mckibben, R. B.; Pyle, K. R.; Simpson, J. A.


    In the period 1980-84, observations of relativistic and low energy (30 E 70 MeV/n) cosmic ray nuclei from Pioneer 10 in the outer heliosphere and from IMP-8 at AU show that increases as well as decreases in intensity propagate outward at velocities equal to or greater than the average solar wind velocity.

  16. IMS/Satellite Situation Center report. Predicted orbit plots for IMP-H-1976. [Explorer 47 satellite

    NASA Technical Reports Server (NTRS)


    Predicted orbit plots are shown in three projections. The time period covered by each set of projections is 12 days 6 hours, corresponding approximately to the period of IMP-H satellite. The three coordinate systems used are the Geocentric Solar Ecliptic system (GSE), the Geocentric Solar Magnetospheric system (GSM), and the Solar Magnetic system (SM). For each of the three projections, time ticks and codes are given on the satellite trajectories. The codes are interpreted in the table at the base of each plot. Time is given in the table as year/day/decimal hour. The total time covered by each plot is shown at the bottom of each table. An additional variable is given in the table for each time tick. For the GSM and SM projection this variable is the geocentric distance to the satellite in earth radii, and for the GSE projection the variable is satellite ecliptic latitude in degrees.

  17. Thermal iron ions in high speed solar wind streams Detection by the IMP 7/8 energetic particle experiments

    NASA Technical Reports Server (NTRS)

    Mitchell, D. G.; Roelof, E. C.


    The first measurements of the abundance of iron ions in high speed (greater than 600 km/s) solar wind streams have been made with the NOAA/JHU energetic particles experiments (EPE) on IMP 7/8. The identification of iron ions is quantitatively established using 4 years of observations and heavy ion accelerator calibrations of detectors similar to those flown on the spacecraft. Preliminary estimates of the Fe/H ratio are within a factor of 2 of the adopted coronal abundance (0.00005), and there is some evidence that Fe/H may remain approximately constant within a given stream. In the peaks of fast streams (700-800 km/s), about 50 iron ion counts are obtained every 20 s, offering the possibility of studying the Fe/H ratio with approximately 1 m time resolution in high speed streams throughout the decline of Solar Cycle 20 and the rise of Solar Cycle 21.

  18. Galactic cosmic ray gradients, field-aligned and latitudinal, among Voyagers 1/2 and IMP-8

    NASA Technical Reports Server (NTRS)

    Roelof, E. C.; Decker, R. B.; Krimigis, S. M.; Venkatesan, D.; Lazarus, A. J.


    The present investigation represents a summary of a comprehensive analysis of the same subject conducted by Roelof et al. (1981). It is pointed out that the tandem earth-Jupiter trajectories of the Voyager 1/2 spacecraft, combined with baseline measurements from the earth-orbiting IMP 7/8 spacecraft, provide the first opportunity for unambiguously separating latitude from radial or field-aligned effects in galactic cosmic ray gradients. Attention is given to the method of data analysis, and the separation of field-aligned and latitudinal gradients. It is found that latitudinal gradients approximately equal to or greater than 1 percent per deg in the cosmic ray intensity were a common feature of the interplanetary medium between 1 and 5 AU in 1977-78. Except in the most disturbed periods, cosmic ray intensities are well-ordered in field-aligned structures.

  19. Anomaly in the quiet-time helium spectrum at 1 MeV per nucleon. [IMP measured solar spectra

    NASA Technical Reports Server (NTRS)

    Gloeckler, G.; Hovestadt, D.; Kleckler, B.; Vollmer, O.; Fan, C. Y.


    The IMP-8 satellite observed (in 1974-1975) an unexpected hump in the solar helium spectrum between 0.6 and about 3 MeV per nucleon and an enhanced helium abundance of up to 70 MeV per nucleon. The energy spectrum of helium below 0.6 MeV per nucleon was consistent with the proton spectrum below 1.5 MeV, while the proton-to-alpha ratio was about 30. The origin of this anomalous low-energy, quiet-time helium is as yet undecided. The alpha particles could be of solar origin, could have been accelerated in the heliosphere or could be of galactic origin.

  20. A study of solar flare soft X rays and their relation to particle events observed with IMP 8

    NASA Technical Reports Server (NTRS)

    Nonnast, J. H.; Armstrong, T. P.; Kohl, J. W.


    Data from the Johns Hopkins University Applied Physics Laboratory charged particle measurement experiment aboard IMP 8 was used to study solar flare events and find correlations between soft X rays (4-17 A) and particle events. The results show that a greater probability exists of observing a proton event if the observed soft X ray flare has a relatively large decay time. It is also found that the H-alpha brightening area is a good indicator of the strength of the soft X ray burst. Results also show that the strength of the soft X ray burst can be used to estimate a probability that a proton event will occur, along with the strength of that particle event.

  1. Multi-spacecraft study of five ICMEs and their shock waves: Helios, IMP-8 and Voyagers observations

    NASA Astrophysics Data System (ADS)

    Romero-Hernandez, E.; Gonzalez-Esparza, J. A.


    We studied the characteristics of five interplanetary coronal mass ejections (ICMEs) detected during the ascending phase of the solar cycle 21, employing simultaneous measurements of five spacecraft: Helios 1, Helios 2, IMP-8, Voyager 1, and Voyager 2. The study covers a time interval of four months (November 1977 to February 1978). We estimated different parameters of the ICMEs and their shock waves: magnetic cloud (MC) signatures, ICME and sheath radial width, ICME front velocity, total perpendicular pressure (Pt), and magnetosonic Mach number (M). In general, the ICME front velocities were slow (| V | ~ 457km/s); but four out of the five ICMEs were preceded by shock waves. Comparing the ICME radial width registered by the Voyagers, we find a clear expansion beyond 1.5 AU. We classified the Pt profiles in three groups depending on its signature within the ejecta (G1, G2, and G3) (Russell et al. (2005)), and we correlated them with the MC signatures.

  2. Digital photogrammetric analysis of the IMP camera images: Mapping the Mars Pathfinder landing site in three dimensions

    USGS Publications Warehouse

    Kirk, R.L.; Howington-Kraus, E.; Hare, T.; Dorrer, E.; Cook, D.; Becker, K.; Thompson, K.; Redding, B.; Blue, J.; Galuszka, D.; Lee, E.M.; Gaddis, L.R.; Johnson, J. R.; Soderblom, L.A.; Ward, A.W.; Smith, P.H.; Britt, D.T.


    This paper describes our photogrammetric analysis of the Imager for Mars Pathfinder data, part of a broader program of mapping the Mars Pathfinder landing site in support of geoscience investigations. This analysis, carried out primarily with a commercial digital photogrammetric system, supported by our in-house Integrated Software for Imagers and Spectrometers (ISIS), consists of three steps: (1) geometric control: simultaneous solution for refined estimates of camera positions and pointing plus three-dimensional (3-D) coordinates of ???103 features sitewide, based on the measured image coordinates of those features; (2) topographic modeling: identification of ???3 ?? 105 closely spaced points in the images and calculation (based on camera parameters from step 1) of their 3-D coordinates, yielding digital terrain models (DTMs); and (3) geometric manipulation of the data: combination of the DTMs from different stereo pairs into a sitewide model, and reprojection of image data to remove parallax between the different spectral filters in the two cameras and to provide an undistorted planimetric view of the site. These processes are described in detail and example products are shown. Plans for combining the photogrammetrically derived topographic data with spectrophotometry are also described. These include photometric modeling using surface orientations from the DTM to study surface microtextures and improve the accuracy of spectral measurements, and photoclinometry to refine the DTM to single-pixel resolution where photometric properties are sufficiently uniform. Finally, the inclusion of rover images in a joint photogrammetric analysis with IMP images is described. This challenging task will provide coverage of areas hidden to the IMP, but accurate ranging of distant features can be achieved only if the lander is also visible in the rover image used. Copyright 1999 by the American Geophysical Union.

  3. The Intense Microwave Prototype (IMP) free electron laser, 140 gigahertz microwave system for the microwave tokamak experiment (MTX)

    NASA Astrophysics Data System (ADS)

    Felker, B.; Ferguson, S. W.


    This paper will present the design, construction, and magnetic test results of the Intense Microwave Prototype (IMP) Free Electron Laser and all of the Microwave System special hardware developed for operation as a plasma heating source for the Microwave Tokamak Experiment. The test results presented will not include electron beam data for the FEL. Those tests will begin in November 1991. The master oscillator for the FEL is a 140 GHz, 400 kW gyrotron. Microwave power will be transmitted to the entrance to the wiggler by waveguide, miter bends, a waveguide-to-free-space vlasov mode convertor, and aluminum quasi-optical mirrors. The electron beam of approx. 2.5 k amps up to 7.5 MeV, and greater than 10(exp 8) A/ sq m-rad brightness will be introduced colinear with the microwave beam into the FEL. The IMP FEL is tunable and made up to both permanent and electromagnets. It is 5.5 meters long with a 10 cm period between shaped steel pole tips. The electromagnets are water cooled, carry up to 140 amps continuously and can be adjusted to vary the wiggler fields from 600 to 5500 gauss. The spent electron beam will be dumped into a water cooled, lead shielded carbon dump. The microwave pulses, at up to 5 GW power levels, will be transmitted through a series of mirrors to the Microwave Tokamak Experiment. Another swinging mirror will reflect the microwave power into a microwave dump/calorimeter for accelerator and FEL conditioning.

  4. Growth responses of entire and immunocastrated male pigs to dietary protein with and without ractopamine hydrochloride.


    Needham, T; Hoffman, L C; Gous, R M


    The interaction between dietary balanced protein, ractopamine (RAC) and Improvac (IMP) on the growth response of 120 individually penned male PIC© pigs was evaluated. The pigs entered the trial at 16 weeks of age and were assigned to 12 treatments using a 2×2×3 factorial design. Three balanced protein diets, formulated with standard illeal digestible lysine levels of 7.50 (low), 9.79 (medium) and 12.07 g/kg (high), were fed from 20 weeks. Improvac was administered at 16 and 20 weeks, the booster being given 4 weeks before slaughter. Ractopamine was supplemented at 10 mg/kg to the applicable treatments from 20 weeks. Live weight, backfat depth and food intake were measured on a weekly basis. Primary vaccination had no influence on the parameters measured. Immunocastration, RAC and higher protein diet treatments increased weight gain, but food intake was increased only with the use of IMP. Although weight gain increased in IMP-treated males, the increased feed intake resulted in their feed conversion efficiencies (FCE) being inferior to the intact controls. Feeding RAC only benefitted FCE when a high or medium protein diet was fed. Immunocastrates deposited more backfat after the booster vaccination than did entire males. Thus the cost of using RAC, IMP and of increasing dietary protein content needs to be weighed up against the additional revenue generated through the use of these interventions.

  5. Detection and Genetic Characterization of Metallo-β-Lactamase IMP-1 and VIM-2 in Pseudomonas aeruginosa Strains From Different Hospitals in Kermanshah, Iran

    PubMed Central

    Abiri, Ramin; Mohammadi, Pantea; Shavani, Navid; Rezaei, Mansour


    Background: Pseudomonas aeruginosais a frequent nosocomial pathogen that causes severe diseases in many settings. Carbapenems, including meropenem and imipenem, are effective antibiotics against this organism. However, the use of carbapenems has been hampered by the emergence of strains resistant to carbapenemsvia different mechanisms such as the production of metallo-β-lactamases (MBLs), which hydrolyze all carbapenems. Several kinds of MBLs have been reported, among them VIM and IMP types being the most clinically significant carbapenemases. Objectives: We aimed to determine the distribution of blaVIM-2 and blaIMP-1 transferable genes encoding MBLs in P. aeruginosa isolated from three academic hospitals in Kermanshah. Patients and Methods: From 22nd June to 22nd September 2012, 225 isolates of P. aeruginosa were collected. These isolates were tested for antibiotic susceptibility with the Kirby-Bauer disk-diffusion method, and the MBLs were assessed using the imipenem-EDTA double-disk synergy test. The isolates were investigated for blaVIM-2 and blaIMP-1 genes using polymerase chain reaction. Results: Among the 225 isolates, 33.7% (76/225) and 18.1% (41/225) were resistant to imipenem and meropenem, respectively. Of the 76 imipenem-resistant P. aeruginosa strains, 45 (59.2%) were positive for MBLs, 34 (75%) strains carried the blaIMP-1 gene, and 1 (2.2%) strain carried the blaVIM-2 gene. Conclusions: Our results showed that there was a high frequency of IMP-1 positive P. aeruginosa in the different wards of the hospitals. PMID:26495110

  6. Evaluation of Zataria MultiFlora Boiss and Carum copticum antibacterial activity on IMP-type metallo-beta-lactamase-producing Pseudomonas aeruginosa

    PubMed Central

    Fallah, F.; Taherpour, A.; Borhan, R.S.; Hashemi, A.; Habibi, M.; Sajadi Nia, R.


    Summary Carbapenem resistance due to acquired metallo-beta-lactamases (MBLs) is considered to be more serious than other resistance mechanisms. The aim of this study was to evaluate the antibacterial activity of Zataria multiflora Boiss and Carum copticum plants on IMP-producing P.aeruginosa strains. This experimental study was carried out on hospitalized burn patients during 2011 and 2012. Antibiotics and extracts susceptibility tests were performed by disc diffusion and broth microdilution methods. MBL detection was performed by Combination Disk Diffusion Test (CDDT). The bla(VIM) and bla(IMP) genes were detected by PCR and sequencing methods. Using Combination Disk Diffusion test method, it was found that among 83 imipenem resistant P.aeruginosa strains, 48 (57.9%) were MBL producers. PCR and sequencing methods proved that these isolates were positive for blaIMP-1 genes, whereas none were positive for bla(VIM) genes. The mortality rate of hospitalized patients with MBL-producing Pseudomonas infection was 4/48 (8.3%). It was shown that Zataria multiflora and Carum copticum extracts had a high antibacterial effect on regular and IMP-producing P. aeruginosa strains in 6.25 mg/ml concentration. The incidence of MBL-producing P. aeruginosa in burn patients is very high. In our study, all MBL-producing isolates carry the blaIMP-1 gene. Therefore, detection of MBL-producing isolates is of great importance in identifying drug resistance patterns in P. aeruginosa, and in prevention and control of infections. In this study, it was shown that extracts of Z. multiflora and C. copticum have high antibacterial effects on ß-lactamase producing P. aeruginosa strains. PMID:24799849

  7. [A technique for a rapid imaging of regional CBF and partition coefficient using dynamic SPECT and N-isopropyl-p-[123I]iodoamphetamine (123I-IMP)].


    Itoh, H; Iida, H; Murakami, M; Bloomfield, P M; Miura, S; Okudera, T; Inugami, A; Ogawa, T; Hatazawa, J; Fujita, H


    IMP is a flow tracer due to a large first pass extraction fraction and high affinity in the brain, but significant clearance from the brain causes change of distribution when the scan start time is delayed. The purpose of the present study is to develop a new method to rapidly calculate a quantitative CBF image by taking into account for the clearance effects. A dynamic SPECT scan was performed on 5 subjects (4 patients with cerebral infarction and 1 normal volunteer) following slow intravenous infusion of 123I-IMP. The arterial input function was obtained by frequent blood sampling and by measuring an octanol extraction ratio for each sample. Firstly, non-linear least square fitting (NLS) was performed to investigate the tracer kinetics of 123I-IMP. The 3 compartment model analysis yielded negligibly small k3 (retaining rate constant) (0.0056 +/- 0.0128 (ml/ml/min)), and consistent k1 (transport rate constant) with those determined by 2 compartment model (2CM) analysis (r = 0.96, p < 0.001). In addition, k1 was consistent with CBF measured by 15O water PET technique. These observations suggested validity of using 2CM for describing the IMP tracer kinetics. Secondly, a weighted integration (WI) technique has been implemented to calculate rapidly images of CBF and partition coefficient (Vd). The WI technique yielded values of CBF (k1) and Vd (k1/k2). They were confirmed to be consistent with those determined by NLS technique (CBF; r = 0.99, p < 0.001, Vd; r = 0.99, p < 0.001), and calculated k1 agreed well with PET CBF (r = 0.91, p < 0.001). We observed changed Vd in infarcted patients. This supports an importance for calculating of Vd image. Vd image will provide additional clinical information because 123I-IMP binding mechanism may be related to cell viability.

