76 FR 20369 - Notice of Invitation-Coal Exploration License Applications MTM 101687 and MTM 101688

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-12

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [LLMT921000-11-L13200000-EL0000-P; MTM 101687-MTM 101688] Notice of Invitation-Coal Exploration License Applications MTM 101687 and MTM 101688..., Wyoming. Such written notice must refer to serial numbers MTM 101687 or MTM 101688. ADDRESSES: The...

Sound Medication Therapy Management Programs, Version 2.0 with validation study.

PubMed

2008-01-01

The Academy of Managed Care Pharmacy (AMCP, the Academy) contracted with the National Committee for Quality Assurance (NCQA) to conduct a field study to validate and assess the 2006 Sound Medication Therapy Management Programs, Version 1.0 document. Version 1.0 posits several principles of sound medication therapy management (MTM) programs: they (1) recruit patients whose data show they may need assistance with managing medications; (2) have health professionals who intervene with patients and their physicians to improve medication regimens; and (3) measure their results. The validation study determined the extent to which the principles identified in version 1.0 are incorporated in MTM programs. The method was designed to determine to what extent the important features and operational elements of sound MTM programs as described in version 1.0 are (1) acceptable and seen as comprehensive to users, (2) incorporated into MTM programs in the field, (3) reflective of the consensus group's intentions, and (4) in need of modification or updating. NCQA first conducted Phase One, in which NCQA gathered perspectives on the principles in the consensus document from a mixed group of stakeholders representing both providers and users of MTM programs. Phase Two involved a deeper analysis of existing programs related to the consensus document, in which NCQA conducted a Web-based survey of 20 varied MTM programs and conducted in-depth site visits with 5 programs. NCQA selected programs offered by a range of MTM-providing organizations -- health plans, pharmacy benefit management companies, disease management organizations, and stand-alone MTM providers. NCQA analyzed the results of both phases. The Phase Two survey asked specific questions of the programs and found that some programs perform beyond the principles listed in version 1.0. NCQA found that none of the elements of the consensus document should be eliminated because programs cannot perform them, although NCQA suggested some areas where the document could be more expansive or more specific, given the state of MTM operations in the field. The important features and operational elements in the document were categorized into the following 3 overall categories, which NCQA used to structure the survey and conduct the site visits in Phase Two: (1) eligibility and enrollment, (2) operations, and (3) quality management. NCQA found that the original consensus document was realistic in identifying the elements of sound MTM. In the current project, NCQA's purpose was not to make judgments about the effectiveness of MTM programs in general or any individual program in particular. NCQA recommended that the consensus document could be made stronger and more specific in 3 areas: (1) specifically state that the Patient Identification and Recruitment section advocates use of various eligibility criteria that may include, but are not limited to, Medicare-defined MTM eligibility criteria; (2) reframe or remove the statement in Appendix A of the consensus document that the preferred modality for MTM is face-to-face interaction between patient and pharmacist, unless there are comparative data to support it as currently written; and (3) specifically recommend that programs measure performance across the entire populations in their plans in addition to measuring results for those patients selected into MTM. This will make benchmarking among programs possible and will lead to substantiated best practices in this growing field.

Potential Health Implications of Medication Therapy Management Eligibility Criteria in the Patient Protection and Affordable Care Act Across Racial and Ethnic Groups.

PubMed

Wang, Junling; Qiao, Yanru; Shih, Ya-Chen Tina; Jarrett-Jamison, JoEllen; Spivey, Christina A; Wan, Jim Y; White-Means, Shelley I; Dagogo-Jack, Samuel; Cushman, William C; Chisholm-Burns, Marie

2015-11-01

The Medicare Prescription Drug, Improvement, and Modernization Act requires Part D plans to establish programs to provide medication therapy management (MTM) services starting from 2006. MTM services have been found to improve patient outcomes from pharmacotherapy, reduce emergency room visits and hospitalizations, and reduce health care costs in a cost-effective fashion. However, previous research found that non-Hispanic blacks (blacks) and Hispanics may be less likely to be eligible for MTM services than non-Hispanic whites (whites) among the Medicare population, according to current Medicare MTM eligibility criteria. This finding is because Medicare MTM eligibility criteria are predominantly based on medication use and costs, and blacks and Hispanics tend to use fewer prescription medications and incur lower prescription medication costs. The Patient Protection and Affordable Care Act (PPACA) laid out a set of MTM eligibility criteria for eligible entities to target patients for MTM services: "(1) take 4 or more prescribed medications ...; (2) take any 'high risk' medications; (3) have 2 or more chronic diseases ... or (4) have undergone a transition of care, or other factors ... that are likely to create a high risk of medication-related problems." To (a) examine racial/ethnic disparities in meeting the eligibility criteria for MTM services in PPACA among the Medicare population and (b) determine whether there would be greater disparities in health and economic outcomes among MTM-ineligible than MTM-eligible groups. This was a retrospective cross-sectional analysis of the Medicare Current Beneficiaries Survey (2007-2008). To determine medication characteristics, the U.S. Food and Drug Administration's Electronic Orange Book was also used. Proportions of the population eligible for MTM services based on PPACA MTM eligibility criteria were compared across racial and ethnic groups using a chi-square test; a logistic regression model was used to adjust for population sociodemographic and health characteristics. Health and economic outcomes examined included health status (self-perceived good health status, number of chronic diseases, activities of daily living [ADLs], and instrumental activities of daily living [IADLs]), health services utilization and costs (physician visits, emergency room visits, and total health care costs), and medication use patterns (generic dispensing ratio). To determine difference in disparities across MTM eligibility categories, difference-in-differences regressions of various functional forms were employed, depending on the nature of the dependent variables. Interaction terms between the dummy variables for minority groups (e.g., blacks or Hispanics) and MTM eligibility were included to test whether disparity patterns varied between MTM-ineligible and MTM-eligible individuals. The sample consisted of 12,966 Medicare beneficiaries, of which 11,161 were white, 930 were black, and 875 were Hispanic. Of the study sample, 9,992 whites (86.4%), 825 blacks (86.3%), and 733 Hispanics (80.6%) were eligible for MTM. The difference between whites and Hispanics was significant (P  less than  0.050), and the difference between whites and blacks was not significant (P  greater than 0.050). In multivariate analyses, significant disparity in eligibility for MTM services was found only between Hispanics and whites (odds ratio [OR] = 0.59; 95% CI = 0.43-0.82) but not between blacks and whites (OR = 0.78; 95% CI = 0.55-1.09). Disparities were greater among the MTM-ineligible than the MTM-eligible populations in self-perceived health status, ADLs, and IADLs for both blacks and Hispanics compared with whites. When analyzing the number of chronic conditions, the number and costs of physician visits, and total health care costs, the authors of this study found lower racial and ethnic disparities among the ineligible population than the eligible population. Hispanics are significantly less likely than whites to qualify for MTM among the Medicare population, according to MTM eligibility criteria stipulated in the PPACA. PPACA MTM eligibility criteria may aggravate existing racial and ethnic disparities in health status but may remediate racial and ethnic disparities in health services utilization. Alternative MTM eligibility criteria other than PPACA MTM eligibility criteria may be needed to improve the efficiency and equity of access to Medicare Part D MTM programs.

75 FR 30060 - Notice of Proposed Reinstatement of Terminated Oil and Gas Leases MTM 97526 and MTM 97527, Montana

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-28

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [LLMT922200-10-L13100000-FI0000-P; MTM 97526 and MTM 97527] Notice of Proposed Reinstatement of Terminated Oil and Gas Leases MTM 97526 and MTM... MTM 97526 and MTM 97527, Richland County, Montana. The lessee paid the required rental accruing from...

Physicians' Preferences for Communication of Pharmacist-Provided Medication Therapy Management in Community Pharmacy.

PubMed

Guthrie, Kendall D; Stoner, Steven C; Hartwig, D Matthew; May, Justin R; Nicolaus, Sara E; Schramm, Andrew M; DiDonato, Kristen L

2017-02-01

(1) To identify physicians' preferences in regard to pharmacist-provided medication therapy management (MTM) communication in the community pharmacy setting; (2) to identify physicians' perceived barriers to communicating with a pharmacist regarding MTM; and (3) to determine whether Missouri physicians feel MTM is beneficial for their patients. A cross-sectional prospective survey study of 2021 family and general practice physicians registered with MO HealthNet, Missouri's Medicaid program. The majority (52.8%) of physicians preferred MTM data to be communicated via fax. Most physicians who provided care to patients in long-term care (LTC) facilities (81.0%) preferred to be contacted at their practice location as opposed to the LTC facility. The greatest barriers to communication were lack of time and inefficient communication practices. Improved/enhanced communication was the most common suggestion for improvement in the MTM process. Approximately 67% of respondents reported MTM as beneficial or somewhat beneficial for their patients. Survey respondents saw value in the MTM services offered by pharmacists. However, pharmacists should use the identified preferences and barriers to improve their currently utilized communication practices in hopes of increasing acceptance of recommendations. Ultimately, this may assist MTM providers in working collaboratively with patients' physicians.

Multi-Objective Optimization of Fleet-Level Metrics to Determine New System Design Requirements: An Application to Military Air Cargo Fuel Efficiency

DTIC Science & Technology

2014-04-30

15, 2014 11:15 a.m. – 12: 45 p.m. Chair: Ken Mitchell Jr., Director, Research and Analysis, Defense Logistics Agency Mixture Distributions for...póåÉêÖó=Ñçê=fåÑçêãÉÇ=`Ü~åÖÉ= = - 276 - DOC = direct operating cost MTM /D = million ton-miles per day Op,i = indicates if airport i is the initial...highest level of modeled strategic airlift demand, required 32.7 million ton-miles per day ( MTM /D). MTM /D values for each type of aircraft are

Comparison of two Medication Therapy Management Practice Models on Return on Investment.

PubMed

Gazda, Nicholas P; Berenbrok, Lucas A; Ferreri, Stefanie P

2017-06-01

To compare the return on investment (ROI) of an integrated practice model versus a "hub and spoke" practice model of pharmacist provided medication therapy management (MTM). A cohort retrospective analysis of MTM claims billed in 76 pharmacies in North Carolina in the 2010 hub and spoke practice model and the 2012 "integrated" practice model were analyzed to calculate the ROI. In 2010, 4089 patients received an MTM resulting in 8757 claims in the hub and spoke model. In 2012, 4896 patients received an MTM resulting in 13 730 claims in the integrated model. In 2010, US$165 897.26 was invested in pharmacist salary and $173 498.00 was received in reimbursement, resulting in an ROI of +US$7600.74 (+4.6%). In 2012, US$280 890.09 was invested in pharmacist salary and US$302 963 was received in reimbursement, resulting in an ROI of +US$22 072.91 or (+7.9%). The integrated model of MTM showed an increase in number of claims submitted and in number of patients receiving MTM services, ultimately resulting in a higher ROI. While a higher ROI was evident in the integrated model, both models resulted in positive ROI (1:12-1:21), highlighting that MTM programs can be cost effective with different strategies of execution.

Myotubular Myopathy in a girl with a deletion of Xq27-q28 and unbalanced X inactivation assigns the MTM1 gene to a 600-kb region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dahl, N.; Mandel, J.L.; Chery, M.

1995-05-01

A young girl with a clinically moderate form of myotubular myopathy was found to carry a cytogenetically detectable deletion in Xq27-q28. The deletion had occurred de novo on the paternal X chromosome. It encompasses the fragile X (FRAXA) and Hunter syndrome (IDS) loci, and the DXS304 and DXS455 markers, in Xq27.3 and proximal Xq28. Other loci from the proximal half of Xq28 (DXS49, DXS256, DXS258, DXS305, and DXS497) were found intact. As the X-linked myotubular myopathy locus (MTM1) was previously mapped to Xq28 by linkage analysis, the present observation suggested that MTM1 is included in the deletion. However, a significantmore » clinical phenotype is unexpected in a female MTM1 carrier. Analysis of inactive X-specific methylation at the androgen receptor gene showed that the deleted X chromosome was active in {approximately}80% of leukocytes. Such unbalanced inactivation may account for the moderate MTM1 phenotype and for the mental retardation that later developed in the patient. This observation is discussed in relation to the hypothesis that a locus modulating X inactivation may lie in the region. Comparison of this deletion with that carried by a male patient with a severe Hunter syndrome phenotype but no myotubular myopathy, in light of recent linkage data on recombinant MTM1 families, led to a considerable refinement of the position of the MTM1 locus, to a region of {approximately}600 kb, between DXS304 and DXS497. 46 refs., 4 figs.« less

Design, Fabrication and Testing of Two Dimensional Radio-Frequency Metamaterials

DTIC Science & Technology

2014-03-03

metasurfaces . These antennas are either MTM based or utilize MTMs to increase performance. The benefits of these antennas are: reduced size, lower...reduced size and increased quality factor. Finally, the antennas loaded with metasurfaces are similar to the MTM loading; in the fact that the... metasurface enhances the antenna performance instead of performing the antenna function. This type of antenna has shown increased directionality and

Comparison of spinal manipulation methods and usual medical care for acute and subacute low back pain: a randomized clinical trial.

PubMed

Schneider, Michael; Haas, Mitchell; Glick, Ronald; Stevans, Joel; Landsittel, Doug

2015-02-15

Randomized controlled trial with follow-up to 6 months. This was a comparative effectiveness trial of manual-thrust manipulation (MTM) versus mechanical-assisted manipulation (MAM); and manipulation versus usual medical care (UMC). Low back pain (LBP) is one of the most common conditions seen in primary care and physical medicine practice. MTM is a common treatment for LBP. Claims that MAM is an effective alternative to MTM have yet to be substantiated. There is also question about the effectiveness of manipulation in acute and subacute LBP compared with UMC. A total of 107 adults with onset of LBP within the past 12 weeks were randomized to 1 of 3 treatment groups: MTM, MAM, or UMC. Outcome measures included the Oswestry LBP Disability Index (0-100 scale) and numeric pain rating (0-10 scale). Participants in the manipulation groups were treated twice weekly during 4 weeks; subjects in UMC were seen for 3 visits during this time. Outcome measures were captured at baseline, 4 weeks, 3 months, and 6 months. Linear regression showed a statistically significant advantage of MTM at 4 weeks compared with MAM (disability = -8.1, P = 0.009; pain = -1.4, P = 0.002) and UMC (disability = -6.5, P = 0.032; pain = -1.7, P < 0.001). Responder analysis, defined as 30% and 50% reductions in Oswestry LBP Disability Index scores revealed a significantly greater proportion of responders at 4 weeks in MTM (76%; 50%) compared with MAM (50%; 16%) and UMC (48%; 39%). Similar between-group results were found for pain: MTM (94%; 76%); MAM (69%; 47%); and UMC (56%; 41%). No statistically significant group differences were found between MAM and UMC, and for any comparison at 3 or 6 months. MTM provides greater short-term reductions in self-reported disability and pain scores compared with UMC or MAM. 2.

Cortical integrity of the inferior alveolar canal as a predictor of paresthesia after third-molar extraction.

PubMed

Park, Wonse; Choi, Ji-Wook; Kim, Jae-Young; Kim, Bong-Chul; Kim, Hyung Jun; Lee, Sang-Hwy

2010-03-01

Paresthesia is a well-known complication of extraction of mandibular third molars (MTMs). The authors evaluated the relationship between paresthesia after MTM extraction and the cortical integrity of the inferior alveolar canal (IAC) by using computed tomography (CT). The authors designed a retrospective cohort study involving participants considered, on the basis of panoramic imaging, to be at high risk of experiencing injury of the inferior alveolar nerve who subsequently underwent CT imaging and extraction of the MTMs. The primary predictor variable was the contact relationship between the IAC and the MTM as viewed on a CT image, classified into three groups: group 1, no contact; group 2, contact between the MTM and the intact IAC cortex; group 3, contact between the MTM and the interrupted IAC cortex. The secondary predictor variable was the number of CT image slices showing the cortical interruption around the MTM. The outcome variable was the presence or absence of postoperative paresthesia after MTM extraction. The study sample comprised 179 participants who underwent MTM extraction (a total of 259 MTMs). Their mean age was 23.6 years, and 85 (47.5 percent) were male. The overall prevalence of paresthesia was 4.2 percent (11 of 259 teeth). The prevalence of paresthesia in group 3 (involving an interrupted IAC cortex) was 11.8 percent (10 of 85 cases), while for group 2 (involving an intact IAC cortex) and group 1 (involving no contact) it was 1.0 percent (1 of 98 cases) and 0.0 percent (no cases), respectively. The frequency of nerve damage increased with the number of CT image slices showing loss of cortical integrity (P=.043). The results of this study indicate that loss of IAC cortical integrity is associated with an increased risk of experiencing paresthesia after MTM extraction.

Developing a dashboard for benchmarking the productivity of a medication therapy management program.

PubMed

Umbreit, Audrey; Holm, Emily; Gander, Kelsey; Davis, Kelsie; Dittrich, Kristina; Jandl, Vanda; Odell, Laura; Sweeten, Perry

To describe a method for internal benchmarking of medication therapy management (MTM) pharmacist activities. Multisite MTM pharmacist practices within an integrated health care system. MTM pharmacists are located within primary care clinics and provide medication management through collaborative practice. MTM pharmacist activity is grouped into 3 categories: direct patient care, nonvisit patient care, and professional activities. MTM pharmacist activities were tracked with the use of the computer-based application Pharmacist Ambulatory Resource Management System (PhARMS) over a 12-month period to measure growth during a time of expansion. A total of 81% of MTM pharmacist time was recorded. A total of 1655.1 hours (41%) was nonvisit patient care, 1185.2 hours (29%) was direct patient care, and 1190.4 hours (30%) was professional activities. The number of patient visits per month increased during the study period. There were 1496 direct patient care encounters documented. Of those, 1051 (70.2%) were face-to-face visits, 257 (17.2%) were by telephone, and 188 (12.6%) were chart reviews. Nonvisit patient care and professional activities also increased during the period. PhARMS reported MTM pharmacist activities and captured nonvisit patient care work not tracked elsewhere. Internal benchmarking data proved to be useful for justifying increases in MTM pharmacist personnel resources. Reviewing data helped to identify best practices from high-performing sites. Limitations include potential for self-reporting bias and lack of patient outcomes data. Implementing PhARMS facilitated internal benchmarking of patient care and nonpatient care activities in a regional MTM program. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Establishment and Implementation of a Required Medication Therapy Management Advanced Pharmacy Practice Experience

PubMed Central

Gilliam, Eric; Thompson, Megan; Vande Griend, Joseph

2017-01-01

Objective. To develop a community pharmacy-based medication therapy management (MTM) advanced pharmacy practice experience (APPE) that provides students with skills and knowledge to deliver entry-level pharmacy MTM services. Design. The University of Colorado Skaggs School of Pharmacy & Pharmaceutical Sciences (SSPPS) partnered with three community pharmacy chains to establish this three-week, required MTM APPE. Students completed the American Pharmacists Association MTM Certificate Course prior to entering the APPE. Students were expected to spend 90% or more of their time at this experience working on MTM interventions, using store MTM platforms. Assessment. All 151 students successfully completed this MTM APPE, and each received a passing evaluation from their preceptor. Preceptor evaluations of students averaged above four (entry-level practice) on a five-point Likert scale. The majority of students reported engagement in MTM services for more than 80% of the time on site. Students’ self-reporting of their ability to perform MTM interventions improved after participation in the APPE. Conclusion. The SSPPS successfully implemented a required MTM APPE, preparing students for entry-level delivery of MTM services. PMID:28381896

Medication Therapy Management in community pharmacy practice: core elements of an MTM service (version 1.0).

PubMed

2005-01-01

To develop a model framework of Medication Therapy Management (MTM) in community pharmacy designed to improve care, enhance communication among patients and providers, improve collaboration among providers, and optimize medication use that leads to improved patient outcomes. Peer-reviewed literature, structured discussions with community pharmacy leaders and representatives from pharmacy benefit providers and health plans, and input from pharmacists and pharmacy associations. Building on an MTM consensus definition adopted by 11 national pharmacy organizations in July 2004, this model describes core elements of an MTM service that can be provided by pharmacists across the spectrum of community pharmacy. The model is structured for pharmacists to use with all patients in need of MTM services, both in the private and public sector. The model describes five core elements of MTM in the community pharmacy setting: medication therapy review (MTR), a personal medication record (PMR), a medication action plan (MAP), intervention and referral, and documentation and follow-up. The MTR can be comprehensive or targeted, depending onthe needs of the patient. The PMR and MAP are patient-centered documents intended to be used by the patient to improve medication self-management. A collaborative approach to patient care involving patients, pharmacists, and physicians and other health care providers is advocated in the model. General patient eligibility considerations are also described. A model framework for consideration by community pharmacists in developing MTM services is described. The model consists of five core elements for MTM service delivery in community pharmacy practice.

Impact of live medication therapy management on cholesterol values in patients with cardiovascular disease.

PubMed

Thumar, Ricky; Zaiken, Kathy

2014-01-01

To compare the impact of clinical pharmacist (CP) recommendations through a live, primary care-based, medication therapy management (MTM) protocol on low-density-lipoprotein (LDL) cholesterol in patients who have cardiovascular disease (CVD) with standard, chart-review MTM. Patients with established CVD who were not at their LDL goal were identified and analyzed by either a chart-review MTM service or a live, one-on-one pharmacist-physician MTM service over a 6-month timeframe. For the chart-review MTM service, recommendations were communicated through an electronic medical record (EMR) that the physician and pharmacist had access to. Primary outcomes included mean LDL reduction from baseline, number of patients achieving their LDL goal, and percent of implemented CP recommendations. Mean LDL reduction from baseline in the chart-review MTM group and the live MTM group was 36 mg/dL ± 23.2 mg/dL (P = 0.001) and 62 mg/dL ± 28.3 mg/dL (P = 0.001), respectively. The difference between these two groups was statistically significant (P = 0.001). The chart-review MTM group had 30% of patients reach their LDL goal with 66.3% of CP recommendations implemented compared to 51.3% and 86.3% for the same parameters in the live MTM group (P = 0.006 and P = 0.003, respectively). Although both MTM services provide a significant LDL reduction from baseline in patients with CVD, live MTM provides significantly greater LDL reductions, implemented CP recommendations, and goal attainment than chart-review MTM. Thus, live MTM services are more effective than chart-review MTM services, at least within the clinics that these protocols were assessed for the purposes of this study.

Evaluation of Eligibility Criteria Used to Identify Patients for Medication Therapy Management Services: A Retrospective Cohort Study in a Medicare Advantage Part D Population.

PubMed

Lee, Janet S; Yang, Jianing; Stockl, Karen M; Lew, Heidi; Solow, Brian K

2016-01-01

General eligibility criteria used by the Centers for Medicare & Medicaid Services (CMS) to identify patients for medication therapy management (MTM) services include having multiple chronic conditions, taking multiple Part D drugs, and being likely to incur annual drug costs that exceed a predetermined threshold. The performance of these criteria in identifying patients in greatest need of MTM services is unknown. Although there are numerous possible versions of MTM identification algorithms that satisfy these criteria, there are limited data that evaluate the performance of MTM services using eligibility thresholds representative of those used by the majority of Part D sponsors. To (a) evaluate the performance of the 2013 CMS MTM eligibility criteria thresholds in identifying Medicare Advantage Prescription Drug (MAPD) plan patients with at least 2 drug therapy problems (DTPs) relative to alternative criteria threshold levels and (b) identify additional patient risk factors significantly associated with the number of DTPs for consideration as potential future MTM eligibility criteria. All patients in the Medicare Advantage Part D population who had pharmacy eligibility as of December 31, 2013, were included in this retrospective cohort study. Study outcomes included 7 different types of DTPs: use of high-risk medications in the elderly, gaps in medication therapy, medication nonadherence, drug-drug interactions, duplicate therapy, drug-disease interactions, and brand-to-generic conversion opportunities. DTPs were identified for each member based on 6 months of most recent pharmacy claims data and 14 months of most recent medical claims data. Risk factors examined in this study included patient demographics and prior health care utilization in the most recent 6 months. Descriptive statistics were used to summarize patient characteristics and to evaluate unadjusted relationships between the average number of DTPs identified per patient and each risk factor. Quartile values identified in the study population for number of diseases, number of drugs, and annual spend were used as potential new criteria thresholds, resulting in 27 new MTM criteria combinations. The performance of each eligibility criterion was evaluated using sensitivity, specificity, positive predictive values (PPVs), and negative predictive values (NPVs). Patients identified with at least 2 DTPs were defined as those who would benefit from MTM services and were used as the gold standard. As part of a sensitivity analysis, patients identified with at least 1 DTP were used as the gold standard. Lastly, a multivariable negative binomial regression model was used to evaluate the relationship between each risk factor and the number of identified DTPs per patient while controlling for the patients' number of drugs, number of chronic diseases, and annual drug spend. A total of 2,578,336 patients were included in the study. The sensitivity, specificity, PPV, and NPV of CMS MTM criteria for the 2013 plan year were 15.3%, 95.6%, 51.3%, and 78.8%, respectively. Sensitivity and PPV improved when the drug count threshold increased from 8 to 10, and when the annual drug cost decreased from $3,144 to $2,239 or less. Results were consistent when at least 1 DTP was used as the gold standard. The adjusted rate of DTPs was significantly greater among patients identified with higher drug and disease counts, annual drug spend, and prior ER or outpatient or hospital visits. Patients with higher median household incomes who were male, younger, or white had significantly lower rates of DTPs. The performance of MTM eligibility criteria can be improved by increasing the threshold values for drug count while decreasing the threshold value for annual drug spend. Furthermore, additional risk factors, such as a recent ER or hospital visit, may be considered as potential MTM eligibility criteria.

Using pharmacists to improve risk stratification and management of stage 3A chronic kidney disease: a feasibility study.

PubMed

Chang, Alex R; Evans, Michael; Yule, Christina; Bohn, Larissa; Young, Amanda; Lewis, Meredith; Graboski, Elisabeth; Gerdy, Bethany; Ehmann, William; Brady, Jonathan; Lawrence, Leah; Antunes, Natacha; Green, Jamie; Snyder, Susan; Kirchner, H Lester; Grams, Morgan; Perkins, Robert

2016-11-08

Measurement of albuminuria to stratify risk in chronic kidney disease (CKD) is not done universally in the primary care setting despite recommendation in KDIGO (Kidney Disease Improving Global Outcomes) guidelines. Pharmacist medication therapy management (MTM) may be helpful in improving CKD risk stratification and management. We conducted a pragmatic, cluster-randomized trial using seven primary care clinic sites in the Geisinger Health System to evaluate the feasibility of pharmacist MTM in patients with estimated glomerular filtration rate (eGFR) 45-59 ml/min/1.73 m 2 and uncontrolled blood pressure (≥150/85 mmHg). In the three pharmacist MTM sites, pharmacists were instructed to follow a protocol aimed to improve adherence to KDIGO guidelines on testing for proteinuria and lipids, and statin and blood pressure medical therapy. In the four control clinics, patients received usual care. The primary outcome was proteinuria screening over a follow-up of 1 year. A telephone survey was administered to physicians, pharmacists, and patients in the pharmacist MTM arm at the end of the trial. Baseline characteristics were similar between pharmacist MTM (n = 24) and control (n = 23) patients, although pharmacist MTM patients tended to be younger (64 vs. 71 y; p = 0.06) and less likely to have diabetes (17 % vs. 35 %; p = 0.2) or baseline proteinuria screening (41.7 % vs. 60.9 %, p = 0.2). Mean eGFR was 54 ml/min/1.73 m 2 in both groups. The pharmacist MTM intervention did not significantly improve total proteinuria screening at the population level (OR 2.6, 95 % CI: 0.5-14.0; p = 0.3). However, it tended to increase screening of previously unscreened patients (78.6 % in the pharmacist MTM group compared to 33.3 % in the control group; OR 7.3, 95 % CI: 0.96-56.3; p = 0.05). In general, the intervention was well-received by patients, pharmacists, and providers, who agreed that pharmacists could play an important role in CKD management. A few patients contacted the research team to express anxiety about having a CKD diagnosis without prior knowledge. Pharmacist MTM may be useful in improving risk stratification and management of CKD in the primary care setting, although implementation requires ongoing education and multidisciplinary collaboration and careful communication regarding CKD diagnosis. Future studies are needed to establish the effectiveness of pharmacist MTM on slowing CKD progression and improvement in cardiovascular outcomes. ClinicalTrials.gov, NCT02208674 Registered August 1, 2014, first patient enrolled September 30, 2014.

Racial and ethnic disparities in meeting MTM eligibility criteria among patients with asthma.

PubMed

Lu, Degan; Qiao, Yanru; Johnson, Karen C; Wang, Junling

2017-06-01

Asthma is one of the most frequently targeted chronic diseases in the medication therapy management (MTM) programs of the Medicare prescription drug (Part D) benefits. Although racial and ethnic disparities in meeting eligibility criteria for MTM services have been reported, little is known about whether there would be similar disparities among adults with asthma in the United States. Adult patients with asthma (age ≥ 18) from Medical Expenditure Panel Survey (2011-2012) were analyzed. Bivariate analyses were conducted to compare the proportions of patients who would meet Medicare MTM eligibility criteria between non-Hispanic Blacks (Blacks), Hispanics and non-Hispanic Whites (Whites). Survey-weighted logistic regression was performed to adjust for patient characteristics. Main and sensitivity analyses were conducted to cover the entire range of the eligibility thresholds used by Part D plans in 2011-2012. The sample included 4,455 patients with asthma, including 2,294 Whites, 1,218 Blacks, and 943 Hispanics. Blacks and Hispanics had lower proportions of meeting MTM eligibility criteria than did Whites (P < 0.001). According to the main analysis, Blacks and Hispanics had 36% and 32% lower, respectively, likelihood of MTM eligibility than Whites (odds ratio [OR]: 0.64, 95% confidence interval [CI]: 0.45-0.90; OR: 0.68, 95% CI: 0.47-0.98, respectively). Similar results were obtained in sensitivity analyses. There are racial and ethnic disparities in meeting Medicare Part D MTM eligibility criteria among adult patients with asthma. Future studies should examine the implications of such disparities on health outcomes of patients with asthma and explore alternative MTM eligibility criteria.

Retrospective financial analysis of medication therapy management services from the pharmacy's perspective.

PubMed

McDonough, Randal P; Harthan, Aaron A; McLeese, Kelly E; Doucette, William R

2010-01-01

To determine the net financial gain or loss for medication therapy management (MTM) services provided to patients by an independent community pharmacy during 16 months of operation. Retrospective study. Independent community pharmacy in Iowa City, IA, from September 1, 2006, to December 31, 2007. Patients receiving MTM services during the specified period who had proper documentation of reimbursement for the services. MTM services were provided to the patient and documented by the pharmacist or student pharmacist. Net financial gains or losses for providing MTM services. Sensitivity analyses included costs that might be incurred under various conditions of operation. 103 initial and 88 follow-up MTM visits were conducted during a 16-month time period. The total cost for these services to the pharmacy was $11,191.72. Total revenue from these services was $11,195.00; therefore, the pharmacy experienced a net financial gain of $3.28. Sensitivity analyses were conducted, revealing the net gain/loss to the pharmacy if a student pharmacist was used and the net gain/loss if the pharmacist needed extra training to provide the services. Using a student pharmacist resulted in a net gain of $6,308.48, while extra training for the pharmacist resulted in a net loss of $1,602.72. The MTM service programs showed a positive financial gain after 16 months of operation, which should encourage pharmacists to incorporate these services into their practice.

Chronic cardiovascular disease mortality in mountaintop mining areas of central Appalachian states.

PubMed

Esch, Laura; Hendryx, Michael

2011-01-01

To determine if chronic cardiovascular disease (CVD) mortality rates are higher among residents of mountaintop mining (MTM) areas compared to mining and nonmining areas, and to examine the association between greater levels of MTM surface mining and CVD mortality. Age-adjusted chronic CVD mortality rates from 1999 to 2006 for counties in 4 Appalachian states where MTM occurs (N = 404) were linked with county coal mining data. Three groups of counties were compared: MTM, coal mining but not MTM, and nonmining. Covariates included smoking rate, rural-urban status, percent male population, primary care physician supply, obesity rate, diabetes rate, poverty rate, race/ethnicity rates, high school and college education rates, and Appalachian county. Linear regression analyses examined the association of mortality rates with mining in MTM areas and non-MTM areas and the association of mortality with quantity of surface coal mined in MTM areas. Prior to covariate adjustment, chronic CVD mortality rates were significantly higher in both mining areas compared to nonmining areas and significantly highest in MTM areas. After adjustment, mortality rates in MTM areas remained significantly higher and increased as a function of greater levels of surface mining. Higher obesity and poverty rates and lower college education rates also significantly predicted CVD mortality overall and in rural counties. MTM activity is significantly associated with elevated chronic CVD mortality rates. Future research is necessary to examine the socioeconomic and environmental impacts of MTM on health to reduce health disparities in rural coal mining areas. © 2011 National Rural Health Association.

Nonlinear surface waves at ferrite-metamaterial waveguide structure

NASA Astrophysics Data System (ADS)

Hissi, Nour El Houda; Mokhtari, Bouchra; Eddeqaqi, Noureddine Cherkaoui; Shabat, Mohammed Musa; Atangana, Jacques

2016-09-01

A new ferrite slab made of a metamaterial (MTM), surrounded by a nonlinear cover cladding and a ferrite substrate, was shown to support unusual types of electromagnetic surface waves. We impose the boundary conditions to derive the dispersion relation and others necessary to formulate the proposed structure. We analyse the dispersion properties of the nonlinear surface waves and we calculate the associated propagation index and the film-cover interface nonlinearity. In the calculation, several sets of the permeability of the MTM are considered. Results show that the waves behaviour depends on the values of the permeability of the MTM, the thickness of the waveguide and the film-cover interface nonlinearity. It is also shown that the use of the singular solutions to the electric field equation allows to identify several new properties of surface waves which do not exist in conventional waveguide.

Modeling the microstructurally dependent mechanical properties of poly(ester-urethane-urea)s.

PubMed

Warren, P Daniel; Sycks, Dalton G; McGrath, Dominic V; Vande Geest, Jonathan P

2013-12-01

Poly(ester-urethane-urea) (PEUU) is one of many synthetic biodegradable elastomers under scrutiny for biomedical and soft tissue applications. The goal of this study was to investigate the effect of the experimental parameters on mechanical properties of PEUUs following exposure to different degrading environments, similar to that of the human body, using linear regression, producing one predictive model. The model utilizes two independent variables of poly(caprolactone) (PCL) type and copolymer crystallinity to predict the dependent variable of maximum tangential modulus (MTM). Results indicate that comparisons between PCLs at different degradation states are statistically different (p < 0.0003), while the difference between experimental and predicted average MTM is statistically negligible (p < 0.02). The linear correlation between experimental and predicted MTM values is R(2) = 0.75. Copyright © 2013 Wiley Periodicals, Inc., a Wiley Company.

Effect of an Advanced Pharmacy Practice Experience on Medication Therapy Management Services in a Centralized Retail Pharmacy Program.

PubMed

Vande Griend, Joseph P; Rodgers, Melissa; Nuffer, Wesley

2017-05-01

Medication therapy management (MTM) delivery is increasingly important in managed care. Successful delivery positively affects patient health and improves Centers for Medicare & Medicaid Services star ratings, a measure of health plan quality. As MTM services continue to grow, there is an increased need for efficient and effective care models. The primary objectives of this project were to describe the delivery of MTM services by fourth-year Advanced Pharmacy Practice Experience (APPE) students in a centralized retail pharmacy system and to evaluate and quantify the clinical and financial contributions of the students. The secondary objective was to describe the engagement needed to complete comprehensive medication reviews (CMRs) and targeted interventions. From May 2015 to December 2015, thirty-five APPE students from the University of Colorado Skaggs School of Pharmacy provided MTM services at Albertsons Companies using the OutcomesMTM and Mirixa platforms. Students delivered patient care services by phone at the central office and provided face-to-face visits at pharmacies in the region. With implementation of the MTM APPE in 2015, the team consisted of 2 MTM pharmacists and pharmacy students, as compared with 1 MTM pharmacist in 2014. The number of CMRs and targeted interventions completed and the estimated additional revenue generated during the 2015 time period were compared with those completed from May through December 2014. The patient and provider engagement needed to complete the CMRs and targeted interventions was summarized. 125 CMRs and 1,918 targeted interventions were billed in 2015, compared with 13 CMRs and 767 targeted interventions in 2014. An estimated $16,575-$49,272 of additional revenue was generated in 2015. To complete the interventions in 2015, the team engaged in 1,714 CMR opportunities and 4,686 targeted intervention opportunities. In this MTM rotation, students provided real-life care to patients, resulting in financial and clinical contributions. This model of education and care delivery can be replicated in the community pharmacy or managed care setting. APPE students are an important component of this model of care delivery, particularly when considering the level of patient engagement needed to complete MTM interventions. No outside funding supported this research. The authors have no conflicts of interest to disclose related to this work. All authors contributed to study concept and design. Rodgers collected the data, and data interpretation was performed by Vande Griend, along with Rodgers and Nuffer. The manuscript was written and revised primarily by Vande Griend, along with Nuffer and Rodgers. This project was presented at the Pharmacy Quality Alliance Annual Meeting in Arlington, Virginia, in May 2016.

Pharmacy technician involvement in community pharmacy medication therapy management.

PubMed

Lengel, Matthew; Kuhn, Catherine H; Worley, Marcia; Wehr, Allison M; McAuley, James W

To assess the impact of technician involvement on the completion of medication therapy management (MTM) services in a community pharmacy setting and to describe pharmacists' and technicians' perceptions of technician involvement in MTM-related tasks and their satisfaction with the technician's role in MTM. Prospective observational study. In the fall of 2015, pharmacists and selected technicians from 32 grocery store-based community pharmacies were trained to use technicians within MTM services. Completed MTM claims were evaluated at all pharmacies for 3 months before training and 3 months after training. An electronic survey, developed with the use of competencies taught in the training and relevant published literature, was distributed via e-mail to trained employees 3 months after training. The total number of completed MTM claims at the 32 pharmacy sites was higher during the posttraining time period (2687 claims) versus the pretraining period (1735 claims). Of the 182 trained participants, 112 (61.5%) completed the survey. Overall, perceived technician involvement was lower than expected. However, identifying MTM opportunities was the most commonly reported technician MTM task, with 62.5% of technicians and 47.2% of pharmacists reporting technician involvement. Nearly one-half of technicians (42.5%) and pharmacists (44.0%) agreed or strongly agreed they were satisfied with the technician's role in MTM services, and 40.0% of technicians agreed that they were more satisfied with their work in the pharmacy after involvement in MTM. Three months after initial training of technicians in MTM, participation of technicians was lower than expected. However, the technicians involved most often reported identifying MTM opportunities for pharmacists, which may be a focus for future technician trainings. In addition, technician involvement in MTM services may increase satisfaction with many aspects of work for actively involved technicians. Copyright © 2018 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Attracting Students to Space Science Fields: Mission to Mars

NASA Astrophysics Data System (ADS)

Congdon, Donald R.; Lovegrove, William P.; Samec, Ronald G.

Attracting high school students to space science is one of the main goals of Bob Jones University's annual Mission to Mars (MTM). MTM develops interest in space exploration through a highly realistic simulated trip to Mars. Students study and learn to appreciate the challenges of space travel including propulsion life support medicine planetary astronomy psychology robotics and communication. Broken into teams (Management Spacecraft Design Communications Life Support Navigation Robotics and Science) they address the problems specific to each aspect of the mission. Teams also learn to interact and recognize that a successful mission requires cooperation. Coordinated by the Management Team the students build a spacecraft and associated apparatus connect computers and communications equipment train astronauts on the mission simulator and program a Pathfinder-type robot. On the big day the astronauts enter the spacecraft as Mission Control gets ready to support them through the expected and unexpected of their mission. Aided by teamwork the astronauts must land on Mars perform their scientific mission on a simulated surface of mars and return home. We see the success of MTM not only in successful missions but in the students who come back year after year for another MTM.

Are residents of mountain-top mining counties more likely to have infants with birth defects? The West Virginia experience.

PubMed

Lamm, Steven H; Li, Ji; Robbins, Shayhan A; Dissen, Elisabeth; Chen, Rusan; Feinleib, Manning

2015-02-01

Pooled 1996 to 2003 birth certificate data for four central states in Appalachia indicated higher rates of infants with birth defects born to residents of counties with mountain-top mining (MTM) than born to residents of non-mining-counties (Ahern 2011). However, those analyses did not consider sources of uncertainty such as unbalanced distributions or quality of data. Quality issues have been a continuing problem with birth certificate analyses. We used 1990 to 2009 live birth certificate data for West Virginia to reassess this hypothesis. Forty-four hospitals contributed 98% of the MTM-county births and 95% of the non-mining-county births, of which six had more than 1000 births from both MTM and nonmining counties. Adjusted and stratified prevalence rate ratios (PRRs) were computed both by using Poisson regression and Mantel-Haenszel analysis. Unbalanced distribution of hospital births was observed by mining groups. The prevalence rate of infants with reported birth defects, higher in MTM-counties (0.021) than in non-mining-counties (0.015), yielded a significant crude PRR (cPRR = 1.43; 95% confidence interval [CI] = 1.36-1.52) but a nonsignificant hospital-adjusted PRR (adjPRR = 1.08; 95% CI = 0.97-1.20; p = 0.16) for the 44 hospitals. So did the six hospital data analysis ([cPRR = 2.39; 95% CI = 2.15-2.65] and [adjPRR = 1.01; 95% CI, 0.89-1.14; p = 0.87]). No increased risk of birth defects was observed for births from MTM-counties after adjustment for, or stratification by, hospital of birth. These results have consistently demonstrated that the reported association between birth defect rates and MTM coal mining was a consequence of data heterogeneity. The data do not demonstrate evidence of a "Mountain-top Mining" effect on the prevalence of infants with reported birth defects in WV. © 2014 Wiley Periodicals, Inc.

Mapping the route to medication therapy management documentation and billing standardization and interoperabilility within the health care system: meeting proceedings.

PubMed

Millonig, Marsha K

2009-01-01

To convene a diverse group of stakeholders to discuss medication therapy management (MTM) documentation and billing standardization and its interoperability within the health care system. More than 70 stakeholders from pharmacy, health information systems, insurers/payers, quality, and standard-setting organizations met on October 7-8, 2008, in Bethesda, MD. The American Pharmacists Association (APhA) organized the invitational conference to facilitate discussion on strategic directions for meeting current market need for MTM documentation and billing interoperability and future market needs for MTM integration into electronic health records (EHRs). APhA recently adopted policy that specifically addresses technology barriers and encourages the use and development of standardized systems for the documentation and billing of MTM services. Day 1 of the conference featured six foundational presentations on health information technology (HIT) trends, perspectives on MTM from the profession and the Centers for Medicare & Medicaid Services, health care quality and medication-related outcome measures, integrating MTM workflow in EHRs, and the current state of MTM operalization in practice. After hearing presentations on day 1 and having the opportunity to pose questions to each speaker, conference participants were divided into three breakout groups on day 2. Each group met three times for 60 minutes each and discussed five questions from the perspective of a patient, provider, or payer. Three facilitators met with each of the groups and led discussion from one perspective (i.e., patient, provider, payer). Participants then reconvened as a complete group to participate in a discussion on next steps. HIT is expected to assist in delivering safe, effective, efficient, coordinated care as health professionals strive to improve the quality of care and outcomes for individual patients. The pharmacy profession is actively contributing to quality patient care through MTM services focused on identifying and preventing medication-related problems, improving medication use, and optimizing individual therapeutic outcomes. As MTM programs continue to expand within the health care system, one important limiting factor is the lack of standardization for documentation and billing of MTM services. This lack of interoperability between technology systems, software, and system platforms is presenting as a barrier to MTM service delivery for patients. APhA convened this invitational conference to identify strategic directions to address MTM documentation and billing standardization and interoperability. Participants viewed the meeting as highly successful in bringing together a unique, wide-ranging set of stakeholders, including the government, regulators, standards organizations, other health professions, technology firms, professional organizations, and practitioners, to share perspectives. They strongly encouraged the Association to continue this unique stakeholder dialogue. Participants provided a number of next-step suggestions for APhA to consider because of the event. Participants noted the pharmacy profession's success in building information technology systems for product transactions with systematic, organized, methodical thinking and the need to apply this success to patient services. A unique opportunity exists for the profession to influence and lead the HIT community in creating a workable health technology solution for MTM services. Reaching consensus on minimum data sets for each functional area--clinical, billing, quality improvement--would be a very important short-term gain. Further, participants said it was imperative for pharmacists and the pharmacy community at large to become actively engaged in HIT standards development efforts.

Geologic mapping of Argyre Planitia

NASA Technical Reports Server (NTRS)

Gorsline, Donn S.; Parker, Timothy J.

1995-01-01

This report describes the results from the geologic mapping of the central and southern Argyre basin of Mars. At the Mars Geologic Mapper's Meeting in Flagstaff during July, 1993, Dave Scott (United States Geological Survey, Mars Geologic Mapping Steering Committee Chair) recommended that all four quadrangles be combined into a single 1:1,000,000 scale map for publication. It was agreed that this would be cost-effective and that the decrease in scale would not compromise the original science goals of the mapping. Tim Parker completed mapping on the 1:500,000 scale base maps, for which all the necessary materials had already been produced, and included the work as a chapter in his dissertation, which was completed in the fall of 1994. Geologic mapping of the two southernmost quadrangles (MTM -55036 and MTM -55043; MTM=Mars Transverse Mercator) was completed as planned during the first year of work. These maps and a detailed draft of the map text were given a preliminary review by Dave Scott during summer, 1993. Geologic mapping of the remaining two quadrangles (MTM -50036 and MTM -50043) was completed by summer, 1994. Results were described at the Mars Geologic Mappers Meeting, held in Pocatello, Idaho, during July, 1994. Funds for the third and final year of the project have been transferred to the Jet Propulsion Laboratory, where Tim Parker will revise and finalize all maps and map text for publication by the United States Geological Survey at the 1:1,000,000 map scale.

Navigating complex patients using an innovative tool: the MTM Spider Web.

PubMed

Morello, Candis M; Hirsch, Jan D; Lee, Kelly C

2013-01-01

To introduce a teaching tool that can be used to assess the complexity of medication therapy management (MTM) patients, prioritize appropriate interventions, and design patient-centered care plans for each encounter. MTM patients are complex as a result of multiple comorbidities, medications, and socioeconomic and behavioral issues. Pharmacists who provide MTM services are required to synthesize a plethora of information (medical and nonmedical), evaluate and prioritize the clinical problems, and design a comprehensive patient-centered care plan. The MTM Spider Web is a visual tool to facilitate this process. A description is provided regarding how to build the MTM Spider Web using case-based scenarios. This model can be used to teach pharmacists, health professional students, and patients. The MTM Spider Web is an innovative teaching tool that can be used to teach pharmacists and students how to assess complex patients and design a patient-centered care plan to deliver the most appropriate medication therapy.

75 FR 440 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease MTM 91625

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-05

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [LLMT922200-10-L13100000-FI0000-P;MTM 91625] Notice of Proposed Reinstatement of Terminated Oil and Gas Lease MTM 91625 AGENCY: Bureau of Land... for reinstatement of noncompetitive oil and gas lease MTM 91625, Musselshell County, Montana. The...

75 FR 76753 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease MTM 91627

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-09

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [LLMT922200-11-L13100000-FI0000-P;MTM 91627] Notice of Proposed Reinstatement of Terminated Oil and Gas Lease MTM 91627 AGENCY: Bureau of Land... for reinstatement of noncompetitive oil and gas lease MTM 91627, Musselshell County, Montana. The...

Evaluation of manometric temperature measurement, a process analytical technology tool for freeze-drying: part I, product temperature measurement.

PubMed

Tang, Xiaolin; Nail, Steven L; Pikal, Michael J

2006-02-10

This study examines the factors that may cause systematic errors in the manometric temperature measurement (MTM) procedure used to evaluate product temperature during primary drying. MTM was conducted during primary drying using different vial loads, and the MTM product temperatures were compared with temperatures directly measured by thermocouples. To clarify the impact of freeze-drying load on MTM product temperature, simulation of the MTM vapor pressure rise was performed, and the results were compared with the experimental results. The effect of product temperature heterogeneity in MTM product temperature determination was investigated by comparing the MTM product temperatures with directly measured thermocouple product temperatures in systems differing in temperature heterogeneity. Both the simulated and experimental results showed that at least 50 vials (5 mL) were needed to give sufficiently rapid pressure rise during the MTM data collection period (25 seconds) in the freeze dryer, to allow accurate determination of the product temperature. The product temperature is location dependent, with higher temperature for vials on the edge of the array and lower temperature for the vials in the center of the array. The product temperature heterogeneity is also dependent upon the freeze-drying conditions. In product temperature heterogeneous systems, MTM measures a temperature close to the coldest product temperature, even if only a small fraction of the samples have the coldest product temperature. The MTM method is valid even at very low product temperature (-45 degrees C).

Evaluation of manometric temperature measurement, a process analytical technology tool for freeze-drying: Part I, product temperature measurement.

PubMed

Tang, Xiaolin; Nail, Steven L; Pikal, Michael J

2006-03-01

This study examines the factors that may cause systematic errors in the manometric temperature measurement (MTM) procedure used to evaluate product temperature during primary drying. MTM was conducted during primary drying using different vial loads, and the MTM product temperatures were compared with temperatures directly measured by thermocouples. To clarify the impact of freeze-drying load on MTM product temperatures, simulation of the MTM vapor pressure rise was performed, and the results were compared with the experimental results. The effect of product temperature heterogeneity in MTM product temperature determination was investigated by comparing the MTM product temperatures with directly measured thermocouple product temperatures in systems differing in temperature heterogeneity. Both the simulated and experimental results showed that at least 50 vials (5 mL) were needed to give sufficiently rapid pressure rise during the MTM data collection period (25 seconds) in the freeze dryer, to allow accurate determination of the product temperature. The product temperature is location dependent, with higher temperature for vials on the edge of the array and lower temperature for the vials in the center of the array. The product temperature heterogeneity is also dependent upon the freeze-drying conditions. In product temperature heterogeneous systems, MTM measures a temperature close to the coldest product temperature, even, if only a small fraction of the samples have the coldest product temperature. The MTM method is valid even at very low product temperature (-45°C).

Trends in Medicare Part D Medication Therapy Management Eligibility Criteria

PubMed Central

Wang, Junling; Shih, Ya-Chen Tina; Qin, Yolanda; Young, Theo; Thomas, Zachary; Spivey, Christina A.; Solomon, David K.; Chisholm-Burns, Marie

2015-01-01

Background To increase the enrollment rate of medication therapy management (MTM) programs in Medicare Part D plans, the US Centers for Medicare & Medicaid Services (CMS) lowered the allowable eligibility thresholds based on the number of chronic diseases and Part D drugs for Medicare Part D plans for 2010 and after. However, an increase in MTM enrollment rates has not been realized. Objectives To describe trends in MTM eligibility thresholds used by Medicare Part D plans and to identify patterns that may hinder enrollment in MTM programs. Methods This study analyzed data extracted from the Medicare Part D MTM Programs Fact Sheets (2008–2014). The annual percentages of utilizing each threshold value of the number of chronic diseases and Part D drugs, as well as other aspects of MTM enrollment practices, were analyzed among Medicare MTM programs that were established by Medicare Part D plans. Results For 2010 and after, increased proportions of Medicare Part D plans set their eligibility thresholds at the maximum numbers allowable. For example, in 2008, 48.7% of Medicare Part D plans (N = 347:712) opened MTM enrollment to Medicare beneficiaries with only 2 chronic disease states (specific diseases varied between plans), whereas the other half restricted enrollment to patients with a minimum of 3 to 5 chronic disease states. After 2010, only approximately 20% of plans opened their MTM enrollment to patients with 2 chronic disease states, with the remaining 80% restricting enrollment to patients with 3 or more chronic diseases. Conclusion The policy change by CMS for 2010 and after is associated with increased proportions of plans setting their MTM eligibility thresholds at the maximum numbers allowable. Changes to the eligibility thresholds by Medicare Part D plans might have acted as a barrier for increased MTM enrollment. Thus, CMS may need to identify alternative strategies to increase MTM enrollment in Medicare plans. PMID:26380030

A natural history study of X-linked myotubular myopathy.

PubMed

Amburgey, Kimberly; Tsuchiya, Etsuko; de Chastonay, Sabine; Glueck, Michael; Alverez, Rachel; Nguyen, Cam-Tu; Rutkowski, Anne; Hornyak, Joseph; Beggs, Alan H; Dowling, James J

2017-09-26

To define the natural history of X-linked myotubular myopathy (MTM). We performed a cross-sectional study that included an online survey (n = 35) and a prospective, 1-year longitudinal investigation using a phone survey (n = 33). We ascertained data from 50 male patients with MTM and performed longitudinal assessments on 33 affected individuals. Consistent with existing knowledge, we found that MTM is a disorder associated with extensive morbidities, including wheelchair (86.7% nonambulant) and ventilator (75% requiring >16 hours of support) dependence. However, unlike previous reports and despite the high burden of disease, mortality was lower than anticipated (approximate rate 10%/y). Seventy-six percent of patients with MTM enrolled (mean age 10 years 11 months) were alive at the end of the study. Nearly all deaths in the study were associated with respiratory failure. In addition, the disease course was more stable than expected, with few adverse events reported during the prospective survey. Few non-muscle-related morbidities were identified, although an unexpectedly high incidence of learning disability (43%) was noted. Conversely, MTM was associated with substantial burdens on patient and caregiver daily living, reflected by missed days of school and lost workdays. MTM is one of the most severe neuromuscular disorders, with affected individuals requiring extensive mechanical interventions for survival. However, among study participants, the disease course was more stable than predicted, with more individuals surviving infancy and early childhood. These data reflect the disease burden of MTM but offer hope in terms of future therapeutic intervention. Copyright © 2017 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology.

A natural history study of X-linked myotubular myopathy

PubMed Central

Amburgey, Kimberly; Tsuchiya, Etsuko; de Chastonay, Sabine; Glueck, Michael; Alverez, Rachel; Nguyen, Cam-Tu; Rutkowski, Anne; Hornyak, Joseph; Beggs, Alan H.

2017-01-01

Objective: To define the natural history of X-linked myotubular myopathy (MTM). Methods: We performed a cross-sectional study that included an online survey (n = 35) and a prospective, 1-year longitudinal investigation using a phone survey (n = 33). Results: We ascertained data from 50 male patients with MTM and performed longitudinal assessments on 33 affected individuals. Consistent with existing knowledge, we found that MTM is a disorder associated with extensive morbidities, including wheelchair (86.7% nonambulant) and ventilator (75% requiring >16 hours of support) dependence. However, unlike previous reports and despite the high burden of disease, mortality was lower than anticipated (approximate rate 10%/y). Seventy-six percent of patients with MTM enrolled (mean age 10 years 11 months) were alive at the end of the study. Nearly all deaths in the study were associated with respiratory failure. In addition, the disease course was more stable than expected, with few adverse events reported during the prospective survey. Few non–muscle-related morbidities were identified, although an unexpectedly high incidence of learning disability (43%) was noted. Conversely, MTM was associated with substantial burdens on patient and caregiver daily living, reflected by missed days of school and lost workdays. Conclusions: MTM is one of the most severe neuromuscular disorders, with affected individuals requiring extensive mechanical interventions for survival. However, among study participants, the disease course was more stable than predicted, with more individuals surviving infancy and early childhood. These data reflect the disease burden of MTM but offer hope in terms of future therapeutic intervention. PMID:28842446

76 FR 10389 - Notice of Proposed Reinstatement of Terminated Oil and Gas lease MTM 96122

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-24

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [LLMT922200-11-L13100000-FI0000-P;MTM 96122] Notice of Proposed Reinstatement of Terminated Oil and Gas lease MTM 96122 AGENCY: Bureau of Land... filed a petition for reinstatement of competitive oil and gas lease MTM 96122, Richland County, Montana...

76 FR 54484 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease MTM 98742

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-01

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [LLMT922200-11-L13100000-FI0000-P;MTM 98742] Notice of Proposed Reinstatement of Terminated Oil and Gas Lease MTM 98742 AGENCY: Bureau of Land... petition for reinstatement of competitive oil and gas lease MTM 98742, Fergus County, Montana. The lessee...

75 FR 63855 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease MTM 98742, Montana

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-18

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [LLMT922200-10-L13100000-FI0000-P;MTM 98742] Notice of Proposed Reinstatement of Terminated Oil and Gas Lease MTM 98742, Montana AGENCY: Bureau of... lease MTM 98742, for land in Fergus County, Montana. The lessee paid the required rental accruing from...

75 FR 30059 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease MTM 98343

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-28

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [LLMT922200-10-L13100000-FI0000-P; MTM 98343] Notice of Proposed Reinstatement of Terminated Oil and Gas Lease MTM 98343 AGENCY: Bureau of Land... petition for reinstatement of competitive oil and gas lease MTM 98343, Fergus County, Montana. The lessee...

75 FR 43553 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease MTM 97827, Montana

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-26

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [LLMT922200-10-L13100000-FI0000-P;MTM 97827] Notice of Proposed Reinstatement of Terminated Oil and Gas Lease MTM 97827, Montana AGENCY: Bureau of... and gas lease MTM 97827, Carbon County, Montana. The lessee paid the required rental accruing from the...

Effects of the midnight temperature maximum observed in the thermosphere-ionosphere over the northeast of Brazil

NASA Astrophysics Data System (ADS)

Figueiredo, Cosme Alexandre O. B.; Buriti, Ricardo A.; Paulino, Igo; Meriwether, John W.; Makela, Jonathan J.; Batista, Inez S.; Barros, Diego; Medeiros, Amauri F.

2017-08-01

The midnight temperature maximum (MTM) has been observed in the lower thermosphere by two Fabry-Pérot interferometers (FPIs) at São João do Cariri (7.4° S, 36.5° W) and Cajazeiras (6.9° S, 38.6° W) during 2011, when the solar activity was moderate and the solar flux was between 90 and 155 SFU (1 SFU = 10-22 W m-2 Hz-1). The MTM is studied in detail using measurements of neutral temperature, wind and airglow relative intensity of OI630.0 nm (referred to as OI6300), and ionospheric parameters, such as virtual height (h'F), the peak height of the F2 region (hmF2), and critical frequency of the F region (foF2), which were measured by a Digisonde instrument (DPS) at Eusébio (3.9° S, 38.4° W; geomagnetic coordinates 7.31° S, 32.40° E for 2011). The MTM peak was observed mostly along the year, except in May, June, and August. The amplitudes of the MTM varied from 64 ± 46 K in April up to 144 ± 48 K in October. The monthly temperature average showed a phase shift in the MTM peak around 0.25 h in September to 2.5 h in December before midnight. On the other hand, in February, March, and April the MTM peak occurred around midnight. International Reference Ionosphere 2012 (IRI-2012) model was compared to the neutral temperature observations and the IRI-2012 model failed in reproducing the MTM peaks. The zonal component of neutral wind flowed eastward the whole night; regardless of the month and the magnitude of the zonal wind, it was typically within the range of 50 to 150 m s-1 during the early evening. The meridional component of the neutral wind changed its direction over the months: from November to February, the meridional wind in the early evening flowed equatorward with a magnitude between 25 and 100 m s-1; in contrast, during the winter months, the meridional wind flowed to the pole within the range of 0 to -50 m s-1. Our results indicate that the reversal (changes in equator to poleward flow) or abatement of the meridional winds is an important factor in the MTM generation. From February to April and from September to December, the h'F and the hmF2 showed an increase around 18:00-20:00 LT within a range between 300 and 550 km and reached a minimal height of about 200-300 km close to midnight; then the layer rose again by about 40 km or, sometimes, remained at constant height. Furthermore, during the winter months, the h'F and hmF2 showed a different behavior; the signature of the pre-reversal enhancement did not appear as in other months and the heights did not exceed 260 and 350 km. Our observation indicated that the midnight collapse of the F region was a consequence of the MTM in the meridional wind that was reflected in the height of the F region. Lastly, the behavior of the OI6300 showed, from February to April and from September to December, an increase in intensity around midnight or 1 h before, which was associated with the MTM, whereas, from May to August, the relative intensity was more intense in the early evening and decayed during the night.

Evaluation of manometric temperature measurement, a process analytical technology tool for freeze-drying: part II measurement of dry-layer resistance.

PubMed

Tang, Xiaolin Charlie; Nail, Steven L; Pikal, Michael J

2006-01-01

The purpose of this work was to study the factors that may cause systematic errors in the manometric temperature measurement (MTM) procedure used to determine product dry-layer resistance to vapor flow. Product temperature and dry-layer resistance were obtained using MTM software installed on a laboratory freeze-dryer. The MTM resistance values were compared with the resistance values obtained using the "vial method." The product dry-layer resistances obtained by MTM, assuming fixed temperature difference (DeltaT; 2 degrees C), were lower than the actual values, especially when the product temperatures and sublimation rates were low, but with DeltaT determined from the pressure rise data, more accurate results were obtained. MTM resistance values were generally lower than the values obtained with the vial method, particularly whenever freeze-drying was conducted under conditions that produced large variations in product temperature (ie, low shelf temperature, low chamber pressure, and without thermal shields). In an experiment designed to magnify temperature heterogeneity, MTM resistance values were much lower than the simple average of the product resistances. However, in experiments where product temperatures were homogenous, good agreement between MTM and "vial-method" resistances was obtained. The reason for the low MTM resistance problem is the fast vapor pressure rise from a few "warm" edge vials or vials with low resistance. With proper use of thermal shields, and the evaluation of DeltaT from the data, MTM resistance data are accurate. Thus, the MTM method for determining dry-layer resistance is a useful tool for freeze-drying process analytical technology.

EFFECTS OF MOUNTAINTOP MINING/VALLEY FILL (MTM/VF) ON FUNCTIONAL INDICATORS IN APPALACHIAN HEADWATER STREAMS

EPA Science Inventory

The objectives of this poster were 1)to evaluate the impact of MTM/VF on the functional attributes SOD, soil/sediment respiration rate, soil/sediment DEA and dissolved trace gas concentrations across gradients of mining disturbance and hydrolgy and 2)compare these functional attr...

The BepiColombo Spacecraft: The Mercury Transfer Module Structure Qualification Test Campaign Description

NASA Astrophysics Data System (ADS)

Martin Zurdo, M. J.

2012-07-01

The BepiColombo is a space mission to Mercury (ESA in cooperation with Japan Aerospace Exploration Agency). The spacecraft consist of three different structures: two orbiters responsible for the scientific mission (MPO and MMO) and one service module, Mercury Transfer Module (MTM), which provides propulsion and services during the journey to Mercury. Taking into account only the MTM structure, the companies involved are ASTRIUM GERMANY acting as the prime contractor and ASTRIUM UK acting as the co- prime contractor company. EADS CASA Espacio (ECE) in Spain is the company responsible for the final design, manufacturing and qualification of the MTM structure. The test campaign specimen is the MTM core structure, which corresponds to the central cone with the structure floors, shear panels and tank support structure. This test campaign qualifies the primary load path and its primary interfaces; the rest of the MTM structure is qualified by system level vibration test. In order to qualify the MTM structure, three different kinds of qualification tests have been performed: stiffness test, global strength test and local tests in different specific areas. The most relevant test during the campaign is the global strength test case, in which several external loads are introduced (different interfaces) simulating the load introduction for a selected critical flight case. There are two important items in the qualification test campaign: 1. The instrumentation of the structure, with two main functions: to control the specimen under test loads, and to demonstrate the qualification of the structure. 2. The set-up structure, designed by ECE to allow the correct load introduction on each testing case during the whole test campaign. This paper describes the MTM structure test campaign from the definition of the loads applied in each test to the qualification of the complete structure.

Community pharmacy-based medication therapy management services: financial impact for patients.

PubMed

Dodson, Sarah E; Ruisinger, Janelle F; Howard, Patricia A; Hare, Sarah E; Barnes, Brian J

2012-07-01

To determine the direct financial impact for patients resulting from Medication Therapy Management (MTM) interventions made by community pharmacists. Secondary objectives include evaluating the patient and physician acceptance rates of the community pharmacists' recommended MTM interventions. This was a retrospective observational study conducted at 20 Price Chopper and Hen House grocery store chain pharmacies in the Kansas City metro area from January 1, 2010 to December 31, 2010. Study patients were Medicare Part D beneficiaries eligible for MTM services. The primary outcome was the change in patient out-of-pocket prescription medication expense as a result of MTM services. Of 128 patients included in this study, 68% experienced no out-of-pocket financial impact on their medication expenses as a result of MTM services. A total of 27% of the patients realized a cost-savings (USD440.50 per year, (SD=289.69)) while another 5% of patients saw a cost increase in out-of-pocket expense (USD255.66 per year, (SD=324.48)). The net financial impact for all 128 patients who participated in MTM services was an average savings of USD102.83 per patient per year (SD=269.18, p<0.0001). Pharmacists attempted a total of 732 recommendations; 391 (53%) were accepted by both the patient and their prescriber. A total of 341 (47%) recommendations were not accepted because of patient refusal (290, 85%) or prescriber refusal (51, 15%). Patient participation in MTM services reduces patient out-of-pocket medication expense. However, this savings is driven by only 32% of subjects who are experiencing a financial impact on out-of-pocket medication expense. Additionally, the majority of the pharmacists' recommended interventions (53%) were accepted by patients and prescribers.

Optimization of PET-MR Registrations for Nonhuman Primates Using Mutual Information Measures: A Multi-Transform Method (MTM)

PubMed Central

Sandiego, Christine M.; Weinzimmer, David; Carson, Richard E.

2012-01-01

An important step in PET brain kinetic analysis is the registration of functional data to an anatomical MR image. Typically, PET-MR registrations in nonhuman primate neuroreceptor studies used PET images acquired early post-injection, (e.g., 0–10 min) to closely resemble the subject’s MR image. However, a substantial fraction of these registrations (~25%) fail due to the differences in kinetics and distribution for various radiotracer studies and conditions (e.g., blocking studies). The Multi-Transform Method (MTM) was developed to improve the success of registrations between PET and MR images. Two algorithms were evaluated, MTM-I and MTM-II. The approach involves creating multiple transformations by registering PET images of different time intervals, from a dynamic study, to a single reference (i.e., MR image) (MTM-I) or to multiple reference images (i.e., MR and PET images pre-registered to the MR) (MTM-II). Normalized mutual information was used to compute similarity between the transformed PET images and the reference image(s) to choose the optimal transformation. This final transformation is used to map the dynamic dataset into the animal’s anatomical MR space, required for kinetic analysis. The chosen transformed from MTM-I and MTM-II were evaluated using visual rating scores to assess the quality of spatial alignment between the resliced PET and reference. One hundred twenty PET datasets involving eleven different tracers from 3 different scanners were used to evaluate the MTM algorithms. Studies were performed with baboons and rhesus monkeys on the HR+, HRRT, and Focus-220. Successful transformations increased from 77.5%, 85.8%, to 96.7% using the 0–10 min method, MTM-I, and MTM-II, respectively, based on visual rating scores. The Multi-Transform Methods proved to be a robust technique for PET-MR registrations for a wide range of PET studies. PMID:22926293

Potential cost savings of medication therapy management in safety-net clinics.

PubMed

Truong, Hoai-An; Groves, C Nicole; Congdon, Heather B; Dang, Diem-Thanh Tanya; Botchway, Rosemary; Thomas, Jennifer

2015-01-01

To evaluate potential cost savings based on estimated cost avoidance from medication therapy management (MTM) services delivered in safety-net clinics over 4 years. High-risk patients taking multiple medications and with chronic conditions were referred for MTM services in primary care safety-net clinics in Maryland from October 1, 2009, to September 30, 2013. Medication-related problems (MRPs) were identified and pharmacists' costs determined to evaluate the estimated cost savings and return on investment (ROI). A range of potential economic outcomes for each MRP identified was assigned to a cost avoidance for outpatient visit, urgent care visit, emergency department visit, and/or hospitalization. Over 4 years, 246 patients received MTM, nearly 2,100 medications were reviewed, and 814 MRPs were identified. The most common MRPs identified were subtherapeutic doses, nonadherence, and untreated indications, with respective prevalences of 38%, 19%, and 16%. The corresponding costs of medical services were estimated at $115,220-$614,570 for all MRPs identified, yielding a mean of $141.55-$755.00 per identified MRP. Pharmacists' expenses for encounters were calculated at a total expenditure of $57,307.50 for 16,965 minutes. ROI based on the time spent during billable face-to-face encounters ranged from 1:5 to 1:25. Pharmacist-provided MTM in safety-net clinics yielded potential economic benefits to the organization. The Primary Care Coalition of Montgomery County plans to expand MTM services to additional clinics to improve patient care and increase cost savings through preventable medical services.

School of pharmacy-based medication therapy management program: development and initial experience.

PubMed

Lam, Annie; Odegard, Peggy Soule; Gardner, Jacqueline

2012-01-01

To describe a school of pharmacy-community pharmacy collaborative model for medication therapy management (MTM) service and training. University of Washington (UW) School of Pharmacy (Seattle), from July to December 2008. MTM services and training. A campus-based MTM pharmacy was established for teaching, practice, and collaboration with community pharmacies to provide comprehensive medication reviews (CMRs) and MTM training. Number of collaborating pharmacies, number of patients contacted, number of CMRs conducted, and estimated cost avoidance (ECA). UW Pharmacy Cares was licensed as a Class A pharmacy (nondispensing) and signed "business associate" agreements with six community pharmacies. During July to December 2008, 10 faculty pharmacists completed training and 5 provided CMR services to 17 patients (5 telephonic and 12 face-to-face interviews). A total of 67 claims (17 CMRs and 50 CMR-generated claims) were submitted for reimbursement of $1,642 ($96.58/CMR case). Total ECA was $54,250, averaging $3,191.19 per patient. Seven student pharmacists gained CMR interview training. Interest in collaboration by community pharmacies was lower than expected; however, the campus-community practice model addressed unmet patient care needs, reduced outstanding MTM CMR case loads, increased ECA, and facilitated faculty development and training of student pharmacists.

Freeze-drying process design by manometric temperature measurement: design of a smart freeze-dryer.

PubMed

Tang, Xiaolin Charlie; Nail, Steven L; Pikal, Michael J

2005-04-01

To develop a procedure based on manometric temperature measurement (MTM) and an expert system for good practices in freeze drying that will allow development of an optimized freeze-drying process during a single laboratory freeze-drying experiment. Freeze drying was performed with a FTS Dura-Stop/Dura-Top freeze dryer with the manometric temperature measurement software installed. Five percent solutions of glycine, sucrose, or mannitol with 2 ml to 4 ml fill in 5 ml vials were used, with all vials loaded on one shelf. Details of freezing, optimization of chamber pressure, target product temperature, and some aspects of secondary drying are determined by the expert system algorithms. MTM measurements were used to select the optimum shelf temperature, to determine drying end points, and to evaluate residual moisture content in real-time. MTM measurements were made at 1 hour or half-hour intervals during primary drying and secondary drying, with a data collection frequency of 4 points per second. The improved MTM equations were fit to pressure-time data generated by the MTM procedure using Microcal Origin software to obtain product temperature and dry layer resistance. Using heat and mass transfer theory, the MTM results were used to evaluate mass and heat transfer rates and to estimate the shelf temperature required to maintain the target product temperature. MTM product dry layer resistance is accurate until about two-thirds of total primary drying time is over, and the MTM product temperature is normally accurate almost to the end of primary drying provided that effective thermal shielding is used in the freeze-drying process. The primary drying times can be accurately estimated from mass transfer rates calculated very early in the run, and we find the target product temperature can be achieved and maintained with only a few adjustments of shelf temperature. The freeze-dryer overload conditions can be estimated by calculation of heat/mass flow at the target product temperature. It was found that the MTM results serve as an excellent indicator of the end point of primary drying. Further, we find that the rate of water desorption during secondary drying may be accurately measured by a variation of the basic MTM procedure. Thus, both the end point of secondary drying and real-time residual moisture may be obtained during secondary drying. Manometric temperature measurement and the expert system for good practices in freeze drying does allow development of an optimized freeze-drying process during a single laboratory freeze-drying experiment.

Effects of Rosemary Oil (Rosmarinus officinalis) On The Shelf-Life of Minced Rainbow Trout (Oncorhynchus mykiss) during Refrigerated Storage

PubMed Central

Peiretti, Pier Giorgio; Gai, Francesco; Ortoffi, Marco; Aigotti, Riccardo; Medana, Claudio

2012-01-01

The effects of three concentrations (0.2%, 1% and 3%) of rosemary oil (RO) on the freshness indicators, oxidative stability, fatty acid and biogenic amine (BA) contents of minced rainbow trout muscle (MTM) were investigated after different periods of storage (three and nine days) at 4 ± 1 °C. Moreover, the terpene and sesquiterpene contents in the treated MTM were also measured. RO treatment improves the pH, oxidative stability of the lipids and the FA profile, which resulted in a significant extension of MTM shelf-life. Storage time influenced all freshness indicators, with the exception of yellowness and chroma. Treatment with RO had a positive effect, leading to low BA content, especially putrescine, cadaverine, tyramine and histamine. Differences in BA were also found to be due to storage time, with the exception of spermidine, which was not influenced by time. Moreover, the presence of the terpenoid fraction of RO in MTM improved the quality of this ready-to-cook fish food. PMID:28239089

Ultra-small single-negative electric metamaterials for electromagnetic coupling reduction of microstrip antenna array.

PubMed

Xu, He-Xiu; Wang, Guang-Ming; Qi, Mei-Qing; Zeng, Hui-Yong

2012-09-24

We report initially the design, fabrication and measurement of using waveguided electric metamaterials (MTM) in the design of closely-spaced microtrip antenna arrays with mutual coupling reduction. The complementary spiral ring resonators (CSRs) which exhibit single negative resonant permittivity around 3.5GHz are used as the basic electric MTM element. For verification, two CSRs with two and three concentric rings are considered, respectively. By properly arranging these well engineered waveguided MTMs between two H-plane coupled patch antennas, both numerical and measured results indicate that more than 8.4 dB mutual coupling reduction is obtained. The mechanism has been studied from a physical insight. The electric MTM element is electrically small, enabling the resultant antenna array to exhibit a small separation (λo/8 at the operating wavelength) and thus a high directivity. The proposed strategy opens an avenue to new types of antenna with super performances and can be generalized for other electric resonators.

Racial and Ethnic Disparities in Meeting MTM Eligibility Criteria Based on Star Ratings Compared with the Medicare Modernization Act.

PubMed

Spivey, Christina A; Wang, Junling; Qiao, Yanru; Shih, Ya-Chen Tina; Wan, Jim Y; Kuhle, Julie; Dagogo-Jack, Samuel; Cushman, William C; Chisholm-Burns, Marie

2018-02-01

Previous research found racial and ethnic disparities in meeting medication therapy management (MTM) eligibility criteria implemented by the Centers for Medicare & Medicaid Services (CMS) in accordance with the Medicare Modernization Act (MMA). To examine whether alternative MTM eligibility criteria based on the CMS Part D star ratings quality evaluation system can reduce racial and ethnic disparities. This study analyzed the Beneficiary Summary File and claims files for Medicare beneficiaries linked to the Area Health Resource File. Three million Medicare beneficiaries with continuous Parts A, B, and D enrollment in 2012-2013 were included. Proposed star ratings criteria included 9 existing medication safety and adherence measures developed mostly by the Pharmacy Quality Alliance. Logistic regression and the Blinder-Oaxaca approach were used to test disparities in meeting MMA and star ratings eligibility criteria across racial and ethnic groups. Multinomial logistic regression was used to examine whether there was a disparity reduction by comparing individuals who were MTM-eligible under MMA but not under star ratings criteria and those who were MTM-eligible under star ratings criteria but not under the MMA. Concerning MMA-based MTM criteria, main and sensitivity analyses were performed to represent the entire range of the MMA eligibility thresholds reported by plans in 2009, 2013, and proposed by CMS in 2015. Regarding star ratings criteria, meeting any 1 of the 9 measures was examined as the main analysis, and various measure combinations were examined as the sensitivity analyses. In the main analysis, adjusted odds ratios for non-Hispanic blacks (backs) and Hispanics to non-Hispanic whites (whites) were 1.394 (95% CI = 1.375-1.414) and 1.197 (95% CI = 1.176-1.218), respectively, under star ratings. Blacks were 39.4% and Hispanics were 19.7% more likely to be MTM-eligible than whites. Blacks and Hispanics were less likely to be MTM-eligible than whites in some sensitivity analyses. Disparities were not completely explained by differences in patient characteristics based on the Blinder-Oaxaca approach. The multinomial logistic regression of each main analysis found significant adjusted relative risk ratios (RRR) between whites and blacks for 2009 (RRR = 0.459, 95% CI = 0.438-0.481); 2013 (RRR = 0.449, 95% CI = 0.434-0.465); and 2015 (RRR = 0.436, 95% CI = 0.425-0.446) and between whites and Hispanics for 2009 (RRR = 0.559, 95% CI = 0.528-0.593); 2013 (RRR = 0.544, 95% CI = 0.521-0.569); and 2015 (RRR = 0.503, 95% CI = 0.488-0.518). These findings indicate a significant reduction in racial and ethnic disparities when using star ratings eligibility criteria; for example, black-white disparities in the likelihood of meeting MTM eligibility criteria were reduced by 55.1% based on star ratings compared with MMA in 2013. Similar patterns were found in most sensitivity and disease-specific analyses. This study found that minorities were more likely than whites to be MTM-eligible under the star ratings criteria. In addition, MTM eligibility criteria based on star ratings would reduce racial and ethnic disparities associated with MMA in the general Medicare population and those with specific chronic conditions. Research reported in this publication was supported by the National Institute on Aging of the National Institutes of Health under award number R01AG049696. The content of this study is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Cushman reports an Eli Lilly grant and uncompensated consulting for Takeda Pharmaceuticals outside this work. The other authors have no potential conflicts of interest to report. Study concept and design were contributed by Wang and Shih, along with Wan, Kuhle, Spivey, and Cushman. Wang, Qiao, and Wan took the lead in data collection, with assistance from the other authors. Data interpretation was performed by Wang, Kuhle, and Qiao, with assistance from the other authors. The manuscript was written by Spivey and Qiao, along with the other authors, and revised by Cushman, Dagogo-Jack, and Chisholm-Burns, along with the other authors.

Statistical Analyses of Raw Material Data for MTM45-1/CF7442A-36% RW: CMH Cure Cycle

NASA Technical Reports Server (NTRS)

Coroneos, Rula; Pai, Shantaram, S.; Murthy, Pappu

2013-01-01

This report describes statistical characterization of physical properties of the composite material system MTM45-1/CF7442A, which has been tested and is currently being considered for use on spacecraft structures. This composite system is made of 6K plain weave graphite fibers in a highly toughened resin system. This report summarizes the distribution types and statistical details of the tests and the conditions for the experimental data generated. These distributions will be used in multivariate regression analyses to help determine material and design allowables for similar material systems and to establish a procedure for other material systems. Additionally, these distributions will be used in future probabilistic analyses of spacecraft structures. The specific properties that are characterized are the ultimate strength, modulus, and Poisson??s ratio by using a commercially available statistical package. Results are displayed using graphical and semigraphical methods and are included in the accompanying appendixes.

New results on the mid-latitude midnight temperature maximum

NASA Astrophysics Data System (ADS)

Mesquita, Rafael L. A.; Meriwether, John W.; Makela, Jonathan J.; Fisher, Daniel J.; Harding, Brian J.; Sanders, Samuel C.; Tesema, Fasil; Ridley, Aaron J.

2018-04-01

Fabry-Perot interferometer (FPI) measurements of thermospheric temperatures and winds show the detection and successful determination of the latitudinal distribution of the midnight temperature maximum (MTM) in the continental mid-eastern United States. These results were obtained through the operation of the five FPI observatories in the North American Thermosphere Ionosphere Observing Network (NATION) located at the Pisgah Astronomic Research Institute (PAR) (35.2° N, 82.8° W), Virginia Tech (VTI) (37.2° N, 80.4° W), Eastern Kentucky University (EKU) (37.8° N, 84.3° W), Urbana-Champaign (UAO) (40.2° N, 88.2° W), and Ann Arbor (ANN) (42.3° N, 83.8° W). A new approach for analyzing the MTM phenomenon is developed, which features the combination of a method of harmonic thermal background removal followed by a 2-D inversion algorithm to generate sequential 2-D temperature residual maps at 30 min intervals. The simultaneous study of the temperature data from these FPI stations represents a novel analysis of the MTM and its large-scale latitudinal and longitudinal structure. The major finding in examining these maps is the frequent detection of a secondary MTM peak occurring during the early evening hours, nearly 4.5 h prior to the timing of the primary MTM peak that generally appears after midnight. The analysis of these observations shows a strong night-to-night variability for this double-peaked MTM structure. A statistical study of the behavior of the MTM events was carried out to determine the extent of this variability with regard to the seasonal and latitudinal dependence. The results show the presence of the MTM peak(s) in 106 out of the 472 determinable nights (when the MTM presence, or lack thereof, can be determined with certainty in the data set) selected for analysis (22 %) out of the total of 846 nights available. The MTM feature is seen to appear slightly more often during the summer (27 %), followed by fall (22 %), winter (20 %), and spring (18 %). Also seen is a northwestward propagation of the MTM signature with a latitude-dependent amplitude. This behavior suggests either a latitudinal dependence of thermosphere tidal dissipation or a night-to-night variation of the composition of the higher-order tidal modes that contribute to the production of the MTM peak at mid-latitudes. Also presented in this paper is the perturbation on the divergence of the wind fields, which is associated with the passage of each MTM peak analyzed with the 2-D interpolation.

Assessing Medicare beneficiaries' willingness-to-pay for medication therapy management services.

PubMed

Woelfel, Joseph A; Carr-Lopez, Sian M; Delos Santos, Melanie; Bui, Ann; Patel, Rajul A; Walberg, Mark P; Galal, Suzanne M

2014-02-01

To assess Medicare beneficiaries' willingness-to-pay (WTP) for medication therapy management (MTM) services and determine sociodemographic and clinical characteristics influencing this payment amount. A cross-sectional, descriptive study design was adopted to elicit Medicare beneficiaries' WTP for MTM. Nine outreach events in cities across Central/Northern California during Medicare's 2011 open-enrollment period. A total of 277 Medicare beneficiaries participated in the study. Comprehensive MTM was offered to each beneficiary. Pharmacy students conducted the MTM session under the supervision of licensed pharmacists. At the end of each MTM session, beneficiaries were asked to indicate their WTP for the service. Medication, self-reported chronic conditions, and beneficiary demographic data were collected and recorded via a survey during the session. The mean WTP for MTM was $33.15 for the 277 beneficiaries receiving the service and answering the WTP question. WTP by low-income subsidy recipients (mean ± standard deviation; $12.80 ± $24.10) was significantly lower than for nonsubsidy recipients ($41.13 ± $88.79). WTP was significantly (positively) correlated with number of medications regularly taken and annual out-of-pocket drug costs. The mean WTP for MTM was $33.15. WTP for MTM significantly varied by race, subsidy status, and number of prescription medications taken. WTP was significantly higher for nonsubsidy recipients than subsidy recipients, and significantly positively correlated with the number of medications regularly taken and the beneficiary rating of the delivered services.

Contingent valuation and pharmacists' acceptable levels of compensation for medication therapy management services.

PubMed

Wang, Junling; Hong, Song Hee

2015-01-01

Pharmacists' acceptable level of compensation for medication therapy management (MTM) services needs to be determined using various economic evaluation techniques. Using contingent valuation method, determine pharmacists' acceptable levels of compensation for MTM services. A mailing survey was used to elicit Tennessee (U.S.) pharmacists' acceptable levels of compensation for a 30-minute MTM session for a new patient with 2 medical conditions, 8 medications, and an annual drug cost of $2000. Three versions of a series of double-bounded, closed-ended, binary discrete choice questions were asked of pharmacists for their willingness to accept (WTA) for an original monetary value ($30, $60, or $90) and then follow-up higher or lower value depending on their responses to the original value. A Kaplan-Meier approach was taken to analyze pharmacists' WTA, and Cox's proportional hazards model was used to examine the effects of pharmacist characteristics on their WTA. Three hundred and forty-eight pharmacists responded to the survey. Pharmacists' WTA for the given MTM session had a mean of $63.31 and median of $60. The proportions of pharmacists willing to accept $30, $60, and $90 for the given MTM session were 30.61%, 85.19%, and 91.01%, respectively. Pharmacists' characteristics had statistically significant association with their WTA rates. Pharmacists' WTA for the given MTM session is higher than current Medicare MTM programs' compensation levels of $15-$50 and patients' willingness to pay of less than $40. Besides advocating for higher MTM compensation levels by third-party payers, pharmacists also may need to charge patients to reach sufficient compensation levels for MTM services. Copyright © 2015 Elsevier Inc. All rights reserved.

Contingent Valuation and Pharmacists' Acceptable Levels of Compensation for Medication Therapy Management Services

PubMed Central

Wang, Junling; Hong, Song Hee

2012-01-01

Background Pharmacists' acceptable level of compensation for medication therapy management (MTM) services needs to be determined using various economic evaluation techniques. Objectives Using contingent valuation method, determine pharmacists' acceptable levels of compensation for MTM services. Methods A mailing survey was used to elicit Tennessee (US) pharmacists' acceptable levels of compensation for a 30-minute MTM session for a new patient with 2 medical conditions, 8 medications, and an annual drug cost of $2,000. Three versions of a series of double-bounded, closed-ended, binary discrete choice questions were asked of pharmacists for their willingness-to-accept (WTA) for an original monetary value ($30, $60, or $90) and then follow-up higher or lower value depending on their responses to the original value. A Kaplan-Meier approach was taken to analyze pharmacists' WTA, and Cox's proportional hazards model was used to examine the effects of pharmacist characteristics on their WTA. Results Three hundred and forty-eight pharmacists responded to the survey. Pharmacists' WTA for the given MTM session had a mean of $63.31 and median of $60. The proportions of pharmacists willing to accept $30, $60, and $90 for the given MTM session were 30.61%, 85.19%, and 91.01%, respectively. Pharmacists' characteristics had statistically significant association with their WTA rates. Conclusions Pharmacists' WTA for the given MTM session is higher than current Medicare MTM programs' compensation levels of $15 to $50 and patients' willingness-to-pay of less than $40. Besides advocating for higher MTM compensation levels by third-party payers, pharmacists also may need to charge patients to reach sufficient compensation levels for MTM services. PMID:22436583

Native and microwave-modified Terminalia mantaly gums as sustained-release and bioadhesive excipients in naproxen matrix tablet formulations.

PubMed

Odeniyi, Michael Ayodele; Oyedokun, Babatunde Mukhtar; Bamiro, Oluyemisi Adebowale

2017-01-01

Hydrophilic polymers provide a means of sustaining drug delivery. Native gums may be limited in function, but modification may improve their activity. The aim of the study was to evaluate native and modified forms of Terminalia mantaly gum for their sustained-release and bioadhesive properties. The native gum (NTM) was modified by microwave irradiation for 20 seconds (MTM20) and 60 seconds (MTM60) and characterized using microscopy, Fourier transform infrared spectroscopy (FTIR) and packing properties. The effects of the thermally induced molecular reorientation were determined. Tablet formulations of naproxen were produced by direct compression. The mechanical, bioadhesive and release properties of the formulations were determined. Irradiation of NTM improved the gum's flow properties, resulting in Carr's Index and Hausner's ratios lower than 16% and 1.25, respectively. Swelling studies showed that MTM20 and MTM60 had lower water absorption capacity and swelling index values, while packing properties improved upon irradiation, as depicted by lower tapped density values. FTIR spectra of samples showed that the irradiated gums were distinct from the native gums and did not interact with naproxen sodium. The gum's mechanical properties improved with MTM20 and MTM60 and sustained-release action of up 12 h was obtained. Inclusion of hydroxypropyl methylcellulose (HPMC) in the tablet formulations proved critical for bioadhesion. Microwave irradiation of native Terminalia mantaly gum improved the flow, mechanical and sustained-release properties of Naproxen tablets, and the addition of HPMC increased bioadhesion properties. The tablet properties of the native gum were significantly improved after 20 s of microwave irradiation.

