Sample records for mtrc terminal reductases

  1. Kinetic Characterization of OmcA and MtrC, Terminal Reductases Involved in Respiratory Electron Transfer for Dissimilatory Iron Reduction in Shewanella oneidensis MR-1▿

    PubMed Central

    Ross, Daniel E.; Brantley, Susan L.; Tien, Ming


    We have used scaling kinetics and the concept of kinetic competence to elucidate the role of hemeproteins OmcA and MtrC in iron reduction by Shewanella oneidensis MR-1. Second-order rate constants for OmcA and MtrC were determined by single-turnover experiments. For soluble iron species, a stopped-flow apparatus was used, and for the less reactive iron oxide goethite, a conventional spectrophotometer was used to measure rates. Steady-state experiments were performed to obtain molecular rate constants by quantifying the OmcA and MtrC contents of membrane fractions and whole cells by Western blot analysis. For reduction of soluble iron, rates determined from transient-state experiments were able to account for rates obtained from steady-state experiments. However, this was not true with goethite; rate constants determined from transient-state experiments were 100 to 1,000 times slower than those calculated from steady-state experiments with membrane fractions and whole cells. In contrast, addition of flavins to the goethite experiments resulted in rates that were consistent with both transient- and steady-state experiments. Kinetic simulations of steady-state results with kinetic constants obtained from transient-state experiments supported flavin involvement. Therefore, we show for the first time that OmcA and MtrC are kinetically competent to account for catalysis of soluble iron reduction in whole Shewanella cells but are not responsible for electron transfer via direct contact alone with insoluble iron-containing minerals. This work supports the hypothesis that electron shuttles are important participants in the reduction of solid Fe phases by this organism. PMID:19542342

  2. Targeted protein degradation of outer membrane decaheme cytochrome MtrC metal reductase in Shewanella oneidensis MR-1 measured using biarsenical probe CrAsH-EDT(2).


    Xiong, Yijia; Chen, Baowei; Shi, Liang; Fredrickson, James K; Bigelow, Diana J; Squier, Thomas C


    Development of efficient microbial biofuel cells requires an ability to exploit interfacial electron transfer reactions to external electron acceptors, such as metal oxides; such reactions occur in the facultative anaerobic Gram-negative bacterium Shewanella oneidensis MR-1 through the catalytic activity of the outer membrane decaheme c-type cytochrome MtrC. Central to the utility of this pathway to synthetic biology is an understanding of cellular mechanisms that maintain optimal MtrC function, cellular localization, and renewal by degradation and resynthesis. In order to monitor trafficking to the outer membrane, and the environmental sensitivity of MtrC, we have engineered a tetracysteine tag (i.e., CCPGCC) at its C-terminus that permits labeling by the cell impermeable biarsenical fluorophore carboxy-FlAsH (CrAsH) of MtrC at the surface of living Shewanella oneidensis MR-1 cells. In comparison, the cell permeable reagent FlAsH permits labeling of the entire population of MtrC, including proteolytic fragments resulting from incorrect maturation. We demonstrate specific labeling by CrAsH of engineered MtrC (MtrC*) which is dependent on the presence of a functional type 2 secretion system (T2S), as evidenced by T2S system gspD or gspG deletion mutants which are incapable of CrAsH labeling. Under these latter conditions, MtrC* undergoes proteolytic degradation to form a large 35-38 kDa fragment; this degradation product is also resolved during normal turnover of the CrAsH-labeled MtrC protein. No MtrC protein is released into the medium during turnover, suggesting the presence of cellular turnover systems involving MtrC reuptake and degradation. The mature MtrC localized on the outer membrane is a long-lived protein, with a turnover rate of 0.043 h(-1) that is insensitive to O(2) concentration. Maturation of MtrC is relatively inefficient, with substantial rates of turnover of the immature protein prior to export to the outer membrane (i.e., 0.028 h(-1)) that are

  3. Targeted Protein Degradation of Outer Membrane Decaheme Cytochrome MtrC Metal Reductase in Shewanella oneidensis MR-1 Measured Using Biarsenical Probe CrAsH-EDT2

    SciTech Connect

    Xiong, Yijia; Chen, Baowei; Shi, Liang; Fredrickson, Jim K.; Bigelow, Diana J.; Squier, Thomas C.


    Development of efficient microbial biofuel cells requires an ability to exploit interfacial electron transfer reactions to external electron acceptors, such as metal oxides; such reactions occur in the facultative anaerobic gram-negative bacterium Shewanella oneidensis MR-1 through the catalytic activity of the outer membrane decaheme c-type cytochrome MtrC. Central to the utility of this pathway to synthetic biology is an understanding of cellular mechanisms that maintain optimal MtrC function, cellular localization, and renewal by degradation and resynthesis. In order to monitor trafficking to the outer membrane, and the environmental sensitivity of MtrC, we have engineered a tetracysteine tag (i.e., CCPGCC) at its C-terminus that permits labeling by the cell impermeable biarsenical fluorophore, carboxy-FlAsH (CrAsH) of MtrC at the surface of living Shewanella oneidensis MR-1 cells. In comparison, the cell permeable reagent FlAsH permits labeling of the entire population of MtrC, including proteolytic fragments resulting from incorrect maturation. We demonstrate specific labeling by CrAsH of engineered MtrC which is dependent on the presence of a functional type-2 secretion system (T2S), as evidenced by T2S system gspD or gspG deletion mutants which are incapable of CrAsH labeling. Under these latter conditions, MtrC undergoes proteolytic degradation to form a large 35-38 kDa fragment; this degradation product is also resolved during normal turnover of the CrAsH-labeled MtrC protein. No MtrC protein is released into the medium during turnover, suggesting the presence of cellular turnover systems involving MtrC reuptake and degradation. The mature MtrC localized on the outer membrane is a long-lived protein, with a turnover rate of 0.043 hr-1 that is insensitive to O2 concentration. Maturation of MtrC is relatively inefficient, with substantial rates of turnover of the immature protein prior to export to the outer membrane (i.e., 0.028 hr-1) that are consistent