  8. Evaluation of Zataria MultiFlora Boiss and Carum copticum antibacterial activity on IMP-type metallo-beta-lactamase-producing Pseudomonas aeruginosa.


    Fallah, F; Taherpour, A; Borhan, R S; Hashemi, A; Habibi, M; Sajadi Nia, R


    Carbapenem resistance due to acquired metallo-beta-lactamases (MBLs) is considered to be more serious than other resistance mechanisms. The aim of this study was to evaluate the antibacterial activity of Zataria multiflora Boiss and Carum copticum plants on IMP-producing P.aeruginosa strains. This experimental study was carried out on hospitalized burn patients during 2011 and 2012. Antibiotics and extracts susceptibility tests were performed by disc diffusion and broth microdilution methods. MBL detection was performed by Combination Disk Diffusion Test (CDDT). The bla(VIM) and bla(IMP) genes were detected by PCR and sequencing methods. Using Combination Disk Diffusion test method, it was found that among 83 imipenem resistant P.aeruginosa strains, 48 (57.9%) were MBL producers. PCR and sequencing methods proved that these isolates were positive for blaIMP-1 genes, whereas none were positive for bla(VIM) genes. The mortality rate of hospitalized patients with MBL-producing Pseudomonas infection was 4/48 (8.3%). It was shown that Zataria multiflora and Carum copticum extracts had a high antibacterial effect on regular and IMP-producing P. aeruginosa strains in 6.25 mg/ml concentration. The incidence of MBL-producing P. aeruginosa in burn patients is very high. In our study, all MBL-producing isolates carry the blaIMP-1 gene. Therefore, detection of MBL-producing isolates is of great importance in identifying drug resistance patterns in P. aeruginosa, and in prevention and control of infections. In this study, it was shown that extracts of Z. multiflora and C. copticum have high antibacterial effects on ß-lactamase producing P. aeruginosa strains.

  9. VIM and IMP metallo-β-lactamases and other extended-spectrum β-lactamases in Escherichia coli and Klebsiella pneumoniae from environmental samples in a Tunisian hospital.


    Chouchani, Chedly; Marrakchi, Rim; Ferchichi, Leila; El Salabi, Allaaeddin; Walsh, Timothy R


    An extremely drug-resistant Enterobacteriaceae species emerged in Kasserine Hospital, Tunisia between 2009 and 2010 causing a local outbreak. We aimed to characterize extended-spectrum β-lactamase (ESBL) and metallo-β-lactamase (MBL)-producing Enterobacteriaceae from the hospital environment. Swabs were collected from ten different wards from Kasserine Hospital, Tunisia. A total of 46 isolates were cultured onto MacConkey agar supplemented with ceftazidime to select for ESBL-producing Enterobacteriaceae. Identification and susceptibility patterns were performed using Phoenix-automated phenotypic identification criteria. Extended spectrum β-lactamases (ESBLs) were detected using cefepime ESBL E-test. Colony blotting was first used to detect the occurrence of bla(SHV) , bla(CTX-M) , bla(CMY) , bla(IMP) , and bla(VIM) genes. PCR was used to amplify these genes, and the amplicons were sequenced and analyzed. Total DNA was digested with XbaI, and PFGE was used to type the major isolates that produced IMP-1. Among the 46 isolates, 63% were Klebsiella pneumoniae, 13% were Escherichia coli, 8.7% were Proteus mirabilis, 6% were Enterobacter cloaceae, 4.3% were Providencia rettgeri, 2.5% were Serratia marcescens, and 2.5% were Pantoea agglomerans. PCR amplification and DNA sequencing showed that hospital environment isolates produced SHV-125, CTX-M-15, CMY-2 ESBLs, and IMP-1 and VIM-2 MBLs. PFGE typing showed the emergence of IMP-1 MBL-producing K. pneumoniae isolates that were not clonal. In this study, we report the first characterization of IMP-1 and VIM-2 MBL-producing K. pneumoniae and E. coli isolates collected from Kasserine Hospital, Tunisia. © 2011 The Authors. APMIS © 2011 APMIS.

  10. Class 1 integrons in non-clonal multidrug-resistant Acinetobacter baumannii from Iran, description of the new blaIMP-55 allele in In1243.


    Azizi, Omid; Shakibaie, Mohammad Reza; Badmasti, Farzad; Modarresi, Farzan; Ramazanzadeh, Rashid; Mansouri, Shahla; Shahcheraghi, Fereshteh


    Infections and outbreaks caused by multidrug-resistant Acinetobacter baumannii (MDR-AB) are prevalent and have been reported worldwide over the past 20 or more years. Class 1 integron in MDR-AB plays an important role in the spread of antibiotic resistance in clinical settings. This study has been conducted to evaluate the detection of metallo-β-lactamase, characterization of class 1 integron and determination of clonal relatedness among A. baumannii hospital isolates. Sixty-five clinical isolates of MDR-AB were recovered from two Iranian hospital's intensive care units from February to August 2013. Integrase (intI1) and blaIMP genes were detected in 70.8 % (n=46/65) and 9.23 % (n=6/65) of the isolates using PCR assay, respectively. No other metallo-β-lactamase genes (blaVIM, blaSIM and blaNDM) were detected. PCR sequencing of integron gene cassette revealed the following arrays: blaOXA10-aacA4-blaIMP-55-cmlA5 (as a novel array was designated In1243), aacC1 and aadA1. Analysis of blaIMP gene revealed a new allele designated as blaIMP-55. Gene transfer experiment by conjugation showed the 36 kb conjugative plasmid harbouring In1243. The clonal assessment by repetitive extragenic palindromic PCR demonstrated a high-degree relatedness among the strains, but strains harbouring In1243 displayed a different repetitive extragenic palindromic PCR profile. In this study, we found that a novel class 1 integron (In1243) that encoded a new blaIMP allele resided on a transferable plasmid in non-clonal strains of MDR-AB.

  11. Two-gigawatt burst-mode operation of the intense microwave prototype (IMP) free-electron laser (FEL) for the microwave tokamak experiment (MTX)

    SciTech Connect

    Felker, B.; Allen, S.; Bell, H.


    The MTX explored the plasma heating effects of 140 GHz microwaves from both Gyrotrons and from the IMP FEL wiggler. The Gyrotron was long pulse length (0.5 seconds maximum) and the FEL produced short-pulse length, high-peak power, single and burst modes of 140 GHZ microwaves. Full-power operations of the IMP FEL wiggler were commenced in April of 1992 and continued into October of 1992. The Experimental Test Accelerator H (ETA-II) provided a 50-nanosecond, 6-MeV, 2--3 kAmp electron beam that was introduced co-linear into the IMP FEL with a 140 GHz Gyrotron master oscillator (MO). The FEL was able to amplify the MO signal from approximately 7 kW to peaks consistently in the range of 1--2 GW. This microwave pulse was transmitted into the MTX and allowed the exploration of the linear and non-linear effects of short pulse, intense power in the MTX plasma. Single pulses were used to explore and gain operating experience in the parameter space of the IMP FEL, and finally evaluate transmission and absorption in the MTX. Single-pulse operations were repeatable. After the MTX was shut down burst-mode operations were successful at 2 kHz. This paper will describe the IMP FEL, Microwave Transmission System to MTX, the diagnostics used for calorimetric measurements, and the operations of the entire Microwave system. A discussion of correlated and uncorrelated errors that affect FEL performance will be made Linear and non-linear absorption data of the microwaves in the MTX plasma will be presented.

  12. Rapid and simple identification of carbapenemase genes, bla NDM, bla OXA-48, bla VIM, bla IMP-14 and bla KPC groups, in Gram-negative bacilli by in-house loop-mediated isothermal amplification with hydroxynaphthol blue dye.


    Srisrattakarn, Arpasiri; Lulitanond, Aroonlug; Wilailuckana, Chotechana; Charoensri, Nicha; Wonglakorn, Lumyai; Saenjamla, Pimjai; Chaimanee, Prajuab; Daduang, Jureerut; Chanawong, Aroonwadee


    Carbapenem-resistant Enterobacteriaceae isolates by carbapenemase production are being reported globally with increasing frequency, leading to limited therapeutic options. We therefore developed a loop-mediated isothermal amplification method with hydroxynaphthol blue dye (LAMP-HNB) for rapid confirmation of bla NDM, bla OXA-48, bla VIM, bla IMP-14 and bla KPC groups. Sixty-two Enterobacteriaceae and Pseudomonas spp. isolates carrying various carbapenemase genes (28 bla NDM-1, 9 bla IMP-14a, 2 bla IMP-48, 1 bla IMP-1, 1 bla IMP-4, 1 bla IMP-9, 1 bla IMP-15, 4 bla VIM-2, 1 bla VIM-1, 1 bla IMP-14a & bla VIM-2, 7 bla KPC-2, 3 bla OXA-48 and 3 bla OXA-181) and 37 non-carbapenemase-producing Enterobacteriaceae isolates as confirmed by the PCR methods were included. Bacterial DNA was extracted by a simple boiling method. The LAMP-HNB method for each target gene was carried out using a set of six primers under isothermal condition at 65 °C in an ordinary water bath within 60 min and visual measurement of reaction by the change from violet to sky blue. This method had high efficiency (100% sensitivity and specificity) for identifying the bla NDM, bla OXA-48, bla VIM, bla IMP-14 and bla KPC groups compared with the PCR method. The HNB is easy to prepare, inexpensive and provides reliable results. Therefore, this method could be used as a confirmatory carbapenemase test in routine laboratory or for epidemiological purposes.

  13. Predominance of carbapenem-resistant Pseudomonas aeruginosa isolates carrying blaIMP and blaVIM metallo-β-lactamases in a major hospital in Costa Rica.


    Toval, Francisco; Guzmán-Marte, Anel; Madriz, Vivian; Somogyi, Teresita; Rodríguez, César; García, Fernando


    This study aimed to assess the molecular basis of the resistance to carbapenems in clinical isolates of Pseudomonas aeruginosa recovered from a tertiary-level health facility in San José, Costa Rica. A total of 198 non-duplicated isolates were evaluated for their susceptibility to β-lactams, aminoglycosides and fluoroquinolones. The production of metallo-β-lactamases (MBLs), the presence of MBL encoding genes (blaIMP, blaVIM and blaGIM-1) and the occurrence of these genes within class 1 integrons were investigated. In addition, an ERIC2 PCR fingerprinting method was used to elucidate the distribution of the detected MBL genes within the strain collection. Of the 198 isolates tested, 125 (63.1 %) were categorized as carbapenem-resistant. The majority (88.8 %) of the carbapemen-resistant isolates also showed resistance to ceftazidime, cefepime, aztreonam, ticarcillin/clavulanic acid, amikacin, gentamicin, tobramycin, ciprofloxacin and gatifloxacin. Among the carbapenem-resistant isolates, 102 (81.6 %) showed MBL activity. Strikingly, both blaIMP and blaVIM genes were simultaneously detected in most (94.1 %) of the 102 MBL producers. Five carbapenem-resistant MBL producers were positive only for blaIMP genes. Almost 70 % of the isolates examined harboured the intI1 gene, accompanied by the sul1 and qacEΔ1 genes in 136 (99 %) and 122 (89 %) isolates, respectively. The majority (94.4 %) of the carbapenem-resistant isolates carried the intI1 gene, in contrast to 26 % of the carbapenem-susceptible isolates. Ninety-three out of 96 (96.9 %) isolates carrying both blaIMP and blaVIM genes also harboured the intI1, sul1 and qacEΔ1 genes. Gene cassettes from carbapenem-susceptible and MBL-negative carbapenem-resistant isolates encoded aminoglycoside-resistance enzymes (aadA2, aadA4 and aadA6) as well as orfD and qacF genes. RAPD analysis distributed 126 of the isolates in 29 clusters. Eighty of the 90 blaIMP (+) blaVIM (+) isolates were sorted into 16

  14. Dry Fractionation Methods to Produce Barley Meals Varying in Protein, Beta-Glucan and Starch Contents

    USDA-ARS?s Scientific Manuscript database

    Barley contains several valuable nutrients including beta-glucan (BG), protein and starch. Each has additional value when concentrated. Dehulled and hulless barleys were sequentially pearled for 1 to 6 cycles, each with 8% removal. The 6 pearled kernels plus the initial kernel were subjected to imp...

  15. Endothelium-Dependent Contractions of Isolated Arteries to Thymoquinone Require Biased Activity of Soluble Guanylyl Cyclase with Subsequent Cyclic IMP Production.


    Detremmerie, Charlotte M; Chen, Zhengju; Li, Zhuoming; Alkharfy, Khalid M; Leung, Susan W S; Xu, Aimin; Gao, Yuansheng; Vanhoutte, Paul M


    Preliminary experiments on isolated rat arteries demonstrated that thymoquinone, a compound widely used for its antioxidant properties and believed to facilitate endothelium-dependent relaxations, as a matter of fact caused endothelium-dependent contractions. The present experiments were designed to determine the mechanisms underlying this unexpected response. Isometric tension was measured in rings (with and without endothelium) of rat mesenteric arteries and aortae and of porcine coronary arteries. Precontracted preparations were exposed to increasing concentrations of thymoquinone, which caused concentration-dependent, sustained further increases in tension (augmentations) that were prevented by endothelium removal, Nω-nitro-L-arginine methyl ester [L-NAME; nitric oxide (NO) synthase inhibitor], and 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ; soluble guanylyl cyclase [sGC] inhibitor). In L-NAME-treated rings, the NO-donor diethylenetriamine NONOate restored the thymoquinone-induced augmentations; 5-[1-(phenylmethyl)-1H-indazol-3-yl]-2-furanmethanol (sGC activator) and cyclic IMP (cIMP) caused similar restorations. By contrast, in ODQ-treated preparations, the cell-permeable cGMP analog did not restore the augmentation by thymoquinone. The compound augmented the content (measured with ultra-high performance liquid chromatography-tandem mass spectrometry) of cIMP, but not that of cGMP; these increases in cIMP content were prevented by endothelium removal, L-NAME, and ODQ. The augmentation of contractions caused by thymoquinone was prevented in porcine arteries, but not in rat arteries, by 1-(5-isoquinolinylsulfonyl)homopiperazine dihydrochloride and trans-4-[(1R)-1-aminoethyl]-N-4-pyridinylcyclohexanecarboxamide dihydrochloride (Rho-kinase inhibitors); in the latter, but not in the former, it was reduced by 3,5-dichloro-N-[[(1α,5α,6-exo,6α)-3-(3,3-dimethylbutyl)-3-azabicyclo[3.1.0]hex-6-yl]methyl]-benzamide hydrochloride (T-type calcium channel inhibitor

  16. Immuno-PET quantitation of de2-7 epidermal growth factor receptor expression in glioma using 124I-IMP-R4-labeled antibody ch806.