Removal of carbamates and detoxification potential in a biomixture: Fungal bioaugmentation versus traditional use.

PubMed

Rodríguez-Rodríguez, Carlos E; Madrigal-León, Karina; Masís-Mora, Mario; Pérez-Villanueva, Marta; Chin-Pampillo, Juan Salvador

2017-01-01

The use of fungal bioaugmentation represents a promising way to improve the performance of biomixtures for the elimination of pesticides. The ligninolyitc fungus Trametes versicolor was employed for the removal of three carbamates (aldicarb, ALD; methomyl, MTM; and methiocarb, MTC) in defined liquid medium; in this matrix ALD and MTM showed similar half-lives (14d), nonetheless MTC exhibited a faster removal, with a half-life of 6.5d. Then the fungus was employed in the bioaugmentation of an optimized biomixture to remove the aforementioned carbamates plus carbofuran (CFN). Bioaugmented and non-bioaugmented systems removed over 99% ALD and MTM after 8d of treatment, nonetheless a slight initial delay in the removal was observed in the bioaugmented biomixtures (removal after 3d: ALD 87%/97%; MTM 86%/99%, in bioaugmented/non-bioaugmented systems). The elimination of the other carbamates was slower, but independent of the presence of the fungus: >98% for MTM after 35d and >99.5% for CFN after 22d. Though the bioaugmentation did not improve the removal capacity of the biomixture, it favored a lower production of transformation products at the first stages of the treatment, and in both cases, a marked decrease in the toxicity of the matrix was swiftly achieved along the process (from 435 to 448 TU to values <1TU in 16d). Copyright © 2016 Elsevier Inc. All rights reserved.

An introductory pharmacy practice experience based on a medication therapy management service model.

PubMed

Agness, Chanel F; Huynh, Donna; Brandt, Nicole

2011-06-10

To implement and evaluate an introductory pharmacy practice experience (IPPE) based on the medication therapy management (MTM) service model. Patient Care 2 is an IPPE that introduces third-year pharmacy students to the MTM service model. Students interacted with older adults to identify medication-related problems and develop recommendations using core MTM elements. Course outcome evaluations were based on number of documented medication-related problems, recommendations, and student reviews. Fifty-seven older adults participated in the course. Students identified 52 medication-related problems and 66 medical problems, and documented 233 recommendations relating to health maintenance and wellness, pharmacotherapy, referrals, and education. Students reported having adequate experience performing core MTM elements. Patient Care 2 may serve as an experiential learning model for pharmacy schools to teach the core elements of MTM and provide patient care services to the community.

Effect of Eruption Status of the Mandibular Third Molar on Distal Caries in the Adjacent Second Molar.

PubMed

Kang, Feiwu; Huang, Cheng; Sah, Manoj Kumar; Jiang, Beizhan

2016-04-01

To analyze the effect of the eruption status of the mandibular third molar (MTM) on distal caries in the mandibular second molar (MSM) by cone-beam computed tomography (CBCT). Five hundred CBCT images of MTMs from 469 patients were evaluated. Presence of distal caries in MSMs, impaction depths and angulations of MTMs, cementoenamel junction (CEJ) distances between distal MSMs and mesial MTMs, presence of pericoronitis in MTMs, and patient characteristics (age and gender) were assessed. Data were analyzed by χ(2) test, univariate and multivariate logistic regression analyses, and Spearman correlation analysis. Descriptive and bivariate statistics were computed and the P value was set at .05. The overall prevalence of distal caries in the MSM was 52.0%. According to the classification of Pell and Gregory, position A was the impaction depth at which most distal caries in MSMs were present (P = .036). For angulation of the MTM, when mesial angulations were 43° to 73°, MSMs developed more distal caries (P < .0001). For the CEJ distance between the distal MSM and the mesial MTM, when distances ranged from 6 to 15 mm, distal caries in MSMs occurred more frequently (6 to 8 mm, P < .0001; 8 to 15 mm, P = .037). Furthermore, there was a linear correlation between angulation of the MTM and the CEJ distance between the distal MSM and the mesial MTM (P < .0001). Impaction depth and angulation of the MTM are associated with distal caries in the MSM. Angulation of the MTM is more stable and reliable than the CEJ distance between the distal MSM and the mesial MTM for the estimation of risk factors related to the MTM. Copyright © 2016 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Minutia Tensor Matrix: A New Strategy for Fingerprint Matching

PubMed Central

Fu, Xiang; Feng, Jufu

2015-01-01

Establishing correspondences between two minutia sets is a fundamental issue in fingerprint recognition. This paper proposes a new tensor matching strategy. First, the concept of minutia tensor matrix (simplified as MTM) is proposed. It describes the first-order features and second-order features of a matching pair. In the MTM, the diagonal elements indicate similarities of minutia pairs and non-diagonal elements indicate pairwise compatibilities between minutia pairs. Correct minutia pairs are likely to establish both large similarities and large compatibilities, so they form a dense sub-block. Minutia matching is then formulated as recovering the dense sub-block in the MTM. This is a new tensor matching strategy for fingerprint recognition. Second, as fingerprint images show both local rigidity and global nonlinearity, we design two different kinds of MTMs: local MTM and global MTM. Meanwhile, a two-level matching algorithm is proposed. For local matching level, the local MTM is constructed and a novel local similarity calculation strategy is proposed. It makes full use of local rigidity in fingerprints. For global matching level, the global MTM is constructed to calculate similarities of entire minutia sets. It makes full use of global compatibility in fingerprints. Proposed method has stronger description ability and better robustness to noise and nonlinearity. Experiments conducted on Fingerprint Verification Competition databases (FVC2002 and FVC2004) demonstrate the effectiveness and the efficiency. PMID:25822489

Mutation spectrum of the MTM1 gene in XLMTM patients: 10 years of experience in prenatal and postnatal diagnosis.

PubMed

Longo, G; Russo, S; Novelli, G; Sangiuolo, F; D'Apice, M R

2016-01-01

X-linked myotubular myopathy (XLMTM) is a congenital neuromuscular disorder defined by severe hypotonia, respiratory failure and histopathologic changes in muscle biopsy. The objective of this report is to inform about our experience of genetic analysis on a group of 25 unrelated XLMTM patients, clinically diagnosed by several Italian and European Medical Institutes from 2006 to 2015. The molecular strategy used for genotyping involved Sanger sequencing of coding and intron/exon regions and the Multiplex Ligation Probe Amplification method. A total of 13 different point variants (6 nonsense, 5 missense, 1 splicing and 1 small deletion) were found in 15 patients (60%). Three were new missense variants: c.185G>T p.(Arg62Ile), c.719T>A p.(Val240Glu), and c.1262G>T p.(Arg421Leu). No large duplications/deletions have been identified. We performed carrier testing of at-risk female relatives. Only one mutation was de novo. Successively, we offered XLMTM prenatal testing for seven pregnancies in five unrelated families. In this context, the aim to propose an effective molecular diagnostic service is to confirm clinical XLMTM diagnosis, to monitor the cause-disease mutation segregation in the family and to offer genetic counseling to have correct information regarding offspring risks and the prenatal testing. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Review of survey articles regarding medication therapy management (MTM) services/programs in the United States.

PubMed

Oladapo, Abiola O; Rascati, Karen L

2012-08-01

To provide a summary of published survey articles regarding the provision of medication therapy management (MTM) services in the United States. A literature search was conducted to identify original articles on MTM-related surveys conducted in the United States, involving community and outpatient pharmacists, physicians, patients, or pharmacy students and published by the primary researchers who conducted the study. Search engines used included PubMed, Medline, and International Pharmaceutical Abstracts (IPA). If MTM was in the keyword list, mesh heading, title, or abstract, the article was reviewed. References from these articles were searched to determine whether other relevant articles were available. A total of 405 articles were initially reviewed; however, only 32 articles met the study requirements. Of the 32 articles, 17 surveyed community/outpatient pharmacists, 3 surveyed pharmacy students, 4 surveyed physicians, and 8 surveyed patients. The survey periods varied across the different studies, with the earliest survey conducted in 2004 and the most recent survey conducted in 2009. The surveys were conducted via the telephone, US mail, interoffice mail, e-mails, Internet/Web sites, hand-delivered questionnaires, and focus groups. Despite the identified barriers to the provision of MTM services, pharmacists reportedly found it professionally rewarding to provide these services. Pharmacists claimed to have adequate clinical knowledge, experience, and access to information required to provide MTM services. Pharmacy students were of the opinion that the provision of MTM services was important to the advancement of the pharmacy profession and in providing patients with a higher level of care. Physicians supported having pharmacists adjust patients’ drug therapy and educate patients on general drug information but not in selecting patients’ drug therapy. Finally, patients suggested that alternative ways need to be explored in describing and marketing MTM services for it to be appealing to them.

"How do I say that?": Using communication principles to enhance medication therapy management instruction.

PubMed

Denvir, Paul M; Cardone, Katie E; Parker, Wendy M; Cerulli, Jennifer

2018-02-01

Medication therapy management (MTM) is a comprehensive, patient-centered approach to improving medication use, reducing the risk of adverse events and improving medication adherence. Given the service delivery model and required outputs of MTM services, communication skills are of utmost importance. The objectives of this study were to identify and describe communication principles and instructional practices to enhance MTM training. Drawing on formative assessment data from interviews of both pharmacy educators and alumni, this article identifies and describes communication principles and instructional practices that pharmacy educators can use to enhance MTM training initiatives to develop student communication strategies. Analysis revealed five key communication challenges of MTM service delivery, two communication principles that pharmacy teachers and learners can use to address those challenges, and a range of specific strategies, derived from communication principles, that students can use when challenges emerge. Implications of the analysis for pharmacy educators and researchers are described. Proactive communication training provided during MTM advanced pharmacy practice experiences enabled students to apply the principles and instructional strategies to specific patient interactions during the advanced pharmacy practice experiences and in their post-graduation practice settings. Copyright © 2017 Elsevier Inc. All rights reserved.

Acute effects of single and multiple level thoracic manipulations on chronic mechanical neck pain: a randomized controlled trial

PubMed Central

Puntumetakul, Rungthip; Suvarnnato, Thavatchai; Werasirirat, Phurichaya; Uthaikhup, Sureeporn; Yamauchi, Junichiro; Boucaut, Rose

2015-01-01

Background Thoracic spine manipulation has become a popular alternative to local cervical manipulative therapy for mechanical neck pain. This study investigated the acute effects of single-level and multiple-level thoracic manipulations on chronic mechanical neck pain (CMNP). Methods Forty-eight patients with CMNP were randomly allocated to single-level thoracic manipulation (STM) at T6–T7 or multiple-level thoracic manipulation (MTM), or to a control group (prone lying). Cervical range of motion (CROM), visual analog scale (VAS), and the Thai version of the Neck Disability Index (NDI-TH) scores were measured at baseline, and at 24-hour and at 1-week follow-up. Results At 24-hour and 1-week follow-up, neck disability and pain levels were significantly (P<0.05) improved in the STM and MTM groups compared with the control group. CROM in flexion and left lateral flexion were increased significantly (P<0.05) in the STM group when compared with the control group at 1-week follow-up. The CROM in right rotation was increased significantly after MTM compared to the control group (P<0.05) at 24-hour follow-up. There were no statistically significant differences in neck disability, pain level at rest, and CROM between the STM and MTM groups. Conclusion These results suggest that both single-level and multiple-level thoracic manipulation improve neck disability, pain levels, and CROM at 24-hour and 1-week follow-up in patients with CMNP. PMID:25624764

Isotopic imprints of mountaintop mining contaminants.

PubMed

Vengosh, Avner; Lindberg, T Ty; Merola, Brittany R; Ruhl, Laura; Warner, Nathaniel R; White, Alissa; Dwyer, Gary S; Di Giulio, Richard T

2013-09-03

Mountaintop mining (MTM) is the primary procedure for surface coal exploration within the central Appalachian region of the eastern United States, and it is known to contaminate streams in local watersheds. In this study, we measured the chemical and isotopic compositions of water samples from MTM-impacted tributaries and streams in the Mud River watershed in West Virginia. We systematically document the isotopic compositions of three major constituents: sulfur isotopes in sulfate (δ(34)SSO4), carbon isotopes in dissolved inorganic carbon (δ(13)CDIC), and strontium isotopes ((87)Sr/(86)Sr). The data show that δ(34)SSO4, δ(13)CDIC, Sr/Ca, and (87)Sr/(86)Sr measured in saline- and selenium-rich MTM impacted tributaries are distinguishable from those of the surface water upstream of mining impacts. These tracers can therefore be used to delineate and quantify the impact of MTM in watersheds. High Sr/Ca and low (87)Sr/(86)Sr characterize tributaries that originated from active MTM areas, while tributaries from reclaimed MTM areas had low Sr/Ca and high (87)Sr/(86)Sr. Leaching experiments of rocks from the watershed show that pyrite oxidation and carbonate dissolution control the solute chemistry with distinct (87)Sr/(86)Sr ratios characterizing different rock sources. We propose that MTM operations that access the deeper Kanawha Formation generate residual mined rocks in valley fills from which effluents with distinctive (87)Sr/(86)Sr and Sr/Ca imprints affect the quality of the Appalachian watersheds.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bosserman, Mary A.; Downey, Theresa; Noinaj, Nicholas

Baeyer–Villiger monooxygenases (BVMOs) have been shown to play key roles for the biosynthesis of important natural products. MtmOIV, a homodimeric FAD- and NADPH-dependent BVMO, catalyzes the key frame-modifying steps of the mithramycin biosynthetic pathway, including an oxidative C–C bond cleavage, by converting its natural substrate premithramycin B into mithramycin DK, the immediate precursor of mithramycin. The drastically improved protein structure of MtmOIV along with the high-resolution structure of MtmOIV in complex with its natural substrate premithramycin B are reported here, revealing previously undetected key residues that are important for substrate recognition and catalysis. Kinetic analyses of selected mutants allowed usmore » to probe the substrate binding pocket of MtmOIV and also to discover the putative NADPH binding site. This is the first substrate-bound structure of MtmOIV providing new insights into substrate recognition and catalysis, which paves the way for the future design of a tailored enzyme for the chemo-enzymatic preparation of novel mithramycin analogues.« less

Pilot study: incorporation of pharmacogenetic testing in medication therapy management services.

PubMed

Haga, Susanne B; Allen LaPointe, Nancy M; Moaddeb, Jivan; Mills, Rachel; Patel, Mahesh; Kraus, William E

2014-11-01

Aim: To describe the rationale and design of a pilot study evaluating the integration of pharmacogenetic (PGx) testing into pharmacist-delivered medication therapy management (MTM). Study rationale: Clinical delivery approaches of PGx testing involving pharmacists may overcome barriers of limited physician knowledge about and experience with testing. Study design: We will assess the addition of PGx testing to MTM services for cardiology patients taking three or more medications including simvastatin or clopidogrel. We will measure the impact of MTM plus PGx testing on drug/dose adjustment and clinical outcomes. Factors associated with delivery, such as time to prepare and conduct MTM and consult with physicians will be recorded. Additionally, patient interest and satisfaction will be measured. Anticipated results: We anticipate that PGx testing can be practically integrated into standard a MTM service, providing a viable delivery model for testing. Conclusion: Given the lack of evidence of an effective PGx delivery models, this study will provide preliminary evidence regarding a pharmacist-delivered approach.

76 FR 18778 - Notice of Proposed Reinstatement of Terminated Oil and Gas Leases MTM 89460, MTM 89461, MTM 89467...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-05

... that affect these lands. The lessee agrees to new lease terms for rentals and royalties of $10 per acre and 16\\2/3\\ percent. The lessee paid the $500 administration fee for the reinstatement of each lease... leases; The increased rental of $10 per acre; The increased royalty of 16\\2/3\\ percent; and The $163 cost...

Medication therapy management: its relationship to patient counseling, disease management, and pharmaceutical care.

PubMed

McGivney, Melissa Somma; Meyer, Susan M; Duncan-Hewitt, Wendy; Hall, Deanne L; Goode, Jean-Venable R; Smith, Randall B

2007-01-01

To delineate the relationship, including similarities and differences, between medication therapy management (MTM) and contemporary pharmacist-provided services, including patient counseling, disease management, and pharmaceutical care, to facilitate the continued evolution of commonly used language and a standard of practice across geographic areas and practice environments. Incorporation of MTM services into the array of Medicare-funded services affords an opportunity for pharmacists to develop direct patient care services in the community. Defining the role of MTM within the scope of pharmacist-provided patient care activities, including patient counseling, disease management, and all currently provided pharmacy services is essential to the delineation of a viable and sustainable practice model for pharmacists. The definitions of each of these services are offered, as well as comparisons and contrasts of the individual services. In addition to Medicare-eligible patients, MTM services are appropriate for anyone with medication-related needs. MTM is offered as an all-encompassing model that incorporates the philosophy of pharmaceutical care, techniques of patient counseling, and disease management in an environment that facilitates the direct collaboration of patients, pharmacists, and other health professionals. Defining the role of MTM within the current patient care models, including patient counseling, disease management, and all who provide pharmacy services, is essential in delineating a viable and sustainable practice model for pharmacists.

Movement-to-music computer technology: a developmental play experience for children with severe physical disabilities.

PubMed

Tam, Cynthia; Schwellnus, Heidi; Eaton, Ceilidh; Hamdani, Yani; Lamont, Andrea; Chau, Tom

2007-01-01

Children with severe physical disabilities often lack the physical skills to explore their environment independently, and to play with toys or musical instruments. The movement-to-music (MTM) system is an affordable computer system that allows children with limited movements to play and create music. The present study explored parents' experiences of using the MTM system with their children. A qualitative methodology employing in-depth interview techniques was used with six mothers and their children. The themes extracted from the data were organized under two main concepts of the International Classification of Functioning, Disability, and Health (ICF) (WHO, 2001) framework. The results showed that the MTM expanded horizons for the child along the ICF health dimensions and the MTM had a positive impact on ICF environmental determinants of health. The small sample size should be noted as a limitation of this study. Further research should be carried out with a larger sample of children with restricted mobility to obtain a better understanding of the impact of MTM technology on children's psychosocial development.

Towards a deterministic KPZ equation with fractional diffusion: the stationary problem

NASA Astrophysics Data System (ADS)

Abdellaoui, Boumediene; Peral, Ireneo

2018-04-01

In this work, we investigate by analysis the possibility of a solution to the fractional quasilinear problem: where is a bounded regular domain ( is sufficient), , 1  <  q and f is a measurable non-negative function with suitable hypotheses. The analysis is done separately in three cases: subcritical, 1  <  q  <  2s critical, q  =  2s and supercritical, q  >  2s. The authors were partially supported by Ministerio de Economia y Competitividad under grants MTM2013-40846-P and MTM2016-80474-P (Spain).

A Multiscale Material Testing System for In Situ Optical and Electron Microscopes and Its Application

PubMed Central

Ye, Xuan; Cui, Zhiguo; Fang, Huajun; Li, Xide

2017-01-01

We report a novel material testing system (MTS) that uses hierarchical designs for in-situ mechanical characterization of multiscale materials. This MTS is adaptable for use in optical microscopes (OMs) and scanning electron microscopes (SEMs). The system consists of a microscale material testing module (m-MTM) and a nanoscale material testing module (n-MTM). The MTS can measure mechanical properties of materials with characteristic lengths ranging from millimeters to tens of nanometers, while load capacity can vary from several hundred micronewtons to several nanonewtons. The m-MTM is integrated using piezoelectric motors and piezoelectric stacks/tubes to form coarse and fine testing modules, with specimen length from millimeters to several micrometers, and displacement distances of 12 mm with 0.2 µm resolution for coarse level and 8 µm with 1 nm resolution for fine level. The n-MTM is fabricated using microelectromechanical system technology to form active and passive components and realizes material testing for specimen lengths ranging from several hundred micrometers to tens of nanometers. The system’s capabilities are demonstrated by in-situ OM and SEM testing of the system’s performance and mechanical properties measurements of carbon fibers and metallic microwires. In-situ multiscale deformation tests of Bacillus subtilis filaments are also presented. PMID:28777341

Use of manometric temperature measurement (MTM) and SMART freeze dryer technology for development of an optimized freeze-drying cycle.

PubMed

Gieseler, Henning; Kramer, Tony; Pikal, Michael J

2007-12-01

This report provides, for the first time, a summary of experiments using SMART Freeze Dryer technology during a 9 month testing period. A minimum ice sublimation area of about 300 cm(2) for the laboratory freeze dryer, with a chamber volume 107.5 L, was found consistent with data obtained during previous experiments with a smaller freeze dryer (52 L). Good reproducibility was found for cycle design with different type of excipients, formulations, and vials used. SMART primary drying end point estimates were accurate in the majority of the experiments, but showed an over prediction of primary cycle time when the product did not fully achieve steady state conditions before the first MTM measurement was performed. Product resistance data for 5% sucrose mixtures at varying fill depths were very reproducible. Product temperature determined by SMART was typically in good agreement with thermocouple data through about 50% of primary drying time, with significant deviations occurring near the end of primary drying, as expected, but showing a bias much earlier in primary drying for high solid content formulations (16.6% Pfizer product) and polyvinylpyrrolidone (40 kDa) likely due to water "re-adsorption" by the amorphous product during the MTM test. (c) 2007 Wiley-Liss, Inc.

Minnesota Department of Human Services audit of medication therapy management programs.

PubMed

Smith, Stephanie; Cell, Penny; Anderson, Lowell; Larson, Tom

2013-01-01

To inform medication therapy management (MTM) providers of findings of the Minnesota Department of Human Services review of claims submitted to Minnesota Health Care Programs (MHCP) for patients receiving MTM services and to discuss the impact of the audit on widespread MTM services and future audits. A retrospective review was completed on MTM claims submitted to MHCP from 2008 to 2010. The auditor verified that the Current Procedural Terminology codes billed matched the actual number of medications, conditions, and drug therapy problems assessed during an encounter. 190 claims were reviewed for 57 distinct pharmacies that billed for MTM services from 2008 to 2010, representing 4.5% of all claims submitted. The auditor reported that generally, the documentation within the electronic medical record had the least "up-coding" of all documentation systems. A total of 18 claims were coded at a higher level than appropriate, but only 10 notices were sent out to recover money because the others did not meet the minimum $50 threshold. The auditor expressed concerns that a number of claims billed at the highest complexity level were only 15 minutes long. Providers will need to be cautious of the conditions that they bill as complex and of how they define drug therapy problems. Everything for which is being billed must be clearly assessed or rationalized in the documentation note. The auditor expressed that overall, documentation was well done; however, many MTM providers are now asking how to internally prepare for future audits.

Comparison of a new transport medium with universal transport medium at a tropical field site.

PubMed

Schlaudecker, Elizabeth P; Heck, Joan P; MacIntyre, Elizabeth T; Martinez, Ruben; Dodd, Caitlin N; McNeal, Monica M; Staat, Mary A; Heck, Jeffery E; Steinhoff, Mark C

2014-10-01

Limited data are available in rural Honduran settings describing the etiology of respiratory infections, partially due to limited specimen transport. A new molecular transport media (MTM) preserves released nucleic acid at ambient temperature for later detection. Prospective surveillance was conducted in a Honduran clinic to identify 233 children less than 5 years of age presenting with respiratory symptoms. We obtained 2 nasopharyngeal samples and stored 1 in PrimeStore® MTM at room temperature and 1 in universal transport media (UTM) at -80 °C. The specimens were then transported to Cincinnati Children's Hospital and tested for 16 respiratory viruses using a multiplex PCR panel. The 2 specimen collection systems were similar for detecting the 4 most common viruses: influenza (Kappa = 0.7676, P < 0.0001), human metapneumovirus (Kappa = 0.8770, P < 0.0001), respiratory syncytial virus (Kappa = 0.6849, P < 0.0001), and parainfluenza (Kappa = 0.8796, P < 0.0001). These results suggest that clinical specimens transported via PrimeStore® MTM and UTM yield similar viral multiplex PCR results. Copyright © 2014 Elsevier Inc. All rights reserved.

Blood pressure kiosks for medication therapy management programs: business opportunity for pharmacists.

PubMed

Houle, Sherilyn K D; Chuck, Anderson W; Tsuyuki, Ross T

2012-01-01

To develop an economic model based on the use of pharmacy-based blood pressure kiosks for case finding of remunerable medication therapy management (MTM) opportunities. Descriptive, exploratory, nonexperimental study. Ontario, Canada, between January 2010 and September 2011. More than 7.5 million blood pressure kiosk readings were taken from 341 pharmacies. A model was developed to estimate revenues achievable by using blood pressure kiosks for 1 month to identify a cohort of patients with blood pressure of 130/80 mm Hg or more and caring for those patients during 1 year. Revenue generated from MTM programs. Pharmacies could generate an average of $12,270 (range $4,523-24,420) annually in revenue from billing for MTM services. Blood pressure kiosks can be used to identify patients with elevated blood pressure who may benefit from reimbursable pharmacist cognitive services. Revenue can be reinvested to purchase automated dispensing technology or offset pharmacy technician costs to free pharmacists to provide pharmaceutical care. Improved patient outcomes, increased patient loyalty, and improved adherence are additional potential benefits.

Small-for-gestational age prevalence risk factors in central Appalachian states with mountain-top mining.

PubMed

Ferdosi, Hamid; Lamm, Steve H; Afari-Dwamena, Nana Ama; Dissen, Elisabeth; Chen, Rusan; Li, Ji; Feinleib, Manning

2018-01-01

To identify risk factors for small-for-gestational age (SGA) for counties in central Appalachian states (Kentucky (KY), Tennessee (TN), Virginia (VA), and West Virginia (WV)) with varied coal mining activities. Live birth certificate files (1990-2002) were used for obtaining SGA prevalence rates for mothers based on the coal mining activities of their counties of residence, mountain-top mining (MTM) activities, underground mining activities but no mountain-top mining activity (non-MTM), or having no mining activities (non-mining). Co-variable information, including maternal tobacco use, was also obtained from the live birth certificate. Adjusted odds ratios were obtained using multivariable logistic regression comparing SGA prevalence rates for counties with coal mining activities to those without coal mining activities and comparing SGA prevalence rates for counties with coal mining activities for those with and without mountain-top mining activities. Comparisons were also made among those who had reported tobacco use and those who had not. Both tobacco use prevalence and SGA prevalence were significantly greater for mining counties than for non-mining counties and for MTM counties than for non-MTM counties. Adjustment for tobacco use alone explained 50% of the increased SGA risk for mining counties and 75% of the risk for MTM counties, including demographic pre-natal care co-variables that explained 75% of the increased SGA risk for mining counties and 100% of the risk for MTM. The increased risk of SGA was limited to the third trimester births among tobacco users and independent of the mining activities of their counties of residence. This study demonstrates that the increased prevalence of SGA among residents of counties with mining activity was primarily explained by the differences in maternal tobacco use prevalence, an effect that itself was gestational-age dependent. Self-reported tobacco use marked the population at the increased risk for SGA in central Appalachian states. Int J Occup Med Environ Health 2018;31(1):11-23. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

Nacre-mimetic clay/xyloglucan bionanocomposites: a chemical modification route for hygromechanical performance at high humidity.

PubMed

Kochumalayil, Joby J; Morimune, Seira; Nishino, Takashi; Ikkala, Olli; Walther, Andreas; Berglund, Lars A

2013-11-11

Nacre-mimetic bionanocomposites of high montmorillonite (MTM) clay content, prepared from hydrocolloidal suspensions, suffer from reduced strength and stiffness at high relative humidity. We address this problem by chemical modification of xyloglucan in (XG)/MTM nacre-mimetic nanocomposites, by subjecting the XG to regioselective periodate oxidation of side chains to enable it to form covalent cross-links to hydroxyl groups in neighboring XG chains or to the MTM surface. The resulting materials are analyzed by FTIR spectroscopy, thermogravimetric analysis, carbohydrate analysis, calorimetry, X-ray diffraction, scanning electron microscopy, tensile tests, and oxygen barrier properties. We compare the resulting mechanical properties at low and high relative humidity. The periodate oxidation leads to a strong increase in modulus and strength of the materials. A modulus of 30 GPa for cross-linked composite at 50% relative humidity compared with 13.7 GPa for neat XG/MTM demonstrates that periodate oxidation of the XG side chains leads to crucially improved stress transfer at the XG/MTM interface, possibly through covalent bond formation. This enhanced interfacial adhesion and internal cross-linking of the matrix moreover preserves the mechanical properties at high humidity condition and leads to a Young's modulus of 21 GPa at 90%RH.

HIV medication therapy management services in community pharmacies

PubMed Central

Kauffman, Yardlee; Nair, Vidya; Herist, Keith; Thomas, Vasavi; Weidle, Paul J.

2015-01-01

Objectives To present a rationale and a proposed structure to support pharmacist-delivered medication therapy management (MTM) for human immunodeficiency virus (HIV) disease and to outline challenges to implementing and sustaining the service. Data sources Professional literature. Summary Historically, the effect of pharmacy services for HIV-infected persons has been demonstrated in inpatient and clinic-based settings. Developing similar programs adapted for community pharmacists could be a model of care to improve patient adherence to antiretroviral therapy and retention in care. Initiation of antiretroviral therapy and regular monitoring of CD4+ cell count, HIV RNA viral load, adverse drug events, and adherence form the backbone of successful medical management of HIV infection. Support for these services can be provided to HIV-infected patients through pharmacist-managed HIV MTM programs in community pharmacy settings in collaboration with primary providers and other health care professionals. Conclusion Community pharmacists can help meet the growing need for HIV care through provision of MTM services. Although resources have been developed, including the general MTM framework, challenges of adequate training, education, and support of community pharmacists need to be addressed in order for HIV MTM to be a successful model. PMID:23229993

The identification of solar wind waves at discrete frequencies and the role of the spectral analysis techniques

NASA Astrophysics Data System (ADS)

Di Matteo, S.; Villante, U.

2017-05-01

The occurrence of waves at discrete frequencies in the solar wind (SW) parameters has been reported in the scientific literature with some controversial results, mostly concerning the existence (and stability) of favored sets of frequencies. On the other hand, the experimental results might be influenced by the analytical methods adopted for the spectral analysis. We focused attention on the fluctuations of the SW dynamic pressure (PSW) occurring in the leading edges of streams following interplanetary shocks and compared the results of the Welch method (WM) with those of the multitaper method (MTM). The results of a simulation analysis demonstrate that the identification of the wave occurrence and the frequency estimate might be strongly influenced by the signal characteristics and analytical methods, especially in the presence of multicomponent signals. In SW streams, PSW oscillations are routinely detected in the entire range f ≈ 1.2-5.0 mHz; nevertheless, the WM/MTM agreement in the identification and frequency estimate occurs in ≈50% of events and different sets of favored frequencies would be proposed for the same set of events by the WM and MTM analysis. The histogram of the frequency distribution of the events identified by both methods suggests more relevant percentages between f ≈ 1.7-1.9, f ≈ 2.7-3.4, and f ≈ 3.9-4.4 (with a most relevant peak at f ≈ 4.2 mHz). Extremely severe thresholds select a small number (14) of remarkable events, with a one-to-one correspondence between WM and MTM: interestingly, these events reveal a tendency for a favored occurrence in bins centered at f ≈ 2.9 and at f ≈ 4.2 mHz.

[Prostate cancer: Quality assessment of clinical management in the Midi-Pyrenean region in 2011].

PubMed

Daubisse-Marliac, L; Lamy, S; Lunardi, P; Tollon, C; Thoulouzan, M; Latorzeff, I; Bauvin, E; Grosclaude, P

2017-02-01

Assessing the quality of the clinical management of prostate cancer in the Midi-Pyrenean region in 2011. The study population was randomly selected among new cases of prostate cancer presented in Multidisciplinary Team Meeting (MTM) in 2011. The indicators defined with the professionals have evaluated the quality of the diagnostic care, when treatment started and at the time of the MTM. Six hundred and thirty-three new patients were included (median age at diagnosis=69years, min: 48; max: 93). In diagnostic period, 92% of patients had a prostate biopsy. Performing a pelvic MRI, an abdomino-pelvic CT and bone scintigraphy concerned respectively 53%, 55% and 61% of intermediate or high-risk patients. The Gleason score, surgical margins and pathological stage were included in over 98% patient records treated by radical prostatectomy. A PSA assay in 3months after prostatectomy was found in 59% of surgical patients. The MTM was performed before treatment to 83% of patients. About three-quarters of surgical patients with stage pT≥3 or pN1 or with no healthy margins were discussed in MTM after surgery. Most of the studied indicators reach a high level. However, the lower level of realization of complementary examinations may question about their real place, accessibility and traceability. 4. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Compact Single-Layer Traveling-Wave Antenna DesignUsing Metamaterial Transmission Lines

NASA Astrophysics Data System (ADS)

Alibakhshikenari, Mohammad; Virdee, Bal Singh; Limiti, Ernesto

2017-12-01

This paper presents a single-layer traveling-wave antenna (TWA) that is based on composite right/left-handed (CRLH)-metamaterial (MTM) transmission line (TL) structure, which is implemented by using a combination of interdigital capacitors and dual-spiral inductive slots. By embedding dual-spiral inductive slots inside the CRLH MTM-TL results in a compact TWA. Dimensions of the proposed CRLH MTM-TL TWA is 21.5 × 30.0 mm2 or 0.372λ0 × 0.520λ0 at 5.2 GHz (center frequency). The fabricated TWA operates over 1.8-8.6 GHz with a fractional bandwidth greater than 120%, and it exhibits a peak gain and radiation efficiency of 4.2 dBi and 81%, respectively, at 5 GHz. By avoiding the use of lumped components, via-holes or defected ground structures, the proposed TWA design is economic for mass production as well as easy to integrate with wireless communication systems.

75 FR 438 - Notice of Invitation-Coal Exploration License Application MTM 99242

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-05

...] Notice of Invitation--Coal Exploration License Application MTM 99242 AGENCY: Bureau of Land Management... Energy Company in a program for the exploration of coal deposits owned by the United States of America in... section [[Page 439

Use of manometric temperature measurements (MTM) to characterize the freeze-drying behavior of amorphous protein formulations.

PubMed

Johnson, Robert E; Oldroyd, Megan E; Ahmed, Saleem S; Gieseler, Henning; Lewis, Lavinia M

2010-06-01

The freeze-drying behavior and cake morphology of a model protein in an amorphous formulation were studied at varying protein concentrations using conservative (-25 degrees C) and aggressive (+25 degrees C) shelf temperatures at constant chamber pressure during primary drying. The two cycles were characterized by manometric temperature measurements (MTM) in a SMART freeze dryer that estimates the sublimation rate (dm/dt), product temperature at the freeze-drying front (T(p-MTM)) and product resistance (R(p)) during a run. The calculated sublimation rates (dm/dt) were 3-4 times faster in the aggressive cycle compared to the conservative cycle. For conservatively dried cakes R(p) increased with both dry layer thickness and protein concentration. For aggressively dried cakes (where freeze-drying occurs at the edge of microcollapse), R(p) also increased with protein concentration but was independent of the dry layer thickness. The sublimation rate was influenced by R(p), dry layer thickness and T(p-MTM) in the conservative cycle, but was governed mainly by T(p-MTM) in the aggressive cycle, where R(p) is independent of the dry layer thickness. The aggressively dried cakes had a more open and porous structure compared to their conservatively dried counterparts. (c) 2009 Wiley-Liss, Inc. and the American Pharmacists Association

Applying a new theory to smoking cessation: case of multi-theory model (MTM) for health behavior change.

PubMed

Sharma, Manoj; Khubchandani, Jagdish; Nahar, Vinayak K

2017-01-01

Background: Smoking continues to be a public health problem worldwide. Smoking and tobacco use are associated with cardiovascular diseases that include coronary heart disease, atherosclerosis, cerebrovascular disease, and abdominal aortic aneurysm. Programs for quitting smoking have played a significant role in reduction of smoking in the United States. The smoking cessation interventions include counseling, nicotine replacement therapy, buproprion therapy, and varenicline therapy. The success rates with each of these approaches vary with clear need for improvement. Moreover, there is a need for a robust theory that can guide smoking cessation counseling interventions and increase the success rates. A fourth generation approach using multi-theory model (MTM) of health behavior change is introduced in this article for smoking cessation. An approach for developing and evaluating an intervention for smoking cessation is presented along with a measurement tool. Methods: A literature review reifying the MTM of health behavior change for smoking cessation has been presented. An instrument designed to measure constructs of MTM and associated smoking cessation behavior has been developed. Results: The instrument developed is available for validation, reliability and prediction study pertaining to smoking cessation. The intervention is available for testing in a randomized control trial involving smokers. Conclusion: MTM is a robust theory that holds promise for testing and application to smoking cessation.

Applying Multi-Theory Model (MTM) of Health Behavior Change to Predict Water Consumption Instead of Sugar-Sweetened Beverages.

PubMed

Sharma, Manoj; Catalano, Hannah Priest; Nahar, Vinayak K; Lingam, Vimala C; Johnson, Paul; Ford, M Allison

2017-02-25

A substantial proportion of college students to not drink enough water and consume sugar-sweetened beverages (SSBs). Consumption of SSBs is associated with weight gain, obesity, type 2 diabetes mellitus, dental carries, and increased risk for cardiovascular disease. Hence, the purpose of this study was to use the multi-theory model (MTM) in predicting initiation and sustenance of plain water consumption instead of sugar-sweetened beverages among college students. A cross-sectional study. In this cross-sectional study, a 37-item valid and reliable MTM-based survey was administered to college students in 2016 via Qualtrics at a large public university in the Southeastern United States. Overall, 410 students responded to the survey; of those, 174 were eligible for the study and completed it. Stepwise multiple regression analysis revealed that 61.8% of the variance in the initiation of drinking plain water instead of SSBs was explained by behavioral confidence (P<0.001) and changes in the physical environment (P<0.001). Further, 58.3% of the variance in the sustenance of drinking plain water instead of SSBs was explained by emotional transformation (P<0.001) and practice for change (P=0.001). Multi-theory model of health behavior change is a robust theory for predicting plain water consumption instead of SSBs in college students. Interventions should be developed based on this theory for this target population.

Reduction of the spatially mutual coupling between dual-polarized patch antennas using coupled metamaterial slabs.

PubMed

Pan, Bai Cao; Tang, Wen Xuan; Qi, Mei Qing; Ma, Hui Feng; Tao, Zui; Cui, Tie Jun

2016-07-22

Mutual coupling inside antenna array is usually caused by two routes: signal leakage via conducting currents on the metallic background or surface wave along substrates; radio leakage received from space between antenna elements. The former one can be depressed by changing the distribution of surface currents, as reported in literatures. But when it comes to the latter one, the radiation-leakage-caused coupling, traditional approaches using circuit manipulation may be inefficient. In this article, we propose and design a new type of decoupling module, which is composed of coupled metamaterial (MTM) slabs. Two classes of MTM particles, the interdigital structure (IS) and the split-ring resonators (SRRs), are adopted to provide the first and second modulations of signal. We validate its function to reduce the radiation leakage between two dual-polarized patch antennas. A prototype is fabricated in a volume with subwavelength scale (0.6λ × 0.3λ × 0.053λ) to provide 7dB improvement for both co-polarization and cross-polarization isolations from 1.95 to 2.2 GHz. The design has good potential for wireless communication and radar systems.

Reduction of the spatially mutual coupling between dual-polarized patch antennas using coupled metamaterial slabs

PubMed Central

Pan, Bai Cao; Tang, Wen Xuan; Qi, Mei Qing; Ma, Hui Feng; Tao, Zui; Cui, Tie Jun

2016-01-01

Mutual coupling inside antenna array is usually caused by two routes: signal leakage via conducting currents on the metallic background or surface wave along substrates; radio leakage received from space between antenna elements. The former one can be depressed by changing the distribution of surface currents, as reported in literatures. But when it comes to the latter one, the radiation-leakage-caused coupling, traditional approaches using circuit manipulation may be inefficient. In this article, we propose and design a new type of decoupling module, which is composed of coupled metamaterial (MTM) slabs. Two classes of MTM particles, the interdigital structure (IS) and the split-ring resonators (SRRs), are adopted to provide the first and second modulations of signal. We validate its function to reduce the radiation leakage between two dual-polarized patch antennas. A prototype is fabricated in a volume with subwavelength scale (0.6λ × 0.3λ × 0.053λ) to provide 7dB improvement for both co-polarization and cross-polarization isolations from 1.95 to 2.2 GHz. The design has good potential for wireless communication and radar systems. PMID:27444147

Evaluation of Sandwich Structure Bonding In Out-of-Autoclave Processing

NASA Technical Reports Server (NTRS)

Hou, Tan-Hung; Baughman, James M.; Zimmerman, Thomas J.; Sutter, James K.; Gardner, John M.

2010-01-01

The out-of-autoclave-vacuum-bag-only (OOA-VBO) process is low in capital expenditures compared to the traditional autoclave, however, the material challenges for OOA-VBO workable material systems are high. Presently there are few such aerospace grade prepreg materials available commercially. In this study, we evaluated processing and properties of honeycomb sandwich structure (HC/SS) panels fabricated by co-curing composite face sheet with adhesives by the OOA-VBO process in an oven. The prepreg materials were IM7/MTM 45-1 and T40-800B/5320. Adhesives studied were AF-555M, XMTA-241/PM15, FM-309-1M and FM-300K. Aluminum H/C cores with and without perforations were included. It was found that adhesives in IM7/MTM 45-1/AF-555M, T40-800B/5320/FM 309-1M and T40-800B/5320/FM-300K panels all foamed but yielded high flatwise tensile (FWT) strength values above 8,275 kPA (1,200 psi). IM7/MTM 45-1/XMTA-241/PM15 did not foam, yet yielded a low FWT strength. SEM photomicrographs revealed that the origin of this low strength was poor adhesion in the interfaces between the adhesive and face sheet composite due to poor wetting associated with the high initial viscosity of the XMTA-241/PM15 adhesive.

Challenges to Integrating Pharmacogenetic Testing into Medication Therapy Management

PubMed Central

Allen LaPointe, Nancy M.; Moaddeb, Jivan

2015-01-01

Background Some have proposed the integration of pharmacogenetic (PGx) testing into medication therapy management (MTM) to enable further refinement of treatment(s) to reduce risk of adverse responses and improve efficacy. PGx testing involves the analysis of genetic variants associated with therapeutic or adverse response and may be useful in enhancing the ability to identify ineffective and/or harmful drugs or drug combinations. This “enhanced” MTM might also reduce patient concerns about side effects and increase confidence that the medication is effective, addressing two key factors that impact patient adherence - concern and necessity. However, the feasibility and effectiveness of the integration of PGx testing into MTM in clinical practice has not yet been determined. Objectives In this paper, we consider some of the challenges to the integration and delivery of PGx testing in MTM services. What is already known about this subject While the addition of pharmacogenetic testing has been suggested, little literature exists exploring the challenges or feasibility of doing so. PMID:25803768

Geologic Map of the MTM -30262 and -30267 Quadrangles, Hadriaca Patera Region of Mars

USGS Publications Warehouse

Crown, David A.; Greeley, Ronald

2007-01-01

Introduction Mars Transverse Mercator (MTM) -30262 and -30267 quadrangles cover the summit region and east margin of Hadriaca Patera, one of the Martian volcanoes designated highland paterae. MTM -30262 quadrangle includes volcanic deposits from Hadriaca Patera and Tyrrhena Patera (summit northeast of map area) and floor deposits associated with the Dao and Niger Valles canyon systems (south of map area). MTM -30267 quadrangle is centered on the caldera of Hadriaca Patera. The highland paterae are among the oldest, central-vent volcanoes on Mars and exhibit evidence for explosive eruptions, which make a detailed study of their geology an important component in understanding the evolution of Martian volcanism. Photogeologic mapping at 1:500,000-scale from analysis of Viking Orbiter images complements volcanological studies of Hadriaca Patera, geologic investigations of the other highland paterae, and an analysis of the styles and evolution of volcanic activity east of Hellas Planitia in the ancient, cratered highlands of Mars. This photogeologic study is an extension of regional geologic mapping east of Hellas Planitia. The Martian highland paterae are low-relief, areally extensive volcanoes exhibiting central calderas and radial channels and ridges. Four of these volcanoes, Hadriaca, Tyrrhena, Amphitrites, and Peneus Paterae, are located in the ancient cratered terrains surrounding Hellas Planitia and are thought to be located on inferred impact basin rings or related fractures. Based on analyses of Mariner 9 images, Potter (1976), Peterson (1977), and King (1978) suggested that the highland paterae were shield volcanoes formed by eruptions of fluid lavas. Later studies noted morphologic similarities between the paterae and terrestrial ash shields and the lack of primary lava flow features on the flanks of the volcanoes. The degraded appearances of Hadriaca and Tyrrhena Paterae and the apparently easily eroded materials composing their low, broad shields further suggest that the highland paterae are composed predominantly of pyroclastic deposits. Analyses of eruption and flow processes indicate that the distribution of units at Hadriaca and Tyrrhena Paterae is consistent with emplacement by gravity-driven pyroclastic flows. Detailed geologic study of the summit caldera and flanks of Hadriaca Patera is essential to determine the types of volcanic materials exposed, the nature of the processes forming these deposits, and the role of volcanism in the evolution of the cratered highlands that are characteristic of the southern hemisphere of Mars.

Impact of passive and active promotional strategies on patient acceptance of medication therapy management services.

PubMed

Huet, Alison L; Frail, Caitlin K; Lake, Leslie M; Snyder, Margie E

2015-01-01

To assess the impact of passive and active promotional strategies on patient acceptance of medication therapy management (MTM) services, and to identify reasons for patient acceptance or refusal. Four promotional approaches were developed to offer MTM services to eligible patients, including letters and bag stuffers ("passive" approaches), and face-to-face offers and telephone calls ("active" approaches). Thirty pharmacies in a grocery store chain were randomized to one of the four approaches. Patient acceptance rates were compared among the four groups, and between active and passive approaches using hierarchical logistic regression techniques. Depending on their decision to accept or decline the service, patients were invited to take part in one of two brief telephone surveys. No significant differences were identified among the four promotional methods or between active and passive methods in the analyses. Patients' most frequent reasons for accepting MTM services were potential cost savings, review of how the medications were working, the expert opinion of the pharmacist, and education about medications. Patients' most frequent reasons for declining MTM services were that the participant already felt comfortable with their medications and felt their pharmacist provides these services on a regular basis. No significant difference was found among any of the four groups or between active or passive approaches. Further research is warranted to identify strategies for improving patient engagement in MTM services.

77 FR 71822 - Notice of Invitation-Coal Exploration License Application MTM 103852, MT

Federal Register 2010, 2011, 2012, 2013, 2014

2012-12-04

...] Notice of Invitation--Coal Exploration License Application MTM 103852, MT AGENCY: Bureau of Land... Ambre Energy on a pro rata cost sharing basis in a program for the exploration of coal deposits owned by... program is to gain additional geologic knowledge of the coal underlying the exploration area for the...

Donating money is not the only way to sustain cooperation in public goods game

NASA Astrophysics Data System (ADS)

Chen, Tong; Wu, Zheng-Hong; Wang, Le

Most of the previous studies research cooperation mainly based on donating money in social public goods games. Owing to the lack of income, some people prefer to donate time instead of money to promote the activity, in our daily life. Motivated by this fact, we here investigate the influence of the encouragement of donating time on the evolution of cooperation based on village opera. In our study, we set up two models: one is money-only model (MOM). Donating money is the only choice in MOM. The other is money-time model (MTM). Besides donating money, donating time is an alternative in MTM. Through numerical simulations, we find that compared to MOM, MTM has a faster speed to reach cooperation equilibrium and cost advantage to sustain the same cooperation level, without the effects of income, reputation, satisfaction, emotion and maximum nonmonetary input. However, it should be noted that MTM is better than MOM in a moderate interval of general budget V. Our results provide stark evidence that the encouragement of donating time can promote and sustain cooperation better than only donating money.

TransitionRx: Impact of community pharmacy postdischarge medication therapy management on hospital readmission rate.

PubMed

Luder, Heidi R; Frede, Stacey M; Kirby, James A; Epplen, Kelly; Cavanaugh, Teresa; Martin-Boone, Jill E; Conrad, Wayne F; Kuhlmann, Diane; Heaton, Pamela C

2015-01-01

To determine if a community pharmacy-based transition of care (TOC) program that included the full scope of medication therapy management (MTM) services (TransitionRx) decreased hospital readmissions, resolved medication-related problems, and increased patient satisfaction. Prospective, quasi-experimental study. Nine Kroger Pharmacies located in Western Cincinnati. Patients older than 18 years of age and discharged from two local hospitals with a diagnosis of congestive heart failure, chronic obstructive pulmonary disease, or pneumonia. Patients were recruited from two local hospitals and referred to the community pharmacy for MTM services with the pharmacist within 1 week of discharge. Pharmacists reconciled the patients' medications, identified drug therapy problems, recommended changes to therapy, and provided self-management education. At 30 days after discharge, research personnel conducted telephone surveys, using a previously validated survey instrument, to assess hospital readmissions and patient satisfaction. Pharmacist interventions and medication-related problems were documented. A total of 90 patients completed the study. Of these, 20% of patients in the usual care group were admitted to the hospital within 30 days compared with 6.9% of patients in the intervention group (P = 0.019). In the 30 patients who received MTM services from the pharmacist, 210 interventions were made. The overall mean patient satisfaction with the TOC process was not significantly different between patients who were seen by the pharmacist and those who were not seen by the pharmacist. Community pharmacies successfully collaborated with hospitals to develop a referral process for TOC interventions. Patients who received MTM services from the pharmacist experienced significantly fewer readmissions than patients who received usual care.

Dual Tuning of Ni-Co-A (A = P, Se, O) Nanosheets by Anion Substitution and Holey Engineering for Efficient Hydrogen Evolution.

PubMed

Fang, Zhiwei; Peng, Lele; Qian, Yumin; Zhang, Xiao; Xie, Yujun; Cha, Judy J; Yu, Guihua

2018-04-18

Seeking earth-abundant electrocatalysts with high efficiency and durability has become the frontier of energy conversion research. Mixed-transition-metal (MTM)-based electrocatalysts, owing to the desirable electrical conductivity, synergistic effect of bimetal atoms, and structural stability, have recently emerged as new-generation hydrogen evolution reaction (HER) electrocatalysts. However, the correlation between anion species and their intrinsic electrocatalytic properties in MTM-based electrocatalysts is still not well understood. Here we present a novel approach to tuning the anion-dependent electrocatalytic characteristics in MTM-based catalyst for HER, using holey Ni/Co-based phosphides/selenides/oxides (Ni-Co-A, A = P, Se, O) as the model materials. The electrochemical results, combined with the electrical conductivity measurement and DFT calculation, reveal that P substitution could modulate the electron configuration, lower the hydrogen adsorption energy, and facilitate the desorption of hydrogen on the active sites in Ni-Co-A holey nanostructures, resulting in superior HER catalytic activity. Accordingly we fabricate the NCP holey nanosheet electrocatalyst for HER with an ultralow onset overpotential of nearly zero, an overpotential of 58 mV, and long-term durability, along with an applied potential of 1.56 V to boost overall water splitting at 10 mA cm -2 , among the best electrocatalysts reported for non-noble-metal catalysts to date. This work not only presents a deeper understanding of the intrinsic HER electrocatalytic properties for MTM-based electrocatalyst with various anion species but also offers new insights to better design efficient and durable water-splitting electrocatalysts.

78 FR 76319 - Notice of Invitation-Coal Exploration License Application MTM 106757, Montana

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-17

...] Notice of Invitation--Coal Exploration License Application MTM 106757, Montana AGENCY: Bureau of Land... Signal Peak Energy, LLC on a pro rata cost sharing basis in a program for the exploration of coal... Office coal Web site at http://www.blm.gov/mt/st/en/prog/energy/coal.html . A written notice to...

76 FR 31976 - Notice of Invitation-Coal Exploration License Application MTM 101688

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-02

...] Notice of Invitation--Coal Exploration License Application MTM 101688 AGENCY: Bureau of Land Management... Creek Coal Company on a pro rata cost sharing basis in a program for the exploration of coal deposits... notice to both the Bureau of Land Management (BLM) and the Spring Creek Coal Company as provided in the...

Chronic Cardiovascular Disease Mortality in Mountaintop Mining Areas of Central Appalachian States

ERIC Educational Resources Information Center

Esch, Laura; Hendryx, Michael

2011-01-01

Purpose: To determine if chronic cardiovascular disease (CVD) mortality rates are higher among residents of mountaintop mining (MTM) areas compared to mining and nonmining areas, and to examine the association between greater levels of MTM surface mining and CVD mortality. Methods: Age-adjusted chronic CVD mortality rates from 1999 to 2006 for…

75 FR 62137 - Notice of Public Meeting; Proposed Alluvial Valley Floor Coal Exchange Public Interest Factors...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-07

...; MTM-99236] Notice of Public Meeting; Proposed Alluvial Valley Floor Coal Exchange Public Interest... (SMCRA) of 1977. This exchange (serial number MTM-99236) has been proposed by Jay Nance, Brett A... Director. [FR Doc. 2010-25060 Filed 10-6-10; 8:45 am] BILLING CODE 4310-DN-P ...

Methylation of Arsenic by Recombinant Human Wild-Type Arsenic (+3 Oxidation State) Methyltransferase and its Methionine 287 Threonine (M287T) Polymorph

EPA Science Inventory

ABSTRACT Arsenic (+3 oxidation state) methyltransferase (AS3MT) is the key enzyme in the pathway for methylation of arsenicals. A common polymorphism in the AS3MT gene that replaces a threonyl residue in position 287 with a methionyl residue (AS3MT/M287T) occurs at a frequency...

Experimental Testing of a Metamaterial Slow Wave Structure for High-Power Microwave Generation

NASA Astrophysics Data System (ADS)

Shipman, K.; Prasad, S.; Andreev, D.; Fisher, D. M.; Reass, D. B.; Schamiloglu, E.; Gilmore, M.

2017-10-01

A high-power L band source has been developed using a metamaterial (MTM) to produce a double negative slow wave structure (SWS) for interaction with an electron beam. The beam is generated by a 700 kV, 6 kA short pulse (10 ns) accelerator. The design of the SWS consists of a cylindrical waveguide, loaded with alternating split-rings that are arrayed axially down the waveguide. The beam is guided down the center of the rings, where electrons interact with the MTM-SWS producing radiation. Power is extracted axially via a circular waveguide, and radiated by a horn antenna. Microwaves are characterized by an external detector placed in a waveguide. Mode characterization is performed using a neon bulb array. The bulbs are lit by the electric field, resulting in an excitation pattern that resembles the field pattern. This is imaged using an SLR camera. The MTM structure has electrically small features so breakdown is a concern. In addition to high speed cameras, a fiber-optic-fed, sub-ns photomultiplier tube array diagnostic has been developed and used to characterize breakdown light. Work supported by the Air Force Office of Scientific Research, MURI Grant FA9550-12-1-0489.

Investigations of Volcanic and Volatile-Driven Processes Northeast of Hellas Basin, Mars

NASA Astrophysics Data System (ADS)

Mest, S. C.; Crown, D. A.; Michalski, J.; Chuang, F. C.; Price Blount, K.; Bleamaster, L. F.

2018-06-01

We are mapping the geologic units and features in three MTM quadrangles northeast of Hellas basin at 1:1M scale. The area displays evidence for volcanism and widespread volatile-related modification of the surface.

Geologic Mapping of MTM -30247, -35247 and -40247 Quadrangles, Reull Vallis Region of Mars

NASA Technical Reports Server (NTRS)

Mest, S. C.; Crown, D. A.

2008-01-01

Geologic mapping and stratigraphic analyses of MTM -30247, -35247, and -40247 quadrangles are being used to characterize the Reull Vallis (RV) system and to determine the history of the eastern Hellas region of Mars. Studies of RV examine the roles and timing of volatile-driven erosional and depositional processes and provide constraints on potential associated climatic changes. This study complements earlier investigations of the eastern Hellas region, including regional analyses [1-6], mapping studies of circum-Hellas canyons [7-10], and volcanic studies of Hadriaca and Tyrrhena Paterae [11-13]. Key scientific objectives for these quadrangles include 1) characterization of RV in its "fluvial zone," 2) analysis of channels in the surrounding plains and potential connections to and interactions with RV, 3) examination of young (?), presumably sedimentary plains along RV that embay the surrounding highlands, and 4) determination of the nature of the connection between segments 1 and 2 of RV.

New results on equatorial thermospheric winds and temperatures from Ethiopia, Africa

NASA Astrophysics Data System (ADS)

Tesema, Fasil; Mesquita, Rafael; Meriwether, John; Damtie, Baylie; Nigussie, Melessew; Makela, Jonathan; Fisher, Daniel; Harding, Brian; Yizengaw, Endawoke; Sanders, Samuel

2017-03-01

Measurements of equatorial thermospheric winds, temperatures, and 630 nm relative intensities were obtained using an imaging Fabry-Perot interferometer (FPI), which was recently deployed at Bahir Dar University in Ethiopia (11.6° N, 37.4° E, 3.7° N magnetic). The results obtained in this study cover 6 months (53 nights of useable data) between November 2015 and April 2016. The monthly-averaged values, which include local winter and equinox seasons, show the magnitude of the maximum monthly-averaged zonal wind is typically within the range of 70 to 90 ms-1 and is eastward between 19:00 and 21:00 LT. Compared to prior studies of the equatorial thermospheric wind for this local time period, the magnitude is considerably weaker as compared to the maximum zonal wind speed observed in the Peruvian sector but comparable to Brazilian FPI results. During the early evening, the meridional wind speeds are 30 to 50 ms-1 poleward during the winter months and 10 to 25 ms-1 equatorward in the equinox months. The direction of the poleward wind during the winter months is believed to be mainly caused by the existence of the interhemispheric wind flow from the summer to winter hemispheres. An equatorial wind surge is observed later in the evening and is shifted to later local times during the winter months and to earlier local times during the equinox months. Significant night-to-night variations are also observed in the maximum speed of both zonal and meridional winds. The temperature observations show the midnight temperature maximum (MTM) to be generally present between 00:30 and 02:00 LT. The amplitude of the MTM was ˜ 110 K in January 2016 with values smaller than this in the other months. The local time difference between the appearance of the MTM and a pre-midnight equatorial wind was generally 60 to 180 min. A meridional wind reversal was also observed after the appearance of the MTM (after 02:00 LT). Climatological models, HWM14 and MSIS-00, were compared to the observations and the HWM14 model generally predicted the zonal wind observations well with the exception of higher model values by 25 ms-1 in the winter months. The HWM14 model meridional wind showed generally good agreement with the observations. Finally, the MSIS-00 model overestimated the temperature by 50 to 75 K during the early evening hours of local winter months. Otherwise, the agreement was generally good, although, in line with prior studies, the model failed to reproduce the MTM peak for any of the 6 months compared with the FPI data.

Geologic Mapping of MTM -30247, -35247 and -40247 Quadrangles, Reull Vallis Region, Mars

NASA Technical Reports Server (NTRS)

Mest, S. C.; Crown, D. A.

2009-01-01

Geologic mapping of MTM -30247, -35247, and -40247 quadrangles is being used to characterize Reull Vallis (RV) and to determine the history of the eastern Hellas region of Mars. Studies of RV examine the roles and timing of volatile-driven erosional and depositional processes and provide constraints on potential associated climatic changes. This study complements earlier investigations of the eastern Hellas region, including regional analyses [1-6], mapping studies of circum-Hellas canyons [7-10], and volcanic studies of Hadriaca and Tyrrhena Paterae [11-13]. Key scientific objectives include 1) characterizing RV in its "fluvial zone," 2) analysis of channels in the surrounding plains and potential connections to and interactions with RV, 3) examining young, presumably sedimentary plains along RV, and 4) determining the nature of the connection between the segments of RV.

76 FR 28452 - Notice of Proposed Reinstatement of Terminated Oil and Gas Leases MTM 99624 and MTM 99625

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-17

... lease terms for rentals and royalties of $10 per acre and 16\\2/3\\ percent. The lessee paid the $500 administration fee for the reinstatement of each lease and $163 cost for publishing this Notice. The lessee met... increased royalty of 16\\2/3\\ percent; and The $163 cost of publishing this Notice. FOR FURTHER INFORMATION...

76 FR 28452 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease MTM 94684 and MTM 94685

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-17

... agrees to new lease terms for rentals and royalties of $10 per acre and 16\\2/3\\ percent. The lessee paid the $500 administration fee for the reinstatement of each lease and $163 cost for publishing this... $10 per acre; The increased royalty of 16\\2/3\\ percent; and The $163 cost of publishing this Notice...

Deconstructing the deconstruction of Appalachia: Mountaintop mining effects on hydrology across temporal and spatial scales

NASA Astrophysics Data System (ADS)

Nippgen, F.; Ross, M. R. V.; Bernhardt, E. S.; McGlynn, B. L.

2017-12-01

Mountaintop mining (MTM) is an especially destructive form of surface coal mining. It is widespread in Central Appalachia and is practiced around the world. In the process of accessing coal seams up to several hundred meters below the surface, mountaintops and ridges are removed via explosives and heavy machinery with the resulting overburden pushed into nearby valleys. This broken up rock and soil material represents a largely unknown amount of storage for incoming precipitation that facilitates enhanced chemical weathering rates and increased dissolved solids exports to streams. However, assessing the independent impact of MTM can be difficult in the presence of other forms of mining, especially underground mining. Here, we evaluate the effect of MTM on water quantity and quality on annual, seasonal, and event time scales in two sets of paired watersheds in southwestern West Virginia impacted by MTM. On an annual timescale, the mined watersheds sustained baseflow throughout the year, while the first order watersheds ceased flowing during the latter parts of the growing season. In fractionally mined watersheds that continued to flow, the water in the stream was exclusively generated from mined portions of the watersheds, leading to elevated total dissolved solids in the stream water. On the event time scale, we analyzed 50 storm events over a water year for a range of hydrologic response metrics. The mined watersheds exhibited smaller runoff ratios and longer response times during the wet dormant season, but responded similarly to rainfall events during the growing season or even exceeded the runoff magnitude of the reference watersheds. Our research demonstrates a clear difference in hydrologic response between mined and unmined watersheds during the growing season and the dormant season that are detectable at annual, seasonal, and event time scales. For larger spatial scales (up to 2,000km2) the effect of MTM on water quantity is not as easily detectable. At these larger scales, other land uses can mask possible alterations in hydrology or the percentage of MTM disturbed areas becomes negligible.

Power weighted L p -inequalities for Laguerre-Riesz transforms

NASA Astrophysics Data System (ADS)

Harboure, Eleonor; Segovia, Carlos; Torrea, José L.; Viviani, Beatriz

2008-10-01

In this paper we give a complete description of the power weighted inequalities, of strong, weak and restricted weak type for the pair of Riesz transforms associated with the Laguerre function system \\{mathcal{L}_k^{α}\\}, for any given α>-1. We achieve these results by a careful estimate of the kernels: near the diagonal we show that they are local Calderón-Zygmund operators while in the complement they are majorized by Hardy type operators and the maximal heat-diffusion operator. We also show that in all the cases our results are sharp.

Temporal changes in taxonomic and functional diversity of fish assemblages downstream from mountaintop mining

USGS Publications Warehouse

Hitt, Nathaniel P.; Chambers, Douglas B.

2014-01-01

Mountaintop mining (MTM) affects chemical, physical, and hydrological properties of receiving streams, but the long-term consequences for fish-assemblage structure and function are poorly understood. We sampled stream fish assemblages using electrofishing techniques in MTM exposure sites and reference sites within the Guyandotte River basin, USA, during 2010–2011. We calculated indices of taxonomic diversity (species richness, abundance, Shannon diversity) and functional diversity (functional richness, functional evenness, functional divergence) to compare exposure and reference assemblages between seasons (spring and autumn) and across years (1999–2011). We based temporal comparisons on 2 sites that were sampled during 1999–2001 by Stauffer and Ferreri (2002). Exposure assemblages had lower taxonomic and functional diversity than reference assemblages or simulated assemblages that accounted for random variation. Differences in taxonomic composition between reference and exposure assemblages were associated with conductivity and aqueous Se concentrations. Exposure assemblages had fewer species, lower abundances, and less biomass than reference assemblages across years and seasons. Green Sunfish (Lepomis cyanellus) and Creek Chub (Semotilus atromaculatus) became numerically dominant in exposure assemblages over time because of their persistence and losses of other taxa. In contrast, species richness increased over time in reference assemblages, a result that may indicate recovery from drought. Mean individual biomass increased as fish density decreased and most obligate invertivores were apparently extirpated at MTM exposure sites. Effects of MTM were not related to physical-habitat conditions but were associated with water-quality variables, which may limit quality and availability of benthic macroinvertebrate prey. Simulations revealed effects of MTM that could not be attributed to random variation in fish assemblage structure.

The Professional Culture of Community Pharmacy and the Provision of MTM Services.

PubMed

Rosenthal, Meagen M; Holmes, Erin R

2018-03-21

The integration of advanced pharmacy services into community pharmacy practice is not complete. According to implementation research understanding professional culture, as a part of context, may provide insights for accelerating this process. There are three objectives in this study. The first objective of this study was to validate an adapted version of an organizational culture measure in a sample of United States' (US) community pharmacists. The second objective was to examine potential relationships between the cultural factors identified using the validated instrument and a number of socialization and education variables. The third objective was to examine any relationships between the scores on the identified cultural factors and the provision of MTM services. This study was a cross-sectional online survey for community pharmacists in the southeastern US. The survey contained questions on socialization/education, respondents' self-reported provision of medication therapy management (MTM) services, and the organizational culture profile (OCP). Analyses included descriptive statistics, a principle components analysis (PCA), independent samples t-test, and multivariate ordinal regression. A total of 303 surveys were completed. The PCA revealed a six-factor structure: social responsibility, innovation, people orientation, competitiveness, attention to detail, and reward orientation. Further analysis revealed significant relationships between social responsibility and years in practice, and people orientation and attention to detail and pharmacists' training and practice setting. Significant positive relationships were observed between social responsibility, innovation, and competitiveness and the increased provision of MTM services. The significant relationships identified between the OCP factors and community pharmacist respondents' provision of MTM services provides an important starting point for developing interventions to improve the uptake of practice change opportunities.

Cloning and characterization of an alternatively spliced gene in proximal Xq28 deleted in two patients with intersexual genitalia and myotubular myopathy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Laporte, J.; Hu, Ling-Jia; Kretz, C.

1997-05-01

We have identified a novel human gene that is entirely deleted in two boys with abnormal genital development and myotubular myopathy (MTM1). The gene, F18, is located in proximal Xq28, approximately 80 kb centromeric to the recently isolated MTM1 gene. Northern analysis of mRNA showed a ubiquitous pattern and suggested high levels of expression in skeletal muscle, brain, and heart. A transcript of 4.6 kb was detected in a range of tissues, and additional alternate forms of 3.8 and 2.6 kb were present in placenta and pancreas, respectively. The gene extends over 100 kb and is composed of at leastmore » seven exons, of which two are non-coding. Sequence analysis of a 4.6-kb cDNA contig revealed two overlapping open reading frames (ORFs) that encode putative proteins of 701 and 424 amino acids, respectively. Two alternative spliced transcripts affecting the large open reading frame were identified that, together with the Northern blot results, suggest that distinct proteins are derived from the gene. No significant homology to other known proteins was detected, but segments of the first ORF encode polyglutamine tracts and proline-rich domains, which are frequently observed in DNA-binding proteins. The F18 gene is a strong candidate for being implicated in the intersexual genitalia present in the two MTM1-deleted patients. The gene also serves as a candidate for other disorders that map to proximal Xq28. 15 refs., 3 figs., 1 tab.« less

Manufacturing Work Measurement System Evaluation. Reference Guide

DTIC Science & Technology

1987-04-01

discussions with users of the MTM-MEK predetermined time system. The coranents listed below are based on these discussions and, while a broad range...discussions with users of the MTM-V predeterroined time system. The coranents listed below are based on these discussions and, while a broad range of...industries were sampled, coranents should not be considered universal and therefore may not be applicable to all manufacturing environments: 0 Easy to

The Effects of Mountaintop Mines and Valley Fills on Aquatic ...

EPA Pesticide Factsheets

This report assesses the state of the science on the environmental impacts of mountaintop mines and valley fills (MTM-VF) on streams in the Central Appalachian Coalfields. Our review focused on the aquatic impacts of mountaintop removal coal mining, which, as its name suggests, involves removing all or some portion of the top of a mountain or ridge to expose and mine one or more coal seams. The excess overburden is disposed of in constructed fills in small valleys or hollows adjacent to the mining site. MTM-VF lead directly to five principal alterations of stream ecosystems: (1) springs, intermittent streams, and small perennial streams are permanently lost with the removal of the mountain and from burial under fill, (2) concentrations of major chemical ions are persistently elevated downstream, (3) degraded water quality reaches levels that are acutely lethal to standard laboratory test organisms, (4) selenium concentrations are elevated, reaching concentrations that have caused toxic effects in fish and birds and (5) macroinvertebrate and fish communities are consistently and significantly degraded. This report assesses the state of the science on the environmental impacts of Mountaintop Mines and Valley Fills (MTM-VF) on streams in the Central Appalachian Coalfields. The draft report will be externally peer reviewed by EPA's Science Advisory Board in early 2010.

Detection of novel NF1 mutations and rapid mutation prescreening with Pyrosequencing.

PubMed

Brinckmann, Anja; Mischung, Claudia; Bässmann, Ingelore; Kühnisch, Jirko; Schuelke, Markus; Tinschert, Sigrid; Nürnberg, Peter

2007-12-01

Neurofibromatosis type 1 (NF1) is caused by mutations in the neurofibromin (NF1) gene. Mutation analysis of NF1 is complicated by its large size, the lack of mutation hotspots, pseudogenes and frequent de novo mutations. Additionally, the search for NF1 mutations on the mRNA level is often hampered by nonsense-mediated mRNA decay (NMD) of the mutant allele. In this study we searched for mutations in a cohort of 38 patients and investigated the relationship between mutation type and allele-specific transcription from the wild-type versus mutant alleles. Quantification of relative mRNA transcript numbers was done by Pyrosequencing, a novel real-time sequencing method whose signals can be quantified very accurately. We identified 21 novel mutations comprising various mutation types. Pyrosequencing detected a definite relationship between allelic NF1 transcript imbalance due to NMD and mutation type in 24 of 29 patients who all carried frame-shift or nonsense mutations. NMD was absent in 5 patients with missense and silent mutations, as well as in 4 patients with splice-site mutations that did not disrupt the reading frame. Pyrosequencing was capable of detecting NMD even when the effects were only moderate. Diagnostic laboratories could thus exploit this effect for rapid prescreening for NF1 mutations as more than 60% of the mutations in this gene disrupt the reading frame and are prone to NMD.

[Gene mutation analysis of X-linked hypophosphatemic rickets].

PubMed

Song, Ying; Ma, Hong-Wei; Li, Fang; Hu, Man; Ren, Shuang; Yu, Ya-Fen; Zhao, Gui-Jie

2013-11-01

To investigate the frequency and type of PHEX gene mutations in children with X-linked hypophosphatemic rickets (XLH), the possible presence of mutational hot spots, and the relationship between genotype and clinical phenotype. Clinical data of 10 children with XLH was retrospectively reviewed. The relationship between gene mutation type and severity of XLH was evaluated. PHEX gene mutations were detected in all 10 children with XLH, including 6 cases of missense mutation, 2 cases of splice site mutation, 1 case of frameshift mutation, and 1 case of nonsense mutation. Two new mutations, c.2048T>C and IVS14+1delAG, were found. The type of PHEX gene mutation was not associated with the degree of short stature and leg deformity (P=0.571 and 0.467), and the mutation site was also not associated with the degree of short stature and leg deformity (P=0.400 and 1.000). Missense mutation is the most common type of PHEX gene mutation in children with XLH, and c.2048T>C and IVS14+1delAG are two new PHEX gene mutations. The type and site of PHEX gene mutation are not associated with the severity of XLH.

Implementation and Clinical Outcomes of an Employer-Sponsored, Pharmacist-Provided Medication Therapy Management Program.

PubMed

Theising, Katie M; Fritschle, Traci L; Scholfield, Angelina M; Hicks, Emily L; Schymik, Michelle L

2015-11-01

Our objective was to describe the implementation and clinical outcomes of an employer-sponsored, pharmacist-provided medication therapy management (MTM) program for health plan beneficiaries with diabetes mellitus and/or hypertension. We conducted a single-center retrospective medical record review. The setting was a Pharmacy MTM Clinic at a self-insured health system consisting of six hospitals and several ancillary facilities. A total of 161 health plan beneficiaries with diabetes identified during annual wellness screenings for the health plan in 2012 and 225 health plan beneficiaries with diabetes and/or hypertension identified during annual wellness screenings for the health plan in 2013 were referred to the MTM clinic based on specific criteria. In 2012 the health system expanded its existing wellness program by implementing a voluntary diabetes care program for health plan beneficiaries with uncontrolled diabetes (hemoglobin A(1c) [A1C] 7% or higher); a similar program was added for hypertension for the 2013 plan year. All participants' A1C and blood pressure results were tracked from the date of their wellness screening through the end of the plan year. The pharmacists involved had the capability to directly implement drug regimen changes according to hospital protocol or provide recommendations to the physician, as specified by the referring physician. For the 2012-2013 plan year, the mean difference in A1C from baseline to program completion was -0.38% (95% confidence interval [CI] -0.58 to -0.18%, p<0.05). For beneficiaries with a baseline A1C of 7% or higher, the mean difference was -0.69% (95% CI -0.99 to -0.39%, p<0.05). For the 2013-2014 plan year, the mean difference in A1C from baseline to program completion was -0.62% (95% CI -0.81 to -0.44%, p<0.05). In that year, the mean difference in A1C for beneficiaries with A1C 7% or higher was -0.97% (95% CI -1.23 to -0.72%, p<0.05). For those referred for hypertension, a mean difference of -13 mm Hg (95% CI -18.59 to -7.73, p<0.05) from baseline to program completion was seen in systolic blood pressure, and the mean difference in diastolic blood pressure was -7 mm Hg (95% CI -9.92 to -4.04, p<0.05). This study demonstrated that health plan beneficiaries who participated in the employer-sponsored, pharmacist-provided MTM program had significant decreases in A1C and blood pressure. © 2015 Pharmacotherapy Publications, Inc.

[Better multidisciplinary team meetings are linked to better care].

PubMed

van Drielen, Eveline; de Vries, Antoinette W; Ottevanger, P B Nelleke; Hermens, Rosella P M G

2012-01-01

Discussing a patient in an oncology multidisciplinary team meeting (MTM) increases the value of the quality of the treatment chosen. MTMs are increasingly mentioned in guidelines and indicator sets. Based on literature review and observations, the Comprehensive Cancer Centre Netherlands (CCCNL), in collaboration with IQ Healthcare and the Department of Medical Oncology of the UMC St Radboud Nijmegen in the Netherlands, has conducted research into the quality criteria for a good MTM. Two of our studies show that the organisation of MTMs can be significantly improved. Based on the results, we developed a checklist to accomplish this. The most significant areas of improvement for optimising the organisation of MTMs are: (a) the presence of specialists from all relevant disciplines; (b) a capable chairman who promotes the efficiency of the MTM; and (c) the reduction of intruding factors, such as mobile phones and participants who walk in and out.

Impact of an Elective Course on Pharmacy Students’ Attitudes, Beliefs, and Competency Regarding Medicare Part D

PubMed Central

Patel, Rajul A.; Thai, Huong K.; Phou, Christine M.; Walberg, Mark P.; Woelfel, Joseph A.; Carr-Lopez, Sian M.; Chan, Emily K.

2012-01-01

Objective. To determine the impact of an elective course on pharmacy students’ perceptions, knowledge, and confidence regarding Medicare Part D, medication therapy management (MTM), and immunizations. Design. Thirty-three pharmacy students were enrolled in a Medicare Part D elective course that included both classroom instruction and experiential training. Assessment. Students’ self-reported confidence in and knowledge of Part D significantly improved upon course completion. End-of-course student perceptions about the relative importance of various aspects of MTM interventions and their confidence in performing MTM services significantly improved from those at the beginning of the course. Students’ confidence in performing immunizations also increased significantly from the start of the course. Conclusion. A classroom course covering Medicare Part D with an experiential requirement serving beneficiaries can improve students’ attitudes and knowledge about Medicare Part D and their confidence in providing related services to beneficiaries in the community. PMID:22761532

Analyzing the costs to deliver medication therapy management services.

PubMed

Rupp, Michael T

2011-01-01

To provide pharmacy managers and consultant pharmacists with a step-by-step approach for analyzing of the costs of delivering medication therapy management (MTM) services and to describe use of a free online software application for determining costs of delivering MTM. The process described is applicable to community pharmacies and consultant pharmacists who provide MTM services from nonpharmacy settings. The PharmAccount Service Cost Calculator is an Internet- based software application that uses a guided online interview to collect information needed to conduct a comprehensive cost analysis of any specialized pharmacy service. In addition to direct variable and fixed costs, the software automatically allocates indirect and overhead costs to the service and generates an itemized report that details the components of service delivery costs. The service cost calculator is sufficiently flexible to support the analysis of virtually any specialized pharmacy service, irrespective of whether the service is being delivered from a physical pharmacy. The software application allows users to perform sensitivity analysis to quickly determine the potential impact that alternate scenarios would have on service delivery cost. It is therefore particularly well suited to assist in the design and planning of a new pharmacy service. Good management requires that the cost implications of service delivery decisions are known and considered. Analyzing the cost of an MTM service is an important step in developing a sustainable business model.

Medication therapy management and condition care services in a community-based employer setting.

PubMed

Johannigman, Mark J; Leifheit, Michael; Bellman, Nick; Pierce, Tracey; Marriott, Angela; Bishop, Cheryl

2010-08-15

A program in which health-system pharmacists and pharmacy technicians provide medication therapy management (MTM), wellness, and condition care (disease management) services under contract with local businesses is described. The health-system pharmacy department's Center for Medication Management contracts directly with company benefits departments for defined services to participating employees. The services include an initial wellness and MTM session and, for certain patients identified during the initial session, ongoing condition care. The initial appointment includes a medication history, point-of-care testing for serum lipids and glucose, body composition analysis, and completion of a health risk assessment. The pharmacist conducts a structured MTM session, reviews the patient's test results and risk factors, provides health education, discusses opportunities for cost savings, and documents all activities on the patient's medication action plan. Eligibility for the condition care program is based on a diagnosis of diabetes, hypertension, asthma, heart failure, or hyperlipidemia or elevation of lipid or glucose levels. Findings are summarized for employers after the initial wellness screening and at six-month intervals. Patients receiving condition care sign a customized contract, establish goals, attend up to four MTM sessions per year, and track their information on a website; employers may offer incentives for participation. When pharmacists recommend adjustments to therapy or cost-saving changes, it is up to patients to discuss these with their physician. A survey completed by each patient after the initial wellness session has indicated high satisfaction. Direct cost savings related to medication changes have averaged $253 per patient per year. Total cost savings to companies in the first year of the program averaged $1011 per patient. For the health system, the program has been financially sustainable. Key laboratory values indicate positive clinical outcomes. A business model in which health-system pharmacists provide MTM and condition care services for company employees has demonstrated successful outcomes in terms of patient satisfaction, cost savings, and clinical benefits.

Identification of a novel COL1A1 frameshift mutation, c.700delG, in a Chinese osteogenesis imperfecta family

PubMed Central

Wang, Xiran; Pei, Yu; Dou, Jingtao; Lu, Juming; Li, Jian; Lv, Zhaohui

2015-01-01

Osteogenesis imperfecta (OI) is a family of genetic disorders associated with bone loss and fragility. Mutations associated with OI have been found in genes encoding the type I collagen chains. People with OI type I often produce insufficient α1-chain type I collagen because of frameshift, nonsense, or splice site mutations in COL1A1 or COL1A2. This report is of a Chinese daughter and mother who had both experienced two bone fractures. Because skeletal fragility is predominantly inherited, we focused on identifying mutations in COL1A1 and COL1A2 genes. A novel mutation in COL1A1, c.700delG, was detected by genomic DNA sequencing in the mother and daughter, but not in their relatives. The identification of this mutation led to the conclusion that they were affected by mild OI type I. Open reading frame analysis indicated that this frameshift mutation would truncate α1-chain type I collagen at residue p263 (p.E234KfsX264), while the wild-type protein would contain 1,464 residues. The clinical data were consistent with the patients’ diagnosis of mild OI type I caused by haploinsufficiency of α1-chain type I collagen. Combined with previous reports, identification of the novel mutation COL1A1-c.700delG in these patients suggests that additional genetic and environmental factors may influence the severity of OI. PMID:25983617

Wild-type and mutated IDH1/2 enzymes and therapy responses.

PubMed

Molenaar, Remco J; Maciejewski, Jaroslaw P; Wilmink, Johanna W; van Noorden, Cornelis J F

2018-04-01

Isocitrate dehydrogenase 1 and 2 (IDH1/2) are key enzymes in cellular metabolism, epigenetic regulation, redox states, and DNA repair. IDH1/2 mutations are causal in the development and/or progression of various types of cancer due to supraphysiological production of D-2-hydroxyglutarate. In various tumor types, IDH1/2-mutated cancers predict for improved responses to treatment with irradiation or chemotherapy. The present review discusses the molecular basis of the sensitivity of IDH1/2-mutated cancers with respect to the function of mutated IDH1/2 in cellular processes and their interactions with novel IDH1/2-mutant inhibitors. Finally, lessons learned from IDH1/2 mutations for future clinical applications in IDH1/2 wild-type cancers are discussed.

Calreticulin mutation analysis in non-mutated Janus kinase 2 essential thrombocythemia patients in Chiang Mai University: analysis of three methods and clinical correlations.

PubMed

Rattarittamrong, Ekarat; Tantiworawit, Adisak; Kumpunya, Noppamas; Wongtagan, Ornkamon; Tongphung, Ratchanoo; Phusua, Arunee; Chai-Adisaksopha, Chatree; Hantrakool, Sasinee; Rattanathammethee, Thanawat; Norasetthada, Lalita; Charoenkwan, Pimlak; Lekawanvijit, Suree

2018-03-09

The primary objective was to determine the prevalence of calreticulin (CALR) mutation in patients with non-JAK2V617F mutated essential thrombocythemia (ET). The secondary objectives were to evaluate the accuracy of CALR mutation analysis by high-resolution melting (HRM) analysis and real-time polymerase chain reaction (PCR) compared with DNA sequencing and to compare clinical characteristics of CALR mutated and JAK2V617F mutated ET. This was a prospective cohort study involving ET patients registered at Chiang Mai University in the period September 2015-September 2017 who were aged more than 2 years, and did not harbor JAK2V617F mutation. The presence of CALR mutation was established by DNA sequencing, HRM, and real-time PCR for type 1 and type 2 mutation. Clinical data were compared with that from ET patients with mutated JAK2V617F. Twenty-eight patients were enrolled onto the study. CALR mutations were found in 10 patients (35.7%). Three patients had type 1 mutation, 5 patients had type 2 mutation, 1 patient had type 18 mutation, and 1 patients had novel mutations (c.1093 C-G, c.1098_1131 del, c.1135 G-A). HRM could differentiate between the types of mutation in complete agreement with DNA sequencing. Patients with a CALR mutation showed a significantly greater male predominance and had a higher platelet count when compared with 42 JAK2V617F patients. The prevalence of CALR mutation in JAK2V617F-negative ET in this study is 35.7%. HRM is an effective method of detecting CALR mutation and is a more advantageous method of screening for CALR mutation.

Muscle RAS oncogene homolog (MRAS) recurrent mutation in Borrmann type IV gastric cancer.

PubMed

Yasumoto, Makiko; Sakamoto, Etsuko; Ogasawara, Sachiko; Isobe, Taro; Kizaki, Junya; Sumi, Akiko; Kusano, Hironori; Akiba, Jun; Torimura, Takuji; Akagi, Yoshito; Itadani, Hiraku; Kobayashi, Tsutomu; Hasako, Shinichi; Kumazaki, Masafumi; Mizuarai, Shinji; Oie, Shinji; Yano, Hirohisa

2017-01-01

The prognosis of patients with Borrmann type IV gastric cancer (Type IV) is extremely poor. Thus, there is an urgent need to elucidate the molecular mechanisms underlying the oncogenesis of Type IV and to identify new therapeutic targets. Although previous studies using whole-exome and whole-genome sequencing have elucidated genomic alterations in gastric cancer, none has focused on comprehensive genetic analysis of Type IV. To discover cancer-relevant genes in Type IV, we performed whole-exome sequencing and genome-wide copy number analysis on 13 patients with Type IV. Exome sequencing identified 178 somatic mutations in protein-coding sequences or at splice sites. Among the mutations, we found a mutation in muscle RAS oncogene homolog (MRAS), which is predicted to cause molecular dysfunction. MRAS belongs to the Ras subgroup of small G proteins, which includes the prototypic RAS oncogenes. We analyzed an additional 46 Type IV samples to investigate the frequency of MRAS mutation. There were eight nonsynonymous mutations (mutation frequency, 17%), showing that MRAS is recurrently mutated in Type IV. Copy number analysis identified six focal amplifications and one homozygous deletion, including insulin-like growth factor 1 receptor (IGF1R) amplification. The samples with IGF1R amplification had remarkably higher IGF1R mRNA and protein expression levels compared with the other samples. This is the first report of MRAS recurrent mutation in human tumor samples. Our results suggest that MRAS mutation and IGF1R amplification could drive tumorigenesis of Type IV and could be new therapeutic targets. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

A New Mechanism of Sound Generation in Songbirds

NASA Astrophysics Data System (ADS)

Goller, Franz; Larsen, Ole N.

1997-12-01

Our current understanding of the sound-generating mechanism in the songbird vocal organ, the syrinx, is based on indirect evidence and theoretical treatments. The classical avian model of sound production postulates that the medial tympaniform membranes (MTM) are the principal sound generators. We tested the role of the MTM in sound generation and studied the songbird syrinx more directly by filming it endoscopically. After we surgically incapacitated the MTM as a vibratory source, zebra finches and cardinals were not only able to vocalize, but sang nearly normal song. This result shows clearly that the MTM are not the principal sound source. The endoscopic images of the intact songbird syrinx during spontaneous and brain stimulation-induced vocalizations illustrate the dynamics of syringeal reconfiguration before phonation and suggest a different model for sound production. Phonation is initiated by rostrad movement and stretching of the syrinx. At the same time, the syrinx is closed through movement of two soft tissue masses, the medial and lateral labia, into the bronchial lumen. Sound production always is accompanied by vibratory motions of both labia, indicating that these vibrations may be the sound source. However, because of the low temporal resolution of the imaging system, the frequency and phase of labial vibrations could not be assessed in relation to that of the generated sound. Nevertheless, in contrast to the previous model, these observations show that both labia contribute to aperture control and strongly suggest that they play an important role as principal sound generators.

A novel pathogenic mutation of the CYP27B1 gene in a patient with vitamin D-dependent rickets type 1: a case report.

PubMed

Babiker, Amir M I; Al Gadi, Iman; Al-Jurayyan, Nasir A M; Al Nemri, Abdulrahman M H; Al Haboob, Ali Abdu N; Al Boukai, Ahmed Amer; Al Zahrani, Ali; Habib, Hanan Ahmed

2014-11-05

Rickets can occur due to Vitamin D deficiency or defects in its metabolism. Three rare genetic types of rickets with different alterations of genes have been reported, including: Vitamin D dependent rickets type 1, Vitamin D dependent rickets type 2 or also known as Vitamin D resistant rickets and 25 hydroxylase deficiency rickets. Vitamin D dependent rickets type 1 is inherited in an autosomal recessive pattern, and is caused by mutations in the CYP27B1 gene encoding the 1α-hydroxylase enzyme. We report here a new mutation in CYP27B1, which lead to Vitamin D dependent rickets type 1. We report on a 13-month-old Arabic Saudi girl with Vitamin D dependent rickets type 1 presented with multiple fractures and classic features of rickets. A whole exome sequencing identified a novel pathogenic missense mutation (CYP27B1:Homozygous c.1510C > T(p.Q504X)) which results in a protein truncating alteration. Both parents are heterozygous carriers of the mutation. Based on data search in Human Gene Mutation Database, 63 CYP27B1 alterations were reported: only 28.6% are protein truncating (5 nonsense, 13 frameshift insertions/deletions, 0 gross deletions), while 61.9% are non-truncating (38 missense, 1 small in-frame insertions/deletion), and 9.5% are possible protein-truncating (5 splice, 1 regulatory). The deleterious effect of this alteration, which was the only mutation detected in the CYP27B1 common gene of Vitamin D dependent rickets type 1 in the proband, and its autosomal recessive inheritance fashion, both support a pathogenic nature of this mutation as the cause of Vitamin D dependent rickets type 1.