  4. Electrochemical interaction of Shewanella oneidensis MR-1 and its outer membrane cytochromes OmcA and MtrC with hematite electrodes

    NASA Astrophysics Data System (ADS)

    Meitl, Leisa A.; Eggleston, Carrick M.; Colberg, Patricia J. S.; Khare, Nidhi; Reardon, Catherine L.; Shi, Liang


    Bacterial metal reduction is an important biogeochemical process in anaerobic environments. An understanding of electron transfer pathways from dissimilatory metal-reducing bacteria (DMRB) to solid phase metal (hydr)oxides is important for understanding metal redox cycling in soils and sediments, for utilizing DMRB in bioremedation, and for developing technologies such as microbial fuel cells. Here we hypothesize that the outer membrane cytochromes OmcA and MtrC from Shewanella oneidensis MR-1 are the only terminal reductases capable of direct electron transfer to a hematite working electrode. Cyclic voltammetry (CV) was used to study electron transfer between hematite electrodes and protein films, S. oneidensis MR-1 wild-type cell suspensions, and cytochrome deletion mutants. After controlling for hematite electrode dissolution at negative potential, the midpoint potentials of adsorbed OmcA and MtrC were measured (-201 mV and -163 mV vs. Ag/AgCl, respectively). Cell suspensions of wild-type MR-1, deletion mutants deficient in OmcA (Δ omcA), MtrCmtrC), and both OmcA and MtrC (Δ mtrC-Δ omcA) were also studied; voltammograms for Δ mtrC-Δ omcA were indistinguishable from the control. When the control was subtracted from the single deletion mutant voltammograms, redox peaks were consistent with the present cytochrome (i.e., Δ omcA consistent with MtrC and Δ mtrC consistent with OmcA). The results indicate that OmcA and MtrC are capable of direct electron exchange with hematite electrodes, consistent with a role as terminal reductases in the S. oneidensis MR-1 anaerobic respiratory pathway involving ferric minerals. There was no evidence for other terminal reductases operating under the conditions investigated. A Marcus-based approach to electron transfer kinetics indicated that the rate constant for electron transfer ket varies from 0.025 s -1 in the absence of a barrier to 63.5 s -1 with a 0.2 eV barrier.

  5. Isolation of a high-affinity functional protein complex between OmcA and MtrC: Two outer membrane decaheme c-type cytochromes of Shewanella oneidensis MR-1.


    Shi, Liang; Chen, Baowei; Wang, Zheming; Elias, Dwayne A; Mayer, M Uljana; Gorby, Yuri A; Ni, Shuison; Lower, Brian H; Kennedy, David W; Wunschel, David S; Mottaz, Heather M; Marshall, Matthew J; Hill, Eric A; Beliaev, Alexander S; Zachara, John M; Fredrickson, James K; Squier, Thomas C


    Shewanella oneidensis MR-1 is a facultatively anaerobic bacterium capable of using soluble and insoluble forms of manganese [Mn(III/IV)] and iron [Fe(III)] as terminal electron acceptors during anaerobic respiration. To assess the structural association of two outer membrane-associated c-type decaheme cytochromes (i.e., OmcA [SO1779] and MtrC [SO1778]) and their ability to reduce soluble Fe(III)-nitrilotriacetic acid (NTA), we expressed these proteins with a C-terminal tag in wild-type S. oneidensis and a mutant deficient in these genes (i.e., Delta omcA mtrC). Endogenous MtrC copurified with tagged OmcA in wild-type Shewanella, suggesting a direct association. To further evaluate their possible interaction, both proteins were purified to near homogeneity following the independent expression of OmcA and MtrC in the Delta omcA mtrC mutant. Each purified cytochrome was confirmed to contain 10 hemes and exhibited Fe(III)-NTA reductase activity. To measure binding, MtrC was labeled with the multiuse affinity probe 4',5'-bis(1,3,2-dithioarsolan-2-yl)fluorescein (1,2-ethanedithiol)2, which specifically associates with a tetracysteine motif engineered at the C terminus of MtrC. Upon titration with OmcA, there was a marked increase in fluorescence polarization indicating the formation of a high-affinity protein complex (Kd < 500 nM) between MtrC and OmcA whose binding was sensitive to changes in ionic strength. Following association, the OmcA-MtrC complex was observed to have enhanced Fe(III)-NTA reductase specific activity relative to either protein alone, demonstrating that OmcA and MtrC can interact directly with each other to form a stable complex that is consistent with their role in the electron transport pathway of S. oneidensis MR-1.

  6. Isolation of a High-Affinity Functional Protein Complex between OmcA and MtrC: Two Outer Membrane Decaheme c-Type Cytochromes of Shewanella oneidensis MR-1

    PubMed Central

    Shi, Liang; Chen, Baowei; Wang, Zheming; Elias, Dwayne A.; Mayer, M. Uljana; Gorby, Yuri A.; Ni, Shuison; Lower, Brian H.; Kennedy, David W.; Wunschel, David S.; Mottaz, Heather M.; Marshall, Matthew J.; Hill, Eric A.; Beliaev, Alexander S.; Zachara, John M.; Fredrickson, James K.; Squier, Thomas C.