    Lee, Fook T; O'Keefe, Graeme J; Gan, Hui K; Mountain, Angela J; Jones, Gareth R; Saunder, Timothy H; Sagona, Jessica; Rigopoulos, Angela; Smyth, Fiona E; Johns, Terrance G; Govindan, Serengulam V; Goldenberg, David M; Old, Lloyd J; Scott, Andrew M


    Overexpression, activation, and mutations of the epidermal growth factor receptor (EGFR) are commonly found in solid tumors. The aim of this study was to develop a PET-based method for detecting the constitutively active mutant de2-7 EGFR, which is associated with disease progression and resistance to chemotherapy and radiotherapy in glioma. The chimeric antibody ch806, which selectively binds an epitope of the EGFR that is exposed only on overexpressed, mutant, or ligand-activated forms of the receptor, was conjugated to the radiohalogen (124)I via the residualizing ligand IMP-R4, and in vitro properties were characterized. In vivo biodistribution and small-animal PET studies were performed in BALB/c nude mice bearing U87MG.de2-7 glioma xenografts. Imaging results were correlated with measured tumor uptake of the radioconjugate. (124)I-IMP-R4-ch806 had an immunoreactivity of 78.3% and was stable for 7 d when incubated in serum in vitro. The biodistribution analysis of (124)I-IMP-R4-ch806 demonstrated a maximal uptake of 30.95 +/- 6.01 percentage injected dose per gram (%ID/g) in U87MG.de2-7 xenografts at 48 h after injection, with prolonged tumor retention (6.07 +/- 0.80 %ID/g at 216 h after injection). The tumor-to-blood ratio increased from 0.44 at 4 h after injection to a maximum of 4.70 at 168 h after injection. PET of (124)I-IMP-R4-ch806 biodistribution was able to clearly detect the U87MG.de2-7 tumors at 24 h after injection and for at least 168 h after injection. Correlation between tumor PET image quantitation of (124)I-IMP-R4-ch806 and %ID/g determined from resected tissues (r = 0.9350) was excellent. These results show that immuno-PET with (124)I-IMP-R4-ch806 is feasible and allows noninvasive quantitation of de2-7 EGFR expression in vivo.

  17. Evaluation of commercial phenotypic assays for the detection of IMP- or New Delhi metallo-β-lactamase-producing Enterobacteriaceae isolates in Japan.


    Sakanashi, Daisuke; Kawachi, Makoto; Uozumi, Yuki; Nishio, Mitsuru; Hara, Yuki; Suematsu, Hiroyuki; Hagihara, Mao; Nishiyama, Naoya; Asai, Nobuhiro; Koizumi, Yusuke; Yamagishi, Yuka; Mikamo, Hiroshige


    This study was designed to evaluate the sodium mercaptoacetic acid double disk synergy test (SMA-DDST), the Etest metallo-β-lactamase (MBL) MP/MPI (Etest MP/MPI), and the Mastdiscs ID Carbapenemase Detection Disc Set (MAST-CDS) for the detection of MBL-producing Enterobacteriaceae isolates in Japan. Fifty-one clinical isolates and four reference strains were tested. These isolates included 40, 4, and 11 IMP-, New Delhi MBL (NDM)-, and non-MBL-producers, respectively. SMA-DDST was performed with meropenem (MEPM)-containing disks. Sensitivities were 38/44 (86%), 40/44 (91%), and 15/44 (34%), and the cost ratio was 1:9.4:3.8 for MEPM-SMA-DDST:Etest MP/MPI:MAST-CDS, respectively. The specificity was 11/11 (100%) for all assays. MEPM-SMA-DDST detected IMP-producing isolates with high sensitivity (38/40; 95%), but the assay was inadequate for NDM-producing isolates (0/4; 0%). The Etest MP/MPI detected both IMP- (36/40; 90%) and NDM-producing isolates (4/4; 100%), but was the most expensive. MAST-CDS detected IMP-producing isolates with low sensitivity (11/40; 28%), but the assay worked well for NDM-producing isolates (4/4; 100%). Our results indicated that MEPM-SMA-DDST was the most cost-effective assay for the detection of IMP-producing isolates. Therefore, we conclude that MEPM-SMA-DDST is the optimal available assay for clinical first-line screening in IMP-endemic areas such as Japan. However, this assay could not detect NDM-producing isolates, whereas the Etest MP/MPI and MAST-CDS could. When MEPM-SMA-DDST is negative, the Etest MP/MPI and MAST-CDS could be used to obtain supportive data and prevent detection failure for NDM-producing isolates. Copyright © 2017 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  18. A microtubule-facilitated nuclear import pathway for cancer regulatory proteins.


    Roth, Daniela Martino; Moseley, Gregory W; Glover, Dominic; Pouton, Colin W; Jans, David A


    Nuclear protein import is dependent on specific targeting signals within cargo proteins recognized by importins (IMPs) that mediate translocation through the nuclear pore. Recent evidence, however, implicates a role for the microtubule (MT) network in facilitating nuclear import of the cancer regulatory proteins parathyroid hormone-related protein (PTHrP) and p53 tumor suppressor. Here we assess the extent to which MT and actin integrity may be generally required for nuclear protein import for the first time. We examine 10 nuclear-localizing proteins with diverse IMP-dependent nuclear import pathways, our results indicating that the cytoskeleton does not have a general mechanistic role in nuclear localization sequence-dependent nuclear protein import. Of the proteins examined, only the p110(Rb) tumor suppressor protein Rb, together with p53 and PTHrP, was found to require MT integrity for optimal nuclear import. Fluorescence recovery after photobleaching experiments indicated that the MT-dependent nuclear transport pathway increases both the rate and extent of Rb nuclear import but does not affect Rb nuclear export. Dynamitin overexpression experiments implicate the MT motor dynein in the import process. The results indicate that, additional to IMP/diffusion-dependent processes, certain cancer regulatory proteins utilize an MT-enhanced pathway for accelerated nuclear import that is presumably required for their nuclear functions.

  19. X-ray crystallographic analysis of IMP-1 metallo-β-lactamase complexed with a 3-aminophthalic acid derivative, structure-based drug design, and synthesis of 3,6-disubstituted phthalic acid derivative inhibitors.


    Hiraiwa, Yukiko; Saito, Jun; Watanabe, Takashi; Yamada, Mototsugu; Morinaka, Akihiro; Fukushima, Takayoshi; Kudo, Toshiaki


    3-(4-Hydroxypiperidine-1-yl) phthalic acid 1 shows potent inhibitory activity against metallo-β-lactamase, which is known to inactivate β-lactam antibiotics such as carbapenems. Here, the structure of co-crystals of the metallo-β-lactamase IMP-1 and 1 was first analyzed by X-ray crystallography, and then used for structure-based drug design. Four novel compounds bearing substituents at the 6-position were synthesized to produce 3,6-disubstituted phthalic acid derivatives, and their IMP-1 inhibitory activity and synergistic effect with the carbapenem biapenem (BIPM) were evaluated. 3,6-Disubstituted phthalic acid derivatives showed potent IMP-1 inhibitory activity. In particular, compound 13 showed 10-fold higher IMP-1 inhibitory activity as compared with the parent derivative 1. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Immersion mode material pocket dynamic mechanical analysis (IMP-DMA): a novel tool to study gelatinisation of purified starches and starch-containing plant materials.


    Warren, Frederick J; Royall, Paul G; Butterworth, Peter J; Ellis, Peter R


    There is a clear need for improved methods for the study of the physical changes that occur in slurries and sol-gel systems that have significant water content. In this paper a novel immersion mode material pocket form of dynamic mechanical analysis (IMP-DMA) has been designed, combining material pocket technology to provide physical support to a powdered sample within an immersion bath. IMP-DMA allows the mechanical response of a powder during heating to be monitored in excess water. IMP-DMA was evaluated using a range of starch samples loaded as a slurry into a solid steel pocket, the mechanical responses of these samples were monitored as a function of temperature, and values for modulus and tanδ peaks were found to correspond well with events occurring at both the onset and peak gelatinisation temperatures as measured by differential scanning calorimetry (DSC) (e.g. wheat starch has an onset and peak DSC temperature of 49.3 °C and 57.2 °C, respectively, and shows a peak in tanδ at 52.8 °C and a modulus peak at 57.7 °C). Some limitations were found in the ability of DMA to detect transitions in starches with low or high amylose contents. IMP-DMA was shown to be an effective tool for monitoring the changes in starch structure that occur during gelatinisation, both in purified starches and in more complex starch-containing food materials. Thus, a new hyphenated form of DMA is now available that permits the thermally induced transitions of particle water dispersions to be characterised.

  1. Draft Genome Sequence of a Pseudomonas sp. Strain Carrying blaIMP-25 and blaVIM-2 Carbapenemase Genes from Hospital Sewage

    PubMed Central

    Hu, Yiyi; Wu, Wenjing; Feng, Yu; Zhang, Xiaoxia


    Pseudomonas strain WCHP16 recovered from hospital sewage in West China Hospital, Chengdu, China was found to carry two carbapenemase genes blaIMP-25 and blaVIM-2. Here, we report its 5.7-Mb draft genome sequence, comprising 141 contigs and an average 59.53% G+C content. The genome contained 5,504 coding sequences and 67 tRNA genes. PMID:27795238

  2. Quantifying regional cerebral blood flow by N-isopropyl-P-[I-123]iodoamphetamine (IMP) using a ring type single-photon emission computed tomography system

    SciTech Connect

    Takahashi, N.; Odano, I.; Ohkubo, M.


    We developed a more accurate quantitative measurement of regional cerebral blood flow (rCBF) with the microsphere model using N-isopropyl-p-[I-123] iodoamphetamine (IMP) and a ring type single photon emission computed tomography (SPECT) system. SPECT studies were performed in 17 patients with brain diseases. A dose of 222 MBq (6 mCi) of [I-123]IMP was injected i.v., at the same time a 5 min period of arterial blood withdrawal was begun. SPECT data were acquired from 25 min to 60 min after tracer injection. For obtaining the brain activity concentration at 5 min after IMP injection, total brain counts collections and one minute period short time SPECT studies were performed at 5, 20, and 60 min. Measurement of the values of rCBF was calculated using short time SPECT images at 5 min (rCBF), static SPECT images corrected with total cerebral counts (rCBF{sub Ct}.) and those corrected with reconstructed counts on short time SPECT images (rCBF{sub Cb}). There was a good relationship (r=0.69) between rCBF and rCBF{sub Ct}, however, rCBF{sub Ct} tends to be underestimated in high flow areas and overestimated in low flow areas. There was better relationship between rCBF and rCBF{sub Cb}(r=0.92). The overestimation and underestimation shown in rCBF{sub Ct} was considered to be due to the correction of reconstructed counts using a total cerebral time activity curve, because of the kinetic behavior of [I-123]IMP was different in each region. We concluded that more accurate rCBF values could be obtained using the regional time activity curves.

  3. Comparative Study Between The Alternative Used By The IMP Type Pecussion Drills And The Version Using Fluid Elements Regarding The Supplying, Command And Automatic Adjustment Systems Of The Injection Water Pressure

    NASA Astrophysics Data System (ADS)

    Cotetiu, Adriana; Cotetiu, Radu; Ungureanu, Nicolae


    Starting from analyzing of an existing solution regarding the injection water feeding system for the pneumatic rotating and percussion drilling installations, which is included in the structure of the perforator installation (IMP-1or IMP-2), the paper presents part of a research regarding an original solution of the automatic command and regulate with monostable fluidic elements, with different physical nature jets. This solution is applicable to this drilling installations type, made in Romania.

  4. A study of solar flare electron events from October 1972 through December 1974 from Imp 7 and 8

    NASA Technical Reports Server (NTRS)

    Decker, R. B.; Armstrong, T. P.


    Data from the Johns Hopkins University Applied Physics Laboratory Charged Particle Measurement Experiment aboard Imp H and J were searched for solar flare produced intensity increases in greater than 0.2-MeV electrons during the 26-month period from October 1972 through December 1974. Of the 44 solar electron events found during this period, 31 were isolated for a detailed statistical study. Systematics among the characteristics of the electron profiles (e.g., peak intensity times and count rates) and those of the associated flares (e.g., H-alpha onset times, H-alpha importance class, heliocentric coordinates, etc.) were examined, and the significant results are presented in several scatter plots. The results reveal that the time delay between the flare onset and the arrival of the peak electron intensity at 1 AU (time to maximum) is a function of the flare's deviation in heliolongitude from the solar region which was well connected to the earth via a magnetic flux tube; the well-connected flares produced electron intensity maxima in the least time.

  5. The February 1986 solar activity - A comparison of Giotto, Vega-1, and IMP-8 solar wind measurements with MHD simulations

    NASA Technical Reports Server (NTRS)

    Dryer, M.; Smith, Z. K.; Coates, A. J.; Johnstone, A. D.


    Large disturbances in the interplanetary medium were observed by several spacecraft during a period of enhanced solar activity in early February 1986. The locations of six solar flares and the spacecraft considered here encompassed more than 100 deg of heliolongitude. These flares during the minimum of cycle 21 set the stage for an extensive multispacecraft comparison performed with a two-dimensional, MHD numerical experiment. The plasma instruments on the Giotto spacecraft, on its way to encounter Comet Halley in March 1986, made measurements of the solar wind for up to 8 hours/day during February. Solar wind measurements from the Johnstone Plasma Analyzer experiment on Giotto are compared with the MHD simulation of the interplanetary medium throughout these events. Using plasma data obtained by the IMP-8 satellite in addition, it appears that an extended period of high solar wind speed is required as well as the simulated flares to represent the interplanetary medium in this case. The plasma and magnetometer data from Vega-1 is compared with the MHD simulation. This comparison tends to support an interpretation that the major solar wind changes at both Giotto and Vega-1 on February 8, 1986 were due to a shock from a W 05 deg solar flare on February 6, 1986 (06:25 UT). The numerical experiment is considered, qualitatively, to resemble the observations at the former spacecraft, but it has less success at the latter one.

  6. Simulations of a Gradual Solar Energetic Particle Event Observed by Helios 1, Helios 2, and IMP 8

    NASA Astrophysics Data System (ADS)

    Qin, Gang; Wang, Yang


    In this work, a gradual solar energetic particle (SEP) event observed by multi-spacecraft has been simulated. The time profiles of SEP fluxes accelerated by an interplanetary shock in the three-dimensional interplanetary space are obtained by solving numerically the Fokker-Planck focused transport equation. The interplanetary shock is modeled as a moving source of energetic particles. By fitting the 1979 March 01 SEP fluxes observed by Helios 1, Helios 2, and IMP 8 with our simulations, we obtain the best parameters for the shock acceleration efficiency model. And we also find that the particle perpendicular diffusion coefficient with the level of ˜1%-3% of parallel diffusion coefficient at 1 AU should be included. The reservoir phenomenon is reproduced in the simulations, and the longitudinal gradient of SEP fluxes in the decay phase, which is observed by three spacecraft at different locations, is more sensitive to the shock acceleration efficiency parameters than that is to the perpendicular diffusion coefficient.

  7. Dependence of 50-keV upstream ion events at IMP 7 and 8 upon magnetic field bow shock geometry

    NASA Technical Reports Server (NTRS)

    Mitchell, D. G.; Roelof, E. C.