Genetic heterogeneity in patients with Bartter syndrome type 1

PubMed Central

Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo

2017-01-01

Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss-of-function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease-causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next-generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long-range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought. PMID:28000888

Genetic heterogeneity in patients with Bartter syndrome type 1.

PubMed

Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo

2017-02-01

Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss‑of‑function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease‑causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next‑generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long‑range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought.

Genetic heterogeneity in type 1 Gaucher disease: Multiple genotypes in Ashkenazic and non-Ashkenazic individuals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsuji, Shoji; Martin, B.M.; Stubblefield, B.K.

1988-04-01

Nucleotide sequence analysis of a genomic clone from an Ashkenazic Jewish patient with type 1 Gaucher disease revealed a single-base mutation (adenosine to guanosine transition) in exon 9 of the glucocerebrosidase gene. This change results in the amino acid substitution of serine for asparagine. Transient expression studies following oligonucleotide-directed mutagenesis of the normal cDNA confirmed that the mutation results in loss of glucocerebrosidase activity. Allele-specific hybridization with oligonucleotide probes demonstrated that this mutation was found exclusively in type 1 phenotype. None of the 6 type 2 patients, 11 type 3 patients, or 12 normal controls had this allele. In contrast,more » 15 of 24 type 1 patients had one allele with this mutation, and 3 others were homozygous for the mutation. Furthermore, some of the Ashkenazic Jewish type 1 patients had only one allele with this mutation, suggesting that even in this population there is allelic heterozygosity. These findings indicate that there are multiple allelic mutations responsible for type 1 Gaucher disease in both the Jewish and non-Jewish populations. Allelic-specific hybridization demonstrating this mutation in exon 9, used in conjunction with the Nci I restriction fragment length polymorphism described as a marker for neuronopathic Gaucher disease, provides a tool for diagnosis and genetic counseling that is {approx}80% informative in all Gaucher patients studied.« less

Mutation screening of INS and KCNJ11 genes in Taiwanese children with type 1B diabetic onset before the age of 5 years.

PubMed

Lo, Fu-Sung

2018-01-17

Type 1 diabetes (T1D) is caused by β-cell destruction, usually leading to absolute insulin deficiency. T1D is a heterogeneous disease and is divided into two subtypes according to the presence or absence of pancreatic autoantibodies: type 1A (immune mediated) and type 1B (idiopathic). Genes such as KCNJ11 or INS, which play key roles in β-cell function, provide some insight into the pathogenesis of type 1B diabetes. In this study, we screened 110 Taiwanese children (61 males and 49 females) with T1D onset before the age of 5 years for mutations of INS and KCNJ11. We identified one missense heterozygous mutation in KCNJ11 (c.989A>G, p.Y330C) and no INS mutations among 28 probands. This is the first study to screen patients with autoantibody-negative T1D diagnosed before the age of 5 years for INS and KCNJ11 mutations in Taiwan. Although KCNJ11 mutations are always reported in patients with permanent neonatal diabetes, this gene mutation can be detected after 6 months of age. Further studies in other patients with type 1B diabetes and their families are required to elucidate the contributions of the KCNJ11 mutation to the T1D phenotype. Copyright © 2018. Published by Elsevier B.V.

Mutations Affecting G-Protein Subunit α11 in Hypercalcemia and Hypocalcemia

PubMed Central

Babinsky, Valerie N.; Head, Rosie A.; Cranston, Treena; Rust, Nigel; Hobbs, Maurine R.; Heath, Hunter; Thakker, Rajesh V.

2013-01-01

BACKGROUND Familial hypocalciuric hypercalcemia is a genetically heterogeneous disorder with three variants: types 1, 2, and 3. Type 1 is due to loss-of-function mutations of the calcium-sensing receptor, a guanine nucleotide–binding protein (G-protein)–coupled receptor that signals through the G-protein subunit α11 (Gα11). Type 3 is associated with adaptor-related protein complex 2, sigma 1 subunit (AP2S1) mutations, which result in altered calcium-sensing receptor endocytosis. We hypothesized that type 2 is due to mutations effecting Gα11 loss of function, since Gα11 is involved in calcium-sensing receptor signaling, and its gene (GNA11) and the type 2 locus are colocalized on chromosome 19p13.3. We also postulated that mutations effecting Gα11 gain of function, like the mutations effecting calcium-sensing receptor gain of function that cause autosomal dominant hypocalcemia type 1, may lead to hypocalcemia. METHODS We performed GNA11 mutational analysis in a kindred with familial hypocalciuric hypercalcemia type 2 and in nine unrelated patients with familial hypocalciuric hypercalcemia who did not have mutations in the gene encoding the calcium-sensing receptor (CASR) or AP2S1. We also performed this analysis in eight unrelated patients with hypocalcemia who did not have CASR mutations. In addition, we studied the effects of GNA11 mutations on Gα11 protein structure and calcium-sensing receptor signaling in human embryonic kidney 293 (HEK293) cells. RESULTS The kindred with familial hypocalciuric hypercalcemia type 2 had an in-frame deletion of a conserved Gα11 isoleucine (Ile200del), and one of the nine unrelated patients with familial hypocalciuric hypercalcemia had a missense GNA11 mutation (Leu135Gln). Missense GNA11 mutations (Arg181Gln and Phe341Leu) were detected in two unrelated patients with hypocalcemia; they were therefore identified as having autosomal dominant hypocalcemia type 2. All four GNA11 mutations predicted disrupted protein structures, and assessment on the basis of in vitro expression showed that familial hypocalciuric hypercalcemia type 2–associated mutations decreased the sensitivity of cells expressing calcium-sensing receptors to changes in extracellular calcium concentrations, whereas autosomal dominant hypocalcemia type 2–associated mutations increased cell sensitivity. CONCLUSIONS Gα11 mutants with loss of function cause familial hypocalciuric hypercalcemia type 2, and Gα11 mutants with gain of function cause a clinical disorder designated as autosomal dominant hypocalcemia type 2. (Funded by the United Kingdom Medical Research Council and others.) PMID:23802516

Identification and functional analysis of CBLB mutations in type 1 diabetes.

PubMed

Yokoi, Norihide; Fujiwara, Yuuka; Wang, He-Yao; Kitao, Mai; Hayashi, Chihiro; Someya, Tomohiro; Kanamori, Masao; Oiso, Yutaka; Tajima, Naoko; Yamada, Yuichiro; Seino, Yutaka; Ikegami, Hiroshi; Seino, Susumu

2008-03-28

Casitas B-lineage lymphoma b (Cblb) is a negative regulator of T-cell activation and dysfunction of Cblb in rats and mice results in autoimmunity. In particular, a nonsense mutation in Cblb has been identified in a rat model of autoimmune type 1 diabetes. To clarify the possible involvement of CBLB mutation in type 1 diabetes in humans, we performed mutation screening of CBLB and characterized functional properties of the mutations in Japanese subjects. Six missense mutations (A155V, F328L, N466D, K837R, T882A, and R968L) were identified in one diabetic subject each, excepting N466D. Of these mutations, F328L showed impaired suppression of T-cell activation and was a loss-of-function mutation. These data suggest that the F328L mutation is involved in the development of autoimmune diseases including type 1 diabetes, and also provide insight into the structure-function relationship of CBLB protein.

VizieR Online Data Catalog: MV Lyr - bursts and periods (Pavlenko, 1998)

NASA Astrophysics Data System (ADS)

Pavlenko, E. P.

2001-01-01

The analysis of photometric behavior of the nova-like star MV Lyr in B in the low brightness state in 1995-1996 based on the observations performed at the Crimean Astrophysical Observatory with the MTM-500 television system was presented. (1 data file).

Prenatal diagnosis of fetal glutaric aciduria type 1 with rare compound heterozygous mutations in GCDH gene.

PubMed

Peng, Hsiu-Huei; Shaw, Sheng-Wen; Huang, Kuan-Gen

2018-02-01

Glutaric aciduria type 1 is a rare disease, with the estimated prevalence about 1 in 100,000 newborns. GCDH gene mutation can lead to glutaric acid and 3- OH glutaric acid accumulation, with clinical manifestation of neuronal damage, brain atrophy, microencephalic macrocephaly, decreased coordination of swallowing, poor muscle coordination, spasticity, and severe dystonic movement disorder. A 22-year-old female, Gravida 4 Para 2, is pregnancy at 13 weeks of gestational age. Her first child is normal, however, the second child was diagnosed as glutaric aciduria type I after birth. She came to our hospital for prenatal genetic counselling of her fetus at 13 weeks of gestational age. We performed GCDH gene mutation analysis of maternal blood showed IVS 3 + 1 G > A heterozygous mutation, GCDH gene mutation analysis of paternal blood showed c. 1240 G > A heterozygous mutation, and the second child has compound heterozygous IVS 3 + 1 G > A and c. 1240 G > A mutations. Later, we performed amniocentesis at 16 weeks of gestational age for chromosome study and GCDH gene mutation analysis for the fetus. The fetal chromosome study showed normal karyotype, however, GCDH gene mutation analysis showed compound heterozygous IVS 3 + 1 G > A and c. 1240 G > A mutations. The couple decided to termination of pregnancy thereafter. Glutaric acidemia type 1 is an autosomal recessive disorder because of pathogenic mutations in the GCDH gene. Early diagnosis and therapy of glutaric acidemia type 1 can reduce the risk of neuronal damage and acute dystonia. We report a case of prenatal diagnosis of fetal glutaric aciduria type 1 with rare compound heterozygous GCDH gene mutation at IVS 3 + 1 G > A and c. 1240 G > A mutations, which provide better genetic counselling for the couples. Copyright © 2018. Published by Elsevier B.V.

Multiple endocrine neoplasia type 1: analysis of germline MEN1 mutations in the Italian multicenter MEN1 patient database.

PubMed

Marini, Francesca; Giusti, Francesca; Fossi, Caterina; Cioppi, Federica; Cianferotti, Luisella; Masi, Laura; Boaretto, Francesca; Zovato, Stefania; Cetani, Filomena; Colao, Annamaria; Davì, Maria Vittoria; Faggiano, Antongiulio; Fanciulli, Giuseppe; Ferolla, Piero; Ferone, Diego; Loli, Paola; Mantero, Franco; Marcocci, Claudio; Opocher, Giuseppe; Beck-Peccoz, Paolo; Persani, Luca; Scillitani, Alfredo; Guizzardi, Fabiana; Spada, Anna; Tomassetti, Paola; Tonelli, Francesco; Brandi, Maria Luisa

2018-03-01

Multiple endocrine neoplasia type 1 (MEN1) is caused by germline inactivating mutations of the MEN1 gene. Currently, no direct genotype-phenotype correlation is identified. We aim to analyze MEN1 mutation site and features, and possible correlations between the mutation type and/or the affected menin functional domain and clinical presentation in patients from the Italian multicenter MEN1 database, one of the largest worldwide MEN1 mutation series published to date. The study included the analysis of MEN1 mutation profile in 410 MEN1 patients [370 familial cases from 123 different pedigrees (48 still asymptomatic at the time of this study) and 40 single cases]. We identified 99 different mutations: 41 frameshift [small intra-exon deletions (28) or insertions (13)], 13 nonsense, 26 missense and 11 splicing site mutations, 4 in-frame small deletions, and 4 intragenic large deletions spanning more than one exon. One family had two different inactivating MEN1 mutations on the same allele. Gastro-entero-pancreatic tumors resulted more frequent in patients with a nonsense mutation, and thoracic neuroendocrine tumors in individuals bearing a splicing-site mutation. Our data regarding mutation type frequency and distribution are in accordance with previously published data: MEN1 mutations are scattered through the entire coding region, and truncating mutations are the most common in MEN1 syndrome. A specific direct correlation between MEN1 genotype and clinical phenotype was not found in all our families, and wide intra-familial clinical variability and variable disease penetrance were both confirmed, suggesting a role for modifying, still undetermined, factors, explaining the variable MEN1 tumorigenesis.

The contribution of the SPINK1 c.194+2T>C mutation to the clinical course of idiopathic chronic pancreatitis in Chinese patients.

PubMed

Sun, Chang; Liao, Zhuan; Jiang, Lili; Yang, Fu; Xue, Geng; Zhou, Qi; Chen, Ruiwen; Sun, Shuhan; Li, Zhaoshen

2013-01-01

Recent data suggest that the serine protease inhibitor Kazal type 1 (SPINK1) gene mutation is associated with idiopathic chronic pancreatitis. However, few studies have focused on the serine protease inhibitor Kazal type 1 c.194+2T>C mutation. Therefore, our goal was to study the prevalence and impact of serine protease inhibitor Kazal type 1 mutations on the clinical profile of idiopathic chronic pancreatitis patients in China. A retrospective-cohort study of 118 Chinese patients with idiopathic chronic pancreatitis was performed, and genetic tests were carried out to detect SPINK1 mutations. Subjects without pancreatitis were used as controls. In total, 118 idiopathic chronic pancreatitis patients and 100 control subjects were evaluated. The serine protease inhibitor Kazal type 1 c.194+2T>C variant was present in 44.9% of patients with idiopathic chronic pancreatitis. The frequency of diabetes in idiopathic chronic pancreatitis patients with the serine protease inhibitor Kazal type 1 c.194+2T>C mutation (39.6%) was higher than that of patients without the mutation (9.2%). The time to occurrence of diabetes mellitus after idiopathic chronic pancreatitis symptom onset is significantly influenced by the c.194+2T>C mutation (p<0.001). In addition, the mean age of diabetes onset in patients with the serine protease inhibitor Kazal type 1 c.194+2T>C mutation (38.33 ± 9.50) was significantly younger than that of patients without this mutation (49.67 ± 6.74). The presence of the serine protease inhibitor Kazal type 1 c.194+2T>C mutation seems to be associated with idiopathic chronic pancreatitis and could predispose individuals to pancreatic diabetes onset at an earlier age. Copyright © 2012 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

Patient-centered health care using pharmacist-delivered medication therapy management in rural Mississippi.

PubMed

Ross, Leigh Ann; Bloodworth, Lauren S

2012-01-01

To describe and provide preliminary clinical and economic outcomes from a pharmacist-delivered patient-centered health care (PCHC) model implemented in the Mississippi Delta. Mississippi between July 2008 and June 2010. 13 community pharmacies in nine Mississippi Delta counties. This PCHC model implements a comprehensive medication therapy management (MTM) program with pharmacist training, individualized patient encounters and group education, provider outreach, integration of pharmacists into health information technology, and on-site support in community pharmacies in a medically underserved region with a large burden of chronic disease and health disparities. The program also expands on traditional MTM services through initiatives in health literacy/cultural competency and efforts to increase the provider network and improve access to care. Criteria-based clinical outcomes, quality indicator reports, cost avoidance. PCHC services have been implemented in 13 pharmacies in nine counties in this underserved region, and 78 pharmacists and 177 students have completed the American Pharmacists Association's MTM Certificate Training Program. Preliminary data from 468 patients showed 681 encounters in which 1,471 drug therapy problems were identified and resolved. Preliminary data for clinical indicators and economic outcome measures are trending in a positive direction. Preliminary data analyses suggest that pharmacist-provided PCHC is beneficial and has the potential to be replicated in similar rural communities that are plagued with chronic disease and traditional primary care provider shortages. This effort aligns with national priorities to reduce medication errors, improve health outcomes, and reduce health care costs in underserved communities.

Integrating pharmacogenomics into pharmacy practice via medication therapy management.

PubMed

Reiss, Susan M

2011-01-01

To explore the application and integration of pharmacogenomics in pharmacy clinical practice via medication therapy management (MTM) to improve patient care. Department of Health & Human Services (HHS) Personalized Health Care Initiative, Food and Drug Administration (FDA) pharmacogenomics activity, and findings from the Utilizing E-Prescribing Technologies to Integrate Pharmacogenomics into Prescribing and Dispensing Practices Stakeholder Workshop, convened by the American Pharmacists Association (APhA) on March 5, 2009. Participants at the Stakeholder Workshop included diverse representatives from pharmacy, medicine, pathology, health information technology (HIT), standards, science, academia, government, and others with a key interest in the clinical application of pharmacogenomics. In 2006, HHS initiated the Personalized Health Care Initiative with the goal of building the foundation for the delivery of gene-based care, which may prove to be more effective for large patient subpopulations. In the years since the initiative was launched, drug manufacturers and FDA have begun to incorporate pharmacogenomic data and applications of this information into the drug development, labeling, and approval processes. New applications and processes for using this emerging pharmacogenomics data are needed to effectively integrate this information into clinical practice. Building from the findings of a stakeholder workshop convened by APhA and the advancement of the pharmacist's collaborative role in patient care through MTM, emerging roles for pharmacists using pharmacogenomic information to improve patient care are taking hold. Realizing the potential role of the pharmacist in pharmacogenomics through MTM will require connectivity of pharmacists into the electronic health record infrastructure to permit the exchange of pertinent health information among all members of a patient's health care team. Addressing current barriers, concerns, and system limitations and developing an effective infrastructure will be necessary for pharmacogenomics to achieve its true potential. To achieve integration of pharmacogenomics into clinical practice via MTM, the pharmacy profession must define a process for the application of pharmacogenomic data into pharmacy clinical practice that is aligned with MTM service delivery, develop a viable business model for these practices, and encourage and direct the development of HIT solutions that support the pharmacist's role in this emerging field.

Mutations of maturity-onset diabetes of the young (MODY) genes in Thais with early-onset type 2 diabetes mellitus.

PubMed

Plengvidhya, Nattachet; Boonyasrisawat, Watip; Chongjaroen, Nalinee; Jungtrakoon, Prapaporn; Sriussadaporn, Sutin; Vannaseang, Sathit; Banchuin, Napatawn; Yenchitsomanus, Pa-thai

2009-06-01

Six known genes responsible for maturity-onset diabetes of the young (MODY) were analysed to evaluate the prevalence of their mutations in Thai patients with MODY and early-onset type 2 diabetes. Fifty-one unrelated probands with early-onset type 2 diabetes, 21 of them fitted into classic MODY criteria, were analysed for nucleotide variations in promoters, exons, and exon-intron boundaries of six known MODY genes, including HNF-4alpha, GCK, HNF-1alpha, IPF-1, HNF-1beta, and NeuroD1/beta2, by the polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) method followed by direct DNA sequencing. Missense mutations or mutations located in regulatory region, which were absent in 130 chromosomes of non-diabetic controls, were classified as potentially pathogenic mutations. We found that mutations of the six known MODY genes account for a small proportion of classic MODY (19%) and early-onset type 2 diabetes (10%) in Thais. Five of these mutations are novel including GCK R327H, HNF-1alpha P475L, HNF-1alphaG554fsX556, NeuroD1-1972 G > A and NeuroD1 A322N. Mutations of IPF-1 and HNF-1beta were not identified in the studied probands. Mutations of the six known MODY genes may not be a major cause of MODY and early-onset type 2 diabetes in Thais. Therefore, unidentified genes await discovery in a majority of Thai patients with MODY and early-onset type 2 diabetes.

High power long pulse microwave generation from a metamaterial structure with reverse symmetry

NASA Astrophysics Data System (ADS)

Lu, Xueying; Stephens, Jacob C.; Mastovsky, Ivan; Shapiro, Michael A.; Temkin, Richard J.

2018-02-01

Experimental operation of a high power microwave source with a metamaterial (MTM) structure is reported at power levels to 2.9 MW at 2.4 GHz in full 1 μs pulses. The MTM structure is formed by a waveguide that is below cutoff for TM modes. The waveguide is loaded by two axial copper plates machined with complementary split ring resonators, allowing two backward wave modes to propagate in the S-Band. A pulsed electron beam of up to 490 kV, 84 A travels down the center of the waveguide, midway between the plates. The electron beam is generated by a Pierce gun and is focused by a lens into a solenoidal magnetic field. The MTM plates are mechanically identical but are placed in the waveguide with reverse symmetry. Theory indicates that both Cherenkov and Cherenkov-cyclotron beam-wave interactions can occur. High power microwave generation was studied by varying the operating parameters over a wide range, including the electron beam voltage, the lens magnetic field, and the solenoidal field. Frequency tuning with a magnetic field and beam voltage was studied to discriminate between operation in the Cherenkov mode and the Cherenkov-cyclotron mode. Both modes were observed, but pulses above 1 MW of output power were only seen in the Cherenkov-cyclotron mode. A pair of steering coils was installed prior to the interaction space to initiate the cyclotron motion of the electron beam and thus encourage the Cherenkov-cyclotron high power mode. This successfully increased the output power from 2.5 MW to 2.9 MW (450 kV, 74 A, 9% efficiency).

Factors associated with independent pharmacy owners' satisfaction with Medicare Part D contracts.

PubMed

Zhang, Su; Doucette, William R; Urmie, Julie M; Xie, Yang; Brooks, John M

2010-06-01

As Medicare Part D contracts apply pressure on the profitability of independent pharmacies, there is concern about their owners' willingness to sign such contracts. Identifying factors affecting independent pharmacy owners' satisfaction with Medicare Part D contracts could inform policy makers in managing Medicare Part D. (1) To identify influences on independent pharmacy owners' satisfaction with Medicare Part D contracts and (2) to characterize comments made by independent pharmacy owners about Medicare Part D. This cross-sectional study used a mail survey of independent pharmacy owners in 15 states comprising 6 Medicare regions to collect information on their most- and least-favorable Medicare Part D contracts, including satisfaction, contract management activities, market position, pharmacy operation, and specific payment levels on brand and generic drugs. Of the 1649 surveys mailed, 296 surveys were analyzed. The regression models for satisfaction with both the least and the most-favorable Part D contracts were significant (P<0.05). A different set of significant influences on satisfaction was identified for each regression model. For the most-favorable contract, influences were contending and equity. For the least-favorable contract, influences were negotiation, equity, generic rate bonus, and medication therapy management (MTM) payment. About one-third of the survey respondents made at least 1 comment. The most frequent themes in the comments were that Medicare Part D reimbursement rate is too low (28%) and that contracts are offered without negotiation in a "take it or leave it" manner (20%). Equity, contending, negotiation, generic rate bonus, and MTM payments were identified as the influences of independent pharmacy owners' satisfaction toward Medicare Part D contracts. Generic rate bonus and MTM payment provide additional financial incentives to less financially favorable contracts and, in turn, contribute to independent pharmacy owner's satisfaction toward these contracts. Copyright 2010 Elsevier Inc. All rights reserved.

Development of a Selective Culture Medium for Primary Isolation of the Main Brucella Species▿

PubMed Central

De Miguel, M. J.; Marín, C. M.; Muñoz, P. M.; Dieste, L.; Grilló, M. J.; Blasco, J. M.

2011-01-01

Bacteriological diagnosis of brucellosis is performed by culturing animal samples directly on both Farrell medium (FM) and modified Thayer-Martin medium (mTM). However, despite inhibiting most contaminating microorganisms, FM also inhibits the growth of Brucella ovis and some B. melitensis and B. abortus strains. In contrast, mTM is adequate for growth of all Brucella species but only partially inhibitory for contaminants. Moreover, the performance of both culture media for isolating B. suis has never been established properly. We first determined the performance of both media for B. suis isolation, proving that FM significantly inhibits B. suis growth. We also determined the susceptibility of B. suis to the antibiotics contained in both selective media, proving that nalidixic acid and bacitracin are highly inhibitory, thus explaining the reduced performance of FM for B. suis isolation. Based on these results, a new selective medium (CITA) containing vancomycin, colistin, nystatin, nitrofurantoin, and amphotericin B was tested for isolation of the main Brucella species, including B. suis. CITA's performance was evaluated using reference contaminant strains but also field samples taken from brucella-infected animals or animals suspected of infection. CITA inhibited most contaminant microorganisms but allowed the growth of all Brucella species, to levels similar to those for both the control medium without antibiotics and mTM. Moreover, CITA medium was more sensitive than both mTM and FM for isolating all Brucella species from field samples. Altogether, these results demonstrate the adequate performance of CITA medium for the primary isolation of the main Brucella species, including B. suis. PMID:21270216

Improving the economic and humanistic outcomes for diabetic patients: making a case for employer-sponsored medication therapy management

PubMed Central

Pinto, Sharrel L; Kumar, Jinender; Partha, Gautam; Bechtol, Robert A

2013-01-01

Background The purpose of this study was to determine the cost savings of a pharmacist-led, employer-sponsored medication therapy management (MTM) program for diabetic patients and to assess for any changes in patient satisfaction and self-reported medication adherence for enrollees. Methods Participants in this study were enrollees of an employer-sponsored MTM program. They were included if their primary medical insurance and prescription coverage was from the City of Toledo, they had a diagnosis of type 2 diabetes, and whether or not they had been on medication or had been given a new prescription for diabetes treatment. The data were analyzed on a prospective, pre-post longitudinal basis, and tracked for one year following enrollment. Outcomes included economic costs, patient satisfaction, and self-reported patient adherence. Descriptive statistics were used to characterize the population, calculate the number of visits, and determine the mean costs for each visit. Friedman’s test was used to determine changes in outcomes due to the nonparametric nature of the data. Results The mean number of visits to a physician’s office decreased from 10.22 to 7.07. The mean cost of these visits for patients increased from $47.70 to $66.41, but use of the emergency room and inpatient visits decreased by at least 50%. Employer spending on emergency room visits decreased by $24,214.17 and inpatient visit costs decreased by $166,610.84. Office visit spending increased by $11,776.41. A total cost savings of $179,047.80 was realized by the employer at the end of the program. Significant improvements in patient satisfaction and adherence were observed. Conclusion Pharmacist interventions provided through the employer-sponsored MTM program led to substantial cost savings to the employer with improved patient satisfaction and adherence on the part of employees at the conclusion of the program. PMID:23610526

Mutation Analysis of IDH1/2 Genes in Unselected De novo Acute Myeloid Leukaemia Patients in India - Identification of A Novel IDH2 Mutation.

PubMed

Raveendran, Sureshkumar; Sarojam, Santhi; Vijay, Sangeetha; Geetha, Aswathy Chandran; Sreedharan, Jayadevan; Narayanan, Geetha; Sreedharan, Hariharan

2015-01-01

IDH1/2 mutations which result in alternation in DNA methylation pattern are one of the most common methylation associated mutations in Acute myeloid leukaemia. IDH1/2 mutations frequently associated with higher platelet level, normal cytogentics and NPM1 mutations. Here we analyzed IDH1/2 mutations in 200 newly diagnosed unselected Indian adult AML patients and investigated their correlation with clinical, cytogenetic parameters along with cooperating NPM1 mutation. We detected 5.5% and 4% mutations in IDH1/2 genes, respectively. Except IDH2 c.515_516GG>AA mutation, all the other identified mutations were reported mutations. Similar to reported c.515G>A mutation, the novel c.515_516GG>AA mutation replaces 172nd arginine to lysine in the active site of the enzyme. Even though there was a preponderance of IDH1/2 mutations in NK-AML, cytogenetically abnormal patients also harboured IDH1/2 mutations. IDH1 mutations showed significant higher platelet count and NPM1 mutations. IDH2 mutated patients displayed infrequent NPM1 mutations and lower WBC count. All the NPM1 mutations in the IDH1/2 mutated cases showed type A mutation. The present data suggest that IDH1/2 mutations are associated with normal cytogenetics and type A NPM1 mutations in adult Indian AML patients.

Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

PubMed

Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

2008-05-01

Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

Hereditary Angioedema Due to C1 Inhibitor Deficiency in Serbia: Two Novel Mutations and Evidence of Genotype-Phenotype Association

PubMed Central

Andrejević, Slađana; Korošec, Peter; Šilar, Mira; Košnik, Mitja; Mijanović, Radovan; Bonači-Nikolić, Branka; Rijavec, Matija

2015-01-01

Hereditary angioedema due to C1 inhibitor deficiency (C1-INH-HAE) is a rare autosomal dominant disease characterized by recurrent life-threatening oedemas and/or abdominal pain and caused by mutations affecting the C1 inhibitor gene, SERPING1. We sought to investigate the spectrum of SERPING1 mutations in Serbia and the possible genotype-phenotype association. C1-INH-HAE was diagnosed on the basis of clinical and laboratory criteria in 40 patients from 27 families; four were asymptomatic. Mutational analysis of the SERPING1 gene was performed by sequencing and multiplex ligation-dependent probe amplification. Disease-causing mutations in SERPING1 were identified in all patients. In C1-INH-HAE type I, we identified 19 different mutations, including 6 missense mutations, 6 nonsense mutations, 2 small deletions, 1 small insertion, 2 splicing defects and 2 large deletions. Two of the mutations (c.300C>T and c.1184_1185insTA) are reported here for the first time. All C1-INH-HAE type II patients from three families harboured the same substitution (c.1396C>T). Based on the type of mutation identified in the SERPING1 gene, patients were divided into two groups: group 1 (nonsense, frameshift, large deletions/insertions, splicing defect, and mutations at Arg444) or group 2 (missense, excluding mutations at Arg444). Significant differences were found in the clinical severity score (P = 0.005), prevalence of laryngeal (P = 0.040) and facial (P = 0.013) oedema, and long-term prophylaxis (P = 0.023) between the groups with different types of mutations. Because our population consisted of related subjects, differences in the severity score between mutation groups were further confirmed using the generalized estimating equation (P = 0.038). Our study identified 20 different disease-causing mutations, including two novel mutations, in all C1-INH-HAE patients, highlighting the heterogeneity of mutations in the SERPING1 gene. Furthermore, it appears that mutations with a clear effect on C1-INH function might be responsible for a more severe disease phenotype. PMID:26535898

Hereditary Angioedema Due to C1 Inhibitor Deficiency in Serbia: Two Novel Mutations and Evidence of Genotype-Phenotype Association.

PubMed

Andrejević, Slađana; Korošec, Peter; Šilar, Mira; Košnik, Mitja; Mijanović, Radovan; Bonači-Nikolić, Branka; Rijavec, Matija

2015-01-01

Hereditary angioedema due to C1 inhibitor deficiency (C1-INH-HAE) is a rare autosomal dominant disease characterized by recurrent life-threatening oedemas and/or abdominal pain and caused by mutations affecting the C1 inhibitor gene, SERPING1. We sought to investigate the spectrum of SERPING1 mutations in Serbia and the possible genotype-phenotype association. C1-INH-HAE was diagnosed on the basis of clinical and laboratory criteria in 40 patients from 27 families; four were asymptomatic. Mutational analysis of the SERPING1 gene was performed by sequencing and multiplex ligation-dependent probe amplification. Disease-causing mutations in SERPING1 were identified in all patients. In C1-INH-HAE type I, we identified 19 different mutations, including 6 missense mutations, 6 nonsense mutations, 2 small deletions, 1 small insertion, 2 splicing defects and 2 large deletions. Two of the mutations (c.300C>T and c.1184_1185insTA) are reported here for the first time. All C1-INH-HAE type II patients from three families harboured the same substitution (c.1396C>T). Based on the type of mutation identified in the SERPING1 gene, patients were divided into two groups: group 1 (nonsense, frameshift, large deletions/insertions, splicing defect, and mutations at Arg444) or group 2 (missense, excluding mutations at Arg444). Significant differences were found in the clinical severity score (P = 0.005), prevalence of laryngeal (P = 0.040) and facial (P = 0.013) oedema, and long-term prophylaxis (P = 0.023) between the groups with different types of mutations. Because our population consisted of related subjects, differences in the severity score between mutation groups were further confirmed using the generalized estimating equation (P = 0.038). Our study identified 20 different disease-causing mutations, including two novel mutations, in all C1-INH-HAE patients, highlighting the heterogeneity of mutations in the SERPING1 gene. Furthermore, it appears that mutations with a clear effect on C1-INH function might be responsible for a more severe disease phenotype.

DNA sequence analysis in 598 individuals with a clinical diagnosis of osteogenesis imperfecta: diagnostic yield and mutation spectrum.

PubMed

Bardai, G; Moffatt, P; Glorieux, F H; Rauch, F

2016-12-01

We detected disease-causing mutations in 585 of 598 individuals (98 %) with typical features of osteogenesis imperfecta (OI). In mild OI, only collagen type I encoding genes were involved. In moderate to severe OI, mutations in 12 different genes were found; 11 % of these patients had mutations in recessive genes. OI is usually caused by mutations in COL1A1 or COL1A2, the genes encoding collagen type I alpha chains, but mutations in at least 16 other genes have also been associated with OI. It is presently unknown what proportion of individuals with clinical features of OI has a disease-causing mutation in one of these genes. DNA sequence analysis was performed on 598 individuals from 487 families who had a typical OI phenotype. OI type I was diagnosed in 43 % of individuals, and 57 % had moderate to severe OI, defined as OI types other than type I. Disease-causing variants were detected in 97 % of individuals with OI type I and in 99 % of patients with moderate to severe OI. All mutations found in OI type I were dominant and exclusively affected COL1A1 or COL1A2. In moderate to severe OI, dominant mutations were found in COL1A1/COL1A2 (77 %), IFITM5 (9 %), and P4HB (0.6 %). Mutations in one of the recessive OI-associated gene were observed in 12 % of individuals with moderate to severe OI. The genes most frequently involved in recessive OI were SERPINF1 (4.0 % of individuals with moderate to severe OI) and CRTAP (2.9 %). DNA sequence analysis of currently known OI-associated genes identifies disease-causing variants in almost all individuals with a typical OI phenotype. About 20 % of individuals with moderate to severe OI had mutations in genes other than COL1A1/COL1A2.

MLH1-deficient Colorectal Carcinoma With Wild-type BRAF and MLH1 Promoter Hypermethylation Harbor KRAS Mutations and Arise From Conventional Adenomas.

PubMed

Farchoukh, Lama; Kuan, Shih-Fan; Dudley, Beth; Brand, Randall; Nikiforova, Marina; Pai, Reetesh K

2016-10-01

Between 10% and 15% of colorectal carcinomas demonstrate sporadic DNA mismatch-repair protein deficiency as a result of MLH1 promoter methylation and are thought to arise from sessile serrated adenomas, termed the serrated neoplasia pathway. Although the presence of the BRAF V600E mutation is indicative of a sporadic cancer, up to 30% to 50% of colorectal carcinomas with MLH1 promoter hypermethylation will lack a BRAF mutation. We report the clinicopathologic and molecular features of MLH1-deficient colorectal carcinoma with wild-type BRAF and MLH1 promoter hypermethylation (referred to as MLH1-hypermethylated BRAF wild-type colorectal carcinoma, n=36) in comparison with MLH1-deficient BRAF-mutated colorectal carcinoma (n=113) and Lynch syndrome-associated colorectal carcinoma (n=36). KRAS mutations were identified in 31% of MLH1-hypermethylated BRAF wild-type colorectal carcinomas compared with 0% of MLH1-deficient BRAF-mutated colorectal carcinomas and 37% of Lynch syndrome-associated colorectal carcinomas. When a precursor polyp was identified, MLH1-hypermethylated BRAF wild-type colorectal carcinomas arose from precursor polyps resembling conventional tubular/tubulovillous adenomas in contrast to MLH1-deficient BRAF-mutated colorectal carcinomas, which arose from precursor sessile serrated adenomas (P<0.001). Both MLH1-hypermethylated BRAF wild-type colorectal carcinoma and MLH1-deficient BRAF-mutated colorectal carcinoma had a predilection for the right colon compared with Lynch syndrome-associated colorectal carcinoma (86% vs. 92% vs. 49%, P<0.001). There was no significant difference in mucinous differentiation, tumor-infiltrating lymphocytes, Crohn-like reaction, and medullary differentiation between the 3 tumor groups. Using Kaplan-Meier survival functions, there was no significant difference in disease-specific survival between the 3 patient groups (P>0.05). In conclusion, our results indicate that MLH1-hypermethylated BRAF wild-type colorectal carcinomas can harbor KRAS mutations and arise from precursor polyps resembling conventional tubular/tubulovillous adenomas.

Geologic Mapping in Southern Margaritifer Terra

NASA Technical Reports Server (NTRS)

Irwin, R. P., III; Grant, J. A.

2010-01-01

Margaritifer Terra records a complex geologic history [1-5], and the area from Holden crater through Ladon Valles, Ladon basin, and up to Morava Valles is no exception [e.g., 6-13]. The 1:500,000 geologic map of MTM quadrangles -15027, -20027, -25027, and -25032 (Figs. 1 and 2 [14]) identifies a range of units that delineate the history of water-related activity and regional geologic context.

Mutation analysis of BRCA1/2 mutations with special reference to polymorphic SNPs in Indian breast cancer patients.

PubMed

Shah, Nidhi D; Shah, Parth S; Panchal, Yash Y; Katudia, Kalpesh H; Khatri, Nikunj B; Ray, Hari Shankar P; Bhatiya, Upti R; Shah, Sandip C; Shah, Bhavini S; Rao, Mandava V

2018-01-01

Germline mutations BRCA1 and BRCA2 contribute almost equally in the causation of breast cancer (BC). The type of mutations in the Indian population that cause this condition is largely unknown. In this cohort, 79 randomized BC patients were screened for various types of BRCA1 and BRCA2 mutations including frameshift, nonsense, missense, in-frame and splice site types. The purified extracted DNA of each referral patient was subjected to Sanger gene sequencing using Codon Code Analyzer and Mutation Surveyor and next-generation sequencing (NGS) methods with Ion torrent software, after appropriate care. The data revealed that 35 cases were positive for BRCA1 or BRCA2 (35/79: 44.3%). BRCA2 mutations were higher (52.4%) than BRCA1 mutations (47.6%). Five novel mutations detected in this study were p.pro163 frameshift, p.asn997 frameshift, p.ser148 frameshift and two splice site single-nucleotide polymorphisms (SNPs). Additionally, four nonsense and one in-frame deletion were identified, which all seemed to be pathogenic. Polymorphic SNPs contributed the highest percentage of mutations (72/82: 87.8%) and contributed to pathogenic, likely pathogenic, likely benign, benign and variant of unknown significance (VUS). Young age groups (20-60 years) had a high frequency of germline mutations (62/82;75.6%) in the Indian population. This study suggested that polymorphic SNPs contributed a high percentage of mutations along with five novel types. Younger age groups are prone to having BC with a higher mutational rate. Furthermore, the SNPs detected in exons 10, 11 and 16 of BRCA1 and BRCA2 were higher than those in other exons 2, 3 and 9 polymorphic sites in two germline genes. These may be contributory for BC although missense types are known to be susceptible for cancer depending on the type of amino acid replaced in the protein and associated with pathologic events. Accordingly, appropriate counseling and treatment may be suggested.

A de novo mutation in the AGXT gene causing primary hyperoxaluria type 1.

PubMed

Williams, Emma L; Kemper, Markus J; Rumsby, Gill

2006-09-01

Primary hyperoxaluria type 1 is caused by mutations in the alanine-glyoxylate aminotransferase (AGXT) gene. In cases in which no mutation was identified, linkage analysis can be used to confirm or exclude the diagnosis in other siblings. We present a family in which a sibling of the index case predicted to have primary hyperoxaluria type 1 by means of linkage analysis failed to show hyperoxaluria during the following 7 years, putting the diagnosis into question. Whole-gene sequence analysis identified 2 causative mutations in the index case, of which only 1, c.646A (Gly216Arg), was inherited. The other sequence change, c.33_34insC, was a de novo mutation occurring on the paternal allele. This particular mutation is a relatively common cause of primary hyperoxaluria type 1. It occurs in a run of 8 cytosines and therefore potentially is susceptible to polymerase slippage. This case illustrates 2 important points. First, biochemical confirmation of a genetic diagnosis should always be made in siblings diagnosed by using genetic tests. Second, de novo mutations should be considered as a potential, albeit rare, cause of primary hyperoxaluria type 1.

Genetic Basis of Glycogen Storage Disease Type 1a: Prevalent Mutations at the Glucose-6-Phosphatase Locus

PubMed Central

Lei, Ke-Jian; Chen, Yuan-Tsong; Chen, Hungwen; Wong, Lee-Jun C.; Liu, Ji-Lan; McConkie-Rosell, Allyn; Van Hove, Johan L. K.; Ou, Henry C.-Y.; Yeh, Nan Jung; Pan, Lorraine Y.; Chou, Janice Yang

1995-01-01

Diagnosis of glycogen storage disease (GSD) type 1a currently is established by demonstrating the lack of glucose-6-phosphatase (G6Pase) activity in the patient's biopsied liver specimen. Recent cloning of the G6Pase gene and identification of mutations within the gene that causes GSD type 1a allow for the development of a DNA-based diagnostic method. Using SSCP analysis and DNA sequencing, we characterized the G6Pase gene of 70 unrelated patients with enzymatically confirmed diagnosis of GSD type 1a and detected mutations in all except 17 alleles (88%). Sixteen mutations were uncovered that were shown by expression to abolish or greatly reduce G6Pase activity and that therefore are responsible for the GSD type 1a disorder. R83C and Q347X are the most prevalent mutations found in Caucasians, 130X and R83C are most prevalent in Hispanics, and R83H is most prevalent in Chinese. The Q347X mutation has thus far been identified only in Caucasian patients, and the 130X mutation has been identified only in Hispanic patients. Our results demonstrate that the DNA-based analysis can accurately, rapidly, and noninvasively detect the majority of mutations in GSD type 1a. This DNA-based diagnosis now permits prenatal diagnosis among at-risk patients and serves as a database in screening and counseling patients clinically suspected of having this disease. ImagesFigure 1Figure 2 PMID:7573034

Mountaintop mining consequences

Treesearch

M.A. Palmer; E.S. Bernhardt; W.H. Schlesinger; K.N. Eshleman; E. Foufoula-Georgiou; M.S. Hendryx; A.D. Lemly; G.E. Likens; O.L. Loucks; M.E. Power; P.S. White; P.R. Wilcock

2010-01-01

There has been a global, 30-year increase in surface mining (1), which is now the dominant driver of land-use change in the central Appalachian ecoregion of the United States (2). One major form of such mining, mountaintop mining with valley fills (MTM/VF) (3), is widespread throughout eastern Kentucky, West Virginia (WV), and southwestern Virginia. Upper elevation...

Four Novel p.N385K, p.V36A, c.1033–1034insT and c.1417–1418delCT Mutations in the Sphingomyelin Phosphodiesterase 1 (SMPD1) Gene in Patients with Types A and B Niemann-Pick Disease (NPD)

PubMed Central

Manshadi, Masoumeh Dehghan; Kamalidehghan, Behnam; Keshavarzi, Fatemeh; Aryani, Omid; Dadgar, Sepideh; Arastehkani, Ahoora; Tondar, Mahdi; Ahmadipour, Fatemeh; Meng, Goh Yong; Houshmand, Massoud

2015-01-01

Background: Types A and B Niemann-Pick disease (NPD) are autosomal-recessive lysosomal storage disorders caused by the deficient activity of acid sphingomyelinase due to mutations in the sphingomyelin phosphodiesterase 1 (SMPD1) gene. Methods: In order to determine the prevalence and distribution of SMPD1 gene mutations, the genomic DNA of 15 unrelated Iranian patients with types A and B NPD was examined using PCR, DNA sequencing and bioinformatics analysis. Results: Of 8 patients with the p.G508R mutation, 5 patients were homozygous, while the other 3 were heterozygous. One patient was heterozygous for both the p.N385K and p.G508R mutations. Another patient was heterozygous for both the p.A487V and p.G508R mutations. Two patients (one homozygous and one heterozygous) showed the p.V36A mutation. One patient was homozygous for the c.1033–1034insT mutation. One patient was homozygous for the c.573delT mutation, and 1 patient was homozygous for the c.1417–1418delCT mutation. Additionally, bioinformatics analysis indicated that two new p.V36A and p.N385K mutations decreased the acid sphingomyelinase (ASM) protein stability, which might be evidence to suggest the pathogenicity of these mutations. Conclusion: with detection of these new mutations, the genotypic spectrum of types A and B NPD is extended, facilitating the definition of disease-related mutations. However, more research is essential to confirm the pathogenic effect of these mutations. PMID:25811928

Primary hyperoxaluria type 1: diagnostic relevance of mutations and polymorphisms in the alanine:glyoxylate aminotransferase gene (AGXT).

PubMed

Tarn, A C; von Schnakenburg, C; Rumsby, G

1997-09-01

Primary hyperoxaluria type 1 (PH1) is an autosomal recessive disorder of glyoxylate metabolism caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). The disease shows considerable phenotypic, enzymatic and genetic heterogeneity. To date, 7 polymorphisms and 11 point mutations have been described in the gene encoding AGT. We report on the prevalence of these polymorphisms and mutations in 79 patients with PH1 with the aim of assessing their diagnostic relevance. A strong association of the C154T, intron 1 insertion and C386T polymorphisms is confirmed and this linkage extends to include the type 1 variant of a polymorphic tandem repeat in intron 4. Only 64 of 158 (40%) PH1 alleles have one of the defined mutations, with the G630A mutation accounting for 39 of these and T853C for 14. Overall only 20 (25%) of the patients studied had the genetic basis of their disease fully explained: 7 were homozygous for the G630A mutation, 5 were homozygous for the T853C mutation, 1 was homozygous for the C819T mutation, and 7 had two different mutations identified and were presumed to be compound heterozygotes. Only the two more frequent G630A and T853C mutations are of general diagnostic relevance for mutation screening. It seems likely that there are a significant number of other mutations, perhaps family-specific, still to be described. There was no apparent difference in the types of mutations in patients presenting in the first year of life (36%), suggesting that other factors, such as periods of dehydration or urinary tract infections, might contribute more to the clinical manifestation than genotype.

Novel mutations in MYO7A and USH2A in Usher syndrome.

PubMed

Maubaret, Cécilia; Griffoin, Jean-Michel; Arnaud, Bernard; Hamel, Christian

2005-03-01

Usher syndrome is an autosomal recessive disease associating retinitis pigmentosa and neurosensory deafness. Three clinical types (USH1, USH2, USH3) and 11 mutated genes or loci have been described. Mutations in MYO7A and USH2A are responsible for about 40% and 60% of Usher syndromes type 1 and 2, respectively. These genes were screened in a series of patients suffering from Usher syndrome. We performed SSCP screening of MYO7A in 12 unrelated patients suffering from Usher syndrome type 1 (USH1) and USH2A in 28 unrelated patients affected by Usher syndrome type 2 (USH2). Six mutations in MYO7A were found in five patients, including two novel mutations c.397C > G (His133Asp) and 1244-2A > G (Glu459Stop), accounting for 42% of our USH1 patients. Twelve mutations in USH2A were found in 11 patients, including four new mutations c.850delGA, c.1841-2A > G, c.3129insT, and c.3920C > G (Ser1307Stop), accounting for 39% of our USH2 patients

Novel findings in patients with primary hyperoxaluria type III and implications for advanced molecular testing strategies

PubMed Central

Beck, Bodo B; Baasner, Anne; Buescher, Anja; Habbig, Sandra; Reintjes, Nadine; Kemper, Markus J; Sikora, Przemyslaw; Mache, Christoph; Pohl, Martin; Stahl, Mirjam; Toenshoff, Burkhard; Pape, Lars; Fehrenbach, Henry; Jacob, Dorrit E; Grohe, Bernd; Wolf, Matthias T; Nürnberg, Gudrun; Yigit, Gökhan; Salido, Eduardo C; Hoppe, Bernd

2013-01-01

Identification of mutations in the HOGA1 gene as the cause of autosomal recessive primary hyperoxaluria (PH) type III has revitalized research in the field of PH and related stone disease. In contrast to the well-characterized entities of PH type I and type II, the pathophysiology and prevalence of type III is largely unknown. In this study, we analyzed a large cohort of subjects previously tested negative for type I/II by complete HOGA1 sequencing. Seven distinct mutations, among them four novel, were found in 15 patients. In patients of non-consanguineous European descent the previously reported c.700+5G>T splice-site mutation was predominant and represents a potential founder mutation, while in consanguineous families private homozygous mutations were identified throughout the gene. Furthermore, we identified a family where a homozygous mutation in HOGA1 (p.P190L) segregated in two siblings with an additional AGXT mutation (p.D201E). The two girls exhibiting triallelic inheritance presented a more severe phenotype than their only mildly affected p.P190L homozygous father. In silico analysis of five mutations reveals that HOGA1 deficiency is causing type III, yet reduced HOGA1 expression or aberrant subcellular protein targeting is unlikely to be the responsible pathomechanism. Our results strongly suggest HOGA1 as a major cause of PH, indicate a greater genetic heterogeneity of hyperoxaluria, and point to a favorable outcome of type III in the context of PH despite incomplete or absent biochemical remission. Multiallelic inheritance could have implications for genetic testing strategies and might represent an unrecognized mechanism for phenotype variability in PH. PMID:22781098

Novel findings in patients with primary hyperoxaluria type III and implications for advanced molecular testing strategies.

PubMed

Beck, Bodo B; Baasner, Anne; Buescher, Anja; Habbig, Sandra; Reintjes, Nadine; Kemper, Markus J; Sikora, Przemyslaw; Mache, Christoph; Pohl, Martin; Stahl, Mirjam; Toenshoff, Burkhard; Pape, Lars; Fehrenbach, Henry; Jacob, Dorrit E; Grohe, Bernd; Wolf, Matthias T; Nürnberg, Gudrun; Yigit, Gökhan; Salido, Eduardo C; Hoppe, Bernd

2013-02-01

Identification of mutations in the HOGA1 gene as the cause of autosomal recessive primary hyperoxaluria (PH) type III has revitalized research in the field of PH and related stone disease. In contrast to the well-characterized entities of PH type I and type II, the pathophysiology and prevalence of type III is largely unknown. In this study, we analyzed a large cohort of subjects previously tested negative for type I/II by complete HOGA1 sequencing. Seven distinct mutations, among them four novel, were found in 15 patients. In patients of non-consanguineous European descent the previously reported c.700+5G>T splice-site mutation was predominant and represents a potential founder mutation, while in consanguineous families private homozygous mutations were identified throughout the gene. Furthermore, we identified a family where a homozygous mutation in HOGA1 (p.P190L) segregated in two siblings with an additional AGXT mutation (p.D201E). The two girls exhibiting triallelic inheritance presented a more severe phenotype than their only mildly affected p.P190L homozygous father. In silico analysis of five mutations reveals that HOGA1 deficiency is causing type III, yet reduced HOGA1 expression or aberrant subcellular protein targeting is unlikely to be the responsible pathomechanism. Our results strongly suggest HOGA1 as a major cause of PH, indicate a greater genetic heterogeneity of hyperoxaluria, and point to a favorable outcome of type III in the context of PH despite incomplete or absent biochemical remission. Multiallelic inheritance could have implications for genetic testing strategies and might represent an unrecognized mechanism for phenotype variability in PH.

Characterizing genomic differences of human cancer stratified by the TP53 mutation status.

PubMed

Wang, Mengyao; Yang, Chao; Zhang, Xiuqing; Li, Xiangchun

2018-06-01

The key roles of the TP53 mutation in cancer have been well established. TP53 is the most frequently mutated gene, and its inactivation is widespread among human cancer types. However, the landscape of genomic alterations in human cancers stratified by the TP53 mutation has not yet been described. We obtained somatic mutation and copy number change data of 6551 regular-mutated samples from the Cancer Genome Atlas (TCGA) and compared significantly mutated genes (SMGs), copy number alterations, mutational signatures and mutational strand asymmetries between cancer samples with and without the TP53 mutation. We identified 126 SMGs, 30 of which were statistically significant in both the TP53 mutant and wild-type groups. Several SMGs, such as VHL, SMAD4 and PTEN, showed a mutation bias towards the TP53 wild-type group, whereas ATRX, IDH1 and RB1 were more prevalent in the TP53 mutant group. Five mutational signatures were extracted from the combined TCGA dataset on which mutational asymmetry analysis was performed, revealing that the TP53 mutant group exhibited substantially greater replication and transcription biases. Furthermore, we found that alterations of multiple genes in a merged mutually exclusive network composed of BRAF, EGFR, PAK1, PIK3CA, PTEN, APC and TERT were related to shortened survival in the TP53 wild-type group. In summary, we characterized the genomic differences and similarities underlying human cancers stratified by the TP53 mutation and identified multi-gene alterations of a merged mutually exclusive network to be a poor prognostic factor for the TP53 wild-type group.

Association of BRCA Mutation Types, Imaging Features, and Pathologic Findings in Patients With Breast Cancer With BRCA1 and BRCA2 Mutations.

PubMed

Ha, Su Min; Chae, Eun Young; Cha, Joo Hee; Kim, Hak Hee; Shin, Hee Jung; Choi, Woo Jung

2017-10-01

The purpose of this study is to retrospectively evaluate the relationships between the BRCA mutation types, imaging features, and pathologic findings of breast cancers in BRCA1 and BRCA2 mutation carriers. We identified patients with breast cancer with BRCA gene mutations from January 2000 to December 2014. After excluding patients who underwent lesion excision before MRI, 99 BRCA1 and 103 BRCA2 lesions in 187 women (mean age, 39.7 and 40.4 years, respectively) were enrolled. Mammographic, sonographic, and MRI scans were reviewed according to the BI-RADS lexicon (5th edition). Pathologic data were reviewed, including the immunohistochemistry findings. The relationships between the BRCA mutations and both imaging and pathologic findings were analyzed. The distribution of molecular subtypes of tumors significantly differed by the mutation type. BRCA1 tumors were associated with the triple-negative subtype, whereas BRCA2 tumors were associated with the luminal B subtype (p = 0.002). At MRI, breast cancers with BRCA1 mutations exhibited a circumscribed margin (p = 0.032) and rim enhancement (p = 0.013). No significant differences in mass shape or kinetic features were observed at MRI. Cancers in BRCA1 mutation carriers tended to develop in the posterior location in the breast (p = 0.034). At mammography, no significant difference in the prevalence of calcifications was observed according to the mutation type. At sonography, BRCA1 lesions were found to be associated with posterior acoustic enhancement (p < 0.0001). Breast cancers with BRCA1 mutations tend to exhibit benign morphologic features at MRI, mammography, and sonography, compared with BRCA2 mutations. Lesion location may represent another difference on imaging among various genetic phenotypes.

Common mutation underlying primary hyperoxaluria type1 in three Indian children

PubMed Central

Chanchlani, R.; Sinha, A.; Gulati, A.; Agarwal, V.; Bagga, A.

2012-01-01

Primary hyperoxaluria is an autosomal recessive disorder caused by deficiency of alanine-glyoxylate aminotransferase, which is encoded by the AGXT gene. We report three Indian children with primary hyperoxaluria type1 having a common mutation in this gene. All patients had evidence of chronic kidney disease at the time of diagnosis, with subsequent progression to end-stage renal disease. The detection of an identical mutation in the AGXT gene suggests that specific genetic screening for this mutation may be useful when considering the diagnosis of primary hyperoxaluria type1. PMID:23439734

Common mutation underlying primary hyperoxaluria type1 in three Indian children.

PubMed

Chanchlani, R; Sinha, A; Gulati, A; Agarwal, V; Bagga, A

2012-11-01

Primary hyperoxaluria is an autosomal recessive disorder caused by deficiency of alanine-glyoxylate aminotransferase, which is encoded by the AGXT gene. We report three Indian children with primary hyperoxaluria type1 having a common mutation in this gene. All patients had evidence of chronic kidney disease at the time of diagnosis, with subsequent progression to end-stage renal disease. The detection of an identical mutation in the AGXT gene suggests that specific genetic screening for this mutation may be useful when considering the diagnosis of primary hyperoxaluria type1.

Clinical Aspects of Type-1 Long-QT Syndrome by Location, Coding Type, and Biophysical Function of Mutations Involving the KCNQ1 Gene

PubMed Central

Moss, Arthur J.; Shimizu, Wataru; Wilde, Arthur A.M.; Towbin, Jeffrey A.; Zareba, Wojciech; Robinson, Jennifer L.; Qi, Ming; Vincent, G. Michael; Ackerman, Michael J.; Kaufman, Elizabeth S.; Hofman, Nynke; Seth, Rahul; Kamakura, Shiro; Miyamoto, Yoshihiro; Goldenberg, Ilan; Andrews, Mark L.; McNitt, Scott

2012-01-01

Background Type-1 long-QT syndrome (LQTS) is caused by loss-of-function mutations in the KCNQ1-encoded IKs cardiac potassium channel. We evaluated the effect of location, coding type, and biophysical function of KCNQ1 mutations on the clinical phenotype of this disorder. Methods and Results We investigated the clinical course in 600 patients with 77 different KCNQ1 mutations in 101 proband-identified families derived from the US portion of the International LQTS Registry (n=425), the Netherlands’ LQTS Registry (n=93), and the Japanese LQTS Registry (n=82). The Cox proportional hazards survivorship model was used to evaluate the independent contribution of clinical and genetic factors to the first occurrence of time-dependent cardiac events from birth through age 40 years. The clinical characteristics, distribution of mutations, and overall outcome event rates were similar in patients enrolled from the 3 geographic regions. Biophysical function of the mutations was categorized according to dominant-negative (>50%) or haploinsufficiency (≤50%) reduction in cardiac repolarizing IKs potassium channel current. Patients with transmembrane versus C-terminus mutations (hazard ratio, 2.06; P<0.001) and those with mutations having dominant-negative versus haploinsufficiency ion channel effects (hazard ratio, 2.26; P<0.001) were at increased risk for cardiac events, and these genetic risks were independent of traditional clinical risk factors. Conclusions This genotype–phenotype study indicates that in type-1 LQTS, mutations located in the transmembrane portion of the ion channel protein and the degree of ion channel dysfunction caused by the mutations are important independent risk factors influencing the clinical course of this disorder. PMID:17470695

Wild Plant Assessment for Heavy Metal Phytoremediation Potential along the Mafic and Ultramafic Terrain in Northern Pakistan

PubMed Central

Shah, Mohammad Tahir; Khan, Sardar; Saddique, Umar; Gul, Nida; Khan, Muhammad Usman; Malik, Riffat Naseem; Farooq, Muhammad; Naz, Alia

2013-01-01

This study investigates the wild plant species for their phytoremediation potential of macro and trace metals (MTM). For this purpose, soil and wild plant species samples were collected along mafic and ultramafic terrain in the Jijal, Dubair, and Alpuri areas of Kohistan region, northern Pakistan. These samples were analyzed for the concentrations of MTM (Na, K, Ca, Mg, Fe, Mn, Pb, Zn, Cd, Cu, Cr, Ni, and Co) using atomic absorption spectrometer (AAS-PEA-700). Soil showed significant (P < .001) contamination level, while plants had greater variability in metal uptake from the contaminated sites. Plant species such as Selaginella jacquemontii, Rumex hastatus, and Plectranthus rugosus showed multifold enrichment factor (EF) of Fe, Mn, Cr, Ni, and Co as compared to background area. Results revealed that these wild plant species have the ability to uptake and accumulate higher metals concentration. Therefore, these plant species may be used for phytoremediation of metals contaminated soil. However, higher MTM concentrations in the wild plant species could cause environmental hazards in the study area, as selected metals (Fe, Mn, Cr, Ni, Co, and Pb) have toxicological concerns. PMID:24078907

Massively Parallel DNA Sequencing Facilitates Diagnosis of Patients with Usher Syndrome Type 1

PubMed Central

Yoshimura, Hidekane; Iwasaki, Satoshi; Nishio, Shin-ya; Kumakawa, Kozo; Tono, Tetsuya; Kobayashi, Yumiko; Sato, Hiroaki; Nagai, Kyoko; Ishikawa, Kotaro; Ikezono, Tetsuo; Naito, Yasushi; Fukushima, Kunihiro; Oshikawa, Chie; Kimitsuki, Takashi; Nakanishi, Hiroshi; Usami, Shin-ichi

2014-01-01

Usher syndrome is an autosomal recessive disorder manifesting hearing loss, retinitis pigmentosa and vestibular dysfunction, and having three clinical subtypes. Usher syndrome type 1 is the most severe subtype due to its profound hearing loss, lack of vestibular responses, and retinitis pigmentosa that appears in prepuberty. Six of the corresponding genes have been identified, making early diagnosis through DNA testing possible, with many immediate and several long-term advantages for patients and their families. However, the conventional genetic techniques, such as direct sequence analysis, are both time-consuming and expensive. Targeted exon sequencing of selected genes using the massively parallel DNA sequencing technology will potentially enable us to systematically tackle previously intractable monogenic disorders and improve molecular diagnosis. Using this technique combined with direct sequence analysis, we screened 17 unrelated Usher syndrome type 1 patients and detected probable pathogenic variants in the 16 of them (94.1%) who carried at least one mutation. Seven patients had the MYO7A mutation (41.2%), which is the most common type in Japanese. Most of the mutations were detected by only the massively parallel DNA sequencing. We report here four patients, who had probable pathogenic mutations in two different Usher syndrome type 1 genes, and one case of MYO7A/PCDH15 digenic inheritance. This is the first report of Usher syndrome mutation analysis using massively parallel DNA sequencing and the frequency of Usher syndrome type 1 genes in Japanese. Mutation screening using this technique has the power to quickly identify mutations of many causative genes while maintaining cost-benefit performance. In addition, the simultaneous mutation analysis of large numbers of genes is useful for detecting mutations in different genes that are possibly disease modifiers or of digenic inheritance. PMID:24618850

Massively parallel DNA sequencing facilitates diagnosis of patients with Usher syndrome type 1.

PubMed

Yoshimura, Hidekane; Iwasaki, Satoshi; Nishio, Shin-Ya; Kumakawa, Kozo; Tono, Tetsuya; Kobayashi, Yumiko; Sato, Hiroaki; Nagai, Kyoko; Ishikawa, Kotaro; Ikezono, Tetsuo; Naito, Yasushi; Fukushima, Kunihiro; Oshikawa, Chie; Kimitsuki, Takashi; Nakanishi, Hiroshi; Usami, Shin-Ichi

2014-01-01

Usher syndrome is an autosomal recessive disorder manifesting hearing loss, retinitis pigmentosa and vestibular dysfunction, and having three clinical subtypes. Usher syndrome type 1 is the most severe subtype due to its profound hearing loss, lack of vestibular responses, and retinitis pigmentosa that appears in prepuberty. Six of the corresponding genes have been identified, making early diagnosis through DNA testing possible, with many immediate and several long-term advantages for patients and their families. However, the conventional genetic techniques, such as direct sequence analysis, are both time-consuming and expensive. Targeted exon sequencing of selected genes using the massively parallel DNA sequencing technology will potentially enable us to systematically tackle previously intractable monogenic disorders and improve molecular diagnosis. Using this technique combined with direct sequence analysis, we screened 17 unrelated Usher syndrome type 1 patients and detected probable pathogenic variants in the 16 of them (94.1%) who carried at least one mutation. Seven patients had the MYO7A mutation (41.2%), which is the most common type in Japanese. Most of the mutations were detected by only the massively parallel DNA sequencing. We report here four patients, who had probable pathogenic mutations in two different Usher syndrome type 1 genes, and one case of MYO7A/PCDH15 digenic inheritance. This is the first report of Usher syndrome mutation analysis using massively parallel DNA sequencing and the frequency of Usher syndrome type 1 genes in Japanese. Mutation screening using this technique has the power to quickly identify mutations of many causative genes while maintaining cost-benefit performance. In addition, the simultaneous mutation analysis of large numbers of genes is useful for detecting mutations in different genes that are possibly disease modifiers or of digenic inheritance.

Mutational analysis of AGXT in two Chinese families with primary hyperoxaluria type 1

PubMed Central

2014-01-01

Background Primary hyperoxaluria type 1 is a rare autosomal recessive disease of glyoxylate metabolism caused by a defect in the liver-specific peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT) that leads to hyperoxaluria, recurrent urolithiasis, and nephrocalcinosis. Methods Two unrelated patients with recurrent urolithiasis, along with members of their families, exhibited mutations in the AGXT gene by PCR direct sequencing. Results Two heterozygous mutations that predict truncated proteins, p.S81X and p.S275delinsRAfs, were identified in one patient. The p.S81X mutation is novel. Two heterozygous missense mutations, p.M1T and p.I202N, were detected in another patient but were not identified in her sibling. These four mutations were confirmed to be of paternal and maternal origin. Conclusions These are the first cases of primary hyperoxaluria type 1 to be diagnosed by clinical manifestations and AGXT gene mutations in mainland China. The novel p.S81X and p.I202N mutations detected in our study extend the spectrum of known AGXT gene mutations. PMID:24934730

Mutational analysis of AGXT in two Chinese families with primary hyperoxaluria type 1.

PubMed

Li, Guo-min; Xu, Hong; Shen, Qian; Gong, Yi-nv; Fang, Xiao-yan; Sun, Li; Liu, Hai-mei; An, Yu

2014-06-17

Primary hyperoxaluria type 1 is a rare autosomal recessive disease of glyoxylate metabolism caused by a defect in the liver-specific peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT) that leads to hyperoxaluria, recurrent urolithiasis, and nephrocalcinosis. Two unrelated patients with recurrent urolithiasis, along with members of their families, exhibited mutations in the AGXT gene by PCR direct sequencing. Two heterozygous mutations that predict truncated proteins, p.S81X and p.S275delinsRAfs, were identified in one patient. The p.S81X mutation is novel. Two heterozygous missense mutations, p.M1T and p.I202N, were detected in another patient but were not identified in her sibling. These four mutations were confirmed to be of paternal and maternal origin. These are the first cases of primary hyperoxaluria type 1 to be diagnosed by clinical manifestations and AGXT gene mutations in mainland China. The novel p.S81X and p.I202N mutations detected in our study extend the spectrum of known AGXT gene mutations.

76 FR 31977 - Public Land Order No. 7768; Extension of Public Land Order No. 6861; Montana

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-02

... DEPARTMENT OF THE INTERIOR Bureau of Land Management [LLMTB01000-L14300000.ET0000; MTM 79264] Public Land Order No. 7768; Extension of Public Land Order No. 6861; Montana AGENCY: Bureau of Land... and Minerals Management. [FR Doc. 2011-13720 Filed 6-1-11; 8:45 am] BILLING CODE P ...

Next-generation sequencing and a novel COL3A1 mutation associated with vascular Ehlers-Danlos syndrome with severe intestinal involvement: a case report.

PubMed

Cortini, Francesca; Marinelli, Barbara; Seia, Manuela; De Giorgio, Barbara; Pesatori, Angela Cecilia; Montano, Nicola; Bassotti, Alessandra

2016-10-31

The vascular type of Ehlers-Danlos syndrome is an autosomal dominant connective tissue disorder caused by a mutation in the COL3A1 gene encoding pro-alpha1 chain of type III collagen. The vascular type of Ehlers-Danlos syndrome causes severe fragility of connective tissues with arterial and intestinal ruptures and complications in surgical and radiological treatments. We present a case of a 38-year-old Italian woman who was diagnosed as having the vascular type of Ehlers-Danlos syndrome. Genetic testing, conducted by Target Enrichment approach (Agilent Technologies), identified a new mutation c.1493G>A, p.G498D in exon 21 of COL3A1 gene (heterozygous state). This mutation disrupts the normal glycine-X-Y repetitions of type III procollagen by converting glycine to aspartic acid. We report a new genetic mutation associated with the vascular type of Ehlers-Danlos syndrome. We also describe clinical and genetic findings that are important to understand the genotype/phenotype correlation in patients with the vascular type of Ehlers-Danlos syndrome.

Genotype-phenotype aspects of type 2 long QT syndrome.

PubMed

Shimizu, Wataru; Moss, Arthur J; Wilde, Arthur A M; Towbin, Jeffrey A; Ackerman, Michael J; January, Craig T; Tester, David J; Zareba, Wojciech; Robinson, Jennifer L; Qi, Ming; Vincent, G Michael; Kaufman, Elizabeth S; Hofman, Nynke; Noda, Takashi; Kamakura, Shiro; Miyamoto, Yoshihiro; Shah, Samit; Amin, Vinit; Goldenberg, Ilan; Andrews, Mark L; McNitt, Scott

2009-11-24

The purpose of this study was to investigate the effect of location, coding type, and topology of KCNH2(hERG) mutations on clinical phenotype in type 2 long QT syndrome (LQTS). Previous studies were limited by population size in their ability to examine phenotypic effect of location, type, and topology. Study subjects included 858 type 2 LQTS patients with 162 different KCNH2 mutations in 213 proband-identified families. The Cox proportional-hazards survivorship model was used to evaluate independent contributions of clinical and genetic factors to the first cardiac events. For patients with missense mutations, the transmembrane pore (S5-loop-S6) and N-terminus regions were a significantly greater risk than the C-terminus region (hazard ratio [HR]: 2.87 and 1.86, respectively), but the transmembrane nonpore (S1-S4) region was not (HR: 1.19). Additionally, the transmembrane pore region was significantly riskier than the N-terminus or transmembrane nonpore regions (HR: 1.54 and 2.42, respectively). However, for nonmissense mutations, these other regions were no longer riskier than the C-terminus (HR: 1.13, 0.77, and 0.46, respectively). Likewise, subjects with nonmissense mutations were at significantly higher risk than were subjects with missense mutations in the C-terminus region (HR: 2.00), but that was not the case in other regions. This mutation location-type interaction was significant (p = 0.008). A significantly higher risk was found in subjects with mutations located in alpha-helical domains than in subjects with mutations in beta-sheet domains or other locations (HR: 1.74 and 1.33, respectively). Time-dependent beta-blocker use was associated with a significant 63% reduction in the risk of first cardiac events (p < 0.001). The KCNH2 missense mutations located in the transmembrane S5-loop-S6 region are associated with the greatest risk.

REEP1 Mutation Spectrum and Genotype/Phenotype Correlation in Hereditary Spastic Paraplegia Type 31

ERIC Educational Resources Information Center

Beetz, Christian; Schule, Rebecca; Deconinck, Tine; Tran-Viet, Khanh-Nhat; Zhu, Hui; Kremer, Berry P. H.; Frints, Suzanna G. M.; van Zelst-Stams, Wendy A. G.; Byrne, Paula; Otto, Susanne; Nygren, Anders O. H.; Baets, Jonathan; Smets, Katrien; Ceulemans, Berten; Dan, Bernard; Nagan, Narasimhan; Kassubek, Jan; Klimpe, Sven; Klopstock, Thomas; Stolze, Henning; Smeets, Hubert J. M.; Schrander-Stumpel, Constance T. R. M.; Hutchinson, Michael; van de Warrenburg, Bart P.; Braastad, Corey; Deufel, Thomas; Pericak-Vance, Margaret; Schols, Ludger; de Jonghe, Peter; Zuchner, Stephan

2008-01-01

Mutations in the receptor expression enhancing protein 1 (REEP1) have recently been reported to cause autosomal dominant hereditary spastic paraplegia (HSP) type SPG31. In a large collaborative effort, we screened a sample of 535 unrelated HSP patients for "REEP1" mutations and copy number variations. We identified 13 novel and 2 known "REEP1"…

Wild-type presenilin 1 protects against Alzheimer disease mutation-induced amyloid pathology.

PubMed

Wang, Runsheng; Wang, Baiping; He, Wanxia; Zheng, Hui

2006-06-02

Mutations in presenilin 1 (PS1) lead to dominant inheritance of early onset familial Alzheimer disease (FAD). These mutations are known to alter the gamma-secretase cleavage of the amyloid precursor protein, resulting in increased ratio of Abeta42/Abeta40 and accelerated amyloid plaque pathology in transgenic mouse models. To investigate the factors that drive the Abeta42/Abeta40 ratio and amyloid pathogenesis and to investigate the possible interactions between wild-type and FAD mutant PS1, which are co-expressed in transgenic animals, we expressed the PS1 M146V knock-in allele either on wild-type PS1 (PS1M146V/+) or PS1 null (PS1M146V/-) background and crossed these alleles with the Tg2576 APP transgenic mice. Introduction of the PS1 M146V mutation on Tg2576 background resulted in earlier onset of plaque pathology. Surprisingly, removing the wild-type PS1 in the presence of the PS1 M146V mutation (PS1M146V/-) greatly exacerbated the amyloid burden; and this was attributed to a reduction of gamma-secretase activity rather than an increase in Abeta42. Our findings establish a protective role of the wild-type PS1 against the FAD mutation-induced amyloid pathology through a partial loss-of-function mechanism.

[Prognostic value of JAK2, MPL and CALR mutations in Chinese patients with primary myelofibrosis].

PubMed

Xu, Z F; Li, B; Liu, J Q; Li, Y; Ai, X F; Zhang, P H; Qin, T J; Zhang, Y; Wang, J Y; Xu, J Q; Zhang, H L; Fang, L W; Pan, L J; Hu, N B; Qu, S Q; Xiao, Z J

2016-07-01

To evaluate the prognostic value of JAK2, MPL and CALR mutations in Chinese patients with primary myelofibrosis (PMF). Four hundred and two Chinese patients with PMF were retrospectively analyzed. The Kaplan-Meier method, the Log-rank test, the likelihood ratio test and the Cox proportional hazards regression model were used to evaluate the prognostic scoring system. This cohort of patients included 209 males and 193 females with a median age of 55 years (range: 15- 89). JAK2V617F mutations were detected in 189 subjects (47.0% ), MPLW515 mutations in 13 (3.2%) and CALR mutations in 81 (20.1%) [There were 30 (37.0%) type-1, 48 (59.3%) type-2 and 3 (3.7%) less common CALR mutations], respectively. 119 subjects (29.6%) had no detectable mutation in JAK2, MPL or CALR. Univariate analysis indicated that patients with CALR type-2 mutations or no detectable mutations had inferior survival compared to those with JAK2, MPL or CALR type- 1 or other less common CALR mutations (the median survival was 74vs 168 months, respectively [HR 2.990 (95% CI 1.935-4.619),P<0.001]. Therefore, patients were categorized into the high-risk with CALR type- 2 mutations or no detectable driver mutations and the low- risk without aforementioned mutations status. The DIPSS-Chinese molecular prognostic model was proposed by adopting mutation categories and DIPSS-Chinese risk group. The median survival of patients classified in low risk (132 subjects, 32.8% ), intermediate- 1 risk (143 subjects, 35.6%), intermediate- 2 risk (106 subjects, 26.4%) and high risk (21 subjects, 5.2%) were not reached, 156 (95% CI 117- 194), 60 (95% CI 28- 91) and 22 (95% CI 10- 33) months, respectively, and there was a statistically significant difference in overall survival among the four risk groups (P<0.001). There was significantly higher predictive power for survival according to the DIPSS-Chinese molecular prognostic model compared with the DIPSS-Chinese model (P=0.005, -2 log-likelihood ratios of 855.6 and 869.7, respectively). The impact of the CALR type- 2 mutations or no detectable driver mutation on survival was independent of current prognostic scoring systems. The DIPSS- Chinese molecular prognostic model based on the molecular features of Chinese patients was proposed and worked well for prognostic indication.

A new nonsense mutation in the NF1 gene with neurofibromatosis-Noonan syndrome phenotype.

PubMed

Yimenicioğlu, Sevgi; Yakut, Ayten; Karaer, Kadri; Zenker, Martin; Ekici, Arzu; Carman, Kürşat Bora

2012-12-01

Neurofibromatosis-Noonan syndrome is a rare autosomal dominant disorder which combines neurofibromatosis type 1 (NF1) features with Noonan syndrome. NF1 gene mutations are reported in the majority of these patients. Sequence analysis of the established genes for Noonan syndrome revealed no mutation; a heterozygous NF1 point mutation c.7549C>T in exon 51, creating a premature stop codon (p.R2517X), had been demonstrated. Neurofibromatosis-Noonan syndrome recently has been considered a subtype of NF1 and caused by different NF1 mutations. We report the case of a 14-year-old boy with neurofibromatosis type 1 with Noonan-like features, who complained of headache with triventricular hydrocephaly and a heterozygous NF1 point mutation c.7549C>T in exon 51.

Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

PubMed

Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

2012-06-01

Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

Rare co-occurrence of osteogenesis imperfecta type I and autosomal dominant polycystic kidney disease.

PubMed

Hoefele, Julia; Mayer, Karin; Marschall, Christoph; Alberer, Martin; Klein, Hanns-Georg; Kirschstein, Martin

2016-11-01

There are several clinical reports about the co-occurrence of autosomal dominant polycystic kidney disease (ADPKD) and connective tissue disorders. A simultaneous occurrence of osteogenesis imperfecta (OI) type I and ADPKD has not been observed so far. This report presents the first patient with OI type I and ADPKD. Mutational analysis of PKD1 and COL1A1 in the index patient revealed a heterozygous mutation in each of the two genes. Mutational analysis of the parents indicated the mother as a carrier of the PKD1 mutation and the father as a carrier of the COL1A1 mutation. The simultaneous occurrence of both disorders has an estimated frequency of 3.5:100 000 000. In singular cases, ADPKD can occur in combination with other rare disorders, e.g. connective tissue disorders.

Mutation Profile of the CDH23 Gene in 56 Probands with Usher Syndrome Type I

PubMed Central

Oshima, A.; Jaijo, T.; Aller, E.; Millan, J.M.; Carney, C.; Usami, S.; Moller, C.; Kimberling, W.J.

2008-01-01

Mutations in the human gene encoding cadherin 23 (CDH23) cause Usher syndrome type 1D (USH1D) and nonsyndromic hearing loss. Individuals with Usher syndrome type I have profound congenital deafness, vestibular areflexia and usually begin to exhibit signs of RP in early adolescence. In the present study, we carried out the mutation analysis in all 69 exons of the CDH23 gene in 56 Usher type 1 probands already screened for mutations in MYO7A. A total of 18 of 56 subjects (32.1%) were observed to have one or two CDH23 variants that are presumed to be pathologic. Twenty one different pathologic genome variants were observed of which 15 were novel. Out of a total of 112 alleles, 31 (27.7%) were considered pathologic. Based on our results it is estimated that about 20% of patients with Usher syndrome type I have CDH23 mutations. PMID:18429043

A novel CANT1 mutation in three Indian patients with Desbuquois dysplasia Kim type.

PubMed

Singh, Ankur; Kim, Ok-Hwa; Iida, Aritoshi; Park, Woong-Yang; Ikegawa, Shiro; Kapoor, Seema

2015-02-01

Desbuquois dysplasia (DBQD) is a rare skeletal dysplasia characterized by severe short stature, laxity, dislocation of multiple joints and developmental delay. DBQD is clinically heterogeneous. Distinct radiographic hand abnormalities such as the presence of extra-ossification distal to the second metacarpal or normal hand has led to its classification into types 1 and 2. Furthermore, the third type of DBQD, Kim type has been reported which is characterized by short metacarpals and elongated phalanges. However, DBQD Kim type has been exclusively reported in Japanese and Korean and its clinical characteristics remain to be delineated. Mutations in the calcium-activated nucleotidase 1 (CANT1) gene have been reported in all three types of DBQD. Previously reported patients with DBQD Kim type had a common mutation c.676G>A (p.Val226Met), which had a common founder between Japanese and Korean. Here, we report 3 Indian patients with DBQD, Kim type from 2 families which were unrelated to each other. We identified a novel mutation of CANT1, c.467C>T (p.Ser156Phe), in all the patients in the homozygous form. Our results show that DBQD Kim type is not exclusive to East Asians and also report a novel mutation from the Indian subcontinent. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Classifying Non-Small Cell Lung Cancer by Status of Programmed Cell Death Ligand 1 and Tumor-Infiltrating Lymphocytes on Tumor Cells.

PubMed

Cui, Shaohua; Dong, Lili; Qian, Jialin; Ye, Lin; Jiang, Liyan

2018-01-01

Purpose: To explore the possible correlation between programmed death ligand 1 (PD-L1)/tumor-infiltrating lymphocytes (TIL) status and clinical factors in non-small cell lung (NSCLC). Materials and Methods: A total of 126 surgical NSCLC samples with stage I to IIIA were retrospectively collected and analyzed. Immunohistochemistry (IHC) assays were used to detect PD-L1 protein expression. PD-L1 positivity on tumor cells was defined by positive tumor cell (TC) percentage using 5% cutoff value. Results: Thirty-seven patients (29.4%), thirty patients (23.8%), six patients (4.8%) and fifty-three patients (42%) were classified as type I (PD-L1+, TIL+), type II (PD-L1-, TIL-), type III (PD-L1+, TIL-) and type IV (PD-L1-, TIL+) tumor environments according to PD-L1/TIL status, respectively. Statistical differences could be observed in factors including gender ( P <0.001), smoking status ( P <0.001), age ( P =0.002), histological types ( P <0.001), EGFR mutation ( P =0.008) and KRAS mutation ( P =0.003) across the four type tumors. Type I tumors were associated with ever smoking, non-adenocarcinoma histological types and KRAS mutation. Type II tumors were associated with female gender, never-smoking, adenocarcinoma histological types and EGFR mutation. Type III tumors were associated with ever smoking and type IV tumors were associated with female gender and EGFR mutation. Conclusion: Clinical factors associated with NSCLC microenvironment types based on PD-L1/TIL differed a lot across different types. The findings of this study may help to facilitate the understanding of the relationship between tumor microenvironment and clinical factors, and also the selecting of patients for combination immunotherapies.

Genetic basis of glycogen storage disease type 1a: Prevalent mutations at the glucose-6-phosphatase locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ke-Jian Lei; Hungwen Chen; Ji-Lan Liu

Diagnosis of glycogen storage disease (GSD) type 1a currently is established by demonstrating the lack of glucose-6-phosphatase (G6Pase) activity in the patient`s biopsied liver specimen. Recent cloning of the G6Pase gene and identification of mutations within the gene that causes GSD type 1a allow for the development of a DNA-based diagnostic method. Using SSCP analysis and DNA sequencing, we characterized the G6Pase gene of 70 unrelated patients with enzymatically confirmed diagnosis of GSD type 1a and detected mutations in all except 17 alleles (88%). Sixteen mutations were uncovered that were shown by expression to abolish or greatly reduce G6Pase activitymore » and that therefore are responsible for the GSD type la disorder. R83C and Q347X are the most prevalent mutations found in Caucasians, 130X and R83C are most prevalent in Hispanics, and R83H is most prevalent in Chinese. The Q347X mutation has thus far been identified only in Caucasian patients, and the 130X mutation has been identified only in Hispanic patients. Our results demonstrate that the DNA-based analysis can accurately, rapidly, and noninvasively detect the majority of mutations in GSD type 1a. This DNA-based diagnosis now permits prenatal diagnosis among at-risk patients and serves as a database in screening and counseling patients clinically suspected of having this disease. 22 refs., 2 figs., 4 tabs.« less

Frequent POLE1 p.S297F mutation in Chinese patients with ovarian endometrioid carcinoma.

PubMed

Zou, Yang; Liu, Fa-Ying; Liu, Huai; Wang, Feng; Li, Wei; Huang, Mei-Zhen; Huang, Yan; Yuan, Xiao-Qun; Xu, Xiao-Yun; Huang, Ou-Ping; He, Ming

2014-03-01

The catalytic subunit of DNA polymerase epsilon (POLE1) functions primarily in nuclear DNA replication and repair. Recently, POLE1 mutations were detected frequently in colorectal and endometrial carcinomas while with lower frequency in several other types of cancer, and the p.P286R and p.V411L mutations were the potential mutation hotspots in human cancers. Nevertheless, the mutation frequency of POLE1 in ovarian cancer still remains largely unknown. Here, we screened a total of 251 Chinese samples with distinct subtypes of ovarian carcinoma for the presence of POLE1 hotspot mutations by direct sequencing. A heterozygous somatic POLE1 mutation, p.S297F (c.890C>T), but not p.P286R and p.V411L hotspot mutations observed in other cancer types, was identified in 3 out of 37 (8.1%) patients with ovarian endometrioid carcinoma; this mutation was evolutionarily highly conserved from Homo sapiens to Schizosaccharomyces. Of note, the POLE1 mutation coexisted with mutation in the ovarian cancer-associated PPP2R1A (protein phosphatase 2, regulatory subunit A, α) gene in a 46-year-old patient, who was also diagnosed with ectopic endometriosis in the benign ovary. In addition, a 45-year-old POLE1-mutated ovarian endometrioid carcinoma patient was also diagnosed with uterine leiomyoma while the remaining 52-year-old POLE1-mutated patient showed no additional distinctive clinical manifestation. In contrast to high frequency of POLE1 mutations in ovarian endometrioid carcinoma, no POLE1 mutations were identified in patients with other subtypes of ovarian carcinoma. Our results showed for the first time that the POLE1 p.S297F mutation, but not p.P286R and p.V411L hotspot mutations observed in other cancer types, was frequent in Chinese ovarian endometrioid carcinoma, but absent in other subtypes of ovarian carcinoma. These results implicated that POLE1 p.S297F mutation might be actively involved in the pathogenesis of ovarian endometrioid carcinoma, but might not be actively involved in other subtypes of ovarian carcinoma. Copyright © 2014 Elsevier B.V. All rights reserved.

Osteogenesis imperfecta type I: Molecular heterogeneity for COL1A1 null alleles of type I collagen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willing, M.C.; Deschenes, S.P.; Pitts, S.H.

Osteogenesis imperfecta (OI) type I is the mildest form of inherited brittle-bone disease. Dermal fibroblasts from most affected individuals produce about half the usual amount of type I procollagen, as a result of a COL1A1 {open_quotes}null{close_quotes} allele. Using PCR amplification of genomic DNA from affected individuals, followed by denaturing gradient gel electrophoresis (DGGE) and SSCP, we identified seven different COL1A1 gene mutations in eight unrelated families with OI type I. Three families have single nucleotide substitutions that alter 5{prime} donor splice sites; two of these unrelated families have the same mutation. One family has a point mutation, in an exon,more » that creates a premature termination codon, and four have small deletions or insertions, within exons, that create translational frameshifts and new termination codons downstream of the mutation sites. Each mutation leads to both marked reduction in steady-state levels of mRNA from the mutant allele and a quantitative decrease in type I procollagen production. Our data demonstrate that different molecular mechanisms that have the same effect on type I collagen production result in the same clinical phenotype. 58 refs., 4 figs., 1 tab.« less

A de novo deletion mutation in SOX10 in a Chinese family with Waardenburg syndrome type 4.

PubMed

Wang, Xiong; Zhu, Yaowu; Shen, Na; Peng, Jing; Wang, Chunyu; Liu, Haiyi; Lu, Yanjun

2017-01-27

Waardenburg syndrome type 4 (WS4) or Waardenburg-Shah syndrome is a rare genetic disorder with a prevalence of <1/1,000,000 and characterized by the association of congenital sensorineural hearing loss, pigmentary abnormalities, and intestinal aganglionosis. There are three types of WS4 (WS4A-C) caused by mutations in endothelin receptor type B, endothelin 3, and SRY-box 10 (SOX10), respectively. This study investigated a genetic mutation in a Chinese family with one WS4 patient in order to improve genetic counselling. Genomic DNA was extracted, and mutation analysis of the three WS4 related genes was performed using Sanger sequencing. We detected a de novo heterozygous deletion mutation [c.1333delT (p.Ser445Glnfs*57)] in SOX10 in the patient; however, this mutation was absent in the unaffected parents and 40 ethnicity matched healthy controls. Subsequent phylogenetic analysis and three-dimensional modelling of the SOX10 protein confirmed that the c.1333delT heterozygous mutation was pathogenic, indicating that this mutation might constitute a candidate disease-causing mutation.