    Shewanella oneidensis MR-1 is a facultatively anaerobic bacterium capable of using soluble and insoluble forms of manganese [Mn(III/IV)] and iron [Fe(III)] as terminal electron acceptors during anaerobic respiration. To assess the structural association of two outer membrane-associated c-type decaheme cytochromes (i.e., OmcA [SO1779] and MtrC [SO1778]) and their ability to reduce soluble Fe(III)-nitrilotriacetic acid (NTA), we expressed these proteins with a C-terminal tag in wild-type S. oneidensis and a mutant deficient in these genes (i.e., ΔomcA mtrC). Endogenous MtrC copurified with tagged OmcA in wild-type Shewanella, suggesting a direct association. To further evaluate their possible interaction, both proteins were purified to near homogeneity following the independent expression of OmcA and MtrC in the ΔomcA mtrC mutant. Each purified cytochrome was confirmed to contain 10 hemes and exhibited Fe(III)-NTA reductase activity. To measure binding, MtrC was labeled with the multiuse affinity probe 4′,5′-bis(1,3,2-dithioarsolan-2-yl)fluorescein (1,2-ethanedithiol)2, which specifically associates with a tetracysteine motif engineered at the C terminus of MtrC. Upon titration with OmcA, there was a marked increase in fluorescence polarization indicating the formation of a high-affinity protein complex (Kd < 500 nM) between MtrC and OmcA whose binding was sensitive to changes in ionic strength. Following association, the OmcA-MtrC complex was observed to have enhanced Fe(III)-NTA reductase specific activity relative to either protein alone, demonstrating that OmcA and MtrC can interact directly with each other to form a stable complex that is consistent with their role in the electron transport pathway of S. oneidensis MR-1. PMID:16788180

  7. Electrochemical interaction of Shewanella oneidensis MR-1 and its outer membrane cytochromes OmcA and MtrC with hematite electrodes

    SciTech Connect

    Meitl, Leisa A.; Eggleston, Carrick M.; Colberg, Patricia J.; Khare, Nidhi; Reardon, Catherine L.; Shi, Liang


    Bacterial metal reduction is an important biogeochemical process in anaerobic environments. An understanding of electron transfer pathways from dissimilatory metal reducing bacteria (DMRB) to solid phase metal (hydr)oxides is important for understanding metal redox cycling in soils and sediments, for utilizing DMRB in bioremedation, and for developing technologies such as microbial fuel cells. Here we hypothesize that the outer membrane cytochromes OmcA and MtrC from Shewanella oneidensis MR-1 are the only terminal reductases capable of direct electron transfer to a hematite working electrode. Cyclic voltammetry (CV) was used to study electron transfer between hematite electrodes and protein films, S. oneidensis MR-1 wild-type cell suspensions, and cytochrome deletion mutants. After controlling for hematite electrode dissolution at negative potential, the midpoint potentials of adsorbed OmcA and MtrC were measured (-201 mV and -163 mV vs. Ag/AgCl, respectively). Cell suspensions of wild-type MR-1, deletion mutants deficient in OmcA (ΔomcA), MtrC (ΔmtrC), and both OmcA and MtrC (ΔmtrC-ΔomcA) were also studied; voltammograms for ΔmtrC-ΔomcA were indistinguishable from the control. When the control was subtracted from the single deletion mutant voltammograms, redox peaks were consistent with the present cytochrome (i.e., ΔomcA consistent with MtrC and ΔmtrC consistent with OmcA). The results indicate that OmcA and MtrC are capable of direct electron exchange with hematite electrodes, consistent with a role as terminal reductases in the S. oneidensis MR-1 anaerobic respiratory pathway involving ferric minerals. There was no evidence for other terminal reductases operating under the conditions investigated. A Marcus-based approach to electron transfer kinetics indicated that the rate constant for electron transfer ket varies from 0.025 s-1 in the absence of a barrier to 63.5 s-1 with a 0.2 eV barrier.

  8. Kinetics of reduction of Fe(III) complexes by outer membrane cytochromes MtrC and OmcA of Shewanella oneidensis MR-1.


    Wang, Zheming; Liu, Chongxuan; Wang, Xuelin; Marshall, Matthew J; Zachara, John M; Rosso, Kevin M; Dupuis, Michel; Fredrickson, James K; Heald, Steve; Shi, Liang


    Because of their cell surface locations, the outer membrane c-type cytochromes MtrC and OmcA of Shewanella oneidensis MR-1 have been suggested to be the terminal reductases for a range of redox-reactive metals that form poorly soluble solids or that do not readily cross the outer membrane. In this work, we determined the kinetics of reduction of a series of Fe(III) complexes with citrate, nitrilotriacetic acid (NTA), and EDTA by MtrC and OmcA using a stopped-flow technique in combination with theoretical computation methods. Stopped-flow kinetic data showed that the reaction proceeded in two stages, a fast stage that was completed in less than 1 s, followed by a second, relatively slower stage. For a given complex, electron transfer by MtrC was faster than that by OmcA. For a given cytochrome, the reaction was completed in the order Fe-EDTA > Fe-NTA > Fe-citrate. The kinetic data could be modeled by two parallel second-order bimolecular redox reactions with second-order rate constants ranging from 0.872 microM(-1) s(-1) for the reaction between MtrC and the Fe-EDTA complex to 0.012 microM(-1) s(-1) for the reaction between OmcA and Fe-citrate. The biphasic reaction kinetics was attributed to redox potential differences among the heme groups or redox site heterogeneity within the cytochromes. The results of redox potential and reorganization energy calculations showed that the reaction rate was influenced mostly by the relatively large reorganization energy. The results demonstrate that ligand complexation plays an important role in microbial dissimilatory reduction and mineral transformation of iron, as well as other redox-sensitive metal species in nature.