    Results are presented for a statistical study of four years (1972-1976) of IMP 7 and 8 observations at approximately 40 R(E) of 50-200 keV upstream ion events measured with the Energetic Particle Experiment. A monotonic increase in the probability of observing upstream particle events is found with a decrease in the angle (theta-Bn) between the interplanetary magnetic field (IMF) and the local shock normal at the point where the IMF intersects the bow shock, independent of the length of time of bow shock connections exceeding approximately 10 min. Approximately equal probabilities are found for observing an event above a given flux from any portion of the bow shock with the same value of theta-Bn, a growth time of the 50-200 keV events of approximately 10 min, a maximum attainable flux of approximately 25,000/sq cm s sr, and a positive correlation between the probability of exceeding a given flux and the 3 hr Kp index. It is concluded that the local structure of the bow shock in the immediate vicinity of the field line connection is the dominant influence in the generation process of energetic upstream particle events and that wave-particle interactions produce a self-throttling mechanism that limits the maximum flux of ions escaping the upstream foreshock.

  8. Rapid detection of blaNDM, blaKPC, blaIMP, and blaVIM carbapenemase genes in bacteria by loop-mediated isothermal amplification.


    Cheng, Cancan; Zheng, Fen; Rui, Yongyu


    A loop-mediated isothermal amplification (LAMP) assay was developed and evaluated for rapid detection of blaKPC, blaNDM, blaIMP, and blaVIM carbapenemase genes. Six oligonucleotides, including outer, inner, and loop primers, were designed for eight distinct regions in each target gene. Two qualitative criteria were used to evaluate LAMP reactions: visual inspection of color change and real-time detection of fluorescence change. The lower detection limit was 10 colony forming units (CFU) per reaction for real-time detection and 100 CFU per reaction for visual inspection for each gene. Two hundred twenty-two carbapenem-resistant clinical isolates (including 100 Pseudomonas aeruginosa, 100 Acinetobacter sp., and 22 Enterobacteriaceae) were tested by LAMP assay. At the same time, these isolates were confirmed by conventional polymerase chain reaction (PCR) and sequencing analysis. In these clinical isolates, the results of 11 strains with blaNDM, 11 strains with blaKPC, 11 strains with blaVIM, and 2 strains with blaIMP obtained using LAMP assays were concordant with conventional PCR. The LAMP method reported here may be a useful and powerful tool for rapid detection of blaNDM, blaKPC, blaIMP, and blaVIM carbapenemase genes in bacteria.

  9. Antibiotic Resistance Pattern and Evaluation of Metallo-Beta Lactamase Genes Including bla- IMP and bla- VIM Types in Pseudomonas aeruginosa Isolated from Patients in Tehran Hospitals.


    Aghamiri, Samira; Amirmozafari, Nour; Fallah Mehrabadi, Jalil; Fouladtan, Babak; Samadi Kafil, Hossein


    Beta-lactamase producing strains of Pseudomonas aeruginosa are important etiological agents of hospital infections. Carbapenems are among the most effective antibiotics used against Pseudomonas infections, but they can be rendered infective by group B β -lactamase, commonly called metallo-beta lactamase. In this study, the antimicrobial sensitivity patterns of P. aeruginosa strains isolated from 9 different hospitals in Tehran, Iran, as well as the prevalence of MBLs genes (bla- VIM and bla- IMP ) were determined. A total of 212 strains of P. aeruginosa recovered from patients in hospitals in Tehran were confirmed by both biochemical methods and PCR. Their antimicrobial sensitivity patterns were determined by Kirby-Bauer disk diffusion method. Following MIC determination, imipenem resistant strains were selected by DDST method which was followed by PCR tests for determination of MBLs genes: bla- IMP and bla- VIM . The results indicated that, in the DDST phenotypic method, among the 100 imipenem resistant isolates, 75 strains were MBLs positive. The PCR test indicated that 70 strains (33%) carried bla- VIM gene and 20 strains (9%) harbored bla- IMP . The results indicated that the extent of antibiotic resistance among Pseudomonas aeruginosa is on the rise. This may be due to production of MBLs enzymes. Therefore, determination of antibiotic sensitivity patterns and MBLs production by these bacteria, can be important in control of clinical Pseudomonas infection.

  10. Testing multiple hypotheses through IMP weighted FDR based on a genetic functional network with application to a new zebrafish transcriptome study.


    Gui, Jiang; Greene, Casey S; Sullivan, Con; Taylor, Walter; Moore, Jason H; Kim, Carol


    In genome-wide studies, hundreds of thousands of hypothesis tests are performed simultaneously. Bonferroni correction and False Discovery Rate (FDR) can effectively control type I error but often yield a high false negative rate. We aim to develop a more powerful method to detect differentially expressed genes. We present a Weighted False Discovery Rate (WFDR) method that incorporate biological knowledge from genetic networks. We first identify weights using Integrative Multi-species Prediction (IMP) and then apply the weights in WFDR to identify differentially expressed genes through an IMP-WFDR algorithm. We performed a gene expression experiment to identify zebrafish genes that change expression in the presence of arsenic during a systemic Pseudomonas aeruginosa infection. Zebrafish were exposed to arsenic at 10 parts per billion and/or infected with P. aeruginosa. Appropriate controls were included. We then applied IMP-WFDR during the analysis of differentially expressed genes. We compared the mRNA expression for each group and found over 200 differentially expressed genes and several enriched pathways including defense response pathways, arsenic response pathways, and the Notch signaling pathway.

  11. IMP dehydrogenase deficiency in Leishmania donovani causes a restrictive growth phenotype in promastigotes but is not essential for infection in mice.


    Fulwiler, Audrey L; Boitz, Jan M; Gilroy, Caslin; Yates, Phillip A; Jardim, Armando; Ullman, Buddy


    Leishmania cannot synthesize purines de novo and therefore must scavenge purines from its host for survival and growth. Biochemical and genomic analyses have indicated that Leishmania species express three potential routes for the synthesis of guanylate nucleotides: (1) a two-step pathway that converts IMP to GMP; (2) a three-step pathway that starts with the deamination of guanine to xanthine, followed by phosphoribosylation to XMP and then conversion to GMP; or (3) direct guanine phosphoribosylation by HGPRT. To determine the role of the first of these pathways to guanylate nucleotide synthesis, an L. donovani line deficient in IMP dehydrogenase (IMPDH), the first step in the IMP to GMP pathway, was constructed by targeted gene replacement. The Δimpdh lesion triggered a highly restrictive growth phenotype in promastigotes in culture but did not impact parasitemias in mice. The dispensability of IMPDH in vivo is the first definitive demonstration that intracellular L. donovani amastigotes have access to a sufficient pool of guanine, xanthine, or guanylate precursors from the host. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Maltose-neopentyl glycol (MNG) amphiphiles for solubilization, stabilization and crystallization of membrane proteins

    PubMed Central

    Chae, Pil Seok; Rasmussen, Søren G. F.; Rana, Rohini; Gotfryd, Kamil; Chandra, Richa; Goren, Michael A.; Kruse, Andrew C.; Nurva, Shailika; Loland, Claus J.; Pierre, Yves; Drew, David; Popot, Jean-Luc; Picot, Daniel; Fox, Brian G.; Guan, Lan; Gether, Ulrik; Byrne, Bernadette; Kobilka, Brian; Gellman, Samuel H.


    The understanding of integral membrane protein (IMP) structure and function is hampered by the difficulty of handling these proteins. Aqueous solubilization, necessary for many types of biophysical analysis, generally requires a detergent to shield the large lipophilic surfaces displayed by native IMPs. Many proteins remain difficult to study owing to a lack of suitable detergents. We introduce a class of amphiphiles, each of which is built around a central quaternary carbon atom derived from neopentyl glycol, with hydrophilic groups derived from maltose. Representatives of this maltose-neopentyl glycol (MNG) amphiphile family display favorable behavior relative to conventional detergents, as tested on multiple membrane protein systems, leading to enhanced structural stability and successful crystallization. MNG amphiphiles are promising tools for membrane protein science because of the ease with which they may be prepared and the facility with which their structures may be varied. PMID:21037590

  13. Taste sensitivity for monosodium glutamate and an increased liking of dietary protein.


    Luscombe-Marsh, Natalie D; Smeets, Astrid J P G; Westerterp-Plantenga, Margriet S


    The aim of the present study was to determine individuals' taste threshold for monosodium glutamate (MSG) alone and in combination with inosine 5'-monophosphate (IMP-5) and to examine if this threshold was related to an increase in sensory properties (including pleasantness of taste) and/or to one's preference for dietary protein over carbohydrate and fat. Using the triangle tasting method, the taste threshold was determined for thirty-six women and twenty-four men. Thresholds varied from zero to infinite as determined using a clear soup with added MSG in the concentration range of 0.1 to 0.8 % (w/w) MSG. Subjects rated fourteen sensory properties of the soup and also their 'liking', 'eating frequency' and 'preference' of twenty-two common high-protein, high-carbohydrate and high-fat food items. The taste threshold (and therefore sensitivity) of MSG was lowered from 0.33 (sem 0.24) to 0.26 (sem 0.22) % MSG when 0.25 % (w/w) IMP-5 was added. None of the sensory properties assessed was associated with the taste threshold of MSG +/- 0.25 % IMP-5 in the overall study population. However, the taste descriptor 'meatiness' was associated with the threshold data for individuals who could taste concentrations of protein were found to be related to the threshold of MSG +/- 0.25 % IMP-5. From this study population we conclude that the taste threshold of MSG in combination with IMP-5 does appear to predict one's 'liking' of as well as 'preference' for high-protein foods.

  14. Potential proteins targeted by let-7f-5p in HeLa cells.


    Wang, Yu; Chen, Xiujuan; Zhang, Yi; Song, Jiandong


    MicroRNAs are a class of small, endogenous, non-coding RNAs mediating posttranscriptional gene silencing. The current authors hypothesized that let-7f-5p is likely involved in cell invasion and proliferation by regulating the expression of target genes. The current study combined let-7f-5p with iTRAQ to assess its effect on gene expression in HeLa cells. Results indicated that 164 proteins were expressed at different levels in HeLa cells overexpressing let-7f-5p and negative controls and that 172 proteins were expressed at different levels in let-7f-5p-silenced HeLa cells and negative controls. Results indicated that let-7f-5p may suppress insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1) in HeLa cells.

  15. Cloning, characterization, and regulation of the human type II IMP dehydrogenase gene

    SciTech Connect

    Glesne, D.A.; Huberman, E. |


    Human type II inosine 5{prime}-monophosphate dehydrogenase (IMPDH, EC is the rate-limiting enzyme in de novo guanine nucleotide biosynthesis. Regulated IMPDH activity is associated with cellular proliferation, transformation, and differentiation. The authors cloned and sequenced the entire gene for type II IMPDH and here provide details regarding the organization of the gene and the characterization of its promoter. The gene spans approximately 5 kb and is disrupted by 12 introns. The transcriptional start sites were determined by S1 nuclease mapping to be somewhat heterogeneous but predominated at 102 and 85 nucleotides from the translational initiation codon. Through the use of heterologous gene constructs and transient transfection assays, a minimal promoter from {minus}206 to {minus}85 was defined. This promoter is TATA-less and contains several transcription factor motifs including four potential Sp 1 binding sites. The minimal promoter is GC-rich (69%) and resembles a CpG island. Through the use of gel mobility shift assays, nuclear proteins were shown to specifically interact with this minimal promoter. Stable transfectants were used to demonstrate that the down-regulation of IMPDH gene expression in response to reduced cellular proliferation occurs by a transcriptional mechanism.

  16. Autophagy suppression sensitizes glioma cells to IMP dehydrogenase inhibition-induced apoptotic death.


    Isakovic, Andjelka M; Dulovic, Marija; Markovic, Ivanka; Kravic-Stevovic, Tamara; Bumbasirevic, Vladimir; Trajkovic, Vladimir; Isakovic, Aleksandra


    We investigated the role of autophagy, a process of controlled self-digestion, in the in vitro anticancer action of the inosine monophosphate dehydrogenase (IMPDH) inhibitor ribavirin. Ribavirin-triggered oxidative stress, caspase activation, and apoptotic death in U251 human glioma cells were associated with the induction of autophagy, as confirmed by intracellular acidification, appearance of autophagic vesicles, conversion of microtubule associated protein 1 light chain 3 (LC3)-I to autophagosome-associated LC3-II, and degradation of autophagic target p62/sequestosome 1. Ribavirin downregulated the activity of autophagy-inhibiting mammalian target of rapamycin complex 1 (mTORC1), as indicated by a decrease in phosphorylation of the mTORC1 substrate ribosomal p70S6 kinase and reduction of the mTORC1-activating Src/Akt signaling. Guanosine supplementation inhibited, while IMPDH inhibitor tiazofurin mimicked ribavirin-mediated autophagy induction, suggesting the involvement of IMPDH blockade in the observed effect. Autophagy suppression by ammonium chloride, bafilomycin A1, or RNA interference-mediated knockdown of LC3 sensitized glioma cells to ribavirin-induced apoptosis. Ribavirin also induced cytoprotective autophagy associated with Akt/mTORC1 inhibition in C6 rat glioma cells. Our data demonstrate that ribavirin-triggered Akt/mTORC1-dependent autophagy counteracts apoptotic death of glioma cells, indicating autophagy suppression as a plausible therapeutic strategy for sensitization of cancer cells to IMPDH inhibition. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Fully automatic input function determination program for simple noninvasive (123)I-IMP microsphere cerebral blood flow quantification method.


    Yamashita, Kosuke; Uchiyama, Yoshikazu; Ofuji, Asato; Mimura, Hiroaki; Okumiya, Shintaro; Takaki, Akihiro; Sone, Teruki; Ito, Shigeki


    We recently developed a simple noninvasive (123)I-IMP microsphere (SIMS) method using chest dynamic planar images and brain single photon emission computed tomography. The SIMS method is an automatic analysis method, except for the process of setting the region of interest (ROI) of the input function. If a fully automatic ROI setting algorithm can be developed to determine the input function for the SIMS method, repeatability and reproducibility of the analysis of regional cerebral blood flow (rCBF) of the SIMS method can be guaranteed. The purpose of this study is to develop a fully automatic input function determination program for the SIMS method and to confirm the clinical usefulness of this program. The automatic input function determination program consists of two ROI setting programs for the PA and lung regions, and it is developed using the image phase analysis of a chest RI angiogram. To confirm the clinical usefulness of this program, the rCBF in 34 patients measured using the automatic method were compared with the values obtained through the manual setting method. Input functions by the automatic and manual methods were approximately equal. A good correlation was observed between the rCBF values obtained by the automatic method and those obtained by the manual setting method (r=0.96, p<0.01). Further, the total time taken for the automatic SIMS analysis is 1-2min as compared to 20-30min for the current analysis, and therefore, this technique contributes to the improvement of the throughput of nuclear medical examinations. Copyright © 2016 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  18. Yeast shuttling SR proteins Npl3p, Gbp2p, and Hrb1p are part of the translating mRNPs, and Npl3p can function as a translational repressor.


    Windgassen, Merle; Sturm, Dorothée; Cajigas, Iván J; González, Carlos I; Seedorf, Matthias; Bastians, Holger; Krebber, Heike


    A major challenge in current molecular biology is to understand how sequential steps in gene expression are coupled. Recently, much attention has been focused on the linkage of transcription, processing, and mRNA export. Here we describe the cytoplasmic rearrangement for shuttling mRNA binding proteins in Saccharomyces cerevisiae during translation. While the bulk of Hrp1p, Nab2p, or Mex67p is not associated with polysome containing mRNAs, significant amounts of the serine/arginine (SR)-type shuttling mRNA binding proteins Npl3p, Gbp2p, and Hrb1p remain associated with the mRNA-protein complex during translation. Interestingly, a prolonged association of Npl3p with polysome containing mRNAs results in translational defects, indicating that Npl3p can function as a negative translational regulator. Consistent with this idea, a mutation in NPL3 that slows down translation suppresses growth defects caused by the presence of translation inhibitors or a mutation in eIF5A. Moreover, using sucrose density gradient analysis, we provide evidence that the import receptor Mtr10p, but not the SR protein kinase Sky1p, is involved in the timely regulated release of Npl3p from polysome-associated mRNAs. Together, these data shed light onto the transformation of an exporting to a translating mRNP.