A de novo deletion mutation in SOX10 in a Chinese family with Waardenburg syndrome type 4

PubMed Central

Wang, Xiong; Zhu, Yaowu; Shen, Na; Peng, Jing; Wang, Chunyu; Liu, Haiyi; Lu, Yanjun

2017-01-01

Waardenburg syndrome type 4 (WS4) or Waardenburg-Shah syndrome is a rare genetic disorder with a prevalence of <1/1,000,000 and characterized by the association of congenital sensorineural hearing loss, pigmentary abnormalities, and intestinal aganglionosis. There are three types of WS4 (WS4A–C) caused by mutations in endothelin receptor type B, endothelin 3, and SRY-box 10 (SOX10), respectively. This study investigated a genetic mutation in a Chinese family with one WS4 patient in order to improve genetic counselling. Genomic DNA was extracted, and mutation analysis of the three WS4 related genes was performed using Sanger sequencing. We detected a de novo heterozygous deletion mutation [c.1333delT (p.Ser445Glnfs*57)] in SOX10 in the patient; however, this mutation was absent in the unaffected parents and 40 ethnicity matched healthy controls. Subsequent phylogenetic analysis and three-dimensional modelling of the SOX10 protein confirmed that the c.1333delT heterozygous mutation was pathogenic, indicating that this mutation might constitute a candidate disease-causing mutation. PMID:28128317

Deletion Mutagenesis Downstream of the 5′ Long Terminal Repeat of Human Immunodeficiency Virus Type 1 Is Compensated for by Point Mutations in both the U5 Region and gag Gene

PubMed Central

Liang, Chen; Rong, Liwei; Russell, Rodney S.; Wainberg, Mark A.

2000-01-01

We have studied the role of an RNA region at nucleotides (nt) +200 to +233, just downstream of the 5′ long terminal repeat, in encapsidation of human immunodeficiency virus type 1 genomic RNA. Three deletion mutations, namely, BH-D0, BH-D1, and BH-D2, were generated to eliminate sequences at positions nt +200 to +219, +200 to +226, and +200 to +233. The result in each case was decreased levels of packaging of viral RNA into the mutated viruses, with the BH-D2 virus being the most severely affected. Consistently, all three deletions resulted in impaired viral infectiousness and the BH-D2 mutation showed the most dramatic impact in this regard. Further analysis revealed additional defects in Gag precursor processing and in the extension efficiency of the tRNA3Lys primer in reverse transcription reactions performed with these mutated viruses. To shed further light on the function of these deleted sequences in viral replication, the mutated viruses were cultured in MT-2 cells over prolonged periods to enable them to reacquire wild-type replication kinetics. Sequencing of the reverted viruses revealed point mutations in both the noncoding region and the gag gene. In the case of the BH-D0 revertant, two mutations were observed at positions G112A in the U5 region, termed M1, and T24I in the nucleocapsid protein, termed MNC, respectively. Either of these two mutations was able to confer wild-type replication capacity on BH-D0. In the case of BH-D1, each of the M1 mutations, a mutation termed M2, i.e., C227T, just downstream of the primer binding site, a mutation termed MP2 (T12I) in the p2 protein, and the MNC mutation were observed. A combination of either M1 and M2 or MP2 and MNC was able to rescue BH-D1. In the case of the BH-D2 deletion-containing viruses, three point mutations, i.e., M1, MP2, and MNC, were observed and the presence of all three was required to restore viral replication to wild-type levels. PMID:10864634

Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1.

PubMed

Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui; Liu, Mugen

2013-01-01

To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A.

Mutation analysis of the MYO7A and CDH23 genes in Japanese patients with Usher syndrome type 1.

PubMed

Nakanishi, Hiroshi; Ohtsubo, Masafumi; Iwasaki, Satoshi; Hotta, Yoshihiro; Takizawa, Yoshinori; Hosono, Katsuhiro; Mizuta, Kunihiro; Mineta, Hiroyuki; Minoshima, Shinsei

2010-12-01

Usher syndrome (USH) is an autosomal recessive disorder characterized by retinitis pigmentosa and hearing loss. USH type 1 (USH1), the second common type of USH, is frequently caused by MYO7A and CDH23 mutations, accounting for 70-80% of the cases among various ethnicities, including Caucasians, Africans and Asians. However, there have been no reports of mutation analysis for any responsible genes for USH1 in Japanese patients. This study describes the first mutation analysis of MYO7A and CDH23 in Japanese USH1 patients. Five mutations (three in MYO7A and two in CDH23) were identified in four of five unrelated patients. Of these mutations, two were novel. One of them, p.Tyr1942SerfsX23 in CDH23, was a large deletion causing the loss of 3 exons. This is the first large deletion to be found in CDH23. The incidence of the MYO7A and CDH23 mutations in the study population was 80%, which is consistent with previous findings. Therefore, mutation screening for these genes is expected to be a highly sensitive method for diagnosing USH1 among the Japanese.

Innate colour preference, individual learning and memory retention in the ant Camponotus blandus.

PubMed

Yilmaz, Ayse; Dyer, Adrian G; Rössler, Wolfgang; Spaethe, Johannes

2017-09-15

Ants are a well-characterized insect model for the study of visual learning and orientation, but the extent to which colour vision is involved in these tasks remains unknown. We investigated the colour preference, learning and memory retention of Camponotus blandus foragers under controlled laboratory conditions. Our results show that C. blandus foragers exhibit a strong innate preference for ultraviolet (UV, 365 nm) over blue (450 nm) and green (528 nm) wavelengths. The ants can learn to discriminate 365 nm from either 528 nm or 450 nm, independent of intensity changes. However, they fail to discriminate between 450 nm and 528 nm. Modelling of putative colour spaces involving different numbers of photoreceptor types revealed that colour discrimination performance of individual ants is best explained by dichromacy, comprising a short-wavelength (UV) receptor with peak sensitivity at about 360 nm, and a long-wavelength receptor with peak sensitivity between 470 nm and 560 nm. Foragers trained to discriminate blue or green from UV light are able to retain the learned colour information in an early mid-term (e-MTM), late mid-term (l-MTM), early long-term (e-LTM) and late long-term (l-LTM) memory from where it can be retrieved after 1 h, 12 h, 24 h, 3 days and 7 days after training, indicating that colour learning may induce different memory phases in ants. Overall, our results show that ants can use chromatic information in a way that should promote efficient foraging in complex natural environments. © 2017. Published by The Company of Biologists Ltd.

Testing multi-theory model (MTM) in predicting initiation and sustenance of physical activity behavior among college students.

PubMed

Nahar, Vinayak K; Sharma, Manoj; Catalano, Hannah Priest; Ickes, Melinda J; Johnson, Paul; Ford, M Allison

2016-01-01

Most college students do not adequately participate in enough physical activity (PA) to attain health benefits. A theory-based approach is critical in developing effective interventions to promote PA. The purpose of this study was to examine the utility of the newly proposed multi-theory model (MTM) of health behavior change in predicting initiation and sustenance of PA among college students. Using a cross-sectional design, a valid and reliable survey was administered in October 2015 electronically to students enrolled at a large Southern US University. The internal consistency Cronbach alphas of the subscales were acceptable (0.65-0.92). Only those who did not engage in more than 150 minutes of moderate to vigorous intensity aerobic PA during the past week were included in this study. Of the 495 respondents, 190 met the inclusion criteria of which 141 completed the survey. The majority of participants were females (72.3%) and Caucasians (70.9%). Findings of the confirmatory factor analysis (CFA) confirmed construct validity of subscales (initiation model: χ2 = 253.92 [df = 143], P < 0.001, CFI = 0.91, RMSEA = 0.07, SRMR = 0.07; sustenance model: χ2= 19.40 [df = 22], P < 0.001, CFI = 1.00, RMSEA = 0.00, SRMR = 0.03). Multivariate regression analysis showed that 26% of the variance in the PA initiation was explained by advantages outweighing disadvantages, behavioral confidence, work status, and changes in physical environment. Additionally, 29.7% of the variance in PA sustenance was explained by emotional transformation, practice for change, and changes in social environment. Based on this study's findings, MTM appears to be a robust theoretical framework for predicting PA behavior change. Future research directions and development of suitable intervention strategies are discussed.

Atmospheric particulate matter in proximity to mountaintop coal mines: Sources and potential environmental and human health impacts

USGS Publications Warehouse

Kurth, Laura; Kolker, Allan; Engle, Mark A.; Geboy, Nicholas J.; Hendryx, Michael; Orem, William H.; McCawley, Michael; Crosby, Lynn M.; Tatu, Calin A.; Varonka, Matthew S.; DeVera, Christina A.

2015-01-01

Mountaintop removal mining (MTM) is a widely used approach to surface coal mining in the US Appalachian region whereby large volumes of coal overburden are excavated using explosives, removed, and transferred to nearby drainages below MTM operations. To investigate the air quality impact of MTM, the geochemical characteristics of atmospheric particulate matter (PM) from five surface mining sites in south central West Virginia, USA, and five in-state study control sites having only underground coal mining or no coal mining whatsoever were determined and compared. Epidemiologic studies show increased rates of cancer, respiratory disease, cardiovascular disease, and overall mortality in Appalachian surface mining areas compared to Appalachian non-mining areas. In the present study, 24-h coarse (>2.5 µm) and fine (≤2.5 µm) PM samples were collected from two surface mining sites in June 2011 showed pronounced enrichment in elements having a crustal affinity (Ga, Al, Ge, Rb, La, Ce) contributed by local sources, relative to controls. Follow-up sampling in August 2011 lacked this enrichment, suggesting that PM input from local sources is intermittent. Using passive samplers, dry deposition total PM elemental fluxes calculated for three surface mining sites over multi-day intervals between May and August 2012 were 5.8 ± 1.5 times higher for crustal elements than at controls. Scanning microscopy of 2,249 particles showed that primary aluminosilicate PM was prevalent at surface mining sites compared to secondary PM at controls. Additional testing is needed to establish any link between input of lithogenic PM and disease rates in the study area.

Testing multi-theory model (MTM) in predicting initiation and sustenance of physical activity behavior among college students

PubMed Central

Nahar, Vinayak K.; Sharma, Manoj; Catalano, Hannah Priest; Ickes, Melinda J.; Johnson, Paul; Ford, M. Allison

2016-01-01

Background: Most college students do not adequately participate in enough physical activity (PA) to attain health benefits. A theory-based approach is critical in developing effective interventions to promote PA. The purpose of this study was to examine the utility of the newly proposed multi-theory model (MTM) of health behavior change in predicting initiation and sustenance of PA among college students. Methods: Using a cross-sectional design, a valid and reliable survey was administered in October 2015 electronically to students enrolled at a large Southern US University. The internal consistency Cronbach alphas of the subscales were acceptable (0.65-0.92). Only those who did not engage in more than 150 minutes of moderate to vigorous intensity aerobic PA during the past week were included in this study. Results: Of the 495 respondents, 190 met the inclusion criteria of which 141 completed the survey. The majority of participants were females (72.3%) and Caucasians (70.9%). Findings of the confirmatory factor analysis (CFA) confirmed construct validity of subscales (initiation model: χ2 = 253.92 [df = 143], P < 0.001, CFI = 0.91, RMSEA = 0.07, SRMR = 0.07; sustenance model: χ2= 19.40 [df = 22], P < 0.001, CFI = 1.00, RMSEA = 0.00, SRMR = 0.03). Multivariate regression analysis showed that 26% of the variance in the PA initiation was explained by advantages outweighing disadvantages, behavioral confidence, work status, and changes in physical environment. Additionally, 29.7% of the variance in PA sustenance was explained by emotional transformation, practice for change, and changes in social environment. Conclusion: Based on this study’s findings, MTM appears to be a robust theoretical framework for predicting PA behavior change. Future research directions and development of suitable intervention strategies are discussed. PMID:27386419

Atmospheric particulate matter in proximity to mountaintop coal mines: sources and potential environmental and human health impacts.

PubMed

Kurth, Laura; Kolker, Allan; Engle, Mark; Geboy, Nicholas; Hendryx, Michael; Orem, William; McCawley, Michael; Crosby, Lynn; Tatu, Calin; Varonka, Matthew; DeVera, Christina

2015-06-01

Mountaintop removal mining (MTM) is a widely used approach to surface coal mining in the US Appalachian region whereby large volumes of coal overburden are excavated using explosives, removed, and transferred to nearby drainages below MTM operations. To investigate the air quality impact of MTM, the geochemical characteristics of atmospheric particulate matter (PM) from five surface mining sites in south central West Virginia, USA, and five in-state study control sites having only underground coal mining or no coal mining whatsoever were determined and compared. Epidemiologic studies show increased rates of cancer, respiratory disease, cardiovascular disease, and overall mortality in Appalachian surface mining areas compared to Appalachian non-mining areas. In the present study, 24-h coarse (>2.5 µm) and fine (≤2.5 µm) PM samples were collected from two surface mining sites in June 2011 showed pronounced enrichment in elements having a crustal affinity (Ga, Al, Ge, Rb, La, Ce) contributed by local sources, relative to controls. Follow-up sampling in August 2011 lacked this enrichment, suggesting that PM input from local sources is intermittent. Using passive samplers, dry deposition total PM elemental fluxes calculated for three surface mining sites over multi-day intervals between May and August 2012 were 5.8 ± 1.5 times higher for crustal elements than at controls. Scanning microscopy of 2,249 particles showed that primary aluminosilicate PM was prevalent at surface mining sites compared to secondary PM at controls. Additional testing is needed to establish any link between input of lithogenic PM and disease rates in the study area.

Tooth agenesis in osteogenesis imperfecta related to mutations in the collagen type I genes.

PubMed

Malmgren, B; Andersson, K; Lindahl, K; Kindmark, A; Grigelioniene, G; Zachariadis, V; Dahllöf, G; Åström, E

2017-01-01

Osteogenesis imperfecta (OI) is a heterogeneous group of disorders of connective tissue, mainly caused by mutations in the collagen type I genes (COL1A1 and COL1A2). Tooth agenesis is a common feature of OI. We investigated the association between tooth agenesis and collagen type I mutations in individuals with OI. In this cohort study, 128 unrelated individuals with OI were included. Panoramic radiographs were analyzed regarding dentinogenesis imperfecta (DGI) and congenitally missing teeth. The collagen I genes were sequenced in all individuals, and in 25, multiplex ligation-dependent probe amplification was performed. Mutations in the COL1A1 and COL1A2 genes were found in 104 of 128 individuals. Tooth agenesis was diagnosed in 17% (hypodontia 11%, oligodontia 6%) and was more frequent in those with DGI (P = 0.016), and in those with OI type III, 47%, compared to those with OI types I, 12% (P = 0.003), and IV, 13% (P = 0.017). Seventy-five percent of the individuals with oligodontia (≥6 missing teeth) had qualitative mutations, but there was no association with OI type, gender, or presence of DGI. The prevalence of tooth agenesis is high (17%) in individuals with OI, and OI caused by a qualitative collagen I mutation is associated with oligodontia. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

NF1 mutations are recurrent in adult acute myeloid leukemia and confer poor outcome.

PubMed

Eisfeld, Ann-Kathrin; Kohlschmidt, Jessica; Mrózek, Krzysztof; Mims, Alice; Walker, Christopher J; Blachly, James S; Nicolet, Deedra; Orwick, Shelley; Maharry, Sophia E; Carroll, Andrew J; Powell, Bayard L; Kolitz, Jonathan E; Wang, Eunice S; Stone, Richard M; de la Chapelle, Albert; Byrd, John C; Bloomfield, Clara D

2018-06-05

Targeted mutation assessment of 81 genes in 1021 adults with de novo acute myeloid leukemia (AML) identified recurrent mutations in the neurofibromin 1 (NF1) gene in 52 (5.1%) patients, including 36 (5.2%) younger and 16 (4.8%) older patients, which suggests NF1 belongs to the 20 most frequently mutated genes in adult AML. NF1 mutations were found throughout the gene, and comprised missense, frameshift, and nonsense mutations. One mutation hotspot, at amino acid threonine 676 (Thr676), was found in 27% of AML patients with NF1 mutations. NF1-mutated patients belonged more often to the adverse European LeukemiaNet (ELN) risk category than NF1 wild-type patients. Among patients aged <60 years, the presence of NF1 Thr676 mutations was associated with lower complete remission (CR) rates (P = 0.04) and shorter overall survival (OS; P = 0.01), as was the presence of any NF1 mutation in patients in the adverse ELN risk category (CR, P = 0.05; OS, P < 0.001). CR rates were also lower in NF1-mutated patients aged ≥60 years compared with NF1 wild-type patients (P = 0.001). In summary, our findings provide novel insights into the frequency of NF1 mutations in AML, and are suggestive of an adverse prognostic impact in patients treated with standard chemotherapy.

A Novel NHERF1 Mutation in Human Breast Cancer and Effects on Malignant Progression.

PubMed

Yang, Xiaomei; Du, Guifang; Yu, Zhen; Si, Yang; Martin, Tracey A; He, Junqi; Cheng, Shan; Jiang, Wen G

2017-01-01

Na + /H + exchanger regulatory factor 1 (NHERF1) has been reported to interact with post-synaptic density protein/Drosophila disc large tumour suppressor/zonula occludens 1 protein (PDZ) binding proteins by its two PDZ domains. These associations have effects on cellular signal transductions. NHERF1 has also been indicated as a cancer-related gene in several solid tumour types. We identified a novel mutation (A190D), of the PDZ2 domain of NHERF1 in breast cancer tissues. NHERF1 A190D mutation abolished NHERF1 modulation of proliferation and migration. In this study, we found that NHERF1 A190D mutation increased nuclear localisation of the protein compared to wild-type NHERF1. It has been reported that YES-associated protein (YAP) interacts with NHERF1. Here we found that NHERF1 A190D mutation increased the binding affinity between NHERF1 and YAP, which inhibited the phosphorylation of YAP. These data suggest that wild-type NHERF1 acts as a tumour suppressor, while NHERF1 A190D mutation abolishes the tumour-suppressive effect in cancer cells, due to A190D mutation-mediated nuclear NHERF1 translocation and induction of YAP phosphorylation. Copyright© 2017 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

77 FR 46111 - Public Land Order No. 7792; Partial Revocation, Power Site Reserve No. 109; Montana

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-02

... DEPARTMENT OF THE INTERIOR Bureau of land management [MT-LLB05000-LL14300000-FQ0000; MTM 40412] Public Land Order No. 7792; Partial Revocation, Power Site Reserve No. 109; Montana AGENCY: Bureau of...--Policy, Management and Budget. [FR Doc. 2012-18888 Filed 8-1-12; 8:45 am] BILLING CODE 4310-DN-P ...

Geologic Map of the Olympia Cavi Region of Mars (MTM 85200): A Summary of Tactical Approaches

NASA Technical Reports Server (NTRS)

Skinner, J. A., Jr.; Herkenhoff, K.

2010-01-01

The 1:500K-scale geologic map of MTM 85200 - the Olympia Cavi region of Mars - has been submitted for peer review [1]. Physiographically, the quadrangle includes portions of Olympia Rupes, a set of sinuous scarps which elevate Planum Boreum 800 meters above Olympia Planum. The region includes the high-standing, spiral troughs of Boreales Scopuli, the rugged and deep depressions of Olympia Cavi, and the vast dune fields of Olympia Undae. Geologically, the mapped units and landforms reflect the recent history of repeated accumulation and degradation. The widespread occurrence of both weakly and strongly stratified units implicates the drape-like accumulation of ice, dust, and sand through climatic variations. Similarly, the occurrence of layer truncations, particularly at unit boundaries, implicates punctuated periods of both localized and regional erosion and surface deflation whereby underlying units were exhumed and their material transported and re-deposited. Herein, we focus on the iterative mapping approaches that allowed not only the accommodation of the burgeoning variety and volume of data sets, but also facilitated the efficient presentation of map information. Unit characteristics and their geologic history are detailed in past abstracts [2-3].

Identification of a novel nonsense mutation and a missense substitution in the AGPAT2 gene causing congenital generalized lipodystrophy type 1

PubMed Central

Haghighi, Amirreza; Razzaghy-Azar, Maryam; Talea, Ali; Sadeghian, Mahnaz; Ellard, Sian; Haghighi, Alireza

2012-01-01

Congenital generalized lipodystrophy (CGL) is an autosomal recessive disease characterized by the generalized scant of adipose tissue. CGL type 1 is caused by mutations in gene encoding 1-acylglycerol-3-phosphate O-acyltransferase-2 (AGPAT2). A clinical and molecular genetic investigation was performed in affected and unaffected members of two families with CGL type 1. The AGPAT2 coding region was sequenced in index cases of the two families. The presence of the identified mutations in relevant parents was tested. We identified a novel nonsense mutation (c.685G>T, p.Glu229*) and a missense substitution (c.514G>A, p.Glu172Lys). The unaffected parents in both families were heterozygous carrier of the relevant mutation. The results expand genotype–phenotype spectrum in CGL1 and will have applications in prenatal and early diagnosis of the disease. This is the first report of Persian families identified with AGPAT2 mutations. PMID:22902344

Fabrication of a First Article Lightweight Composite Technology Demonstrator - Exospine

DTIC Science & Technology

2014-01-01

core, (b) 0/90, and (c) ± 45 ply cuts of ACG-MTM 45-1/CF0526 prepreg fabric...onboard diagnostics. 2. Experimental 2.1 Materials Plain woven carbon fiber/epoxy prepreg and a low-density foam core were provided to ARL for the...fabrication of the exospine technology demonstrator by UD-CCM. The prepreg was ACG - MTM∗ 45-1/CF0526 and has a cured ply thickness of 0.201 mm. It is

Bioinformatic Analysis of Pathogenic Missense Mutations of Activin Receptor Like Kinase 1 Ectodomain

PubMed Central

Scotti, Claudia; Olivieri, Carla; Boeri, Laura; Canzonieri, Cecilia; Ornati, Federica; Buscarini, Elisabetta; Pagella, Fabio; Danesino, Cesare

2011-01-01

Activin A receptor, type II-like kinase 1 (also called ALK1), is a serine-threonine kinase predominantly expressed on endothelial cells surface. Mutations in its ACVRL1 encoding gene (12q11-14) cause type 2 Hereditary Haemorrhagic Telangiectasia (HHT2), an autosomal dominant multisystem vascular dysplasia. The study of the structural effects of mutations is crucial to understand their pathogenic mechanism. However, while an X-ray structure of ALK1 intracellular domain has recently become available (PDB ID: 3MY0), structure determination of ALK1 ectodomain (ALK1EC) has been elusive so far. We here describe the building of a homology model for ALK1EC, followed by an extensive bioinformatic analysis, based on a set of 38 methods, of the effect of missense mutations at the sequence and structural level. ALK1EC potential interaction mode with its ligand BMP9 was then predicted combining modelling and docking data. The calculated model of the ALK1EC allowed mapping and a preliminary characterization of HHT2 associated mutations. Major structural changes and loss of stability of the protein were predicted for several mutations, while others were found to interfere mainly with binding to BMP9 or other interactors, like Endoglin (CD105), whose encoding ENG gene (9q34) mutations are known to cause type 1 HHT. This study gives a preliminary insight into the potential structure of ALK1EC and into the structural effects of HHT2 associated mutations, which can be useful to predict the potential effect of each single mutation, to devise new biological experiments and to interpret the biological significance of new mutations, private mutations, or non-synonymous polymorphisms. PMID:22028876

A mutational signature in gastric cancer suggests therapeutic strategies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexandrov, Ludmil B.; Nik-Zainal, Serena; Siu, Hoi Cheong

Targeting defects in the DNA repair machinery of neoplastic cells, for example, those due to inactivating BRCA1 and/or BRCA2 mutations, has been used for developing new therapies in certain types of breast, ovarian and pancreatic cancers. Recently, a mutational signature was associated with failure of double-strand DNA break repair by homologous recombination based on its high mutational burden in samples harbouring BRCA1 or BRCA2 mutations. In pancreatic cancer, all responders to platinum therapy exhibit this mutational signature including a sample that lacked any defects in BRCA1 or BRCA2. Here, we examine 10,250 cancer genomes across 36 types of cancer andmore » demonstrate that, in addition to breast, ovarian and pancreatic cancers, gastric cancer is another cancer type that exhibits this mutational signature. Furthermore, our results suggest that 7–12% of gastric cancers have defective double-strand DNA break repair by homologous recombination and may benefit from either platinum therapy or PARP inhibitors.« less

A mutational signature in gastric cancer suggests therapeutic strategies

DOE PAGES

Alexandrov, Ludmil B.; Nik-Zainal, Serena; Siu, Hoi Cheong; ...

2015-10-29

Targeting defects in the DNA repair machinery of neoplastic cells, for example, those due to inactivating BRCA1 and/or BRCA2 mutations, has been used for developing new therapies in certain types of breast, ovarian and pancreatic cancers. Recently, a mutational signature was associated with failure of double-strand DNA break repair by homologous recombination based on its high mutational burden in samples harbouring BRCA1 or BRCA2 mutations. In pancreatic cancer, all responders to platinum therapy exhibit this mutational signature including a sample that lacked any defects in BRCA1 or BRCA2. Here, we examine 10,250 cancer genomes across 36 types of cancer andmore » demonstrate that, in addition to breast, ovarian and pancreatic cancers, gastric cancer is another cancer type that exhibits this mutational signature. Furthermore, our results suggest that 7–12% of gastric cancers have defective double-strand DNA break repair by homologous recombination and may benefit from either platinum therapy or PARP inhibitors.« less

Role of mutations G-480 and C-6203 in the attenuation phenotype of Sabin type 1 poliovirus.

PubMed

McGoldrick, A; Macadam, A J; Dunn, G; Rowe, A; Burlison, J; Minor, P D; Meredith, J; Evans, D J; Almond, J W

1995-12-01

Of the 55 point mutations which distinguish the type 1 poliovirus vaccine strain (Sabin 1) from its neurovirulent progenitor (P1/Mahoney), two have been strongly implicated by previous studies as determinants of the attenuation phenotype. A change of an A to a G at position 480, located within the 5' noncoding region, has been suggested to be the major attenuating mutation, analogous to the mutations at positions 481 and 472 in poliovirus types 2 and 3, respectively. In addition, the change of a U to a C at position 6203, resulting in an amino acid change in the polymerase protein 3D, has also been implicated as a determinant of attenuation, albeit to a lesser extent. To assess the contributions of these mutations to attenuation and temperature sensitivity, reciprocal changes were generated at these positions in infectious cDNA clones of Sabin 1 and P1/Mahoney. Assays in tissue culture and primates indicated that the two mutations make some contribution to the temperature sensitivity of the Sabin 1 strain but that neither is a strong determinant of attenuation.

The 1448C mutation in Chinese with type 1 and 2 Gaucher disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsai, F.J.; Tsai, C.H.

1994-09-01

Gaucher disease (GD) is the most common glycolipid storage disorder. Just 5 mutations account for over 97% of all the alleles that produce enzyme deficiency in the Ashkenazic Jewish population. However, GD occurs in all populations but with a much lower frequency, as is the case with other mutations that are common in a single ethnic group. To characterize the molecular basis of Chinese with GD, two cases of GD was analyzed (type 1 and type 2) by selective amplification and restriction endonuclease analysis. Homozygosity of this mutation seems to result in neuronopathic GD (type 2 or 3), but somemore » exceptional cases have been reported. Our results show that the existence of the 1448C mutation in Chinese patients is similar to that of other ethnic groups. In our case 2, who had a homozygotic 1448C mutation but without any CNS manifestation, type 1 GD was diagnosed. In view of the young age of the patient (11 year old), he may develop neurological disease later in life. We suggest that such a case should be followed to observe if any neurological sign becomes present. Patients with GD sharing identical genotypes can exhibit different phenotypic pictures. Thus one cannot rely solely on DNA mutation analysis to predict prognosis in GD. The Chinese mutation data of GD presented here can support this hypothesis.« less

Laboratory diagnosis of von Willebrand disease type 1/2E (2A subtype IIE), type 1 Vicenza and mild type 1 caused by mutations in the D3, D4, B1-B3 and C1-C2 domains of the von Willebrand factor gene. Role of von Willebrand factor multimers and the von Willebrand factor propeptide/antigen ratio.

PubMed

Gadisseur, Alain; Berneman, Zwi; Schroyens, Wilfried; Michiels, Jan Jacques

2009-01-01

Autosomal dominant von Willebrand disease (VWD) type 1/2E is a quantitative/qualitative defect in the von Willebrand factor (VWF) caused by heterozygous cysteine and non-cysteine mutations in the D3 domain of the VWF gene and results in a secretion-multimerization-clearance defect in mutant VWF with the loss of large VWF multimers not due to proteolysis. The multimers of patients with dominant VWD type 1/2E due to mutations in the D3 domain show an aberrant triplet structure with lack of outer bands but with pronounced inner bands of the triplet structure combined with a relative decrease in large multimers reflecting heterozygosity for multimerization defects. There is a good response to desmopressin (DDAVP) followed by rapid clearance of VWF:antigen (Ag), factor VIII coagulant activity (FVIII:C) and VWF:ristocetin cofactor activity (RCo) as the main cause of VWD type 1 or 2 with typical 2E multimeric pattern (VWD type 1/2E). Cysteine mutations in the D3 domains (C1130, C1149 and C1190) show pronounced features of VWD 1/2E with the relative loss of large and relative increase in small VWF multimers with abnormal triplet structure in heterozygotes. Such abnormalities are less pronounced in patients with a milder form of VWD type 1 due to non-cysteine mutations W1144G, T1156M and W1120S in the D3 domain. VWD type 1 Vicenza is caused by the R1205H mutation in the D3 domain and characterized by equally low levels of FVIII:C, VWF:Ag and VWF:RCo. The response to DDAVP in VWD Vicenza is good for FVIII:C, VWF:Ag and VWF:RCo, which is followed by a rapid clearance in less than a few hours of FVIII:C and VWF parameters. The ratios for FVIII:C/VWF:Ag, VWF:RCo/Ag and VWF:CB/Ag remain normal before and after DDAVP indicating that VWD Vicenza clearly differs from VWD type 1, 1/2E and 2M. A new set of missense mutations in D4, B1-B3 and C1-C2 domains has been discovered as the cause of a mild VWD type 1 secretion defect with normal VWF multimers or smeary VWF multimeric pattern. Cysteine mutations in exons 38, 40, 42 and 43 (D4, B1-B3 and C1 domain), show smeary patterns (either smf or sm), with the presence of large VWF multimers and a laboratory phenotype of mild VWD type 1 with variable penetrance of bleeding manifestations. Recent studies showed that the ratio of VWF propeptide (pp) to VWF:Ag can be used to predict a shorter than normal half-life for VWF:Ag. There is a strong inverse correlation between rapid clearance of VWF:Ag after DDAVP and increased VWFpp/Ag ratios >10 in VWD type 1 Vicenza, and >2 in VWD type 1/2E but normal or slightly increased (1-<2) VWFpp/Ag ratios in mild-type VWD due to nonsense or missense mutations in the D1, D2, D4, B and C domains. Copyright (c) 2009 S. Karger AG, Basel.

Association of Climatic Variability, Vector Population and Malarial Disease in District of Visakhapatnam, India: A Modeling and Prediction Analysis.

PubMed

Srimath-Tirumula-Peddinti, Ravi Chandra Pavan Kumar; Neelapu, Nageswara Rao Reddy; Sidagam, Naresh

2015-01-01

Malarial incidence, severity, dynamics and distribution of malaria are strongly determined by climatic factors, i.e., temperature, precipitation, and relative humidity. The objectives of the current study were to analyse and model the relationships among climate, vector and malaria disease in district of Visakhapatnam, India to understand malaria transmission mechanism (MTM). Epidemiological, vector and climate data were analysed for the years 2005 to 2011 in Visakhapatnam to understand the magnitude, trends and seasonal patterns of the malarial disease. Statistical software MINITAB ver. 14 was used for performing correlation, linear and multiple regression analysis. Perennial malaria disease incidence and mosquito population was observed in the district of Visakhapatnam with peaks in seasons. All the climatic variables have a significant influence on disease incidence as well as on mosquito populations. Correlation coefficient analysis, seasonal index and seasonal analysis demonstrated significant relationships among climatic factors, mosquito population and malaria disease incidence in the district of Visakhapatnam, India. Multiple regression and ARIMA (I) models are best suited models for modeling and prediction of disease incidences and mosquito population. Predicted values of average temperature, mosquito population and malarial cases increased along with the year. Developed MTM algorithm observed a major MTM cycle following the June to August rains and occurring between June to September and minor MTM cycles following March to April rains and occurring between March to April in the district of Visakhapatnam. Fluctuations in climatic factors favored an increase in mosquito populations and thereby increasing the number of malarial cases. Rainfall, temperatures (20°C to 33°C) and humidity (66% to 81%) maintained a warmer, wetter climate for mosquito growth, parasite development and malaria transmission. Changes in climatic factors influence malaria directly by modifying the behaviour and geographical distribution of vectors and by changing the length of the life cycle of the parasite.

Association of Climatic Variability, Vector Population and Malarial Disease in District of Visakhapatnam, India: A Modeling and Prediction Analysis

PubMed Central

Srimath-Tirumula-Peddinti, Ravi Chandra Pavan Kumar; Neelapu, Nageswara Rao Reddy; Sidagam, Naresh

2015-01-01

Background Malarial incidence, severity, dynamics and distribution of malaria are strongly determined by climatic factors, i.e., temperature, precipitation, and relative humidity. The objectives of the current study were to analyse and model the relationships among climate, vector and malaria disease in district of Visakhapatnam, India to understand malaria transmission mechanism (MTM). Methodology Epidemiological, vector and climate data were analysed for the years 2005 to 2011 in Visakhapatnam to understand the magnitude, trends and seasonal patterns of the malarial disease. Statistical software MINITAB ver. 14 was used for performing correlation, linear and multiple regression analysis. Results/Findings Perennial malaria disease incidence and mosquito population was observed in the district of Visakhapatnam with peaks in seasons. All the climatic variables have a significant influence on disease incidence as well as on mosquito populations. Correlation coefficient analysis, seasonal index and seasonal analysis demonstrated significant relationships among climatic factors, mosquito population and malaria disease incidence in the district of Visakhapatnam, India. Multiple regression and ARIMA (I) models are best suited models for modeling and prediction of disease incidences and mosquito population. Predicted values of average temperature, mosquito population and malarial cases increased along with the year. Developed MTM algorithm observed a major MTM cycle following the June to August rains and occurring between June to September and minor MTM cycles following March to April rains and occurring between March to April in the district of Visakhapatnam. Fluctuations in climatic factors favored an increase in mosquito populations and thereby increasing the number of malarial cases. Rainfall, temperatures (20°C to 33°C) and humidity (66% to 81%) maintained a warmer, wetter climate for mosquito growth, parasite development and malaria transmission. Conclusions/Significance Changes in climatic factors influence malaria directly by modifying the behaviour and geographical distribution of vectors and by changing the length of the life cycle of the parasite. PMID:26110279

Mutations of the KISS1 Gene in Disorders of Puberty

PubMed Central

Silveira, L. G.; Noel, S. D.; Silveira-Neto, A. P.; Abreu, A. P.; Brito, V. N.; Santos, M. G.; Bianco, S. D. C.; Kuohung, W.; Xu, S.; Gryngarten, M.; Escobar, M. E.; Arnhold, I. J. P.; Mendonca, B. B.; Kaiser, U. B.; Latronico, A. C.

2010-01-01

Context: Kisspeptin, encoded by the KISS1 gene, is a key stimulatory factor of GnRH secretion and puberty onset. Inactivating mutations of its receptor (KISS1R) cause isolated hypogonadotropic hypogonadism (IHH). A unique KISS1R-activating mutation was described in central precocious puberty (CPP). Objective: Our objective was to investigate KISS1 mutations in patients with idiopathic CPP and normosmic IHH. Patients: Eighty-three children with CPP (77 girls) and 61 patients with IHH (40 men) were studied. The control group consisted of 200 individuals with normal pubertal development. Methods: The promoter region and the three exons of KISS1 were amplified and sequenced. Cells expressing KISS1R were stimulated with synthetic human wild-type or mutant kisspeptin-54 (kp54), and inositol phosphate accumulation was measured. In a second set of experiments, kp54 was preincubated in human serum before stimulation of the cells. Results: Two novel KISS1 missense mutations, p.P74S and p.H90D, were identified in three unrelated children with idiopathic CPP. Both mutations were absent in 400 control alleles. The p.P74S mutation was identified in the heterozygous state in a boy who developed CPP at 1 yr of age. The p.H90D mutation was identified in the homozygous state in two unrelated girls with CPP. In vitro studies revealed that the capacity of the P74S and H90D mutants to stimulate IP production was similar to the wild type. After preincubation of wild-type and mutant kp54 in human serum, the capacity to stimulate signal transduction was significantly greater for P74S compared with the wild type, suggesting that the p.P74S variant is more stable. Only polymorphisms were found in the IHH group. Conclusion: Two KISS1 mutations were identified in unrelated patients with idiopathic CPP. The p.P74S variant was associated with higher kisspeptin resistance to degradation in comparison with the wild type, suggesting a role for this mutation in the precocious puberty phenotype. PMID:20237166

Mutations of the KISS1 gene in disorders of puberty.

PubMed

Silveira, L G; Noel, S D; Silveira-Neto, A P; Abreu, A P; Brito, V N; Santos, M G; Bianco, S D C; Kuohung, W; Xu, S; Gryngarten, M; Escobar, M E; Arnhold, I J P; Mendonca, B B; Kaiser, U B; Latronico, A C

2010-05-01

Kisspeptin, encoded by the KISS1 gene, is a key stimulatory factor of GnRH secretion and puberty onset. Inactivating mutations of its receptor (KISS1R) cause isolated hypogonadotropic hypogonadism (IHH). A unique KISS1R-activating mutation was described in central precocious puberty (CPP). Our objective was to investigate KISS1 mutations in patients with idiopathic CPP and normosmic IHH. Eighty-three children with CPP (77 girls) and 61 patients with IHH (40 men) were studied. The control group consisted of 200 individuals with normal pubertal development. The promoter region and the three exons of KISS1 were amplified and sequenced. Cells expressing KISS1R were stimulated with synthetic human wild-type or mutant kisspeptin-54 (kp54), and inositol phosphate accumulation was measured. In a second set of experiments, kp54 was preincubated in human serum before stimulation of the cells. Two novel KISS1 missense mutations, p.P74S and p.H90D, were identified in three unrelated children with idiopathic CPP. Both mutations were absent in 400 control alleles. The p.P74S mutation was identified in the heterozygous state in a boy who developed CPP at 1 yr of age. The p.H90D mutation was identified in the homozygous state in two unrelated girls with CPP. In vitro studies revealed that the capacity of the P74S and H90D mutants to stimulate IP production was similar to the wild type. After preincubation of wild-type and mutant kp54 in human serum, the capacity to stimulate signal transduction was significantly greater for P74S compared with the wild type, suggesting that the p.P74S variant is more stable. Only polymorphisms were found in the IHH group. Two KISS1 mutations were identified in unrelated patients with idiopathic CPP. The p.P74S variant was associated with higher kisspeptin resistance to degradation in comparison with the wild type, suggesting a role for this mutation in the precocious puberty phenotype.

Association Between Molecular Subtypes of Colorectal Cancer and Patient Survival

PubMed Central

Phipps, Amanda I.; Limburg, Paul J.; Baron, John A.; Burnett-Hartman, Andrea N.; Weisenberger, Daniel J.; Laird, Peter W.; Sinicrope, Frank A.; Rosty, Christophe; Buchanan, Daniel D.; Potter, John D.; Newcomb, Polly A.

2014-01-01

Background and Aims. Colorectal cancer (CRC) is a heterogeneous disease that can develop via several pathways. Different CRC subtypes, identified based on tumor markers, have been proposed to reflect these pathways. We evaluated the significance of these previously proposed classifications to survival. Methods. Participants in the population-based Seattle Colon Cancer Family Registry were diagnosed with invasive CRC from 1998 through 2007 in western Washington State (n=2706), and followed for survival through 2012. Tumor samples were collected from 2050 participants and classified into 5 subtypes based on combinations of tumor markers: type 1 (microsatellite instability [MSI] high, CpG island methylator phenotype [CIMP] positive, positive for BRAF mutation, negative for KRAS mutation); type 2 (microsatellite stable [MSS] or MSI-low, CIMP-positive, positive for BRAF mutation, negative for KRAS mutation); type 3 (MSS or MSI-low, non-CIMP, negative for BRAF mutation, positive for KRAS mutation); type 4 (MSS or MSI-low, non-CIMP, negative for mutations in BRAF and KRAS); and type 5 (MSI-high, non-CIMP, negative for mutations in BRAF and KRAS). Multiple imputation was used to impute tumor markers for those missing data on 1-3 markers. We used Cox regression to estimate hazard ratios (HR) and 95% confidence intervals (CI) for associations of subtypes with disease-specific and overall mortality, adjusting for age, sex, body mass, diagnosis year, and smoking history. Results. Compared to participants with type 4 tumors (the most predominant), participants with type 2 tumors had the highest disease-specific mortality (HR=2.20, 95% CI: 1.47-3.31); subjects with type 3 tumors also had higher disease-specific mortality (HR=1.32, 95% CI: 1.07-1.63). Subjects with type 5 tumors had the lowest disease-specific mortality (HR=0.30, 95% CI: 0.14-0.66). Associations with overall mortality were similar to those with disease-specific mortality. Conclusions. Based on a large, population-based study, CRC subtypes, defined by proposed etiologic pathways, are associated with marked differences in survival. These findings indicate the clinical importance of studies into the molecular heterogeneity of CRC. PMID:25280443

Association between molecular subtypes of colorectal cancer and patient survival.

PubMed

Phipps, Amanda I; Limburg, Paul J; Baron, John A; Burnett-Hartman, Andrea N; Weisenberger, Daniel J; Laird, Peter W; Sinicrope, Frank A; Rosty, Christophe; Buchanan, Daniel D; Potter, John D; Newcomb, Polly A

2015-01-01

Colorectal cancer (CRC) is a heterogeneous disease that can develop via several pathways. Different CRC subtypes, identified based on tumor markers, have been proposed to reflect these pathways. We evaluated the significance of these previously proposed classifications to survival. Participants in the population-based Seattle Colon Cancer Family Registry were diagnosed with invasive CRC from 1998 through 2007 in western Washington State (N = 2706), and followed for survival through 2012. Tumor samples were collected from 2050 participants and classified into 5 subtypes based on combinations of tumor markers: type 1 (microsatellite instability [MSI]-high, CpG island methylator phenotype [CIMP] -positive, positive for BRAF mutation, negative for KRAS mutation); type 2 (microsatellite stable [MSS] or MSI-low, CIMP-positive, positive for BRAF mutation, negative for KRAS mutation); type 3 (MSS or MSI low, non-CIMP, negative for BRAF mutation, positive for KRAS mutation); type 4 (MSS or MSI-low, non-CIMP, negative for mutations in BRAF and KRAS); and type 5 (MSI-high, non-CIMP, negative for mutations in BRAF and KRAS). Multiple imputation was used to impute tumor markers for those missing data on 1-3 markers. We used Cox regression to estimate hazard ratios (HR) and 95% confidence intervals (CI) for associations of subtypes with disease-specific and overall mortality, adjusting for age, sex, body mass, diagnosis year, and smoking history. Compared with participants with type 4 tumors (the most predominant), participants with type 2 tumors had the highest disease-specific mortality (HR = 2.20, 95% CI: 1.47-3.31); subjects with type 3 tumors also had higher disease-specific mortality (HR = 1.32, 95% CI: 1.07-1.63). Subjects with type 5 tumors had the lowest disease-specific mortality (HR = 0.30, 95% CI: 0.14-0.66). Associations with overall mortality were similar to those with disease-specific mortality. Based on a large, population-based study, CRC subtypes, defined by proposed etiologic pathways, are associated with marked differences in survival. These findings indicate the clinical importance of studies into the molecular heterogeneity of CRC. Copyright © 2015 AGA Institute. Published by Elsevier Inc. All rights reserved.

Identification of HNF4A Mutation p.T130I and HNF1A Mutations p.I27L and p.S487N in a Han Chinese Family with Early-Onset Maternally Inherited Type 2 Diabetes.

PubMed

Yang, Ying; Zhou, Tai-Cheng; Liu, Yong-Ying; Li, Xiao; Wang, Wen-Xue; Irwin, David M; Zhang, Ya-Ping

2016-01-01

Maturity-onset diabetes of the young (MODY) is characterized by the onset of diabetes before the age of 25 years, positive family history, high genetic predisposition, monogenic mutations, and an autosomal dominant mode of inheritance. Here, we aimed to investigate the mutations and to characterize the phenotypes of a Han Chinese family with early-onset maternally inherited type 2 diabetes. Detailed clinical assessments and genetic screening for mutations in the HNF4α, GCK, HNF-1α, IPF-1, HNF1β, and NEUROD1 genes were carried out in this family. One HNF4A mutation (p.T130I) and two HNF1A polymorphisms (p.I27L and p.S487N) were identified. Mutation p.T130I was associated with both early-onset and late-onset diabetes and caused downregulated HNF4A expression, whereas HNF1A polymorphisms p.I27L and p.S487N were associated with the age of diagnosis of diabetes. We demonstrated that mutation p.T130I in HNF4A was pathogenic as were the predicted polymorphisms p.I27L and p.S487N in HNF1A by genetic and functional analysis. Our results show that mutations in HNF4A and HNF1A genes might account for this early-onset inherited type 2 diabetes.

Premature chain termination is a unifying mechanism for COL1A1 null alleles in osteogenesis imperfecta type I cell strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willing, M.C.; Deschenes, S.P.; Roberts, E.J.

Nonsense and frameshift mutations, which predict premature termination of translation, often cause a dramatic reduction in the amount of transcript from the mutant allele (nonsense-mediated mRNA decay). In some genes, these mutations also influence RNA splicing and induce skipping of the exon that contains the nonsense codon. To begin to dissect how premature termination alters the metabolism of RNA from the COL1A1 gene, we studied nonsense and frameshift mutations distributed over exons 11-49 of the gene. These mutations were originally identified in 10 unrelated families with osteogenesis imperfecta (OI) type I. We observed marked reduction in steady-state amounts of mRNAmore » from the mutant allele in both total cellular and nuclear RNA extracts of cells from affected individuals, suggesting that nonsense-mediated decay of COL1A1 RNA is a nuclear phenomenon. Position of the mutation within the gene did not influence this observation. None of the mutations induced skipping of either the exon containing the mutation or, for the frameshifts, the downstream exons with the new termination sites. Our data suggest that nonsense and frameshift mutations throughout most of the COL1A1 gene result in a null allele, which is associated with the predictable mild clinical phenotype, OI type I. 42 refs., 6 figs., 1 tab.« less

CALR, JAK2 and MPL mutation status in Argentinean patients with BCR-ABL1- negative myeloproliferative neoplasms.

PubMed

Ojeda, Mara Jorgelina; Bragós, Irma Margarita; Calvo, Karina Lucrecia; Williams, Gladis Marcela; Carbonell, María Magdalena; Pratti, Arianna Flavia

2018-05-01

To establish the frequency of JAK2, MPL and CALR mutations in Argentinean patients with BCR-ABL1-negative  myeloproliferative neoplasms (MPN) and to compare their clinical and haematological features. Mutations of JAK2V617F, JAK2 exon 12, MPL W515L/K and CALR were analysed in 439 Argentinean patients with BCR-ABL1-negative MPN, including 176 polycythemia vera (PV), 214 essential thrombocythemia (ET) and 49 primary myelofibrosis (PMF). In 94.9% of PV, 85.5% ET and 85.2% PMF, we found mutations in JAK2, MPL or CALR. 74.9% carried JAK2V617F, 12.3% CALR mutations, 2.1% MPL mutations and 10.7% were triple negative. In ET, nine types of CALR mutations were identified, four of which were novel. PMF patients were limited to types 1 and 2, type 2 being more frequent. In ET, patients with CALR mutation were younger and had higher platelet counts than those with JAK2V617F and triple negative. In addition, JAK2V617F patients had high leucocyte and haemoglobin values compared with CALR-mutated and triple-negative patients. In PMF, patients with mutant CALR were associated with higher platelet counts. Our study underscores the importance of JAK2, MPL and CALR genotyping for accurate diagnosis of patients with BCR-ABL1-negative MPN.

Expanding the spectrum of genetic mutations in antenatal Bartter syndrome type II.

PubMed

Fretzayas, Andreas; Gole, Evangelia; Attilakos, Achilleas; Daskalaki, Anna; Nicolaidou, Polyxeni; Papadopoulou, Anna

2013-06-01

Bartter syndrome (BS) is a group of genetic disorders characterized by hypokalemic metabolic alkalosis, hyponatremia and elevated renin and aldosterone plasma concentrations. BS type II is caused by mutations in the KCNJ1 gene and usually presents with transient hyperkalemia. We report here a novel KCNJ1 mutation in a male neonate, prematurely born after a pregnancy complicated by polyhydramnios. The infant presented with typical clinical and laboratory findings of BS type II, such as hyponatremia, hypochloremic metabolic alkalosis, severe weight loss, elevated renin and aldosterone levels and transient hyperkalemia in the early postnatal period, which were later normalized. Molecular analysis revealed a compound heterozygous mutation in the KCNJ1 gene, consisting of a novel K76E and an already described V315G mutation, both affecting functional domains of the channel protein. Typical manifestations of antenatal BS in combination with hyperkalemia should prompt the clinician to search for mutations in the KCNJ1 gene first. © 2013 The Authors. Pediatrics International © 2013 Japan Pediatric Society.

DNA analysis of an uncommon missense mutation in a Gaucher disease patient of Jewish-Polish-Russian descent

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choy, F.Y.M.; Wei, C.; Applegarth, D.A.

1994-06-01

Gaucher disease is the most frequent lysosomal lipid storage disease. It results from deficient glucocerebrosidase activity and is transmitted as an autosomal recessive trait. Three clinical forms of Gaucher disease have been described: type 1, non-neuronopathic; type 2, acute neuronopathic; and type 3, subacute neuronopathic. We have sequenced the full length cDNA of the glucocerebrosidase gene and identified an uncommon mutation in nucleotide position 1604 (genoma DNA nucleotide position 6683) from a Gaucher disease patient of Jewish-Polish-Russian descent with type 1 Gaucher disease. It is a G{yields}A transition in exon 11 that results in {sup 496}Arg{yields}{sup 496}His of glucocerebrosidase. Thismore » missense mutation is present in the heterozygous form and creates a new cleavage site for the endonuclease HphI. We have developed a simple method to detect the presence of this mutation by using HphI restriction fragment length polymorphism analysis of glucocerebrosidase genomic DNA or cDNA. The mutation in the other Gaucher allele of this patient is an A{yields}G transition at cDNA nucleotide position 1226 which creates an XhoI cleavage site after PCR mismatch amplification. The presence of this mutation was also confirmed by sequence analysis. Based on previous reports that mutation 1226 is present only in type 1 Gaucher disease and the observation that there is no neurological involvement in this patient, we conclude that our patient with the 1226/1604 genotype is diagnosed as having type 1 Gaucher disease. Since it was also postulated that mutation 1226 in the homozygous form will usually result in a good prognosis, we speculate that the orthopedic complications and the unusual presence of glomerulosclerosis in this patient may be attributable to the mutation at nucleotide 1604. This speculation will require a description of more patients with this mutation for confirmation. 32 refs., 5 figs.« less

Factors influencing clinical outcome in patients with primary hyperoxaluria type 1.

PubMed

Fargue, Sonia

2014-12-01

The renal outcome in patients with primary hyperoxaluria type 1 is partly determined by AGXT mutations, including but not limited to the p.Gly170Arg mutation. The study by Mandrile et al. reports on the largest cohort of patients genotyped yet, with long-term renal survival and medical treatment by pyridoxine. In addition to the common p.Gly170Arg mutation, three other mutations were shown to be potentially associated with slower evolution.

Exome sequencing identifies a DNAJB6 mutation in a family with dominantly-inherited limb-girdle muscular dystrophy.

PubMed

Couthouis, Julien; Raphael, Alya R; Siskind, Carly; Findlay, Andrew R; Buenrostro, Jason D; Greenleaf, William J; Vogel, Hannes; Day, John W; Flanigan, Kevin M; Gitler, Aaron D

2014-05-01

Limb-girdle muscular dystrophy primarily affects the muscles of the hips and shoulders (the "limb-girdle" muscles), although it is a heterogeneous disorder that can present with varying symptoms. There is currently no cure. We sought to identify the genetic basis of limb-girdle muscular dystrophy type 1 in an American family of Northern European descent using exome sequencing. Exome sequencing was performed on DNA samples from two affected siblings and one unaffected sibling and resulted in the identification of eleven candidate mutations that co-segregated with the disease. Notably, this list included a previously reported mutation in DNAJB6, p.Phe89Ile, which was recently identified as a cause of limb-girdle muscular dystrophy type 1D. Additional family members were Sanger sequenced and the mutation in DNAJB6 was only found in affected individuals. Subsequent haplotype analysis indicated that this DNAJB6 p.Phe89Ile mutation likely arose independently of the previously reported mutation. Since other published mutations are located close by in the G/F domain of DNAJB6, this suggests that the area may represent a mutational hotspot. Exome sequencing provided an unbiased and effective method for identifying the genetic etiology of limb-girdle muscular dystrophy type 1 in a previously genetically uncharacterized family. This work further confirms the causative role of DNAJB6 mutations in limb-girdle muscular dystrophy type 1D. Copyright © 2014 Elsevier B.V. All rights reserved.

A New COL3A1 Mutation in Ehlers-Danlos Syndrome Vascular Type With Different Phenotypes in the Same Family.

PubMed

Cortini, Francesca; Marinelli, Barbara; Romi, Silvia; Seresini, Agostino; Pesatori, Angela Cecilia; Seia, Manuela; Montano, Nicola; Bassotti, Alessandra

2017-04-01

Vascular Ehlers-Danlos syndrome (vEDS) is a rare and severe connective tissue disorder caused by mutations in the collagen type III alpha I chain ( COL3A1) gene. We describe a pathogenetic heterozygous COL3A1 mutation c.3140 G>A, p. Gly1047Asp, identified using next-generation sequencing, in a 40-year-old Italian female. The genetic test performed on her relatives, which present different clinical phenotypes, confirmed that they carry the same mutation in heterozygous state. This finding confirms that mutations causing vEDS have an incomplete penetrance.

Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports.

PubMed

Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi

2015-05-01

This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.

Novel and recurrent XYLT1 mutations in two Turkish families with Desbuquois dysplasia, type 2.

PubMed

Guo, Long; Elcioglu, Nursel H; Iida, Aritoshi; Demirkol, Yasemin K; Aras, Seda; Matsumoto, Naomichi; Nishimura, Gen; Miyake, Noriko; Ikegawa, Shiro

2017-03-01

Desbuquois dysplasia (DBQD) is an autosomal recessive skeletal disorder characterized by growth retardation, joint laxity, short extremities, and progressive scoliosis. DBQD is classified into two types based on the presence (DBQD1) or absence (DBQD2) of characteristic hand abnormalities. CANT1 mutations have been reported in both DBQD1 and DBQD2. Recently, mutations in the gene encoding xylosyltransferase 1 (XYLT1) were identified in several families with DBQD2. In this study, we performed whole-exome sequencing in two Turkish families with DBQD2. We found a novel and a recurrent XYLT1 mutation in each family. The patients were homozygous for the mutations. Our results further support that XYLT1 is responsible for a major subset of DBQD2.

Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1

PubMed Central

Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui

2013-01-01

Purpose To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). Methods An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Results Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. Conclusions In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A. PMID:23559863

Association of Mismatch Repair Mutation With Age at Cancer Onset in Lynch Syndrome: Implications for Stratified Surveillance Strategies.

PubMed

Ryan, Neil A J; Morris, Julie; Green, Kate; Lalloo, Fiona; Woodward, Emma R; Hill, James; Crosbie, Emma J; Evans, D Gareth

2017-12-01

Lynch syndrome is caused by dominantly inherited germline mutations that predispose individuals to colorectal, endometrial, ovarian, and other cancers through inactivation of the cellular mismatch repair system. Lynch syndrome–associated cancers are amenable to surveillance strategies that may improve survival. The age at which surveillance should start is disputed. To determine whether mutated gene and type of mutation influence age at onset of Lynch syndrome–associated cancers. A retrospective cohort study of individuals with Lynch syndrome–associated colorectal, endometrial, and/or ovarian cancers whose medical records were included in the clinical database of a large quaternary referral center for genomic medicine in the Northwest of England. Mutated gene (MLH1, MSH2, MSH6, and/or PMS2) and type of mutation (truncating, splicing, or large rearrangement). Age at cancer diagnosis. A total of 1063 individuals with proven Lynch syndrome were included, 495 male and 568 female (mean age 52 years; age range, 10-93 years [children were included in the database, but no children developed cancer]). There were 546 men and women with colorectal cancer, 162 women with endometrial cancer, and 49 women with ovarian cancer; mean follow-up was 68.2 months. Among MLH1 mutation carriers, mutations in MLH1 were associated with colorectal cancer in 249 (61%) of 409 men and women; endometrial cancer in 53 of 196 (27%) women; and ovarian cancer in 15 (8%) of 196 women. Among MSH2 mutation carriers, mutations in MSH2 (the most prevalent mutations overall) were most commonly associated with female-specific cancers: endometrial cancer in 83 (30%) of 279 women; ovarian cancer in 28 (10%) of 279 women; and colorectal cancer in 239 (50%) 479 men and women. Mutations in MSH6 were less prevalent, and MSH6 mutation carriers presented with colorectal and endometrial cancer at later ages than carriers of mutations in MSH2 or MLH1. When stratified by mutation type, women with truncating MLH1 mutations had later ages of onset of endometrial cancer than those with nontruncating mutations (median difference, 6.6 years; 95% CI, 2.7-10.4; P = .002). Carriers of truncating MLH1 mutations presented with colorectal cancer at later ages than those with other mutations, but the difference was not statistically significant. Individuals with known Lynch syndrome could be risk stratified by mutated gene and mutation type in tailored surveillance programs. Specifically, individuals with MSH6 mutations could be offered cancer surveillance from a later age. Furthermore, those with truncating MLH1 mutations could begin endometrial cancer surveillance later than those with nontruncating mutations.

Computational Analysis Reveals the Association of Threonine 118 Methionine Mutation in PMP22 Resulting in CMT-1A

PubMed Central

Swetha, Rayapadi G.

2014-01-01

The T118M mutation in PMP22 gene is associated with Charcot Marie Tooth, type 1A (CMT1A). CMT1A is a form of Charcot-Marie-Tooth disease, the most common inherited disorder of the peripheral nervous system. Mutations in CMT related disorder are seen to increase the stability of the protein resulting in the diseased state. We performed SNP analysis for all the nsSNPs of PMP22 protein and carried out molecular dynamics simulation for T118M mutation to compare the stability difference between the wild type protein structure and the mutant protein structure. The mutation T118M resulted in the overall increase in the stability of the mutant protein. The superimposed structure shows marked structural variation between the wild type and the mutant protein structures. PMID:25400662

Novel insertion mutation in a non-Jewish Caucasian type 1 Gaucher disease patient

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choy, F.Y.M.; Humphries, M.L.; Ferreira, P.

1997-01-20

Gaucher disease is the most prevalent lysosomal storage disorder. It is autosomal recessive, resulting in lysosomal glucocerebrosidase deficiency. Three clinical forms of Gaucher disease have been described: type 1 (nonneuronopathic), type 2 (acute neuronopathic), and type 3 (subacute neuronopathic). We performed PCR-thermal cycle sequence analysis of glucocerebrosidase genomic DNA and identified a novel mutation in a non-Jewish type 1 Gaucher disease patient. It is a C insertion in exon 3 at cDNA nucleotide position 122 and genomic nucleotide position 1626. This mutation causes a frameshift and, subsequently, four of the five codons immediately downstream of the insertion were changed whilemore » the sixth was converted to a stop codon, resulting in premature termination of protein translation. The 122CC insertion abolishes a Cac81 restriction endonuclease cleavage site, allowing a convenient and reliable method for detection using RFLP analysis of PCR-amplified glucocerebrosidase genomic DNA. The mutation in the other Gaucher allele was found to be an A{r_arrow}G substitution at glucocerebrosidase cDNA nucleotide position 1226 that so far has only been reported among type 1 Gaucher disease patients. Since mutation 122CC causes a frameshift and early termination of protein translation, it most likely results in a meaningless transcript and subsequently no residual glucocerebrosidase enzyme activity. We speculate that mutation 122CC may result in a worse prognosis than mutations associated with partial activity. When present in the homozygous form, it could be a lethal allele similar to what has been postulated for the other known insertion mutation, 84GG. Our patient, who is a compound heterozygote 122CC/1226G, has moderately severe type 1 Gaucher disease. Her clinical response to Ceredase{reg_sign} therapy that began 31 months ago has been favorable, though incomplete. 30 refs., 3 figs., 2 tabs.« less

Protective effects of Rutin against methanol induced acute toxic optic neuropathy: an experimental study.

PubMed

Taşlı, Nurdan Gamze; Çimen, Ferda Keskin; Karakurt, Yücel; Uçak, Turgay; Mammadov, Renad; Süleyman, Bahadır; Kurt, Nezahat; Süleyman, Halis

2018-01-01

To determine the effects of Rutin on methanol induced optic neuropathy and compare the results with the effects of ethanol. Totally 30 rats were divided into 5 groups, with 6 rats in each group as follows: healthy controls (C), methotrexate (MTX), methotrexate+methanol (MTM), methotrexate+methanol+ethanol (MTME) and methotrexate+ methanol+Rutin (MTMR). In all rabbits except those of the control group, MTX, diluted in sterile serum physiologic, 0.3 mg/kg per oral was applied for 7d by the aid of a tube. After this procedure to the rats of MTM, MTME and MTMR groups, 20% methanol with a dose of 3 g/kg per oral was given by the aid of a tube. In MTME group, 4h after the application of methanol, 20% ethanol was applied by the same way with a dose of 0.5 g/kg. On the other hand, in MTMR group 4h after the application of methanol, Rutin, which was dissolved in distilled water, was applied by the same way with a dose of 50 mg/kg. There were statistically significant differences in tissue 8-hydroxy-2 deoxyguanine (8-OHdG), interleukin-1β (IL-1β), tumor necrosis factor-alpha (TNF-α), malondialdehyde (MDA), myeloperoxidase (MPO). glutathione peroxidase (tGSH) and superoxide dismutase (SOD) levels between groups ( P <0.001). In MTMR group tissue 8-OHdG, IL-1β, MDA, and MPO levels were similar with the healthy controls but significantly different than the other groups. In histopathological evaluations, in MTX group there was moderate focal destruction, hemorrhage and decrease in number of astrocytes and oligodendrocytes; in MTM group there was severe destruction and edema with decrease in number of astrocytes and oligodendrocytes; in MTME group there was mild hemorrhage, mild edema, mildly dilated blood vessels with congestion while in MTMR group, optic nerve tissue was resembling the healthy controls. Rutin may prevent methanol-induced optic neuropathy via anti-inflammatory effects and decreasing the oxidative stress. New treatment options are warranted in this disease to avoid loss of vision in patients.

Primary Hyperoxaluria Type 1 with Homozygosity for a Double-mutated AGXT Allele in a 2-year-old Child.

PubMed

Krishnamurthy, S; Kartha, G B; Venkateswaran, V S; Prasannakumar, M; Mahadevan, S; Gowda, M; Pelle, A; Giachino, D

2017-01-01

Primary hyperoxaluria (PH) Type 1 is a rare, genetic disorder caused by deficiency of the liver enzyme alanine-glyoxylate aminotransferase, which is encoded by AGXT gene. We report a 2-year-old South Indian Tamil child with nephrocalcinosis due to PH Type 1, in whom a homozygous genotype for two missense mutations in the AGXT gene was found: first, a C to G transversion (c. 32C>G) in exon 1 resulting in the amino acid substitution p.Pro11Arg; second, a T to A transversion (c. 167T>A) in exon 2 resulting in p.Ile56Asn. A therapy based on potassium citrate and pyridoxine was started. This is the first report of molecular testing-proven childhood onset-PH Type 1 from South India and is notable for the co-occurrence of two missense mutations in one AGXT allele, which might lead to different and more severe phenotype than each mutation alone. To the best of our knowledge, AGXT allele carrying two already known mutations has not been previously reported.

Primary Hyperoxaluria Type 1 with Homozygosity for a Double-mutated AGXT Allele in a 2-year-old Child

PubMed Central

Krishnamurthy, S.; Kartha, G. B.; Venkateswaran, V. S.; Prasannakumar, M.; Mahadevan, S.; Gowda, M.; Pelle, A.; Giachino, D.

2017-01-01

Primary hyperoxaluria (PH) Type 1 is a rare, genetic disorder caused by deficiency of the liver enzyme alanine-glyoxylate aminotransferase, which is encoded by AGXT gene. We report a 2-year-old South Indian Tamil child with nephrocalcinosis due to PH Type 1, in whom a homozygous genotype for two missense mutations in the AGXT gene was found: first, a C to G transversion (c. 32C>G) in exon 1 resulting in the amino acid substitution p.Pro11Arg; second, a T to A transversion (c. 167T>A) in exon 2 resulting in p.Ile56Asn. A therapy based on potassium citrate and pyridoxine was started. This is the first report of molecular testing-proven childhood onset-PH Type 1 from South India and is notable for the co-occurrence of two missense mutations in one AGXT allele, which might lead to different and more severe phenotype than each mutation alone. To the best of our knowledge, AGXT allele carrying two already known mutations has not been previously reported. PMID:28904440

Prognostic significance of IDH 1 mutation in patients with glioblastoma multiforme.

PubMed

Khan, Inamullah; Waqas, Muhammad; Shamim, Muhammad Shahzad

2017-05-01

Focus of brain tumour research is shifting towards tumour genesis and genetics, and possible development of individualized treatment plans. Genetic analysis shows recurrent mutation in isocitrate dehydrogenase (IDH1) gene in most Glioblastoma multiforme (GBM) cells. In this review we evaluated the prognostic significance of IDH 1 mutation on the basis of published evidence. Multiple retrospective clinical analyses correlate the presence of IDH1 mutation in GBM with good prognostic outcomes compared to wild-type IDH1. A systematic review reported similar results. Based on the review of current literature IDH1 mutation is an independent factor for longer overall survival (OS) and progression free survival (PFS) in GBM patients when compared to wild-type IDH1. The prognostic significance opens up new avenues for treatment.

IDH1 mutation is associated with lower expression of VEGF but not microvessel formation in glioblastoma multiforme

PubMed Central

Polívka, Jiří; Pešta, Martin; Pitule, Pavel; Hes, Ondřej; Holubec, Luboš; Polívka, Jiří; Kubíková, Tereza; Tonar, Zbyněk

2018-01-01

Introduction Glioblastoma multiforme (GBM) represents the most malignant primary brain tumor characterized by pathological vascularization. Mutations in isocitrate dehydrogenases 1 and 2 (IDH1 and IDH2) were observed in GBM. We aimed to assess the intra-tumor hypoxia, angiogenesis and microvessel formation in GBM and to find their associations with IDH1 mutation status and patients prognosis. Methods 52 patients with a diagnosis of GBM were included into the study. IDH1 R132H mutation was assessed by RT-PCR from FFPE tumor samples obtained during surgery. The expression of markers of hypoxia (HIF2α), angiogenesis (VEGF), tumor microvascularity (CD31, CD34, vWF, CD105), and proliferation (Ki-67) were assessed immunohistochemically (IHC). IDH1 mutation and IHC markers were correlated with the patient survival. Results 20 from 52 GBM tumor samples comprised IDH1 R132H mutation (38.5%). The majority of mutated tumors were classified as secondary glioblastomas (89.9%). Patients with IDH1 mutated tumors experienced better progression-free survival (P = 0.037) as well as overall survival (P = 0.035) compared with wild type tumors. The significantly lower expression of VEGF was observed in GBM with IDH1 mutation than in wild type tumors (P = 0.01). No such association was found for microvascular markers. The increased expression of newly-formed microvessels (ratio CD105/CD31) in tumor samples was associated with worse patient’s progression-free survival (P = 0.026). Summary No increase in HIF/VEGF-mediated angiogenesis was observed in IDH1-mutated GBM compared with IDH1 wild type tumors. The histological assessment of the portion of newly-formed microvessels in tumor tissue can be used for the prediction of GBM patient’s prognosis. PMID:29662659

Mutations of NPM1 gene in de novo acute myeloid leukaemia: determination of incidence, distribution pattern and identification of two novel mutations in Indian population.

PubMed

Ahmad, Firoz; Mandava, Swarna; Das, Bibhu Ranjan

2009-06-01

Mutations in the nucleophosmin (NPM1) gene have been recently described to occur in about one-third of acute myeloid leukaemias (AMLs) and represent the most frequent genetic alteration currently known in this subset, specially in those with normal karyotype. This study explored the prevalence and clinical profile of NPM1 mutations in a cohort of 200 Indian adult and children with AML. NPM1 mutations were observed in 19.5% of all population and 34.2% of those with normal karyotype. Adults had a significantly higher incidence of NPM1 mutations than children [38 of 161 (23.6%) vs. 1 of 39 (2.5%), p = 0.002]. NPM1 mutations were significantly associated with normal karyotype (p = 0.001), high WBC count (p = 0.034), AML-M4 subtype (p = 0.039) and a gradient increase of mutation rate with the increase in age groups. Sequence analysis of 39 mutated cases revealed typical mutations (types A, B, D, Nm and H*) as well as two novel variations (types F1 and F2). Majority of the patients had mutation type A (69.2%), followed by B (5.1%), D (15.3%), H* (2.5%) and Nm (2.5%) all involving COOH terminal of the NPM1 protein. In conclusion, this study represents the first report of NPM1 mutation from Indian population and confirms that the incidence of NPM1 mutations varies considerably globally, with slightly lower incidence in Indian population compared to western countries. The current study also served to identify two novel NPM1 mutants that add new insights into the heterogeneity of genomic insertions at exon 12. More ongoing larger studies are warranted to elucidate the molecular pathogenesis of AML that arises in this part of the world. Furthermore, we believe that in light of its high prevalence worldwide, inclusion of NPM1 mutation detection assay in diagnostic evaluations of AML may improve the efficacy of routine genetic characterization and allow assignment of patients to better-defined risk categories.

Pyrosequencing-based quantitative measurement of CALR mutation allele burdens and their clinical implications in patients with myeloproliferative neoplasms.

PubMed

Oh, Yejin; Song, Ik-Chan; Kim, Jimyung; Kwon, Gye Cheol; Koo, Sun Hoe; Kim, Seon Young

2018-05-01

We developed a pyrosequencing-based method for the quantification of CALR mutations and compared the results using Sanger sequencing, fragment length analysis (FLA), digital-droplet PCR (ddPCR), and next-generation sequencing (NGS). Method validation studies were performed using cloned plasmid controls. Samples from 24 patients with myeloproliferative neoplasms were evaluated. Among the 24 patients, 15 had CALR mutations (7 type 1, 2 type 2, and 6 other mutations). The type 1 or type 2 mutation-positive results from pyrosequencing exhibited 100% concordance with the Sanger sequencing results. One novel CALR mutation was not detected by pyrosequencing. The CALR mutation allele burdens measured by pyrosequencing were slightly lower than those measured by FLA but slightly higher than the results obtained using ddPCR. Pyrosequencing exhibited high correlations with both methods. The mutation allele burdens estimated by NGS were significantly lower than those measured by pyrosequencing. An increased CALR mutation allele burden was associated with overt primary myelofibrosis. Patients with >70% mutation allele burdens in myeloid cells had a significantly longer time from diagnosis (P = 0.007), more bone marrow fibrosis (P = 0.010), and lower hemoglobin (P = 0.007). Pyrosequencing was a useful rapid sequencing method to determine the burden of CALR mutations. Copyright © 2018 Elsevier B.V. All rights reserved.

Concentration of mutations causing Schmid metaphyseal chondrodysplasia in the NC1 domain of type X collagen

DOE Office of Scientific and Technical Information (OSTI.GOV)

McIntosh, I.; Abbott, M.H.; Francomano, C.A.

1994-09-01

Schmid metaphyseal chondrodysplasia (SMCD, MIM 156500) is an autosomal dominant disorder of the osseous skeleton resulting in short stature, coxa vara and a waddling gait. Type X collagen is an extracellular matrix protein expressed exclusively by hypertrophic chondrocytes. We have previously identified four mutations in the type X collagen gene (COL10A1) in patients with SMCD. Each of these mutations, as well as another three reported by other investigators, are in the carboxy-terminal non-collagenous domain (NC1). Here, we present data for another three mutations each predicted to cause premature termination of translation within the NC1 domain. Two are nonsense mutations, Y628Xmore » and W651X, while the third is a frameshift resulting from the deletion of two nucleotides, 1856delCC. Each of these mutations occurred de novo, resulting in sporadic cases of SMCD. Four frameshift mutations have now been reported to initiate within 10bp of each other in the NC1 domain, namely 1865delC, 1856delCC, 1856del13 and 1866del10. These findings further support the hypothesis that SMCD is the result of the mutant type X collagen molecule being unable to participate in trimerization, although a dominant-negative model of disease pathogenesis has not been formally excluded.« less

Clinical and Mutational Analysis of the GCDH Gene in Malaysian Patients with Glutaric Aciduria Type 1.

PubMed

Abdul Wahab, Siti Aishah; Yakob, Yusnita; Abdul Azize, Nor Azimah; Md Yunus, Zabedah; Huey Yin, Leong; Mohd Khalid, Mohd Khairul Nizam; Lock Hock, Ngu

Glutaric aciduria type 1 (GA1) is an autosomal recessive metabolic disorder caused by deficiency of glutaryl-CoA dehydrogenase enzyme encoded by the GCDH gene. In this study, we presented the clinical and molecular findings of seven GA1 patients in Malaysia. All the patients were symptomatic from infancy and diagnosed clinically from large excretion of glutaric and 3-hydroxyglutaric acids. Bidirectional sequencing of the GCDH gene revealed ten mutations, three of which were novel (Gln76Pro, Glu131Val, and Gly390Trp). The spectrum of mutations included eight missense mutations, a nonsense mutation, and a splice site mutation. Two mutations (Gln76Pro and Arg386Gln) were homozygous in two patients with parental consanguinity. All mutations were predicted to be disease causing by MutationTaster2. In conclusion, this is the first report of both clinical and molecular aspects of GA1 in Malaysian patients. Despite the lack of genotype and phenotype correlation, early diagnosis and timely treatment remained the most important determinant of patient outcome.

Clinical and Mutational Analysis of the GCDH Gene in Malaysian Patients with Glutaric Aciduria Type 1

PubMed Central

Yakob, Yusnita; Abdul Azize, Nor Azimah; Md Yunus, Zabedah; Huey Yin, Leong; Mohd Khalid, Mohd Khairul Nizam; Lock Hock, Ngu

2016-01-01

Glutaric aciduria type 1 (GA1) is an autosomal recessive metabolic disorder caused by deficiency of glutaryl-CoA dehydrogenase enzyme encoded by the GCDH gene. In this study, we presented the clinical and molecular findings of seven GA1 patients in Malaysia. All the patients were symptomatic from infancy and diagnosed clinically from large excretion of glutaric and 3-hydroxyglutaric acids. Bidirectional sequencing of the GCDH gene revealed ten mutations, three of which were novel (Gln76Pro, Glu131Val, and Gly390Trp). The spectrum of mutations included eight missense mutations, a nonsense mutation, and a splice site mutation. Two mutations (Gln76Pro and Arg386Gln) were homozygous in two patients with parental consanguinity. All mutations were predicted to be disease causing by MutationTaster2. In conclusion, this is the first report of both clinical and molecular aspects of GA1 in Malaysian patients. Despite the lack of genotype and phenotype correlation, early diagnosis and timely treatment remained the most important determinant of patient outcome. PMID:27672653

[Construction and characterization of an epitope-mutated Asia 1 type foot-and-mouth disease virus].

PubMed

Zhang, Yan; Hu, Yonghao; Yang, Fan; Yang, Bo; Wang, Songhao; Zhu, Zixiang; Zheng, Haixue

2015-01-01

To generate an epitope-mutated foot-and-mouth disease virus (FMDV) as a marker vaccine, the infectious clone pAsia 1-FMDV containing the complete genomic cDNA of Asia 1 type FMDV was used as backbone, the residues at positions 27 and 31 in the 3D gene were mutated (H27Y and N31R). The resulting plasmid pAsia 1-FMDV-3DM encoding a mutated epitope was transfected into BHK-21 cells and the recombinant virus rAsia 1-3DM was rescued. The recombinant virus showed similar biological characteristics comparable with the parental virus. In serological neutralization test the antisera against recombine virus have a good reactivity with parental virus. The antisera against the mutant virus were shown to be reactive with the mutated epitope but not the wild-type one. The results indicated that the two virus strains could be distinguished by western blotting using synthetic peptides. This epitope-mutated FMDV strain will be evaluated as a potential marker vaccine against FMDV infections.

Common variants of the BRCA1 wild-type allele modify the risk of breast cancer in BRCA1 mutation carriers

PubMed Central

Cox, David G.; Simard, Jacques; Sinnett, Daniel; Hamdi, Yosr; Soucy, Penny; Ouimet, Manon; Barjhoux, Laure; Verny-Pierre, Carole; McGuffog, Lesley; Healey, Sue; Szabo, Csilla; Greene, Mark H.; Mai, Phuong L.; Andrulis, Irene L.; Thomassen, Mads; Gerdes, Anne-Marie; Caligo, Maria A.; Friedman, Eitan; Laitman, Yael; Kaufman, Bella; Paluch, Shani S.; Borg, Åke; Karlsson, Per; Stenmark Askmalm, Marie; Barbany Bustinza, Gisela; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy R.; Benítez, Javier; Hamann, Ute; Rookus, Matti A.; van den Ouweland, Ans M.W.; Ausems, Margreet G.E.M.; Aalfs, Cora M.; van Asperen, Christi J.; Devilee, Peter; Gille, Hans J.J.P.; Peock, Susan; Frost, Debra; Evans, D. Gareth; Eeles, Ros; Izatt, Louise; Adlard, Julian; Paterson, Joan; Eason, Jacqueline; Godwin, Andrew K.; Remon, Marie-Alice; Moncoutier, Virginie; Gauthier-Villars, Marion; Lasset, Christine; Giraud, Sophie; Hardouin, Agnès; Berthet, Pascaline; Sobol, Hagay; Eisinger, François; Bressac de Paillerets, Brigitte; Caron, Olivier; Delnatte, Capucine; Goldgar, David; Miron, Alex; Ozcelik, Hilmi; Buys, Saundra; Southey, Melissa C.; Terry, Mary Beth; Singer, Christian F.; Dressler, Anne-Catharina; Tea, Muy-Kheng; Hansen, Thomas V.O.; Johannsson, Oskar; Piedmonte, Marion; Rodriguez, Gustavo C.; Basil, Jack B.; Blank, Stephanie; Toland, Amanda E.; Montagna, Marco; Isaacs, Claudine; Blanco, Ignacio; Gayther, Simon A.; Moysich, Kirsten B.; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Niederacher, Dieter; Sutter, Christian; Gadzicki, Dorothea; Fiebig, Britta; Caldes, Trinidad; Laframboise, Rachel; Nevanlinna, Heli; Chen, Xiaoqing; Beesley, Jonathan; Spurdle, Amanda B.; Neuhausen, Susan L.; Ding, Yuan C.; Couch, Fergus J.; Wang, Xianshu; Peterlongo, Paolo; Manoukian, Siranoush; Bernard, Loris; Radice, Paolo; Easton, Douglas F.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Stoppa-Lyonnet, Dominique; Mazoyer, Sylvie; Sinilnikova, Olga M.

2011-01-01

Mutations in the BRCA1 gene substantially increase a woman's lifetime risk of breast cancer. However, there is great variation in this increase in risk with several genetic and non-genetic modifiers identified. The BRCA1 protein plays a central role in DNA repair, a mechanism that is particularly instrumental in safeguarding cells against tumorigenesis. We hypothesized that polymorphisms that alter the expression and/or function of BRCA1 carried on the wild-type (non-mutated) copy of the BRCA1 gene would modify the risk of breast cancer in carriers of BRCA1 mutations. A total of 9874 BRCA1 mutation carriers were available in the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA) for haplotype analyses of BRCA1. Women carrying the rare allele of single nucleotide polymorphism rs16942 on the wild-type copy of BRCA1 were at decreased risk of breast cancer (hazard ratio 0.86, 95% confidence interval 0.77–0.95, P = 0.003). Promoter in vitro assays of the major BRCA1 haplotypes showed that common polymorphisms in the regulatory region alter its activity and that this effect may be attributed to the differential binding affinity of nuclear proteins. In conclusion, variants on the wild-type copy of BRCA1 modify risk of breast cancer among carriers of BRCA1 mutations, possibly by altering the efficiency of BRCA1 transcription. PMID:21890493

Wide spetcrum mutational analysis of metastatic renal cell cancer: a retrospective next generation sequencing approach

PubMed Central

Fiorentino, Michelangelo; Gruppioni, Elisa; Massari, Francesco; Giunchi, Francesca; Altimari, Annalisa; Ciccarese, Chiara; Bimbatti, Davide; Scarpa, Aldo; Iacovelli, Roberto; Porta, Camillo; Virinder, Sarhadi; Tortora, Giampaolo; Artibani, Walter; Schiavina, Riccardo; Ardizzoni, Andrea; Brunelli, Matteo; Knuutila, Sakari; Martignoni, Guido

2017-01-01

Renal cell cancer (RCC) is characterized by histological and molecular heterogeneity that may account for variable response to targeted therapies. We evaluated retrospectively with a next generation sequencing (NGS) approach using a pre-designed cancer panel the mutation burden of 32 lesions from 22 metastatic RCC patients treated with at least one tyrosine kinase or mTOR inhibitor. We identified mutations in the VHL, PTEN, JAK3, MET, ERBB4, APC, CDKN2A, FGFR3, EGFR, RB1, TP53 genes. Somatic alterations were correlated with response to therapy. Most mutations hit VHL1 (31,8%) followed by PTEN (13,6%), JAK3, FGFR and TP53 (9% each). Eight (36%) patients were wild-type at least for the genes included in the panel. A genotype concordance between primary RCC and its secondary lesion was found in 3/6 cases. Patients were treated with Sorafenib, Sunitinib and Temsirolimus with partial responses in 4 (18,2%) and disease stabilization in 7 (31,8%). Among the 4 partial responders, 1 (25%) was wild-type and 3 (75%) harbored different VHL1 variants. Among the 7 patients with disease stabilization 2 (29%) were wild-type, 2 (29%) PTEN mutated, and single patients (14% each) displayed mutations in VHL1, JAK3 and APC/CDKN2A. Among the 11 non-responders 7 (64%) were wild-type, 2 (18%) were p53 mutated and 2 (18%) VHL1 mutated. No significant associations were found among RCC histotype, mutation variants and response to therapies. In the absence of predictive biomarkers for metastatic RCC treatment, a NGS approach may address single patients to basket clinical trials according to actionable molecular specific alterations. PMID:27741505

A BAP1 Mutation-specific MicroRNA Signature Predicts Clinical Outcomes in Clear Cell Renal Cell Carcinoma Patients with Wild-type BAP1

PubMed Central

Ge, Yu-Zheng; Xu, Lu-Wei; Zhou, Chang-Cheng; Lu, Tian-Ze; Yao, Wen-Tao; Wu, Ran; Zhao, You-Cai; Xu, Xiao; Hu, Zhi-Kai; Wang, Min; Yang, Xiao-Bing; Zhou, Liu-Hua; Zhong, Bing; Xu, Zheng; Li, Wen-Cheng; Zhu, Jia-Geng; Jia, Rui-Peng

2017-01-01

Background: Clear cell renal cell carcinoma (ccRCC) is the most prevalent histologic subtype of kidney cancers in adults, which could be divided into two distinct subgroups according to the BRCA1 associated protein-1 (BAP1) mutation status. In the current study, we comprehensively analyzed the genome-wide microRNA (miRNA) expression profiles in ccRCC, with the aim to identify the differentially expressed miRNAs between BAP1 mutant and wild-type tumors, and generate a BAP1 mutation-specific miRNA signature for ccRCC patients with wild-type BAP1. Methods: The BAP1 mutation status and miRNA profiles in BAP1 mutant and wild-type tumors were analyzed. Subsequently, the association of the differentially expressed miRNAs with patient survival was examined, and a BAP1 mutation-specific miRNA signature was generated and examined with Kaplan-Meier survival, univariate and multivariate Cox regression analyses. Finally, the bioinformatics methods were adopted for the target prediction of selected miRNAs and functional annotation analyses. Results: A total of 350 treatment-naïve primary ccRCC patients were selected from The Cancer Genome Atlas project, among which 35 (10.0%) subjects carried mutant BAP1 and had a shorter overall survival (OS) time. Furthermore, 33 miRNAs were found to be differentially expressed between BAP1 mutant and wild-type tumors, among which 11 (miR-149, miR-29b-2, miR-182, miR-183, miR-21, miR-365-2, miR-671, miR-365-1, miR-10b, miR-139, and miR-181a-2) were significantly associated with OS in ccRCC patients with wild-type BAP1. Finally, a BAP1 mutation-specific miRNA signature consisting of 11 miRNAs was generated and validated as an independent prognostic parameter. Conclusions: In summary, our study identified a total of 33 miRNAs differentially expressed between BAP1 mutant and wild-type tumors, and generated a BAP1 mutation-specific miRNA signature including eleven miRNAs, which could serve as a novel prognostic biomarker for ccRCC patients with wild-type BAP1. PMID:28900502

Mutational Analysis of the Adaptor Protein 2 Sigma Subunit (AP2S1) Gene: Search for Autosomal Dominant Hypocalcemia Type 3 (ADH3)

PubMed Central

Rogers, Angela; Nesbit, M. Andrew; Hannan, Fadil M.; Howles, Sarah A.; Gorvin, Caroline M.; Cranston, Treena; Allgrove, Jeremy; Bevan, John S.; Bano, Gul; Brain, Caroline; Datta, Vipan; Grossman, Ashley B.; Hodgson, Shirley V.; Izatt, Louise; Millar-Jones, Lynne; Pearce, Simon H.; Robertson, Lisa; Selby, Peter L.; Shine, Brian; Snape, Katie; Warner, Justin

2014-01-01

Context: Autosomal dominant hypocalcemia (ADH) types 1 and 2 are due to calcium-sensing receptor (CASR) and G-protein subunit-α11 (GNA11) gain-of-function mutations, respectively, whereas CASR and GNA11 loss-of-function mutations result in familial hypocalciuric hypercalcemia (FHH) types 1 and 2, respectively. Loss-of-function mutations of adaptor protein-2 sigma subunit (AP2σ 2), encoded by AP2S1, cause FHH3, and we therefore sought for gain-of-function AP2S1 mutations that may cause an additional form of ADH, which we designated ADH3. Objective: The objective of the study was to investigate the hypothesis that gain-of-function AP2S1 mutations may cause ADH3. Design: The sample size required for the detection of at least one mutation with a greater than 95% likelihood was determined by binomial probability analysis. Nineteen patients (including six familial cases) with hypocalcemia in association with low or normal serum PTH concentrations, consistent with ADH, but who did not have CASR or GNA11 mutations, were ascertained. Leukocyte DNA was used for sequence and copy number variation analysis of AP2S1. Results: Binomial probability analysis, using the assumption that AP2S1 mutations would occur in hypocalcemic patients at a prevalence of 20%, which is observed in FHH patients without CASR or GNA11 mutations, indicated that the likelihood of detecting at least one AP2S1 mutation was greater than 95% and greater than 98% in sample sizes of 14 and 19 hypocalcemic patients, respectively. AP2S1 mutations and copy number variations were not detected in the 19 hypocalcemic patients. Conclusion: The absence of AP2S1 abnormalities in hypocalcemic patients, suggests that ADH3 may not occur or otherwise represents a rare hypocalcemic disorder. PMID:24708097

Sp1 is a transcription repressor to stanniocalcin-1 expression in TSA-treated human colon cancer cells, HT29.