  9. Kinetics of Reduction of Fe(III) Complexes by Outer Membrane Cytochromes MtrC and OmcA of Shewanella oneidensis MR-1▿

    PubMed Central

    Wang, Zheming; Liu, Chongxuan; Wang, Xuelin; Marshall, Matthew J.; Zachara, John M.; Rosso, Kevin M.; Dupuis, Michel; Fredrickson, James K.; Heald, Steve; Shi, Liang


    Because of their cell surface locations, the outer membrane c-type cytochromes MtrC and OmcA of Shewanella oneidensis MR-1 have been suggested to be the terminal reductases for a range of redox-reactive metals that form poorly soluble solids or that do not readily cross the outer membrane. In this work, we determined the kinetics of reduction of a series of Fe(III) complexes with citrate, nitrilotriacetic acid (NTA), and EDTA by MtrC and OmcA using a stopped-flow technique in combination with theoretical computation methods. Stopped-flow kinetic data showed that the reaction proceeded in two stages, a fast stage that was completed in less than 1 s, followed by a second, relatively slower stage. For a given complex, electron transfer by MtrC was faster than that by OmcA. For a given cytochrome, the reaction was completed in the order Fe-EDTA > Fe-NTA > Fe-citrate. The kinetic data could be modeled by two parallel second-order bimolecular redox reactions with second-order rate constants ranging from 0.872 μM−1 s−1 for the reaction between MtrC and the Fe-EDTA complex to 0.012 μM−1 s−1 for the reaction between OmcA and Fe-citrate. The biphasic reaction kinetics was attributed to redox potential differences among the heme groups or redox site heterogeneity within the cytochromes. The results of redox potential and reorganization energy calculations showed that the reaction rate was influenced mostly by the relatively large reorganization energy. The results demonstrate that ligand complexation plays an important role in microbial dissimilatory reduction and mineral transformation of iron, as well as other redox-sensitive metal species in nature. PMID:18791025

  10. MTRC compensation in high-resolution ISAR imaging via improved polar format algorithm

    NASA Astrophysics Data System (ADS)

    Liu, Yang; Li, Hao; Li, Na; Xu, Shiyou; Chen, Zengping


    Migration through resolution cells (MTRC) is generated in high-resolution inverse synthetic aperture radar (ISAR) imaging. A MTRC compensation algorithm for high-resolution ISAR imaging based on improved polar format algorithm (PFA) is proposed in this paper. Firstly, in the situation that a rigid-body target stably flies, the initial value of the rotation angle and center of the target is obtained from the rotation of radar line of sight (RLOS) and high range resolution profile (HRRP). Then, the PFA is iteratively applied to the echo data to search the optimization solution based on minimum entropy criterion. The procedure starts with the estimated initial rotation angle and center, and terminated when the entropy of the compensated ISAR image is minimized. To reduce the computational load, the 2-D iterative search is divided into two 1-D search. One is carried along the rotation angle and the other one is carried along rotation center. Each of the 1-D searches is realized by using of the golden section search method. The accurate rotation angle and center can be obtained when the iterative search terminates. Finally, apply the PFA to compensate the MTRC by the use of the obtained optimized rotation angle and center. After MTRC compensation, the ISAR image can be best focused. Simulated and real data demonstrate the effectiveness and robustness of the proposed algorithm.

  11. Antibody Recognition Force Microscopy Shows that Outer Membrane Cytochromes OmcA and MtrC Are Expressed on the Exterior Surface of Shewanella oneidensis MR-1▿

    PubMed Central

    Lower, Brian H.; Yongsunthon, Ruchirej; Shi, Liang; Wildling, Linda; Gruber, Hermann J.; Wigginton, Nicholas S.; Reardon, Catherine L.; Pinchuk, Grigoriy E.; Droubay, Timothy C.; Boily, Jean-François; Lower, Steven K.


    Antibody recognition force microscopy showed that OmcA and MtrC are expressed on the exterior surface of living Shewanella oneidensis MR-1 cells when Fe(III), including solid-phase hematite (Fe2O3), was the terminal electron acceptor. OmcA was localized to the interface between the cell and mineral. MtrC displayed a more uniform distribution across the cell surface. Both cytochromes were associated with an extracellular polymeric substance. PMID:19286784

  12. Antibody recognition force microscopy shows that outer membrane cytochromes OmcA and MtrC are expressed on the exterior surface of Shewanella oneidensis MR-1

    SciTech Connect

    Lower, Brian H.; Yongsunthon, Ruchirej; Shi, Liang; Wildling, Linda; Gruber, Hermann J.; Wigginton, Nicholas S.; Reardon, Catherine L.; Pinchuk, Grigoriy E.; Droubay, Timothy C.; Boily, Jean F.; Lower, Steven


    Antibody-recognition force microscopy showed that OmcA and MtrC are expressed on the exterior surface of living Shewanella oneidensis MR-1 cells during anaerobic growth, when Fe(III) served as the terminal electron acceptor. OmcA was localized to the interface with hematite, while MtrC was more uniformly displayed on the bacterium’s exterior cell surface. Both cytochromes were also found associated with extracellular material.

  13. Antibody recognition force microscopy shows that outer membrane cytochromes OmcA and MtrC are expressed on the exterior surface of Shewanella oneidensis MR-1.


    Lower, Brian H; Yongsunthon, Ruchirej; Shi, Liang; Wildling, Linda; Gruber, Hermann J; Wigginton, Nicholas S; Reardon, Catherine L; Pinchuk, Grigoriy E; Droubay, Timothy C; Boily, Jean-François; Lower, Steven K


    Antibody recognition force microscopy showed that OmcA and MtrC are expressed on the exterior surface of living Shewanella oneidensis MR-1 cells when Fe(III), including solid-phase hematite (Fe(2)O(3)), was the terminal electron acceptor. OmcA was localized to the interface between the cell and mineral. MtrC displayed a more uniform distribution across the cell surface. Both cytochromes were associated with an extracellular polymeric substance.

  14. Direct Involvement of Type II Secretion System in Extracellular Translocation of Shewanella Oneidensis Outer Membrane Cytochromes MtrC and OmcA

    SciTech Connect

    Shi, Liang; Deng, Shuang; Marshall, Matthew J.; Wang, Zheming; Kennedy, David W.; Dohnalkova, Alice; Mottaz, Heather M.; Hill, Eric A.; Gorby, Yuri A.; Beliaev, Alex S.; Richardson, David J.; Zachara, John M.; Fredrickson, Jim K.