  19. Quantitative and regional measurement of retinal blood flow in rats using N-isopropyl-p-[14C]-iodoamphetamine ([14C]-IMP).


    Pouliot, Mylène; Deschênes, Micheline C; Hétu, Simon; Chemtob, Sylvain; Lesk, Mark R; Couture, Réjean; Vaucher, Elvire


    Quantitative and regional measurement of retinal blood flow in rodents is of prime interest for the investigation of regulatory mechanisms of ocular circulation in physiological and pathological conditions. In this study, a quantitative autoradiographic method using N-isopropyl-p-(14)C-iodoamphetamine ([(14)C]-IMP), a diffusible radioactive tracer, was evaluated for its ability to detect changes in retinal blood perfusion during hypercapnia. Findings were compared to cerebral blood flow values measured simultaneously. Hypercapnia was induced in awaken Wistar rats by inhalation of 5% or 8% CO(2) in medical air for 5 min. [(14)C]-IMP (100 microCi/kg) was injected in the femoral vein over a 30 s period and the rats were sacrificed 2 min later. Blood flow was calculated from whole-mount retinae and 20 microm thick brain sections in discrete regions of interest by quantitative autoradiography or from digested samples of retina and brain by liquid scintillation counting. Retinal blood flow values measured with quantitative and regional autoradiography were higher in the central (108 +/- 20 ml/100 g/min) than in peripheral (84 +/- 15 ml/100 g/min) retina. These values were within the same range as cortical blood flow values (97 +/- 4 ml/100 g/min). The retinal blood flow values obtained on whole-mount retinae were validated by the sampling method. Hypercapnia significantly increased overall blood flow in the retina (24-53%) with a maximal augmentation in the peripheral region and in the brain (22-142%). The changes were stronger in the brain compared to retina (p = 0.016). These results demonstrate that retinal blood flow can be quantified using [(14)C]-IMP and compared with cerebral blood flow. This technique is a powerful tool to study how retinal blood flow is regulated in different regions of the rat retina.

  20. A new graphic method for estimation of distribution volume in chronic ischemic brain lesions on I-123 IMP SPECT; in prediction of regional CBF increase by bypass surgery

    SciTech Connect

    Odano, I.; Ohkubo, M.; Takahashi, N.


    The estimate the distribution volume (Vd) of Iodine-123 IMP brain SPECT, we developed a new graphic plot, the rate constant square method, which was useful to predict an increase of rCBF in the ischemic lesions caused by bypass surgery. The tracer kinetics of IMP was assumed to be a 2-compartment model as follows: dCb(t)/dt=K1Ca(t)-k2Cb(t), where K1 is rCBF(ml/g/min), k2 is the washout constant(/min), and K1/k2 is defined as distribution volume (Vd:ml/g). When input function Ca(t) is prepared, we can determine the relationship between K1, Delayed/Early ratio and Vd on the graph. The method was applied to 13 patients with chronic cerebral infarction. Regional CBF was measured by the microsphere model and early and delayed scans were performed. In the normal area, K1 and Delayed/Early ratio were 0.5 ml/g/min and 1.0, respectively, then Vd (=31.5 ml/g) was obtained on the graph. 30.0 ml/g, the value in the infarct area was reduced. After bypass surgery undertaken on five patients, we observed a significant relationship between % increase of rCBF in the lesions and values of Vd. Since Vd reflects the extent of IMP retention in the brain tissue, we can predict an increase of rCBF by the bypass operation using this method.

  1. [The group study of diagnostic efficacy of cerebro-vascular disease by I-123 IMP SPECT images obtained with ring type SPECT scanner--the ROC analysis on the diagnosis of perfusion defect and redistribution].


    Machida, K; Matsumoto, T; Honda, N; Mamiya, T; Takahashi, T; Takishima, T; Kamano, T; Tamaki, S; Iinuma, T A; Tateno, Y


    We performed two image reading experiments in order to investigate the diagnostic capability of I-123 IMP SPECT obtained by the ring type SPECT scanner in cerebro-vascular disease. Fourteen physicians diagnosed SPECT images of 55 cases with reference to clinical neurological informations, first without brain XCT images and second with XCT images. Each physician detected perfusion defects and redistributions of I-123 IMP and assigned a confidence level of abnormality for these SPECT findings by means of five rating method. From results obtained by ROC analysis, we concluded as follows: (1) Generally, I-123 IMP SPECT is a stable diagnostic modality in the diagnosis of cerebro-vascular disease and the image reading of XCT had no effects on the diagnosis of SPECT on the whole of physician, (2) However, there were unnegligible differences among individuals in the detectability of findings and the effect of XCT image reading, (3) Detectability of redistribution of I-123 IMP was lower than that of perfusion defect and inter-observer variation in the diagnostic performance for redistribution was larger than that of perfusion defect. The results suggest that it is necessary to standardize diagnostic criteria among physicians for redistribution of I-123 IMP.

  2. Rapid detection of Pseudomonas aeruginosa and Acinetobacter baumannii Harboring bla(VIM-2), bla(IMP-1) and bla(OXA-23) genes by using loop-mediated isothermal amplification methods.


    Kim, Hye Jin; Kim, Hyung Sun; Lee, Jae Myun; Yoon, Sang Sun; Yong, Dongeun


    Carbapenem-resistant Pseudomonas aeruginosa (CRPA) and Acinetobacter baumannii (CRAB) are the leading causes of nosocomial infections. A rapid and sensitive test to detect CRPA and CRAB is required for appropriate antibiotic treatment. We optimized a loop-mediated isothermal amplification (LAMP) assay to detect the presence of bla(VIM-2), bla(IMP-1), and bla(OXA-23), which are critical components for carbapenem resistance. Two sets of primers, inner and outer primers, were manually designed as previously described. The LAMP buffer was optimized (at 2mM MgSO₄) by testing different concentrations of MgSO₄. The optimal reaction temperature and incubation time were determined by using a gradient thermocycler. Then, the optimized bla(VIM-2), bla(IMP-1), and bla(OXA-23) LAMP reactions were evaluated by using 120 P. aeruginosa and 99 A. baumannii clinical isolates. Only one strain of the 100 CRPA isolates harbored bla(IMP-1), whereas none of them harbored bla(VIM-2). These results indicate that the acquisition of bla(VIM-2) or bla(IMP-1) may not play a major role in carbapenem resistance in Korea. Fifty two strains of the 75 CRAB isolates contained bla(OXA-23), but none contained bla(VIM-2) and bla(IMP-1) alleles. Our results demonstrate the usefulness of LAMP for the diagnosis of CRPA and CRAB.

  3. Translational diffusion measurements by microcoil NMR in aqueous solutions of the Fos-10 detergent-solubilized membrane protein OmpX.


    Horst, Reto; Stanczak, Pawel; Serrano, Pedro; Wüthrich, Kurt


    Aqueous solutions of the detergent Fos-10 (n-decylphosphocholine) without and with addition of the integral membrane protein (IMP) OmpX (outer membrane protein X) have been characterized using pulsed field gradient-stimulated echo (PFG-STE) NMR experiments for measurements of translational diffusion coefficients. Effective diffusion coefficients for Fos-10 micelles in the absence of OmpX were obtained by observation of NMR signals from 10-bromodecan-1-ol that had been inserted into the micelles, and in the presence of OmpX by NMR observation of the protein. It is thus shown that solutions of Fos-10-reconstituted OmpX can be quantitatively described as a mixture of Fos-10 monomers, uniform Fos-10 micelles, and uniform OmpX-containing Fos-10 micelles, with Fos-10 monomers in fast exchange between the pools of these three species. This result establishes an avenue for efficient determination of the effective translational diffusion coefficients of IMP-containing detergent micelles based on observation of the intense detergent NMR signals, which is also applicable with unlabeled IMPs. This monitoring of the species present in a given IMP solution contributes to improved guidelines for rational selection of detergent and buffer conditions in structural studies of integral membrane proteins.

  4. Bidirectional MeV/n ion intervals - Observations from the Goddard Space Flight Center instruments on the ISEE 3/ICE, IMP 8, Helios 1 and Helios 2 spacecraft

    NASA Technical Reports Server (NTRS)

    Richardson, I. G.; Reames, D. V.


    A search is made for intervals of bidirectional energetic ion streaming in approximately 1 MeV data from the instruments on ISEE 3/ICE, IMP 8 and Helios 1 and 2 during 1973 to 1989. The longest duration intervals are found around solar maximum, consistent with the expected association with coronal mass ejections. The ISEE 3/ICE intervals are associated with previously identified bidirectional 35-1000 keV ions and solar-wind electron heat fluxes, though additional bidirectional intervals are found.

  5. Interplanetary particles and fields, November 22 to December 6, 1977 - Helios, Voyager and Imp observations between 0.6 and 1.6 AU

    NASA Technical Reports Server (NTRS)

    Burlaga, L.; Lepping, R.; Weber, R.; Armstrong, T.; Goodrich, C.; Sullivan, J.; Gurnett, D.; Kellogg, P.; Keppler, E.; Mariani, F.


    The paper presents a wealth of data obtained at approximately 0.6, 1, and 1.6 AU by Helios 1 and 2, Voyager 1 and 2, and Imp 7 and 8, describing the evolution and interactions of particles, flows, and fields in the period 22 November to 6 December 1977. Three flow systems were observed in the period under consideration: (1) a corotating stream and a stream interface associated with a coronal hole; (2) a shock wave and an energetic particle event associated with a 2B flare; and (3) an isolated shock wave of uncertain origin. These phenomena are discussed in some detail.

  6. Bidirectional MeV/n ion intervals - Observations from the Goddard Space Flight Center instruments on the ISEE 3/ICE, IMP 8, Helios 1 and Helios 2 spacecraft

    NASA Technical Reports Server (NTRS)

    Richardson, I. G.; Reames, D. V.


    A search is made for intervals of bidirectional energetic ion streaming in approximately 1 MeV data from the instruments on ISEE 3/ICE, IMP 8 and Helios 1 and 2 during 1973 to 1989. The longest duration intervals are found around solar maximum, consistent with the expected association with coronal mass ejections. The ISEE 3/ICE intervals are associated with previously identified bidirectional 35-1000 keV ions and solar-wind electron heat fluxes, though additional bidirectional intervals are found.

  7. Variability of the bla(IMP-15)-containing integrons, highly related to In95, on an endemic clone of Pseudomonas aeruginosa in Mexico.


    Garza-Ramos, Jesus Ulises; Sanchez-Martinez, Guillermina; Barajas, Juan Manuel; Suarez, Sandra; Sanchez-Perez, Alejandro; Rojas-Moreno, Teresa; Carrillo-Quiroz, Berta; Silva-Sanchez, Jesus


    The acquisition of β-lactamases, such as class B metallo-β-lactamases, in Pseudomonas aeruginosa is detrimental to antimicrobial therapy in hospitalized patients. In Mexico, metallo-β-lactamase IMP-15 has been found to be encoded on the In95 class 1 integron in a major clone of P. aeruginosa. In this work, we describe the variability of this class 1 integron in an epidemic clone of carbapenem-resistant P. aeruginosa clinical isolates highly related to isolates previously described in Mexico.

  8. Membrane protein stability can be compromised by detergent interactions with the extramembranous soluble domains.


    Yang, Zhengrong; Wang, Chi; Zhou, Qingxian; An, Jianli; Hildebrandt, Ellen; Aleksandrov, Luba A; Kappes, John C; DeLucas, Lawrence J; Riordan, John R; Urbatsch, Ina L; Hunt, John F; Brouillette, Christie G


    Detergent interaction with extramembranous soluble domains (ESDs) is not commonly considered an important determinant of integral membrane protein (IMP) behavior during purification and crystallization, even though ESDs contribute to the stability of many IMPs. Here we demonstrate that some generally nondenaturing detergents critically destabilize a model ESD, the first nucleotide-binding domain (NBD1) from the human cystic fibrosis transmembrane conductance regulator (CFTR), a model IMP. Notably, the detergents show equivalent trends in their influence on the stability of isolated NBD1 and full-length CFTR. We used differential scanning calorimetry (DSC) and circular dichroism (CD) spectroscopy to monitor changes in NBD1 stability and secondary structure, respectively, during titration with a series of detergents. Their effective harshness in these assays mirrors that widely accepted for their interaction with IMPs, i.e., anionic > zwitterionic > nonionic. It is noteworthy that including lipids or nonionic detergents is shown to mitigate detergent harshness, as will limiting contact time. We infer three thermodynamic mechanisms from the observed thermal destabilization by monomer or micelle: (i) binding to the unfolded state with no change in the native structure (all detergent classes); (ii) native state binding that alters thermodynamic properties and perhaps conformation (nonionic detergents); and (iii) detergent binding that directly leads to denaturation of the native state (anionic and zwitterionic). These results demonstrate that the accepted model for the harshness of detergents applies to their interaction with an ESD. It is concluded that destabilization of extramembranous soluble domains by specific detergents will influence the stability of some IMPs during purification. © 2014 The Protein Society.

  9. Solar-cycle dependence of a model turbulence spectrum using IMP and ACE observations over 38 years

    NASA Astrophysics Data System (ADS)

    Burger, R. A.; Nel, A. E.; Engelbrecht, N. E.


    Ab initio modulation models require a number of turbulence quantities as input for any reasonable diffusion tensor. While turbulence transport models describe the radial evolution of such quantities, they in turn require observations in the inner heliosphere as input values. So far we have concentrated on solar minimum conditions (e.g. Engelbrecht and Burger 2013, ApJ), but are now looking at long-term modulation which requires turbulence data over at a least a solar magnetic cycle. As a start we analyzed 1-minute resolution data for the N-component of the magnetic field, from 1974 to 2012, covering about two solar magnetic cycles (initially using IMP and then ACE data). We assume a very simple three-stage power-law frequency spectrum, calculate the integral from the highest to the lowest frequency, and fit it to variances calculated with lags from 5 minutes to 80 hours. From the fit we then obtain not only the asymptotic variance at large lags, but also the spectral index of the inertial and the energy, as well as the breakpoint between the inertial and energy range (bendover scale) and between the energy and cutoff range (cutoff scale). All values given here are preliminary. The cutoff range is a constraint imposed in order to ensure a finite energy density; the spectrum is forced to be either flat or to decrease with decreasing frequency in this range. Given that cosmic rays sample magnetic fluctuations over long periods in their transport through the heliosphere, we average the spectra over at least 27 days. We find that the variance of the N-component has a clear solar cycle dependence, with smaller values (~6 nT2) during solar minimum and larger during solar maximum periods (~17 nT2), well correlated with the magnetic field magnitude (e.g. Smith et al. 2006, ApJ). Whereas the inertial range spectral index (-1.65 ± 0.06) does not show a significant solar cycle variation, the energy range index (-1.1 ± 0.3) seems to be anti-correlated with the variance

  10. IMPs, EGOs, and Skyhooks

    NASA Astrophysics Data System (ADS)

    McDonald, Frank B.


    In the October 1994 issue of the Journal of Geophysical Research, J. Simpson, E. Parker, and C. Sonnett wrote of the early history of space physics. Previously, J. Van Allen had written a monogram on the genesis of magnetospheric physics, and H. Newell (``Above the atmosphere'') and J. Naugle (``First among equals'') had given excellent accounts of the initial development of the space sciences within NASA and the broader research community. I write as a member of the second generation or Junior Pioneers who profited greatly from the foundation laid down by the Pioneers of the era. With the second wave it was possible to fully participate in the dramatic expansion of the nation's space science program that occurred in the 1960s. In this brief memoir, I give a personal recollection of this period and try to relate it to some of the current developments in space physics.