PubMed

Law, Alice Y S; Yeung, B H Y; Ching, L Y; Wong, Chris K C

2011-08-01

Our previous study demonstrated that, stanniocalcin-1 (STC1) was a target of histone deacetylase (HDAC) inhibitors and was involved in trichostatin A (TSA) induced apoptosis in the human colon cancer cells, HT29. In this study, we reported that the transcriptional factor, specificity protein 1 (Sp1) in association with retinoblastoma (Rb) repressed STC1 gene transcription in TSA-treated HT29 cells. Our data demonstrated that, a co-treatment of the cells with TSA and Sp1 inhibitor, mithramycin A (MTM) led to a marked synergistic induction of STC1 transcript levels, STC1 promoter (1 kb)-driven luciferase activity and an increase of apoptotic cell population. The knockdown of Sp1 gene expression in TSA treated cells, revealed the repressor role of Sp1 in STC1 transcription. Using a protein phosphatase inhibitor okadaic acid (OKA), an increase of Sp1 hyperphosphorylation and so a reduction of its transcriptional activity, led to a significant induction of STC1 gene expression. Chromatin immunoprecipitation (ChIP) assay revealed that Sp1 binding on STC1 proximal promoter in TSA treated cells. The binding of Sp1 to STC1 promoter was abolished by the co-treatment of MTM or OKA in TSA-treated cells. Re-ChIP assay illustrated that Sp1-mediated inhibition of STC1 transcription was associated with the recruitment of another repressor molecule, Rb. Collectively our findings identify STC1 is a downstream target of Sp1. Copyright © 2011 Wiley-Liss, Inc.

The RAS mutation status predicts survival in patients undergoing hepatic resection for colorectal liver metastases: The results from a genetic analysis of all-RAS.

PubMed

Amikura, Katsumi; Akagi, Kiwamu; Ogura, Toshiro; Takahashi, Amane; Sakamoto, Hirohiko

2018-03-01

We investigated the impact of mutations in KRAS exons 3-4 and NRAS exons 2-3 in addition to KRAS exon 2, so-called all-RAS mutations, in patients with colorectal liver metastasis (CLM) undergoing hepatic resection. We analyzed 421 samples from CLM patients for their all-RAS mutation status to compare the overall survival rate (OS), recurrence-free survival rate (RFS), and the pattern of recurrence between the patients with and without RAS mutations. RAS mutations were detected in 191 (43.8%). Thirty-two rare mutations (12.2%) were detected in 262 patients with KRAS exon 2 wild-type. After excluding 79 patients who received anti-EGFR antibody therapy, 168 were classified as all-RAS wild-type, and 174 as RAS mutant-type. A multivariate analysis of factors associated with OS and RFS identified the RAS status as an independent factor (OS; hazard ratio [HR] = 1.672, P = 0.0031, RFS; HR = 1.703, P = 0.0024). Recurrence with lung metastasis was observed significantly more frequent in patients with RAS mutations than in patients with RAS wild-type (P = 0.0005). Approximately half of CLM patients may have a RAS mutation. CLM patients with RAS mutations had a significantly worse survival rate in comparison to patients with RAS wild-type, regardless of the administration of anti-EGFR antibody therapy. © 2017 Wiley Periodicals, Inc.

Ongoing compression triggered exhumation of the orogenic crust in the Variscan Maures-Tanneron Massif, France - Geological arguments and thermo-mechanical tests

NASA Astrophysics Data System (ADS)

Gerbault, Muriel; Schneider, Julie; Reverso-Peila, Alexandre; Corsini, Michel

2016-04-01

The Maures-Tanneron Massif (MTM), together with Corsica and Sardinia, hosted the South-Eastern Variscan belt and record a continuous evolution from continental collision to exhumation. We present a synthesis of the available geological and geochronogical data that explores the transition from convergence to perpendicular Permean extension in the MTM (at ~ 325 Ma ± 25 My). The migmatitic Internal Zone that composes the Western MTM displays structural clues such as backthrusting and magmatic foliations, and metamorphic data indicating exhumation of deep seated partially molten rocks at an apparent heating rate of 1-2 °C/km/My from ca. 345 Ma to 320 Ma. This suggests vertical advective heat transport during continued N140° convergence (D2 phase). In contrast at the same time, the low grade External zone composing the Eastern part of the MTM recorded exhumation of more conductive patterns at an apparent rate of 0.3-0.6 °C/km/My. It is only from ca. 320 Ma that transcurrent motion dominates in the Internal zone and progressively leaves way to N-S strecthing (D3 phase), indicative of orogenic collapse and extension and in asociation with emplacement of larger volumes of magmatism in the crust. Thermo-mechanical modeling complements this synthesis in order to highlight the conditions under which deep seated HP units could melt and massively start to exhume during maintained convergence (phase D2). Accounting for temperature dependent elasto-visco-plastic rheologies, our models explore the dynamics of an orogenic prism starting from a dis-equilibrated state just after slab break-off or delamination, at ca. 350 Ma. We simulate the development of gravitational instabilities in partially melting crust, a process that is already well known to depend on strain-rate, heat sources and strength layering. In order to reproduce the exhumation patterns of rocks from ~50 km depth over the appropriate time-scale (>20 My) and spatial extent (>100 km), a best fit was obtained with a mean convergence rate of 0.5 cm/yr and no exceptional surface processes. Internal heating has a crucial effect and mostly resulted from the radiogenic decay of stacked felsic crustal units. However alternation with mafic units is also necessary in order to prevent lateral spreading of the orogeny. A low viscosity partially molten (eg. felsic) crust also permits mechanical decoupling of surface deformation from the deeper mantle domains, thus reducing the differences due to either a shallow asthenosphere or a competent mantle lithosphere under the orogeny. A shallow asthenosphere produces too warm and fast exhumation. The bulk viscosity of the partially molten orogenic crust controls the timing of exhumation, pointing to the need for further constraints to link the behaviour at different scales of partially molten crust. The MTM witnesses the typical competition between far-field plate convergence and internal body forces, and we plead for a subsequent progressive evolution of transpression to perpendicular extension (still to be tackled with 3D modeling).

Impact of Mutation Type and Amplicon Characteristics on Genetic Diversity Measures Generated Using a High-Resolution Melting Diversity Assay

PubMed Central

Cousins, Matthew M.; Donnell, Deborah; Eshleman, Susan H.

2013-01-01

We adapted high-resolution melting (HRM) technology to measure genetic diversity without sequencing. Diversity is measured as a single numeric HRM score. Herein, we determined the impact of mutation types and amplicon characteristics on HRM diversity scores. Plasmids were generated with single-base changes, insertions, and deletions. Different primer sets were used to vary the position of mutations within amplicons. Plasmids and plasmid mixtures were analyzed to determine the impact of mutation type, position, and concentration on HRM scores. The impact of amplicon length and G/C content on HRM scores was also evaluated. Different mutation types affected HRM scores to varying degrees (1-bp deletion < 1-bp change < 3-bp insertion < 9-bp insertion). The impact of mutations on HRM scores was influenced by amplicon length and the position of the mutation within the amplicon. Mutations were detected at concentrations of 5% to 95%, with the greatest impact at 50%. The G/C content altered melting temperature values of amplicons but had no impact on HRM scores. These data are relevant to the design of assays that measure genetic diversity using HRM technology. PMID:23178437

Identification of new mutations in primary hyperoxaluria type 1 (PH1).

PubMed

von Schnakenburg, C; Rumsby, G

1998-01-01

Primary hyperoxaluria type 1 (PH1) is caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). The AGXT gene, which codes for the 392 amino acid protein, has been mapped to chromosome 2q37.3. In order to identify new mutations in the AGXT gene we studied 79 PH1 patients using single strand conformation polymorphism analysis. In addition to a cluster of new mutations in exon 7 we report five novel mutations in exons 2, 4, 5, 9 and 10. These are T444C, G640A, G690A, 1008-1010delGCG and G1171A. These five new mutations contribute to our knowledge of the AGXT gene. Their possible consequences for PH1 phenotype and enzyme activity are discussed.

Analyses of clinicopathological, molecular, and prognostic associations of KRAS codon 61 and codon 146 mutations in colorectal cancer: cohort study and literature review

PubMed Central

2014-01-01

Background KRAS mutations in codons 12 and 13 are established predictive biomarkers for anti-EGFR therapy in colorectal cancer. Previous studies suggest that KRAS codon 61 and 146 mutations may also predict resistance to anti-EGFR therapy in colorectal cancer. However, clinicopathological, molecular, and prognostic features of colorectal carcinoma with KRAS codon 61 or 146 mutation remain unclear. Methods We utilized a molecular pathological epidemiology database of 1267 colon and rectal cancers in the Nurse’s Health Study and the Health Professionals Follow-up Study. We examined KRAS mutations in codons 12, 13, 61 and 146 (assessed by pyrosequencing), in relation to clinicopathological features, and tumor molecular markers, including BRAF and PIK3CA mutations, CpG island methylator phenotype (CIMP), LINE-1 methylation, and microsatellite instability (MSI). Survival analyses were performed in 1067 BRAF-wild-type cancers to avoid confounding by BRAF mutation. Cox proportional hazards models were used to compute mortality hazard ratio, adjusting for potential confounders, including disease stage, PIK3CA mutation, CIMP, LINE-1 hypomethylation, and MSI. Results KRAS codon 61 mutations were detected in 19 cases (1.5%), and codon 146 mutations in 40 cases (3.2%). Overall KRAS mutation prevalence in colorectal cancers was 40% (=505/1267). Of interest, compared to KRAS-wild-type, overall, KRAS-mutated cancers more frequently exhibited cecal location (24% vs. 12% in KRAS-wild-type; P < 0.0001), CIMP-low (49% vs. 32% in KRAS-wild-type; P < 0.0001), and PIK3CA mutations (24% vs. 11% in KRAS-wild-type; P < 0.0001). These trends were evident irrespective of mutated codon, though statistical power was limited for codon 61 mutants. Neither KRAS codon 61 nor codon 146 mutation was significantly associated with clinical outcome or prognosis in univariate or multivariate analysis [colorectal cancer-specific mortality hazard ratio (HR) = 0.81, 95% confidence interval (CI) = 0.29-2.26 for codon 61 mutation; colorectal cancer-specific mortality HR = 0.86, 95% CI = 0.42-1.78 for codon 146 mutation]. Conclusions Tumors with KRAS mutations in codons 61 and 146 account for an appreciable proportion (approximately 5%) of colorectal cancers, and their clinicopathological and molecular features appear generally similar to KRAS codon 12 or 13 mutated cancers. To further assess clinical utility of KRAS codon 61 and 146 testing, large-scale trials are warranted. PMID:24885062

A novel PAX3 mutation in a Japanese boy with Waardenburg syndrome type 1.

PubMed

Yoshida, Yu; Doi, Rieko; Adachi, Kaori; Nanba, Eiji; Kodani, Isamu; Ryoke, Kazuo

2016-01-01

Waardenburg syndrome type 1 (WS1) is a rare autosomal dominant disorder characterized by hair hypopigmentation, abnormal iris pigmentation, and congenital hearing loss. WS1 is caused by mutations in paired box gene 3 (PAX3). We identified a novel PAX3 mutation (c.1107 C>G, p.Ser369Arg) in a Japanese WS1 patient showing abnormal right iris pigmentation, right-sided congenital hearing loss, synophrys, incomplete left cleft lip, and cryptorchidism.

A novel PAX3 mutation in a Japanese boy with Waardenburg syndrome type 1

PubMed Central

Yoshida, Yu; Doi, Rieko; Adachi, Kaori; Nanba, Eiji; Kodani, Isamu; Ryoke, Kazuo

2016-01-01

Waardenburg syndrome type 1 (WS1) is a rare autosomal dominant disorder characterized by hair hypopigmentation, abnormal iris pigmentation, and congenital hearing loss. WS1 is caused by mutations in paired box gene 3 (PAX3). We identified a novel PAX3 mutation (c.1107 C>G, p.Ser369Arg) in a Japanese WS1 patient showing abnormal right iris pigmentation, right-sided congenital hearing loss, synophrys, incomplete left cleft lip, and cryptorchidism. PMID:27081571

PD-L1 expression according to the EGFR status in primary lung adenocarcinoma.

PubMed

Takada, Kazuki; Toyokawa, Gouji; Tagawa, Tetsuzo; Kohashi, Kenichi; Shimokawa, Mototsugu; Akamine, Takaki; Takamori, Shinkichi; Hirai, Fumihiko; Shoji, Fumihiro; Okamoto, Tatsuro; Oda, Yoshinao; Maehara, Yoshihiko

2018-02-01

It was reported that programmed cell death-ligand 1 (PD-L1) expression is associated with smoking and wild-type epidermal growth factor receptor (EGFR) in lung adenocarcinoma. However, the association between PD-L1 expression and EGFR mutation site in EGFR mutation-positive lung adenocarcinoma is unclear. We retrospectively examined the relationship between PD-L1 expression and EGFR status in 441 surgically resected primary lung adenocarcinomas. Membrane PD-L1 expression on tumor cells was evaluated by immunohistochemical analysis using a PD-L1 antibody (clone SP142) and defined by tumor proportion scores (TPSs) of 0%, 1-4%, 5-49%, and ≥50%, respectively. Two hundred and eighteen (49.4%) patients had wild-type EGFR, and 223 (50.6%) had mutant EGFR-98 (44.0%) with exon 19 deletion, 116 (52.0%) with exon 21 L858R point mutation, and nine (4.0%) with another EGFR mutation. Overall, Fisher's exact test showed that PD-L1 positivity was associated with wild-type EGFR, and there was only one case with PD-L1 TPS ≥50% among the cases with mutant EGFR. The analysis of cases with mutant EGFR indicated no significant association between EGFR mutation site and PD-L1 expression. However, the prevalence of PD-L1 TPS 5-49% was higher among patients with EGFR exon 19 deletion than with EGFR exon 21 L858R point mutation. PD-L1 expression was significantly associated with wild-type EGFR, and PD-L1 TPS ≥50% seldom overlaps with presence of driver oncogene EGFR. There was no significant difference in PD-L1 expression among the EGFR mutation sites. Copyright © 2017 Elsevier B.V. All rights reserved.

[A clinical and hereditary analysis of novel complex heterozygous KCNJ1 mutation in a Bartter syndrome type Ⅱ patient].

PubMed

Li, X Y; Jiang, Y; Xu, L J; Duan, L; Peng, X Y; Chen, L M; Xia, W B; Xing, X P

2017-10-01

Bartter syndrome (BS) is a hereditary condition transmitted as an autosomal recessive (Bartter type 1 to 4) or dominant trait (Bartter type 5). The disease associates hypokalemic alkalosis with varying degrees of hypercalciuria. Here we presented a case (BS type Ⅱ) of a 17 years old female presented with polyhydramnios, polyuria, nephrocalcinosis and hypokalemia, which was alleviated after treatment with celecoxib and vitamin D(3). DNA sequencing identified compound heterozygous KCNJ 1 gene mutations, c. 931C >T (p.R311W) and c. 445-446insCCTGAACAC (p.V149Afs, 150X), with the latter a novel mutation. Her father and mother were heterozygous carriers of c. 931C >T (p.R311W) and c. 445-446insCCTGAACAC (p.V149Afs, 150X), respectively. In conclusion, this case of BS type Ⅱ is caused by a novel compound heterozygous KCNJ 1 mutation. Further studies are needed to verify the effect of celecoxib in BS patients.

Molecular etiology and genotype-phenotype correlation of Chinese Han deaf patients with type I and type II Waardenburg Syndrome.

PubMed

Sun, Lianhua; Li, Xiaohua; Shi, Jun; Pang, Xiuhong; Hu, Yechen; Wang, Xiaowen; Wu, Hao; Yang, Tao

2016-10-19

Waardenburg syndrome (WS) characterized by sensorineural hearing loss and pigmentary abnormalities is genetically heterogeneous and phenotypically variable. This study investigated the molecular etiology and genotype-phenotype correlation of WS in 36 Chinese Han deaf probands and 16 additional family members that were clinically diagnosed with WS type I (WS1, n = 8) and type II (WS2, n = 42). Mutation screening of six WS-associated genes detected PAX3 mutations in 6 (86%) of the 7 WS1 probands. Among the 29 WS2 probands, 13 (45%) and 10 (34%) were identified with SOX10 and MITF mutations, respectively. Nineteen of the 26 detected mutations were novel. In WS2 probands whose parental DNA samples were available, de novo mutations were frequently seen for SOX10 mutations (7/8) but not for MITF mutations (0/5, P = 0.005). Excessive freckle, a common feature of WS2 in Chinese Hans, was frequent in WS2 probands with MITF mutations (7/10) but not in those with SOX10 mutations (0/13, P = 4.9 × 10 -4 ). Our results showed that mutations in SOX10 and MITF are two major causes for deafness associated with WS2. These two subtypes of WS2 can be distinguished by the high de novo rate of the SOX10 mutations and the excessive freckle phenotype exclusively associated with the MITF mutations.

Molecular etiology and genotype-phenotype correlation of Chinese Han deaf patients with type I and type II Waardenburg Syndrome

PubMed Central

Sun, Lianhua; Li, Xiaohua; Shi, Jun; Pang, Xiuhong; Hu, Yechen; Wang, Xiaowen; Wu, Hao; Yang, Tao

2016-01-01

Waardenburg syndrome (WS) characterized by sensorineural hearing loss and pigmentary abnormalities is genetically heterogeneous and phenotypically variable. This study investigated the molecular etiology and genotype-phenotype correlation of WS in 36 Chinese Han deaf probands and 16 additional family members that were clinically diagnosed with WS type I (WS1, n = 8) and type II (WS2, n = 42). Mutation screening of six WS-associated genes detected PAX3 mutations in 6 (86%) of the 7 WS1 probands. Among the 29 WS2 probands, 13 (45%) and 10 (34%) were identified with SOX10 and MITF mutations, respectively. Nineteen of the 26 detected mutations were novel. In WS2 probands whose parental DNA samples were available, de novo mutations were frequently seen for SOX10 mutations (7/8) but not for MITF mutations (0/5, P = 0.005). Excessive freckle, a common feature of WS2 in Chinese Hans, was frequent in WS2 probands with MITF mutations (7/10) but not in those with SOX10 mutations (0/13, P = 4.9 × 10−4). Our results showed that mutations in SOX10 and MITF are two major causes for deafness associated with WS2. These two subtypes of WS2 can be distinguished by the high de novo rate of the SOX10 mutations and the excessive freckle phenotype exclusively associated with the MITF mutations. PMID:27759048

Germline mutation of CHEK2 in neurofibromatosis 1 and 2: Two case reports.

PubMed

Li, Qiang; Zhao, Feilong; Ju, Yan

2018-06-01

Neurofibromatosis, including type 1 and type 2, is inherited dominant disease that causes serious consequences. The genetic mechanism of these diseases has been described, but germline mutation of checkpoint 2 kinase gene, together with other DNA repair related genes, has not been fully elucidated in the context of neurofibromatosis. In this article, we reported identical germline mutation of CHEK2 gene (p.R180C) in a 7-year-old Tibetan boy with NF1, and in a 12-year-old Chinese girl with NF2. Neurofibromatosis 1 and 2 with CHECK2 gene germline mutation. Both patients underwent operation to obtain tumor tissue, and peripheral blood of their family was tested. Identical germline mutation of CHEK2 gene (p.R180C) was detected in both patients, and germline mutations of POLE, MUTYH and ATR were also detected. This is the first article to describe CHEK2 mutation in both NF1 and NF2. This article highlights a possible role of CHEK2, in association with other germline genetic mutations, in tumorigenesis of NF1 and NF2.

Mutations in the von Hippel-Lindau (VHL) tumor suppressor gene and VHL-haplotype analysis in patients with presumable congenital erythrocytosis.

PubMed

Cario, Holger; Schwarz, Klaus; Jorch, Norbert; Kyank, Ulrike; Petrides, Petro E; Schneider, Dominik T; Uhle, Renate; Debatin, Klaus-Michael; Kohne, Elisabeth

2005-01-01

Congenital erythrocytoses or polycythemias are rare and heterogeneous. A homozygous mutation (C598T->Arg200Trp) in the von Hippel-Lindau (VHL) gene was originally identified as the cause of the endemic Chuvash polycythemia. Subsequently this and other mutations in the VHL gene were also detected in several patients of different ethnic origin. Haplotype analyses of the VHL gene suggested a common origin for the Chuvash-type mutation. Thirty-four patients with presumable congenital erythrocytosis due to an unknown underlying disorder were examined for VHL gene mutations and VHL region haplotypes. Four patients were homozygous and one patient heterozygous for the Chuvash-type mutation. One additional patient presented a previously not described heterozygous mutation G311->T VHL in exon 1. The haplotype analyses were in agreement with recently published data for three of the four patients with homozygous mutations as well as for the patient with a heterozygous Chuvash-type mutation. One patient of Turkish origin with homozygous Chuvash-type mutation had a haplotype not previously found in individuals with Chuvash-type mutation. These results confirm that mutations in the VHL gene are responsible for a substantial proportion of patients with congenital erythrocytoses. Erythrocytoses due to a C598->T mutation of the VHL gene are not geographically restricted. The majority of patients with Chuvash polycythemia share a common VHL gene haplotype. The different haplotype in one of the patients with Chuvash-type mutation indicates that this mutation was not spread only from a single founder but developed independently in other individuals.

CMS-dependent prognostic impact of KRAS and BRAFV600E mutations in primary colorectal cancer.

PubMed

Smeby, J; Sveen, A; Merok, M A; Danielsen, S A; Eilertsen, I A; Guren, M G; Dienstmann, R; Nesbakken, A; Lothe, R A

2018-05-01

The prognostic impact of KRAS and BRAFV600E mutations in primary colorectal cancer (CRC) varies with microsatellite instability (MSI) status. The gene expression-based consensus molecular subtypes (CMSs) of CRC define molecularly and clinically distinct subgroups, and represent a novel stratification framework in biomarker analysis. We investigated the prognostic value of these mutations within the CMS groups. Totally 1197 primary tumors from a Norwegian series of CRC stage I-IV were analyzed for MSI and mutation status in hotspots in KRAS (codons 12, 13 and 61) and BRAF (codon 600). A subset was analyzed for gene expression and confident CMS classification was obtained for 317 samples. This cohort was expanded with clinical and molecular data, including CMS classification, from 514 patients in the publically available dataset GSE39582. Gene expression signatures associated with KRAS and BRAFV600E mutations were used to evaluate differential impact of mutations on gene expression among the CMS groups. BRAFV600E and KRAS mutations were both associated with inferior 5-year overall survival (OS) exclusively in MSS tumors (BRAFV600E mutation versus KRAS/BRAF wild-type: Hazard ratio (HR) 2.85, P < 0.001; KRAS mutation versus KRAS/BRAF wild-type: HR 1.30, P = 0.013). BRAFV600E-mutated MSS tumors were strongly enriched and associated with metastatic disease in CMS1, leading to negative prognostic impact in this subtype (OS: BRAFV600E mutation versus wild-type: HR 7.73, P = 0.001). In contrast, the poor prognosis of KRAS mutations was limited to MSS tumors with CMS2/CMS3 epithelial-like gene expression profiles (OS: KRAS mutation versus wild-type: HR 1.51, P = 0.011). The subtype-specific prognostic associations were substantiated by differential effects of BRAFV600E and KRAS mutations on gene expression signatures according to the MSI status and CMS group. BRAFV600E mutations are enriched and associated with metastatic disease in CMS1 MSS tumors, leading to poor prognosis in this subtype. KRAS mutations are associated with adverse outcome in epithelial (CMS2/CMS3) MSS tumors.

Polymerase ε (POLE) ultra-mutation in uterine tumors correlates with T lymphocyte infiltration and increased resistance to platinum-based chemotherapy in vitro

PubMed Central

Bellone, Stefania; Eliana, Bignotti; Lonardi, Silvia; Ferrari, Francesca; Centritto, Floriana; Masserdotti, Alice; Pettinella, Francesca; Black, Jonathan; Menderes, Gulden; Altwerger, Gary; Hui, Pei; Lopez, Salvatore; de Haydu, Christopher; Bonazzoli, Elena; Predolini, Federica; Zammataro, Luca; Cocco, Emiliano; Ferrari, Federico; Ravaggi, Antonella; Romani, Chiara; Facchettie, Fabio; Sartori, Enrico; Odicino, Franco E.; Silasi, Dan-Arin; Litkouhi, Babak; Ratner, Elena; Azodi, Masoud; Schwartz, Peter E.; Santin, Alessandro D.

2016-01-01

Objective Up to 12 % of all endometrial-carcinomas (EC) harbor DNA-polymerase-ε-(POLE) mutations. It is currently unknown whether the favorable prognosis of POLE-mutated EC is derived from their low metastatic capability, extraordinary number of somatic mutations thus imparting immunogenicity, or a high sensitivity to chemotherapy. Methods Polymerase-chain-reaction-amplification and Sanger-sequencing were used to test for POLE exonuclease-domain-mutations (exons 9–14) 131 EC. Infiltration of CD4+ and CD8+ T-lymphocytes (TIL) and PD-1-expression in POLE-mutated vs POLE wild-type EC was studied by immunohistochemistry (IHC) and the correlations between survival and molecular features were investigated. Finally, primary POLE-mutated and POLE-wild-type EC cell lines were established and compared in-vitro for their sensitivity to chemotherapy. Results Eleven POLE-mutated EC (8.5%) were identified. POLE-mutated tumors were associated with improved progression-free-survival (P<0.05) and displayed increased numbers of CD4+ (44.5 vs 21.8; P = .001) and CD8+ (32.8 vs 13.5; P < .001) TILs when compared to wild-type POLE EC. PD-1 receptor was overexpressed in TILs from POLE-mutated vs wild-type-tumors (81% vs 28%; P < .001). Primary POLE tumor cell lines were significantly more resistant to platinum-chemotherapy in-vitro when compared to POLE-wild-type tumors (P < 0.004). Conclusions POLE ultra-mutated EC are heavily infiltrated with CD4+/CD8+ TIL, overexpress PD-1 immune-check-point (i.e., features consistent with chronic antigen-exposure), and have a better prognosis when compared to other molecular subtypes of EC patients. POLE-mutated tumor-cell lines are resistant to platinum-chemotherapy in-vitro suggesting that the better prognosis of POLE-patients is not secondary to a higher sensitivity to chemotherapy but likely linked to enhanced immunogenicity. PMID:27894751

Development of breast tumors in CHEK2, NBN/NBS1 and BLM mutation carriers does not commonly involve somatic inactivation of the wild-type allele.

PubMed

Suspitsin, Evgeny N; Yanus, Grigory A; Sokolenko, Anna P; Yatsuk, Olga S; Zaitseva, Olga A; Bessonov, Alexandr A; Ivantsov, Alexandr O; Heinstein, Valeria A; Klimashevskiy, Valery F; Togo, Alexandr V; Imyanitov, Evgeny N

2014-02-01

Somatic inactivation of the remaining allele is a characteristic feature of cancers arising in BRCA1 and BRCA2 mutation carriers, which determines their unprecedented sensitivity to some DNA-damaging agents. Data on tumor-specific status of the involved gene in novel varieties of hereditary breast cancer (BC) remain incomplete. We analyzed 32 tumors obtained from 30 patients with non-BRCA1/2 BC-associated germ-line mutations: 25 women were single mutation carriers (7 BLM, 15 CHEK2 and 3 NBN/NBS1) and 5 were double mutation carriers (2 BLM/BRCA1, 1 CHEK2/BLM, 1 CHEK2/BRCA1 and 1 NBN/BLM). Losses of heterozygosity affecting the wild-type allele were detected in none of the tumors from BLM mutation carriers, 3/18 (17 %) CHEK2-associated BC and 1/4 (25 %) NBN/NBS1-driven tumors. The remaining 28 BC were subjected to the sequence analysis of entire coding region of the involved gene; no somatic mutations were identified. We conclude that the tumor-specific loss of the wild-type allele is not characteristic for BC arising in CHEK2, NBN/NBS1 and BLM mutation carriers. Rarity of "second-hit" inactivation of the involved gene in CHEK2-, NBN/NBS1- and BLM-associated BC demonstrates their substantial biological difference from BRCA1/2-driven cancers and makes them poorly suitable for the clinical trials with cisplatin and PARP inhibitors.

Molecular genetics of cystinuria: Identification of four new mutations and seven polymorphisms, and evidence for genetic heterogeneity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gasparini, P.; Bisceglia, L.; Notarangelo, A.

A cystinuria disease gene (rBAT) has been recently identified, and some mutations causing the disease have been described. The frequency of these mutations has been investigated in a large sample of 51 Italian and Spanish cystinuric patients. In addition, to identify new mutated alleles, genomic DNA has been analyzed by an accurate and sensitive method able to detect nucleotide changes. Because of the lack of information available on the genomic structure of rBAT gene, the study was carried out using the sequence data so far obtained by us. More than 70% of the entire coding sequence and 8 intron-exon boundariesmore » have been analyzed. Four new mutations and seven intragenic polymorphisms have been detected. All mutations so far identified in rBAT belong only to cystinuria type I alleles, accounting for {approximately} 44% of all type I cystinuric chromosomes. Mutation M467T is the most common mutated allele in the Italian and Spanish populations. After analysis of 70% of the rBAT coding region, we have detected normal sequences in cystinuria type II and type III chromosomes. The presence of rBAT mutated alleles only in type I chromosomes of homozygous (type I/I) and heterozygous (type I/III) patients provides evidence for genetic heterogeneity where rBAT would be responsible only for type I cystinuria and suggests a complementation mechanism to explain the intermediate type I/type III phenotype. 25 refs., 1 fig., 3 tabs.« less

Germline mutations of BRCA1 gene exon 11 are not associated with platinum response neither with survival advantage in patients with primary ovarian cancer: understanding the clinical importance of one of the biggest human exons. A study of the Tumor Bank Ovarian Cancer (TOC) Consortium.

PubMed

Dimitrova, Desislava; Ruscito, Ilary; Olek, Sven; Richter, Rolf; Hellwag, Alexander; Türbachova, Ivana; Woopen, Hannah; Baron, Udo; Braicu, Elena Ioana; Sehouli, Jalid

2016-09-01

Germline mutations in BRCA1 gene have been reported in up to 20 % of epithelial ovarian cancer (EOC) patients. Distinct clinical characteristics have been attributed to this special EOC population. We hypothesized that mutations in different BRCA1 gene exons may differently affect the clinical course of the disease. The aim of this study was to analyze, in a large cohort of primary EOCs, the clinical impact of mutations in BRCA1 gene exon 11, the largest exon of the gene sequence encoding the 60 % of BRCA1 protein. Two hundred sixty-three primary EOC patients, treated between 2000 and 2008 at Charité University Hospital of Berlin, were included. Patients' blood samples were obtained from the Tumor Ovarian Cancer (TOC) Network ( www.toc-network.de ). Direct sequencing of BRCA1 gene exon 11 was performed for each patient to detect mutations. Based on their BRCA1 exon 11 mutational status, patients were compared regarding clinico-pathological variables and survival. Mutations in BRCA1 exon 11 were found in 18 out of 263 patients (6.8 %). Further 10/263 (3.8 %) cases showed variants of uncertain significance (VUS). All exon 11 BRCA1-positive tumors (100 %) were Type 2 ovarian carcinomas (p = 0.05). Age at diagnosis was significantly younger in Type 2 exon 11 mutated patients (p = 0.01). On multivariate analysis, BRCA1 exon 11 mutational status was not found to be an independent predictive factor for optimal cytoreduction, platinum response, or survival. Mutations in BRCA1 gene exon 11 seem to predispose women to exclusively develop a Type 2 ovarian cancer at younger age. Exon 11 BRCA1-mutated EOC patients showed distinct clinico-pathological features but similar clinical outcome with respect to sporadic EOC patients.

Characterization of six mutations in Exon 37 of neurofibromatosis type 1 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Upadhyaya, M.; Osborn, M.; Maynard, J.

Neurofibromatosis type 1 (NF1) is one of the most common inherited disorders, with an incidence of 1 in 3,000. We screened a total of 320 unrelated NF1 patients for mutations in exon 37 of the NF1 gene. Six independent mutations were identified, of which three are novel, and these include a recurrent nonsense mutation identified in 2 unrelated patients at codon 2281 (G2281X), a 1-bp insertion (6791 ins A) resulting in a change of TAG (tyrosine) to a TAA (stop codon), and a 3-bp deletion (6839 del TAC) which generated a frameshift. Another recurrent nonsense mutation, Y2264X, which was detectedmore » in 2 unrelated patients in this study, was also previously reported in 2 NF1 individuals. All the mutations were identified within a contiguous 49-bp sequence. Further studies are warranted to support the notion that this region of the gene contains highly mutable sequences. 17 refs., 2 figs., 1 tab.« less

Mutation spectrum of primary hyperoxaluria type 1 in Tunisia: implication for diagnosis in North Africa.

PubMed

Nagara, Majdi; Tiar, Afaf; Ben Halim, Nizar; Ben Rhouma, Faten; Messaoud, Olfa; Bouyacoub, Yosra; Kefi, Rym; Hassayoun, Saida; Zouari, Noura; Ben Ammar, Mohamed Slim; Abdelhak, Sonia; Chemli, Jalel

2013-09-15

Primary hyperoxaluria type 1 (PH1) is an autosomal recessive inherited metabolic disease, characterized by progressive kidney failure due to renal deposition of calcium oxalate. Mutations in the AGXT gene, encoding the liver-specific enzyme alanine glyoxylate aminotransferase, are responsible for the disease. We aimed to determine the mutational spectrum causing PH1 and to provide an accurate tool for diagnosis as well as for prenatal diagnosis in the affected families. Direct sequencing was used to detect mutations in the AGXT gene in DNA samples from 13 patients belonging to 12 Tunisian families. Molecular analysis revealed five mutations causing PH1 in Tunisia. The mutations were identified along exons 1, 2, 4, 5 and 7. The most predominant mutations were the Maghrebian "p.I244T" and the Arabic "p.G190R". Furthermore, three other mutations characteristic of different ethnic groups were found in our study population. These results confirm the mutational heterogeneity related to PH1 in Tunisian population. All the mutations are in a homozygous state, reflecting the high impact of endogamy in our population. Mutation analysis through DNA sequencing can provide a useful first line investigation for PH1. This identification could provide an accurate tool for prenatal diagnosis, genetic counseling and screen for potential presymptomatic individuals. © 2013 Elsevier B.V. All rights reserved.

CACNA1H missense mutations associated with amyotrophic lateral sclerosis alter Cav3.2 T-type calcium channel activity and reticular thalamic neuron firing.

PubMed

Rzhepetskyy, Yuriy; Lazniewska, Joanna; Blesneac, Iulia; Pamphlett, Roger; Weiss, Norbert

2016-11-01

Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease that affects nerve cells in the brain and the spinal cord. In a recent study by Steinberg and colleagues, 2 recessive missense mutations were identified in the Cav3.2 T-type calcium channel gene (CACNA1H), in a family with an affected proband (early onset, long duration ALS) and 2 unaffected parents. We have introduced and functionally characterized these mutations using transiently expressed human Cav3.2 channels in tsA-201 cells. Both of these mutations produced mild but significant changes on T-type channel activity that are consistent with a loss of channel function. Computer modeling in thalamic reticular neurons suggested that these mutations result in decreased neuronal excitability of thalamic structures. Taken together, these findings implicate CACNA1H as a susceptibility gene in amyotrophic lateral sclerosis.

Mosaic generalized neurofibromatosis 1: report of two cases.

PubMed

Hardin, Jori; Behm, Allan; Haber, Richard M

2014-01-01

We report two cases of mosaic generalized neurofibromatosis 1 (NF1) and review the history of the classification of segmental neurofibromatosis (SNF; Ricardi type NF-V). Somatic mutations giving rise to limited disease, such as segmental neurofibromatosis are manifestations of mosaicism. If the mutation occurs before tissue differentiation, the clinical phenotype will be generalized disease. Mutations that occur later in development give rise to disease that is confined to a single region. Segmental neurofibromatosis is caused by a somatic mutation of neurofibromatosis type 1, and should not be regarded as a distinct entity from neurofibromatosis 1. Cases previously referred to as unilateral or bilateral segmental neurofibromatosis are now best referred to as mosaic generalized or mosaic localized neurofibromatosis 1.

CRISPR/Cas9-mediated ASXL1 mutations in U937 cells disrupt myeloid differentiation

PubMed Central

Wu, Zhi-Jie; Zhao, Xin; Banaszak, Lauren G.; Gutierrez-Rodrigues, Fernanda; Keyvanfar, Keyvan; Gao, Shou-Guo; Raffo, Diego Quinones; Kajigaya, Sachiko; Young, Neal S.

2018-01-01

Additional sex combs-like 1 (ASXL1) is a well-known tumor suppressor gene and epigenetic modifier. ASXL1 mutations are frequent in myeloid malignances; these mutations are risk factors for the development of myelodysplasia and also appear as small clones during normal aging. ASXL1 appears to act as an epigenetic regulator of cell survival and myeloid differentiation; however, the molecular mechanisms underlying the malignant transformation of cells with ASXL1 mutations are not well defined. Using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein-9 nuclease (Cas9) genome editing, heterozygous and homozygous ASXL1 mutations were introduced into human U937 leukemic cells. Comparable cell growth and cell cycle progression were observed between wild-type (WT) and ASXL1-mutated U937 cells. Drug-induced cytotoxicity, as measured by growth inhibition and apoptosis in the presence of the cell-cycle active agent 5-fluorouracil, was variable among the mutated clones but was not significantly different from WT cells. In addition, ASXL1-mutated cells exhibited defects in monocyte/macrophage differentiation. Transcriptome analysis revealed that ASXL1 mutations altered differentiation of U937 cells by disturbing genes involved in myeloid differentiation, including cytochrome B-245 β chain and C-type lectin domain family 5, member A. Dysregulation of numerous gene sets associated with cell death and survival were also observed in ASXL1-mutated cells. These data provide evidence regarding the underlying molecular mechanisms induced by mutated ASXL1 in leukemogenesis. PMID:29532865

Mutation Analysis of COL1A1 and COL1A2 in Fetuses with Osteogenesis Imperfecta Type II/III.

PubMed

Wang, Wenbo; Wu, Qichang; Cao, Lin; Sun, Li; Xu, Yasong; Guo, Qiwei

2015-01-27

Aim: To analyze COL1A1/2 mutations in prenatal-onset OI for determine the proportion of mutations in type I collagen genes among prenatal onset OI and to provide additional data for genotype-phenotype analyses. Material and Methods: Ten cases of severe fetal short-limb dwarfism detected by antenatal ultrasonography were referred to our center. Before the termination of pregnancy, cordocentesis was performed for fetal karyotype and COL1A1/2 gene sequencing analysis. Postmortem radiographic examination was performed at all instances for definitive diagnosis. Results: COL1A1 and COL1A2 SNP and mutations were identified in all the cases. Among these, one synonymous SNP and four synonymous SNPs were recognized in COL1A1/2, respectively, seven cases have distinct heterozygous mutations and six new COL1A1/2 gene mutations were identified. Conclusion: There has been substantial progress in the identification of the molecular defects responsible for skeletal dysplasias. With the constant increase in the number of identified mutations in COL1A1 and COL1A2, genotype-phenotype correlation is becoming increasingly pertinent. © 2015 S. Karger AG, Basel.

A second mutation in the type II procollagen gene (COL2AI) causing stickler syndrome (arthro-ophthalmopathy) is also a premature termination codon.

PubMed Central

Ahmad, N N; McDonald-McGinn, D M; Zackai, E H; Knowlton, R G; LaRossa, D; DiMascio, J; Prockop, D J

1993-01-01

Genetic linkage analyses suggest that mutations in type II collagen may be responsible for Stickler syndrome, or arthro-ophthalmopathy (AO), in many families. In the present study oligonucleotide primers were developed to amplify and directly sequence eight of the first nine exons of the gene for type II procollagen (COL2A1). Analysis of the eight exons in 10 unrelated probands with AO revealed that one had a single-base mutation in one allele that changed the codon of -CGA- for arginine at amino acid position alpha 1-9 in exon 7 to a premature termination signal for translation. The second mutation found to cause AO was, therefore, similar to the first in that both created premature termination signals in the COL2A1 gene. Since mutations producing premature termination signals have not previously been detected in genes for fibrillar collagens, the results raise the possibility that such mutations in the COL2A1 gene are a common cause of AO. Images Figure 2 Figure 3 PMID:8434604

Impacts of Usher syndrome type IB mutations on human myosin VIIa motor function.

PubMed

Watanabe, Shinya; Umeki, Nobuhisa; Ikebe, Reiko; Ikebe, Mitsuo

2008-09-09

Usher syndrome (USH) is a human hereditary disorder characterized by profound congenital deafness, retinitis pigmentosa, and vestibular dysfunction. Myosin VIIa has been identified as the responsible gene for USH type 1B, and a number of missense mutations have been identified in the affected families. However, the molecular basis of the dysfunction of USH gene, myosin VIIa, in the affected families is unknown to date. Here we clarified the effects of USH1B mutations on human myosin VIIa motor function for the first time. The missense mutations of USH1B significantly inhibited the actin activation of ATPase activity of myosin VIIa. G25R, R212C, A397D, and E450Q mutations abolished the actin-activated ATPase activity completely. P503L mutation increased the basal ATPase activity for 2-3-fold but reduced the actin-activated ATPase activity to 50% of the wild type. While all of the mutations examined, except for R302H, reduced the affinity for actin and the ATP hydrolysis cycling rate, they did not largely decrease the rate of ADP release from actomyosin, suggesting that the mutations reduce the duty ratio of myosin VIIa. Taken together, the results suggest that the mutations responsible for USH1B cause the complete loss of the actin-activated ATPase activity or the reduction of duty ratio of myosin VIIa.

Impacts of Usher Syndrome Type IB Mutations on Human Myosin VIIa Motor Function†

PubMed Central

Watanabe, Shinya; Umeki, Nobuhisa; Ikebe, Reiko; Ikebe, Mitsuo

2010-01-01

Usher syndrome (USH) is a human hereditary disorder characterized by profound congenital deafness, retinitis pigmentosa and vestibular dysfunction. Myosin VIIa has been identified as the responsible gene for USH type 1B, and a number of missense mutations have been identified in the affected families. However, the molecular basis of the dysfunction of USH gene, myosin VIIa, in the affected families is unknown to date. Here we clarified the effects of USH1B mutations on human myosin VIIa motor function for the first time. The missense mutations of USH1B significantly inhibited the actin activation of ATPase activity of myosin VIIa. G25R, R212C, A397D and E450Q mutations abolished the actin-activated ATPase activity completely. P503L mutation increased the basal ATPase activity for 2-3 fold, but reduced the actin-activated ATPase activity to 50% of the wild type. While all the mutations examined, except for R302H, reduced the affinity for actin and the ATP hydrolysis cycling rate, they did not largely decrease the rate of ADP release from acto-myosin, suggesting that the mutations reduce the duty ratio of myosin VIIa. Taken together, the results suggest that the mutations responsible for USH1B cause the complete loss of the actin-activated ATPase activity or the reduction of duty ratio of myosin VIIa. PMID:18700726

Epidermal growth factor receptor mutations in Japanese men with lung adenocarcinomas.

PubMed

Tomita, Masaki; Ayabe, Takanori; Chosa, Eiichi; Kawagoe, Katsuya; Nakamura, Kunihide

2014-01-01

Epidermal growth factor receptor (EGFR) mutations play a vital role in the prognosis of patients with lung adenocarcinoma. Such somatic mutations are more common in women who are non-smokers with adenocarcinoma and are of Asian origin. However, to our knowledge, there are few studies that have focused on men. One hundred and eighty-four consecutive patients (90 men and 94 women) of resected lung adenocarcinoma were studied retrospectively. EGFR mutations were positive in 48.9% and negative (wild type) in 51.1%. Overall mutation was significant in women (66.0% vs. 32.2%) compared with men (p<0.001). For overall patients, EGFR mutation status was associated with gender, pStage, pT status, lepidic dominant histologic subtype, pure or mixed ground-glass nodule type on computed tomography and smoking status. However, in men, EGFR mutation status was only associated with lepidic dominant histologic subtype and not the other variables. Interestingly, the Brinkman index of men with mutant EGFR also did not differ from that for the wild type (680.0±619.3 vs. 813.1±552.1 p=0.1077). The clinical characteristics of men with lung adenocarcinoma related to EGFR mutation are not always similar to that of overall patients. Especially we failed to find the relationship between EGFR mutations and smoking status in men.

A novel deletion mutation is recurrent in von Willebrand disease types 1 and 3.

PubMed

Sutherland, Megan S; Cumming, Anthony M; Bowman, Mackenzie; Bolton-Maggs, Paula H B; Bowen, Derrick J; Collins, Peter W; Hay, Charles R M; Will, Andrew M; Keeney, Stephen

2009-07-30

Direct sequencing of VWF genomic DNA in 21 patients with type 3 von Willebrand disease (VWD) failed to reveal a causative homozygous or compound heterozygous VWF genotype in 5 cases. Subsequent analysis of VWF mRNA led to the discovery of a deletion (c.221-977_532 + 7059del [p.Asp75_Gly178del]) of VWF in 7 of 12 white type 3 VWD patients from 6 unrelated families. This deletion of VWF exons 4 and 5 was absent in 9 patients of Asian origin. We developed a genomic DNA-based assay for the deletion, which also revealed its presence in 2 of 34 type 1 VWD families, segregating with VWD in an autosomal dominant fashion. The deletion was associated with a specific VWF haplotype, indicating a possible founder origin. Expression studies indicated markedly decreased secretion and defective multimerization of the mutant VWF protein. Further studies have found the mutation in additional type 1 VWD patients and in a family expressing both type 3 and type 1 VWD. The c.221-977_532 + 7059del mutation represents a previously unreported cause of both types 1 and 3 VWD. Screening for this mutation in other type 1 and type 3 VWD patient populations is required to elucidate further its overall contribution to VWD arising from quantitative deficiencies of VWF.

Freeze-drying in novel container system: Characterization of heat and mass transfer in glass syringes.

PubMed

Patel, Sajal M; Pikal, Michael J

2010-07-01

This study is aimed at characterizing and understanding different modes of heat and mass transfer in glass syringes to develop a robust freeze-drying process. Two different holder systems were used to freeze-dry in syringes: an aluminum (Al) block and a plexiglass holder. The syringe heat transfer coefficient was characterized by a sublimation test using pure water. Mannitol and sucrose (5% w/v) were also freeze-dried, as model systems, in both the assemblies. Dry layer resistance was determined from manometric temperature measurement (MTM) and product temperature was measured using thermocouples, and was also determined from MTM. Further, freeze-drying process was also designed using Smart freeze-dryer to assess its application for freeze-drying in novel container systems. Heat and mass transfer in syringes were compared against the traditional container system (i.e., glass tubing vial). In the Al block, the heat transfer was via three modes: contact conduction, gas conduction, and radiation with gas conduction being the dominant mode of heat transfer. In the plexiglass holder, the heat transfer was mostly via radiation; convection was not involved. Also, MTM/Smart freeze-drying did work reasonably well for freeze-drying in syringes. When compared to tubing vials, product temperature decreases and hence drying time increases in syringes. (c) 2010 Wiley-Liss, Inc. and the American Pharmacists Association

TBM/MTM for HTS-FNSF: An innovative testing strategy to qualify/validate fusion technologies for U.S. DEMO

DOE PAGES

El-Guebaly, Laila; Rowcliffe, Arthur; Menard, Jonathan; ...

2016-08-11

The qualification and validation of nuclear technologies are daunting tasks for fusion demonstration (DEMO) and power plants. This is particularly true for advanced designs that involve harsh radiation environment with 14 MeV neutrons and high-temperature operating regimes. This paper outlines the unique qualification and validation processes developed in the U.S., offering the only access to the complete fusion environment, focusing on the most prominent U.S. blanket concept (the dual cooled PbLi (DCLL)) along with testing new generations of structural and functional materials in dedicated test modules. The venue for such activities is the proposed Fusion Nuclear Science Facility (FNSF), whichmore » is viewed as an essential element of the U.S. fusion roadmap. A staged blanket testing strategy has been developed to test and enhance the DCLL blanket performance during each phase of FNSF D-T operation. A materials testing module (MTM) is critically important to include in the FNSF as well to test a broad range of specimens of future, more advanced generations of materials in a relevant fusion environment. Here, the most important attributes for MTM are the relevant He/dpa ratio (10–15) and the much larger specimen volumes compared to the 10–500 mL range available in the International Fusion Materials Irradiation Facility (IFMIF) and European DEMO-Oriented Neutron Source (DONES).« less

A design for living technology: experiments with the mind time machine.

PubMed

Ikegami, Takashi

2013-01-01

Living technology aims to help people expand their experiences in everyday life. The environment offers people ways to interact with it, which we call affordances. Living technology is a design for new affordances. When we experience something new, we remember it by the way we perceive and interact with it. Recent studies in neuroscience have led to the idea of a default mode network, which is a baseline activity of a brain system. The autonomy of artificial life must be understood as a sort of default mode that self-organizes its baseline activity, preparing for its external inputs and its interaction with humans. I thus propose a method for creating a suitable default mode as a design principle for living technology. I built a machine called the mind time machine (MTM), which runs continuously for 10 h per day and receives visual data from its environment using 15 video cameras. The MTM receives and edits the video inputs while it self-organizes the momentary now. Its base program is a neural network that includes chaotic dynamics inside the system and a meta-network that consists of video feedback systems. Using this system as the hardware and a default mode network as a conceptual framework, I describe the system's autonomous behavior. Using the MTM as a testing ground, I propose a design principle for living technology.

Application of process analytical technology for monitoring freeze-drying of an amorphous protein formulation: use of complementary tools for real-time product temperature measurements and endpoint detection.

PubMed

Schneid, Stefan C; Johnson, Robert E; Lewis, Lavinia M; Stärtzel, Peter; Gieseler, Henning

2015-05-01

Process analytical technology (PAT) and quality by design have gained importance in all areas of pharmaceutical development and manufacturing. One important method for monitoring of critical product attributes and process optimization in laboratory scale freeze-drying is manometric temperature measurement (MTM). A drawback of this innovative technology is that problems are encountered when processing high-concentrated amorphous materials, particularly protein formulations. In this study, a model solution of bovine serum albumin and sucrose was lyophilized at both conservative and aggressive primary drying conditions. Different temperature sensors were employed to monitor product temperatures. The residual moisture content at primary drying endpoints as indicated by temperature sensors and batch PAT methods was quantified from extracted sample vials. The data from temperature probes were then used to recalculate critical product parameters, and the results were compared with MTM data. The drying endpoints indicated by the temperature sensors were not suitable for endpoint indication, in contrast to the batch methods endpoints. The accuracy of MTM Pice data was found to be influenced by water reabsorption. Recalculation of Rp and Pice values based on data from temperature sensors and weighed vials was possible. Overall, extensive information about critical product parameters could be obtained using data from complementary PAT tools. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.

Novel compound heterozygous mutations in SERPINH1 cause rare autosomal recessive osteogenesis imperfecta type X.

PubMed

Song, Y; Zhao, D; Xu, X; Lv, F; Li, L; Jiang, Y; Wang, O; Xia, W; Xing, X; Li, M

2018-03-09

We identified novel compound heterozygous mutations in SERPINH1 in a Chinese boy suffering from recurrent fractures, femoral deformities, and growth retardation, which resulted in extremely rare autosomal recessive OI type X. Long-term treatment of BPs was effective in increasing BMD Z-score, reducing fracture incidence and reshaping vertebrae compression. Osteogenesis imperfecta (OI) is a heritable bone disorder characterized by low bone mineral density, recurrent fractures, and progressive bone deformities. Mutation in serpin peptidase inhibitor clade H, member 1 (SERPINH1), which encodes heat shock protein 47 (HSP47), leads to rare autosomal recessive OI type X. We aimed to detect the phenotype and the pathogenic mutation of OI type X in a boy from a non-consanguineous Chinese family. We investigated the pathogenic mutations and analyzed their relationship with the phenotype in the patient using next-generation sequencing (NGS) and Sanger sequencing. Moreover, the efficacy of long-term bisphosphonate treatment in this patient was evaluated. The patient suffered from multiple fractures, low bone mass, and bone deformities in the femur, without dentinogenesis imperfecta or hearing loss. Compound heterozygous variants were found in SERPINH1 as follows: c.149 T>G in exon 2 and c.1214G>A in exon 5. His parents were heterozygous carriers of each of these mutations, respectively. Bisphosphonates could be helpful in increasing BMD Z-score, reducing bone fracture risk and reshaping the compressed vertebral bodies of this patient. We reported novel compound heterozygous mutations in SERPINH1 in a Chinese OI patient for the first time, which expanded the spectrum of phenotype and genotype of extremely rare OI type X.

The pso4-1 mutation reduces spontaneous mitotic gene conversion and reciprocal recombination in Saccharomyces cerevisiae.

PubMed

Meira, L B; Fonseca, M B; Averbeck, D; Schenberg, A C; Henriques, J A

1992-11-01

Spontaneous mitotic recombination was examined in the haploid pso4-1 mutant of Saccharomyces cerevisiae and in the corresponding wild-type strain. Using a genetic system involving a duplication of the his4 gene it was shown that the pso4-1 mutation decreases at least fourfold the spontaneous rate of mitotic recombination. The frequency of spontaneous recombination was reduced tenfold in pso4-1 strains, as previously observed in the rad52-1 mutant. However, whereas the rad52-1 mutation specifically reduces gene conversion, the pso4-1 mutation reduces both gene conversion and reciprocal recombination. Induced mitotic recombination was also studied in pso4-1 mutant and wild-type strains after treatment with 8-methoxypsoralen plus UVA and 254 nm UV irradiation. Consistent with previous results, the pso4-1 mutation was found strongly to affect recombination induction.

A study of the mutational landscape of pediatric-type follicular lymphoma and pediatric nodal marginal zone lymphoma.

PubMed

Ozawa, Michael G; Bhaduri, Aparna; Chisholm, Karen M; Baker, Steven A; Ma, Lisa; Zehnder, James L; Luna-Fineman, Sandra; Link, Michael P; Merker, Jason D; Arber, Daniel A; Ohgami, Robert S

2016-10-01

Pediatric-type follicular lymphoma and pediatric marginal zone lymphoma are two of the rarest B-cell lymphomas. These lymphomas occur predominantly in the pediatric population and show features distinct from their more common counterparts in adults: adult-type follicular lymphoma and adult-type nodal marginal zone lymphoma. Here we report a detailed whole-exome deep sequencing analysis of a cohort of pediatric-type follicular lymphomas and pediatric marginal zone lymphomas. This analysis revealed a recurrent somatic variant encoding p.Lys66Arg in the transcription factor interferon regulatory factor 8 (IRF8) in 3 of 6 cases (50%) of pediatric-type follicular lymphoma. This specific point mutation was not detected in pediatric marginal zone lymphoma or in adult-type follicular lymphoma. Additional somatic point mutations in pediatric-type follicular lymphoma were observed in genes involved in transcription, intracellular signaling, and cell proliferation. In pediatric marginal zone lymphoma, no recurrent mutation was identified; however, somatic point mutations were observed in genes involved in cellular adhesion, cytokine regulatory elements, and cellular proliferation. A somatic variant in AMOTL1, a recurrently mutated gene in splenic marginal zone lymphoma, was also identified in a case of pediatric marginal zone lymphoma. The overall non-synonymous mutational burden was low in both pediatric-type follicular lymphoma and pediatric marginal zone lymphoma (4.6 mutations per exome). Altogether, these findings support a distinctive genetic basis for pediatric-type follicular lymphoma and pediatric marginal zone lymphoma when compared with adult subtypes and to one another. Moreover, identification of a recurrent point mutation in IRF8 provides insight into a potential driver mutation in the pathogenesis of pediatric-type follicular lymphoma with implications for novel diagnostic or therapeutic strategies.

A study of the mutational landscape of pediatric-type follicular lymphoma and pediatric nodal marginal zone lymphoma

PubMed Central

Ozawa, Michael G; Bhaduri, Aparna; Chisholm, Karen M; Baker, Steven A; Ma, Lisa; Zehnder, James L; Luna-Fineman, Sandra; Link, Michael P; Merker, Jason D; Arber, Daniel A; Ohgami, Robert S

2016-01-01

Pediatric-type follicular lymphoma and pediatric marginal zone lymphoma are two of the rarest B-cell lymphomas. These lymphomas occur predominantly in the pediatric population and show features distinct from their more common counterparts in adults: adult-type follicular lymphoma and adult-type nodal marginal zone lymphoma. Here we report a detailed whole-exome deep sequencing analysis of a cohort of pediatric-type follicular lymphomas and pediatric marginal zone lymphomas. This analysis revealed a recurrent somatic variant encoding p.Lys66Arg in the transcription factor interferon regulatory factor 8 (IRF8) in 3 of 6 cases (50%) of pediatric-type follicular lymphoma. This specific point mutation was not detected in pediatric marginal zone lymphoma or in adult-type follicular lymphoma. Additional somatic point mutations in pediatric-type follicular lymphoma were observed in genes involved in transcription, intracellular signaling, and cell proliferation. In pediatric marginal zone lymphoma, no recurrent mutation was identified; however, somatic point mutations were observed in genes involved in cellular adhesion, cytokine regulatory elements, and cellular proliferation. A somatic variant in AMOTL1, a recurrently mutated gene in splenic marginal zone lymphoma, was also identified in a case of pediatric marginal zone lymphoma. The overall non-synonymous mutational burden was low in both pediatric-type follicular lymphoma and pediatric marginal zone lymphoma (4.6 mutations per exome). Altogether, these findings support a distinctive genetic basis for pediatric-type follicular lymphoma and pediatric marginal zone lymphoma when compared with adult subtypes and to one another. Moreover, identification of a recurrent point mutation in IRF8 provides insight into a potential driver mutation in the pathogenesis of pediatric-type follicular lymphoma with implications for novel diagnostic or therapeutic strategies. PMID:27338637

Nonsense mutations in the PAX3 gene cause Waardenburg syndrome type I in two Chinese patients.

PubMed

Yang, Shu-Zhi; Cao, Ju-Yang; Zhang, Rui-Ning; Liu, Li-Xian; Liu, Xin; Zhang, Xin; Kang, Dong-Yang; Li, Mei; Han, Dong-Yi; Yuan, Hui-Jun; Yang, Wei-Yan

2007-01-05

Waardenburg syndrome type I (WS1) is an autosomal dominant disorder characterized by sensorineural hearing loss, pigmental abnormalities of the eye, hair and skin, and dystopia canthorum. The gene mainly responsible for WS1 is PAX3 which is involved in melanocytic development and survival. Mutations of PAX3 have been reported in familiar or sporadic patients with WS1 in several populations of the world except Chinese. In order to explore the genetic background of Chinese WS1 patients, a mutation screening of PAX3 gene was carried out in four WS1 pedigrees. A questionnaire survey and comprehensive clinical examination were conducted in four Chinese pedigrees of WS1. Genomic DNA from each patient and their family members was extracted and exons of PAX3 were amplified by PCR. PCR fragments were ethanol-purified and sequenced in both directions on an ABI_Prism 3100 DNA sequencer with the BigDye Terminator Cycle Sequencing Ready Reaction Kit. The sequences were obtained and aligned to the wild type sequence of PAX3 with the GeneTool program. Two nonsense PAX3 mutations have been found in the study population. One is heterozygous for a novel nonsense mutation S209X. The other is heterozygous for a previously reported mutation in European population R223X. Both mutations create stop codons leading to truncation of the PAX3 protein. This is the first demonstration of PAX3 mutations in Chinese WS1 patients and one of the few examples of an identical mutation of PAX3 occurred in different populations.

Development of a practical NF1 genetic testing method through the pilot analysis of five Japanese families with neurofibromatosis type 1.

PubMed

Okumura, Akiko; Ozaki, Mamoru; Niida, Yo

2015-08-01

Mutation analysis of NF1, the responsible gene for neurofibromatosis type 1 (NF1), is still difficult due to its large size, lack of mutational hotspots, the presence of many pseudogenes, and its wide spectrum of mutations. To develop a simple and inexpensive NF1 genetic testing for clinical use, we analyzed five Japanese families with NF1 as a pilot study. Our original method, CEL endonuclease mediated heteroduplex incision with polyacrylamide gel electrophoresis and silver staining (CHIPS) was optimized for NF1 mutation screening, and reverse transcription polymerase chain reaction (RT-PCR) was performed to determine the effect of transcription. Also, we employed DNA microarray analysis to evaluate the break points of the large deletion. A new nonsense mutation, p.Gln209(∗), was detected in family 1 and the splicing donor site mutation, c.2850+1G>T, was detected in family 2. In family 3, c.4402A>G was detected in exon 34 and the p.Ser1468Gly missense mutation was predicted. However mRNA analysis revealed that this substitution created an aberrant splicing acceptor site, thereby causing the p.Phe1457(∗) nonsense mutation. In the other two families, type-1 and unique NF1 microdeletions were detected by DNA microarray analysis. Our results show that the combination of CHIPS and RT-PCR effectively screen and characterize NF1 point mutations, and both DNA and RNA level analysis are required to understand the nature of the NF1 mutation. Our results also suggest the possibility of a higher incidence and unique profile of NF1 large deletions in the Japanese population as compared to previous studies performed in Europe. Copyright © 2014 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Use of mutation profiles to refine the classification of endometrial carcinomas

PubMed Central

Cheang, Maggie CU; Wiegand, Kimberly; Senz, Janine; Tone, Alicia; Yang, Winnie; Prentice, Leah; Tse, Kane; Zeng, Thomas; McDonald, Helen; Schmidt, Amy P.; Mutch, David G.; McAlpine, Jessica N; Hirst, Martin; Shah, Sohrab P; Lee, Cheng-Han; Goodfellow, Paul J; Gilks, C. Blake; Huntsman, David G

2014-01-01

The classification of endometrial carcinomas is based on pathological assessment of tumour cell type; the different cell types (endometrioid, serous, carcinosarcoma, mixed, and clear cell) are associated with distinct molecular alterations. This current classification system for high-grade subtypes, in particular the distinction between high-grade endometrioid (EEC-3) and serous carcinomas (ESC), is limited in its reproducibility and prognostic abilities. Therefore, a search for specific molecular classifiers to improve endometrial carcinoma subclassification is warranted. We performed target enrichment sequencing on 393 endometrial carcinomas from two large cohorts, sequencing exons from the following 9 genes; ARID1A, PPP2R1A, PTEN, PIK3CA, KRAS, CTNNB1, TP53, BRAF and PPP2R5C. Based on this gene panel each endometrial carcinoma subtype shows a distinct mutation profile. EEC-3s have significantly different frequencies of PTEN and TP53 mutations when compared to low-grade endometrioid carcinomas. ESCs and EEC-3s are distinct subtypes with significantly different frequencies of mutations in PTEN, ARID1A, PPP2R1A, TP53, and CTNNB1. From the mutation profiles we were able to identify subtype outliers, i.e. cases diagnosed morphologically as one subtype but with a mutation profile suggestive of a different subtype. Careful review of these diagnostically challenging cases suggested that the original morphological classification was incorrect in most instances. The molecular profile of carcinosarcomas suggests two distinct mutation profiles for these tumours; endometrioid-type (PTEN, PIK3CA, ARID1A, KRAS mutations), and serous-type (TP53 and PPP2R1A mutations). While this nine gene panel does not allow for a purely molecularly based classification of endometrial carcinoma, it may prove useful as an adjunct to morphological classification and serve as an aid in the classification of problematic cases. If used in practice, it may lead to improved diagnostic reproducibility and may also serve to stratify patients for targeted therapeutics. PMID:22653804

Detection of AGXT bgene mutations by denaturing high-performance liquid chromatography for diagnosis of hyperoxaluria type 1.

PubMed

Pirulli, D; Giordano, M; Lessi, M; Spanò, A; Puzzer, D; Zezlina, S; Boniotto, M; Crovella, S; Florian, F; Marangella, M; Momigliano-Richiardi, P; Savoldi, S; Amoroso, A

2001-06-01

Primary hyperoxaluria type 1 is an autosomal recessive disorder of glyoxylate metabolism, caused by a deficiency of alanine:glyoxylate aminotransferase, which is encoded by a single copy gene (AGXT. The aim of this research was to standardize denaturing high-performance liquid chromatography, a new, sensitive, relatively inexpensive, and automated technique, for the detection of AGXT mutation. Denaturing high-performance liquid chromatography was used to analyze in blind the AGXT gene in 20 unrelated Italian patients with primary hyperoxaluria type I previously studied by other standard methods (single-strand conformation polymorphism analysis and direct sequencing) and 50 controls. Denaturing high-performance liquid chromatography allowed us to identify 13 mutations and the polymorphism at position 154 in exon I of the AGXT gene. Hence the method is more sensitive and less time consuming than single-strand conformation polymorphism analysis for the detection of AGXT mutations, thus representing a useful and reliable tool for detecting the mutations responsible for primary hyperoxaluria type 1. The new technology could also be helpful in the search for healthy carriers of AGXT mutations amongst family members and their partners, and for screening of AGXT polymorphisms in patients with nephrolithiasis and healthy populations.

Papillary renal cell carcinoma: a clinicopathological and whole-genome exon sequencing study

PubMed Central

Liu, Kunpeng; Ren, Yuan; Pang, Lijuan; Qi, Yan; Jia, Wei; Tao, Lin; Hu, Zhengyan; Zhao, Jin; Zhang, Haijun; Li, Li; Yue, Haifeng; Han, Juan; Liang, Weihua; Hu, Jianming; Zou, Hong; Yuan, Xianglin; Li, Feng

2015-01-01

Papillary renal cell carcinoma (PRCC) represents the second most common histological subtype of RCC, and comprises 2 subtypes. Prognosis for type 1 PRCC is relatively good, whereas type 2 PRCC is associated with poor clinical outcomes. The aim of the present study was to evaluate the clinicopathological and mutations characteristics of PRCC. Hence, we reported on 13 cases of PRCC analyzed using whole-exome sequencing. Histologically, type 2 PRCC showed a higher nuclear grade and lymphovascular invasion rate versus type 1 PRCC (P < 0.05). Immunostaining revealed type 1 PRCC had higher CK7 and lower Top IIα expression rates (P < 0.05). Whole-exome sequencing data analysis revealed that the mutational statuses of 373 genes (287 missense, 69 silent, 6 nonsense, and 11 synonymous mutations) differed significantly between PRCC and normal renal tissues (P < 0.05). Functional enrichment analysis was used to classify the 287 missense-mutated genes into 11 biological process clusters (comprised of 61 biological processes) and 5 pathways, involved in cell adhesion, microtubule-based movement, the cell cycle, polysaccharide biosynthesis, muscle cell development and differentiation, cell death, and negative regulation. Associated pathways included the ATP-binding cassette transporter, extracellular matrix-receptor interaction, lysosome, complement and coagulation cascades, and glyoxylate and dicarboxylate metabolism pathways. The missense mutation status of 19 genes differed significantly between the groups (P < 0.05), and alterations in the EEF1D, RFNG, GPR142, and RAB37 genes were located in different chromosomal regions in type 1 and 2 PRCC. These mutations may contribute to future studies on pathogenic mechanisms and targeted therapy of PRCC. PMID:26339402

Mutation in a gene for type I procollagen (COL1A2) in a woman with postmenopausal osteoporosis: Evidence for phenotypic and genotypic overlap with mild osteogenesis imperfecta

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spotila, L.D.; Constantinou, C.D.; Sereda, L.

Mutations in the two genes for type I collagen (COL1A1 or COL1A2) cause osteogenesis imperfecta (OI), a heritable disease characterized by moderate to extreme brittleness of bone early in life. Here, the authors show that a 52-year-old post menopausal woman with severe osteopenia and a compression fracture of a thoracic vertebra had a mutation in the gene for the {alpha}2(I) chain of type I collagen (COL1A2) similar to mutations that cause OI. cDNA was prepared from the woman's skin fibroblast RNA and assayed for the presence of a mutation by treating DNA heteroduplexes with carbodiimide. The results indicated a sequencemore » variation in the region encoding amino acid residues 660-667 of the {alpha}2(I) chain. Further analysis demonstrated a single-base mutation that caused a serine-for-glycine substitution at position 661 of the {alpha}2(I) triple-helical domain. The substitution produced posttranslational overmodification of the collagen triple helix, as is seen with most glycine substitutions that cause OI. The patient had a history of five previous fractures, slightly blue sclerae, and slight hearing loss. Therefore, the results suggest that there may be phenotypic and genotypic overlap between mild osteogenesis imperfecta and postmenopausal osteoporosis, and that a subset of women with postmenopausal osteoporosis may have mutations in the genes for type I procollagen.« less

Consortium for Osteogenesis Imperfecta Mutations in the Helical Domain of Type I Collagen: Regions Rich in Lethal Mutations Align With Collagen Binding Sites for Integrins and Proteoglycans

PubMed Central

Marini, Joan C.; Forlino, Antonella; Cabral, Wayne A.; Barnes, Aileen M.; San Antonio, James D.; Milgrom, Sarah; Hyland, James C.; Körkkö, Jarmo; Prockop, Darwin J.; De Paepe, Anne; Coucke, Paul; Symoens, Sofie; Glorieux, Francis H.; Roughley, Peter J.; Lund, Alan M.; Kuurila-Svahn, Kaija; Hartikka, Heini; Cohn, Daniel H.; Krakow, Deborah; Mottes, Monica; Schwarze, Ulrike; Chen, Diana; Yang, Kathleen; Kuslich, Christine; Troendle, James; Dalgleish, Raymond; Byers, Peter H.

2014-01-01

Osteogenesis imperfecta (OI) is a generalized disorder of connective tissue characterized by fragile bones and easy susceptibility to fracture. Most cases of OI are caused by mutations in type I collagen. We have identified and assembled structural mutations in type I collagen genes (COL1A1 and COL1A2, encoding the proα1(I) and proα2(I) chains, respectively) that result in OI. Quantitative defects causing type I OI were not included. Of these 832 independent mutations, 682 result in substitution for glycine residues in the triple helical domain of the encoded protein and 150 alter splice sites. Distinct genotype–phenotype relationships emerge for each chain. One-third of the mutations that result in glycine substitutions in α1(I) are lethal, especially when the substituting residues are charged or have a branched side chain. Substitutions in the first 200 residues are nonlethal and have variable outcome thereafter, unrelated to folding or helix stability domains. Two exclusively lethal regions (helix positions 691–823 and 910–964) align with major ligand binding regions (MLBRs), suggesting crucial interactions of collagen monomers or fibrils with integrins, matrix metalloproteinases (MMPs), fibronectin, and cartilage oligomeric matrix protein (COMP). Mutations in COL1A2 are predominantly nonlethal (80%). Lethal substitutions are located in eight regularly spaced clusters along the chain, supporting a regional model. The lethal regions align with proteoglycan binding sites along the fibril, suggesting a role in fibril–matrix interactions. Recurrences at the same site in α2(I) are generally concordant for outcome, unlike α1(I). Splice site mutations comprise 20% of helical mutations identified in OI patients, and may lead to exon skipping, intron inclusion, or the activation of cryptic splice sites. Splice site mutations in COL1A1 are rarely lethal; they often lead to frameshifts and the mild type I phenotype. In α2(I), lethal exon skipping events are located in the carboxyl half of the chain. Our data on genotype–phenotype relationships indicate that the two collagen chains play very different roles in matrix integrity and that phenotype depends on intracellular and extracellular events. PMID:17078022

Genomic Analysis of Tumor Microenvironment Immune Types across 14 Solid Cancer Types: Immunotherapeutic Implications.

PubMed

Chen, Yu-Pei; Zhang, Yu; Lv, Jia-Wei; Li, Ying-Qin; Wang, Ya-Qin; He, Qing-Mei; Yang, Xiao-Jing; Sun, Ying; Mao, Yan-Ping; Yun, Jing-Ping; Liu, Na; Ma, Jun

2017-01-01

We performed a comprehensive immuno-genomic analysis of tumor microenvironment immune types (TMITs), which is classified into four groups based on PD-L1+CD8A or PD-L1+cytolytic activity (CYT) expression, across a broad spectrum of solid tumors in order to help identify patients who will benefit from anti- PD-1/PD-L1 therapy. The mRNA sequencing data from The Cancer Genome Atlas (TCGA) of 14 solid cancer types representing 6,685 tumor samples was analyzed. TMIT was classified only for those tumor types that both PD-L1 and CD8A/CYT could prefict mutation and/or neoantigen number. The mutational and neoepitope features of the tumor were compared according to the four TMITs. We found that PD-L1/CD8A/CYT subgroups could not distinguish different mutation and neoantigen numbers in certain tumor types such as glioblastoma multiforme, prostate adenocarcinoma, and head and neck and lung squamous cell carcinoma. For the remaining tumor types, compared with TIMT II (low PD-L1 and CD8A/CYT), TIMT I (high PD-L1 and CD8A/CYT) had a significantly higher number of mutations or neoantigens in bladder urothelial carcinoma, breast and cervical cancer, colorectal, stomach and lung adenocarcinoma, and melanoma. In contrast, TMIT I of kidney clear cell, liver hepatocellular, and thyroid carcinoma were negatively correlated with mutation burden or neoantigen numbers. Our findings show that the TMIT stratification proposed could serve as a favorable approach for tailoring optimal immunotherapeutic strategies in certain tumor types. Going forward, it will be important to test the clinical practicability of TMIT based on quantification of immune infiltrates using mRNA-seq to predict clinical response to these and other immunotherapeutic strategies in more different tumors.

In vitro modeling to determine mutation specificity of EGFR tyrosine kinase inhibitors against clinically relevant EGFR mutants in non-small-cell lung cancer

PubMed Central

Yasuda, Hiroyuki; Hamamoto, Junko; Oashi, Ayano; Ishioka, Kota; Arai, Daisuke; Nukaga, Shigenari; Miyawaki, Masayoshi; Kawada, Ichiro; Naoki, Katsuhiko; Costa, Daniel B.; Kobayashi, Susumu S.; Betsuyaku, Tomoko; Soejima, Kenzo

2015-01-01

EGFR mutated lung cancer accounts for a significant subgroup of non-small-cell lung cancer (NSCLC). Over the last decade, multiple EGFR tyrosine kinase inhibitors (EGFR-TKIs) have been developed to target mutated EGFR. However, there is little information regarding mutation specific potency of EGFR-TKIs against various types of EGFR mutations. The purpose of this study is to establish an in vitro model to determine the “therapeutic window” of EGFR-TKIs against various types of EGFR mutations, including EGFR exon 20 insertion mutations. The potency of 1st (erlotinib), 2nd (afatinib) and 3rd (osimertinib and rociletinib) generation EGFR-TKIs was compared in vitro for human lung cancer cell lines and Ba/F3 cells, which exogenously express mutated or wild type EGFR. An in vitro model of mutation specificity was created by calculating the ratio of IC50 values between mutated and wild type EGFR. The in vitro model identified a wide therapeutic window of afatinib for exon 19 deletions and L858R and of osimertinib and rociletinib for T790M positive mutations. The results obtained with our models matched well with previously reported preclinical and clinical data. Interestingly, for EGFR exon 20 insertion mutations, most of which are known to be resistant to 1st and 2nd generation EGFR-TKIS, osimertinib was potent and presented a wide therapeutic window. To our knowledge, this is the first report that has identified the therapeutic window of osimertinib for EGFR exon 20 insertion mutations. In conclusion, this model will provide a preclinical rationale for proper selection of EGFR-TKIs against clinically-relevant EGFR mutations. PMID:26515464

Getting It Right Matters: Climate Spectra and Their Estimation

NASA Astrophysics Data System (ADS)

Privalsky, Victor; Yushkov, Vladislav

2018-06-01

In many recent publications, climate spectra estimated with different methods from observed, GCM-simulated, and reconstructed time series contain many peaks at time scales from a few years to many decades and even centuries. However, respective spectral estimates obtained with the autoregressive (AR) and multitapering (MTM) methods showed that spectra of climate time series are smooth and contain no evidence of periodic or quasi-periodic behavior. Four order selection criteria for the autoregressive models were studied and proven sufficiently reliable for 25 time series of climate observations at individual locations or spatially averaged at local-to-global scales. As time series of climate observations are short, an alternative reliable nonparametric approach is Thomson's MTM. These results agree with both the earlier climate spectral analyses and the Markovian stochastic model of climate.

Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnb1.

PubMed

Fang, Ling; Du, William W; Lyu, Juanjuan; Dong, Jun; Zhang, Chao; Yang, Weining; He, Alina; Kwok, Yat Sze Sheila; Ma, Jian; Wu, Nan; Li, Feiya; Awan, Faryal Mehwish; He, Chengyan; Yang, Bing L; Peng, Chun; MacKay, Helen J; Yee, Albert J; Yang, Burton B

2018-05-23

TP53 mutations occur in many different types of cancers that produce mutant p53 proteins. The mutant p53 proteins have lost wild-type p53 activity and gained new functions that contribute to malignant tumor progression. Different p53 mutations create distinct profiles in loss of wild-type p53 activity and gain of functions. Targeting the consequences generated by the great number of p53 mutations would be extremely complex. Therefore, in this study we used a workaround and took advantage of the fact that mutant p53 cannot bind H2AX. Using this, we developed a new approach to repress the acquisition of mutant p53 functions. We show here that the delivery of a circular RNA circ-Ccnb1 inhibited the function of three p53 mutations. By microarray analysis and real-time PCR, we detected decreased circ-Ccnb1 expression levels in patients bearing breast carcinoma. Ectopic delivery of circ-Ccnb1 inhibited tumor growth and extended mouse viability. Using proteomics, we found that circ-Ccnb1 precipitated p53 in p53 wild-type cells, but instead precipitated Bclaf1 in p53 mutant cells. Further experiments showed that H2AX serves as a bridge, linking the interaction of circ-Ccnb1 and wild-type p53, thus allowing Bclaf1 to bind Bcl2 resulting in cell survival. In the p53 mutant cells, circ-Ccnb1 formed a complex with H2AX and Bclaf1, resulting in the induction of cell death. We found that this occurred in three p53 mutations. These results shed light on the possible development of new approaches to inhibit the malignancy of p53 mutations.

Subtypes of the Type II Pit Pattern Reflect Distinct Molecular Subclasses in the Serrated Neoplastic Pathway.

PubMed

Aoki, Hironori; Yamamoto, Eiichiro; Yamano, Hiro-O; Sugai, Tamotsu; Kimura, Tomoaki; Tanaka, Yoshihito; Matsushita, Hiro-O; Yoshikawa, Kenjiro; Takagi, Ryo; Harada, Eiji; Nakaoka, Michiko; Yoshida, Yuko; Harada, Taku; Sudo, Gota; Eizuka, Makoto; Yorozu, Akira; Kitajima, Hiroshi; Niinuma, Takeshi; Kai, Masahiro; Nojima, Masanori; Suzuki, Hiromu; Nakase, Hiroshi

2018-03-15

Colorectal serrated lesions (SLs) are important premalignant lesions whose clinical and biological features are not fully understood. We aimed to establish accurate colonoscopic diagnosis and treatment of SLs through evaluation of associations among the morphological, pathological, and molecular characteristics of SLs. A total of 388 premalignant and 18 malignant colorectal lesions were studied. Using magnifying colonoscopy, microsurface structures were assessed based on Kudo's pit pattern classification system, and the Type II pit pattern was subcategorized into classical Type II, Type II-Open (Type II-O) and Type II-Long (Type II-L). BRAF/KRAS mutations and DNA methylation of CpG island methylator phenotype (CIMP) markers (MINT1, - 2, - 12, - 31, p16, and MLH1) were analyzed through pyrosequencing. Type II-O was tightly associated with sessile serrated adenoma/polyps (SSA/Ps) with BRAF mutation and CIMP-high. Most lesions with simple Type II or Type II-L were hyperplastic polyps, while mixtures of Type II or Type II-L plus more advanced pit patterns (III/IV) were characteristic of traditional serrated adenomas (TSAs). Type II-positive TSAs frequently exhibited BRAF mutation and CIMP-low, while Type II-L-positive TSAs were tightly associated with KRAS mutation and CIMP-low. Analysis of lesions containing both premalignant and cancerous components suggested Type II-L-positive TSAs may develop into KRAS-mutated/CIMP-low/microsatellite stable cancers, while Type II-O-positive SSA/Ps develop into BRAF-mutated/CIMP-high/microsatellite unstable cancers. These results suggest that Type II subtypes reflect distinct molecular subclasses in the serrated neoplasia pathway and that they could be useful hallmarks for identifying SLs at high risk of developing into CRC.

X-linked Charcot-Marie-Tooth (CMT) neuropathies (CMTX1, CMTX2, CMTX3) show different clinical phenotype and molecular genetics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ionasescu, V.V.; Searby, C.C.; Ionasescu, R.

1994-09-01

The purpose of this study was to compare the X-linked dominant type CMTX1 (20 families) with X-linked recessive types CMTX2 and CMTX3 (2 families). The clinical phenotype was consistent with CMT peripheral neuropathy in all cases including distal weakness, atrophy and sensory loss, pes cavus and areflexia. Additional clinicial involvement of the central nervous system was present in one family with CMTX2 (mental retardation) and one family with CMTX3 (spastic paraparesis). Tight genetic linkage to Xq13.1 was present in 20 families with CMTX1 (Z=34.07 at {theta}=0) for the marker DXS453. Fifteen of the CMTX1 families showed point mutations of themore » connexin 32 coding region (5 nonsense mutations, 8 missense mutations, 2 deletions). Five CMTX1 neuropathy families showed no evidence of point mutations of the CX32 coding sequence. These findings suggest that the CMTX1 neuropathy genotype in these families may be the result of promoter mutations, 3{prime}-untranslated region mutations or exon/intron splice site mutations or a mutation with a different type of connexin but which has close structural similarities to CX32. No mutations of the CX32 coding region were found in the CMTX2 or CMTX3 families. Linkage to Xq13.1 was excluded in both families. Genetic linkage to Xp22.2 was present in the CMTX2 family (Z=3.54 at {theta}=0) for the markers DXS987 and DXS999. Suggestion of linkage to Xq26 (Z=1.81 at {theta}=0) for the marker DXS86 was present in the CMTX3 family.« less

A novel missense mutation of the TYR gene in a pedigree with oculocutaneous albinism type 1 from China.

PubMed

Lin, Yu-Ying; Wei, Ai-Hua; Zhou, Zhi-Yong; Zhu, Wei; He, Xin; Lian, Shi

2011-10-01

The mutation of the tyrosinase (TYR) gene results in oculocutaneous albinism type 1 (OCA1), an autosomal recessive genetic disorder. OCA1 is the most common type of OCA in the Chinese population. Hence, the TYR gene was tested in this study. We also delineated the genetic analysis of OCA1 in a Chinese family. Genomic DNA was isolated from the blood leukocytes of a proband and his family. Mutational analysis at the TYR locus by DNA sequencing was used to screen five exons, including the intron/exon junctions. A pedigree chart was drawn and the fundus of the eyes of the proband was also examined. A novel missense mutation p.I151S on exon 1, and homozygous TYR mutant alleles were identified in the proband. None of the mutants was identified among the 100 normal control subjects. Genetic analysis of the proband's wife showed normal alleles in the TYR gene. Thus, the fetus was predicated a carrier of OCA1 with a normal appearance. This study provided new information about a novel mutation, p.I151S, in the TYR gene in a Chinese family with OCA1. Further investigation of the proband would be helpful to determine the effects of this mutation on TYR activity.

Condensation Heat Transfer of Steam on a Single Horizontal Tube.

DTIC Science & Technology

1983-06-01

public release; distribution unlimited 88 09 07 1?0 L_ I jmmAzzLEim. SICUR1TY CLASStFICATION o« THIS r-AOt (*»*< Data Enf«r»d) REPORT...steam side data were taken at atmospheric pressure to test the data acquisition/reduction computer programs.^— S N 0102- LF. 014-1601 Accession For...Dlst H Special UNCLASSIFIED ItCUHlTV CLASSIFICATION O» TMI( PAOtyWft«! Data >*H mtm Im. ! Approved for public release; distribution

Novel pathogenic mutations and skin biopsy analysis in Knobloch syndrome

PubMed Central

Suzuki, Oscar; Kague, Erika; Bagatini, Kelly; Tu, Hongmin; Heljasvaara, Ritva; Carvalhaes, Lorenza; Gava, Elisandra; de Oliveira, Gisele; Godoi, Paulo; Oliva, Glaucius; Kitten, Gregory; Pihlajaniemi, Taina; Passos-Bueno, Maria-Rita

2009-01-01

Purpose To facilitate future diagnosis of Knobloch syndrome (KS) and better understand its etiology, we sought to identify not yet described COL18A1 mutations in KS patients. In addition, we tested whether mutations in this gene lead to absence of the COL18A1 gene product and attempted to better characterize the functional effect of a previously reported missense mutation. Methods Direct sequencing of COL18A1 exons was performed in KS patients from four unrelated pedigrees. We used immunofluorescent histochemistry in skin biopsies to evaluate the presence of type XVIII collagen in four KS patients carrying two already described mutations: c.3277C>T, a nonsense mutation, and c.3601G>A, a missense mutation. Furthermore, we determined the binding properties of the mutated endostatin domain p.A1381T (c.3601G>A) to extracellular matrix proteins using ELISA and surface plasmon resonance assays. Results We identified four novel mutations in COL18A1, including a large deletion involving exon 41. Skin biopsies from KS patients revealed lack of type XVIII collagen in epithelial basement membranes and blood vessels. We also found a reduced affinity of p.A1381T endostatin to some extracellular matrix components. Conclusions COL18A1 mutations involved in Knobloch syndrome have a distribution bias toward the coding exons of the C-terminal end. Large deletions must also be considered when point mutations are not identified in patients with characteristic KS phenotype. We report, for the first time, lack of type XVIII collagen in KS patients by immunofluorescent histochemistry in skin biopsy samples. As a final point, we suggest the employment of this technique as a preliminary and complementary test for diagnosis of KS in cases when mutation screening either does not detect mutations or reveals mutations of uncertain effect, such as the p.A1381T change. PMID:19390655

Novel pathogenic mutations and skin biopsy analysis in Knobloch syndrome.

PubMed

Suzuki, Oscar; Kague, Erika; Bagatini, Kelly; Tu, Hongmin; Heljasvaara, Ritva; Carvalhaes, Lorenza; Gava, Elisandra; de Oliveira, Gisele; Godoi, Paulo; Oliva, Glaucius; Kitten, Gregory; Pihlajaniemi, Taina; Passos-Bueno, Maria-Rita

2009-01-01

To facilitate future diagnosis of Knobloch syndrome (KS) and better understand its etiology, we sought to identify not yet described COL18A1 mutations in KS patients. In addition, we tested whether mutations in this gene lead to absence of the COL18A1 gene product and attempted to better characterize the functional effect of a previously reported missense mutation. Direct sequencing of COL18A1 exons was performed in KS patients from four unrelated pedigrees. We used immunofluorescent histochemistry in skin biopsies to evaluate the presence of type XVIII collagen in four KS patients carrying two already described mutations: c.3277C>T, a nonsense mutation, and c.3601G>A, a missense mutation. Furthermore, we determined the binding properties of the mutated endostatin domain p.A1381T (c.3601G>A) to extracellular matrix proteins using ELISA and surface plasmon resonance assays. We identified four novel mutations in COL18A1, including a large deletion involving exon 41. Skin biopsies from KS patients revealed lack of type XVIII collagen in epithelial basement membranes and blood vessels. We also found a reduced affinity of p.A1381T endostatin to some extracellular matrix components. COL18A1 mutations involved in Knobloch syndrome have a distribution bias toward the coding exons of the C-terminal end. Large deletions must also be considered when point mutations are not identified in patients with characteristic KS phenotype. We report, for the first time, lack of type XVIII collagen in KS patients by immunofluorescent histochemistry in skin biopsy samples. As a final point, we suggest the employment of this technique as a preliminary and complementary test for diagnosis of KS in cases when mutation screening either does not detect mutations or reveals mutations of uncertain effect, such as the p.A1381T change.

Biochemical and genetic diagnosis of the primary hyperoxalurias: a review.

PubMed

Rumsby, G

2000-01-01

The primary hyperoxalurias are a group of inherited disorders of endogenous oxalate overproduction. Diagnosis of the two best-characterized disorders, primary hyperoxaluria (PH) Types 1 and 2, is achieved by sequential measurement of alanine:glyoxylate aminotransferase and glyoxylate reductase enzyme activity in a single needle liver biopsy. While genetic analysis of PH2 is still at a relatively early stage, the AGXT gene defective in the Type 1 disorder is well characterized, and a number of mutations have been identified. To determine whether mutation analysis could replace enzymatic analysis for the diagnosis of PH1, DNA samples from 127 consecutive unrelated patients in whom there was a high clinical suspicion of primary hyperoxaluria were analyzed for the presence of the G630A and T853C mutations, which together account for approximately 34% of the mutant alleles in our patient cohort. The sensitivity of mutation detection was 47% in those patients with enzymologically confirmed Type 1 disease, showing that mutation analysis cannot effectively replace enzymology at the present time. However, there is little doubt of the value of genetic methods (mutation and linkage analysis) for diagnosing PH1 (and eventually PH2) in other family members and for prenatal diagnosis and carrier testing.