    Outer membrane decaheme c-type cytochromes MtrC and OmcA of Shewanella oneidensis MR-1 are extracellular lipoproteins important for dissimilatory reduction of solid metal (hydr)oxides during anaerobic respiration. To investigate the roles of type II secretion system (T2S) in translocation of MtrC and OmcA across outer membrane, we measured the effects of deleting two T2S genes, gspD and gspG, on the secretion of MtrC and OmcA when cells were grown under anaerobic conditions. Deletion of gspD or gspG resulted in slightly yellowish supernatants, different from the pink supernatant of wild type (wt). Comparative proteomic analyses revealed that, although MtrC, OmcA and NrfA, a periplasmic nitrite reductase, were present the supernatants of wt and ΔgspD mutant, their peptides counts were much lower in ΔgspD than in wt. Subsequent analyses with heme-staining and Western blot not only confirmed that deletion of gspD or gspG reduced the abundances of MtrC and OmcA in the supernatants, but also revealed that the deletions consequently increased their abundances inside the cells. Complementation of ΔgspG mutant with functional GspG could reverse the effects of deleting gspG on the colors of the supernatants and the abundances of MtrC and OmcA. In contrast, Western results showed that the abundance of NrfA was reduced in the supernatant and the cells of ΔgspD mutant, suggesting that reduced NrfA in the periplasm, where MtrC and OmcA were accumulated, contributed to its reduction in the supernatant. Thus, our results demonstrate at the first time that T2S facilitates translocation of MtrC and OmcA across outer membrane.

  15. Flavin Binding to the Deca-heme Cytochrome MtrC: Insights from Computational Molecular Simulation

    PubMed Central

    Breuer, Marian; Rosso, Kevin M.; Blumberger, Jochen


    Certain dissimilatory bacteria have the remarkable ability to use extracellular metal oxide minerals instead of oxygen as terminal electron sinks, using a process known as “extracellular respiration”. Specialized multiheme cytochromes located on the outer membrane of the microbe were shown to be crucial for electron transfer from the cell surface to the mineral. This process is facilitated by soluble, biogenic flavins secreted by the organism for the purpose of acting as an electron shuttle. However, their interactions with the outer-membrane cytochromes are not established on a molecular scale. Here, we study the interaction between the outer-membrane deca-heme cytochrome MtrC from Shewanella oneidensis and flavin mononucleotide (FMN in fully oxidized quinone form) using computational docking. We find that interaction of FMN with MtrC is significantly weaker than with known FMN-binding proteins, but identify a mildly preferred interaction site close to heme 2 with a dissociation constant (Kd) = 490 μM, in good agreement with recent experimental estimates, Kd = 255 μM. The weak interaction with MtrC can be qualitatively explained by the smaller number of hydrogen bonds that the planar headgroup of FMN can form with this protein compared to FMN-binding proteins. Molecular dynamics simulation gives indications for a possible conformational switch upon cleavage of the disulphide bond of MtrC, but without concomitant increase in binding affinities according to this docking study. Overall, our results suggest that binding of FMN to MtrC is reversible and not highly specific, which may be consistent with a role as redox shuttle that facilitates extracellular respiration. PMID:26682818

  16. Flavin Binding to the Deca-heme Cytochrome MtrC: Insights from Computational Molecular Simulation.


    Breuer, Marian; Rosso, Kevin M; Blumberger, Jochen


    Certain dissimilatory bacteria have the remarkable ability to use extracellular metal oxide minerals instead of oxygen as terminal electron sinks, using a process known as "extracellular respiration". Specialized multiheme cytochromes located on the outer membrane of the microbe were shown to be crucial for electron transfer from the cell surface to the mineral. This process is facilitated by soluble, biogenic flavins secreted by the organism for the purpose of acting as an electron shuttle. However, their interactions with the outer-membrane cytochromes are not established on a molecular scale. Here, we study the interaction between the outer-membrane deca-heme cytochrome MtrC from Shewanella oneidensis and flavin mononucleotide (FMN in fully oxidized quinone form) using computational docking. We find that interaction of FMN with MtrC is significantly weaker than with known FMN-binding proteins, but identify a mildly preferred interaction site close to heme 2 with a dissociation constant (Kd) = 490 μM, in good agreement with recent experimental estimates, Kd = 255 μM. The weak interaction with MtrC can be qualitatively explained by the smaller number of hydrogen bonds that the planar headgroup of FMN can form with this protein compared to FMN-binding proteins. Molecular dynamics simulation gives indications for a possible conformational switch upon cleavage of the disulphide bond of MtrC, but without concomitant increase in binding affinities according to this docking study. Overall, our results suggest that binding of FMN to MtrC is reversible and not highly specific, which may be consistent with a role as redox shuttle that facilitates extracellular respiration.

  17. Characterization of Shewanella oneidensis MtrC: a cell-surface decaheme cytochrome involved in respiratory electron transport to extracellular electron acceptors

    SciTech Connect

    Hartshorne, Robert S.; Jepson, Brian N.; Clarke, Thomas A.; Field, Sarah J.; Fredrickson, Jim K.; Zachara, John M.; Shi, Liang; Butt, Julea N.; Richardson, David


    Abstract MtrC is a decaheme c-type cytochrome associated with the outer cell membrane of Fe(III)-respiring species of the Shewanella genus. It is proposed to play a role in anaerobic respiration by mediating electron transfer to extracellular mineral oxides that can serve as terminal electron acceptors. The present work presents the first spectropotentiometric and voltammetric characterization of MtrC, using protein purified from Shewanella oneidensis MR-1. Potentiometric titrations, monitored by UV–vis absorption and electron paramagnetic resonance (EPR) spectroscopy, reveal that the hemes within MtrC titrate over a broad potential range spanning between approximately +100 and approximately *500 mV (vs. the standard hydrogen electrode). Across this potential window the UV– vis absorption spectra are characteristic of low-spin c-type hemes and the EPR spectra reveal broad, complex features that suggest the presence of magnetically spin-coupled lowspin c-hemes. Non-catalytic protein film voltammetry of MtrC demonstrates reversible electrochemistry over a potential window similar to that disclosed spectroscopically. The voltammetry also allows definition of kinetic properties of MtrC in direct electron exchange with a solid electrode surface and during reduction of a model Fe(III) substrate. Taken together, the data provide quantitative information on the potential domain in which MtrC can operate.