  11. Autoantibody detection to tumor-associated antigens of P53, IMP1, P16, cyclin B1, P62, C-myc, Survivn, and Koc for the screening of high-risk subjects and early detection of esophageal squamous cell carcinoma.


    Zhou, S L; Yue, W B; Fan, Z M; Du, F; Liu, B C; Li, B; Han, X N; Ku, J W; Zhao, X K; Zhang, P; Cui, J; Zhou, F Y; Zhang, L Q; Fan, X P; Zhou, Y F; Zhu, L L; Liu, H Y; Wang, L D


    The aim of this study was to evaluate the diagnostic values by detecting sera autoantibodies to eight tumor-associated antigens (TAAs) of P53, IMP1, P16, cyclin B1, P62, C-myc, Survivn and Koc full-length recombinant proteins for the screening of high-risk subjects and early detection of esophageal squamous cell carcinoma (ESCC). Enzyme-linked immunosorbent assay was used to detect autoantibodies against the eight selected TAAs in 567 sera samples from four groups, including 200 individuals with normal esophageal epithelia (NOR), 214 patients with esophageal basal cell hyperplasia (BCH), 65 patients with esophageal dysplasia (DYS), and 88 patients with ESCC. In addition, the expression of the eight antigens in esophageal tissues was analyzed by immunohistochemistry. Statistically significant distribution differences were identified among the four groups for each of the individual autoantibodies to six TAAs (P53, IMP1, P16, cyclin B1, P62, and C-myc); the detection rates of antoantibodies were positively correlated with the progression of ESCC. When autoantibody assay successively accumulated to six TAAs (P53, IMP1, P16, cyclin B1, P62, and C-myc), a stepwise increased detection frequency of autoantibodies was found in the four sera groups (6% in NOR, 18% in BCH, 38% in DYS, and 64% in ESCC, respectively), the risks to BHC, DYS, and ESCC steadily increased about 3-, 9-, and 27-folds. The sensitivity and the specificity for autoantibodies against the six TAAs in diagnosing ESCC reached up to 64% and 94%, respectively. The area under the receiver operating characteristic curve for the six anti-TAA autoantibodies was 0.78 (95% confidence interval 0.74-0.83). No more increasing in sensitivity was found with the addition of new anti-TAA autoantibodies. A combination detection of autoantibodies to TAAs might distinguish ESCC patients from normal individuals and the patients with esophageal precancerous lesions. © 2013 Wiley Periodicals, Inc. and the International Society

  12. SYNCHROTRON RADIATION, FREE ELECTRON LASER, APPLICATION OF NUCLEAR TECHNOLOGY, ETC.: Design of the IMP microbeam irradiation system for 100 MeV/u heavy ions

    NASA Astrophysics Data System (ADS)

    Sheng, Li-Na; Song, Ming-Tao; Zhang, Xiao-Qi; Yang, Xiao-Tian; Gao, Da-Qing; He, Yuan; Zhang, Bin; Liu, Jie; Sun, You-Mei; Dang, Bing-Rong; Li, Wen-Jian; Su, Hong; Man, Kai-Di; Guo, Yi-Zhen; Wang, Zhi-Guang; Zhan, Wen-Long


    A state-of-the-art high energy heavy ion microbeam irradiation system is constructed at the Institute of Modern Physics of the Chinese Academy of Sciences. This microbeam system operates in both full current intensity mode and single ion mode. It delivers a predefined number of ions to pre-selected targets for research in biology and material science. The characteristic of this microbeam system is high energy and vertical irradiation. A quadrupole focusing system, in combination with a series of slits, has been designed to optimize the spatial resolution. A symmetrically achromatic system leads the beam downwards and serves simultaneously as an energy analyzer. A high gradient quadrupole triplet finally focuses a C6+ ion beam to 1 μm in the vacuum chamber within the energy range from 10 MeV/u to 100 MeV/u. In this paper, the IMP microbeam system is described in detail. A systematic investigation of the ion beam optics of this microbeam system is presented together with the associated aberrations. Comparison is made between the IMP microbeam system and the other existing systems to further discuss the performance of this microbeam. Then the optimized initial beam parameters are given for high resolution and high hitting efficiency. At last, the experiment platform is briefly introduced.

  13. Detection of blaIMP4 and blaNDM1 harboring Klebsiella pneumoniae isolates in a university hospital in Malaysia

    PubMed Central

    Hamzan, Nurul Izzati; Yean, Chan Yean; Rahman, Rosliza Abdul; Hasan, Habsah; Rahman, Zaidah Abdul


    Background Antibiotic resistance among Enterobacteriaceae posts a great challenge to the health care service. The emergence of carbapenem-resistant Klebsiella pneumoniae (CRKP) is attracting significant attention due to its rapid and global dissemination. The infection is associated with significant morbidity and mortality, thus creating challenges for infection control and managing teams to curb the infection. In Southeast Asia, there have been limited reports and subsequent research regarding CRKP infections. Thus, the study was conducted to characterize CRKP that has been isolated in our setting. Methods A total of 321 K. pneumoniae were included in the study. Each isolate went through an identification process using an automated identification system. Phenotypic characterization was determined using disk diffusion, modified Hodge test, Epsilometer test, and inhibitor combined disk test. Further detection of carbapenemase genes was carried out using polymerase chain reaction and confirmed by gene sequence analysis. Results All together, 13 isolates (4.05%) were CRKP and the majority of them were resistant to tested antibiotics except colistin and tigercycline. Among seven different carbapenemase genes studied (bla KPC, bla IMP, bla SME, bla NDM, bla IMI, bla VIM, and bla OXA), only two, bla IMP4 (1.87%) and bla NDM1 (2.18%), were detected in our setting. Conclusion Evidence suggests that the prevalence of CRKP in our setting is low, and knowledge of Carbapenem-resistant Enterobacteriaceae and CRKP has improved and become available among clinicians. PMID:25765342

  14. Triton X-114 phase separation in the isolation and purification of mouse liver microsomal membrane proteins.


    Mathias, Rommel A; Chen, Yuan-Shou; Kapp, Eugene A; Greening, David W; Mathivanan, Suresh; Simpson, Richard J


    Integral membrane proteins (IMPs) mediate several cellular functions including cell adhesion, ion and nutrient transport, and cell signalling. IMPs are typically hard to isolate and purify due to their hydrophobic nature and low cellular abundance, however, microsomes are small lipid vesicles rich in IMPs, which form spontaneously when cells are mechanically disrupted. In this study, we have employed mouse liver microsomes as a model for optimising a method for IMP isolation and characterisation. Microsomes were collected by differential centrifugation, purified with sodium carbonate, and subjected to GeLC-MS/MS analysis. A total of 1124 proteins were identified in the microsome fraction, with 47% (524/1124) predicted by TMHMM to contain at least one transmembrane domain (TMD). The ability of phase partitioning using the detergent Triton X-114 (TX-114) to further enrich for membrane proteins was evaluated. Microsomes were subjected to successive rounds of solubility-based phase separation, with proteins partitioning into the aqueous phase, detergent phase, or TX-114-insoluble pellet fraction. GeLC-MS/MS analysis of the three TX-114 fractions identified 1212 proteins, of which 146 were not detected in the un-fractionated microsome sample. Conspicuously, IMPs partitioned to the detergent phase, with 56% (435/770) of proteins identified in that fraction containing at least one TMD. GO Slim characterisation of the microsome proteome revealed enrichment of proteins from the endoplasmic reticulum, mitochondria, Golgi apparatus, endosome, and cytoplasm. Further, enzymes including monooxygenases were well represented with 35 cytochrome P450 identifications (CYPs 1A2, 2A5, 2A12, 2B10, 2C29, 2C37, 2C39, 2C44, 2C50, 2C54. 2C67, 2C68, 2C70, 2D10, 2D11, 2D22, 2D26, 2D9, 2E1, 2F2, 2J5, 2U1, 3A11, 3A13, 3A25, 4A10, 4A12A, 4A12B, 4F13, 4F14, 4F15, 4V3, 51,7B1, and 8B1). Evaluation of biological processes showed enrichment of proteins involved in fatty acid biosynthesis and

  15. Membrane protein stability can be compromised by detergent interactions with the extramembranous soluble domains

    PubMed Central

    Yang, Zhengrong; Wang, Chi; Zhou, Qingxian; An, Jianli; Hildebrandt, Ellen; Aleksandrov, Luba A; Kappes, John C; DeLucas, Lawrence J; Riordan, John R; Urbatsch, Ina L; Hunt, John F; Brouillette, Christie G


    Detergent interaction with extramembranous soluble domains (ESDs) is not commonly considered an important determinant of integral membrane protein (IMP) behavior during purification and crystallization, even though ESDs contribute to the stability of many IMPs. Here we demonstrate that some generally nondenaturing detergents critically destabilize a model ESD, the first nucleotide-binding domain (NBD1) from the human cystic fibrosis transmembrane conductance regulator (CFTR), a model IMP. Notably, the detergents show equivalent trends in their influence on the stability of isolated NBD1 and full-length CFTR. We used differential scanning calorimetry (DSC) and circular dichroism (CD) spectroscopy to monitor changes in NBD1 stability and secondary structure, respectively, during titration with a series of detergents. Their effective harshness in these assays mirrors that widely accepted for their interaction with IMPs, i.e., anionic > zwitterionic > nonionic. It is noteworthy that including lipids or nonionic detergents is shown to mitigate detergent harshness, as will limiting contact time. We infer three thermodynamic mechanisms from the observed thermal destabilization by monomer or micelle: (i) binding to the unfolded state with no change in the native structure (all detergent classes); (ii) native state binding that alters thermodynamic properties and perhaps conformation (nonionic detergents); and (iii) detergent binding that directly leads to denaturation of the native state (anionic and zwitterionic). These results demonstrate that the accepted model for the harshness of detergents applies to their interaction with an ESD. It is concluded that destabilization of extramembranous soluble domains by specific detergents will influence the stability of some IMPs during purification. PMID:24652590

  16. A Guide to Differential Scanning Calorimetry of Membrane and Soluble Proteins in Detergents.


    Yang, Zhengrong; Brouillette, Christie G


    Differential scanning calorimetry (DSC) detects protein thermal unfolding by directly measuring the heat absorbed. Simple DSC experiments that require relatively small amounts of pure material can provide a wealth of information related to structure, especially with respect to domain architecture, without the need for a complete thermodynamic analysis. Thus, DSC is an ideal additional tool for membrane protein characterization and also offers several advantages over indirect thermal unfolding methods. Integral membrane proteins (IMPs) that comprise both large multitopic transmembrane domains (TMDs) and extramembranous domains (EMDs) are differentially affected by detergent interactions with both domains. In fact, in some cases, destabilization of the EMD by detergent may dominate overall IMP stability. This chapter will (1) provide a perspective on the advantages of DSC for membrane protein characterization and stability measurements, including numerous examples spanning decades of research; (2) introduce models for the interaction and destabilization of IMPs by detergents; (3) discuss two case studies from the authors' lab; and (4) offer practical advice for performing DSC in the presence of detergents.

  17. Quantifying Protein-mRNA Interactions in Single Live Cells.


    Wu, Bin; Buxbaum, Adina R; Katz, Zachary B; Yoon, Young J; Singer, Robert H


    Specific binding proteins are crucial for the correct spatiotemporal expression of mRNA. To understand this process, a method is required to characterize RNA-protein interactions in single living cells with subcellular resolution. We combined endogenous single RNA and protein detection with two-photon fluorescence fluctuation analysis to measure the average number of proteins bound to mRNA at specific locations within live cells. We applied this to quantify the known binding of zipcode binding protein 1 (ZBP1) and ribosomes to β-actin mRNA within subcellular compartments of primary fibroblasts and neurons. ZBP1-mRNA binding did not occur in nuclei, contrary to previous conclusions. ZBP1 interaction with β-actin mRNA was enhanced perinuclearly in neurons compared to fibroblasts. Cytoplasmic ZBP1 and ribosome binding to the mRNA were anti-correlated depending on their location in the cell. These measurements support a mechanism whereby ZBP1 inhibits translation of localizing mRNA until its release from the mRNA peripherally, allowing ribosome binding. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. DAZ Family Proteins, Key Players for Germ Cell Development.


    Fu, Xia-Fei; Cheng, Shun-Feng; Wang, Lin-Qing; Yin, Shen; De Felici, Massimo; Shen, Wei


    DAZ family proteins are found almost exclusively in germ cells in distant animal species. Deletion or mutations of their encoding genes usually severely impair either oogenesis or spermatogenesis or both. The family includes Boule (or Boll), Dazl (or Dazla) and DAZ genes. Boule and Dazl are situated on autosomes while DAZ, exclusive of higher primates, is located on the Y chromosome. Deletion of DAZ gene is the most common causes of infertility in humans. These genes, encoding for RNA binding proteins, contain a highly conserved RNA recognition motif and at least one DAZ repeat encoding for a 24 amino acids sequence able to bind other mRNA binding proteins. Basically, Daz family proteins function as adaptors for target mRNA transport and activators of their translation. In some invertebrate species, BOULE protein play a pivotal role in germline specification and a conserved regulatory role in meiosis. Depending on the species, DAZL is expressed in primordial germ cells (PGCs) and/or pre-meiotic and meiotic germ cells of both sexes. Daz is found in fetal gonocytes, spermatogonia and spermatocytes of adult testes. Here we discuss DAZ family genes in a phylogenic perspective, focusing on the common and distinct features of these genes, and their pivotal roles during gametogenesis evolved during evolution.

  19. Integral membrane proteins in proteomics. How to break open the black box?


    Vit, O; Petrak, J


    Integral membrane proteins (IMPs) are coded by 20-30% of human genes and execute important functions - transmembrane transport, signal transduction, cell-cell communication, cell adhesion to the extracellular matrix, and many other processes. Due to their hydrophobicity, low expression and lack of trypsin cleavage sites in their transmembrane segments, IMPs have been generally under-represented in routine proteomic analyses. However, the field of membrane proteomics has changed markedly in the past decade, namely due to the introduction of filter assisted sample preparation (FASP), the establishment of cell surface capture (CSC) protocols, and the development of methods that enable analysis of the hydrophobic transmembrane segments. This review will summarize the recent developments in the field and outline the most successful strategies for the analysis of integral membrane proteins.

  20. SATNET development and operation, pluribus satellite IMP development, remote site maintenance, internet operations and maintenance, mobile access terminal network, TCP for the HP3000, TCP for VAK-UNIX

    NASA Astrophysics Data System (ADS)

    Haverty, J. F.


    This Quarterly Technical Report describes work on the development of and experimentation with packet broadcast by satellite; on development of Pluribus Satellite IMPs (Interface Message Provision); on a study of the technology of Remote Site Maintenance; on Internetwork monitoring; on shipboard satellite communications; and on the development of Transmission control Protocols for the HP3000 and VAX-UNIX.

  1. SATNET development and operation, Pluribus Satellite IMP development, Remote Site maintenance, Internet operations and maintenance, Mobile Access Terminal Network, TCP for the HP3000, TCP for VAX-UNIX

    NASA Astrophysics Data System (ADS)

    Haverty, J. F.


    This Quarterly Technical Report describes work on the development of and experimentation with packet broadcast by satellite; on development of Pluribus Satellite IMPs; on a study of the technology of Remote Site Maintenance; on Internetwork monitoring; on shipboard satellite communications; and on the development of Transmission Control Protocols for the HP3000 and VAX-UNIX.