Homozygous EDNRB mutation in a patient with Waardenburg syndrome type 1.

PubMed

Morimoto, Noriko; Mutai, Hideki; Namba, Kazunori; Kaneko, Hiroki; Kosaki, Rika; Matsunaga, Tatsuo

2018-04-01

To examine and expand the genetic spectrum of Waardenburg syndrome type 1 (WS1). Clinical features related to Waardenburg syndrome (WS) were examined in a five-year old patient. Mutation analysis of genes related to WS was performed in the proband and her parents. Molecular modeling of EDNRB and the p.R319W mutant was conducted to predict the pathogenicity of the mutation. The proband showed sensorineural hearing loss, heterochromia iridis, and dystopia canthorum, fulfilling the clinical criteria of WS1. Genetic analyses revealed that the proband had no mutation in PAX3 which has been known as the cause of WS1, but had a homozygous missense mutation (p.R319W) in endothelin receptor type B (EDNRB) gene. The asymptomatic parents had the mutation in a heterozygote state. This mutation has been previously reported in a heterozygous state in a patient with Hirschsprung's disease unaccompanied by WS, but the patient and her parents did not show any symptoms in gastrointestinal tract. Molecular modeling of EDNRB with the p.R319W mutation demonstrated reduction of the positively charged surface area in this region, which might reduce binding ability of EDNRB to G protein and lead to abnormal signal transduction underlying the WS phenotype. Our findings suggested that autosomal recessive mutation in EDNRB may underlie a part of WS1 with the current diagnostic criteria, and supported that Hirschsprung's disease is a multifactorial genetic disease which requires additional factors. Further molecular analysis is necessary to elucidate the gene interaction and to reappraise the current WS classification. Copyright © 2017 Elsevier B.V. All rights reserved.

Detection of ESR1 mutations in plasma and tumors from metastatic breast cancer patients using next-generation sequencing.

PubMed

Yanagawa, Takehiro; Kagara, Naofumi; Miyake, Tomohiro; Tanei, Tomonori; Naoi, Yasuto; Shimoda, Masafumi; Shimazu, Kenzo; Kim, Seung Jin; Noguchi, Shinzaburo

2017-06-01

Liquid biopsy using digital PCR (dPCR) has been widely used for the screening of ESR1 mutations, since they are frequently identified in the hotspot. However, dPCR is limited to the known mutations. Therefore, we aimed to analyze the utility of next-generation sequencing (NGS) to discover novel ESR1 mutations. Whole exon sequencing of the ESR1 gene using NGS was performed in 16 primary and 47 recurrent tumor samples and 38 plasma samples from hormone receptor-positive metastatic breast cancer patients. Functional analyses were then performed for the novel mutations we detected. We identified no mutations in primary tumors and six mutations in five recurrent tumors, including three types of known mutations (Y537C, Y537N, and D538G) and two novel mutations (E279V and G557R). We also identified seven mutations in five plasma samples, including three types of known mutations (S463P, Y537S, and D538G) and one mutation not reported in COSMIC database (L536H). All nine patients with ESR1 mutations were treated with aromatase inhibitors (AIs) prior to sampling, and the mutations were frequently detected in patients who received AI treatments in the metastatic setting. Among the three novel mutations (E279V, L536H, and G557R), L536H, but not E279V and G557R, showed ligand-independent activity. All three mutant proteins showed nuclear localization and had no relation with non-genomic ER pathways. Although the molecular mechanisms of the E279V and G557R mutations remain unclear, our data suggest the utility of NGS as a liquid biopsy for metastatic breast cancer patients and the potential to identify novel ESR1 mutations.

[Clinical significance of JAK2、CALR and MPL gene mutations in 1 648 Philadelphia chromosome negative myeloproliferative neoplasms patients from a single center].

PubMed

Li, M Y; Chao, H Y; Sun, A N; Qiu, H Y; Jin, Z M; Tang, X W; Han, Y; Fu, C C; Chen, S N; Wu, D P

2017-04-14

Objective: To explore the prevalences of JAK2, CALR and MPL gene mutations and the mutation types in patients with Philadelphia chromosome negative myeloproliferative neoplasms (MPNs) , and to compare their clinical characteristics of different mutation types with each other and mutation negative group. Methods: The mutations of JAK2 V617F, JAK2 gene at exon 12, CALR gene at exon 9 and MPL gene at exon 10 in 1 648 Ph negative MPNs patients were detected by direct sequencing. Results: ① The JAK2V617F mutation was found in 471 (92.7%) of 508 PV patients, 819 (78.1%) of 1 049 ET patients and 74 (81.3%) of 91 PMF patients respectively, with the total mutation rate as 82.8% (1 364/1 648) . The JAK2 exon12 mutation was found in 9 (1.7%) of 508 PV patients, none was found in ET or PMF patients, with the total mutation rate as 0.5% (9/1 648) . The CALR mutation was found in 132 (12.6%) of 1 049 ET patients and 11 (12.1%) of 91 PMF patients respectively, with the total mutation rate as 8.7% (143/1 648) ; the MPL mutation was found in 9 (0.9%) of 1 049 ET patients and 1 (1.1%) of 91 PMF patients respectively, with the total mutation rate as 0.6% (10/1 648) . The co-occurrence of any two types of driver gene mutations was not detected by direct sequencing. ②The median onset age of patients with JAK2V617F[61 (15-95) y] was significant higher than of with JAK2 exon12 mutation[49 (33-62) y] or without mutations[42 (3-78) y] ( P <0.001) , but not for patients with CALR[57 (17-89) y] or MPL mutation[59 (22-71) y] ( P >0.05) . Patients with JAK2V617F had higher white blood cell count and hemoglobin level ( P <0.05) when compared with patients with CALR mutation or without mutations, or only significantly higher white blood cell count when compared with patients with MPL mutation ( P =0.013) . The platelet count of patients with CALR mutation was significantly higher than of with JAK2V617F[966 (400-2 069) ×10(9)/L vs 800 (198-3 730) ×10(9)/L, P <0.001]. ③Karyotype analysis was conducted in 1 160 patients with MPNs, the rates of karyotype abnormality of patients with and without CALR mutation were 9.8% (8/82) and 7.4% (80/1 078) ( P =0.441) respectively; The rates of karyotype abnormality of patients with and without JAK2V617F mutation were 7.7% (75/971) and 6.9% (13/189) ( P =0.688) respectively. The incidence of karyotype abnormality of patients with CALR mutation was higher than of with JAK2V617F[9.8% (8/82) vs 7.7% (75/971) ] without statistically significant difference ( P =0.512) . The karyotype analysis of 7 cases of JAK2 exon12 mutation and 6 ones with MPL gene mutation revealed normal karyotype. Conclusions: Driver gene mutations detection could ensure the diagnosis and prognosis judgment of MPN more reliable, different subtypes of MPNs had different profiles of driver gene mutations, the latter lead to unique clinical phenotype.

MSH6 and PMS2 mutation positive Australian Lynch syndrome families: novel mutations, cancer risk and age of diagnosis of colorectal cancer.

PubMed

Talseth-Palmer, Bente A; McPhillips, Mary; Groombridge, Claire; Spigelman, Allan; Scott, Rodney J

2010-05-21

Approximately 10% of Lynch syndrome families have a mutation in MSH6 and fewer families have a mutation in PMS2. It is assumed that the cancer incidence is the same in families with mutations in MSH6 as in families with mutations in MLH1/MSH2 but that the disease tends to occur later in life, little is known about families with PMS2 mutations. This study reports on our findings on mutation type, cancer risk and age of diagnosis in MSH6 and PMS2 families. A total of 78 participants (from 29 families) with a mutation in MSH6 and 7 participants (from 6 families) with a mutation in PMS2 were included in the current study. A database of de-identified patient information was analysed to extract all relevant information such as mutation type, cancer incidence, age of diagnosis and cancer type in this Lynch syndrome cohort. Cumulative lifetime risk was calculated utilising Kaplan-Meier survival analysis. MSH6 and PMS2 mutations represent 10.3% and 1.9%, respectively, of the pathogenic mutations in our Australian Lynch syndrome families. We identified 26 different MSH6 and 4 different PMS2 mutations in the 35 families studied. We report 15 novel MSH6 and 1 novel PMS2 mutations. The estimated cumulative risk of CRC at age 70 years was 61% (similar in males and females) and 65% for endometrial cancer in MSH6 mutation carriers. The risk of developing CRC is different between males and females at age 50 years, which is 34% for males and 21% for females. Novel MSH6 and PMS2 mutations are being reported and submitted to the current databases for identified Lynch syndrome mutations. Our data provides additional information to add to the genotype-phenotype spectrum for both MSH6 and PMS2 mutations.

Identification of a novel insertion mutation in FGFR3 that causes thanatophoric dysplasia type 1.

PubMed

Lindy, Amanda S; Basehore, Monica J; Munisha, Mumingjiang; Williams, Aimee Leanne; Friez, Michael J; Writzl, Karin; Willems, Patrick; Dougan, Scott T

2016-06-01

Thanatophoric dysplasia is a type of short-limbed neonatal dwarfism that is usually lethal in the perinatal period. It is characterized by short limbs, a narrow, bell-shaped thorax, macrocephaly with a prominent forehead, and flattened vertebral bodies. These malformations result from autosomal dominant mutations in the fibroblast growth factor receptor 3 (FGFR3) gene. In this report, we describe a novel FGFR3 insertion mutation in a fetus with shortened limbs, curved femurs, and a narrow thorax. The diagnosis of thanatophoric dysplasia type 1 was suspected clinically, and FGFR3 sequencing showed a c.742_743insTGT variant, which predicts p.R248delinsLC. In vivo studies in zebrafish demonstrated that this mutation resulted in the overexpression of zebrafish Fgfr3, leading to the over-activation of downstream signaling and dorsalized embryos. To date, no insertions or deletions in FGFR3 have been reported to cause thanatophoric dysplasia types 1 or 2; therefore, this represents the first report to describe such a mutation. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Mutational Analysis of Agxt in Tunisian Population with Primary Hyperoxaluria Type 1.

PubMed

M'dimegh, Saoussen; Omezzine, Asma; M'barek, Ibtihel; Moussa, Amira; Mabrouk, Sameh; Kaarout, Hayet; Souche, Geneviéve; Chemli, Jalel; Aloui, Sabra; Aquaviva-Bourdain, Cécile; Achour, Abdellatif; Abroug, Saoussen; Bouslama, Ali

2017-01-01

Primary hyperoxaluria type 1 (PH1) is an autosomal recessive metabolic disorder caused by inherited mutations in the AGXT gene encoding liver peroxisomal alanine:glyoxylate aminotransferase (AGT). PH1 is a clinically and genetically heterogeneous disorder. The aim of our study was to analyze and characterize the mutational spectrum of PH1 in Tunisian patients. Molecular studies of 146 Tunisian patients suspected with PH were performed by PCR/Restriction fragment length polymorphism (RFLP) to detect seven mutations described as the most common. Direct sequencing for the 11 exons was performed in patients in whom any mutation was not identified. The genetic diagnosis of PH1 was confirmed in 62.3% of patients. The first molecular approach based on PCR/restriction enzyme test was positive in 37.6% of patients, whereas the second molecular approach based on whole gene sequencing was successful in 24% of cases. Twelve pathogenic mutations were detected in our cohort. Two mutations were novel, and five were detected for the first time in Tunisians. The three most frequent mutations were p.Ile244Thr, p.Gly190Arg, and c.33dupC, with a frequency of 43.4%, 21.4%, and 13.1%, respectively. The two novel mutations detected in our study extend the spectrum of known AGXT gene mutations. The screen for the mutations identified in this study can provide a useful, cost-effective, and first-line investigation in Tunisian PH1 patients. © 2016 John Wiley & Sons Ltd/University College London.

Gaucher disease: molecular heterogeneity and phenotype-genotype correlations.

PubMed

Theophilus, B; Latham, T; Grabowski, G A; Smith, F I

1989-08-01

Gaucher disease (GD) is the most prevalent lysosomal storage disease. This autosomal recessive trait results from the defective activity of acid beta-glucosidase (beta-Glc). Four different exonic point mutations have been identified as causal alleles for GD. To facilitate screening for these alleles, assays were developed using allele-specific oligonucleotide hybridization to amplified genomic DNA sequences. Specifically, intron bases flanking exons 5, 9, and 10 were determined, and conditions for PCR amplification of these exons were obtained. Two different procedures were developed to distinguish signals obtained from the structural beta-Glc gene exons and those from the pseudogene. These procedures were used to determine the distribution of all known GD alleles in a population of 44 affected patients of varying phenotypes and ethnicity. The high frequency of one of the exon 9 mutations in Ashkenazi Jewish GD type 1 patients was confirmed, and, in addition, this mutation was present in ethnically diverse non-Jewish type 1 GD patients. Homozygotes (N = 5) for this allele were midly affected older individuals, and this mutant allele was not found in any patient with neuronopathic disease. The exon 10 mutation was confirmed as the predominant allele in types 2 and 3 GD. However, several type 1 GD patients, including one of Ashkenazi-Jewish heritage, also were heterozygous for this allele. The presence of this allele in type 1 patients did not correlate with the severity of clinical symptoms. The second exon 9 mutation and the exon 5 mutation were rare, since they occurred only heterozygously either in one type 2 GD patient or in two related Ashkenazi-Jewish GD patients, respectively. Although most GD patients (38 of 44) had at least one of the known mutant alleles, 57% were heterozygotes for only one of these mutations. Fourteen percent of patients were negative for all mutations. A total of 73% of GD patients had at least one unknown allele. The varying clinical phenotypes and ethnic origins of these incompletely characterized patients suggest that multiple other GD alleles exist.

Association of The IDH1 C.395G>A (R132H) Mutation with Histological Type in Malay Brain Tumors

PubMed

Mohamed Yusoff, Abdul Aziz; Zulfakhar, Fatin Najwa; Sul’ain, Mohd Dasuki; Idris, Zamzuri; Abdullah, Jafri Malin

2016-12-01

Background: Brain tumors, constituting one of the most deadly forms of cancer worldwide, result from the accumulation of multiple genetic and epigenetic alterations in genes and signaling pathways. Isocitrate dehydrogenase enzyme isoform 1 (IDH1) mutations are frequently identified in primary brain tumors and acute myeloid leukemia. Studies on IDH1 gene mutations have been extensively performed in various populations worldwide but not in Malaysia. This work was conducted to study the prevalence of IDH1 c.395G>A (R132H) hotspot mutations in a group of Malaysian patients with brain tumors in order to gain local data for the IDH1 mutation profile in our population. Methods: Mutation analysis of c.395G>A (R132H) of IDH1 was performed in 40 brain tumor specimens by the polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP) and then verified by direct sequencing. Associations between the IDH1 c.395G>A (R132H) mutation and clinicopathologic characteristics were also analyzed. Results: The IDH1 c.395G>A (R132H) mutation was detected in 14/40 patients (35%). A significant association was found with histological tumor types, but not with age, gender and race. Conclusions: IDH1 is frequently mutated and associated with histological subtypes in Malay brain tumors. Creative Commons Attribution License

Association of The IDH1 C.395G>A (R132H) Mutation with Histological Type in Malay Brain Tumors

PubMed Central

Yusoff, Abdul Aziz Mohamed; Zulfakhar, Fatin Najwa; Sul’ain, Mohd Dasuki; Idris, Zamzuri; Abdullah, Jafri Malin

2016-01-01

Background: Brain tumors, constituting one of the most deadly forms of cancer worldwide, result from the accumulation of multiple genetic and epigenetic alterations in genes and signaling pathways. Isocitrate dehydrogenase enzyme isoform 1 (IDH1) mutations are frequently identified in primary brain tumors and acute myeloid leukemia. Studies on IDH1 gene mutations have been extensively performed in various populations worldwide but not in Malaysia. This work was conducted to study the prevalence of IDH1 c.395G>A (R132H) hotspot mutations in a group of Malaysian patients with brain tumors in order to gain local data for the IDH1 mutation profile in our population. Methods: Mutation analysis of c.395G>A (R132H) of IDH1 was performed in 40 brain tumor specimens by the polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP) and then verified by direct sequencing. Associations between the IDH1 c.395G>A (R132H) mutation and clinicopathologic characteristics were also analyzed. Results: The IDH1 c.395G>A (R132H) mutation was detected in 14/40 patients (35%). A significant association was found with histological tumor types, but not with age, gender and race. Conclusions: IDH1 is frequently mutated and associated with histological subtypes in Malay brain tumors. PMID:28125199

Potential hot spot for de novo mutations in PTCH1 gene in Gorlin syndrome patients: a case report of twins from Croatia.

PubMed

Musani, Vesna; Ozretić, Petar; Trnski, Diana; Sabol, Maja; Poduje, Sanja; Tošić, Mateja; Šitum, Mirna; Levanat, Sonja

2018-02-28

We describe a case of twins with sporadic Gorlin syndrome. Both twins had common Gorlin syndrome features including calcification of the falx cerebri, multiple jaw keratocysts, and multiple basal cell carcinomas, but with different expressivity. One brother also had benign testicular mesothelioma. We propose this tumor type as a possible new feature of Gorlin syndrome. Gorlin syndrome is a rare autosomal dominant disorder characterized by both developmental abnormalities and cancer predisposition, with variable expression of various developmental abnormalities and different types of tumors. The syndrome is primarily caused by mutations in the Patched 1 (PTCH1) gene, although rare mutations of Patched 2 (PTCH2) or Suppressor of Fused (SUFU) genes have also been found. Neither founder mutations nor hot spot locations have been described for PTCH1 in Gorlin syndrome patients. Although de novo mutations of the PTCH1 gene occur in almost 50% of Gorlin syndrome cases, there are a few recurrent mutations. Our twin patients were carriers of a de novo mutation in the PTCH1 gene, c.3364_3365delAT (p.Met1122ValfsX22). This is, to our knowledge, the first Gorlin syndrome-causing mutation that has been reported four independent times in distant geographical locations. Therefore, we propose the location of the described mutation as a potential hot spot for mutations in PTCH1.

A case of thanatophoric dysplasia type 2: a novel mutation.

PubMed

Gülaşı, Selvi; Atıcı, Aytuğ; Çelik, Yalçın

2015-03-01

Thanatophoric dysplasia (TD) is a lethal form of skeletal dysplasia with short-limb dwarfism. Two types distinguished with their radiological characteristics have been defined clinically. The femur is curved in type 1, while it is straight in type 2. TD is known to be due to a mutation in the fibroblast growth factor receptor 3 (FGFR3) gene. We report a male patient who showed clinical findings congruent with TD type 2 and a new mutation in the FGFR3 gene, a finding which has not been reported previously.

Episodic ataxia and SCA6 within the same family due to the D302N CACNA1A gene mutation.

PubMed

Pradotto, Luca; Mencarelli, Monica; Bigoni, Matteo; Milesi, Alessandra; Di Blasio, Anna; Mauro, Alessandro

2016-12-15

Several dominant mutations of CACNA1A gene were associated with at least three different allelic disorders: spino-cerebellar ataxia type 6 (SCA6), episodic ataxia type 2 (EA2), and familial hemiplegic migraine-1 (FHM1). It is generally thought that loss-of-function mutations are associated with EA2, gain-of-function missense mutations with FHM1, and abnormal CAG expansions with SCA6. But, overlapping features, atypical symptoms and co-occurrence of distinct phenotypes within the same family were reported. We describe a four generation family showing different phenotypes ranging from EA2 to SCA6 and carrying the p.D302N CACNA1A gene mutation. In our family the phenotypes maintained separate and gender differences corresponding to different phenotypes were observed. Copyright © 2016 Elsevier B.V. All rights reserved.

Investigating the Impact of Asp181 Point Mutations on Interactions between PTP1B and Phosphotyrosine Substrate

NASA Astrophysics Data System (ADS)

Liu, Mengyuan; Wang, Lushan; Sun, Xun; Zhao, Xian

2014-05-01

Protein tyrosine phosphatase 1B (PTP1B) is a key negative regulator of insulin and leptin signaling, which suggests that it is an attractive therapeutic target in type II diabetes and obesity. The aim of this research is to explore residues which interact with phosphotyrosine substrate can be affected by D181 point mutations and lead to increased substrate binding. To achieve this goal, molecular dynamics simulations were performed on wild type (WT) and two mutated PTP1B/substrate complexes. The cross-correlation and principal component analyses show that point mutations can affect the motions of some residues in the active site of PTP1B. Moreover, the hydrogen bond and energy decomposition analyses indicate that apart from residue 181, point mutations have influence on the interactions of substrate with several residues in the active site of PTP1B.

Trained student pharmacists' telephonic collection of patient medication information: Evaluation of a structured interview tool.

PubMed

Margolis, Amanda R; Martin, Beth A; Mott, David A

2016-01-01

To determine the feasibility and fidelity of student pharmacists collecting patient medication list information using a structured interview tool and the accuracy of documenting the information. The medication lists were used by a community pharmacist to provide a targeted medication therapy management (MTM) intervention. Descriptive analysis of patient medication lists collected with telephone interviews. Ten trained student pharmacists collected the medication lists. Trained student pharmacists conducted audio-recorded telephone interviews with 80 English-speaking, community-dwelling older adults using a structured interview tool to collect and document medication lists. Feasibility was measured using the number of completed interviews, the time student pharmacists took to collect the information, and pharmacist feedback. Fidelity to the interview tool was measured by assessing student pharmacists' adherence to asking all scripted questions and probes. Accuracy was measured by comparing the audio-recorded interviews to the medication list information documented in an electronic medical record. On average, it took student pharmacists 26.7 minutes to collect the medication lists. The community pharmacist said the medication lists were complete and that having the medication lists saved time and allowed him to focus on assessment, recommendations, and education during the targeted MTM session. Fidelity was high, with an overall proportion of asked scripted probes of 83.75% (95% confidence interval [CI], 80.62-86.88%). Accuracy was also high for both prescription (95.1%; 95% CI, 94.3-95.8%) and nonprescription (90.5%; 95% CI, 89.4-91.4%) medications. Trained student pharmacists were able to use an interview tool to collect and document medication lists with a high degree of fidelity and accuracy. This study suggests that student pharmacists or trained technicians may be able to collect patient medication lists to facilitate MTM sessions in the community pharmacy setting. Evaluating the sustainability of using student pharmacists or trained technicians to collect medication lists is needed. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Trained student pharmacists’ telephonic collection of patient medication information: Evaluation of a structured interview tool

PubMed Central

Margolis, Amanda R.; Martin, Beth A.; Mott, David A.

2016-01-01

Objective To determine the feasibility and fidelity of student pharmacists collecting patient medication list information using a structured interview tool and the accuracy of documenting the information. The medication lists were used by a community pharmacist to provide a targeted medication therapy management (MTM) intervention. Design Descriptive analysis of patient medication lists collected via telephone interviews. Participants 10 trained student pharmacists collected the medication lists. Intervention Trained student pharmacists conducted audio-recorded telephone interviews with 80 English-speaking community dwelling older adults using a structured interview tool to collect and document medication lists. Main outcome measures Feasibility was measured using the number of completed interviews, the time student pharmacists took to collect the information, and pharmacist feedback. Fidelity to the interview tool was measured by assessing student pharmacists’ adherence to asking all scripted questions and probes. Accuracy was measured by comparing the audio recorded interviews to the medication list information documented in an electronic medical record. Results On average it took student pharmacists 26.7 minutes to collect the medication lists. The community pharmacist said the medication lists were complete and that having the medication lists saved time and allowed him to focus on assessment, recommendations, and education during the targeted MTM session. Fidelity was high with an overall proportion of asked scripted probes of 83.75% (95%CI: 80.62–86.88%). Accuracy was also high for both prescription (95.1%, 95%CI: 94.3–95.8%) and non-prescription (90.5%, 95%CI: 89.4–91.4%) medications. Conclusion Trained student pharmacists were able to use an interview tool to collect and document medication lists with a high degree of fidelity and accuracy. This study suggests that student pharmacists or trained technicians may be able to collect patient medication lists to facilitate MTM sessions in the community pharmacy setting. Evaluating the sustainability of using student pharmacists or trained technicians to collect medication lists is needed. PMID:27000165

Geologic map of the MTM 85200 quadrangle, Olympia Rupes region of Mars

USGS Publications Warehouse

Skinner, James A.; Herkenhoff, Kenneth E.

2012-01-01

The north polar region of Mars is dominated by Planum Boreum, a roughly circular, domical plateau that rises >2,500 m above the surrounding lowland. Planum Boreum is >1,500 km in diameter, contains deep, curvilinear troughs and chasmata, isolated cavi, and marginal scarps and slopes. The north polar plateau is surrounded by low-lying and nearly horizontal plains of various surface texture, geologic origin, and stratigraphic significance. The MTM 85200 quadrangle spans 5° of latitude (lat 82.5° to 87.5° N.) and 40° of longitude (long 140° to 180° E.) within the eastern hemisphere of Mars. The quadrangle includes the high-standing Planum Boreum, curvilinear troughs of Boreales Scopuli, deep, sinuous scarps of Olympia Rupes, isolated and coalesced depressions of Olympia Cavi, margins of the circular polar erg Olympia Undae, and low-standing Olympia Planum. The surface of Planum Boreum within the MTM 85200 quadrangle is characterized by smoothly sculptured landforms with shallow slopes and variable relief at kilometer scales. Areas that are perennially covered with bright frost are generally smooth and planar at 100-m scales. However, MGS MOC and MRO HiRISE images show that much of the icy polar plateau is rough at decameter scale. The Martian polar plateaus are likely to contain a record of global climate history for >107 to as much as ~3 x 109 years. This record is partly observable as rhythmically layered deposits exposed in the curvilinear troughs of the north polar plateau, Planum Boreum. The north polar layered deposits are widely interpreted to be among the most youthful bedrock deposits on the Martian surface. These materials and their stratigraphic and structural relations provide a glimpse into some of the more recent geologic processes that have occurred on Mars. The ability of the massive polar deposits to periodically trap and release both volatiles and lithic particles may represent a globally important, recurring geologic process for Mars.

Case reports of juvenile GM1 gangliosidosisis type II caused by mutation in GLB1 gene.

PubMed

Karimzadeh, Parvaneh; Naderi, Samaneh; Modarresi, Farzaneh; Dastsooz, Hassan; Nemati, Hamid; Farokhashtiani, Tayebeh; Shamsian, Bibi Shahin; Inaloo, Soroor; Faghihi, Mohammad Ali

2017-07-17

Type II or juvenile GM1-gangliosidosis is an autosomal recessive lysosomal storage disorder, which is clinically distinct from infantile form of the disease by the lack of characteristic cherry-red spot and hepatosplenomegaly. The disease is characterized by slowly progressive neurodegeneration and mild skeletal changes. Due to the later age of onset and uncharacteristic presentation, diagnosis is frequently puzzled with other ataxic and purely neurological disorders. Up to now, 3-4 types of GM1-gangliosidosis have been reported and among them type I is the most common phenotype with the age of onset around 6 months. Various forms of GM1-gangliosidosis are caused by GLB1 gene mutations but severity of the disease and age of onset are directly related to the position and the nature of deleterious mutations. However, due to its unique genetic cause and overlapping clinical features, some researchers believe that GM1 gangliosidosis represents an overlapped disease spectrum instead of four distinct types. Here, we report a less frequent type of autosomal recessive GM1 gangliosidosis with perplexing clinical presentation in three families in the southwest part of Iran, who are unrelated but all from "Lurs" ethnic background. To identify disease-causing mutations, Whole Exome Sequencing (WES) utilizing next generation sequencing was performed. Four patients from three families were investigated with the age of onset around 3 years old. Clinical presentations were ataxia, gate disturbances and dystonia leading to wheelchair-dependent disability, regression of intellectual abilities, and general developmental regression. They all were born in consanguineous families with no previous documented similar disease in their parents. A homozygote missense mutation in GLB1 gene (c. 601 G > A, p.R201C) was found in all patients. Using Sanger sequencing this identified mutation was confirmed in the proband, their parents, grandparents, and extended family members, confirming its autosomal recessive pattern of inheritance. Our study identified a rare pathogenic missense mutation in GLB1 gene in patients with complex neurodevelopmental findings, which can extend the list of differential diagnoses for childhood ataxia in Iranian patients.

Hereditary Angioedema Nationwide Study in Slovenia Reveals Four Novel Mutations in SERPING1 Gene

PubMed Central

Rijavec, Matija; Korošec, Peter; Šilar, Mira; Zidarn, Mihaela; Miljković, Jovan; Košnik, Mitja

2013-01-01

Hereditary angioedema (HAE) is a rare autosomal dominant disease characterized by swelling of the face, lips, tongue, larynx, genitalia, or extremities, with abdominal pain caused by intra-abdominal edema. HAE is caused by mutations affecting the C1 inhibitor gene, SERPING1, resulting in low levels of C1 inhibitor (Type I HAE) or normal levels of ineffective C1 inhibitor (Type II HAE). A nationwide survey identified nine unrelated families with HAE in Slovenia, among whom 17 individuals from eight families were recruited for genetic analyses. A diagnosis of HAE was established in the presence of clinical and laboratory criteria (low C1 inhibitor antigenic levels and/or function), followed up by a positive family history. Genetic studies were carried out using PCR and sequencing to detect SERPING1 mutations in promoter, noncoding exon 1, the 7 coding exons, and exon-intron boundaries. Multiplex ligation-dependent probe amplification was performed in order to search for large deletions/duplications in SERPING1 gene. A mutation responsible for HAE was identified in patients from seven families with the disease. In HAE type I families, one previously reported substitution (Gln67Stop, c.265C>T) and four novel mutations were identified. The new mutations included two missense substitutions, Ser128Phe (c.449C>T), and Glu429Lys (c.1351G>A), together with two frameshift mutations, indel (c.49delGinsTT) and deletion (c.593_594delCT). Both families with HAE type II harbored the two well-known substitutions affecting the arginyl residue at the reactive center in exon 8, Arg444Cys (c.1396C>T) and Arg444His (c.1397G>A), respectively. In one patient only the homozygous variant g.566T>C (c.-21T>C) was identified. Our study identified four novel mutations in the Slovenian HAE population, highlighting the heterogeneity of mutations in the SERPING1 gene causing C1 inhibitor deficiency and HAE. In a single patient with HAE a homozygous variant g.566T>C (c.-21T>C) might be responsible for the disease. PMID:23437219

Hereditary angioedema nationwide study in Slovenia reveals four novel mutations in SERPING1 gene.

PubMed

Rijavec, Matija; Korošec, Peter; Šilar, Mira; Zidarn, Mihaela; Miljković, Jovan; Košnik, Mitja

2013-01-01

Hereditary angioedema (HAE) is a rare autosomal dominant disease characterized by swelling of the face, lips, tongue, larynx, genitalia, or extremities, with abdominal pain caused by intra-abdominal edema. HAE is caused by mutations affecting the C1 inhibitor gene, SERPING1, resulting in low levels of C1 inhibitor (Type I HAE) or normal levels of ineffective C1 inhibitor (Type II HAE). A nationwide survey identified nine unrelated families with HAE in Slovenia, among whom 17 individuals from eight families were recruited for genetic analyses. A diagnosis of HAE was established in the presence of clinical and laboratory criteria (low C1 inhibitor antigenic levels and/or function), followed up by a positive family history. Genetic studies were carried out using PCR and sequencing to detect SERPING1 mutations in promoter, noncoding exon 1, the 7 coding exons, and exon-intron boundaries. Multiplex ligation-dependent probe amplification was performed in order to search for large deletions/duplications in SERPING1 gene. A mutation responsible for HAE was identified in patients from seven families with the disease. In HAE type I families, one previously reported substitution (Gln67Stop, c.265C>T) and four novel mutations were identified. The new mutations included two missense substitutions, Ser128Phe (c.449C>T), and Glu429Lys (c.1351G>A), together with two frameshift mutations, indel (c.49delGinsTT) and deletion (c.593_594delCT). Both families with HAE type II harbored the two well-known substitutions affecting the arginyl residue at the reactive center in exon 8, Arg444Cys (c.1396C>T) and Arg444His (c.1397G>A), respectively. In one patient only the homozygous variant g.566T>C (c.-21T>C) was identified. Our study identified four novel mutations in the Slovenian HAE population, highlighting the heterogeneity of mutations in the SERPING1 gene causing C1 inhibitor deficiency and HAE. In a single patient with HAE a homozygous variant g.566T>C (c.-21T>C) might be responsible for the disease.

Mechanistic Basis for Type 2 Long QT Syndrome Caused by KCNH2 Mutations that Disrupt Conserved Arginine Residue in the Voltage Sensor

PubMed Central

McBride, Christie M.; Smith, Ashley M.; Smith, Jennifer L.; Reloj, Allison R.; Velasco, Ellyn J.; Powell, Jonathan; Elayi, Claude S.; Bartos, Daniel C.; Burgess, Don E.

2013-01-01

KCNH2 encodes the Kv11.1 channel, which conducts the rapidly activating delayed rectifier K+ current (IKr) in the heart. KCNH2 mutations cause type 2 long QT syndrome (LQT2), which increases the risk for life-threatening ventricular arrhythmias. LQT2 mutations are predicted to prolong the cardiac action potential (AP) by reducing IKr during repolarization. Kv11.1 contains several conserved basic amino acids in the fourth transmembrane segment (S4) of the voltage sensor that are important for normal channel trafficking and gating. This study sought to determine the mechanism(s) by which LQT2 mutations at conserved arginine residues in S4 (R531Q, R531W or R534L) alter Kv11.1 function. Western blot analyses of HEK293 cells transiently expressing R531Q, R531W or R534L suggested that only R534L inhibited Kv11.1 trafficking. Voltage-clamping experiments showed that R531Q or R531W dramatically altered Kv11.1 current (IKv11.1) activation, inactivation, recovery from inactivation and deactivation. Coexpression of wild type (to mimic the patients’ genotypes) mostly corrected the changes in IKv11.1 activation and inactivation, but deactivation kinetics were still faster. Computational simulations using a human ventricular AP model showed that accelerating deactivation rates was sufficient to prolong the AP, but these effects were minimal compared to simply reducing IKr. These are the first data to demonstrate that coexpressing wild type can correct activation and inactivation dysfunction caused by mutations at a critical voltage-sensing residue in Kv11.1. We conclude that some Kv11.1 mutations might accelerate deactivation to cause LQT2 but that the ventricular AP duration is much more sensitive to mutations that decrease IKr. This likely explains why most LQT2 mutations are nonsense or trafficking-deficient. PMID:23546015

Mechanistic basis for type 2 long QT syndrome caused by KCNH2 mutations that disrupt conserved arginine residues in the voltage sensor.

PubMed

McBride, Christie M; Smith, Ashley M; Smith, Jennifer L; Reloj, Allison R; Velasco, Ellyn J; Powell, Jonathan; Elayi, Claude S; Bartos, Daniel C; Burgess, Don E; Delisle, Brian P

2013-05-01

KCNH2 encodes the Kv11.1 channel, which conducts the rapidly activating delayed rectifier K+ current (I Kr) in the heart. KCNH2 mutations cause type 2 long QT syndrome (LQT2), which increases the risk for life-threatening ventricular arrhythmias. LQT2 mutations are predicted to prolong the cardiac action potential (AP) by reducing I Kr during repolarization. Kv11.1 contains several conserved basic amino acids in the fourth transmembrane segment (S4) of the voltage sensor that are important for normal channel trafficking and gating. This study sought to determine the mechanism(s) by which LQT2 mutations at conserved arginine residues in S4 (R531Q, R531W or R534L) alter Kv11.1 function. Western blot analyses of HEK293 cells transiently expressing R531Q, R531W or R534L suggested that only R534L inhibited Kv11.1 trafficking. Voltage-clamping experiments showed that R531Q or R531W dramatically altered Kv11.1 current (I Kv11.1) activation, inactivation, recovery from inactivation and deactivation. Coexpression of wild type (to mimic the patients' genotypes) mostly corrected the changes in I Kv11.1 activation and inactivation, but deactivation kinetics were still faster. Computational simulations using a human ventricular AP model showed that accelerating deactivation rates was sufficient to prolong the AP, but these effects were minimal compared to simply reducing I Kr. These are the first data to demonstrate that coexpressing wild type can correct activation and inactivation dysfunction caused by mutations at a critical voltage-sensing residue in Kv11.1. We conclude that some Kv11.1 mutations might accelerate deactivation to cause LQT2 but that the ventricular AP duration is much more sensitive to mutations that decrease I Kr. This likely explains why most LQT2 mutations are nonsense or trafficking-deficient.

A novel CYP27B1 mutation causes a feline vitamin D-dependent rickets type IA.

PubMed

Grahn, Robert A; Ellis, Melanie R; Grahn, Jennifer C; Lyons, Leslie A

2012-08-01

A 12-week-old domestic cat presented at a local veterinary clinic with hypocalcemia and skeletal abnormalities suggestive of rickets. Osteomalacia (rickets) is a disease caused by impaired bone mineralization leading to an increased prevalence of fractures and deformity. Described in a variety of species, rickets is most commonly caused by vitamin D or calcium deficiencies owing to both environmental and or genetic abnormalities. Vitamin D-dependent rickets type 1A (VDDR-1A) is a result of the enzymatic pathway defect caused by mutations in the 25-hydroxyvitamin D(3)-1-alpha-hydroxylase gene [cytochrome P27 B1 (CYP27B1)]. Calcitriol, the active form of vitamin D(3), regulates calcium homeostasis, which requires sufficient dietary calcium availability and correct hormonal function for proper bone growth and maintenance. Patient calcitriol concentrations were low while calcidiol levels were normal suggestive of VDDR-1A. The entire DNA coding sequencing of CYP27B1 was evaluated. The affected cat was wild type for previously identified VDDR-1A causative mutations. However, six novel mutations were identified, one of which was a nonsense mutation at G637T in exon 4. The exon 4 G637T nonsense mutation results in a premature protein truncation, changing a glutamic acid to a stop codon, E213X, likely causing the clinical presentation of rickets. The previously documented genetic mutation resulting in feline VDDR-1A rickets, as well as the case presented in this research, result from novel exon 4 CYP27B1 mutations, thus exon 4 should be the initial focus of future sequencing efforts.

Gene structure and mutant alleles of PCDH15: nonsyndromic deafness DFNB23 and type 1 Usher syndrome

PubMed Central

Ahmed, Zubair M.; Riazuddin, Saima; Aye, Sandar; Ali, Rana A.; Venselaar, Hanka; Anwar, Saima; Belyantseva, Polina P.; Qasim, Muhammad; Riazuddin, Sheikh; Friedman, Thomas B.

2009-01-01

Mutations of PCDH15, encoding protocadherin 15, can cause either combined hearing and vision impairment (type 1 Usher syndrome; USH1F) or nonsyndromic deafness (DFNB23). Human PCDH15 is reported to be comprised of 35 exons and encodes a variety of isoforms with 3 to 11 ectodomains (EC), a transmembrane domain and a carboxy-terminal cytoplasmic domain (CD). Building on these observations we describe an updated gene structure that has four additional exons of PCDH15 and isoforms that can be subdivided into four classes. Human PCDH15 encodes three alternative, evolutionarily conserved unique cytoplasmic domains (CD1, CD2 or CD3). Families ascertained on the basis of prelingual hearing loss were screened for linkage of this phenotype to markers for PCDH15 on chromosome 10q21.1. In seven of twelve families segregating USH1 we identified homozygous mutant alleles (1 missense, 1 splice site, 3 nonsense and 2 deletion mutations) of which six are novel. One family was segregating nonsyndromic deafness DFNB23 due to a homozygous missense mutation. To date in our cohort of 557 Pakistani families, we have found 11 different PCDH15 mutations that account for deafness in 13 families. Molecular modeling provided mechanistic insight into the phenotypic variation in severity of the PCDH15 missense mutations. We did not find pathogenic mutations in five of the twelve USH1 families linked to markers for USH1F, which suggest either the presence of mutations of yet additional undiscovered exons of PCDH15, mutations in the introns or regulatory elements of PCDH15, or an additional locus for type I USH at chromosome 10q21.1. PMID:18719945

Nephrocalcinosis as adult presentation of Bartter syndrome type II.

PubMed

Huang, L; Luiken, G P M; van Riemsdijk, I C; Petrij, F; Zandbergen, A A M; Dees, A

2014-02-01

Bartter syndrome consists a group of rare autosomal-recessive renal tubulopathies characterised by renal salt wasting, hypokalaemic metabolic alkalosis, hypercalciuria and hyperreninaemic hyperaldosteronism. It is classified into five types. Mutations in the KCNJ1 gene (classified as type II) usually cause the neonatal form of Bartter syndrome. We describe an adult patient with a homozygous KCNJ1 mutation resulting in a remarkably mild phenotype of neonatal type Bartter syndrome.

Body size and risk for colorectal cancers showing BRAF mutations or microsatellite instability: a pooled analysis.

PubMed

Hughes, Laura A E; Williamson, Elizabeth J; van Engeland, Manon; Jenkins, Mark A; Giles, Graham G; Hopper, John L; Southey, Melissa C; Young, Joanne P; Buchanan, Daniel D; Walsh, Michael D; van den Brandt, Piet A; Alexandra Goldbohm, R; Weijenberg, Matty P; English, Dallas R

2012-08-01

How body size influences risk of molecular subtypes of colorectal cancer (CRC) is unclear. We investigated whether measures of anthropometry differentially influence risk of tumours according to BRAF c.1799T>A p.V600E mutation (BRAF) and microsatellite instability (MSI) status. Data from The Netherlands Cohort Study (n = 120,852) and Melbourne Collaborative Cohort Study (n = 40,514) were pooled and included 734 and 717 colorectal cancer cases from each study, respectively. Hazard ratios (HRs) and 95% confidence intervals (CIs) for body mass index (BMI), waist measurement and height were calculated and compared for subtypes defined by BRAF mutation and MSI status, measured from archival tissue. Results were consistent between studies. When pooled, BMI modelled in 5 kg/m(2) increments was positively associated with BRAF wild-type (HR: 1.16, 95% CI: 1.08-1.26) and MS-stable tumours (HR: 1.15, 95% CI: 1.06-1.24). Waist measurement was also associated with BRAF wild-type (highest vs lowest quartile, HR: 1.59, 95% CI: 1.33-1.90) and MS-stable tumours (highest vs lowest quartile HR: 1.68, 95% CI: 1.31-2.15). The HRs for BRAF mutation tumours and MSI tumours were smaller and non-significant, but differences between the HRs by tumour subtypes were not significant. Height, modelled per 5-cm increase, was positively associated with BRAF wild-type and BRAF mutation tumours, but the HR was greater for tumours with a BRAF mutation than BRAF wild-type (HR: 1.23, 95% CI: 1.11-1.37, P(heterogeneity) = 0.03). Similar associations were observed with respect to height and MSI tumours (HR: 1.26, 95% CI: 1.13-1.40, P(heterogeneity) = 0.02). Generally, overweight increases the risk of CRC. Taller individuals have an increased risk of developing a tumour with a BRAF mutation or MSI.

Maturity onset diabetes of youth (MODY) in Turkish children: sequence analysis of 11 causative genes by next generation sequencing.

PubMed

Ağladıoğlu, Sebahat Yılmaz; Aycan, Zehra; Çetinkaya, Semra; Baş, Veysel Nijat; Önder, Aşan; Peltek Kendirci, Havva Nur; Doğan, Haldun; Ceylaner, Serdar

2016-04-01

Maturity-onset diabetes of the youth (MODY), is a genetically and clinically heterogeneous group of diseasesand is often misdiagnosed as type 1 or type 2 diabetes. The aim of this study is to investigate both novel and proven mutations of 11 MODY genes in Turkish children by using targeted next generation sequencing. A panel of 11 MODY genes were screened in 43 children with MODY diagnosed by clinical criterias. Studies of index cases was done with MISEQ-ILLUMINA, and family screenings and confirmation studies of mutations was done by Sanger sequencing. We identified 28 (65%) point mutations among 43 patients. Eighteen patients have GCK mutations, four have HNF1A, one has HNF4A, one has HNF1B, two have NEUROD1, one has PDX1 gene variations and one patient has both HNF1A and HNF4A heterozygote mutations. This is the first study including molecular studies of 11 MODY genes in Turkish children. GCK is the most frequent type of MODY in our study population. Very high frequency of novel mutations (42%) in our study population, supports that in heterogenous disorders like MODY sequence analysis provides rapid, cost effective and accurate genetic diagnosis.

Expanding the phenotypic and mutational spectrum in microcephalic osteodysplastic primordial dwarfism type I.

PubMed

Abdel-Salam, Ghada M H; Abdel-Hamid, Mohamed S; Issa, Mahmoud; Magdy, Ahmed; El-Kotoury, Ahmed; Amr, Khalda

2012-06-01

Mutations in the RNU4ATAC gene cause microcephalic osteodysplastic primordial dwarfism type I. It encodes U4atac, a small nuclear RNA that is a component of the minor spliceosome. Six distinct mutations in 30 patients diagnosed as microcephalic osteodysplastic primordial dwarfism type I have been described. We report on three additional patients from two unrelated families presenting with a milder phenotype of microcephalic osteodysplastic primordial dwarfism type I and metopic synostosis. Patient 1 had two novel heterozygous mutations in the 3' prime stem-loop, g.66G > C and g.124G > A while Patients 2 and 3 had a homozygous mutation g.55G > A in the 5' prime stem-loop. Although they manifested the known spectrum of clinical features of microcephalic osteodysplastic primordial dwarfism type I, they lacked evidence of severe developmental delay and neurological symptoms. These findings expand the mutational and phenotypic spectrum of this syndrome. Copyright © 2012 Wiley Periodicals, Inc.

E2 Cargo Transport--The Necessary Inclusion of Primary Oceanic Airlift

DTIC Science & Technology

2013-06-01

Energy Initiatives (L: Lead-; F: Follow-; W: Watch- Industry ) (Maybury, 2010:6...at the same time halting all supplies—including coal, food and fresh milk—which were drawn from the Soviet Sector…There was no longer any doubt...which consists of 223 C-17s and 111 C- 5s , provides a capacity of 35.9 million ton-miles per day (MTM/D). The peak for MCRS Case 1, which

NATO Mobilization and Reinforcement: Can We Get There from Here?

DTIC Science & Technology

1990-05-30

of the USSR," Military Power , 1986, p . 93. 27. Pettavino. Paul J., Ibid. p . 1. 28. Carlucci, Frank C ., Ibid, p . 29. 29. Rowden. William H., Ibid, p ...mobility objectives (requirements) for the European theater: o Sixty-six million ton-miles-per-day (MTM/ D ) of cargo airlift. 25 o Sealift for one...Aircraft In Mili- tary Use," Independent Review of Economic, Political and Military Power , VOL. 33, Dec 88.

A novel TRPS1 mutation in a Moroccan family with Tricho-rhino-phalangeal syndrome type III: case report.

PubMed

Smaili, W; Elalaoui, S Chafai; Meier, S; Zerkaoui, M; Sefiani, A; Heinimann, K

2017-05-03

Tricho-rhino-phalangeal syndrome (TRPS) is an autosomal dominant disorder characterized by craniofacial and skeletal malformations including short stature, thin scalp hair, sparse lateral eyebrows, pear-shaped nose and cone shaped epiphyses. This condition is caused by haploinsufficiency of the TRPS1 gene. Previous genotype-phenotype studies have correlated exon 6 missense mutations with TRPS type III, a severe form of type I with pronounced, facial characteristics, short stature and brachydactyly and differing from type II by the absence of exostoses and mental retardation. We report the first case of a Moroccan family, a father and his three children, in which the diagnosis of type III TRPS was suspected based on severe clinical and radiological features. Molecular analysis of the TRPS1 gene revealed a novel missense mutation in exon 6, (p.Ala932Ser), located in the GATA-type DNA-binding zinc finger domain. Our observations in this kindred support the previous genotype-phenotype results suggesting that patients with more pronounced facial characteristics and more severe shortening of hands and feet are more likely to have mutation in exon 6 of TRPS1.

Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.

PubMed

Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C

2001-01-01

Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.

Hereditary sensory and autonomic neuropathy type 1 (HSANI) caused by a novel mutation in SPTLC2

PubMed Central

Murphy, Sinéad M.; Ernst, Daniela; Wei, Yu; Laurà, Matilde; Liu, Yo-Tsen; Polke, James; Blake, Julian; Winer, John; Houlden, Henry; Hornemann, Thorsten

2013-01-01

Objective: To describe the clinical and neurophysiologic phenotype of a family with hereditary sensory and autonomic neuropathy type 1 (HSANI) due to a novel mutation in SPTLC2 and to characterize the biochemical properties of this mutation. Methods: We screened 107 patients with HSAN who were negative for other genetic causes for mutations in SPTLC2. The biochemical properties of a new mutation were characterized in cell-free and cell-based activity assays. Results: A novel mutation (A182P) was found in 2 subjects of a single family. The phenotype of the 2 subjects was an ulcero-mutilating sensory-predominant neuropathy as described previously for patients with HSANI, but with prominent motor involvement and earlier disease onset in the first decade of life. Affected patients had elevated levels of plasma 1-deoxysphingolipids (1-deoxySLs). Biochemically, the A182P mutation was associated with a reduced canonical activity but an increased alternative activity with alanine, which results in largely increased 1-deoxySL levels, supporting their pathogenicity. Conclusion: This study confirms that mutations in SPTLC2 are associated with increased deoxySL formation causing HSANI. PMID:23658386

Assessment of the potential pathogenicity of missense mutations identified in the GTPase-activating protein (GAP)-related domain of the neurofibromatosis type-1 (NF1) gene.

PubMed

Thomas, Laura; Richards, Mark; Mort, Matthew; Dunlop, Elaine; Cooper, David N; Upadhyaya, Meena

2012-12-01

Neurofibromatosis type-1 (NF1) is caused by constitutional mutations of the NF1 tumor-suppressor gene. Although ∼85% of inherited NF1 microlesions constitute truncating mutations, the remaining ∼15% are missense mutations whose pathological relevance is often unclear. The GTPase-activating protein-related domain (GRD) of the NF1-encoded protein, neurofibromin, serves to define its major function as a negative regulator of the Ras-MAPK (mitogen-activated protein kinase) signaling pathway. We have established a functional assay to assess the potential pathogenicity of 15 constitutional nonsynonymous NF1 missense mutations (11 novel and 4 previously reported but not functionally characterized) identified in the NF1-GRD (p.R1204G, p.R1204W, p.R1276Q, p.L1301R, p.I1307V, p.T1324N, p.E1327G, p.Q1336R, p.E1356G, p.R1391G, p.V1398D, p.K1409E, p.P1412R, p.K1436Q, p.S1463F). Individual mutations were introduced into an NF1-GRD expression vector and activated Ras was assayed by an enzyme-linked immunosorbent assay (ELISA). Ten NF1-GRD variants were deemed to be potentially pathogenic by virtue of significantly elevated levels of activated GTP-bound Ras in comparison to wild-type NF1 protein. The remaining five NF1-GRD variants were deemed less likely to be of pathological significance as they exhibited similar levels of activated Ras to the wild-type protein. These conclusions received broad support from both bioinformatic analysis and molecular modeling and serve to improve our understanding of NF1-GRD structure and function. © 2012 Wiley Periodicals, Inc.

'Laminopathies': A wide spectrum of human diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Worman, Howard J.; Bonne, Gisele; Universite Pierre et Marie Curie-Paris 6, Faculte de medecine, Paris F-75013

2007-06-10

Mutations in genes encoding the intermediate filament nuclear lamins and associated proteins cause a wide spectrum of diseases sometimes called 'laminopathies.' Diseases caused by mutations in LMNA encoding A-type lamins include autosomal dominant Emery-Dreifuss muscular dystrophy and related myopathies, Dunnigan-type familial partial lipodystrophy, Charcot-Marie-Tooth disease type 2B1 and developmental and accelerated aging disorders. Duplication in LMNB1 encoding lamin B1 causes autosomal dominant leukodystrophy and mutations in LMNB2 encoding lamin B2 are associated with acquired partial lipodystrophy. Disorders caused by mutations in genes encoding lamin-associated integral inner nuclear membrane proteins include X-linked Emery-Dreifuss muscular dystrophy, sclerosing bone dysplasias, HEM/Greenberg skeletal dysplasiamore » and Pelger-Huet anomaly. While mutations and clinical phenotypes of 'laminopathies' have been carefully described, data explaining pathogenic mechanisms are only emerging. Future investigations will likely identify new 'laminopathies' and a combination of basic and clinical research will lead to a better understanding of pathophysiology and the development of therapies.« less

CASK and CaMKII function in Drosophila memory

PubMed Central

Malik, Bilal R.; Hodge, James J. L.

2014-01-01

Calcium (Ca2+) and Calmodulin (CaM)-dependent serine/threonine kinase II (CaMKII) plays a central role in synaptic plasticity and memory due to its ability to phosphorylate itself and regulate its own kinase activity. Autophosphorylation at threonine 287 (T287) switches CaMKII to a Ca2+ independent and constitutively active state replicated by overexpression of a phosphomimetic CaMKII-T287D transgene or blocked by expression of a T287A transgene. A second pair of sites, T306 T307 in the CaM binding region once autophosphorylated, prevents CaM binding and inactivates the kinase during synaptic plasticity and memory, and can be blocked by a TT306/7AA transgene. Recently the synaptic scaffolding molecule called CASK (Ca2+/CaM-associated serine kinase) has been shown to control both sets of CaMKII autophosphorylation events during neuronal growth, Ca2+ signaling and memory in Drosophila. Deletion of either full length CASK or just its CaMK-like and L27 domains removed middle-term memory (MTM) and long-term memory (LTM), with CASK function in the α′/ß′ mushroom body neurons being required for memory. In a similar manner directly changing the levels of CaMKII autophosphorylation (T287D, T287A, or TT306/7AA) in the α′/ß′ neurons also removed MTM and LTM. In the CASK null mutant expression of either the Drosophila or human CASK transgene in the α′/ß′ neurons was found to completely rescue memory, confirming that CASK signaling in α′/β′ neurons is necessary and sufficient for Drosophila memory formation and that the neuronal function of CASK is conserved between Drosophila and human. Expression of human CASK in Drosophila also rescued the effect of CASK deletion on the activity state of CaMKII, suggesting that human CASK may also regulate CaMKII autophosphorylation. Mutations in human CASK have recently been shown to result in intellectual disability and neurological defects suggesting a role in plasticity and learning possibly via regulation of CaMKII autophosphorylation. PMID:25009461

4-Hydroxy-2(E)-nonenal metabolism differs in Apc(+/+) cells and in Apc(Min/+) cells: it may explain colon cancer promotion by heme iron.

PubMed

Baradat, Maryse; Jouanin, Isabelle; Dalleau, Sabine; Taché, Sylviane; Gieules, Mathilde; Debrauwer, Laurent; Canlet, Cécile; Huc, Laurence; Dupuy, Jacques; Pierre, Fabrice H F; Guéraud, Françoise

2011-11-21

Animal and epidemiological studies suggest that dietary heme iron would promote colorectal cancer. Oxidative properties of heme could lead to the formation of cytotoxic and genotoxic secondary lipid oxidation products, such as 4-hydroxy-2(E)-nonenal (HNE). This compound is more cytotoxic to mouse wild-type colon cells than to isogenic cells with a mutation on the adenomatous polyposis coli (APC) gene. The latter thus have a selective advantage, possibly leading to cancer promotion. This mutation is an early and frequent event in human colorectal cancer. To explain this difference, the HNE biotransformation capacities of the two cell types have been studied using radiolabeled and stable isotope-labeled HNE. Apc-mutated cells showed better biotransformation capacities than nonmutated cells did. Thiol compound conjugation capacities were higher for mutated cells, with an important advantage for the extracellular conjugation to cysteine. Both cells types were able to reduce HNE to 4-hydroxynonanal, a biotransformation pathway that has not been reported for other intestinal cells. Mutated cells showed higher capacities to oxidize 4-hydroxynonanal into 4-hydroxynonanoic acid. The mRNA expression of different enzymes involved in HNE metabolism such as aldehyde dehydrogenase 1A1, 2 and 3A1, glutathione transferase A4-4, or cystine transporter xCT was upregulated in mutated cells compared with wild-type cells. In conclusion, this study suggests that Apc-mutated cells are more efficient than wild-type cells in metabolizing HNE into thiol conjugates and 4-hydroxynonanoic acid due to the higher expression of key biotransformation enzymes. These differential biotransformation capacities would explain the differences of susceptibility between normal and Apc-mutated cells regarding secondary lipid oxidation products.

HIV-1 protease-substrate coevolution in nelfinavir resistance.

PubMed

Kolli, Madhavi; Ozen, Ayşegül; Kurt-Yilmaz, Nese; Schiffer, Celia A

2014-07-01

Resistance to various human immunodeficiency virus type 1 (HIV-1) protease inhibitors (PIs) challenges the effectiveness of therapies in treating HIV-1-infected individuals and AIDS patients. The virus accumulates mutations within the protease (PR) that render the PIs less potent. Occasionally, Gag sequences also coevolve with mutations at PR cleavage sites contributing to drug resistance. In this study, we investigated the structural basis of coevolution of the p1-p6 cleavage site with the nelfinavir (NFV) resistance D30N/N88D protease mutations by determining crystal structures of wild-type and NFV-resistant HIV-1 protease in complex with p1-p6 substrate peptide variants with L449F and/or S451N. Alterations of residue 30's interaction with the substrate are compensated by the coevolving L449F and S451N cleavage site mutations. This interdependency in the PR-p1-p6 interactions enhances intermolecular contacts and reinforces the overall fit of the substrate within the substrate envelope, likely enabling coevolution to sustain substrate recognition and cleavage in the presence of PR resistance mutations. Resistance to human immunodeficiency virus type 1 (HIV-1) protease inhibitors challenges the effectiveness of therapies in treating HIV-1-infected individuals and AIDS patients. Mutations in HIV-1 protease selected under the pressure of protease inhibitors render the inhibitors less potent. Occasionally, Gag sequences also mutate and coevolve with protease, contributing to maintenance of viral fitness and to drug resistance. In this study, we investigated the structural basis of coevolution at the Gag p1-p6 cleavage site with the nelfinavir (NFV) resistance D30N/N88D protease mutations. Our structural analysis reveals the interdependency of protease-substrate interactions and how coevolution may restore substrate recognition and cleavage in the presence of protease drug resistance mutations. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Scoliosis in osteogenesis imperfecta caused by COL1A1/COL1A2 mutations - genotype-phenotype correlations and effect of bisphosphonate treatment.

PubMed

Sato, Atsuko; Ouellet, Jean; Muneta, Takeshi; Glorieux, Francis H; Rauch, Frank

2016-05-01

Bisphosphonates are widely used to treat children with osteogenesis imperfecta (OI), a bone fragility disorder that is most often caused by mutations in COL1A1 or COL1A2. However, it is unclear whether this treatment decreases the risk of developing scoliosis. We retrospectively evaluated spine radiographs and charts of 437 patients (227 female) with OI caused by mutations in COL1A1 or COL1A2 and compared the relationship between scoliosis, genotype and bisphosphonate treatment history. At the last follow-up (mean age 11.9 [SD: 5.9] years), 242 (55%) patients had scoliosis. The prevalence of scoliosis was highest in OI type III (89%), followed by OI type IV (61%) and OI type I (36%). Moderate to severe scoliosis (Cobb angle ≥25°) was rare in individuals with COL1A1 haploinsufficiency mutations but was present in about two fifth of patients with triple helical glycine substitutions or C-propeptide mutations. During the first 2 to 4years of bisphosphonate therapy, patients with OI type III had lower Cobb angle progression rates than before bisphosphonate treatment, whereas in OI types I and IV bisphosphonate treatment was not associated with a change in Cobb angle progression rates. At skeletal maturity, the prevalence of scoliosis (Cobb angle >10°) was similar in patients who had started bisphosphonate treatment early in life (before 5.0years of age) and in patients who had started therapy later (after the age of 10.0years) or had never received bisphosphonate therapy. Bisphosphonate treatment decreased progression rate of scoliosis in OI type III but there was no evidence of a positive effect on scoliosis in OI types I and IV. The prevalence of scoliosis at maturity was not influenced by the bisphosphonate treatment history in any OI type. Copyright © 2016 Elsevier Inc. All rights reserved.

The occurrence and the type of germline mutations in the RET gene in patients with medullary thyroid carcinoma and their unaffected kindred's from Central Poland.

PubMed

Paszko, Z; Sromek, M; Czetwertynska, M; Skasko, E; Czapczak, D; Wisniewska, A; Prokurat, A; Chrupek, M; Jagielska, A; Kozlowicz-Gudzinska, I

2007-12-01

We aimed to investigate the occurrence and types of pathogenic mutations in the RET gene in patients with MTC of the Central Poland population and in their relatives. DNA was extracted from the peripheral blood lymphocytes of a total of 330 persons, including 235 MTC patients and 95 of their unaffected kindred's. Exons 10, 11, 13, 14, 15 and 16 of the RET gene were amplified by PCR and sequenced. Sixty-seven people were found to carry pathogenic, germline mutations in the RET gene. In exon 10, C609F, C609R and C609Y (3 families), C618G, C618F (2 families), and C620G (4 families) mutations were identified. In exon 11, C634R (8 families) and C649L mutations (1 patient) were found. Five families carried Y791F mutation in exon 13. One patient with PTC revealed the presence of a Y791F mutation. In 3 families, exon 14 of the RET gene harbored the following mutations: V804L (1 patient), E819K (1 patient) and R844Q (1 patient). In 1 family, the S891A mutation was identified in exon 15, 3 families were found to carry mutations in exon16, R912P in 1 family and M918T in 2 families. In summary, of the 235 patients affected by MTC, 46 (19.6%) carried pathogenic RET gene mutations, 1 patient with RET mutation had kidney carcinoma, and 1 had PTC. The results show the occurrence of a variety of mutations prevalent in patients with MTC in the population of Central Poland. These results may contribute to a better diagnosis of medullary thyroid carcinoma.

Recurrent PRKAR1A mutation in acrodysostosis with hormone resistance.

PubMed

Linglart, Agnès; Menguy, Christine; Couvineau, Alain; Auzan, Colette; Gunes, Yasemin; Cancel, Mathilde; Motte, Emmanuelle; Pinto, Graziella; Chanson, Philippe; Bougnères, Pierre; Clauser, Eric; Silve, Caroline

2011-06-09

The skeletal dysplasia characteristic of acrodysostosis resembles the Albright's hereditary osteodystrophy seen in patients with pseudohypoparathyroidism type 1a, but defects in the α-stimulatory subunit of the G-protein (GNAS), the cause of pseudohypoparathyroidism type 1a, are not present in patients with acrodysostosis. We report a germ-line mutation in the gene encoding PRKAR1A, the cyclic AMP (cAMP)-dependent regulatory subunit of protein kinase A, in three unrelated patients with acrodysostosis and resistance to multiple hormones. The mutated subunit impairs the protein kinase A response to stimulation by cAMP; this explains our patients' hormone resistance and the similarities of their skeletal abnormalities with those observed in patients with pseudohypoparathyroidism type 1a.

Mutations in myosin VIIA (MYO7A) and usherin (USH2A) in Spanish patients with Usher syndrome types I and II, respectively.

PubMed

Nájera, Carmen; Beneyto, Magdalena; Blanca, José; Aller, Elena; Fontcuberta, Ana; Millán, José María; Ayuso, Carmen

2002-07-01

Usher syndrome is an autosomal recessive disorder characterized by congenital hearing impairment and retinitis pigmentosa. Three clinical types are known (USH1, USH2 and USH3), and there is an extensive genetic heterogeneity, with at least ten genes implicated. The most frequently mutated genes are MYO7A, which causes USH1B, and usherin, which causes USH2A. We carried out a mutation analysis of these two genes in the Spanish population. Analysis of the MYO7A gene in patients from 30 USH1 families and sporadic cases identified 32% of disease alleles, with mutation Q821X being the most frequent. Most of the remaining variants are private mutations. With regard to USH2, mutation 2299delG was detected in 25% of the Spanish patients. Altogether the mutations detected in USH2A families account for 23% of the disease alleles. Copyright 2002 Wiley-Liss, Inc.

Glycogen storage disease type 1a in three siblings with the G270V mutation.

PubMed

Parvari, R; Isam, J; Moses, S W

1999-04-01

Glycogen storage disease type 1a (von Gierke disease, GSD1a) is caused by the deficiency of microsomal glucose-6-phosphatase (G6Pase) activity. The cloning of G6Pase cDNA and characterization of the human G6Pase gene enabled the identification of the mutations causing GSD1a. Here we report on the clinical and biochemical features of three GSD1a siblings of a Muslin Arab family with a G270V mutation. Two older patients presented with an unusually mild clinical and biochemical course.

Gene structure and mutant alleles of PCDH15: nonsyndromic deafness DFNB23 and type 1 Usher syndrome.

PubMed

Ahmed, Zubair M; Riazuddin, Saima; Aye, Sandar; Ali, Rana A; Venselaar, Hanka; Anwar, Saima; Belyantseva, Polina P; Qasim, Muhammad; Riazuddin, Sheikh; Friedman, Thomas B

2008-10-01

Mutations of PCDH15, encoding protocadherin 15, can cause either combined hearing and vision impairment (type 1 Usher syndrome; USH1F) or nonsyndromic deafness (DFNB23). Human PCDH15 is reported to be composed of 35 exons and encodes a variety of isoforms with 3-11 ectodomains (ECs), a transmembrane domain and a carboxy-terminal cytoplasmic domain (CD). Building on these observations, we describe an updated gene structure that has four additional exons of PCDH15 and isoforms that can be subdivided into four classes. Human PCDH15 encodes three alternative, evolutionarily conserved unique cytoplasmic domains (CD1, CD2 or CD3). Families ascertained on the basis of prelingual hearing loss were screened for linkage of this phenotype to markers for PCDH15 on chromosome 10q21.1. In seven of twelve families segregating USH1, we identified homozygous mutant alleles (one missense, one splice site, three nonsense and two deletion mutations) of which six are novel. One family was segregating nonsyndromic deafness DFNB23 due to a homozygous missense mutation. To date, in our cohort of 557 Pakistani families, we have found 11 different PCDH15 mutations that account for deafness in 13 families. Molecular modeling provided mechanistic insight into the phenotypic variation in severity of the PCDH15 missense mutations. We did not find pathogenic mutations in five of the twelve USH1 families linked to markers for USH1F, which suggest either the presence of mutations of yet additional undiscovered exons of PCDH15, mutations in the introns or regulatory elements of PCDH15, or an additional locus for type I USH at chromosome 10q21.1.

Radioprotection of IDH1-Mutated Cancer Cells by the IDH1-Mutant Inhibitor AGI-5198.

PubMed

Molenaar, Remco J; Botman, Dennis; Smits, Myrthe A; Hira, Vashendriya V; van Lith, Sanne A; Stap, Jan; Henneman, Peter; Khurshed, Mohammed; Lenting, Krissie; Mul, Adri N; Dimitrakopoulou, Dionysia; van Drunen, Cornelis M; Hoebe, Ron A; Radivoyevitch, Tomas; Wilmink, Johanna W; Maciejewski, Jaroslaw P; Vandertop, W Peter; Leenders, William P; Bleeker, Fonnet E; van Noorden, Cornelis J

2015-11-15

Isocitrate dehydrogenase 1 (IDH1) is mutated in various types of human cancer to IDH1(R132H), a structural alteration that leads to catalysis of α-ketoglutarate to the oncometabolite D-2-hydroxyglutarate. In this study, we present evidence that small-molecule inhibitors of IDH1(R132H) that are being developed for cancer therapy may pose risks with coadministration of radiotherapy. Cancer cells heterozygous for the IDH1(R132H) mutation exhibited less IDH-mediated production of NADPH, such that after exposure to ionizing radiation (IR), there were higher levels of reactive oxygen species, DNA double-strand breaks, and cell death compared with IDH1 wild-type cells. These effects were reversed by the IDH1(R132H) inhibitor AGI-5198. Exposure of IDH1 wild-type cells to D-2-hydroxyglutarate was sufficient to reduce IDH-mediated NADPH production and increase IR sensitivity. Mechanistic investigations revealed that the radiosensitivity of heterozygous cells was independent of the well-described DNA hypermethylation phenotype in IDH1-mutated cancers. Thus, our results argue that altered oxidative stress responses are a plausible mechanism to understand the radiosensitivity of IDH1-mutated cancer cells. Further, they offer an explanation for the relatively longer survival of patients with IDH1-mutated tumors, and they imply that administration of IDH1(R132H) inhibitors in these patients may limit irradiation efficacy in this setting. ©2015 American Association for Cancer Research.

Serine Protease Inhibitor Kazal Type 1 (SPINK1) c.194+2T > C Mutation May Predict Long-term Outcome of Endoscopic Treatments in Idiopathic Chronic Pancreatitis.

PubMed

Sun, Chang; Liu, Mu-Yun; Liu, Xiao-Gang; Hu, Liang-Hao; Xia, Tian; Liao, Zhuan; Li, Zhao-Shen

2015-11-01

Endoscopic interventional is a commonly used treatment method for idiopathic chronic pancreatitis. Serine protease inhibitor Kazal type 1 (SPINK1) 194+2T>C mutation is most frequently observed in Chinese pancreatitis patients and influences the clinical course of idiopathic chronic pancreatitis patients. We conducted this study to determine the impacts of this mutation on the outcome of endoscopic treatments.In this study, we enrolled 423 patients. Among them, 101 idiopathic chronic pancreatitis patients without other relevant mutations had a successful endoscopic procedure and completed follow-up. Clinical characteristics including Izbicki pain score, exocrine and endocrine function, were evaluated. Genetic sequencing was conducted to detect SPINK1 194+2T>C mutations.The c.194+2T>C mutation was found in 58 (57.43%) patients. Factors relevant to pain relief are c.194+2T>C mutation (P = 0.011), severe pain before treatment (P = 0.005), and necessary subsequent endoscopic treatments (P < 0.001). More patients with the intronic mutation had deteriorated endocrine function (P = 0.001) relative to those patients without the mutation.Patients carrying the c.194+2T>C mutation were less likely to achieve pain relief through endoscopic treatments. They also have a higher risk of endocrine function deterioration. SPINK1 c.194+2T>C mutation may be applied as a pretreatment predictor in idiopathic chronic pancreatitis patients.

Immunohistochemical and genetic profiles of endometrioid endometrial carcinoma arising from atrophic endometrium.

PubMed

Geels, Yvette P; van der Putten, Louis J M; van Tilborg, Angela A G; Lurkin, Irene; Zwarthoff, Ellen C; Pijnenborg, Johanna M A; van den Berg-van Erp, Saskia H; Snijders, Marc P L M; Bulten, Johan; Visscher, Daniel W; Dowdy, Sean C; Massuger, Leon F A G

2015-05-01

Endometrial carcinomas are divided into type I endometrioid endometrial carcinomas (EECs), thought to arise from hyperplastic endometrium, and type II nonendometrioid endometrial carcinomas, thought to arise from atrophic endometrium. However, a minority (20%) of EECs have atrophic background endometrium, which was shown to be a marker of a worse prognosis. This study compares the immunohistochemical and genetic profiles of this possible third type to that of the known two types. 43 patients with grade 1 EEC and hyperplastic background endometrium (type I), 43 patients with grade 1 EEC and atrophic background endometrium (type III) and 21 patients with serous carcinoma (type II) were included (n=107). Tissue microarrays of tumor samples were immunohistochemically stained for PTEN, L1CAM, ER, PR, p53, MLH1, PMS2, β-catenin, E-cadherin and MIB1. The BRAF, KRAS, and PIK3CA genes were analyzed for mutations. A significantly higher expression of ER and PR, and a lower expression of L1CAM, p53 and MLH1 were found in type I and III compared to type II carcinomas. Expression of E-cadherin was significantly reduced in type III compared to type I carcinomas. Mutation analysis showed significantly less mutations of KRAS in type III compared to type I and II carcinomas (p<0.01). There appear to be slight immunohistochemical and genetic differences between EECs with hyperplastic and atrophic background endometrium. Carcinogenesis of EEC in atrophic endometrium seems to be characterized by loss of E-cadherin and a lack of KRAS mutations. As expected, endometrioid and serous carcinomas were immunohistochemically different. Copyright © 2015 Elsevier Inc. All rights reserved.

Disparity Implications of the Medicare MTM Eligibility Criteria: A Literature Review

PubMed Central

Munshi, Kiraat D.; Shih, Ya-Chen Tina; Brown, Lawrence M.; Dagogo-Jack, Samuel; Wan, Jim Y.; Wang, Junling

2013-01-01

Summary The emphasis on eliminating racial and ethnic disparities in health care has received national attention, with various policy initiatives addressing this problem and proposing solutions. However, in the current economic era requiring tight monetary constraints, emphasis is increasingly being placed on economic efficiency, which often conflicts with the equality doctrine upon which many policies have been framed. Our review aims to highlight the disparity implications of one such policy provision—the predominantly utilization-based eligibility criteria for medication therapy management (MTM) services under Medicare Part D—by identifying studies that have documented racial and ethnic disparities in health status and the use of and spending on prescription medications. Future design and evaluation of various regulations and legislations employing utilization-based eligibility criteria must use caution in order to strike an equity-efficiency balance. PMID:23570431

Medication therapy management and complex patients with disability: a randomized controlled trial.

PubMed

Chrischilles, Elizabeth A; Doucette, William; Farris, Karen; Lindgren, Scott; Gryzlak, Brian; Rubenstein, Linda; Youland, Kelly; Wallace, Robert B

2014-02-01

Drug therapy problems, adverse drug events (ADEs), and symptom burden are high among adults with disabilities. To compare the effects of a modified medication therapy management (MTM) program within a self-efficacy workshop versus the workshop alone or usual care on symptom burden among adults with activity limitations. Three-group randomized controlled trial among adults (age 40 and older) with self-reported activity limitations in community practice. 8 weekly Living Well With a Disability (LWD) 2-hour workshop sessions with and without a collaborative medication management (CMM) module. mean number of moderate to very severe symptoms from a list of 11 physical and mental symptoms. Process measures: changes in medication regimens and self-reported ADEs. general linear mixed models (continuous outcomes) and generalized estimating equations (categorical outcomes). Participants had high symptom burden, low physical health, and took many medications. There was a significant increase in ADE reporting in the LWD + CMM group relative to the other 2 groups (Study group × Time P = .014), and there were significantly more changes in medication regimens in the LWD + CMM group (P = .013 LWD only vs LWD + CMM). The oldest third of participants had significantly fewer mean symptoms but received more intense CMM. There was no difference between the LWD-only, LWD + CMM, and usual care groups in symptom burden over time. Pharmacist MTM practices and MTM guidelines may need to be modified to affect symptom burden in a population with physical activity limitations.

Trigeminal ganglion neuron subtype-specific alterations of CaV2.1 calcium current and excitability in a Cacna1a mouse model of migraine

PubMed Central

Fioretti, B; Catacuzzeno, L; Sforna, L; Gerke-Duncan, M B; van den Maagdenberg, A M J M; Franciolini, F; Connor, M; Pietrobon, D

2011-01-01

Abstract Familial hemiplegic migraine type-1 (FHM1), a monogenic subtype of migraine with aura, is caused by gain-of-function mutations in CaV2.1 (P/Q-type) calcium channels. The consequences of FHM1 mutations on the trigeminovascular pathway that generates migraine headache remain largely unexplored. Here we studied the calcium currents and excitability properties of two subpopulations of small-diameter trigeminal ganglion (TG) neurons from adult wild-type (WT) and R192Q FHM1 knockin (KI) mice: capsaicin-sensitive neurons without T-type calcium currents (CS) and capsaicin-insensitive neurons characterized by the expression of T-type calcium currents (CI-T). Small TG neurons retrogradely labelled from the dura are mostly CS neurons, while CI-T neurons were not present in the labelled population. CS and CI-T neurons express CaV2.1 channels with different activation properties, and the CaV2.1 channels are differently affected by the FHM1 mutation in the two TG neuron subtypes. In CI-T neurons from FHM1 KI mice there was a larger P/Q-type current density following mild depolarizations, a larger action potential (AP)-evoked calcium current and a longer AP duration when compared to CI-T neurons from WT mice. In striking contrast, the P/Q-type current density, voltage dependence and kinetics were not altered by the FHM1 mutation in CS neurons. The excitability properties of mutant CS neurons were also unaltered. Congruently, the FHM1 mutation did not alter depolarization-evoked CGRP release from the dura mater, while CGRP release from the trigeminal ganglion was larger in KI compared to WT mice. Our findings suggest that the facilitation of peripheral mechanisms of CGRP action, such as dural vasodilatation and nociceptor sensitization at the meninges, does not contribute to the generation of headache in FHM1. PMID:22005682

Imaging of Skeletal Disorders Caused by Fibroblast Growth Factor Receptor Gene Mutations.

PubMed

Sargar, Kiran M; Singh, Achint K; Kao, Simon C

2017-10-01

Fibroblast growth factors and fibroblast growth factor receptors (FGFRs) play important roles in human axial and craniofacial skeletal development. FGFR1, FGFR2, and FGFR3 are crucial for both chondrogenesis and osteogenesis. Mutations in the genes encoding FGFRs, types 1-3, are responsible for various skeletal dysplasias and craniosynostosis syndromes. Many of these disorders are relatively common in the pediatric population, and diagnosis is often challenging. These skeletal disorders can be classified based on which FGFR is affected. Skeletal disorders caused by type 1 mutations include Pfeiffer syndrome (PS) and osteoglophonic dysplasia, and disorders caused by type 2 mutations include Crouzon syndrome (CS), Apert syndrome (AS), and PS. Disorders caused by type 3 mutations include achondroplasia, hypochondroplasia, thanatophoric dysplasia (TD), severe achondroplasia with developmental delay and acanthosis nigricans, Crouzonodermoskeletal syndrome, and Muenke syndrome. Most of these mutations are inherited in an autosomal dominant fashion and are gain-of-function-type mutations. Imaging plays a key role in the evaluation of these skeletal disorders. Knowledge of the characteristic imaging and clinical findings can help confirm the correct diagnosis and guide the appropriate molecular genetic tests. Some characteristics and clinical findings include premature fusion of cranial sutures and deviated broad thumbs and toes in PS; premature fusion of cranial sutures and syndactyly of the hands and feet in AS; craniosynostosis, ocular proptosis, and absence of hand and foot abnormalities in CS; rhizomelic limb shortening, caudal narrowing of the lumbar interpediculate distance, small and square iliac wings, and trident hands in achondroplasia; and micromelia, bowing of the femora, and platyspondyly in TD. © RSNA, 2017.

Alanine to valine substitutions in the pore helix IIIP1 and linker-helix IIIL45 confer cockroach sodium channel resistance to DDT and pyrethroids.

PubMed

Chen, Mengli; Du, Yuzhe; Nomura, Yoshiko; Zhu, Guonian; Zhorov, Boris S; Dong, Ke

2017-05-01

Pyrethroid insecticides exert toxic effects by prolonging the opening of voltage-gated sodium channels. More than 20 sodium channel mutations from arthropod pests and disease vectors have been confirmed to confer pyrethroid resistance. These mutations have been valuable in elucidating the molecular interaction between pyrethroids and sodium channels, including identification of two pyrethroid receptor sites. Previously, two alanine to valine substitutions, one in the pore helix IIIP1 and the other in the linker-helix connecting S4 and S5 in domain III (IIIL45), were found in Drosophila melanogaster mutants that are resistant to DDT and deltamethrin (a type II pyrethroid with an α-cyano group at the phenylbenzyl alcohol position, which is lacking in type I pyrethroids), but their role in target-site-mediated insecticide resistance has not been functionally confirmed. In this study, we functionally examined the two mutations in cockroach sodium channels expressed in Xenopus laevis oocytes. Both mutations caused depolarizing shifts in the voltage dependence of activation, conferred DDT resistance and also resistance to two Type I pyrethroids by almost abolishing the tail currents induced by Type I pyrethroids. In contrast, neither mutation reduced the amplitude of tail currents induced by the Type II pyrethroids, deltamethrin or cypermethrin. However, both mutations accelerated the decay of Type II pyrethroid-induced tail currents, which normally decay extremely slowly. These results provided new insight into the molecular basis of different actions of Type I and Type II pyrethroids on sodium channels. Computer modeling predicts that both mutations may allosterically affect pyrethroid binding. Copyright © 2016 Elsevier B.V. All rights reserved.

An N-terminal glycine to cysteine mutation in the collagen COL1A1 gene produces moderately severe osteogenesis imperfecta

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilcox, W.; Scott, L.; Cohn, D.

Osteogenesis imperfecta (OI) is usually due to mutations in the type I procollagen genes COL1A1 and COL1A2. Point mutations close to the N-terminus are generally milder than those near the C-terminus of the molecule (the gradient hypothesis of collagen mutations). We describe a patient with moderately severe OI due to a mutation in the N-terminal portion of the triple helical domain of the {alpha}1(I) chain. Electrophoretic analysis of collagen isolated from fibroblast cultures suggested the abnormal presence of a cysteine in the N-terminal portion of the {alpha}1(I) chain. Five overlapping DNA fragments amplified from fibroblast RNA were screened for mutationsmore » using single strand conformational polymorphism (SSCP) and heteroduplex analyses. Direct DNA sequence analysis of the single positive fragment demonstrated a G to T transversion, corresponding to a glycine to cysteine substitution at position 226 of the triple helical domain of the {alpha}1(I) chain. The mutation was confirmed by restriction enzyme analysis of amplified genomic DNA. The mutation was not present in fibroblasts from either phenotypically normal parent. Combining this mutation with other reported mutations, glycine to cysteine substitutions at positions 205, 211, 223, and 226 produce a moderately severe phenotype whereas flanking mutations at positions 175 and 382 produce a mild phenotype. This data supports a regional rather than a gradient model of the relationship between the nature and location of type I collagen mutations and OI phenotype.« less

Tandem duplication within a Neurofibromatosis type I (NFI) gene exon in a family with features of Watson syndrome and Noonan syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tassabehji, M.; Strachan, T.; Colley, A.

Type 1 neurofibromatosis (NF1), Watson syndrome (WS), and Noonan syndrome (NS) show some overlap in clinical manifestations. In addition, WS has been shown to be linked to markers flanking the NF1 locus and a deletion at the NF1 locus demonstrated in a WS patient. This suggests either that WS and NF1 are allelic or the phenotypes arise from mutations in very closely linked genes. Here the authors provide evidence for the former by demonstrating a mutation in the NF1 gene in a family with features of both WS and NS. The mutation is an almost perfect in-frame tandem duplication ofmore » 42 bases in exon 28 of the NF1 gene. Unlike the mutations previously described in classical NF1, which show a preponderance of null alleles, the mutation in this family would be expected to result in a mutant neurofibromin product. 31 refs., 2 figs.« less

Hereditary sensory and autonomic neuropathy type I in a Chinese family: British C133W mutation exists in the Chinese.

PubMed

Bi, Hongyan; Gao, Yunying; Yao, Sheng; Dong, Mingrui; Headley, Alexander Peter; Yuan, Yun

2007-10-01

Hereditary sensory and autonomic neuropathy type I (HSAN I) is an autosomal dominant disorder of the peripheral nervous system characterized by marked progressive sensory loss, with variable autonomic and motor involvement. The HSAN I locus maps to chromosome 9q22.1-22.3 and is caused by mutations in the gene coding for serine palmitoyltransferase long chain base subunit 1 (SPTLC1). Sequencing in HSAN I families have previously identified mutations in exons 5, 6 and 13 of this gene. Here we report the clinical, electrophysiological and pathological findings of a proband in a Chinese family with HSAN I. The affected members showed almost typical clinical features. Electrophysiological findings showed an axonal, predominantly sensory, neuropathy with motor and autonomic involvement. Sural nerve biopsy showed loss of myelinated and unmyelinated fibers. SPTLC1 mutational analysis revealed the C133W mutation, a mutation common in British HSAN I families.

Prevalence and Type of BRCA Mutations in Hispanics Undergoing Genetic Cancer Risk Assessment in the Southwestern United States: A Report From the Clinical Cancer Genetics Community Research Network

PubMed Central

Weitzel, Jeffrey N.; Clague, Jessica; Martir-Negron, Arelis; Ogaz, Raquel; Herzog, Josef; Ricker, Charité; Jungbluth, Chelsy; Cina, Cheryl; Duncan, Paul; Unzeitig, Gary; Saldivar, J. Salvador; Beattie, Mary; Feldman, Nancy; Sand, Sharon; Port, Danielle; Barragan, Deborah I.; John, Esther M.; Neuhausen, Susan L.; Larson, Garrett P.

2013-01-01

Purpose To determine the prevalence and type of BRCA1 and BRCA2 (BRCA) mutations among Hispanics in the Southwestern United States and their potential impact on genetic cancer risk assessment (GCRA). Patients and Methods Hispanics (n = 746) with a personal or family history of breast and/or ovarian cancer were enrolled in an institutional review board–approved registry and received GCRA and BRCA testing within a consortium of 14 clinics. Population-based Hispanic breast cancer cases (n = 492) enrolled in the Northern California Breast Cancer Family Registry, negative by sequencing for BRCA mutations, were analyzed for the presence of the BRCA1 ex9-12del large rearrangement. Results Deleterious BRCA mutations were detected in 189 (25%) of 746 familial clinic patients (124 BRCA1, 65 BRCA2); 21 (11%) of 189 were large rearrangement mutations, of which 62% (13 of 21) were BRCA1 ex9-12del. Nine recurrent mutations accounted for 53% of the total. Among these, BRCA1 ex9-12del seems to be a Mexican founder mutation and represents 10% to 12% of all BRCA1 mutations in clinic- and population-based cohorts in the United States. Conclusion BRCA mutations were prevalent in the largest study of Hispanic breast and/or ovarian cancer families in the United States to date, and a significant proportion were large rearrangement mutations. The high frequency of large rearrangement mutations warrants screening in every case. We document the first Mexican founder mutation (BRCA1 ex9-12del), which, along with other recurrent mutations, suggests the potential for a cost-effective panel approach to ancestry-informed GCRA. PMID:23233716

AGXT Gene Mutations and Prevalence of Primary Hyperoxaluria Type 1 in Moroccan Population.

PubMed

Boualla, Lamiae; Tajir, Mariam; Oulahiane, Najat; Lyahyai, Jaber; Laarabi, Fatima Zahra; Chafai Elalaoui, Siham; Soulami, Kenza; Ait Ouamar, Hassan; Sefiani, Abdelaziz

2015-11-01

Primary hyperoxaluria type 1 (PH1) is an autosomal recessive disorder caused by deficiency of alanine glyoxylate aminotransferase, due to a defect in the AGXT gene. Several mutations in this gene have been reported and some of them have been observed in multiple populations. The aim of our study was to analyze the mutations causing PH1 in the Moroccan population and to estimate its prevalence in Morocco. Molecular studies of 29 unrelated Moroccan patients with PH were performed by direct sequencing of all exons of the AGXT gene. In addition, to estimate the prevalence of PH1, we screened for the recurrent p.Ile244Thr mutation in 250 unrelated Moroccan newborns using real-time polymerase chain reaction. Four pathogenic mutations were detected in 25 unrelated patients. The c.731T>C (p.Ile244Thr) was the most frequent mutation with a frequency of 84%. The other three mutations were c.33delC, c.976delG, and c.331C>T. The prevalence of the PH1 mutation among Moroccans was then estimated to range from 1/7267 to 1/6264. PH1 is one of the most prevalent genetic diseases in the Moroccan population and is probably underdiagnosed. Front line genetic testing for PH1 in Morocco should be initiated using an assay for the recurrent p.Ile244Thr mutation. This strategy would provide a useful tool for precocious diagnosis of presymptomatic individuals and to prevent their rapid progression to renal failure.

Characterization of the mutations in the glucose-6-phosphatase gene in Israeli patients with glycogen storage disease type 1a: R83C in six Jews and a novel V166G mutation in a Muslim Arab.