  18. Flavin binding to the deca-heme cytochrome MtrC: Insights from computational molecular simulation


    Breuer, Marian; Rosso, Kevin  M.; Blumberger, Jochen


    Here, certain dissimilatory bacteria have the remarkable ability to use extracellular metal oxide minerals instead of oxygen as terminal electron sinks, using a process known as “extracellular respiration”. Specialized multiheme cytochromes located on the outer membrane of the microbe were shown to be crucial for electron transfer from the cell surface to the mineral. This process is facilitated by soluble, biogenic flavins secreted by the organism for the purpose of acting as an electron shuttle. However, their interactions with the outer-membrane cytochromes are not established on a molecular scale. Here, we study the interaction between the outer-membrane deca-heme cytochrome MtrCmore » from Shewanella oneidensis and flavin mononucleotide (FMN in fully oxidized quinone form) using computational docking. We find that interaction of FMN with MtrC is significantly weaker than with known FMN-binding proteins, but identify a mildly preferred interaction site close to heme 2 with a dissociation constant (Kd) = 490 μM, in good agreement with recent experimental estimates, Kd = 255 μM. The weak interaction with MtrC can be qualitatively explained by the smaller number of hydrogen bonds that the planar headgroup of FMN can form with this protein compared to FMN-binding proteins. Molecular dynamics simulation gives indications for a possible conformational switch upon cleavage of the disulphide bond of MtrC, but without concomitant increase in binding affinities according to this docking study. Overall, our results suggest that binding of FMN to MtrC is reversible and not highly specific, which may be consistent with a role as redox shuttle that facilitates extracellular respiration.« less

  19. Kinetics of Reduction of Fe(III) Complexes by Outer Membrane Cytochromes MtrC and OmcA of Shewanella oneidensis MR-1

    SciTech Connect

    Wang, Zheming; Liu, Chongxuan; Wang, Xuelin; Marshall, Matthew J.; Zachara, John M.; Rosso, Kevin M.; Dupuis, Michel; Fredrickson, Jim K.; Heald, Steve M.; Shi, Liang


    Shewanella Oneidensis MR-1 possesses up to 42 c-type cytochromes with heme content varying between 1 to as many as 37. Among them, the outer-membrane cytochromes, particularly MtrC and OmcA, are suspected to function as terminal reductases and are responsible for its enzymatic catalysis capability. So far, the mechanisms of metal reduction by these outer-membrane cytochromes are unknown. In this work, we report the study of reduction kinetics of a series of Fe(III) complexes with citrate, NTA and EDTA by abiotically reduced MtrC and OmcA using a stopped-flow technique in combination with theoretical computation methods within the framework of the electron transfer theory of Marcus and speciation calculations based on the current thermodynamic database. Stopped-flow kinetic data showed that the reaction was very fast and appeared to proceed in two stages, a fast stage that completes in much less than a second and a slower stage afterwards. For a given complex, the reaction is faster by reduction with MtrC than OmcA, while for a given protein, the reaction completes in the decreasing order of Fe-EDTA > Fe-NTA > Fe-citrate. All the stopped-flow kinetic curves could be modeled by two parallel second-order bimolecular redox reactions with second-order rate constants ranging from 0.872 µM-1s-1 for the fast reaction between MtrC with Fe-EDTA complex to 0.012 µM-1s-1 for the slow reaction between OmcA and Fe-citrate complex. Speciation calculations indicated that at both metal:ligand ratios, 1:1.5 and 1:10, a single dominant ferric complex was responsible for the observed reaction for each ligand and, therefore, the observed dual-reaction pathways was attributed to the differences in the reduction behavior among various heme groups within each protein. The results of redox potential calculations with known thermodynamic data show only small differences on the scale of a few millivolts among the three complexes, suggested that

  20. Role of outer membrane c-type cytochromes MtrC and OmcA in Shewanella oneidensis MR-1 cell production, accumulation, and detachment during respiration on hematite.


    Mitchell, A C; Peterson, L; Reardon, C L; Reed, S B; Culley, D E; Romine, M R; Geesey, G G


    The iron-reducing bacterium Shewanella oneidensis MR-1 has the capacity to contribute to iron cycling over the long term by respiring on crystalline iron oxides such as hematite when poorly crystalline phases are depleted. The ability of outer membrane cytochromes OmcA and MtrC of MR-1 to bind to and transfer electrons to hematite has led to the suggestion that they function as terminal reductases when this mineral is used as a respiratory substrate. Differences in their redox behavior and hematite-binding properties, however, indicate that they play different roles in the electron transfer reaction. Here, we investigated how these differences in cytochrome behavior with respect to hematite affected biofilm development when the mineral served as terminal electron acceptor (TEA). Upon attachment to hematite, cells of the wild-type (WT) strain as well as those of a ΔomcA mutant but not those of a ΔmtrC mutant replicated and accumulated on the mineral surface. The results indicate that MtrC but not OmcA is required for growth when this mineral serves as TEA. While an OmcA deficiency did not impede cell replication and accumulation on hematite prior to achievement of a maximum surface cell density comparable to that established by WT cells, OmcA was required for efficient electron transfer and cell attachment to hematite once maximum surface cell density was achieved. OmcA may therefore play a role in overcoming barriers to electron transfer and cell attachment to hematite imposed by reductive dissolution of the mineral surface from cell respiration associated with achievement of high surface cell densities.

  1. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E


    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  2. Phosphorylation regulates activity of 7-dehydrocholesterol reductase (DHCR7), a terminal enzyme of cholesterol synthesis.