  2. SATNET development and operation. Pluribus satellite IMP development. Remote site maintenance. Internet development. Mobile access terminal network. TCP for the HP3000. TCP-TAC. TCP for VAX-UNIX

    NASA Astrophysics Data System (ADS)

    Bressler, R. D.


    This Quarterly Technical Report describes work on the development of and experimentation with packet broadcast by satellite; on development of Pluribus Satellite IMPs; on a study of the technology of Remote Site Maintenance; on the development of Inter-network monitoring; on shipboard satellite communications; and on the development of Transmission control protocols for the HP3000, TAC, and VAX-UNIX.

  3. Molecular detection of metallo-β-lactamase genes, bla IMP-1, bla VIM-2 and bla SPM-1 in imipenem resistant Pseudomonas aeruginosa isolated from clinical specimens in teaching hospitals of Ahvaz, Iran.


    Moosavian, Mojtaba; Rahimzadeh, Mohammad


    Carbapenem resistant Pseudomonas aeruginosa is a serious cause of nosocomial infections. The main purpose of the study is to determine the prevalence rate of imipenem resistant Pseudomonas aeruginosa carrying metallo-ß-lactamase (MBL) genes. 236 Pseudomonas aeruginosa isolates were collected from teaching hospitals of Ahvaz University of Medical Sciences during a period of 9 months in 2012. These strains were identified using conventional microbiological tests. The susceptibility of isolates to antibiotics were assessed using disk diffusion test. The IMP-EDTA combination disk phenotypic test was performed for detection of MBL producing strains. Finally, polymerase chain reaction (PCR) was performed to detect MBL genes, bla IMP-1, bla VIM-2 and bla SPM-1 in imipenem resistant strains. Out of 236 examined isolates, 122 isolates (51.4%) were resistant to imipenem. The IMP-EDTA combination test showed that among 122 imipenem resistant strains, 110 strains (90%) were phenotipically MBL producers. Additionally, the results of PCR method showed that 2 strains (1.6%) and 67strains (55%) of imipenem resistant Pseudomonas aeruginosa isolates contained bla VIM-2 and bla IMP-1 genes respectively. No SPM-1gene was found in the examined samples. Resistance of P. aeruginosa isolates to imipenem due to MBL enzymes is increasing in Ahavaz. Because of clinical significance of this kind of resistance, rapid detection of MBL producing strains and followed by appropriate treatment is necessary to prevent the spreading of these organisms.

  4. Bidirectional about 1 MeV/amu ion intervals in 1973-1991 observed by the Goddard Space Flight Center instruments on IMP 8 and ISEE 3/ICE

    NASA Technical Reports Server (NTRS)

    Richardson, I. G.; Reames, D. V.


    Bidirectional energetic ion flows (BIFs) in the solar wind at 1AU during 1973-1991 are examined on the basis of about 1 MeV/amu data from the Goddard Space Flight Center instruments on ISEE3/ICE and IMP 8. BIFs are observed more frequently around solar maximum, when they are observed about 12 percent of the time compared with about 5 percent at solar minimum. Intervals with durations greater than 4 hr are observed on average approximately every 3-4 d at solar maximum and every 2 wk at solar minimum, with about 33 percent of these intervals following within 2 d of an interplanetary shock. Various coronal mass ejection signatures and BIFs greater than 1 MeV/amu usually do not coincide exactly, and additional bidirectional ion events are identified.

  5. A catalogue of solar cosmic ray events: IMPS 4 and 5, May 1967 - December 1972. [analysis of data acquired during operation of Explorer 34 and 41 satellites

    NASA Technical Reports Server (NTRS)

    Vanhollebeke, M. A.; Wang, J. R.; Mcdonald, F. B.


    This catalogue of solar cosmic ray events has been prepared for the use of solar physicists and other interested scientists. It contains some 185 solar particle events detected by the Goddard Space Flight Center Cosmic Ray Experiments on IMP's IV and V (Explorer 34 and 41) for the period May 1967 - December 1972. The data is presented in the form of hourly averages for three proton energy intervals - 0.9 - 1.6 MeV; 6 - 20 MeV and 20 - 80 MeV. In addition the time histories of .5 - 1.1 MeV electrons are shown on a separate scale. To assist in the identification of related solar events, the onset time of the electron event is indicated. The details of the instrumentation and detector techniques are described. Further descriptions of data reduction procedure and on the time-history plots are given.

  6. Bidirectional about 1 MeV/amu ion intervals in 1973-1991 observed by the Goddard Space Flight Center instruments on IMP 8 and ISEE 3/ICE

    NASA Technical Reports Server (NTRS)

    Richardson, I. G.; Reames, D. V.


    Bidirectional energetic ion flows (BIFs) in the solar wind at 1AU during 1973-1991 are examined on the basis of about 1 MeV/amu data from the Goddard Space Flight Center instruments on ISEE3/ICE and IMP 8. BIFs are observed more frequently around solar maximum, when they are observed about 12 percent of the time compared with about 5 percent at solar minimum. Intervals with durations greater than 4 hr are observed on average approximately every 3-4 d at solar maximum and every 2 wk at solar minimum, with about 33 percent of these intervals following within 2 d of an interplanetary shock. Various coronal mass ejection signatures and BIFs greater than 1 MeV/amu usually do not coincide exactly, and additional bidirectional ion events are identified.

  7. Investigation of Solar Wind Correlations and Solar Wind Modifications Near Earth by Multi-Spacecraft Observations: IMP 8, WIND and INTERBALL-1

    NASA Technical Reports Server (NTRS)

    Paularena, Karolen I.; Richardson, John D.; Zastenker, Georgy N.


    The foundation of this Project is use of the opportunity available during the ISTP (International Solar-Terrestrial Physics) era to compare solar wind measurements obtained simultaneously by three spacecraft - IMP 8, WIND and INTERBALL-1 at wide-separated points. Using these data allows us to study three important topics: (1) the size and dynamics of near-Earth mid-scale (with dimension about 1-10 million km) and small-scale (with dimension about 10-100 thousand km) solar wind structures; (2) the reliability of the common assumption that solar wind conditions at the upstream Lagrangian (L1) point accurately predict the conditions affecting Earth's magnetosphere; (3) modification of the solar wind plasma and magnetic field in the regions near the Earth magnetosphere, the foreshock and the magnetosheath. Our Project was dedicated to these problems. Our research has made substantial contributions to the field and has lead others to undertake similar work.

  8. Interspecies Dissemination of a Mobilizable Plasmid Harboring blaIMP-19 and the Possibility of Horizontal Gene Transfer in a Single Patient

    PubMed Central

    Gomi, Ryota; Matsuda, Tomonari; Tanaka, Michio; Nagao, Miki; Takakura, Shunji; Uemoto, Shinji; Ichiyama, Satoshi


    Carbapenemase-producing Gram-negative bacilli have been a global concern over the past 2 decades because these organisms can cause severe infections with high mortality rates. Carbapenemase genes are often carried by mobile genetic elements, and resistance plasmids can be transferred through conjugation. We conducted whole-genome sequencing (WGS) to demonstrate that the same plasmid harboring a metallo-β-lactamase gene was detected in two different species isolated from a single patient. Metallo-β-lactamase-producing Achromobacter xylosoxidans (KUN4507), non-metallo-β-lactamase-producing Klebsiella pneumoniae (KUN4843), and metallo-β-lactamase-producing K. pneumoniae (KUN5033) were sequentially isolated from a single patient and then analyzed in this study. Antimicrobial susceptibility testing, molecular typing (pulsed-field gel electrophoresis and multilocus sequence typing), and conjugation analyses were performed by conventional methods. Phylogenetic and molecular clock analysis of K. pneumoniae isolates were performed with WGS, and the nucleotide sequences of plasmids detected from these isolates were determined using WGS. Conventional molecular typing revealed that KUN4843 and KUN5033 were identical, whereas the phylogenetic tree analysis revealed a slight difference. These two isolates were separated from the most recent common ancestor 0.74 years before they were isolated. The same resistance plasmid harboring blaIMP-19 was detected in metallo-β-lactamase-producing A. xylosoxidans and K. pneumoniae. Although this plasmid was not self-transferable, the conjugation of this plasmid from A. xylosoxidans to non-metallo-β-lactamase-producing K. pneumoniae was successfully performed. The susceptibility patterns for metallo-β-lactamase-producing K. pneumoniae and the transconjugant were similar. These findings supported the possibility of the horizontal transfer of plasmid-borne blaIMP-19 from A. xylosoxidans to K. pneumoniae in a single patient. PMID

  9. Difficult-to-detect carbapenem-resistant IMP13-producing P. aeruginosa: experience feedback concerning a cluster of urinary tract infections at a surgical clinic in France

    PubMed Central


    Background We report a carbapenem-resistant P. aeruginosa clone responsible for a cluster of urinary tract infections in elderly surgery patients, diagnosed during a three-month period in a 59-bed surgical clinic. Findings The clonal nature of the cluster was established by molecular study of the P. aeruginosa isolates (PFGE and MLST). Despite an MIC of imipenem in the susceptibility range for two isolates, all were metallo-β-lactamase-producers (IMP13-type, clone ST621). We conducted a review of the medical and surgical procedures. We tested water delivered into the clinic and urological devices for the presence of the epidemic strain. The hygiene nurse observed hygiene practices. A week after the implementation of barrier precautions around the fourth infected patient, we studied the extent to which the patients hospitalised were colonised to assess whether the spread of the epidemic strain had been controlled. Conclusions 1/ Our findings indicate the difficulties in the detection of the metallo-β-lactamase in this clone, that resulted in the alert being delayed. 2/ Unlike most investigations of UTI outbreaks described in urology wards, we did not detect any contaminated urological devices or water colonisation. 3/ Consistent with outbreaks involving the IMP-13 clone in critical care units, the observation of inadequate application of standard precautions argued for patient-to-patient transmission during urinary management of the urology patients. 4/ The implementation of barrier precautions around infected patients resulted in control of the spread of the epidemic clone. This report serves as an alert concerning a difficult-to-detect multidrug-resistant P. aeruginosa clone in elderly urology patients. PMID:23557539

  10. Role of p70S6K1-mediated phosphorylation of eIF4B and PDCD4 proteins in the regulation of protein synthesis.


    Dennis, Michael D; Jefferson, Leonard S; Kimball, Scot R


    Modulation of mRNA binding to the 40 S ribosomal subunit during translation initiation controls not only global rates of protein synthesis but also regulates the pattern of protein expression by allowing for selective inclusion, or exclusion, of mRNAs encoding particular proteins from polysomes. The mRNA binding step is modulated by signaling through a protein kinase known as the mechanistic target of rapamycin complex 1 (mTORC1). mTORC1 directly phosphorylates the translational repressors eIF4E binding proteins (4E-BP) 1 and 2, releasing them from the mRNA cap binding protein eIF4E, thereby promoting assembly of the eIF4E·eIF4G complex. mTORC1 also phosphorylates the 70-kDa ribosomal protein S6 kinase 1 (p70S6K1), which subsequently phosphorylates eIF4B, and programmed cell death 4 (PDCD4), which sequesters eIF4A from the eIF4E·eIF4G complex, resulting in repressed translation of mRNAs with highly structured 5'-untranslated regions. In the present study, we compared the role of the 4E-BPs in the regulation of global rates of protein synthesis to that of eIF4B and PDCD4. We found that maintenance of eIF4E interaction with eIF4G was not by itself sufficient to sustain global rates of protein synthesis in the absence of mTORC1 signaling to p70S6K1; phosphorylation of both eIF4B and PDCD4 was additionally required. We also found that the interaction of eIF4E with eIF4G was maintained in the liver of fasted rats as well as in serum-deprived mouse embryo fibroblasts lacking both 4E-BP1 and 4E-BP2, suggesting that the interaction of eIF4G with eIF4E is controlled primarily through the 4E-BPs.

  11. Diagnosis of dementia with Lewy bodies: can (123)I-IMP and (123)I-MIBG scintigraphy yield new core features?


    Sakamoto, Fumi; Shiraishi, Shinya; Tsuda, Noriko; Hashimoto, Mamoru; Tomiguchi, Seiji; Ikeda, Manabu; Yamashita, Yasuyuki


    Since the clinical symptoms of different types of dementia frequently overlap, especially in the earlier stages at onset, it is difficult to distinguish dementia with Lewy bodies (DLB) from other neurodegenerative dementias based on their clinical manifestations alone. Nuclear medicine imaging has been reported as a high-value index for the objective evaluation and diagnosis of DLB. The aim of this study was to evaluate whether nuclear medicine imaging findings may yield core features to be added to the diagnosis of DLB. We enrolled 332 patients with suspected DLB. All were evaluated by both (123)I-metaiodobenzylguanidine ((123)I-MIBG) myocardial scintigraphy and (123)I-labelled N-isopropyl-p-iodoamphetamine ((123)I-IMP). brain perfusion single-photon emission CT. The final clinical diagnosis indicated probable DLB in 92 patients (40 males, 52 females; mean age ± standard deviation, 77.4 ± 6.4 years; range, 56-89 years); 240 patients (98 males, 142 females; mean age, 75.5 ± 9.0 years; range, 70-87 years) were recorded as being without DLB. The accepted core features used for clinical evaluations were fluctuating cognition, visual hallucinations and Parkinsonism. The nuclear medicine evaluation indices were the severity score of cerebral blood flow on (123)I-IMP scintigraphs of the posterior cingulate and praecuneus and a reduction in the blood flow in the occipital lobe. For (123)I-MIBG evaluation, we recorded the early and delayed heart-to-mediastinum (H/M) ratios and the washout rate. Univariate and multivariate analyses of fluctuating cognition, visual hallucinations, Parkinsonism and early H/M ratio in patients with probable and without DLB revealed significant differences. Parameters based on (123)I-IMP studies did not show any significant differences by multivariate analysis. The area under the curve for the early H/M ratio was 0.918; for fluctuating cognition, visual hallucinations and Parkinsonism, it was 0.693, 0.760 and 0.611, respectively

  12. Image interpretation criteria for FDG PET/CT in multiple myeloma: a new proposal from an Italian expert panel. IMPeTUs (Italian Myeloma criteria for PET USe).