PubMed

Parvari, R; Moses, S; Hershkovitz, E; Carmi, R; Bashan, N

1995-01-01

Glycogen storage disease type 1a (GSD 1a), an autosomal recessive disease, is caused by the inactivity of glucose-6-phosphatase, the gene of which has been recently cloned. We report on the missense mutation C-->T at nucleotide 326 of the G6Pase gene, causing the change of the Arg codon at position 83 into a Cys codon, as the single mutation detected in six Jewish patients. This finding suggests that this mutation might be prevalent among the Jewish population. A new missense mutation T-->G at nucleotide 576 resulting in V166G was found in an Arab Muslim patient. These families may benefit now from pre- and postnatal diagnosis by analysis of DNA from blood and amniotic fluid or chorionic villus cells rather than liver biopsy. No mutations in the G6Pase gene were detected in two GSD 1b patients.

Functional analysis of mutations in SLC7A9, and genotype-phenotype correlation in non-Type I cystinuria.

PubMed

Font, M A; Feliubadaló, L; Estivill, X; Nunes, V; Golomb, E; Kreiss, Y; Pras, E; Bisceglia, L; d'Adamo, A P; Zelante, L; Gasparini, P; Bassi, M T; George , A L; Manzoni, M; Riboni, M; Ballabio, A; Borsani, G; Reig, N; Fernández, E; Zorzano, A; Bertran, J; Palacín, M

2001-02-15

Cystinuria (OMIM 220100) is a common recessive disorder of renal reabsorption of cystine and dibasic amino acids that results in nephrolithiasis of cystine. Mutations in SLC3A1, which encodes rBAT, cause Type I cystinuria, and mutations in SLC7A9, which encodes a putative subunit of rBAT (b(o,+)AT), cause non-Type I cystinuria. Here we describe the genomic structure of SLC7A9 (13 exons) and 28 new mutations in this gene that, together with the seven previously reported, explain 79% of the alleles in 61 non-Type I cystinuria patients. These data demonstrate that SLC7A9 is the main non-Type I cystinuria gene. Mutations G105R, V170M, A182T and R333W are the most frequent SLC7A9 missense mutations found. Among heterozygotes carrying these mutations, A182T heterozygotes showed the lowest urinary excretion values of cystine and dibasic amino acids. Functional analysis of mutation A182T after co-expression with rBAT in HeLa cells revealed significant residual transport activity. In contrast, mutations G105R, V170M and R333W are associated to a complete or almost complete loss of transport activity, leading to a more severe urinary phenotype in heterozygotes. SLC7A9 mutations located in the putative transmembrane domains of b(o,+)AT and affecting conserved amino acid residues with a small side chain generate a severe phenotype, while mutations in non-conserved residues give rise to a mild phenotype. These data provide the first genotype-phenotype correlation in non-Type I cystinuria, and show that a mild urinary phenotype in heterozygotes may associate with mutations with significant residual transport activity.

Use of mutation profiles to refine the classification of endometrial carcinomas.

PubMed

McConechy, Melissa K; Ding, Jiarui; Cheang, Maggie Cu; Wiegand, Kimberly; Senz, Janine; Tone, Alicia; Yang, Winnie; Prentice, Leah; Tse, Kane; Zeng, Thomas; McDonald, Helen; Schmidt, Amy P; Mutch, David G; McAlpine, Jessica N; Hirst, Martin; Shah, Sohrab P; Lee, Cheng-Han; Goodfellow, Paul J; Gilks, C Blake; Huntsman, David G

2012-09-01

The classification of endometrial carcinomas is based on pathological assessment of tumour cell type; the different cell types (endometrioid, serous, carcinosarcoma, mixed, undifferentiated, and clear cell) are associated with distinct molecular alterations. This current classification system for high-grade subtypes, in particular the distinction between high-grade endometrioid (EEC-3) and serous carcinomas (ESC), is limited in its reproducibility and prognostic abilities. Therefore, a search for specific molecular classifiers to improve endometrial carcinoma subclassification is warranted. We performed target enrichment sequencing on 393 endometrial carcinomas from two large cohorts, sequencing exons from the following nine genes: ARID1A, PPP2R1A, PTEN, PIK3CA, KRAS, CTNNB1, TP53, BRAF, and PPP2R5C. Based on this gene panel, each endometrial carcinoma subtype shows a distinct mutation profile. EEC-3s have significantly different frequencies of PTEN and TP53 mutations when compared to low-grade endometrioid carcinomas. ESCs and EEC-3s are distinct subtypes with significantly different frequencies of mutations in PTEN, ARID1A, PPP2R1A, TP53, and CTNNB1. From the mutation profiles, we were able to identify subtype outliers, ie cases diagnosed morphologically as one subtype but with a mutation profile suggestive of a different subtype. Careful review of these diagnostically challenging cases suggested that the original morphological classification was incorrect in most instances. The molecular profile of carcinosarcomas suggests two distinct mutation profiles for these tumours: endometrioid-type (PTEN, PIK3CA, ARID1A, KRAS mutations) and serous-type (TP53 and PPP2R1A mutations). While this nine-gene panel does not allow for a purely molecularly based classification of endometrial carcinoma, it may prove useful as an adjunct to morphological classification and serve as an aid in the classification of problematic cases. If used in practice, it may lead to improved diagnostic reproducibility and may also serve to stratify patients for targeted therapeutics. Copyright © 2012 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Mutational Analysis of Cell Types in Tuberous Sclerosis Complex (TSC)

DTIC Science & Technology

2007-01-01

disorder resulting from mutations in the TSC1 or TSC2 genes that is associated with epilepsy, cognitive disability, and autism . TSC1/TSC2 gene mutations...cognitive disability, and autism . TSC1/TSC2 gene mutations lead to developmental alterations in brain structure known as tubers in over 80% of TSC...TSC (Sparagana and Roach, 2000). Comorbid neuropsychological disorders such as autism , mental retardation (MR), pervasive developmental disorder

Autosomal Dominant Growth Hormone Deficiency (Type II).

PubMed

Alatzoglou, Kyriaki S; Kular, Dalvir; Dattani, Mehul T

2015-06-01

Isolated growth hormone deficiency (IGHD) is the commonest pituitary hormone deficiency resulting from congenital or acquired causes, although for most patients its etiology remains unknown. Among the known factors, heterozygous mutations in the growth hormone gene (GH1) lead to the autosomal dominant form of GHD, also known as type II GHD. In many cohorts this is the commonest form of congenital isolated GHD and is mainly caused by mutations that affect the correct splicing of GH-1. These mutations cause skipping of the third exon and lead to the production of a 17.5-kDa GH isoform that exerts a dominant negative effect on the secretion of the wild type GH. The identification of these mutations has clinical implications for the management of patients, as there is a well-documented correlation between the severity of the phenotype and the increased expression of the 17.5-kDa isoform. Patients with type II GHD have a variable height deficit and severity of GHD and may develop additional pituitary hormone defiencies over time, including ACTH, TSH and gonadotropin deficiencies. Therefore, their lifelong follow-up is recommended. Detailed studies on the effect of heterozygous GH1 mutations on the trafficking, secretion and action of growth hormone can elucidate their mechanism on a cellular level and may influence future treatment options for GHD type II.

Myelin protein zero gene mutated in Charcot-Marie-Tooth type 1B patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su, Ying; Li, Lanying; Lepercq, J.

1993-11-15

The autosomal dominant of Charcot-Marie-Tooth disease (CMT), whose gene is type 1B (CMT1B), has slow nerve conduction with demyelinated Schwann cells. In this study the abundant peripheral myelin protein zero (MPZ) gene, MPZ, was mapped 130 kb centromeric to the Fc receptor immunoglobulin gene cluster in band 1q22, and a major MPZ point mutation was found to cosegregate with CMT1B in one large CMT1B family. The MPZ point mutation in 18 of 18 related CMT1B pedigree 1 patients converts a positively charged lysine in codon 96 to a negatively charged glutamate. The same MPZ locus cosegregates with the CMT1B diseasemore » gene in a second CMT1B family [total multipoint logarithm of odds (lod) = 11.4 at [theta] = 0.00] with a splice junction mutation. Both mutations occur in MPZ protein regions otherwise conserved identically in human, rat, and cow since these species diverged 100 million years ago. MPZ protein, expressed exclusively in myelinated peripheral nerve Schwann cells, constitutes >50% of myelin protein. These mutations are anticipated to disrupt homophilic MPZ binding and result in CMT1B peripheral nerve demyelination.« less

Additive loss-of-function proteasome subunit mutations in CANDLE/PRAAS patients promote type I IFN production

PubMed Central

Brehm, Anja; Liu, Yin; Sheikh, Afzal; Marrero, Bernadette; Omoyinmi, Ebun; Zhou, Qing; Montealegre, Gina; Biancotto, Angelique; Reinhardt, Adam; Almeida de Jesus, Adriana; Pelletier, Martin; Tsai, Wanxia L.; Remmers, Elaine F.; Kardava, Lela; Hill, Suvimol; Kim, Hanna; Lachmann, Helen J.; Megarbane, Andre; Chae, Jae Jin; Brady, Jilian; Castillo, Rhina D.; Brown, Diane; Casano, Angel Vera; Gao, Ling; Chapelle, Dawn; Huang, Yan; Stone, Deborah; Chen, Yongqing; Sotzny, Franziska; Lee, Chyi-Chia Richard; Kastner, Daniel L.; Torrelo, Antonio; Zlotogorski, Abraham; Moir, Susan; Gadina, Massimo; McCoy, Phil; Wesley, Robert; Rother, Kristina; Hildebrand, Peter W.; Brogan, Paul; Krüger, Elke; Aksentijevich, Ivona; Goldbach-Mansky, Raphaela

2015-01-01

Autosomal recessive mutations in proteasome subunit β 8 (PSMB8), which encodes the inducible proteasome subunit β5i, cause the immune-dysregulatory disease chronic atypical neutrophilic dermatosis with lipodystrophy and elevated temperature (CANDLE), which is classified as a proteasome-associated autoinflammatory syndrome (PRAAS). Here, we identified 8 mutations in 4 proteasome genes, PSMA3 (encodes α7), PSMB4 (encodes β7), PSMB9 (encodes β1i), and proteasome maturation protein (POMP), that have not been previously associated with disease and 1 mutation in PSMB8 that has not been previously reported. One patient was compound heterozygous for PSMB4 mutations, 6 patients from 4 families were heterozygous for a missense mutation in 1 inducible proteasome subunit and a mutation in a constitutive proteasome subunit, and 1 patient was heterozygous for a POMP mutation, thus establishing a digenic and autosomal dominant inheritance pattern of PRAAS. Function evaluation revealed that these mutations variably affect transcription, protein expression, protein folding, proteasome assembly, and, ultimately, proteasome activity. Moreover, defects in proteasome formation and function were recapitulated by siRNA-mediated knockdown of the respective subunits in primary fibroblasts from healthy individuals. Patient-isolated hematopoietic and nonhematopoietic cells exhibited a strong IFN gene-expression signature, irrespective of genotype. Additionally, chemical proteasome inhibition or progressive depletion of proteasome subunit gene transcription with siRNA induced transcription of type I IFN genes in healthy control cells. Our results provide further insight into CANDLE genetics and link global proteasome dysfunction to increased type I IFN production. PMID:26524591

Identification and characterisation of mutations associated with von Willebrand disease in a Turkish patient cohort

PubMed Central

Hampshire, Daniel J.; Abuzenadah, Adel M.; Cartwright, Ashley; Al-Shammari, Nawal S.; Coyle, Rachael E.; Eckert, Michaela; Al-Buhairan, Ahlam M.; Messenger, Sarah L.; Budde, Ulrich; Gürsel, Türkiz; Ingerslev, Jørgen; Peake, Ian R.; Goodeve, Anne C.

2014-01-01

Summary Several cohort studies have investigated the molecular basis of von Willebrand disease (VWD); however these have mostly focused on European and North American populations. This study aimed to investigate mutation spectrum in 26 index cases (IC) from Turkey diagnosed with all three VWD types, the majority (73%) with parents who were knowingly related. IC were screened for mutations using multiplex ligation-dependent probe amplification and analysis of all von Willebrand factor gene (VWF) exons and exon/intron boundaries. Selected missense mutations were expressed in vitro. Candidate VWF mutations were identified in 25 of 26 IC and included propeptide missense mutations in four IC (two resulting in type 1 and two in recessive 2A), all influencing VWF expression in vitro. Four missense mutations, a nonsense mutation and a small in-frame insertion resulting in type 2A were also identified. Of 15 type 3 VWD IC, 13 were homozygous and two compound heterozygous for 14 candidate mutations predicted to result in lack of expression and two propeptide missense changes. Identification of intronic breakpoints of an exon 17–18 deletion suggested that the mutation resulted from non-homologous end joining. This study provides further insight into the pathogenesis of VWD in a population with a high degree of consanguineous partnerships. PMID:23702511

Scopolamine Administration Modulates Muscarinic, Nicotinic and NMDA Receptor Systems

PubMed Central

Höger, Harald; Pollak, Arnold; Lubec, Gert

2012-01-01

Studies on the effect of scopolamine on memory are abundant but so far only regulation of the muscarinic receptor (M1) has been reported. We hypothesized that levels of other cholinergic brain receptors as the nicotinic receptors and the N-methyl-D-aspartate (NMDA) receptor, known to be involved in memory formation, would be modified by scopolamine administration. C57BL/6J mice were used for the experiments and divided into four groups. Two groups were given scopolamine 1 mg/kg i.p. (the first group was trained and the second group untrained) in the multiple T-maze (MTM), a paradigm for evaluation of spatial memory. Likewise, vehicle-treated mice were trained or untrained thus serving as controls. Hippocampal levels of M1, nicotinic receptor alpha 4 (Nic4) and 7 (Nic7) and subunit NR1containing complexes were determined by immunoblotting on blue native gel electrophoresis. Vehicle-treated trained mice learned the task and showed memory retrieval on day 8, while scopolamine-treatment led to significant impairment of performance in the MTM. At the day of retrieval, hippocampal levels for M1, Nic7 and NR1 were higher in the scopolamine treated groups than in vehicle-treated groups. The concerted action, i.e. the pattern of four brain receptor complexes regulated by the anticholinergic compound scopolamine, is shown. Insight into probable action mechanisms of scopolamine at the brain receptor complex level in the hippocampus is provided. Scopolamine treatment is a standard approach to test cognitive enhancers and other psychoactive compounds in pharmacological studies and therefore knowledge on mechanisms is of pivotal interest. PMID:22384146

Myosin storage myopathy: slow skeletal myosin (MYH7) mutation in two isolated cases.

PubMed

Laing, N G; Ceuterick-de Groote, C; Dye, D E; Liyanage, K; Duff, R M; Dubois, B; Robberecht, W; Sciot, R; Martin, J-J; Goebel, H H

2005-02-08

Myosin storage myopathy is a congenital myopathy characterized by subsarcolemmal hyaline bodies in type 1 muscle fibers, which are ATPase positive and thus contain myosin. Mutations recently were identified in the type 1 muscle fiber myosin gene (MYH7) in Swedish and Saudi families with myosin storage myopathy. The authors have identified the arginine 1845 tryptophan mutation found in the Swedish families in two isolated Belgian cases, indicating a critical role for myosin residue arginine 1845.

Loss-of-function thrombospondin-1 mutations in familial pulmonary hypertension

PubMed Central

Stearman, Robert S.; Bull, Todd M.; Calabrese, David W.; Tripp-Addison, Megan L.; Wick, Marilee J.; Broeckel, Ulrich; Robbins, Ivan M.; Wheeler, Lisa A.; Cogan, Joy D.; Loyd, James E.

2012-01-01

Most patients with familial pulmonary arterial hypertension (FPAH) carry mutations in the bone morphogenic protein receptor 2 gene (BMPR2). Yet carriers have only a 20% risk of disease, suggesting that other factors influence penetrance. Thrombospondin-1 (TSP1) regulates activation of TGF-β and inhibits endothelial and smooth muscle cell proliferation, pathways coincidentally altered in pulmonary arterial hypertension (PAH). To determine whether a subset of FPAH patients also have mutations in the TSP1 gene (THBS1) we resequenced the type I repeats of THBS1 encoding the TGF-β regulation and cell growth inhibition domains in 60 FPAH probands, 70 nonfamilial PAH subjects, and in large control groups. We identified THBS1 mutations in three families: a novel missense mutation in two (Asp362Asn), and an intronic mutation in a third (IVS8+255 G/A). Neither mutation was detected in population controls. Mutant 362Asn TSP1 had less than half of the ability of wild-type TSP1 to activate TGF-β. Mutant 362Asn TSP1 also lost the ability to inhibit growth of pulmonary arterial smooth muscle cells and was over threefold less effective at inhibiting endothelial cell growth. The IVS8+255 G/A mutation decreased and/or eliminated local binding of the transcription factors SP1 and MAZ but did not affect RNA splicing. These novel mutations implicate THBS1 as a modifier gene in FPAH. These THBS1 mutations have implications in the genetic evaluation of FPAH patients. However, since FPAH is rare, these data are most relevant as evidence for the importance of TSP1 in pulmonary vascular homeostasis. Further examination of THBS1 in the pathogenesis of PAH is warranted. PMID:22198906

A method distinguishing expressed vs. null mutations of the Col1A1 gene in osteogenesis imperfecta

DOE Office of Scientific and Technical Information (OSTI.GOV)

Redford-Badwal, D.A.; Stover, M.L.; McKinstry, M.

Osteogenesis imperfecta (OI) is a heterogeneous group of heritable disorders of bone characterized by increased susceptibility to fracture. Most of the causative mutations were identified in patients with the lethal form of the disease. Attention is now shifting to the milder forms of OI where glycine substitutions and null producing mutations have been found. Single amino acid substitutions can be identified by RT/PCR of total cellular RNA, but this approach does not work well for null mutations since the defective transcript does not accumulate in the cytoplasm. We have altered our RNA extraction method to separate RNA from the nuclearmore » and cytoplasmic compartments of cultured fibroblasts. Standard methods of mutation identification (RT/PCR followed by SSCP) is applied to each RNA fraction. DNA from an abnormal band on the SSCP gel is eluted and amplified by PCR for cloning and sequencing. Using this approach we have identified an Asp to Asn change in exon 50 (type II OI) and a Gly to Arg in exon 11 (type I OI) of the COL1A1 gene. These changes were found in both nuclear and cytoplasmic compartments. These putative mutations are currently being confirmed by protein studies. In contrast, three patients with mild OI associated with reduced {proportional_to}(I)mRNA, had distinguishing SSCP bands present in the nuclear but not the cytoplasmic compartment. In one case a frame shift mutation was observed, while the other two revealed polymorphisms. The compartmentalization of the mutant allele has directed us to look elsewhere in the transcript for the causative mutation. This approach to mutation identification is capable of distinguishing these fundamentally different types of mutations and allows for preferential cloning and sequencing of the abnormal allele.« less

Stickler syndrome caused by COL2A1 mutations: genotype–phenotype correlation in a series of 100 patients

PubMed Central

Hoornaert, Kristien P; Vereecke, Inge; Dewinter, Chantal; Rosenberg, Thomas; Beemer, Frits A; Leroy, Jules G; Bendix, Laila; Björck, Erik; Bonduelle, Maryse; Boute, Odile; Cormier-Daire, Valerie; De Die-Smulders, Christine; Dieux-Coeslier, Anne; Dollfus, Hélène; Elting, Mariet; Green, Andrew; Guerci, Veronica I; Hennekam, Raoul C M; Hilhorts-Hofstee, Yvonne; Holder, Muriel; Hoyng, Carel; Jones, Kristi J; Josifova, Dragana; Kaitila, Ilkka; Kjaergaard, Suzanne; Kroes, Yolande H; Lagerstedt, Kristina; Lees, Melissa; LeMerrer, Martine; Magnani, Cinzia; Marcelis, Carlo; Martorell, Loreto; Mathieu, Michèle; McEntagart, Meriel; Mendicino, Angela; Morton, Jenny; Orazio, Gabrielli; Paquis, Véronique; Reish, Orit; Simola, Kalle O J; Smithson, Sarah F; Temple, Karen I; Van Aken, Elisabeth; Van Bever, Yolande; van den Ende, Jenneke; Van Hagen, Johanna M; Zelante, Leopoldo; Zordania, Riina; De Paepe, Anne; Leroy, Bart P; De Buyzere, Marc; Coucke, Paul J; Mortier, Geert R

2010-01-01

Stickler syndrome is an autosomal dominant connective tissue disorder caused by mutations in different collagen genes. The aim of our study was to define more precisely the phenotype and genotype of Stickler syndrome type 1 by investigating a large series of patients with a heterozygous mutation in COL2A1. In 188 probands with the clinical diagnosis of Stickler syndrome, the COL2A1 gene was analyzed by either a mutation scanning technique or bidirectional fluorescent DNA sequencing. The effect of splice site alterations was investigated by analyzing mRNA. Multiplex ligation-dependent amplification analysis was used for the detection of intragenic deletions. We identified 77 different COL2A1 mutations in 100 affected individuals. Analysis of the splice site mutations showed unusual RNA isoforms, most of which contained a premature stop codon. Vitreous anomalies and retinal detachments were found more frequently in patients with a COL2A1 mutation compared with the mutation-negative group (P<0.01). Overall, 20 of 23 sporadic patients with a COL2A1 mutation had either a cleft palate or retinal detachment with vitreous anomalies. The presence of vitreous anomalies, retinal tears or detachments, cleft palate and a positive family history were shown to be good indicators for a COL2A1 defect. In conclusion, we confirm that Stickler syndrome type 1 is predominantly caused by loss-of-function mutations in the COL2A1 gene as >90% of the mutations were predicted to result in nonsense-mediated decay. On the basis of binary regression analysis, we developed a scoring system that may be useful when evaluating patients with Stickler syndrome. PMID:20179744

Combination of isocitrate dehydrogenase 1 (IDH1) mutation and podoplanin expression in brain tumors identifies patients at high or low risk of venous thromboembolism.

PubMed

Mir Seyed Nazari, P; Riedl, J; Preusser, M; Posch, F; Thaler, J; Marosi, C; Birner, P; Ricken, G; Hainfellner, J A; Pabinger, I; Ay, C

2018-06-01

Essentials Risk stratification for venous thromboembolism (VTE) in patients with brain tumors is challenging. Patients with IDH1 wildtype and high podoplanin expression have a 6-month VTE risk of 18.2%. Patients with IDH1 mutation and no podoplanin expression have a 6-month VTE risk of 0%. IDH1 mutation and podoplanin overexpression in primary brain tumors appear to be exclusive. Background Venous thromboembolism (VTE) is a frequent complication in primary brain tumor patients. Independent studies revealed that podoplanin expression in brain tumors is associated with increased VTE risk, whereas the isocitrate dehydrogenase 1 (IDH1) mutation is associated with very low VTE risk. Objectives To investigate the interrelation between intratumoral podoplanin expression and IDH1 mutation, and their mutual impact on VTE development. Patients/Methods In a prospective cohort study, intratumoral IDH1 R132H mutation and podoplanin were determined in brain tumor specimens (mainly glioma) by immunohistochemistry. The primary endpoint of the study was symptomatic VTE during a 2-year follow-up. Results All brain tumors that expressed podoplanin to a medium-high extent showed also an IDH1 wild-type status. A score based on IDH1 status and podoplanin expression levels allowed prediction of the risk of VTE. Patients with wild-type IDH1 brain tumors and high podoplanin expression had a significantly increased VTE risk compared with those with mutant IDH1 tumors and no podoplanin expression (6-month risk 18.2% vs. 0%). Conclusions IDH1 mutation and podoplanin overexpression seem to be exclusive. Although brain tumor patients with IDH1 mutation are at very low risk of VTE, the risk of VTE in patients with IDH1 wild-type tumors is strongly linked to podoplanin expression levels. © 2018 International Society on Thrombosis and Haemostasis.

A chondrodysplasia family produced by mutations in the diastrophic dysplasia sulfate transporter gene: Genotype/phenotype correlations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Superti-Furga, A.; Steinmann, B.; Gitzelmann, R.

1996-05-03

Achondrogenesis type 1B (ACG-1B), atelosteogenesis type 2 (AO-2), and diastrophic dysplasia (DTD) are recessively inherited chondrodysplasia of decreasing severity caused by mutations in the diastrophic dysplasia sulfate transporter (DTDST) gene on chromosome 5. In these conditions, sulfate transport across the cell membrane is impaired which results in insufficient sulfation of cartilage proteoglycans and thus in an abnormally low sulfate content of cartilage. The severity of the phenotype correlates well with the predicted effect of the underlying DTDST mutations: homozygosity or compound heterozygosity for stop codons or transmembrane domain substitutions mostly result in achondrogenesis type 1B, while other structural or regulatorymore » mutations usually result in one of the less severe phenotypes. The chondrodysplasia arising at the DTDST locus constitute a bone dysplasia family with recessive inheritance. 28 refs., 2 tabs.« less

Analysis of the GCK gene in 79 MODY type 2 patients: A multicenter Turkish study, mutation profile and description of twenty novel mutations.

PubMed

Aykut, Ayça; Karaca, Emin; Onay, Hüseyin; Gökşen, Damla; Çetinkalp, Şevki; Eren, Erdal; Ersoy, Betül; Çakır, Esra Papatya; Büyükinan, Muammer; Kara, Cengiz; Anık, Ahmet; Kırel, Birgül; Özen, Samim; Atik, Tahir; Darcan, Şükran; Özkınay, Ferda

2018-01-30

Maturity onset diabetes is a genetic form of diabetes mellitus characterized by an early age at onset and several etiologic genes for this form of diabetes have been identified in many patients. Maturity onset diabetes type 2 [MODY2 (#125851)] caused by mutations in the glucokinase gene (GCK). Although its prevalence is not clear, it is estimated that 1%-2% of patients with diabetes have the monogenic form. The aim of this study was to evaluate the molecular spectrum of GCK gene mutations in 177 Turkish MODY type 2 patients. Mutations in the GCK gene were identified in 79 out of 177. All mutant alleles were identified, including 45 different GCK mutations, 20 of which were novel. Copyright © 2017. Published by Elsevier B.V.

Genetic testing for oculocutaneous albinism type 1 and 2 and Hermansky-Pudlak syndrome type 1 and 3 mutations in Puerto Rico.

PubMed

Santiago Borrero, Pedro J; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y; Izquierdo, Natalio J; Del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A; Cadilla, Carmen L

2006-01-01

Hermansky-Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of approximately 1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population.

Genetic Testing for Oculocutaneous Albinism Type 1 and 2 and Hermansky–Pudlak Syndrome Type 1 and 3 Mutations in Puerto Rico

PubMed Central

Santiago Borrero, Pedro J.; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y.; Izquierdo, Natalio J.; del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A.; Cadilla, Carmen L.

2013-01-01

Hermansky–Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of ~1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population. PMID:16417222

Epidermal growth factor receptor signaling pathway is frequently altered in ampullary carcinoma at protein and genetic levels.

PubMed

Mikhitarian, Kaidi; Pollen, Maressa; Zhao, Zhiguo; Shyr, Yu; Merchant, Nipun B; Parikh, Alexander; Revetta, Frank; Washington, M Kay; Vnencak-Jones, Cindy; Shi, Chanjuan

2014-05-01

Our objective was to explore alteration of the epidermal growth factor receptor (EGFR) signaling pathway in ampullary carcinoma. Immunohistochemical studies were employed to evaluate expression of amphiregulin as well as expression and activation of EGFR. A lab-developed assay was used to identify mutations in the EGFR pathway genes, including KRAS, BRAF, PIK3CA, PTEN, and AKT1. A total of 52 ampullary carcinomas were identified, including 25 intestinal-type and 24 pancreatobiliary-type tumors, with the intestinal type being associated with a younger age at diagnosis (P=0.03) and a better prognosis (P<0.01). Expression of amphiregulin correlated with better differentiation (P<0.01), but no difference was observed between two major histologic types. Expression and activation of EGFR was more commonly seen in the pancreatobiliary type (P<0.01). Mutations were detected in 50% of the pancreatobiliary type and 60% of the intestinal type. KRAS was the most common gene mutated in the pancreatobiliary type (42%) as well as the intestinal type (52%). Other mutations detected included PIK3CA, SMAD4 and BRAF. KRAS mutations at codons 12 and 13 did not adversely affect overall survival. In conclusion, EGFR expression and activation were different between intestinal- and pancreatobiliary-type ampullary carcinoma. KRAS mutation was common in both histologic types; however, the incidence appeared to be lower in the pancreatobiliary type compared with its pancreatic counterpart, pancreatic ductal adenocarcinoma. Mutational analysis of the EGFR pathway genes may provide important insights into personalized treatment for patients with ampullary carcinoma.

Wild-Type U2AF1 Antagonizes the Splicing Program Characteristic of U2AF1-Mutant Tumors and Is Required for Cell Survival

PubMed Central

Fei, Dennis Liang; Motowski, Hayley; Chatrikhi, Rakesh; Gao, Shaojian; Kielkopf, Clara L.; Varmus, Harold

2016-01-01

We have asked how the common S34F mutation in the splicing factor U2AF1 regulates alternative splicing in lung cancer, and why wild-type U2AF1 is retained in cancers with this mutation. A human lung epithelial cell line was genetically modified so that U2AF1S34F is expressed from one of the two endogenous U2AF1 loci. By altering levels of mutant or wild-type U2AF1 in this cell line and by analyzing published data on human lung adenocarcinomas, we show that S34F-associated changes in alternative splicing are proportional to the ratio of S34F:wild-type gene products and not to absolute levels of either the mutant or wild-type factor. Preferential recognition of specific 3′ splice sites in S34F-expressing cells is largely explained by differential in vitro RNA-binding affinities of mutant versus wild-type U2AF1 for those same 3′ splice sites. Finally, we show that lung adenocarcinoma cell lines bearing U2AF1 mutations do not require the mutant protein for growth in vitro or in vivo. In contrast, wild-type U2AF1 is required for survival, regardless of whether cells carry the U2AF1S34F allele. Our results provide mechanistic explanations of the magnitude of splicing changes observed in U2AF1-mutant cells and why tumors harboring U2AF1 mutations always retain an expressed copy of the wild-type allele. PMID:27776121

Mutations of NOTCH3 in childhood pulmonary arterial hypertension

PubMed Central

Chida, Ayako; Shintani, Masaki; Matsushita, Yoshihisa; Sato, Hiroki; Eitoku, Takahiro; Nakayama, Tomotaka; Furutani, Yoshiyuki; Hayama, Emiko; Kawamura, Yoichi; Inai, Kei; Ohtsuki, Shinichi; Saji, Tsutomu; Nonoyama, Shigeaki; Nakanishi, Toshio

2014-01-01

Mutations of BMPR2 and other TGF-β superfamily genes have been reported in pulmonary arterial hypertension (PAH). However, 60–90% of idiopathic PAH cases have no mutations in these genes. Recently, the expression of NOTCH3 was shown to be increased in the pulmonary artery smooth muscle cells of PAH patients. We sought to investigate NOTCH3 and its target genes in PAH patients and clarify the role of NOTCH3 signaling. We screened for mutations in NOTCH3, HES1, and HES5 in 41 PAH patients who had no mutations in BMPR2, ALK1, endoglin, SMAD1/4/8, BMPR1B, or Caveolin-1. Two novel missense mutations (c.2519 G>A p.G840E, c.2698 A>C p.T900P) in NOTCH3 were identified in two PAH patients. We performed functional analysis using stable cell lines expressing either wild-type or mutant NOTCH3. The protein-folding chaperone GRP78/BiP was colocalized with wild-type NOTCH3 in the endoplasmic reticulum, whereas the majority of GRP78/BiP was translocated into the nuclei of cells expressing mutant NOTCH3. Cell proliferation and viability were higher for cells expressing mutant NOTCH3 than for those expressing wild-type NOTCH3. We identified novel NOTCH3 mutations in PAH patients and revealed that these mutations were involved in cell proliferation and viability. NOTCH3 mutants induced an impairment in NOTCH3-HES5 signaling. The results may contribute to the elucidation of PAH pathogenesis. PMID:24936512

The Product of the fimI Gene Is Necessary for Escherichia coli Type 1 Pilus Biosynthesis

PubMed Central

Valenski, Mary L.; Harris, Sandra L.; Spears, Patricia A.; Horton, John R.; Orndorff, Paul E.

2003-01-01

Site-directed mutagenesis was employed to create lesions in fimI, a gene of uncertain function located in the chromosomal gene cluster (fim) involved in Escherichia coli type 1 pilus biosynthesis. Chromosomal fimI mutations produced a piliation-negative phenotype. Complementation analysis indicated that a fimI′-kan insertion mutation and a fimI frameshift mutation produced polarity-like effects not seen with an in-frame fimI deletion mutation. Minicell analysis associated fimI with a 16.4-kDa noncytoplasmic protein product (FimI). We conclude that FimI has a required role in normal pilus biosynthesis. PMID:12897022

Clinical implications of mutation analysis in primary hyperoxaluria type 1.

PubMed

van Woerden, Christiaan S; Groothoff, Jaap W; Wijburg, Frits A; Annink, Carla; Wanders, Ronald J A; Waterham, Hans R

2004-08-01

Primary hyperoxaluria type 1 (PH1) is an inborn error of glyoxylate metabolism with an extensive clinical and genetic heterogeneity. Although over 50 disease-causing mutations have been identified, the relationship between genotype and clinical outcome remains unclear. The aim of this study was to determine this association in order to find clues for improvement of patient care. AGXT mutation analysis and assessment of biochemical characteristics and clinical outcome were performed on patients from a Dutch PH1 cohort. Thirty-three of a cohort of 57 PH1 patients, identified in The Netherlands over a period of 30 years, were analyzed. Ten different mutations were found. The most common mutations were the Gly170Arg, Phe152Ile, and the 33insC mutations, with an allele frequency of 43%, 19%, and 15%, respectively. Homozygous Gly170Arg and Phe152Ile mutations were associated with pyridoxine responsiveness and a preserved renal function over time when treatment was timely initiated. All patients homozygous for the 33insC mutation had end-stage renal disease (ESRD) before the first year of age. In two unrelated patients, a new Val336Asp mutation was found coupled with the Gly170Arg mutation on the minor allele. We also found 3 patients homozygous for a novel Gly82Arg mutation with adverse outcome in 2 of them. Early detection of Gly170Arg and Phe152Ile mutations in PH1 has important clinical implications because of their association with pyridoxine responsiveness and clinical outcome. The association of a homozygous 33insC mutation with severe infantile ESRD, resulting in early deaths in 2 out of 3 cases, warrants a choice for prenatal diagnostics in affected families.

Pediatric-type nodal follicular lymphoma: a biologically distinct lymphoma with frequent MAPK pathway mutations

PubMed Central

Schafernak, Kristian T.; Geyer, Julia T.; Kovach, Alexandra E.; Ghandi, Mahmoud; Gratzinger, Dita; Roth, Christine G.; Paxton, Christian N.; Kim, Sunhee; Namgyal, Chungdak; Morin, Ryan; Morgan, Elizabeth A.; Neuberg, Donna S.; South, Sarah T.; Harris, Marian H.; Hasserjian, Robert P.; Hochberg, Ephraim P.; Garraway, Levi A.; Harris, Nancy Lee; Weinstock, David M.

2016-01-01

Pediatric-type nodal follicular lymphoma (PTNFL) is a variant of follicular lymphoma (FL) characterized by limited-stage presentation and invariably benign behavior despite often high-grade histological appearance. It is important to distinguish PTNFL from typical FL in order to avoid unnecessary treatment; however, this distinction relies solely on clinical and pathological criteria, which may be variably applied. To define the genetic landscape of PTNFL, we performed copy number analysis and exome and/or targeted sequencing of 26 PTNFLs (16 pediatric and 10 adult). The most commonly mutated gene in PTNFL was MAP2K1, encoding MEK1, with a mutation frequency of 43%. All MAP2K1 mutations were activating missense mutations localized to exons 2 and 3, which encode negative regulatory and catalytic domains, respectively. Missense mutations in MAPK1 (2/22) and RRAS (1/22) were identified in cases that lacked MAP2K1 mutations. The second most commonly mutated gene in PTNFL was TNFRSF14, with a mutation frequency of 29%, similar to that seen in limited-stage typical FL (P = .35). PTNFL was otherwise genomically bland and specifically lacked recurrent mutations in epigenetic modifiers (eg, CREBBP, KMT2D). Copy number aberrations affected a mean of only 0.5% of PTNFL genomes, compared with 10% of limited-stage typical FL genomes (P < .02). Importantly, the mutational profiles of PTNFLs in children and adults were highly similar. Together, these findings define PTNFL as a biologically and clinically distinct indolent lymphoma of children and adults characterized by a high prevalence of MAPK pathway mutations and a near absence of mutations in epigenetic modifiers. PMID:27325104

Pediatric-type nodal follicular lymphoma: a biologically distinct lymphoma with frequent MAPK pathway mutations.

PubMed

Louissaint, Abner; Schafernak, Kristian T; Geyer, Julia T; Kovach, Alexandra E; Ghandi, Mahmoud; Gratzinger, Dita; Roth, Christine G; Paxton, Christian N; Kim, Sunhee; Namgyal, Chungdak; Morin, Ryan; Morgan, Elizabeth A; Neuberg, Donna S; South, Sarah T; Harris, Marian H; Hasserjian, Robert P; Hochberg, Ephraim P; Garraway, Levi A; Harris, Nancy Lee; Weinstock, David M

2016-08-25

Pediatric-type nodal follicular lymphoma (PTNFL) is a variant of follicular lymphoma (FL) characterized by limited-stage presentation and invariably benign behavior despite often high-grade histological appearance. It is important to distinguish PTNFL from typical FL in order to avoid unnecessary treatment; however, this distinction relies solely on clinical and pathological criteria, which may be variably applied. To define the genetic landscape of PTNFL, we performed copy number analysis and exome and/or targeted sequencing of 26 PTNFLs (16 pediatric and 10 adult). The most commonly mutated gene in PTNFL was MAP2K1, encoding MEK1, with a mutation frequency of 43%. All MAP2K1 mutations were activating missense mutations localized to exons 2 and 3, which encode negative regulatory and catalytic domains, respectively. Missense mutations in MAPK1 (2/22) and RRAS (1/22) were identified in cases that lacked MAP2K1 mutations. The second most commonly mutated gene in PTNFL was TNFRSF14, with a mutation frequency of 29%, similar to that seen in limited-stage typical FL (P = .35). PTNFL was otherwise genomically bland and specifically lacked recurrent mutations in epigenetic modifiers (eg, CREBBP, KMT2D). Copy number aberrations affected a mean of only 0.5% of PTNFL genomes, compared with 10% of limited-stage typical FL genomes (P < .02). Importantly, the mutational profiles of PTNFLs in children and adults were highly similar. Together, these findings define PTNFL as a biologically and clinically distinct indolent lymphoma of children and adults characterized by a high prevalence of MAPK pathway mutations and a near absence of mutations in epigenetic modifiers. © 2016 by The American Society of Hematology.

Topographic Map of the West Candor Chasma Region of Mars, MTM 500k -05/282E OMKT

USGS Publications Warehouse

,

2004-01-01

This map, compiled photogrammetrically from Viking Orbiter stereo image pairs, is part of a series of topographic maps of areas of special scientific interest on Mars. The figure of Mars used for the computation of the map projection is an oblate spheroid (flattening of 1/176.875) with an equatorial radius of 3396.0 km and a polar radius of 3376.8 km. The datum (the 0-km contour line) for elevations is defined as the equipotential surface (gravitational plus rotational) whose average value at the equator is equal to the mean radius as determined by Mars Orbiter Laser Altimeter. The projection is part of a Mars Transverse Mercator (MTM) system with 20? wide zones. For the area covered by this map sheet the central meridian is at 290? E. (70? W.). The scale factor at the central meridian of the zone containing this quadrangle is 0.9960 relative to a nominal scale of 1:500,000. Longitude increases to the east and latitude is planetocentric as allowed by IAU/IAG standards and in accordance with current NASA and USGS standards. A secondary grid (printed in red) has been added to the map as a reference to the west longitude/planetographic latitude system that is also allowed by IAU/IAG standards and has been used for previous Mars maps.

Topographic Map of the Ophir and Central Candor Chasmata Region of Mars MTM 500k -05/287E OMKT

USGS Publications Warehouse

,

2004-01-01

This map, compiled photogrammetrically from Viking Orbiter stereo image pairs, is part of a series of topographic maps of areas of special scientific interest on Mars. The figure of Mars used for the computation of the map projection is an oblate spheroid (flattening of 1/176.875) with an equatorial radius of 3396.0 km and a polar radius of 3376.8 km. The datum (the 0-km contour line) for elevations is defined as the equipotential surface (gravitational plus rotational) whose average value at the equator is equal to the mean radius as determined by Mars Orbiter Laser Altimeter. The projection is part of a Mars Transverse Mercator (MTM) system with 20? wide zones. For the area covered by this map sheet the central meridian is at 290? E. (70? W.). The scale factor at the central meridian of the zone containing this quadrangle is 0.9960 relative to a nominal scale of 1:500,000. Longitude increases to the east and latitude is planetocentric as allowed by IAU/IAG standards and in accordance with current NASA and USGS standards. A secondary grid (printed in red) has been added to the map as a reference to the west longitude/planetographic latitude system that is also allowed by IAU/IAG standards and has been used for previous Mars maps.

Topographic map of the Tithonium Chasma Region of Mars, MTM 500k -05/277E OMKT

USGS Publications Warehouse

,

2004-01-01

This map, compiled photogrammetrically from Viking Orbiter stereo image pairs, is part of a series of topographic maps of areas of special scientific interest on Mars. The figure of Mars used for the computation of the map projection is an oblate spheroid (flattening of 1/176.875) with an equatorial radius of 3396.0 km and a polar radius of 3376.8 km. The datum (the 0-km contour line) for elevations is defined as the equipotential surface (gravitational plus rotational) whose average value at the equator is equal to the mean radius as determined by Mars Orbiter Laser Altimeter. The projection is part of a Mars Transverse Mercator (MTM) system with 20? wide zones. For the area covered by this map sheet the central meridian is at 270? E. (70? W.). The scale factor at the central meridian of the zone containing this quadrangle is 0.9960 relative to a nominal scale of 1:500,000. Longitude increases to the east and latitude is planetocentric as allowed by IAU/IAG standards and in accordance with current NASA and USGS standards. A secondary grid (printed in red) has been added to the map as a reference to the west longitude/planetographic latitude system that is also allowed by IAU/IAG standards and has been used for previous Mars maps.

Topographic map of the Parana Valles region of Mars MTM 500k -25/337E OMKT

USGS Publications Warehouse

,

2003-01-01

This map, compiled photogrammetrically from Viking Orbiter stereo image pairs, is part of a series of topographic maps of areas of special scientific interest on Mars. MTM 500k –25/347E OMKT: Abbreviation for Mars Transverse Mercator; 1:500,000 series; center of sheet latitude 25° S., longitude 347.5° E. in planetocentric coordinate system (this corresponds to –25/012; latitude 25° S., longitude 12.5° W. in planetographic coordinate system); orthophotomosaic (OM) with color coded (K) topographic contours and nomenclature (T) [Greeley and Batson, 1990]. The figure of Mars used for the computation of the map projection is an oblate spheroid (flattening of 1/176.875) with an equatorial radius of 3396.0 km and a polar radius of 3376.8 km (Kirk and others, 2000). The datum (the 0-km contour line) for elevations is defined as the equipotential surface (gravitational plus rotational) whose average value at the equator is equal to the mean radius as determined by Mars Orbiter Laser Altimeter (Smith and others, 2001). The image base for this map employs Viking Orbiter images from orbit 651. An orthophotomosaic was created on the digital photogrammetric workstation using the DTM compiled from stereo models. Integrated Software for Imagers and Spectrometers (ISIS) (Torson and Becker, 1997) provided the software to project the orthophotomosaic into the Transverse Mercator Projection.

Topographic Map of the Northwest Loire Valles Region of Mars MTM 500k -15/337E OMKT

USGS Publications Warehouse

,

2003-01-01

This map, compiled photogrammetrically from Viking Orbiter stereo image pairs, is part of a series of topographic maps of areas of special scientific interest on Mars. MTM 500k –15/337E OMKT: Abbreviation for Mars Transverse Mercator; 1:500,000 series; center of sheet latitude 15° S., longitude 337.5° E. in planetocentric coordinate system (this corresponds to –15/022; latitude 15° S., longitude 22.5° W. in planetographic coordinate system); orthophotomosaic (OM) with color coded (K) topographic contours and nomenclature (T) [Greeley and Batson, 1990]. The figure of Mars used for the computation of the map projection is an oblate spheroid (flattening of 1/176.875) with an equatorial radius of 3396.0 km and a polar radius of 3376.8 km (Kirk and others, 2000). The datum (the 0–km contour line) for elevations is defined as the equipotential surface (gravitational plus rotational) whose average value at the equator is equal to the mean radius as determined by Mars Orbiter Laser Altimeter (Smith and others, 2001). The image base for this map employs Viking Orbiter images from orbit 651. An orthophotomosaic was created on the digital photogrammetric workstation using the DTM compiled from stereo models. Integrated Software for Imagers and Spectrometers (ISIS) (Torson and Becker, 1997) provided the software to project the orthophotomosaic into the Transverse Mercator Projection.

[Study of gene mutation in 62 hemophilia A children].

PubMed

Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

2017-11-02

Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense mutation; the most frequent gene mutation in medium hemophilia A is missense mutation.

Circulating ghrelin level is higher in HNF1A-MODY and GCK-MODY than in polygenic forms of diabetes mellitus.

PubMed

Nowak, Natalia; Hohendorff, Jerzy; Solecka, Iwona; Szopa, Magdalena; Skupien, Jan; Kiec-Wilk, Beata; Mlynarski, Wojciech; Malecki, Maciej T

2015-12-01

Ghrelin is a hormone that regulates appetite. It is likely to be involved in the pathophysiology of varying forms of diabetes. In animal studies, the ghrelin expression was regulated by the hepatocyte nuclear factor 1 alpha (HNF1A). Mutations of the HNF1A gene cause maturity onset diabetes of the young (MODY). We aimed to assess the circulating ghrelin levels in HNF1A-MODY and in other types of diabetes and to evaluate its association with HNF1A mutation status. Our cohort included 46 diabetic HNF1A gene mutation carriers, 55 type 2 diabetes (T2DM) subjects, 42 type 1 diabetes (T1DM) patients, and 31 glucokinase (GCK) gene mutation carriers with diabetes as well as 51 healthy controls. Plasma ghrelin concentration was measured using the immunoenzymatic assay with polyclonal antibody against the C-terminal fragment of its acylated and desacylated forms. Ghrelin concentrations were 0.75 ± 0.32, 0.70 ± 0.21, 0.50 ± 0.20, and 0.40 ± 0.16 ng/ml in patients with HNF1A-MODY, GCK-MODY, T1DM, and T2DM, respectively. The ghrelin levels were higher in HNF1A-MODY and GCK-MODY than in T1DM and T2DM (p < 0.001 for all comparisons) but lower than in non-diabetic controls (1.02 ± 0.29 ng/ml, p < 0.001 for both comparisons). In the multivariate linear model, the differences between both MODY groups and common diabetes types remained significant. Analysis by a HNF1A mutation type indicated that ghrelin concentration is similar in patients with different types of sequence differences. Plasma ghrelin level is higher in HNF1A-MODY and GCK-MODY than in the common polygenic forms of diabetes.

[Spinocerebellar ataxias in infancy: pathogenesis of potassium and calcium channels' diseases, clinical features and therapeutical approach].

PubMed

Bozzola, E; Savasta, S; Peruzzi, C; Bozzola, M; Bona, G

2007-04-01

In infancy, the autosomal dominant inherited ataxias are severe neurological diseases, due to inherited mutations of ion channels. The main forms are: episodic ataxia type 1 (EA1), episodic ataxia type 2 (EA2), spinocerebellar ataxia type 6 (SCA6). EA1 is due to a mutation in KCNA1, the gene encoding human Kv1.1 on chromosome 12p13, which contributes as a subunit to the formation of potassium channels in motor nerve terminals and in many central nervous system neurones. To date, there are fifteen different mutations, which affect potassium channel's properties and lead to phenotypic variability and to different responses to therapy. EA2 can result from mutations in the CACNA1A gene, encoding calcium channels on chromosome 19p13.1 and widely distributed throughout the central nervous system. To date, associated with EA2, in the CACNA1A gene thirty different mutations have been described, resulting in altered or truncated protein products and, as a consequence, in nonfunctional calcium channels. There is phenotypic variability, also inside the same family, without correlation genotype-phenotype. SCA6 is a progressive neurodegenerative disease due to mutations of the CACNA1A gene. CACNA1A is responsible for both EA2 and SCA6. Nevertheless, the pathogenesis of the two diseases is different: SCA6 is associated with small expansion of a CAGn repeat, while EA2 is due to point mutations. Clinically, SCA6 is characterized by a slowly progressive development and by an inverse correlation between the number of repeats and the severity of the disease.

Neurofibromatosis type 1 molecular diagnosis: what can NGS do for you when you have a large gene with loss of function mutations?

PubMed Central

Pasmant, Eric; Parfait, Béatrice; Luscan, Armelle; Goussard, Philippe; Briand-Suleau, Audrey; Laurendeau, Ingrid; Fouveaut, Corinne; Leroy, Chrystel; Montadert, Annelore; Wolkenstein, Pierre; Vidaud, Michel; Vidaud, Dominique

2015-01-01

Molecular diagnosis of neurofibromatosis type 1 (NF1) is challenging owing to the large size of the tumour suppressor gene NF1, and the lack of mutation hotspots. A somatic alteration of the wild-type NF1 allele is observed in NF1-associated tumours. Genetic heterogeneity in NF1 was confirmed in patients with SPRED1 mutations. Here, we present a targeted next-generation sequencing (NGS) of NF1 and SPRED1 using a multiplex PCR approach (230 amplicons of ∼150 bp) on a PGM sequencer. The chip capacity allowed mixing 48 bar-coded samples in a 4-day workflow. We validated the NGS approach by retrospectively testing 30 NF1-mutated samples, and then prospectively analysed 279 patients in routine diagnosis. On average, 98.5% of all targeted bases were covered by at least 20X and 96% by at least 100X. An NF1 or SPRED1 alteration was found in 246/279 (88%) and 10/279 (4%) patients, respectively. Genotyping throughput was increased over 10 times, as compared with Sanger, with ∼90€ for consumables per sample. Interestingly, our targeted NGS approach also provided quantitative information based on sequencing depth allowing identification of multiexons deletion or duplication. We then addressed the NF1 somatic mutation detection sensitivity in mosaic NF1 patients and tumours. PMID:25074460

Novel nonnucleoside inhibitors that select nucleoside inhibitor resistance mutations in human immunodeficiency virus type 1 reverse transcriptase.

PubMed

Zhang, Zhijun; Walker, Michelle; Xu, Wen; Shim, Jae Hoon; Girardet, Jean-Luc; Hamatake, Robert K; Hong, Zhi

2006-08-01

Mutations in and around the catalytic site of the reverse transcriptase (RT) of human immunodeficiency virus type 1 (HIV-1) are associated with resistance to nucleoside RT inhibitors (NRTIs), whereas changes in the hydrophobic pocket of the RT are attributed to nonnucleoside RT inhibitor (NNRTI) resistance. In this study, we report a novel series of nonnucleoside inhibitors of HIV-1, exemplified by VRX-329747 and VRX-413638, which inhibit both NNRTI- and NRTI-resistant HIV-1 isolates. Enzymatic studies indicated that these compounds are HIV-1 RT inhibitors. Surprisingly, however, following prolonged (6 months) tissue culture selection, this series of nonnucleoside inhibitors did not select NNRTI-resistant mutations in HIV-1 RT. Rather, four mutations (M41L, A62T/V, V118I, and M184V) known to cause resistance to NRTIs and two additional novel mutations (S68N and G112S) adjacent to the catalytic site of the enzyme were selected. Although the M184V mutation appears to be the initial mutation to establish resistance, this mutation alone confers only a two- to fourfold decrease in susceptibility to VRX-329747 and VRX-413638. At least two additional mutations must accumulate for significant resistance. Moreover, while VRX-329747-selected viruses are resistant to lamivudine and emtricitabine due to the M184V mutation, they remain susceptible to zidovudine, stavudine, dideoxyinosine, abacavir, tenofovir, and efavirenz. These results directly demonstrate that VRX-329747 and VRX-413638 are novel nonnucleoside inhibitors of HIV-1 RT with the potential to augment current therapies.

Novel Nonnucleoside Inhibitors That Select Nucleoside Inhibitor Resistance Mutations in Human Immunodeficiency Virus Type 1 Reverse Transcriptase

PubMed Central

Zhang, Zhijun; Walker, Michelle; Xu, Wen; Shim, Jae Hoon; Girardet, Jean-Luc; Hamatake, Robert K.; Hong, Zhi

2006-01-01

Mutations in and around the catalytic site of the reverse transcriptase (RT) of human immunodeficiency virus type 1 (HIV-1) are associated with resistance to nucleoside RT inhibitors (NRTIs), whereas changes in the hydrophobic pocket of the RT are attributed to nonnucleoside RT inhibitor (NNRTI) resistance. In this study, we report a novel series of nonnucleoside inhibitors of HIV-1, exemplified by VRX-329747 and VRX-413638, which inhibit both NNRTI- and NRTI-resistant HIV-1 isolates. Enzymatic studies indicated that these compounds are HIV-1 RT inhibitors. Surprisingly, however, following prolonged (6 months) tissue culture selection, this series of nonnucleoside inhibitors did not select NNRTI-resistant mutations in HIV-1 RT. Rather, four mutations (M41L, A62T/V, V118I, and M184V) known to cause resistance to NRTIs and two additional novel mutations (S68N and G112S) adjacent to the catalytic site of the enzyme were selected. Although the M184V mutation appears to be the initial mutation to establish resistance, this mutation alone confers only a two- to fourfold decrease in susceptibility to VRX-329747 and VRX-413638. At least two additional mutations must accumulate for significant resistance. Moreover, while VRX-329747-selected viruses are resistant to lamivudine and emtricitabine due to the M184V mutation, they remain susceptible to zidovudine, stavudine, dideoxyinosine, abacavir, tenofovir, and efavirenz. These results directly demonstrate that VRX-329747 and VRX-413638 are novel nonnucleoside inhibitors of HIV-1 RT with the potential to augment current therapies. PMID:16870771

Functional characterisation of the type 1 von Willebrand disease candidate VWF gene variants: p.M771I, p.L881R and p.P1413L

PubMed Central

Berber, Ergul; Ozbil, Mehmet; Brown, Christine; Baslar, Zafer; Caglayan, S. Hande; Lillicrap, David

2017-01-01

Background Abnormalities in the biosynthetic pathway or increased clearance of plasma von Willebrand factor (VWF) are likely to contribute to decreased plasma VWF levels in inherited type 1 von Willebrand disease (VWD). Recent studies demonstrated that 65% of type 1 VWD patients have candidate VWF mutations, the majority of which are missense variants. The purpose of this study was to explore the effects of three VWF missense mutations (p.M771I, p.L881R and p.P1413L) located in different functional domains of VWF, reported as candidate mutations in type 1 VWD patients in the course of the MCMDM-1VWD study. Materials and methods The focus of these studies was on the intracellular biosynthetic processing and localisation of VWF in a heterologous cell system. Molecular dynamic simulation for p.M771I and p.P1413L was also performed to analyse the conformational effects of the changes. Results As determined by immunofluorescence antibody staining and confocal microscopy of HEK293 cells, the intracellular localisation of recombinant VWF with the p.M771I variation was impaired. Transient transfection studies and phorbol myristate acetate stimulation in COS-7 cells revealed significant intracellular retention. In addition, major loss of VWF multimers was observed for only the p.M771I mutation. Molecular dynamic simulations on p.M771I mutant VWF revealed distinct structural rearrangements including a large deviation in the E’ domain, and significant loss of β-sheet secondary structure. Discussion The pathogenic effects of candidate VWF gene mutations were explored in this study. In vitro expression studies in heterologous cell systems revealed impaired secretion of VWF and a dominant negative effect on the processing of the wild-type protein for only the p.M771I mutation and none of the mutations affected the regulated secretion. PMID:27483487

Functional characterisation of the type 1 von Willebrand disease candidate VWF gene variants: p.M771I, p.L881R and p.P1413L.

PubMed

Berber, Ergul; Ozbil, Mehmet; Brown, Christine; Baslar, Zafer; Caglayan, S Hande; Lillicrap, David

2017-10-01

Abnormalities in the biosynthetic pathway or increased clearance of plasma von Willebrand factor (VWF) are likely to contribute to decreased plasma VWF levels in inherited type 1 von Willebrand disease (VWD). Recent studies demonstrated that 65% of type 1 VWD patients have candidate VWF mutations, the majority of which are missense variants. The purpose of this study was to explore the effects of three VWF missense mutations (p.M771I, p.L881R and p.P1413L) located in different functional domains of VWF, reported as candidate mutations in type 1 VWD patients in the course of the MCMDM-1VWD study. The focus of these studies was on the intracellular biosynthetic processing and localisation of VWF in a heterologous cell system. Molecular dynamic simulation for p.M771I and p.P1413L was also performed to analyse the conformational effects of the changes. As determined by immunofluorescence antibody staining and confocal microscopy of HEK293 cells, the intracellular localisation of recombinant VWF with the p.M771I variation was impaired. Transient transfection studies and phorbol myristate acetate stimulation in COS-7 cells revealed significant intracellular retention. In addition, major loss of VWF multimers was observed for only the p.M771I mutation. Molecular dynamic simulations on p.M771I mutant VWF revealed distinct structural rearrangements including a large deviation in the E' domain, and significant loss of β-sheet secondary structure. The pathogenic effects of candidate VWF gene mutations were explored in this study. In vitro expression studies in heterologous cell systems revealed impaired secretion of VWF and a dominant negative effect on the processing of the wild-type protein for only the p.M771I mutation and none of the mutations affected the regulated secretion.

Targeted Gene Next-Generation Sequencing in Chinese Children with Chronic Pancreatitis and Acute Recurrent Pancreatitis.

PubMed

Xiao, Yuan; Yuan, Wentao; Yu, Bo; Guo, Yan; Xu, Xu; Wang, Xinqiong; Yu, Yi; Yu, Yi; Gong, Biao; Xu, Chundi

2017-12-01

To identify causal mutations in certain genes in children with acute recurrent pancreatitis (ARP) or chronic pancreatitis (CP). After patients were enrolled (CP, 55; ARP, 14) and their clinical characteristics were investigated, we performed next-generation sequencing to detect nucleotide variations among the following 10 genes: cationic trypsinogen protease serine 1 (PRSS1), serine protease inhibitor, Kazal type 1 (SPINK1), cystic fibrosis transmembrane conductance regulator gene (CFTR), chymotrypsin C (CTRC), calcium-sensing receptor (CASR), cathepsin B (CTSB), keratin 8 (KRT8), CLAUDIN 2 (CLDN2), carboxypeptidase A1 (CPA1), and ATPase type 8B member 1 (ATP8B1). Mutations were searched against online databases to obtain information on the cause of the diseases. Certain novel mutations were analyzed using the SIFT2 and Polyphen-2 to predict the effect on protein function. There were 45 patients with CP and 10 patients with ARP who harbored 1 or more mutations in these genes; 45 patients had at least 1 mutation related to pancreatitis. Mutations were observed in the PRSS1, SPINK1, and CFTR genes in 17 patients, the CASR gene in 5 patients, and the CTSB, CTRC, and KRT8 genes in 1 patient. Mutations were not found in the CLDN, CPA1, or ATP8B1 genes. We found that mutations in SPINK1 may increase the risk of pancreatic duct stones (OR, 11.07; P = .003). The patients with CFTR mutations had a higher level of serum amylase (316.0 U/L vs 92.5 U/L; P = .026). Mutations, especially those in PRSS1, SPINK1, and CFTR, accounted for the major etiologies in Chinese children with CP or ARP. Children presenting mutations in the SPINK1 gene may have a higher risk of developing pancreatic duct stones. Copyright © 2017 Elsevier Inc. All rights reserved.

Clinical, biochemical and molecular characterization of cystinuria in a cohort of 12 patients.

PubMed

Barbosa, M; Lopes, A; Mota, C; Martins, E; Oliveira, J; Alves, S; De Bonis, P; Mota, M do Céu; Dias, C; Rodrigues-Santos, P; Fortuna, A M; Quelhas, D; Lacerda, L; Bisceglia, L; Cardoso, M L

2012-01-01

Cystinuria is a rare autosomal inherited disorder characterized by impaired transport of cystine and dibasic aminoacids in the proximal renal tubule. Classically, cystinuria is classified as type I (silent heterozygotes) and non-type I (heterozygotes with urinary hyperexcretion of cystine). Molecularly, cystinuria is classified as type A (mutations on SLC3A1 gene) and type B (mutations on SLC7A9 gene). The goal of this study is to provide a comprehensive clinical, biochemical and molecular characterization of a cohort of 12 Portuguese patients affected with cystinuria in order to provide insight into genotype-phenotype correlations. We describe seven type I and five non-type I patients. Regarding the molecular classification, seven patients were type A and five were type B. In SLC3A1 gene, two large genomic rearrangements and 13 sequence variants, including four new variants c.611-2A>C; c.1136+44G>A; c.1597T (p.Y533N); c.*70A>G, were found. One large genomic rearrangement was found in SLC7A9 gene as well as 24 sequence variants including 3 novel variants: c.216C>T (p.C72C), c.1119G>A (p.S373S) and c.*82C>T. In our cohort the most frequent pathogenic mutations were: large rearrangements (33.3% of mutant alleles) and a missense mutation c.1400T>C (p.M467T) (11.1%). This report expands the spectrum of SLC3A1 and SLC7A9 mutations and provides guidance in the clinical implementation of molecular assays in routine genetic counseling of Portuguese patients affected with cystinuria. © 2011 John Wiley & Sons A/S.

Nagashima-type palmoplantar keratosis in a Chinese Han population

PubMed Central

Zhang, Jia; Zhang, Guolong; Ni, Cheng; Cheng, Ruhong; Liang, Jianying; Li, Ming; Yao, Zhirong

2016-01-01

Nagashima-type palmoplantar keratosis (NPPK) is an autosomal recessive form of palmoplantar keratoderma (PPK), which is caused by mutations in the SERPINB7 gene. NPPK has only been reported in Japanese and Chinese populations. The present study was conducted on 12 unrelated Chinese patients who were clinically predicted to suffer from NPPK. Mutation screening was performed by direct sequencing of the entire coding regions of SERPINB7, SLURP1, AQP5, CSTA, KRT1 and KRT9 genes. Direct sequencing of SERPINB7 revealed five homozygous founder mutations (c.796C>T) and four compound heterozygous mutations in nine patients, including one novel mutation (c.122_127delTGGTCC). Nine out of the 12 patients were diagnosed with NPPK due to SERPINB7 pathogenic mutations, and the results expanded the known mutation spectrum of NPPK. Taking the other seven reported Chinese patients, who had been definitively diagnosed with NPPK by genetic testing, into account, the present study further demonstrated that NPPK is a common entity in Mainland China, and c.796C>T is the most prevalent mutation and exerts a founder effect. Furthermore, the NPPK cases described in the current study presented a consistently mild phenotype, as compared with the degrees of phenotypic variability associated with other types of relatively severe PPK, including Mal de Meleda and Olmsted syndrome. PMID:27666198

Comparison of Thoracic Radiotherapy Efficacy Between Patients With and Without EGFR-mutated Lung Adenocarcinoma.

PubMed

Li, Ming-Hsien; Tsai, Jo-Ting; Ting, Lai-Lei; Lin, Jang-Chun; Liu, Yu-Chang

2018-01-01

To investigate the association between tumor response to thoracic radiotherapy and epidermal growth factor receptor (EGFR) mutation status in patients with lung adenocarcinoma, we collected 48 patients treated between January 2010 and December 2013. Of the 18 patients with EGFR mutation, 15 (83.3%) had a single mutation, and three (16.7%) had double mutation. Different EGFR mutation subtypes exhibited different responses to radiotherapy. The identified double EGFR mutations were associated with reduction of residual tumor burden (RTB) after radiotherapy. In univariate analysis, EGFR mutations in exon 18, 20, and 21 and double EGFR mutation were significant factors predicting RTB. In multivariate analysis, exon 20 mutation was the only significant factor. Patients with EGFR mutation seemed to have longer mean overall survival (OS) compared to the group with wild-type EGFR (31.1 vs. 26.6 months, p=0.49). The median and mean OS in patients with double EGFR mutation vs. wild-type EGFR were 20.1 vs. 16.9 months and 28.9 vs. 26.6 months, respectively. Further studies with larger sample size are warranted to clarify the association of EGFR mutation status with the lung tumor response after radiotherapy. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Appearance of Drug Resistance-Associated Mutations in Human Immunodeficiency Virus Type 1 CRF01_AE Integrase Derived from Drug-Naive Thai Patients.

PubMed

Isarangkura-Na-Ayuthaya, Panasda; Kaewnoo, Wiyada; Auwanit, Wattana; de Silva, U Chandimal; Ikuta, Kazuyoshi; Sawanpanyalert, Pathom; Kameoka, Masanori

2010-12-01

CRF01_AE is a major subtype of human immunodeficiency virus type 1 (HIV-1) circulating in Southeast Asia, including Thailand. We performed genotypic studies on HIV-1 CRF01_AE integrase derived from plasma samples from drug-naive Thai patients. Direct sequencing of amplified CRF01_AE integrase genes revealed that although no primary mutations associated with drug resistance to integrase inhibitors were detected, at least one secondary mutation was found in 96% of samples. Our results indicate that the impact of these mutations on the baseline drug susceptibility of CRF01_AE viruses to integrase inhibitors may need to be addressed prior to the introduction of these drugs in Southeast Asian countries, including Thailand.

Epidermal growth factor receptor gene mutation defines distinct subsets among small adenocarcinomas of the lung.

PubMed

Haneda, Hiroshi; Sasaki, Hidefumi; Shimizu, Shigeki; Endo, Katsuhiko; Suzuki, Eriko; Yukiue, Haruhiro; Kobayashi, Yoshihiro; Yano, Motoki; Fujii, Yoshitaka

2006-04-01

Epidermal growth factor receptor (EGFR) gene mutations are frequently detected in lung cancer, especially in adenocarcinoma, in females, and non-smoking patients. EGFR mutations are closely associated with clinical response to EGFR tyrosine kinase inhibitor. Bronchioloalveolar carcinoma (BAC) appearance is a good predictor of response to this agent. Noguchi et al. subdivided small peripheral adenocarcinoma of the lung into two groups. One group was characterized with tumor cell growth replacing the normal alveolar cells with varying degree of fibrosis (types A-C), and the other shows non-replacing and destructive growth (types D-F). Using probes for the 13 mutations which have been previously described, we have genotyped the EGFR gene status in surgically resected atypical adenomatous hyperplasias (AAH) and small peripheral adenocarcinomas up to 2 cm in diameter using TaqMan PCR assay. In 95 small-sized adenocarcinomas, the EGFR mutations were detected in 37 patients (38.9%), and no mutations were found in five AAHs. In small peripheral adenocarcinomas, EGFR mutations were found 47.1% of types A, B, or C adenocarcinomas; it was less frequent (16%) in Noguchi's types D, E or F adenocarcinomas. These results suggest that type D, F adenocarcinomas are not derived from the less malignant types A-C adenocarcinomas; rather, they have arisen de novo by distinct mechanisms. Although types A and B adenocarcinomas are almost 100% cured by surgery, some type C adenocarcinoma show lymph node metastasis and relapse. EGFR mutation analysis may help identify patients who will respond to treatment with tyrosine kinase inhibitors, e.g., gefitinib.

Mutational analysis of the myelin protein zero (MPZ) gene associated with Charcot-Marie-Tooth neuropathy type 1B

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roa, B.B.; Warner, L.E.; Lupski, J.R.

1994-09-01

The MPZ gene that maps to chromosome 1q22q23 encodes myelin protein zero, which is the most abundant peripheral nerve myelin protein that functions as a homophilic adhesion molecule in myelin compaction. Association of the MPZ gene with the dysmyelinating peripheral neuropathies Charcot-Marie-Tooth disease type 1B (CMT1B) and the more severe Dejerine-Sottas syndrome (DSS) was previously demonstrated by MPZ mutations identified in CMT1B and in rare DSS patients. In this study, the coding region of the MPZ gene was screened for mutations in a cohort of 74 unrelated patients with either CMT type 1 or DSS who do not carry themore » most common CMT1-associated molecular lesion of a 1.5 Mb DNA duplication on 17p11.2-p12. Heteroduplex analysis detected base mismatches in ten patients that were distributed over three exons of MPZ. Direct sequencing of PCR-amplified genomic DNA identified a de novo MPZ mutation associated with CMT1B that predicts an Ile(135)Thr substitution. This finding further confirms the role of MPZ in the CMT1B disease process. In addition, two polymorphisms were identified within the Gly(200) and Ser(228) codons that do not alter the respective amino acid residues. A fourth base mismatch in MPZ exon 3 detected by heteroduplex analysis is currently being characterized by direct sequence determination. Previously, four unrelated patients in this same cohort were found to have unique point mutations in the coding region of the PMP22 gene. The collective findings on CMT1 point mutations could suggest that regulatory region mutations, and possibly mutations in CMT gene(s) apart from the MPZ, PMP22 and Cx32 genes identified thus far, may prove to be significant for a number of CMT1 cases that do not involve DNA duplication.« less

IDH1/2 mutations target a key hallmark of cancer by deregulating cellular metabolism in glioma.

PubMed

Zhang, Chunzhi; Moore, Lynette M; Li, Xia; Yung, W K Alfred; Zhang, Wei

2013-09-01

Isocitrate dehydrogenase (IDH) enzymes have recently become a focal point for research aimed at understanding the biology of glioma. IDH1 and IDH2 are mutated in 50%-80% of astrocytomas, oligodendrogliomas, oligoastrocytomas, and secondary glioblastomas but are seldom mutated in primary glioblastomas. Gliomas with IDH1/2 mutations always harbor other molecular aberrations, such as TP53 mutation or 1p/19q loss. IDH1 and IDH2 mutations may serve as prognostic factors because patients with an IDH-mutated glioma survive significantly longer than those with an IDH-wild-type tumor. However, the molecular pathogenic role of IDH1/2 mutations in the development of gliomas is unclear. The production of 2-hydroxyglutarate and enhanced NADP+ levels in tumor cells with mutant IDH1/2 suggest mechanisms through which these mutations contribute to tumorigenesis. Elucidating the pathogenesis of IDH mutations will improve understanding of the molecular mechanisms of gliomagenesis and may lead to development of a new molecular classification system and novel therapies.

Analysis of full coding sequence of the TP53 gene in invasive vulvar cancers: Implications for therapy.

PubMed

Kashofer, Karl; Regauer, Sigrid

2017-08-01

This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years. DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry. 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas. 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers. Copyright © 2017. Published by Elsevier Inc.

Germline Mutation of INI1/SMARCB1 in Familial Schwannomatosis

PubMed Central

Hulsebos, Theo J. M.; Plomp, Astrid S.; Wolterman, Ruud A.; Robanus-Maandag, Els C.; Baas, Frank; Wesseling, Pieter

2007-01-01

Patients with schwannomatosis develop multiple schwannomas but no vestibular schwannomas diagnostic of neurofibromatosis type 2. We report an inactivating germline mutation in exon 1 of the tumor-suppressor gene INI1 in a father and daughter who both had schwannomatosis. Inactivation of the wild-type INI1 allele, by a second mutation in exon 5 or by clear loss, was found in two of four investigated schwannomas from these patients. All four schwannomas displayed complete loss of nuclear INI1 protein expression in part of the cells. Although the exact oncogenetic mechanism in these schwannomas remains to be elucidated, our findings suggest that INI1 is the predisposing gene in familial schwannomatosis. PMID:17357086

Structure of adenovirus bound to cellular receptor car

DOEpatents

Freimuth, Paul I.

2004-05-18

Disclosed is a mutant adenovirus which has a genome comprising one or more mutations in sequences which encode the fiber protein knob domain wherein the mutation causes the encoded viral particle to have significantly weakened binding affinity for CARD1 relative to wild-type adenovirus. Such mutations may be in sequences which encode either the AB loop, or the HI loop of the fiber protein knob domain. Specific residues and mutations are described. Also disclosed is a method for generating a mutant adenovirus which is characterized by a receptor binding affinity or specificity which differs substantially from wild type. In the method, residues of the adenovirus fiber protein knob domain which are predicted to alter D1 binding when mutated, are identified from the crystal structure coordinates of the AD12knob:CAR-D1 complex. A mutation which alters one or more of the identified residues is introduced into the genome of the adenovirus to generate a mutant adenovirus. Whether or not the mutant produced exhibits altered adenovirus-CAR binding properties is then determined.

Use of multivariate analysis to suggest a new molecular classification of colorectal cancer

PubMed Central

Domingo, Enric; Ramamoorthy, Rajarajan; Oukrif, Dahmane; Rosmarin, Daniel; Presz, Michal; Wang, Haitao; Pulker, Hannah; Lockstone, Helen; Hveem, Tarjei; Cranston, Treena; Danielsen, Havard; Novelli, Marco; Davidson, Brian; Xu, Zheng-Zhou; Molloy, Peter; Johnstone, Elaine; Holmes, Christopher; Midgley, Rachel; Kerr, David; Sieber, Oliver; Tomlinson, Ian

2013-01-01

Abstract Molecular classification of colorectal cancer (CRC) is currently based on microsatellite instability (MSI), KRAS or BRAF mutation and, occasionally, chromosomal instability (CIN). Whilst useful, these categories may not fully represent the underlying molecular subgroups. We screened 906 stage II/III CRCs from the VICTOR clinical trial for somatic mutations. Multivariate analyses (logistic regression, clustering, Bayesian networks) identified the primary molecular associations. Positive associations occurred between: CIN and TP53 mutation; MSI and BRAF mutation; and KRAS and PIK3CA mutations. Negative associations occurred between: MSI and CIN; MSI and NRAS mutation; and KRAS mutation, and each of NRAS, TP53 and BRAF mutations. Some complex relationships were elucidated: KRAS and TP53 mutations had both a direct negative association and a weaker, confounding, positive association via TP53–CIN–MSI–BRAF–KRAS. Our results suggested a new molecular classification of CRCs: (1) MSI+ and/or BRAF-mutant; (2) CIN+ and/or TP53– mutant, with wild-type KRAS and PIK3CA; (3) KRAS- and/or PIK3CA-mutant, CIN+, TP53-wild-type; (4) KRAS– and/or PIK3CA-mutant, CIN–, TP53-wild-type; (5) NRAS-mutant; (6) no mutations; (7) others. As expected, group 1 cancers were mostly proximal and poorly differentiated, usually occurring in women. Unexpectedly, two different types of CIN+ CRC were found: group 2 cancers were usually distal and occurred in men, whereas group 3 showed neither of these associations but were of higher stage. CIN+ cancers have conventionally been associated with all three of these variables, because they have been tested en masse. Our classification also showed potentially improved prognostic capabilities, with group 3, and possibly group 1, independently predicting disease-free survival. Copyright © 2012 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. PMID:23165447

Osteogenesis imperfecta type I: second-trimester diagnosis and incidental identification of a dominant COL1A1 deletion mutation in the paucisymptomatic father.

PubMed

Chen, Chih-Ping; Su, Yi-Ning; Chang, Tung-Yao; Chern, Schu-Rern; Chen, Chen-Yu; Su, Jun-Wei; Wang, Wayseen

2012-06-01

To present second-trimester ultrasound and molecular diagnosis for osteogenesis imperfecta (OI) type I in a female fetus and incidental identification of a dominant COL1A1 deletion mutation in her paucisymptomatic father. A 30-year-old, primigravid woman was referred for genetic counseling in the second trimester because of bowing of the fetal lower limbs. She and her husband were non-consanguineous, and there was no family history of skeletal dysplasias. Prenatal ultrasound at 22 weeks of gestation revealed short and curved right femur and left tibia, and a short left fibula. The lengths of other long bones were normal. The husband was 158 cm tall, had blue sclerae, a history of habitual subluxation and dislocation of bilateral elbows and left knee, and an episode of left ulna fracture, and was not aware of his being affected with OI type I. The woman underwent amniocentesis. Cytogenetic analysis revealed a karyotype of 46,XX. Molecular analysis of the amniocytes revealed a heterozygous deletion mutation of c.1064_1068delCTGGT in exon 17 of the COL1A1 gene. By genetic testing the husband was found to carry the same mutation. Despite counseling of favorable outcome for OI type I with the parents, the woman elected to terminate the pregnancy. Postnatal skeletal X-ray findings were consistent with OI type I. Prenatal ultrasound diagnosis of mild forms of OI should include molecular analysis of type I collagen genes in both fetus and parents. Molecular genetic analysis of the family may incidentally identify a collagen gene mutation in the paucisymptomatic affected parent. Copyright © 2012. Published by Elsevier B.V.

Population variability of the FimH type 1 fimbrial adhesin in Klebsiella pneumoniae.

PubMed

Stahlhut, Steen G; Chattopadhyay, Sujay; Struve, Carsten; Weissman, Scott J; Aprikian, Pavel; Libby, Stephen J; Fang, Ferric C; Krogfelt, Karen Angeliki; Sokurenko, Evgeni V

2009-03-01

FimH is an adhesive subunit of type 1 fimbriae expressed by different enterobacterial species. The enteric bacterium Klebsiella pneumoniae is an environmental organism that is also a frequent cause of sepsis, urinary tract infection (UTI), and liver abscess. Type 1 fimbriae have been shown to be critical for the ability of K. pneumoniae to cause UTI in a murine model. We show here that the K. pneumoniae fimH gene is found in 90% of strains from various environmental and clinical sources. The fimH alleles exhibit relatively low nucleotide and structural diversity but are prone to frequent horizontal-transfer events between different bacterial clones. Addition of the fimH locus to multiple-locus sequence typing significantly improved the resolution of the clonal structure of pathogenic strains, including the K1 encapsulated liver isolates. In addition, the K. pneumoniae FimH protein is targeted by adaptive point mutations, though not to the same extent as FimH from uropathogenic Escherichia coli or TonB from the same K. pneumoniae strains. Such adaptive mutations include a single amino acid deletion from the signal peptide that might affect the length of the fimbrial rod by affecting FimH translocation into the periplasm. Another FimH mutation (S62A) occurred in the course of endemic circulation of a nosocomial uropathogenic clone of K. pneumoniae. This mutation is identical to one found in a highly virulent uropathogenic strain of E. coli, suggesting that the FimH mutations are pathoadaptive in nature. Considering the abundance of type 1 fimbriae in Enterobacteriaceae, our present finding that fimH genes are subject to adaptive microevolution substantiates the importance of type 1 fimbria-mediated adhesion in K. pneumoniae.

Prevalence of ESR1 Mutations in Cell-Free DNA and Outcomes in Metastatic Breast Cancer: A Secondary Analysis of the BOLERO-2 Clinical Trial.

PubMed

Chandarlapaty, Sarat; Chen, David; He, Wei; Sung, Patricia; Samoila, Aliaksandra; You, Daoqi; Bhatt, Trusha; Patel, Parul; Voi, Maurizio; Gnant, Michael; Hortobagyi, Gabriel; Baselga, José; Moynahan, Mary Ellen

2016-10-01

Estrogen receptor α (ESR1) mutations found in metastatic breast cancer (MBC) promote ligand-independent receptor activation and resistance to estrogen-deprivation therapy in laboratory models. The prevalence of these mutations and their potential impact on clinical outcomes has not been established. To determine the prevalence of ESR1 mutations (Y537S and D538G) in estrogen receptor (ER)-positive MBC and determine whether mutation is associated with inferior outcomes. From December 16, 2014, to August 26, 2015, we analyzed cell-free DNA (cfDNA) from baseline plasma samples from participants in the BOLERO-2 double-blind phase 3 study that randomized patients from 189 centers in 24 countries with MBC to exemestane plus placebo or exemestane plus everolimus. The study enrolled postmenopausal women with a diagnosis of MBC and prior exposure to an aromatase inhibitor. Baseline plasma samples were available from 541 of 724 patients (74.7%). We assessed the effect of mutation on overall survival of the population and the effect of mutation on progression-free survival (PFS) by treatment arm. Patients were randomized to treatment with exemestane (25 mg oral daily) together with everolimus (10 mg oral daily) or with placebo. The 2 most frequent mutations in ESR1 (Y537S and D538G) were analyzed from cfDNA using droplet digital polymerase chain reaction and samples scored as wild-type, D538G, Y537S, or double mutant. Cox-proportional hazards model was used to assess PFS in patient subgroups defined by mutations, and the effect of each mutation on overall survival. Of 541 evaluable patients, 156 (28.8%) had ESR1 mutation D538G (21.1%) and/or Y537S (13.3%), and 30 had both. These mutations were associated with shorter overall survival (wild-type, 32.1 months [95% CI, 28.09-36.40 months]; D538G, 25.99 months [95% CI, 19.19-32.36 months]; Y537S, 19.98 months [13.01-29.31 months]; both mutations, 15.15 months [95% CI, 10.87-27.43 months]). The D538G group (hazard ratio, 0.34 [95% CI, 0.02-0.57]) derived a similar PFS benefit as wild type from addition of everolimus to exemestane. ESR1 mutations are prevalent in ER-positive aromatase inhibitor-treated MBC. Both Y537S and D538G mutations are associated with more aggressive disease biology. clinicaltrials.gov Identifier: NCT00863655.

Integration of remote blood glucose meter upload technology into a clinical pharmacist medication therapy management service.

PubMed

Schenk, Robert J; Schenk, Jenna

2011-01-01

A pharmacist-delivered, outpatient-focused medication therapy management (MTM) program is using a remote blood glucose (BG) meter upload device to provide better care and to improve outcomes for its patients with diabetes. Sharing uploaded BG meter data, presented in easily comprehensible graphs and charts, enables patients, caregivers, and the medical team to better understand how the patients' diabetes care is progressing. Pharmacists are becoming increasingly more active in helping to manage patients' complex medication regimens in an effort to help detect and avoid medication-related problems. Working together with patients and their physicians as part of an interdisciplinary health care team, pharmacists are helping to improve medication outcomes. This article focuses on two case studies highlighting the Diabetes Monitoring Program, one component of the Meridian Pharmacology Institute MTM service, and discusses the clinical application of a unique BG meter upload device. © 2010 Diabetes Technology Society.

Trajectory-based morphological operators: a model for efficient image processing.

PubMed

Jimeno-Morenilla, Antonio; Pujol, Francisco A; Molina-Carmona, Rafael; Sánchez-Romero, José L; Pujol, Mar

2014-01-01

Mathematical morphology has been an area of intensive research over the last few years. Although many remarkable advances have been achieved throughout these years, there is still a great interest in accelerating morphological operations in order for them to be implemented in real-time systems. In this work, we present a new model for computing mathematical morphology operations, the so-called morphological trajectory model (MTM), in which a morphological filter will be divided into a sequence of basic operations. Then, a trajectory-based morphological operation (such as dilation, and erosion) is defined as the set of points resulting from the ordered application of the instant basic operations. The MTM approach allows working with different structuring elements, such as disks, and from the experiments, it can be extracted that our method is independent of the structuring element size and can be easily applied to industrial systems and high-resolution images.

High-order rogue wave solutions of the classical massive Thirring model equations

NASA Astrophysics Data System (ADS)

Guo, Lijuan; Wang, Lihong; Cheng, Yi; He, Jingsong

2017-11-01

The nth-order solutions of the classical massive Thirring model (MTM) equations are derived by using the n-fold Darboux transformation. These solutions are expressed by the ratios of the two determinants consisted of 2n eigenfunctions under the reduction conditions. Using this method, rogue waves are constructed explicitly up to the third-order. Three patterns, i.e., fundamental, triangular and circular patterns, of the rogue waves are discussed. The parameter μ in the MTM model plays the role of the mass in the relativistic field theory while in optics it is related to the medium periodic constant, which also results in a significant rotation and a remarkable lengthening of the first-order rogue wave. These results provide new opportunities to observe rouge waves by using a combination of electromagnetically induced transparency and the Bragg scattering four-wave mixing because of large amplitudes.

In vitro and ex vivo suppression by aminoglycosides of PCDH15 nonsense mutations underlying type 1 Usher syndrome.

PubMed

Rebibo-Sabbah, Annie; Nudelman, Igor; Ahmed, Zubair M; Baasov, Timor; Ben-Yosef, Tamar

2007-11-01

Type 1 Usher syndrome (USH1) is a recessively inherited condition, characterized by profound prelingual deafness, vestibular areflexia, and prepubertal onset of retinitis pigmentosa (RP). While the auditory component of USH1 can be treated by cochlear implants, to date there is no effective treatment for RP. USH1 can be caused by mutations in each of at least six genes. While truncating mutations of these genes cause USH1, some missense mutations of the same genes cause nonsyndromic deafness. These observations suggest that partial or low level activity of the encoded proteins may be sufficient for normal retinal function, although not for normal hearing. In individuals with USH1 due to nonsense mutations, interventions enabling partial translation of a full-length functional protein may delay the onset and/or progression of RP. One such possible therapeutic approach is suppression of nonsense mutations by small molecules such as aminoglycosides. We decided to test this approach as a potential therapy for RP in USH1 patients due to nonsense mutations. We initially focused on nonsense mutations of the PCDH15 gene, underlying USH1F. Here, we show suppression of several PCDH15 nonsense mutations, both in vitro and ex vivo. Suppression was achieved both by commercial aminoglycosides and by NB30, a new aminoglycoside-derivative developed by us. NB30 has reduced cytotoxicity in comparison to commercial aminoglycosides, and thus may be more efficiently used for therapeutic purposes. The research described here has important implications for the development of targeted interventions that are effective for patients with USH1 caused by various nonsense mutations.

A vaccine targeting mutant IDH1 induces antitumour immunity.

PubMed

Schumacher, Theresa; Bunse, Lukas; Pusch, Stefan; Sahm, Felix; Wiestler, Benedikt; Quandt, Jasmin; Menn, Oliver; Osswald, Matthias; Oezen, Iris; Ott, Martina; Keil, Melanie; Balß, Jörg; Rauschenbach, Katharina; Grabowska, Agnieszka K; Vogler, Isabel; Diekmann, Jan; Trautwein, Nico; Eichmüller, Stefan B; Okun, Jürgen; Stevanović, Stefan; Riemer, Angelika B; Sahin, Ugur; Friese, Manuel A; Beckhove, Philipp; von Deimling, Andreas; Wick, Wolfgang; Platten, Michael

2014-08-21

Monoallelic point mutations of isocitrate dehydrogenase type 1 (IDH1) are an early and defining event in the development of a subgroup of gliomas and other types of tumour. They almost uniformly occur in the critical arginine residue (Arg 132) in the catalytic pocket, resulting in a neomorphic enzymatic function, production of the oncometabolite 2-hydroxyglutarate (2-HG), genomic hypermethylation, genetic instability and malignant transformation. More than 70% of diffuse grade II and grade III gliomas carry the most frequent mutation, IDH1(R132H) (ref. 3). From an immunological perspective, IDH1(R132H) represents a potential target for immunotherapy as it is a tumour-specific potential neoantigen with high uniformity and penetrance expressed in all tumour cells. Here we demonstrate that IDH1(R132H) contains an immunogenic epitope suitable for mutation-specific vaccination. Peptides encompassing the mutated region are presented on major histocompatibility complexes (MHC) class II and induce mutation-specific CD4(+) T-helper-1 (TH1) responses. CD4(+) TH1 cells and antibodies spontaneously occurring in patients with IDH1(R132H)-mutated gliomas specifically recognize IDH1(R132H). Peptide vaccination of mice devoid of mouse MHC and transgenic for human MHC class I and II with IDH1(R132H) p123-142 results in an effective MHC class II-restricted mutation-specific antitumour immune response and control of pre-established syngeneic IDH1(R132H)-expressing tumours in a CD4(+) T-cell-dependent manner. As IDH1(R132H) is present in all tumour cells of these slow-growing gliomas, a mutation-specific anti-IDH1(R132H) vaccine may represent a viable novel therapeutic strategy for IDH1(R132H)-mutated tumours.