    Prabhu, Anika V; Luu, Winnie; Sharpe, Laura J; Brown, Andrew J


    Cholesterol is essential for survival, but too much or too little can cause disease. Thus, cholesterol levels must be kept within close margins. 7-dehydrocholesterol reductase (DHCR7) is a terminal enzyme of cholesterol synthesis, and is essential for embryonic development. Largely, DHCR7 research is associated with the developmental disease Smith-Lemli-Opitz syndrome, which is caused by mutations in the DHCR7 gene. However, little is known about what regulates DHCR7 activity. Here we provide evidence that phosphorylation plays a role in controlling DHCR7 activity, which may provide a means to divert flux from cholesterol synthesis to vitamin D production. DHCR7 activity was significantly decreased when we used pharmacological inhibitors against two important kinases, AMP-activated protein kinase and protein kinase A. Moreover, mutating a known phosphorylated residue, S14, also decreased DHCR7 activity. Thus, we demonstrate that phosphorylation modulates DHCR7 activity in cells, and contributes to the overall synthesis of cholesterol, and probably vitamin D. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. C-terminal tyrosine of ferredoxin-NADP+ reductase in hydride transfer processes with NAD(P)+/H.


    Tejero, Jesús; Pérez-Dorado, Inmaculada; Maya, Celia; Martínez-Júlvez, Marta; Sanz-Aparicio, Julia; Gómez-Moreno, Carlos; Hermoso, Juan A; Medina, Milagros


    Ferredoxin-NADP+ reductase (FNR) catalyzes the reduction of NADP+ to NADPH in an overall reversible reaction, showing some differences in the mechanisms between cyanobacterial and higher plant FNRs. During hydride transfer it is proposed that the FNR C-terminal Tyr is displaced by the nicotinamide. Thus, this C-terminal Tyr might be involved not only in modulating the flavin redox properties, as already shown, but also in nicotinamide binding and hydride transfer. FNR variants from the cyanobacterium Anabaena in which the C-terminal Tyr has been replaced by Trp, Phe, or Ser have been produced. All FNR variants show enhanced NADP+ and NAD+ binding, especially Tyr303Ser, which correlates with a noticeable improvement of NADH-dependent reactions. Nevertheless, the Tyr303Ser variant shows a decrease in the steady-state kcat value with NADPH. Fast kinetic analysis of the hydride transfer shows that the low efficiency observed for this mutant FNR under steady-state conditions is not due to a lack of catalytic ability but rather to the strong enzyme-coenzyme interaction. Three-dimensional structures for Tyr303Ser and Tyr303Trp variants and its complexes with NADP+ show significant differences between plant and cyanobacterial FNRs. Our results suggest that modulation of coenzyme affinity is highly influenced by the strength of the C-terminus-FAD interaction and that subtle changes between plant and cyanobacterial structures are able to modify the energy of that interaction. Additionally, it is shown that the C-terminal Tyr of FNR lowers the affinity for NADP+/H to levels compatible with steady-state turnover during the catalytic cycle, but it is not involved in the hydride transfer itself.

  4. N-terminal structure of maize ferredoxin:NADP+ reductase determines recruitment into different thylakoid membrane complexes.


    Twachtmann, Manuel; Altmann, Bianca; Muraki, Norifumi; Voss, Ingo; Okutani, Satoshi; Kurisu, Genji; Hase, Toshiharu; Hanke, Guy T


    To adapt to different light intensities, photosynthetic organisms manipulate the flow of electrons through several alternative pathways at the thylakoid membrane. The enzyme ferredoxin:NADP(+) reductase (FNR) has the potential to regulate this electron partitioning because it is integral to most of these electron cascades and can associate with several different membrane complexes. However, the factors controlling relative localization of FNR to different membrane complexes have not yet been established. Maize (Zea mays) contains three chloroplast FNR proteins with totally different membrane association, and we found that these proteins have variable distribution between cells conducting predominantly cyclic electron transport (bundle sheath) and linear electron transport (mesophyll). Here, the crystal structures of all three enzymes were solved, revealing major structural differences at the N-terminal domain and dimer interface. Expression in Arabidopsis thaliana of maize FNRs as chimeras and truncated proteins showed the N-terminal determines recruitment of FNR to different membrane complexes. In addition, the different maize FNR proteins localized to different thylakoid membrane complexes on expression in Arabidopsis, and analysis of chlorophyll fluorescence and photosystem I absorbance demonstrates the impact of FNR location on photosynthetic electron flow.

  5. N-Terminal Structure of Maize Ferredoxin:NADP+ Reductase Determines Recruitment into Different Thylakoid Membrane Complexes[W

    PubMed Central

    Twachtmann, Manuel; Altmann, Bianca; Muraki, Norifumi; Voss, Ingo; Okutani, Satoshi; Kurisu, Genji; Hase, Toshiharu; Hanke, Guy T.


    To adapt to different light intensities, photosynthetic organisms manipulate the flow of electrons through several alternative pathways at the thylakoid membrane. The enzyme ferredoxin:NADP+ reductase (FNR) has the potential to regulate this electron partitioning because it is integral to most of these electron cascades and can associate with several different membrane complexes. However, the factors controlling relative localization of FNR to different membrane complexes have not yet been established. Maize (Zea mays) contains three chloroplast FNR proteins with totally different membrane association, and we found that these proteins have variable distribution between cells conducting predominantly cyclic electron transport (bundle sheath) and linear electron transport (mesophyll). Here, the crystal structures of all three enzymes were solved, revealing major structural differences at the N-terminal domain and dimer interface. Expression in Arabidopsis thaliana of maize FNRs as chimeras and truncated proteins showed the N-terminal determines recruitment of FNR to different membrane complexes. In addition, the different maize FNR proteins localized to different thylakoid membrane complexes on expression in Arabidopsis, and analysis of chlorophyll fluorescence and photosystem I absorbance demonstrates the impact of FNR location on photosynthetic electron flow. PMID:22805436

  6. The C-terminal extension of bacterial flavodoxin-reductases: involvement in the hydride transfer mechanism from the coenzyme.