    Nanni, Cristina; Zamagni, Elena; Versari, Annibale; Chauvie, Stephane; Bianchi, Andrea; Rensi, Marco; Bellò, Marilena; Rambaldi, Ilaria; Gallamini, Andrea; Patriarca, Francesca; Gay, Francesca; Gamberi, Barbara; Cavo, Michele; Fanti, Stefano


    FDG PET/CT is able to detect active disease in patients with multiple myeloma (MM) and can be helpful for staging and assessing therapy response, but no standard interpretation criteria have been proposed for the evaluation of FDG PET/CT in MM. A group of Italian nuclear medicine physicians and haematologists met to propose new visual interpretation criteria to standardize FDG PET/CT evaluation in MM patients (Italian Myeloma criteria for PET USe; IMPeTUs) and the reproducibility of these criteria was tested. This Italian multicentre protocol was set up as a subprotocol of EMN02, an international prospective multicentre trial of the European Myeloma Network. The criteria were agreed at multidisciplinary consensus meetings. They include a description of the metabolic state of the bone marrow (BM), number and site of focal PET-positive lesions, the number of osteolytic lesions, and the presence and site of extramedullary disease, paramedullary disease and fractures. A visual degree of uptake was defined for the target lesion and extramedullary lesions according to modified Deauville criteria. MM patients who had undergone FDG PET/CT at baseline (PET-0), after induction (PET-AI) and at the end of treatment (PET-EoT) were enrolled. The patients had been prospectively enrolled in EMN02 and their PET scans were a posteriori reinterpreted in a blinded independent central review process managed by WIDEN®. Five expert nuclear medicine physicians scored the scans according to the new criteria. A case was considered read when four out of the five reviewers completed the report. Concordance among reviewers on different metrics was calculated using Krippendorff's alpha coefficient. A total of 17 consecutive patients were enrolled. On PET-0, the alpha coefficients for the BM score, the score for the hottest focal lesion, the number of focal lesions and the number of lytic lesions were 0.33 and 0.47, 0.40 and 0.32, respectively. On PET-AI, the alpha coefficients were 0.09 and 0

  13. Polymer-based cell-free expression of ligand-binding family B G-protein coupled receptors without detergents

    PubMed Central

    Klammt, Christian; Perrin, Marilyn H; Maslennikov, Innokentiy; Renault, Ludovic; Krupa, Martin; Kwiatkowski, Witek; Stahlberg, Henning; Vale, Wylie; Choe, Senyon


    G-protein coupled receptors (GPCRs) constitute the largest family of intercellular signaling molecules and are estimated to be the target of more than 50% of all modern drugs. As with most integral membrane proteins (IMPs), a major bottleneck in the structural and biochemical analysis of GPCRs is their expression by conventional expression systems. Cell-free (CF) expression provides a relatively new and powerful tool for obtaining preparative amounts of IMPs. However, in the case of GPCRs, insufficient homogeneity of the targeted protein is a problem as the in vitro expression is mainly done with detergents, in which aggregation and solubilization difficulties, as well as problems with proper folding of hydrophilic domains, are common. Here, we report that using CF expression with the help of a fructose-based polymer, NV10 polymer (NVoy), we obtained preparative amounts of homogeneous GPCRs from the three GPCR families. We demonstrate that two GPCR B family members, corticotrophin-releasing factor receptors 1 and 2β are not only solubilized in NVoy but also have functional ligand-binding characteristics with different agonists and antagonists in a detergent-free environment as well. Our findings open new possibilities for functional and structural studies of GPCRs and IMPs in general. PMID:21465615

  14. Empirical in operando analysis of the charge carrier dynamics in hematite photoanodes by PEIS, IMPS and IMVS† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c6cp04683e Click here for additional data file.

    PubMed Central

    Ellis, David Shai; Dotan, Hen


    In this Perspective, we introduce intensity modulated photocurrent/voltage spectroscopy (IMPS and IMVS) as powerful tools for the analysis of charge carrier dynamics in photoelectrochemical (PEC) cells for solar water splitting, taking hematite (α-Fe2O3) photoanodes as a case study. We complete the picture by including photoelectrochemical impedance spectroscopy (PEIS) and linking the trio of PEIS, IMPS and IMVS, introduced here as photoelectrochemical immittance triplets (PIT), both mathematically and phenomenologically, demonstrating what conclusions can be extracted from these measurements. A novel way of analyzing the results by an empirical approach with minimal presumptions is introduced, using the distribution of relaxation times (DRT) function. The DRT approach is compared to conventional analysis approaches that are based on physical models and therefore come with model presumptions. This work uses a thin film hematite photoanode as a model system, but the approach can be applied to other PEC systems as well. PMID:27524381

  15. Characterization of pKP-M1144, a Novel ColE1-Like Plasmid Encoding IMP-8, GES-5, and BEL-1 β-Lactamases, from a Klebsiella pneumoniae Sequence Type 252 Isolate.


    Papagiannitsis, Costas C; Dolejska, Monika; Izdebski, Radoslaw; Dobiasova, Hana; Studentova, Vendula; Esteves, Francisco J; Derde, Lennie P G; Bonten, Marc J M; Hrabák, Jaroslav; Gniadkowski, Marek


    IMP-8 metallo-β-lactamase was identified in Klebsiella pneumoniae sequence type 252 (ST252), isolated in a Portuguese hospital in 2009. blaIMP-8 was the first gene cassette of a novel class 3 integron, In1144, also carrying the blaGES-5, blaBEL-1, and aacA4 cassettes. In1144 was located on a ColE1-like plasmid, pKP-M1144 (12,029 bp), with a replication region of limited nucleotide similarity to those of other RNA-priming plasmids, such as pJHCMW1. In1144 and pKP-M1144 represent an interesting case of evolution of resistance determinants in Gram-negative bacteria.

  16. Divergence in the evolution of Paleolithic symbolic and technological systems: The shining bull and engraved tablets of Rocher de l'Impératrice.


    Naudinot, Nicolas; Bourdier, Camille; Laforge, Marine; Paris, Céline; Bellot-Gurlet, Ludovic; Beyries, Sylvie; Thery-Parisot, Isabelle; Le Goffic, Michel


    The development of the Azilian in Western Europe 14,000 years ago is considered a "revolution" in Upper Paleolithic Archaeology. One of the main elements of this rapid social restructuring is the abandonment of naturalistic figurative art on portable pieces or on cave walls in the Magdalenian in favor of abstract expression on small pebbles. Recent work shows that the transformation of human societies between the Magdalenian and the Azilian was more gradual. The discovery of a new Early Azilian site with decorated stones in France supports this hypothesis. While major changes in stone tool technology between the Magdalenian and Azilian clearly mark important adaptive changes, the discovery of 45 engraved schist tablets from archaeological layers at Le Rocher de l'Impératrice attests to iconographic continuity together with special valorization of aurochs as shown by a "shining" bull depiction. This evidence suggests that some cultural features such as iconography may lag far behind technological changes. We also argue that eventual change in symbolic expression, which includes the later disappearance of figurative art, provides new insight into the probable restructuring of the societies.

  17. A correlative study of simultaneously measured He(++) fluxes in the solar wind and in the magnetosphere utilizing Imp-1 and 1971-089A satellite data

    NASA Technical Reports Server (NTRS)

    Shelley, E. G.


    Simultaneously measured He(++) fluxes in the solar wind and in the magnetosphere were studied using data from the plasma spectrometer on the Imp I satellite and the energetic ion mass spectrometer on the low altitude polar orbiting satellite 1971-89A. A detailed comparison of the He(++) energy spectra measured simultaneously in the solar wind and in the low altitude dayside polar cusp on March 7, 1972 was made. The energy-per-unit-charge range of the energetic ion mass spectrometer on board the polar orbiting satellite was 700 eV to 12 keV. Within this range there was a clear maximum in the He(++) energy spectrum at approximately 1.5 keV/nucleon. There was not a clearly defined maximum in the H(+) spectrum, but the data were consistent with a peak between 0.7 and 1.0 keV/nucleon. Both spectra could be reasonably well fit with a convecting Maxwellian plus a high energy tail; however, the mean velocity for He(++) distribution was significantly greater than that for the H(+) distribution. The simultaneous solar wind measurements showed the mean velocities for both ion species to be approximately 600 km/sec. The discrepancies between the relative velocity distributions in the low altitude cusp and those in the solar wind are consistent with a potential difference of approximately 1.4 kV along their flow direction between the two points of observation.

  18. Divergence in the evolution of Paleolithic symbolic and technological systems: The shining bull and engraved tablets of Rocher de l'Impératrice

    PubMed Central

    Naudinot, Nicolas; Bourdier, Camille; Laforge, Marine; Paris, Céline; Bellot-Gurlet, Ludovic; Beyries, Sylvie; Thery-Parisot, Isabelle; Le Goffic, Michel


    The development of the Azilian in Western Europe 14,000 years ago is considered a “revolution” in Upper Paleolithic Archaeology. One of the main elements of this rapid social restructuring is the abandonment of naturalistic figurative art on portable pieces or on cave walls in the Magdalenian in favor of abstract expression on small pebbles. Recent work shows that the transformation of human societies between the Magdalenian and the Azilian was more gradual. The discovery of a new Early Azilian site with decorated stones in France supports this hypothesis. While major changes in stone tool technology between the Magdalenian and Azilian clearly mark important adaptive changes, the discovery of 45 engraved schist tablets from archaeological layers at Le Rocher de l’Impératrice attests to iconographic continuity together with special valorization of aurochs as shown by a “shining” bull depiction. This evidence suggests that some cultural features such as iconography may lag far behind technological changes. We also argue that eventual change in symbolic expression, which includes the later disappearance of figurative art, provides new insight into the probable restructuring of the societies. PMID:28257445

  19. Use of Imipenem To Detect KPC, NDM, OXA, IMP, and VIM Carbapenemase Activity from Gram-Negative Rods in 75 Minutes Using Liquid Chromatography-Tandem Mass Spectrometry

    PubMed Central

    Kulkarni, M. V.; Zurita, A. N.; Pyka, J. S.; Murray, T. S.; Hodsdon, M. E.


    Resistance to extended-spectrum β-lactam antibiotics has led to a greater reliance upon carbapenems, but the expression of carbapenemases threatens to limit the utility of these drugs. Current methods to detect carbapenemase activity are suboptimal, requiring prolonged incubations during which ineffective therapy may be prescribed. We previously described a sensitive and specific assay for the detection of carbapenemase activity using ertapenem and liquid chromatography-tandem mass spectrometry (LC-MS/MS). In this study, we assessed 402 Gram-negative rods, including both Enterobacteriaceae and non-Enterobacteriaceae expressing IMP, VIM, KPC, NDM, and/or OXA carbapenemases, by using imipenem, meropenem, and ertapenem with LC-MS/MS assays. LC-MS/MS methods for the detection of intact and hydrolyzed carbapenems from an enrichment broth were developed. No ion suppression was observed, and the limits of detection for all three drugs were below 0.04 μg/ml. The sensitivity and specificity of meropenem and ertapenem for carbapenemase activity among non-Enterobacteriaceae were low, but imipenem demonstrated a sensitivity and specificity of 96% and 95%, respectively, among all Gram-negative rods (GNR) tested, including both Enterobacteriaceae and non-Enterobacteriaceae. LC-MS/MS allows for the analysis of more complex matrices, and this LC-MS/MS assay could easily be adapted for use with primary specimens requiring growth enrichment. PMID:24789180

  20. RNA stabilizing proteins as molecular targets in cardiovascular pathologies

    PubMed Central

    Babu, Sahana Suresh; Joladarashi, Darukeshwara; Jeyabal, Prince; Thandavarayan, Rajarajan Amirthalingam; Krishnamurthy, Prasanna


    The stability of mRNA has emerged as a key step in the regulation of eukaryotic gene expression and function. RNA stabilizing proteins (RSPs) contain several RNA recognition motifs, and selectively bind to Adenylate- and uridylate- Rich Elements in the 3′ untranslated region of several mRNAs leading to altered processing, stability and translation. These post-transcriptional gene regulations play a critical role in cellular homeostasis; therefore act as molecular switch between ‘normal cell’ and ‘disease state’. Many mRNA binding proteins have been discovered to date, which either stabilize (HuR/HuA, HuB, HuC, HuD) or destabilize (AUF1, Tristetraprolin, KSRP) the target transcripts. Although the function of RSPs has been widely studied in cancer biology, its role in cardiovascular pathologies is only beginning to evolve. The current review provides an overall understanding of the potential role of RSP, specifically HuR-mediated mRNA stability in myocardial infarction, hypertension and hypertrophy. Also, the effect of RSPs on various cellular processes including inflammation, fibrosis, angiogenesis, cell-death and proliferation and its relevance to cardiovascular pathophysiological processes is presented. We also discuss the potential clinical implications of RSPs as therapeutic targets in cardiovascular diseases. PMID:25801788

  1. Detection of P. aeruginosa harboring bla CTX-M-2, bla GES-1 and bla GES-5, bla IMP-1 and bla SPM-1 causing infections in Brazilian tertiary-care hospital

    PubMed Central


    Background Nosocomial infections caused by Pseudomonas aeruginosa presenting resistance to beta-lactam drugs are one of the most challenging targets for antimicrobial therapy, leading to substantial increase in mortality rates in hospitals worldwide. In this context, P. aeruginosa harboring acquired mechanisms of resistance, such as production of metallo-beta-lactamase (MBLs) and extended-spectrum beta-lactamases (ESBLs) have the highest clinical impact. Hence, this study was designed to investigate the presence of genes codifying for MBLs and ESBLs among carbapenem resistant P. aeruginosa isolated in a Brazilian 720-bed teaching tertiary care hospital. Methods Fifty-six carbapenem-resistant P. aeruginosa strains were evaluated for the presence of MBL and ESBL genes. Strains presenting MBL and/or ESBL genes were submitted to pulsed-field gel electrophoresis for genetic similarity evaluation. Results Despite the carbapenem resistance, genes for MBLs (blaSPM-1 or blaIMP-1) were detected in only 26.7% of isolates. Genes encoding ESBLs were detected in 23.2% of isolates. The blaCTX-M-2 was the most prevalent ESBL gene (19.6%), followed by blaGES-1 and blaGES-5 detected in one isolate each. In all isolates presenting MBL phenotype by double-disc synergy test (DDST), the blaSPM-1 or blaIMP-1 genes were detected. In addition, blaIMP-1 was also detected in three isolates which did not display any MBL phenotype. These isolates also presented the blaCTX-M-2 gene. The co-existence of blaCTX-M-2 with blaIMP-1 is presently reported for the first time, as like as co-existence of blaGES-1 with blaIMP-1. Conclusions In this study MBLs production was not the major mechanism of resistance to carbapenems, suggesting the occurrence of multidrug efflux pumps, reduction in porin channels and production of other beta-lactamases. The detection of blaCTX-M-2,blaGES-1 and blaGES-5 reflects the recent emergence of ESBLs among antimicrobial resistant P. aeruginosa and the extraordinary

  2. Domain-specific phosphomimetic mutation allows dissection of different protein kinase C (PKC) isotype-triggered activities of the RNA binding protein HuR.


    Schulz, Sebastian; Doller, Anke; Pendini, Nicole R; Wilce, Jacqueline A; Pfeilschifter, Josef; Eberhardt, Wolfgang


    The ubiquitous mRNA binding protein human antigen R (HuR) participates in the post-transcriptional regulation of many AU-rich element (ARE)-bearing mRNAs. Previously, by using in vitro kinase assay, we have identified serines (Ser) 158, 221 and 318 as targets of protein kinase C (PKC)-triggered phosphorylation. In this study, we tested whether GFP- or GST-tagged HuR constructs bearing a phosphomimetic Ser (S)-to-Asp (D) substitution at the different PKC target sites, would affect different HuR functions including HuR nucleo-cytoplasmic redistribution and binding to different types of ARE-containing mRNAs. The phosphomimetic GFP-tagged HuR protein bearing a phosphomimetic substitution in the hinge region of HuR (HuR-S221D) showed an increased cytoplasmic abundance when compared to wild-type HuR. Conversely, data from in vitro kinase assay and electrophoretic mobility shift assay (EMSA), implicates that phosphorylation at Ser 221 is not relevant for mRNA binding of HuR. Quantification of in vitro binding affinities of GST-tagged wild-type HuR and corresponding HuR proteins bearing a phosphomimetic substitution in either RRM2 (HuR-S158D) or in RRM3 (HuR-S318D) by microscale thermophoresis (MST) indicates a specific binding of wild-type HuR to type I, II or type III-ARE-oligonucleotides in the high nanomolar range. Interestingly, phosphomimetic mutation at position 158 or 318 had a negative influence on HuR binding to type I- and type II-ARE-mRNAs whereas it significantly enhanced HuR affinity to a type III-ARE substrate. Our data suggest that differential phosphorylation of HuR by PKCs at different HuR domains coordinates subcellular HuR distribution and leads to a preferential binding to U-rich bearing target mRNA.

  3. Biochemical characterization of the Caenorhabditis elegans FBF.CPB-1 translational regulat