Metastatic pancreatic adenocarcinoma associated with chronic calcific pancreatitis and a heterozygous SPINK1 N34S mutation.

PubMed

Moran, Robert A; Klapheke, Robert; Jalaly, Niloofar Y; Makary, Martin A; Hirose, Kenzo; Goggins, Michael; Wood, Laura; Laheru, Daniel A; Lennon, Anne Marie; Khashab, Mouen A; Singh, Vikesh K

2016-01-01

Contrary to patients with a cationic trypsinogen gene (PRSS1) mutations, Serine protease inhibitor Kazal-type 1 (SPINK1) heterozygote gene mutation carriers have a very low penetrance for acute, acute recurrent and/or chronic pancreatitis. Despite this, heterozygote SPINK 1 gene mutation patients have a similar age of onset of pancreatitis as PRSS 1 gene mutation patients. While the substantially elevated risk of pancreatic cancer in patients with PRSS1 gene mutations with chronic pancreatitis has been well established, little is known about the risk of pancreatic cancer in SPINK 1 gene mutation carriers with pancreatitis. We describe a case of malignant pancreatic cancer diagnosed in a young patient with chronic pancreatitis who is a SPINK 1 heterozygote gene mutation carrier. The risk of pancreatic cancer in gene mutation patients with chronic pancreatitis, in addition to screening options and management options for these patients is discussed. Copyright © 2016 IAP and EPC. Published by Elsevier B.V. All rights reserved.

PPIB mutations cause severe osteogenesis imperfecta.

PubMed

van Dijk, Fleur S; Nesbitt, Isabel M; Zwikstra, Eline H; Nikkels, Peter G J; Piersma, Sander R; Fratantoni, Silvina A; Jimenez, Connie R; Huizer, Margriet; Morsman, Alice C; Cobben, Jan M; van Roij, Mirjam H H; Elting, Mariet W; Verbeke, Jonathan I M L; Wijnaendts, Liliane C D; Shaw, Nick J; Högler, Wolfgang; McKeown, Carole; Sistermans, Erik A; Dalton, Ann; Meijers-Heijboer, Hanne; Pals, Gerard

2009-10-01

Deficiency of cartilage-associated protein (CRTAP) or prolyl 3-hydroxylase 1(P3H1) has been reported in autosomal-recessive lethal or severe osteogenesis imperfecta (OI). CRTAP, P3H1, and cyclophilin B (CyPB) form an intracellular collagen-modifying complex that 3-hydroxylates proline at position 986 (P986) in the alpha1 chains of collagen type I. This 3-prolyl hydroxylation is decreased in patients with CRTAP and P3H1 deficiency. It was suspected that mutations in the PPIB gene encoding CyPB would also cause OI with decreased collagen 3-prolyl hydroxylation. To our knowledge we present the first two families with recessive OI caused by PPIB gene mutations. The clinical phenotype is compatible with OI Sillence type II-B/III as seen with COL1A1/2, CRTAP, and LEPRE1 mutations. The percentage of 3-hydroxylated P986 residues in patients with PPIB mutations is decreased in comparison to normal, but it is higher than in patients with CRTAP and LEPRE1 mutations. This result and the fact that CyPB is demonstrable independent of CRTAP and P3H1, along with reported decreased 3-prolyl hydroxylation due to deficiency of CRTAP lacking the catalytic hydroxylation domain and the known function of CyPB as a cis-trans isomerase, suggest that recessive OI is caused by a dysfunctional P3H1/CRTAP/CyPB complex rather than by the lack of 3-prolyl hydroxylation of a single proline residue in the alpha1 chains of collagen type I.

Selected exonic sequencing of the AGXT gene provides a genetic diagnosis in 50% of patients with primary hyperoxaluria type 1.

PubMed

Williams, Emma; Rumsby, Gill

2007-07-01

Definitive diagnosis of primary hyperoxaluria type 1 (PH1) requires analysis of alanine:glyoxylate aminotransferase (AGT) activity in the liver. We have previously shown that targeted screening for the 3 most common mutations in the AGXT gene (c.33_34insC, c.508G>A, and c.731T>C) can provide a molecular diagnosis in 34.5% of PH1 patients, eliminating the need for a liver biopsy. Having reviewed the distribution of all AGXT mutations, we have evaluated a diagnostic strategy that uses selected exon sequencing for the molecular diagnosis of PH1. We sequenced exons 1, 4, and 7 for 300 biopsy-confirmed PH1 patients and expressed the identified missense mutations in vitro. Our identification of at least 1 mutation in 224 patients (75%) and 2 mutations in 149 patients increased the diagnostic sensitivity to 50%. We detected 29 kinds of sequence changes, 15 of which were novel. Four of these mutations were in exon 1 (c.2_3delinsAT, c.30_32delCC, c.122G>A, c.126delG), 7 were in exon 4 (c.447_454delGCTGCTGT, c.449T>C, c.473C>T, c.481G>A, c.481G>T, c.497T>C, c.424-2A>G), and 4 were in exon 7 (c.725insT, c.737G>A, c.757T>C, c.776 + 1G>A). The missense changes were associated with severely decreased AGT catalytic activity and negative immunoreactivity when expressed in vitro. Missense mutation c.26C>A, previously described as a pathological mutation, had activity similar to that of the wild-type enzyme. Selective exon sequencing can allow a definitive diagnosis in 50% of PH1 patients. The test offers a rapid turnaround time (15 days) with minimal risk to the patient. Demonstration of the expression of missense changes is essential to demonstrate pathogenicity.

Comparative chemical genomics reveal that the spiroindolone antimalarial KAE609 (Cipargamin) is a P-type ATPase inhibitor

PubMed Central

Goldgof, Gregory M.; Durrant, Jacob D.; Ottilie, Sabine; Vigil, Edgar; Allen, Kenneth E.; Gunawan, Felicia; Kostylev, Maxim; Henderson, Kiersten A.; Yang, Jennifer; Schenken, Jake; LaMonte, Gregory M.; Manary, Micah J.; Murao, Ayako; Nachon, Marie; Stanhope, Rebecca; Prescott, Maximo; McNamara, Case W.; Slayman, Carolyn W.; Amaro, Rommie E.; Suzuki, Yo; Winzeler, Elizabeth A.

2016-01-01

The spiroindolones, a new class of antimalarial medicines discovered in a cellular screen, are rendered less active by mutations in a parasite P-type ATPase, PfATP4. We show here that S. cerevisiae also acquires mutations in a gene encoding a P-type ATPase (ScPMA1) after exposure to spiroindolones and that these mutations are sufficient for resistance. KAE609 resistance mutations in ScPMA1 do not confer resistance to unrelated antimicrobials, but do confer cross sensitivity to the alkyl-lysophospholipid edelfosine, which is known to displace ScPma1p from the plasma membrane. Using an in vitro cell-free assay, we demonstrate that KAE609 directly inhibits ScPma1p ATPase activity. KAE609 also increases cytoplasmic hydrogen ion concentrations in yeast cells. Computer docking into a ScPma1p homology model identifies a binding mode that supports genetic resistance determinants and in vitro experimental structure-activity relationships in both P. falciparum and S. cerevisiae. This model also suggests a shared binding site with the dihydroisoquinolones antimalarials. Our data support a model in which KAE609 exerts its antimalarial activity by directly interfering with P-type ATPase activity. PMID:27291296

Allele-specific siRNA knockdown as a personalized treatment strategy for vascular Ehlers-Danlos syndrome in human fibroblasts.

PubMed

Müller, Gerd A; Hansen, Uwe; Xu, Zhi; Griswold, Benjamin; Talan, Mark I; McDonnell, Nazli B; Briest, Wilfried

2012-02-01

The vascular type of the Ehlers-Danlos syndrome (vEDS) is caused by dominant-negative mutations in the procollagen type III (COL3A1) gene. Patients with this autosomal dominant disorder have a shortened life expectancy due to complications from ruptured vessels or hollow organs. We tested the effectiveness of allele-specific RNA interference (RNAi) to reduce the mutated phenotype in fibroblasts. Small-interfering RNAs (siRNAs) discriminating between wild-type and mutant COL3A1 allele were identified by a luciferase reporter gene assay and in primary fibroblasts from a normal donor and a patient with vEDS. The best discriminative siRNA with the mutation at position 10 resulted in >90% silencing of the mutant allele without affecting the wild-type allele. Transmission and immunogold electron microscopy of extracted extracellular matrices from untreated fibroblasts of the patient with vEDS revealed structurally abnormal fibrils. After siRNA treatment, collagen fibrils became similar to fibrils from fibroblasts of normal and COL3A1 haploinsufficient donors. In addition, it was shown that expression of mutated COL3A1 activates the unfolded protein response and that reduction of the amount of mutated protein by siRNA reduces cellular stress. Taken together, the results provide evidence that allele-specific siRNAs are able to reduce negative effects of mutated COL3A1 proteins. Thus, the application of allele-specific RNAi may be a promising direction for future personalized therapies to reduce the severity of vEDS.

Static and dynamic 18F-FET PET for the characterization of gliomas defined by IDH and 1p/19q status.

PubMed

Verger, Antoine; Stoffels, Gabriele; Bauer, Elena K; Lohmann, Philipp; Blau, Tobias; Fink, Gereon R; Neumaier, Bernd; Shah, Nadim J; Langen, Karl-Josef; Galldiks, Norbert

2018-03-01

The molecular features isocitrate dehydrogenase (IDH) mutation and 1p/19q co-deletion have gained major importance for both glioma typing and prognosis and have, therefore, been integrated in the World Health Organization (WHO) classification in 2016. The aim of this study was to characterize static and dynamic O-(2- 18 F-fluoroethyl)-L-tyrosine ( 18 F-FET) PET parameters in gliomas with or without IDH mutation or 1p/19q co-deletion. Ninety patients with newly diagnosed and untreated gliomas with a static and dynamic 18 F-FET PET scan prior to evaluation of tumor tissue according to the 2016 WHO classification were identified retrospectively. Mean and maximum tumor-to-brain ratios (TBR mean/max ), as well as dynamic parameters (time-to-peak and slope) of 18 F-FET uptake were calculated. Sixteen (18%) oligodendrogliomas (IDH mutated, 1p/19q co-deleted), 27 (30%) astrocytomas (IDH mutated only), and 47 (52%) glioblastomas (IDH wild type only) were identified. TBR mean , TBR max , TTP and slope discriminated between IDH mutated astrocytomas and IDH wild type glioblastomas (P < 0.01). TBR mean showed the best diagnostic performance (cut-off 1.95; sensitivity, 89%; specificity, 67%; accuracy, 81%). None of the parameters discriminated between oligodendrogliomas (IDH mutated, 1p/19q co-deleted) and glioblastomas or astrocytomas. Furthermore, TBR mean , TBR max , TTP, and slope discriminated between gliomas with and without IDH mutation (p < 0.01). The best diagnostic performance was obtained for the combination of TTP with TBR max or slope (accuracy, 73%). Data suggest that static and dynamic 18 F-FET PET parameters may allow determining non-invasively the IDH mutation status. However, IDH mutated and 1p/19q co-deleted oligodendrogliomas cannot be differentiated from glioblastomas and astrocytomas by 18 F-FET PET.

Minimal Contribution of APOBEC3-Induced G-to-A Hypermutation to HIV-1 Recombination and Genetic Variation

PubMed Central

Nikolaitchik, Olga A.; Burdick, Ryan C.; Gorelick, Robert J.; Keele, Brandon F.; Hu, Wei-Shau; Pathak, Vinay K.

2016-01-01

Although the predominant effect of host restriction APOBEC3 proteins on HIV-1 infection is to block viral replication, they might inadvertently increase retroviral genetic variation by inducing G-to-A hypermutation. Numerous studies have disagreed on the contribution of hypermutation to viral genetic diversity and evolution. Confounding factors contributing to the debate include the extent of lethal (stop codon) and sublethal hypermutation induced by different APOBEC3 proteins, the inability to distinguish between G-to-A mutations induced by APOBEC3 proteins and error-prone viral replication, the potential impact of hypermutation on the frequency of retroviral recombination, and the extent to which viral recombination occurs in vivo, which can reassort mutations in hypermutated genomes. Here, we determined the effects of hypermutation on the HIV-1 recombination rate and its contribution to genetic variation through recombination to generate progeny genomes containing portions of hypermutated genomes without lethal mutations. We found that hypermutation did not significantly affect the rate of recombination, and recombination between hypermutated and wild-type genomes only increased the viral mutation rate by 3.9 × 10−5 mutations/bp/replication cycle in heterozygous virions, which is similar to the HIV-1 mutation rate. Since copackaging of hypermutated and wild-type genomes occurs very rarely in vivo, recombination between hypermutated and wild-type genomes does not significantly contribute to the genetic variation of replicating HIV-1. We also analyzed previously reported hypermutated sequences from infected patients and determined that the frequency of sublethal mutagenesis for A3G and A3F is negligible (4 × 10−21 and1 × 10−11, respectively) and its contribution to viral mutations is far below mutations generated during error-prone reverse transcription. Taken together, we conclude that the contribution of APOBEC3-induced hypermutation to HIV-1 genetic variation is substantially lower than that from mutations during error-prone replication. PMID:27186986

Relationship between Tumor Biomarkers and Efficacy in EMILIA, a Phase III Study of Trastuzumab Emtansine in HER2-Positive Metastatic Breast Cancer.

PubMed

Baselga, José; Lewis Phillips, Gail D; Verma, Sunil; Ro, Jungsil; Huober, Jens; Guardino, Alice E; Samant, Meghna K; Olsen, Steve; de Haas, Sanne L; Pegram, Mark D

2016-08-01

HER2-positive breast cancer is heterogeneous. Some tumors express mutations, like activating PIK3CA mutations or reduced PTEN expression, that negatively correlate with response to HER2-targeted therapies. In this exploratory analysis, we investigated whether the efficacy of trastuzumab emtansine (T-DM1), an antibody-drug conjugate comprised of the cytotoxic agent DM1 linked to the HER2-targeted antibody trastuzumab, was correlated with the expression of specific biomarkers in the phase III EMILIA study. Tumors were evaluated for HER2 (n = 866), EGFR (n = 832), and HER3 (n = 860) mRNA expression by quantitative reverse transcriptase PCR; for PTEN protein expression (n = 271) by IHC; and for PIK3CA mutations (n = 259) using a mutation detection kit. Survival outcomes were analyzed by biomarker subgroups. T-DM1 was also tested on cell lines and in breast cancer xenograft models containing PIK3CA mutations. Longer progression-free survival (PFS) and overall survival (OS) were observed with T-DM1 compared with capecitabine plus lapatinib in all biomarker subgroups. PIK3CA mutations were associated with shorter median PFS (mutant vs. wild type: 4.3 vs. 6.4 months) and OS (17.3 vs. 27.8 months) in capecitabine plus lapatinib-treated patients, but not in T-DM1-treated patients (PFS, 10.9 vs. 9.8 months; OS, not reached in mutant or wild type). T-DM1 showed potent activity in cell lines and xenograft models with PIK3CA mutations. Although other standard HER2-directed therapies are less effective in tumors with PI3KCA mutations, T-DM1 appears to be effective in both PI3KCA-mutated and wild-type tumors. Clin Cancer Res; 22(15); 3755-63. ©2016 AACR. ©2016 American Association for Cancer Research.

Minimal Contribution of APOBEC3-Induced G-to-A Hypermutation to HIV-1 Recombination and Genetic Variation.

PubMed

Delviks-Frankenberry, Krista A; Nikolaitchik, Olga A; Burdick, Ryan C; Gorelick, Robert J; Keele, Brandon F; Hu, Wei-Shau; Pathak, Vinay K

2016-05-01

Although the predominant effect of host restriction APOBEC3 proteins on HIV-1 infection is to block viral replication, they might inadvertently increase retroviral genetic variation by inducing G-to-A hypermutation. Numerous studies have disagreed on the contribution of hypermutation to viral genetic diversity and evolution. Confounding factors contributing to the debate include the extent of lethal (stop codon) and sublethal hypermutation induced by different APOBEC3 proteins, the inability to distinguish between G-to-A mutations induced by APOBEC3 proteins and error-prone viral replication, the potential impact of hypermutation on the frequency of retroviral recombination, and the extent to which viral recombination occurs in vivo, which can reassort mutations in hypermutated genomes. Here, we determined the effects of hypermutation on the HIV-1 recombination rate and its contribution to genetic variation through recombination to generate progeny genomes containing portions of hypermutated genomes without lethal mutations. We found that hypermutation did not significantly affect the rate of recombination, and recombination between hypermutated and wild-type genomes only increased the viral mutation rate by 3.9 × 10-5 mutations/bp/replication cycle in heterozygous virions, which is similar to the HIV-1 mutation rate. Since copackaging of hypermutated and wild-type genomes occurs very rarely in vivo, recombination between hypermutated and wild-type genomes does not significantly contribute to the genetic variation of replicating HIV-1. We also analyzed previously reported hypermutated sequences from infected patients and determined that the frequency of sublethal mutagenesis for A3G and A3F is negligible (4 × 10-21 and1 × 10-11, respectively) and its contribution to viral mutations is far below mutations generated during error-prone reverse transcription. Taken together, we conclude that the contribution of APOBEC3-induced hypermutation to HIV-1 genetic variation is substantially lower than that from mutations during error-prone replication.

Screening of the USH1G gene among Spanish patients with Usher syndrome. Lack of mutations and evidence of a minor role in the pathogenesis of the syndrome.

PubMed

Aller, Elena; Jaijo, Teresa; Beneyto, Magdalena; Nájera, Carmen; Morera, Constantino; Pérez-Garrigues, Herminio; Ayuso, Carmen; Millán, Jose

2007-09-01

The Usher syndrome (USH) is an autosomal recessive hereditary disorder characterized by the association of sensorineural hearing loss, retinitis pigmentosa (RP) and, in some cases, vestibular dysfunction. The USH1G gene, encoding SANS, has been found to cause both Usher syndrome type I and atypical Usher syndrome. 109 Spanish unrelated patients suffering from Usher syndrome type I, type II, type III and unclassified Usher syndrome were screened for mutations in this gene, but only eight different changes without a clear pathogenic effect have been detected. Based on these results as well as previous studies in other populations where mutational analysis of this gene has been carried out, one can conclude that USH1G has a minor involvement in Usher syndrome pathogenesis.

Col4a1 mutations cause progressive retinal neovascular defects and retinopathy

PubMed Central

Alavi, Marcel V.; Mao, Mao; Pawlikowski, Bradley T.; Kvezereli, Manana; Duncan, Jacque L.; Libby, Richard T.; John, Simon W. M.; Gould, Douglas B.

2016-01-01

Mutations in collagen, type IV, alpha 1 (COL4A1), a major component of basement membranes, cause multisystem disorders in humans and mice. In the eye, these include anterior segment dysgenesis, optic nerve hypoplasia and retinal vascular tortuosity. Here we investigate the retinal pathology in mice carrying dominant-negative Col4a1 mutations. To this end, we examined retinas longitudinally in vivo using fluorescein angiography, funduscopy and optical coherence tomography. We assessed retinal function by electroretinography and studied the retinal ultrastructural pathology. Retinal examinations revealed serous chorioretinopathy, retinal hemorrhages, fibrosis or signs of pathogenic angiogenesis with chorioretinal anastomosis in up to approximately 90% of Col4a1 mutant eyes depending on age and the specific mutation. To identify the cell-type responsible for pathogenesis we generated a conditional Col4a1 mutation and determined that primary vascular defects underlie Col4a1-associated retinopathy. We also found focal activation of Müller cells and increased expression of pro-angiogenic factors in retinas from Col4a1+/Δex41mice. Together, our findings suggest that patients with COL4A1 and COL4A2 mutations may be at elevated risk of retinal hemorrhages and that retinal examinations may be useful for identifying patients with COL4A1 and COL4A2 mutations who are also at elevated risk of hemorrhagic strokes. PMID:26813606

Gene structure and mutations of glutaryl-coenzyme A dehydrogenase: Impaired association of enzyme subunits that is due to an A421V substitution causes glutaric acidemia type I in the Amish

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biery, B.J.; Stein, D.E.; Goodman, S.I.

The structure of the human glutaryl coenzyme A dehydrogenase (GCD) gene was determined to contain 11 exons and to span {approximately}7 kb. Fibroblast DNA from 64 unrelated glutaric academia type I (GA1) patients was screened for mutations by PCR amplification and analysis of SSCP. Fragments with altered electrophoretic mobility were subcloned and sequenced to detect mutations that caused GA1. This report describes the structure of the GCD gene, as well as point mutations and polymorphisms found in 7 of its 11 exons. Several mutations were found in more than one patient, but no one prevalent mutation was detected in themore » general population. As expected from pedigree analysis, a single mutant allele causes GA1 in the Old Order Amish of Lancaster County, Pennsylvania. Several mutations have been expressed in Escherichia coli, and all produce diminished enzyme activity. Reduced activity in GCD encoded by the A421V mutation in the Amish may be due to impaired association of enzyme subunits. 13 refs., 5 figs., 3 tabs.« less

Mutation Update for Kabuki Syndrome Genes KMT2D and KDM6A and Further Delineation of X-Linked Kabuki Syndrome Subtype 2.

PubMed

Bögershausen, Nina; Gatinois, Vincent; Riehmer, Vera; Kayserili, Hülya; Becker, Jutta; Thoenes, Michaela; Simsek-Kiper, Pelin Özlem; Barat-Houari, Mouna; Elcioglu, Nursel H; Wieczorek, Dagmar; Tinschert, Sigrid; Sarrabay, Guillaume; Strom, Tim M; Fabre, Aurélie; Baynam, Gareth; Sanchez, Elodie; Nürnberg, Gudrun; Altunoglu, Umut; Capri, Yline; Isidor, Bertrand; Lacombe, Didier; Corsini, Carole; Cormier-Daire, Valérie; Sanlaville, Damien; Giuliano, Fabienne; Le Quan Sang, Kim-Hanh; Kayirangwa, Honorine; Nürnberg, Peter; Meitinger, Thomas; Boduroglu, Koray; Zoll, Barbara; Lyonnet, Stanislas; Tzschach, Andreas; Verloes, Alain; Di Donato, Nataliya; Touitou, Isabelle; Netzer, Christian; Li, Yun; Geneviève, David; Yigit, Gökhan; Wollnik, Bernd

2016-09-01

Kabuki syndrome (KS) is a rare but recognizable condition that consists of a characteristic face, short stature, various organ malformations, and a variable degree of intellectual disability. Mutations in KMT2D have been identified as the main cause for KS, whereas mutations in KDM6A are a much less frequent cause. Here, we report a mutation screening in a case series of 347 unpublished patients, in which we identified 12 novel KDM6A mutations (KS type 2) and 208 mutations in KMT2D (KS type 1), 132 of them novel. Two of the KDM6A mutations were maternally inherited and nine were shown to be de novo. We give an up-to-date overview of all published mutations for the two KS genes and point out possible mutation hot spots and strategies for molecular genetic testing. We also report the clinical details for 11 patients with KS type 2, summarize the published clinical information, specifically with a focus on the less well-defined X-linked KS type 2, and comment on phenotype-genotype correlations as well as sex-specific phenotypic differences. Finally, we also discuss a possible role of KDM6A in Kabuki-like Turner syndrome and report a mutation screening of KDM6C (UTY) in male KS patients. © 2016 WILEY PERIODICALS, INC.

Modeling the effect of 3 missense AGXT mutations on dimerization of the AGT enzyme in primary hyperoxaluria type 1.

PubMed

Robbiano, Angela; Frecer, Vladimir; Miertus, Jan; Zadro, Cristina; Ulivi, Sheila; Bevilacqua, Elena; Mandrile, Giorgia; De Marchi, Mario; Miertus, Stanislav; Amoroso, Antonio

2010-01-01

Mutations of the AGXT gene encoding the alanine:glyoxylate aminotransferase liver enzyme (AGT) cause primary hyperoxaluria type 1 (PH1). Here we report a molecular modeling study of selected missense AGXT mutations: the common Gly170Arg and the recently described Gly47Arg and Ser81Leu variants, predicted to be pathogenic using standard criteria. Taking advantage of the refined 3D structure of AGT, we computed the dimerization energy of the wild-type and mutated proteins. Molecular modeling predicted that Gly47Arg affects dimerization with a similar effect to that shown previously for Gly170Arg through classical biochemical approaches. In contrast, no effect on dimerization was predicted for Ser81Leu. Therefore, this probably demonstrates pathogenic properties via a different mechanism, similar to that described for the adjacent Gly82Glu mutation that affects pyridoxine binding. This study shows that the molecular modeling approach can contribute to evaluating the pathogenicity of some missense variants that affect dimerization. However, in silico studies--aimed to assess the relationship between structural change and biological effects--require the integrated use of more than 1 tool.

[Comparative analysis of real-time quantitative PCR-Sanger sequencing method and TaqMan probe method for detection of KRAS/BRAF mutation in colorectal carcinomas].

PubMed

Zhang, Xun; Wang, Yuehua; Gao, Ning; Wang, Jinfen

2014-02-01

To compare the application values of real-time quantitative PCR-Sanger sequencing and TaqMan probe method in the detection of KRAS and BRAF mutations, and to correlate KRAS/BRAF mutations with the clinicopathological characteristics in colorectal carcinomas. Genomic DNA of the tumor cells was extracted from formalin fixed paraffin embedded (FFPE) tissue samples of 344 colorectal carcinomas by microdissection. Real-time quantitative PCR-Sanger sequencing and TaqMan probe method were performed to detect the KRAS/BRAF mutations. The frequency and types of KRAS/BRAF mutations, clinicopathological characteristics and survival time were analyzed. KRAS mutations were detected in 39.8% (137/344) and 38.7% (133/344) of 344 colorectal carcinomas by using real-time quantitative PCR-Sanger sequencing and TaqMan probe method, respectively. BRAF mutation was detected in 4.7% (16/344) and 4.1% (14/344), respectively. There was no significant correlation between the two methods. The frequency of the KRAS mutation in female was higher than that in male (P < 0.05). The frequency of the BRAF mutation in colon was higher than that in rectum. The frequency of the BRAF mutation in stage III-IV cases was higher than that in stageI-II cases. The frequency of the BRAF mutation in signet ring cell carcinoma was higher than that in mucinous carcinoma and nonspecific adenocarcinoma had the lowest mutation rate. The frequency of the BRAF mutation in grade III cases was higher than that in grade II cases (P < 0.05). The overall concordance for the two methods of KRAS/BRAF mutation detection was 98.8% (kappa = 0.976). There was statistic significance between BRAF and KRAS mutations for the survival time of colorectal carcinomas (P = 0.039). There were no statistic significance between BRAF mutation type and BRAF/KRAS wild type (P = 0.058). (1) Compared with real-time quantitative PCR-Sanger sequencing, TaqMan probe method is better with regard to handling time, efficiency, repeatability, cost and equipment. (2) The frequency of the KRAS mutation is correlated with gender. BRAF mutation is correlated with primary tumor site, TNM stage, histological types and histological grades.(3) BRAF gene mutation is an independent prognostic marker for colorectal carcinomas.

Ocular findings in patients with the Hermansky-Pudlak syndrome (types 1 and 3)

PubMed Central

Jardón, Javier; Izquierdo, Natalio J.; Renta, Jessica Y; García-Rodríguez, Omar; Cadilla, Carmen L.

2014-01-01

Purpose To describe and compare ocular findings in patients with Hermansky-Pudlak syndrome (HPS) type 1 and 3. Methods This is a retrospective case series of 64 patients with HPS from 1999 to 2009 evaluated at an outpatient private ophthalmologic clinic. Patients underwent genetic analysis of selected albinism (Tyrosine and P gene) and HPS genes (HPS-1 and HPS-3) by screening for common mutations and exon sequencing with DNA screening. Descriptive and a non-parametric statistical analysis were done. Results Nearly 70% of the patients were homozygous for common Puerto Rican mutations leading to the HPS1 gene (16-BP DUP, 53.6%), while 30% had the 3904-BP DEL HPS3 gene mutation. BCVA was poorer in patients with type 1 HPS than in patients with type 3 HPS (p<0.001), esotropia was more common among type 1 HPS (p<0.018), while exotropia was more common among patients with type 3 HPS. Total iris transillumination was more common in patients with type 1 HPS and minimal iris transillumination in patients with type 3 HPS (p<0.001). The maculae were translucent in patients with type 1 HPS, while patients with type 3 HPS had opaque maculae (p<0.001). Conclusions Patients with type 1 HPS had poorer BCVA, increase incidence of esotropia, lighter iris and macular appearance. In contrast, patients with type 3 HPS 3 had more exotropia. In addition, to our knowledge this is the largest series type 3 HPS ever reported. PMID:24766090

Direct detection of a BRAF mutation in total RNA from melanoma cells using cantilever arrays

NASA Astrophysics Data System (ADS)

Huber, F.; Lang, H. P.; Backmann, N.; Rimoldi, D.; Gerber, Ch.

2013-02-01

Malignant melanoma, the deadliest form of skin cancer, is characterized by a predominant mutation in the BRAF gene. Drugs that target tumours carrying this mutation have recently entered the clinic. Accordingly, patients are routinely screened for mutations in this gene to determine whether they can benefit from this type of treatment. The current gold standard for mutation screening uses real-time polymerase chain reaction and sequencing methods. Here we show that an assay based on microcantilever arrays can detect the mutation nanomechanically without amplification in total RNA samples isolated from melanoma cells. The assay is based on a BRAF-specific oligonucleotide probe. We detected mutant BRAF at a concentration of 500 pM in a 50-fold excess of the wild-type sequence. The method was able to distinguish melanoma cells carrying the mutation from wild-type cells using as little as 20 ng µl-1 of RNA material, without prior PCR amplification and use of labels.

Mutation Spectrum and Birth Prevalence of Inborn Errors of Metabolism among Emiratis

PubMed Central

Al-Shamsi, Aisha; Hertecant, Jozef L.; Al-Hamad, Sania; Souid, Abdul-Kader; Al-Jasmi, Fatma

2014-01-01

Objectives: This study aimed to determine the mutation spectrum and prevalence of inborn errors of metabolism (IEM) among Emiratis. Methods: The reported mutation spectrum included all patients who were diagnosed with IEM (excluding those with lysosomal storage diseases [LSD]) at Tawam Hospital Metabolic Center in Abu Dhabi, United Arab Emirates, between January 1995 and May 2013. Disease prevalence (per 100,000 live births) was estimated from data available for 1995–2011. Results: In 189 patients, 57 distinct IEM were diagnosed, of which 20 (35%) entities were previously reported LSD (65 patients with 39 mutations), with a birth prevalence of 26.87/100,000. This study investigated the remaining 37 (65%) patients with other IEM (124 patients with 62 mutations). Mutation analysis was performed on 108 (87%) of the 124 patients. Five patients with biotinidase deficiency had compound heterozygous mutations, and two siblings with lysinuric protein intolerance had two homozygous mutations. The remaining 103 (95%) patients had homozygous mutations. As of this study, 29 (47%) of the mutations have been reported only in Emiratis. Two mutations were found in three tribes (biotinidase deficiency [BTD, c.1330G>C] and phenylketonuria [PAH, c.168+5G>C]). Two mutations were found in two tribes (isovaleric aciduria [IVD, c.1184G>A] and propionic aciduria [PCCB, c.990dupT]). The remaining 58 (94%) mutations were each found in individual tribes. The prevalence was 48.37/100,000. The most prevalent diseases (2.2–4.9/100,000) were biotinidase deficiency; tyrosinemia type 1; phenylketonuria; propionic aciduria; glutaric aciduria type 1; glycogen storage disease type Ia, and mitochondrial deoxyribonucleic acid depletion. Conclusion: The IEM birth prevalence (LSD and non-LSD) was 75.24/100,000. These results justify implementing prevention programmes that incorporate genetic counselling and screening. PMID:24516753

Construction and properties of a temperature-sensitive mutation in the gene for the bacteriophage SPO1 DNA-binding protein TF1.

PubMed

Sayre, M H; Geiduschek, E P

1990-08-01

The Bacillus subtilis bacteriophage SPO1 encodes the DNA-binding protein TF1, a homolog of the ubiquitous type II DNA-binding proteins that are components of bacterial chromatin. The known three-dimensional structure of a related protein was used in devising a scheme of site-directed mutagenesis that led to the creation of a temperature-sensitive mutation in the TF1 gene. At the nonpermissive temperature, this mutation disrupted the temporal regulation of viral protein synthesis and processing, altered the kinetics of accumulation of at least one viral transcript, and prohibited the production of infective progeny phage. We suggest that TF1 function is required to shut off the expression of several early-middle and middle viral genes and that TF1 plays a role in phage head morphogenesis. Spontaneous second-site mutations of the temperature-sensitive mutant TF1 allele that suppressed its associated phenotypes were analyzed. These suppressor mutations conferred greater amino acid sequence homology with the type II DNA-binding protein from the thermophile Bacillus stearothermophilus.

Novel and Recurrent MYO7A Mutations in Usher Syndrome Type 1 and Type 2

PubMed Central

Liu, Yani; Liu, Xiaoxing; Ha, Shaoping; Liu, Wenzhou; Kang, Xiaoli; Sheng, Xunlun; Zhao, Chen

2014-01-01

Usher syndrome (USH) is a group of disorders manifested as retinitis pigmentosa and bilateral sensorineural hearing loss, with or without vestibular dysfunction. Here, we recruited three Chinese families affected with autosomal recessive USH for detailed clinical evaluations and for mutation screening in the genes associated with inherited retinal diseases. Using targeted next-generation sequencing (NGS) approach, three new alleles and one known mutation in MYO7A gene were identified in the three families. In two families with USH type 1, novel homozygous frameshift variant p.Pro194Hisfs*13 and recurrent missense variant p.Thr165Met were demonstrated as the causative mutations respectively. Crystal structural analysis denoted that p.Thr165Met would very likely change the tertiary structure of the protein encoded by MYO7A. In another family affected with USH type 2, novel biallelic mutations in MYO7A, c.[1343+1G>A];[2837T>G] or p.[?];[Met946Arg], were identified with clinical significance. Because MYO7A, to our knowledge, has rarely been correlated with USH type 2, our findings therefore reveal distinguished clinical phenotypes associated with MYO7A. We also conclude that targeted NGS is an effective approach for genetic diagnosis for USH, which can further provide better understanding of genotype-phenotype relationship of the disease. PMID:24831256

Novel and recurrent MYO7A mutations in Usher syndrome type 1 and type 2.

PubMed

Rong, Weining; Chen, Xue; Zhao, Kanxing; Liu, Yani; Liu, Xiaoxing; Ha, Shaoping; Liu, Wenzhou; Kang, Xiaoli; Sheng, Xunlun; Zhao, Chen

2014-01-01

Usher syndrome (USH) is a group of disorders manifested as retinitis pigmentosa and bilateral sensorineural hearing loss, with or without vestibular dysfunction. Here, we recruited three Chinese families affected with autosomal recessive USH for detailed clinical evaluations and for mutation screening in the genes associated with inherited retinal diseases. Using targeted next-generation sequencing (NGS) approach, three new alleles and one known mutation in MYO7A gene were identified in the three families. In two families with USH type 1, novel homozygous frameshift variant p.Pro194Hisfs*13 and recurrent missense variant p.Thr165Met were demonstrated as the causative mutations respectively. Crystal structural analysis denoted that p.Thr165Met would very likely change the tertiary structure of the protein encoded by MYO7A. In another family affected with USH type 2, novel biallelic mutations in MYO7A, c.[1343+1G>A];[2837T>G] or p.[?];[Met946Arg], were identified with clinical significance. Because MYO7A, to our knowledge, has rarely been correlated with USH type 2, our findings therefore reveal distinguished clinical phenotypes associated with MYO7A. We also conclude that targeted NGS is an effective approach for genetic diagnosis for USH, which can further provide better understanding of genotype-phenotype relationship of the disease.

The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

PubMed

Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

2000-03-01

Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

Detection of drug resistance-associated mutations in human immunodeficiency virus type 1 integrase derived from drug-naive individuals in Surabaya, Indonesia.

PubMed

Kotaki, Tomohiro; Khairunisa, Siti Qamariyah; Sukartiningrum, Septhia Dwi; Witaningrum, Adiana Mutamsari; Rusli, Musofa; Diansyah, M Noor; Arfijanto, M Vitanata; Rahayu, Retno Pudji; Nasronudin; Kameoka, Masanori

2014-05-01

Although human immunodeficiency virus type 1 (HIV-1) infection causes serious health problems in Indonesia, information in regard to drug resistance is limited. We performed a genotypic study on HIV-1 integrase derived from drug-naive individuals in Surabaya, Indonesia. Sequencing analysis revealed that no primary mutations associated with drug resistance to integrase inhibitors were detected; however, secondary mutations, V72I, L74I/M, V165I, V201I, I203M, and S230N, were detected in more than 5% of samples. In addition, V201I was conserved among all samples. Most integrase genes were classified into CRF01_AE genes. Interestingly, 40% of the CRF01_AE genes had an unusual insertion in the C-terminus of integrase. These mutations and insertions were considered natural polymorphisms since these mutations coincided with previous reports, and integrase inhibitors have not been used in Indonesia. Our results indicated that further studies may be required to assess the impact of these mutations on integrase inhibitors prior to their introduction into Indonesia.

Primary hyperoxaluria type 1: update and additional mutation analysis of the AGXT gene.

PubMed

Williams, Emma L; Acquaviva, Cecile; Amoroso, Antonio; Chevalier, Francoise; Coulter-Mackie, Marion; Monico, Carla G; Giachino, Daniela; Owen, Tricia; Robbiano, Angela; Salido, Eduardo; Waterham, Hans; Rumsby, Gill

2009-06-01

Primary hyperoxaluria type 1 (PH1) is an autosomal recessive, inherited disorder of glyoxylate metabolism arising from a deficiency of the alanine:glyoxylate aminotransferase (AGT) enzyme, encoded by the AGXT gene. The disease is manifested by excessive endogenous oxalate production, which leads to impaired renal function and associated morbidity. At least 146 mutations have now been described, 50 of which are newly reported here. The mutations, which occur along the length of the AGXT gene, are predominantly single-nucleotide substitutions (75%), 73 are missense, 19 nonsense, and 18 splice mutations; but 36 major and minor deletions and insertions are also included. There is little association of mutation with ethnicity, the most obvious exception being the p.Ile244Thr mutation, which appears to have North African/Spanish origins. A common, polymorphic variant encoding leucine at codon 11, the so-called minor allele, has significantly lower catalytic activity in vitro, and has a higher frequency in PH1 compared to the rest of the population. This polymorphism influences enzyme targeting in the presence of the most common Gly170Arg mutation and potentiates the effect of several other pathological sequence variants. This review discusses the spectrum of AGXT mutations and polymorphisms, their clinical significance, and their diagnostic relevance.

Comparison of droplet digital PCR and conventional quantitative PCR for measuring EGFR gene mutation

PubMed Central

ZHANG, BO; XU, CHUN-WEI; SHAO, YUN; WANG, HUAI-TAO; WU, YONG-FANG; SONG, YE-YING; LI, XIAO-BING; ZHANG, ZHE; WANG, WEN-JING; LI, LI-QIONG; CAI, CONG-LI

2015-01-01

Early detection of epidermal growth factor receptor (EGFR) mutation, particularly EGFR T790M mutation, is of clinical significance. The aim of the present study was to compare the performances of amplification refractory mutation system-based quantitative polymerase chain reaction (ARMS-qPCR) and droplet digital polymerase chain reaction (ddPCR) approaches in the detection of EGFR mutation and explore the feasibility of using ddPCR in the detection of samples with low mutation rates. EGFR gene mutations in plasmid samples with different T790M mutation rates (0.1–5%) and 10 clinical samples were detected using the ARMS-qPCR and ddPCR approaches. The results demonstrated that the ARMS-qPCR method stably detected the plasmid samples (6,000 copies) with 5 and 1% mutation rates, while the ddPCR approach reliably detected those with 5% (398 copies), 1% (57 copies), 0.5% (24 copies) and 0.1% (average 6 copies) mutation rates. For the 10 clinical samples, the results for nine samples by the ARMS-qPCR and ddPCR methods were consistent; however, the sample N006, indicated to be EGFR wild-type by ARMS-qPCR, was revealed to have a clear EGFR T790M mutation with seven copies of mutant alleles in a background of 6,000 wild-type copies using ddPCR technology. This study demonstrates the feasibility of applying the ddPCR system to detect EGFR mutation and identified the advantage of ddPCR in the detection of samples with a low EGFR mutation abundance, particularly the secondary EGFR T790M resistance mutation, which enables early diagnosis before acquired resistance to tyrosine kinase inhibitors becomes clinically detectable. PMID:25780439

The National Niemann-Pick Type C1 Disease Database: correlation of lipid profiles, mutations, and biochemical phenotypes

PubMed Central

Garver, William S.; Jelinek, David; Meaney, F. John; Flynn, James; Pettit, Kathleen M.; Shepherd, Glen; Heidenreich, Randall A.; Vockley, Cate M. Walsh; Castro, Graciela; Francis, Gordon A.

2010-01-01

Niemann-Pick type C1 disease (NPC1) is an autosomal recessive lysosomal storage disorder characterized by neonatal jaundice, hepatosplenomegaly, and progressive neurodegeneration. The present study provides the lipid profiles, mutations, and corresponding associations with the biochemical phenotype obtained from NPC1 patients who participated in the National NPC1 Disease Database. Lipid profiles were obtained from 34 patients (39%) in the survey and demonstrated significantly reduced plasma LDL cholesterol (LDL-C) and increased plasma triglycerides in the majority of patients. Reduced plasma HDL cholesterol (HDL-C) was the most consistent lipoprotein abnormality found in male and female NPC1 patients across age groups and occurred independent of changes in plasma triglycerides. A subset of 19 patients for whom the biochemical severity of known NPC1 mutations could be correlated with their lipid profile showed a strong inverse correlation between plasma HDL-C and severity of the biochemical phenotype. Gene mutations were available for 52 patients (59%) in the survey, including 52 different mutations and five novel mutations (Y628C, P887L, I923V, A1151T, and 3741_3744delACTC). Together, these findings provide novel information regarding the plasma lipoprotein changes and mutations in NPC1 disease, and suggest plasma HDL-C represents a potential biomarker of NPC1 disease severity. PMID:19744920

Molecular analysis of the AGXT gene in Italian patients with primary hyperoxaluria type 1 (PH1).

PubMed

Ferrettini, C; Pirulli, D; Cosseddu, D; Marangella, M; Petrarulo, M; Mazzola, G; Vatta, S; Amoroso, A

1998-01-01

Specimens were collected from 22 Italian patients with primary hyperoxaluria type 1 (PH1). Ten of them had already been analyzed by molecular biology. To clarify the molecular characteristics of the AGXT gene disease responsible for PH1, DNA samples were examined for known mutations by hybridisation of PCR products with Sequence Specific Oligonucleotides (PCR-SSO). We planned to identify new mutations of the AGXT gene by heteroduplex analysis followed by direct sequencing. We had already standardized a) the conditions for the amplification of the 11 exons of AGXT, b) the PCR-SSO technique and c) the heteroduplex analysis of amplified products. Preliminary results demonstrated that the AGXT mutations described in previous studies were found only in 40% of the examined Italian patients with PH1. The remaining 60% of mutations should be characterised in future studies.

Epithelial self-healing is recapitulated by a 3D biomimetic E-cadherin junction.

PubMed

Cohen, Daniel J; Gloerich, Martijn; Nelson, W James

2016-12-20

Epithelial monolayers undergo self-healing when wounded. During healing, cells collectively migrate into the wound site, and the converging tissue fronts collide and form a stable interface. To heal, migrating tissues must form cell-cell adhesions and reorganize from the front-rear polarity characteristic of cell migration to the apical-basal polarity of an epithelium. However, identifying the "stop signal" that induces colliding tissues to cease migrating and heal remains an open question. Epithelial cells form integrin-based adhesions to the basal extracellular matrix (ECM) and E-cadherin-mediated cell-cell adhesions on the orthogonal, lateral surfaces between cells. Current biological tools have been unable to probe this multicellular 3D interface to determine the stop signal. We addressed this problem by developing a unique biointerface that mimicked the 3D organization of epithelial cell adhesions. This "minimal tissue mimic" (MTM) comprised a basal ECM substrate and a vertical surface coated with purified extracellular domain of E-cadherin, and was designed for collision with the healing edge of an epithelial monolayer. Three-dimensional imaging showed that adhesions formed between cells, and the E-cadherin-coated MTM resembled the morphology and dynamics of native epithelial cell-cell junctions and induced the same polarity transition that occurs during epithelial self-healing. These results indicate that E-cadherin presented in the proper 3D context constitutes a minimum essential stop signal to induce self-healing. That the Ecad:Fc MTM stably integrated into an epithelial tissue and reduced migration at the interface suggests that this biointerface is a complimentary approach to existing tissue-material interfaces.

Epithelial self-healing is recapitulated by a 3D biomimetic E-cadherin junction

PubMed Central

Cohen, Daniel J.; Gloerich, Martijn; Nelson, W. James

2016-01-01

Epithelial monolayers undergo self-healing when wounded. During healing, cells collectively migrate into the wound site, and the converging tissue fronts collide and form a stable interface. To heal, migrating tissues must form cell–cell adhesions and reorganize from the front-rear polarity characteristic of cell migration to the apical-basal polarity of an epithelium. However, identifying the "stop signal" that induces colliding tissues to cease migrating and heal remains an open question. Epithelial cells form integrin-based adhesions to the basal extracellular matrix (ECM) and E-cadherin–mediated cell–cell adhesions on the orthogonal, lateral surfaces between cells. Current biological tools have been unable to probe this multicellular 3D interface to determine the stop signal. We addressed this problem by developing a unique biointerface that mimicked the 3D organization of epithelial cell adhesions. This "minimal tissue mimic" (MTM) comprised a basal ECM substrate and a vertical surface coated with purified extracellular domain of E-cadherin, and was designed for collision with the healing edge of an epithelial monolayer. Three-dimensional imaging showed that adhesions formed between cells, and the E-cadherin-coated MTM resembled the morphology and dynamics of native epithelial cell–cell junctions and induced the same polarity transition that occurs during epithelial self-healing. These results indicate that E-cadherin presented in the proper 3D context constitutes a minimum essential stop signal to induce self-healing. That the Ecad:Fc MTM stably integrated into an epithelial tissue and reduced migration at the interface suggests that this biointerface is a complimentary approach to existing tissue–material interfaces. PMID:27930308

A systematic comparison of all mutations in hereditary sensory neuropathy type I (HSAN I) reveals that the G387A mutation is not disease associated.

PubMed

Hornemann, Thorsten; Penno, Anke; Richard, Stephane; Nicholson, Garth; van Dijk, Fleur S; Rotthier, Annelies; Timmerman, Vincent; von Eckardstein, Arnold

2009-04-01

Hereditary sensory neuropathy type 1 (HSAN I) is an autosomal dominant inherited neurodegenerative disorder of the peripheral nervous system associated with mutations in the SPTLC1 subunit of the serine palmitoyltransferase (SPT). Four missense mutations (C133W, C133Y, V144D and G387A) in SPTLC1 were reported to cause HSAN I. SPT catalyses the condensation of Serine and Palmitoyl-CoA, which is the first and rate-limiting step in the de novo synthesis of ceramides. Earlier studies showed that C133W and C133Y mutants have a reduced activity, whereas the impact of the V144D and G387A mutations on the human enzyme was not tested yet. In this paper, we show that none of the HSAN I mutations interferes with SPT complex formation. We demonstrate that also V144D has a reduced SPT activity, however to a lower extent than C133W and C133Y. In contrast, the G387A mutation showed no influence on SPT activity. Furthermore, the growth phenotype of LY-B cells--a SPTLC1 deficient CHO cell line--could be reversed by expressing either the wild-type SPTLC1 or the G387A mutant, but not the C133W mutant. This indicates that the G387A mutation is most likely not directly associated with HSAN I. These findings were genetically confirmed by the identification of a nuclear HSAN family which showed segregation of the G387A variant as a non-synonymous SNP.

Characterization of phospholipase C gamma enzymes with gain-of-function mutations.

PubMed

Everett, Katy L; Bunney, Tom D; Yoon, Youngdae; Rodrigues-Lima, Fernando; Harris, Richard; Driscoll, Paul C; Abe, Koichiro; Fuchs, Helmut; de Angelis, Martin Hrabé; Yu, Philipp; Cho, Wohnwa; Katan, Matilda

2009-08-21

Phospholipase C gamma isozymes (PLC gamma 1 and PLC gamma 2) have a crucial role in the regulation of a variety of cellular functions. Both enzymes have also been implicated in signaling events underlying aberrant cellular responses. Using N-ethyl-N-nitrosourea (ENU) mutagenesis, we have recently identified single point mutations in murine PLC gamma 2 that lead to spontaneous inflammation and autoimmunity. Here we describe further, mechanistic characterization of two gain-of-function mutations, D993G and Y495C, designated as ALI5 and ALI14. The residue Asp-993, mutated in ALI5, is a conserved residue in the catalytic domain of PLC enzymes. Analysis of PLC gamma 1 and PLC gamma 2 with point mutations of this residue showed that removal of the negative charge enhanced PLC activity in response to EGF stimulation or activation by Rac. Measurements of PLC activity in vitro and analysis of membrane binding have suggested that ALI5-type mutations facilitate membrane interactions without compromising substrate binding and hydrolysis. The residue mutated in ALI14 (Tyr-495) is within the spPH domain. Replacement of this residue had no effect on folding of the domain and enhanced Rac activation of PLC gamma 2 without increasing Rac binding. Importantly, the activation of the ALI14-PLC gamma 2 and corresponding PLC gamma 1 variants was enhanced in response to EGF stimulation and bypassed the requirement for phosphorylation of critical tyrosine residues. ALI5- and ALI14-type mutations affected basal activity only slightly; however, their combination resulted in a constitutively active PLC. Based on these data, we suggest that each mutation could compromise auto-inhibition in the inactive PLC, facilitating the activation process; in addition, ALI5-type mutations could enhance membrane interaction in the activated state.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

PubMed

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

2010-12-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

PubMed Central

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol

2010-01-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104

Two Finnish USH1B patients with three novel mutations in myosin VIIA.

PubMed

Vastinsalo, Hanna; Isosomppi, Juha; Aittakorpi, Anne; Sankila, Eeva-Marja

2006-09-21

Usher syndrome (USH) is an autosomal recessive disorder resulting in retinal degeneration and sensorineural deafness caused by mutations in at least 10 gene loci. USH is divided into three main clinical types: USH1 (33-44%), USH2 (56-67%), and USH3. Worldwide, USH1 and USH2 account for most of the Usher syndrome cases with rare occurrence of USH3. In Finland, however, USH3 is the most common type (40%), explained by genetic and geographical isolation accompanied with a founder mutation, while USH1 is estimated to comprise 34% and USH2 12% of all USH cases. We examined two unrelated Finnish USH1 patients by sequencing. We found three new myosin VIIA (MYO7A) mutations: p.K923AfsX8, p.Q1896X, and p.E1349K. The p.K923AfsX8 mutation was present in both patients as well as in one of 200 Finnish control chromosomes. This is the first molecular genetic study of USH1 in Finland. We have found three new pathological mutations causing either premature termination of translation or replacement of an evolutionary conserved MYO7A amino acid.

R124C mutation of the betaIGH3 gene leads to remarkable phenotypic variability in a Greek four-generation family with lattice corneal dystrophy type 1.

PubMed

Hellenbroich, Y; Tzivras, G; Neppert, B; Schwinger, E; Zühlke, C

2001-01-01

Five autosomal dominantly inherited corneal dystrophies are caused by missense mutations in the betaIGH3 gene on chromosome 5q31. Here we describe the clinical features and the analysis of the betaIGH3 gene in a Greek four-generation family with lattice corneal dystrophy type 1 (CDL1). Sequencing of the betaIGH3 cDNA from an affected family member revealed the R124C mutation. More recent data indicate that this is probably a mutation hot spot in CDL1. We could not find a common haplotype with another CDL1 family with the R124C mutation demonstrating that this mutation occurs independently in different families. The clinical course of the disease showed a remarkable variability between the affected family members. To investigate a possible role between the phenotypic variability and apolipoprotein E (ApoE), which co-localises with amyloid deposits in CDL1, we determined the ApoE genotype of all family members. The resulting data revealed no association with the variable clinical course. Copyright 2001 S. Karger AG, Basel

Prevalence and Prognostic Impact of Wilms' Tumor 1 (WT1) Gene, Including SNP rs16754 in Cytogenetically Normal Acute Myeloblastic Leukemia (CN-AML): An Iranian Experience.

PubMed

Toogeh, Gholamreza; Ramzi, Mani; Faranoush, Mohammad; Amirizadeh, Naser; Haghpanah, Sezaneh; Moghadam, Mohammad; Cohan, Nader

2016-03-01

The aim of this study was to evaluate the effect of Wilms' tumor 1 (WT1) gene mutations in adult cytogenetically normal acute myeloblastic leukemia (CN-AML) patients on survival and clinical outcome. A total of 88 untreated Iranian adult patients with CN-AML were selected as a study group. Exons 7 (including the SNP rs16754), 8, and 9 as a WT1 gene hotspot region were evaluated by polymerase chain reaction and direct sequencing for detection of mutations. Response to treatment and clinical outcome including overall survival (OS) and disease-free survival (DFS) were evaluated according to WT1 gene mutational status. WT1 gene mutations were found in 12.5% of patients, most of which were found in exon 7. Complete remission was lower and relapse was higher in patients with WT1 gene mutation compared with WT1 gene wild type patients. OS and DFS was significantly lower in patients with WT1 gene mutation compared with patients with WT1 gene wild type (P < .001). Also, we did not find any significant effects of SNP rs16754 in exon 7 on clinical outcome and survival in patients with CN-AML. WT1 gene mutations are a predictor indicator of a poor prognosis factor in CN-AML patients. It is recommended that WT1 gene mutations be included in the molecular testing panel in order to better diagnose and confirm their prognostic significance for better management and treatment strategy. Copyright © 2016 Elsevier Inc. All rights reserved.

Germline mutations in RYR1 are associated with foetal akinesia deformation sequence/lethal multiple pterygium syndrome.

PubMed

McKie, Arthur B; Alsaedi, Atif; Vogt, Julie; Stuurman, Kyra E; Weiss, Marjan M; Shakeel, Hassan; Tee, Louise; Morgan, Neil V; Nikkels, Peter G J; van Haaften, Gijs; Park, Soo-Mi; van der Smagt, Jasper J; Bugiani, Marianna; Maher, Eamonn R

2014-12-05

Foetal akinesia deformation sequence syndrome (FADS) is a genetically heterogeneous disorder characterised by the combination of foetal akinesia and developmental defects which may include pterygia (joint webbing). Traditionally multiple pterygium syndrome (MPS) has been divided into two forms: prenatally lethal (LMPS) and non-lethal Escobar type (EVMPS) types. Interestingly, FADS, LMPS and EVMPS may be allelic e.g. each of these phenotypes may result from mutations in the foetal acetylcholine receptor gamma subunit gene (CHRNG). Many cases of FADS and MPS do not have a mutation in a known FADS/MPS gene and we undertook molecular genetic studies to identify novel causes of these phenotypes. After mapping a novel locus for FADS/LMPS to chromosome 19, we identified a homozygous null mutation in the RYR1 gene in a consanguineous kindred with recurrent LMPS pregnancies. Resequencing of RYR1 in a cohort of 66 unrelated probands with FADS/LMPS/EVMPS (36 with FADS/LMPS and 30 with EVMPS) revealed two additional homozygous mutations (in frame deletions). The overall frequency of RYR1 mutations in probands with FADS/LMPS was 8.3%. Our findings report, for the first time, a homozygous RYR1 null mutation and expand the range of RYR1-related phenotypes to include early lethal FADS/LMPS. We suggest that RYR1 mutation analysis should be performed in cases of severe FADS/LMPS even in the absence of specific histopathological indicators of RYR1-related disease.

Osteogenesis imperfecta: recent findings shed new light on this once well-understood condition.

PubMed

Basel, Donald; Steiner, Robert D

2009-06-01

Osteogenesis imperfecta is a systemic heritable disorder of connective tissue whose cardinal manifestation is bone fragility. In approximately 90% of individuals with osteogenesis imperfecta, mutations in either of the genes encoding the pro-alpha1 or pro-alpha2 chains of type I collagen (COL1A1 or COL1A2) can be identified. Of those without collagen mutations, a number of them will have mutations involving the enzyme complex responsible for posttranslational hydroxylation of the position 3 proline residue of COL1A1. Two of the genes encoding proteins involved in that enzyme complex, LEPRE1 and cartilage-associated protein, when mutated have been shown to cause autosomal recessive osteogenesis imperfecta, which has a moderate to severe clinical phenotype, often indistinguishable from osteogenesis imperfecta types II or III. Mutations in COL1A1 or COL1A2 which result in an abnormal protein still capable of forming a triple helix cause a more severe phenotype than mutations that lead to decreased collagen production as a result of the dominant negative effect mediated by continuous protein turnover. The current standard of care includes a multidisciplinary approach with surgical intervention when necessary, proactive physiotherapy, and consideration for the use of bisphosphonates all in attempts to improve quality of life.

Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I.

PubMed

Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Millán, José M; Kimberling, William J

2012-01-01

PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I

PubMed Central

Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Kimberling, William J.

2012-01-01

Purpose PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Methods Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Results Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Conclusions Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment. PMID:22815625

Large-scale, thick, self-assembled, nacre-mimetic brick-walls as fire barrier coatings on textiles

NASA Astrophysics Data System (ADS)

Das, Paramita; Thomas, Helga; Moeller, Martin; Walther, Andreas

2017-01-01

Highly loaded polymer/clay nanocomposites with layered structures are emerging as robust fire retardant surface coatings. However, time-intensive sequential deposition processes, e.g. layer-by-layer strategies, hinders obtaining large coating thicknesses and complicates an implementation into existing technologies. Here, we demonstrate a single-step, water-borne approach to prepare thick, self-assembling, hybrid fire barrier coatings of sodium carboxymethyl cellulose (CMC)/montmorillonite (MTM) with well-defined, bioinspired brick-wall nanostructure, and showcase their application on textile. The coating thickness on the textile is tailored using different concentrations of CMC/MTM (1-5 wt%) in the coating bath. While lower concentrations impart conformal coatings of fibers, thicker continuous coatings are obtained on the textile surface from highest concentration. Comprehensive fire barrier and fire retardancy tests elucidate the increasing fire barrier and retardancy properties with increasing coating thickness. The materials are free of halogen and heavy metal atoms, and are sourced from sustainable and partly even renewable building blocks. We further introduce an amphiphobic surface modification on the coating to impart oil and water repellency, as well as self-cleaning features. Hence, our study presents a generic, environmentally friendly, scalable, and one-pot coating approach that can be introduced into existing technologies to prepare bioinspired, thick, fire barrier nanocomposite coatings on diverse surfaces.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

[Kenny-Caffey syndrome and its related syndromes].

PubMed

Isojima, Tsuyoshi; Kitanaka, Sachiko

2015-11-01

Kenny-Caffey syndrome (KCS) is a very rare dysmorphologic syndrome characterized by proportionate short stature, cortical thickening and medullary stenosis of tubular bones, delayed closure of anterior fontanelle, eye abnormalities, and hypoparathyroidism. Two types of KCS were known: the autosomal recessive form (KCS type 1), which is caused by mutations of the TBCE gene, and the autosomal dominant form (KCS type 2), which is caused by mutations of the FAM111A gene. TBCE mutation also causes hypoparathyroidism-retardation-dysmorphism syndrome, and FAM111A mutation also causes gracile bone dysplasia. These two diseases can be called as KCS-related syndromes. In this article, we review the clinical manifestations of KCS and discuss its related syndromes.

Detection of IDH1 mutation in human gliomas: comparison of immunohistochemistry and sequencing.

PubMed

Takano, Shingo; Tian, Wei; Matsuda, Masahide; Yamamoto, Tetsuya; Ishikawa, Eiichi; Kaneko, Mika Kato; Yamazaki, Kentaro; Kato, Yukinari; Matsumura, Akira

2011-04-01

Isocitrate dehydrogenase 1 (IDH1) mutations have recently been identified as early and frequent genetic alterations in astrocytomas, oligodendrogliomas, and oligoastrocytomas, as well as secondary glioblastomas, whereas primary glioblastomas very rarely contain IDH1 mutations. Furthermore, a specific monoclonal antibody, IMab-1, which recognizes IDH1-R132H-the most frequent IDH1 mutation-has been generated. IMab-1 has been reported to react with the IDH1-R132H protein, but not the wild-type IDH1 or the other IDH1 mutant proteins in Western-blot analysis. However, the importance of immunohistochemistry using IMab-1 has not yet been elucidated. In this study, we compared the findings from IMab-1 immunohistochemistry and direct DNA sequencing using 49 glioma samples. IMab-1 detected 12 out of 49 cases; however, only nine cases were found to be IDH1-R132H by direct DNA sequencing because of a small population of IDH1-R132H mutation-possessing tumor cells, indicating that IMab-1 immunohistochemistry is useful for detecting IDH1-R132H. We conducted immunohistochemical detection in 52 cases of grade III astrocytomas. The median time to progression (TTP) was significantly longer in the cases with the IDH1 mutation (86.7 months) compared to the cases without the IDH1 mutation (wild type, 10.4 months) (p < 0.01). In conclusion, the anti-IDH1-R132H-specific monoclonal antibody IMab-1 is very useful for detecting IDH1-R132H in immunohistochemistry, and predicting the time to progression in grade III anaplastic astrocytomas. Therefore, IMab-1 is likely to be useful for the diagnosis of mutation-bearing gliomas and for determining the treatment strategy of grade III gliomas.

REMOTE SENSING AND MOUNTAINTOP MINING

EPA Science Inventory

Coal mining is Appalachia has undergone dramatic changes in the past decade. Modem mining practices know as Mountaintop Mining (MTM) and Valley Fills (VF) are at the center of an environmental and legal controversy that has spawned lawsuits and major environmental investigations....

Evaluation of 3M(TM) Scotchlite linear delineation system : final report.

DOT National Transportation Integrated Search

2004-09-01

Major construction projects present many hazards for drivers to negotiate. Detours, lane shifts and confusing curves : present unique challenges to all drivers. At night, the difficulties in negotiating these obstacles are amplified due to : reduced ...

White Sands Missile Range Non-Track Optics: Streamlining the Process of Conducting Business for Improved Customer Support

DTIC Science & Technology

2013-12-01

45 A. METHODOLOGY... 45 B. ANALYSIS .....................................................................................................46 C...digital airborne guidance section MFOM MLRS family of munitions MLRS Multiple Launch Rocket System MMW millimeter wave MT material test MTM

A novel gene for Usher syndrome type 2: mutations in the long isoform of whirlin are associated with retinitis pigmentosa and sensorineural hearing loss.

PubMed

Ebermann, Inga; Scholl, Hendrik P N; Charbel Issa, Peter; Becirovic, Elvir; Lamprecht, Jürgen; Jurklies, Bernhard; Millán, José M; Aller, Elena; Mitter, Diana; Bolz, Hanno

2007-04-01

Usher syndrome is an autosomal recessive condition characterized by sensorineural hearing loss, variable vestibular dysfunction, and visual impairment due to retinitis pigmentosa (RP). The seven proteins that have been identified for Usher syndrome type 1 (USH1) and type 2 (USH2) may interact in a large protein complex. In order to identify novel USH genes, we followed a candidate strategy, assuming that mutations in proteins interacting with this "USH network" may cause Usher syndrome as well. The DFNB31 gene encodes whirlin, a PDZ scaffold protein with expression in both hair cell stereocilia and retinal photoreceptor cells. Whirlin represents an excellent candidate for USH2 because it binds to Usherin (USH2A) and VLGR1b (USH2C). Genotyping of microsatellite markers specific for the DFNB31 gene locus on chromosome 9q32 was performed in a German USH2 family that had been excluded for all known USH loci. Patients showed common haplotypes. Sequence analysis of DFNB31 revealed compound heterozygosity for a nonsense mutation, p.Q103X, in exon 1, and a mutation in the splice donor site of exon 2, c.837+1G>A. DFNB31 mutations appear to be a rare cause of Usher syndrome, since no mutations were identified in an additional 96 USH2 patients. While mutations in the C-terminal half of whirlin have previously been reported in non-syndromic deafness (DFNB31), both alterations identified in our USH2 family affect the long protein isoform. We propose that mutations causing Usher syndrome are probably restricted to exons 1-6 that are specific for the long isoform and probably crucial for retinal function. We describe a novel genetic subtype for Usher syndrome, which we named USH2D and which is caused by mutations in whirlin. Moreover, this is the first case of USH2 that is allelic to non-syndromic deafness.

Preimplantation diagnosis for neurofibromatosis.

PubMed

Verlinsky, Yury; Rechitsky, Svetlana; Verlinsky, Oleg; Chistokhina, Anna; Sharapova, Tatyana; Masciangelo, Christina; Levy, Michael; Kaplan, Brian; Lederer, Kevin; Kuliev, Anver

2002-01-01

Preimplantation genetic diagnosis (PGD) has recently been performed for inherited cancer predisposition determined by p53 tumour suppressor gene mutations, suggesting the usefulness of PGD for late onset disorders with genetic predisposition, including those caused by the germline mutations of other tumour suppressor genes. Here PGD was performed for two couples, one at risk for producing a child with maternally derived neurofibromatosis type I (NF1), and the other with paternally derived neurofibromatosis type II (NF2). The procedure involved a standard IVF protocol, combined with testing of oocytes or embryos prior to their transfer back to the patients. Maternal mutation Trp-->Ter (TGG-->TGA) in exon 29 of the NF1 gene was tested by sequential PCR analysis of the first and second polar bodies, and paternal L141P mutation in exon 4 of the NF2 gene by embryo biopsy at the cleavage stage. In both cases, multiplex nested PCR was applied, involving NF1 and NF2 mutation analysis simultaneously with the 3 and 2 linked markers, respectively. Of 57 oocytes tested in four PGD cycles for NF1 mutation, 26 mutation-free oocytes were detected, from which eight were preselected for transfer, two in each cycle. These produced two clinical pregnancies, one confirmed to be mutation free by chorionic villus sampling but ending in a stillbirth, and the other still ongoing. Of 18 embryos analysed in a cycle performed for NF2 mutation, eight mutation-free embryos were detected, three of which were transferred back to the patient, resulting in a singleton pregnancy and the birth of a mutation-free child. This suggests that PGD is a useful approach for avoiding the birth of children with inherited cancer predisposition, determined by NF1 and NF2 gene mutations.

Therapeutic strategies based on modified U1 snRNAs and chaperones for Sanfilippo C splicing mutations.

PubMed

Matos, Liliana; Canals, Isaac; Dridi, Larbi; Choi, Yoo; Prata, Maria João; Jordan, Peter; Desviat, Lourdes R; Pérez, Belén; Pshezhetsky, Alexey V; Grinberg, Daniel; Alves, Sandra; Vilageliu, Lluïsa

2014-12-10

Mutations affecting RNA splicing represent more than 20% of the mutant alleles in Sanfilippo syndrome type C, a rare lysosomal storage disorder that causes severe neurodegeneration. Many of these mutations are localized in the conserved donor or acceptor splice sites, while few are found in the nearby nucleotides. In this study we tested several therapeutic approaches specifically designed for different splicing mutations depending on how the mutations affect mRNA processing. For three mutations that affect the donor site (c.234 + 1G > A, c.633 + 1G > A and c.1542 + 4dupA), different modified U1 snRNAs recognizing the mutated donor sites, have been developed in an attempt to rescue the normal splicing process. For another mutation that affects an acceptor splice site (c.372-2A > G) and gives rise to a protein lacking four amino acids, a competitive inhibitor of the HGSNAT protein, glucosamine, was tested as a pharmacological chaperone to correct the aberrant folding and to restore the normal trafficking of the protein to the lysosome. Partial correction of c.234 + 1G > A mutation was achieved with a modified U1 snRNA that completely matches the splice donor site suggesting that these molecules may have a therapeutic potential for some splicing mutations. Furthermore, the importance of the splice site sequence context is highlighted as a key factor in the success of this type of therapy. Additionally, glucosamine treatment resulted in an increase in the enzymatic activity, indicating a partial recovery of the correct folding. We have assayed two therapeutic strategies for different splicing mutations with promising results for the future applications.

GSTA1 Expression Is Correlated With Aldosterone Level in KCNJ5-Mutated Adrenal Aldosterone-Producing Adenoma.

PubMed

Li, Xintao; Wang, Baojun; Tang, Lu; Zhang, Yu; Chen, Luyao; Gu, Liangyou; Zhang, Fan; Ouyang, Jinzhi; Zhang, Xu

2018-03-01

KCNJ5 mutation is a major cause of aldosterone-producing adenomas (APAs). The development of APA apart from KCNJ5 mutation is less investigated. To investigate other mechanisms affecting aldosterone secretion apart from KCNJ5. Six pairs of KCNJ5-mutated, high and low aldosterone-secreting APAs, five non-KCNJ5-mutated APAs, and four normal adrenal glands were assayed by Affymetrix GeneChip Human Transcriptome Array 2.0. A total of 113 APA samples were investigated to explore the expression of glutathione-S-transferase A1 (GSTA1). H295R cells were used to verify the function of GSTA1. GSTA1 was the top gene downregulated in high-aldosterone KCNJ5-mutated APAs. GSTA1 was also downregulated in KCNJ5-mutated APAs compared with wild-type KCNJ5 APAs. Accordingly, mutant KCNJ5 decreased GSTA1 messenger RNA and protein expression levels. GSTA1 overexpression suppressed aldosterone secretion whether in wild-type or mutant KCNJ5 H295R cells. Adding ethacrynic acid or silencing of GSTA1 increased aldosterone secretion by increasing reactive oxygen species (ROS), superoxide, H2O2 levels, and Ca2+ influx. The expression of the transcription factors NR4A1, NR4A2, and CAMK1 and intracellular Ca2+ were significantly upregulated by GSTA1 inhibition. The reduced form of NAD phosphate oxidase inhibitor or H2O2 scavenger or blocking calmodulin or calcium channels could significantly reduce aldosterone secretion in GSTA1-inhibited cells. (1) GSTA1 expression is reversely correlated with aldosterone level in KCNJ5-mutated APAs, (2) GSTA1 regulates aldosterone secretion by ROS and Ca2+ signaling, and (3) KCNJ5 mutation downregulates GSTA1 expression, and overexpression of GSTA1 reverses increased aldosterone in KCNJ5-mutated adrenal cells.

a/alpha-specific effect on the mms3 mutation on ultraviolet mutagenesis in Saccharomyces cerevisiae.

PubMed

Martin, P; Prakash, L; Prakash, S

1981-05-01

A new gene involved in error-prone repair of ultraviolet (UV) damage has been identified in Saccharomyces cerevisiae by the mms3-1 mutation. UV-induced reversion is reduced in diploids that are homozygous for mms3-1, only if they are also heterozygous (MATa/MAT alpha) at the mating type locus. The mms3-1 mutation has no effect on UV-induced reversion either in haploids or MATa/MATa or MAT alpha/MAT alpha diploids. The mutation confers sensitivity to UV and methyl methane sulfonate in both haploids and diploids. Even though mutation induction by UV is restored to wild-type levels in MATa/MATa mms3-1/mms3-1 or MAT alpha/MAT alpha mms3-1/mms3-1 diploids, such strains still retain sensitivity to the lethal effects of UV. Survival after UV irradiation in mms3-1 rad double mutant combinations indicates that mms3-1 is epistatic to rad6-1 whereas non-epistatic interactions are observed with rad3 and rad52 mutants. When present in the homozygous state in MATa/MAT alpha his1-1/his1-315 heteroallelic diploids, mms3-1 was found to lower UV-induced mitotic recombination.

Abnormal Expressions of DNA Glycosylase Genes NEIL1, NEIL2, and NEIL3 Are Associated with Somatic Mutation Loads in Human Cancer.

PubMed

Shinmura, Kazuya; Kato, Hisami; Kawanishi, Yuichi; Igarashi, Hisaki; Goto, Masanori; Tao, Hong; Inoue, Yusuke; Nakamura, Satoki; Misawa, Kiyoshi; Mineta, Hiroyuki; Sugimura, Haruhiko

2016-01-01

The effects of abnormalities in the DNA glycosylases NEIL1, NEIL2, and NEIL3 on human cancer have not been fully elucidated. In this paper, we found that the median somatic total mutation loads and the median somatic single nucleotide mutation loads exhibited significant inverse correlations with the median NEIL1 and NEIL2 expression levels and a significant positive correlation with the median NEIL3 expression level using data for 13 cancer types from the Cancer Genome Atlas (TCGA) database. A subset of the cancer types exhibited reduced NEIL1 and NEIL2 expressions and elevated NEIL3 expression, and such abnormal expressions of NEIL1, NEIL2, and NEIL3 were also significantly associated with the mutation loads in cancer. As a mechanism underlying the reduced expression of NEIL1 in cancer, the epigenetic silencing of NEIL1 through promoter hypermethylation was found. Finally, we investigated the reason why an elevated NEIL3 expression level was associated with an increased number of somatic mutations in cancer and found that NEIL3 expression was positively correlated with the expression of APOBEC3B, a potent inducer of mutations, in diverse cancers. These results suggested that the abnormal expressions of NEIL1, NEIL2, and NEIL3 are involved in cancer through their association with the somatic mutation load.

Molecular basis of splotch and Waardenburg Pax-3 mutations.

PubMed Central

Chalepakis, G; Goulding, M; Read, A; Strachan, T; Gruss, P

1994-01-01

Pax genes control certain aspects of development, as mutations result in (semi)dominant defects apparent during embryogenesis. Pax-3 has been associated with the mouse mutant splotch (Sp) and the human Waardenburg syndrome type 1 (WS1). We have examined the molecular basis of splotch and WS1 by studying the effect of mutations on DNA binding, using a defined target sequence. Pax-3 contains two different types of functional DNA-binding domains, a paired domain and a homeodomain. Mutational analysis of Pax-3 reveals different modes of DNA binding depending on the presence of these domains. A segment of Pax-3 located between the two DNA-binding domains, including a conserved octapeptide, participates in protein homodimerization. Pax-3 mutations found in splotch alleles and WS1 individuals change DNA binding and, in the case of a protein product of the Sp allele, dimerization. These findings were taken as a basis to define the molecular nature of the mutants. Images PMID:7909605

A novel splicing site IRP1 somatic mutation in a patient with pheochromocytoma and JAK2V617F positive polycythemia vera: a case report.

PubMed

Pang, Ying; Gupta, Garima; Yang, Chunzhang; Wang, Herui; Huynh, Thanh-Truc; Abdullaev, Ziedulla; Pack, Svetlana D; Percy, Melanie J; Lappin, Terence R J; Zhuang, Zhengping; Pacak, Karel

2018-03-13

The role of the hypoxia signaling pathway in the pathogenesis of pheochromocytoma/paraganglioma (PPGL)-polycythemia syndrome has been elucidated. Novel somatic mutations in hypoxia-inducible factor type 2A (HIF2A) and germline mutations in prolyl hydroxylase type 1 and type 2 (PHD1 and PHD2) have been identified to cause upregulation of the hypoxia signaling pathway and its target genes including erythropoietin (EPO) and its receptor (EPOR). However, in a minority of patients presenting with this syndrome, the genetics and molecular pathogenesis remain unexplained. The aim of the present study was to uncover novel genetic causes of PPGL-polycythemia syndrome. A female presented with a history of JAK2 V617F positive PV, diagnosed in 2007, and right adrenal pheochromocytoma diagnosed and resected in 2011. Her polycythemia symptoms and hematocrit levels continued to worsen from 2007 to 2011, with an increased frequency of phlebotomies. Postoperatively, until early 2013, her hematocrit levels remained normalized. Following this, the hematocrit levels ranged between 46.4 and 48.9% [35-45%]. Tumor tissue from the patient was further tested for mutations in genes related to upregulation of the hypoxia signaling pathway including iron regulatory protein 1 (IRP1), which is a known regulator of HIF-2α mRNA translation. Functional studies were performed to investigate the consequences of these mutations, especially their effect on the HIF signaling pathway and EPO. Indel mutations (c.267-1_267delGGinsTA) were discovered at the exon 3 splicing site of IRP1. Minigene construct and splicing site analysis showed that the mutation led to a new splicing site and a frameshift mutation of IRP1, which caused a truncated protein. Fluorescence in situ hybridization analysis demonstrated heterozygous IRP1 deletions in tumor cells. Immunohistochemistry results confirmed the truncated IRP1 and overexpressed HIF-2α, EPO and EPOR in tumor cells. This is the first report which provides direct molecular genetic evidence of association between a somatic IRP1 loss-of-function mutation and PHEO and secondary polycythemia. In patients diagnosed with PHEO/PGL and polycythemia with negative genetic testing for mutations in HIF2A, PHD1/2, and VHL, IRP1 should be considered as a candidate gene.

Primary hyperoxaluria type 1: a cluster of new mutations in exon 7 of the AGXT gene.

PubMed

von Schnakenburg, C; Rumsby, G

1997-06-01

Primary hyperoxaluria type 1 (PH1) is a severe autosomal recessive inborn error of glyoxylate metabolism caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase. This enzyme is encoded by the AGXT gene on chromosome 2q37.3. DNA samples from 79 PH1 patients were studied using single strand conformation polymorphism analysis to detect sequence variants, which were then characterised by direct sequencing and confirmed by restriction enzyme digestion. Four novel mutations were identified in exon 7 of AGXT: a point mutation T853C, which leads to a predicted Ile244Thr amino acid substitution, occurred in nine patients. Two other mutations in adjacent nucleotides, C819T and G820A, mutated the same codon at residue 233 from arginine to cysteine and histidine, respectively. The fourth mutation, G860A, introduced a stop codon at amino acid residue 246. Enzyme studies in these patients showed that AGT catalytic activity was either very low or absent and that little or no immunoreactive protein was present. Together with a new polymorphism in exon 11 (C1342A) these findings underline the genetic heterogeneity of the AGXT gene. The novel mutation T853C is the second most common mutation found to date with an allelic frequency of 9% and will therefore be of clinical importance for the diagnosis of PH1.

Primary hyperoxaluria type 1: a cluster of new mutations in exon 7 of the AGXT gene.

PubMed Central

von Schnakenburg, C; Rumsby, G

1997-01-01

Primary hyperoxaluria type 1 (PH1) is a severe autosomal recessive inborn error of glyoxylate metabolism caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase. This enzyme is encoded by the AGXT gene on chromosome 2q37.3. DNA samples from 79 PH1 patients were studied using single strand conformation polymorphism analysis to detect sequence variants, which were then characterised by direct sequencing and confirmed by restriction enzyme digestion. Four novel mutations were identified in exon 7 of AGXT: a point mutation T853C, which leads to a predicted Ile244Thr amino acid substitution, occurred in nine patients. Two other mutations in adjacent nucleotides, C819T and G820A, mutated the same codon at residue 233 from arginine to cysteine and histidine, respectively. The fourth mutation, G860A, introduced a stop codon at amino acid residue 246. Enzyme studies in these patients showed that AGT catalytic activity was either very low or absent and that little or no immunoreactive protein was present. Together with a new polymorphism in exon 11 (C1342A) these findings underline the genetic heterogeneity of the AGXT gene. The novel mutation T853C is the second most common mutation found to date with an allelic frequency of 9% and will therefore be of clinical importance for the diagnosis of PH1. Images PMID:9192270

Heterogeneity and clinical significance of ESR1 mutations in ER-positive metastatic breast cancer patients receiving fulvestrant

PubMed Central

Spoerke, Jill M.; Gendreau, Steven; Walter, Kimberly; Qiu, Jiaheng; Wilson, Timothy R.; Savage, Heidi; Aimi, Junko; Derynck, Mika K.; Chen, Meng; Chan, Iris T.; Amler, Lukas C.; Hampton, Garret M.; Johnston, Stephen; Krop, Ian; Schmid, Peter; Lackner, Mark R.

2016-01-01

Mutations in ESR1 have been associated with resistance to aromatase inhibitor (AI) therapy in patients with ER+ metastatic breast cancer. Little is known of the impact of these mutations in patients receiving selective oestrogen receptor degrader (SERD) therapy. In this study, hotspot mutations in ESR1 and PIK3CA from ctDNA were assayed in clinical trial samples from ER+ metastatic breast cancer patients randomized either to the SERD fulvestrant or fulvestrant plus a pan-PI3K inhibitor. ESR1 mutations are present in 37% of baseline samples and are enriched in patients with luminal A and PIK3CA-mutated tumours. ESR1 mutations are often polyclonal and longitudinal analysis shows distinct clones exhibiting divergent behaviour over time. ESR1 mutation allele frequency does not show a consistent pattern of increases during fulvestrant treatment, and progression-free survival is not different in patients with ESR1 mutations compared with wild-type patients. ESR1 mutations are not associated with clinical resistance to fulvestrant in this study. PMID:27174596

Heterogeneity and clinical significance of ESR1 mutations in ER-positive metastatic breast cancer patients receiving fulvestrant.

PubMed

Spoerke, Jill M; Gendreau, Steven; Walter, Kimberly; Qiu, Jiaheng; Wilson, Timothy R; Savage, Heidi; Aimi, Junko; Derynck, Mika K; Chen, Meng; Chan, Iris T; Amler, Lukas C; Hampton, Garret M; Johnston, Stephen; Krop, Ian; Schmid, Peter; Lackner, Mark R

2016-05-13

Mutations in ESR1 have been associated with resistance to aromatase inhibitor (AI) therapy in patients with ER+ metastatic breast cancer. Little is known of the impact of these mutations in patients receiving selective oestrogen receptor degrader (SERD) therapy. In this study, hotspot mutations in ESR1 and PIK3CA from ctDNA were assayed in clinical trial samples from ER+ metastatic breast cancer patients randomized either to the SERD fulvestrant or fulvestrant plus a pan-PI3K inhibitor. ESR1 mutations are present in 37% of baseline samples and are enriched in patients with luminal A and PIK3CA-mutated tumours. ESR1 mutations are often polyclonal and longitudinal analysis shows distinct clones exhibiting divergent behaviour over time. ESR1 mutation allele frequency does not show a consistent pattern of increases during fulvestrant treatment, and progression-free survival is not different in patients with ESR1 mutations compared with wild-type patients. ESR1 mutations are not associated with clinical resistance to fulvestrant in this study.

GBM-associated mutations and altered protein expression are more common in young patients.

PubMed

Ferguson, Sherise D; Xiu, Joanne; Weathers, Shiao-Pei; Zhou, Shouhao; Kesari, Santosh; Weiss, Stephanie E; Verhaak, Roeland G; Hohl, Raymond J; Barger, Geoffrey R; Reddy, Sandeep K; Heimberger, Amy B

2016-10-25

Geriatric glioblastoma (GBM) patients have a poorer prognosis than younger patients, but IDH1/2 mutations (more common in younger patients) confer a favorable prognosis. We compared key GBM molecular alterations between an elderly (age ≥ 70) and younger (18 < = age < = 45) cohort to explore potential therapeutic opportunities. Alterations more prevalent in the young GBM cohort compared to the older cohort (P < 0.05) were: overexpression of ALK, RRM1, TUBB3 and mutation of ATRX, BRAF, IDH1, and TP53. However, PTEN mutation was significantly more frequent in older patients. Among patients with wild-type IDH1/2 status, TOPO1 expression was higher in younger patients, whereas MGMT methylation was more frequent in older patients. Within the molecularly-defined IDH wild-type GBM cohort, younger patients had significantly more mutations in PDGFRA, PTPN11, SMARCA4, BRAF and TP53. GBMs from 178 elderly patients and 197 young patients were analyzed using DNA sequencing, immunohistochemistry, in situ hybridization, and MGMT-methylation assay to ascertain mutational and amplification/expressional status. Significant molecular differences occurred in GBMs from elderly and young patients. Except for the older cohort's more frequent PTEN mutation and MGMT methylation, younger patients had a higher frequency of potential therapeutic targets.

[From gene to disease; genetic causes of hearing loss and visual impairment sometimes accompanied by vestibular problems (Usher syndrome)].

PubMed

Pennings, R J E; Kremer, H; Deutman, A F; Kimberling, W J; Cremers, C W R J

2002-12-07

Usher syndrome is an autosomal recessively inherited disease, characterised by sensorineural hearing loss, tapetoretinal degeneration and in some cases vestibular problems. Based on the clinical heterogeneity, the disease can be classified into three clinical types (I, II and III), which have their own genetic subtypes (Usher 1A-Usher IG, Usher 2A-Usher 2C and Usher 3). The majority of the Usher type I cases are caused by mutations in the MYO7A gene (Usher 1B) while mutations in the USH2A gene (Usher 2A) are the cause of most cases of type II. Usher syndrome type III, caused by mutations in the USH3 gene, is frequently seen only in Finland.

Coexistence of JAK2 and CALR mutations and their clinical implications in patients with essential thrombocythemia.

PubMed

Kang, Min-Gu; Choi, Hyun-Woo; Lee, Jun Hyung; Choi, Yong Jun; Choi, Hyun-Jung; Shin, Jong-Hee; Suh, Soon-Pal; Szardenings, Michael; Kim, Hye-Ran; Shin, Myung-Geun

2016-08-30

Janus kinase 2 (JAK2) and calreticulin (CALR) constitute the two most frequent mutations in essential thrombocythemia (ET), and both are reported to be mutually exclusive. Hence, we examined a cohort of 123 myeloproliferative neoplasm (MPN) patients without BCR-ABL1 rearrangement and additional ET patients (n=96) for coexistence of JAK2 and CALR mutations. The frequency of CALR mutations was 20.3% in 123 MPN patients; 31.1% in ET (n=74), 25% in primary myelofibrosis (n=4) and 2.2% in polycythemia vera (n=45). JAK2 and CALR mutations coexisted in 7 (4.2%) of 167 ET patients. Clinical characteristics, progression-free survival (PFS), and elapsed time to achieve partial remission across 4 groups (JAK2+/CALR+, JAK2+/CALR-, JAK2-/CALR+, JAK2-/CALR-) were reviewed. The JAK2+/CALR- group had higher leukocyte counts and hemoglobin levels and more frequent thrombotic events than JAK2-/CALR- group. JAK2 mutations have a greater effect on the disease phenotype and the clinical features of MPN patients rather than do CALR mutation. JAK2+ groups showed a tendency of poor PFS than JAK2- groups regardless of CALR mutation. CALR+ was a predictor of late response to the treatment. Our study also showed that thrombosis was more frequent in ET patients with type 2 CALR mutations than in those with type 1 CALR mutations.

An Usher syndrome type 1 patient diagnosed before the appearance of visual symptoms by MYO7A mutation analysis.

PubMed

Yoshimura, Hidekane; Iwasaki, Satoshi; Kanda, Yukihiko; Nakanishi, Hiroshi; Murata, Toshinori; Iwasa, Yoh-ichiro; Nishio, Shin-ya; Takumi, Yutaka; Usami, Shin-ichi

2013-02-01

Usher syndrome type 1 (USH1) appears to have only profound non-syndromic hearing loss in childhood and retinitis pigmentosa develops in later years. This study examined the frequency of USH1 before the appearance of visual symptoms in Japanese deaf children by MYO7A mutation analysis. We report the case of 6-year-old male with profound hearing loss, who did not have visual symptoms. The frequency of MYO7A mutations in profound hearing loss children is also discussed. We sequenced all exons of the MYO7A gene in 80 Japanese children with severe to profound non-syndromic HL not due to mutations of the GJB2 gene (ages 0-14 years). A total of nine DNA variants were found and six of them were presumed to be non-pathogenic variants. In addition, three variants of them were found in two patients (2.5%) with deafness and were classified as possible pathogenic variants. Among them, at least one nonsense mutation and one missense mutation from the patient were confirmed to be responsible for deafness. After MYO7A mutation analysis, the patient was diagnosed with RP, and therefore, also diagnosed with USH1. This is the first case report to show the advantage of MYO7A mutation analysis to diagnose USH1 before the appearance of visual symptoms. We believed that MYO7A mutation analysis is valid for the early diagnosis of USH1. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.