    Bortolotti, Ana; Sánchez-Azqueta, Ana; Maya, Celia M; Velázquez-Campoy, Adrián; Hermoso, Juan A; Medina, Milagros; Cortez, Néstor


    To study the role of the mobile C-terminal extension present in bacterial class of plant type NADP(H):ferredoxin reductases during catalysis, we generated a series of mutants of the Rhodobacter capsulatus enzyme (RcFPR). Deletion of the six C-terminal amino acids beyond alanine 266 was combined with the replacement A266Y, emulating the structure present in plastidic versions of this flavoenzyme. Analysis of absorbance and fluorescence spectra suggests that deletion does not modify the general geometry of FAD itself, but increases exposure of the flavin to the solvent, prevents a productive geometry of FAD:NADP(H) complex and decreases the protein thermal stability. Although the replacement A266Y partially coats the isoalloxazine from solvent and slightly restores protein stability, this single change does not allow formation of active charge-transfer complexes commonly present in the wild-type FPR, probably due to restraints of C-terminus pliability. A proton exchange process is deduced from ITC measurements during coenzyme binding. All studied RcFPR variants display higher affinity for NADP(+) than wild-type, evidencing the contribution of the C-terminus in tempering a non-productive strong (rigid) interaction with the coenzyme. The decreased catalytic rate parameters confirm that the hydride transfer from NADPH to the flavin ring is considerably hampered in the mutants. Although the involvement of the C-terminal extension from bacterial FPRs in stabilizing overall folding and bent-FAD geometry has been stated, the most relevant contributions to catalysis are modulation of coenzyme entrance and affinity, promotion of the optimal geometry of an active complex and supply of a proton acceptor acting during coenzyme binding.

  7. Truncation of N-terminal regions of Digitalis lanata progesterone 5β-reductase alters catalytic efficiency and substrate preference.


    Rudolph, Kristin; Bauer, Peter; Schmid, Benedikt; Mueller-Uri, Frieder; Kreis, Wolfgang


    N-Terminal truncated forms of progesterone 5β-reductase (P5βR) were synthesized taking a full-length cDNA encoding for Digitalis lanata P5βR with a hexa-histidine tag attached at the C-terminus (rDlP5βRc) as the starting point. Four pETite-c-His/DlP5βR constructs coding for P5βR derivatives truncated in the N-terminal region, termed rDlP5βRcn-10, rDlP5βRcn-20, rDlP5βRcn-30, and rDlP5βRcn-40 were obtained by site-directed mutagenesis. The cDNAs coding for full-length rDlP5βRc, rDlP5βRcn-10 and rDlP5βRcn-20 were over-expressed in Escherichia coli and the respective enzymes were soluble and catalytically active (progesterone and 2-cyclohexen-1-one as substrates). GST-tagged recombinant DlP5βR (rDlP5βR-GST) and rDlP5βR-GSTr, with the GST-tag removed by protease treatment were produced as well and served as controls. The Km values and substrate preferences considerably differed between the various DlP5βR derivatives. As for the C-terminal His-tagged rDlP5βR the catalytic efficiency for progesterone was highest for the full-length rDlP5βRc whereas the N-terminal truncated forms preferred 2-cyclohexen-1-one as the substrate. Affinity tags and artifacts resulting from the cloning strategy used may alter substrate specificity. Therefore enzyme properties determined with recombinant proteins should not be used to infer in vivo scenarios and should be considered for each particular case. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  8. Functional Mechanism of C-Terminal Tail in the Enzymatic Role of Porcine Testicular Carbonyl Reductase: A Combined Experiment and Molecular Dynamics Simulation Study of the C-Terminal Tail in the Enzymatic Role of PTCR

    PubMed Central

    Park, Chanin; Lee, Yuno; Kwon, Seul Gi; Kim, Sam Woong; Kim, Chul Wook; Lee, Keun Woo


    Porcine testicular carbonyl reductase, PTCR which is one of the short chain dehydrogenases/reductases (SDR) superfamily catalyzes the NADPH-dependent reduction of carbonyl compounds including steroids and prostaglandins. Previously we reported C- terminal tail of PTCR was deleted due to a nonsynonymous single nucleotide variation (nsSNV). Here we identified from kinetic studies that the enzymatic properties for 5α-dihydrotestosterone (5α-DHT) were different between wild-type and C-terminal-deleted PTCRs. Compared to wild-type PTCR, C-terminal-deleted PTCR has much higher reduction rate. To investigate structural difference between wild-type and C-terminal-deleted PTCRs upon 5α-DHT binding, we performed molecular dynamics simulations for two complexes. Using trajectories, molecular interactions including hydrogen bonding patterns, distance between 5α-DHT and catalytic Tyr193, and interaction energies are analyzed and compared. During the MD simulation time, the dynamic behavior of C-terminal tail in wild-type PTCR is also examined using essential dynamics analysis. The results of our simulations reveal that the binding conformation of 5α-DHT in C-terminal-deleted PTCR is more favorable for reduction reaction in PTCR, which shows strong agreement with kinetic data. These structural findings provide valuable information to understand substrate specificity of PTCR and further kinetic properties of enzymes belonging to the SDR superfamily. PMID:24646606

  9. Expression of chlorite dismutase and chlorate reductase in the presence of oxygen and/or chlorate as the terminal electron acceptor in Ideonella dechloratans.


    Lindqvist, Miriam Hellberg; Johansson, Nicklas; Nilsson, Thomas; Rova, Maria


    The ability of microorganisms to perform dissimilatory (per)chlorate reduction is, for most species, known to be oxygen sensitive. Consequently, bioremediation processes for the removal of oxochlorates will be disturbed if oxygen is present. We measured the expression of chlorite dismutase and chlorate reductase in the presence of different terminal electron acceptors in the chlorate reducer Ideonella dechloratans. Enzyme activity assays and mRNA analyses by real-time quantitative reverse transcription (qRT)-PCR were performed on cell extracts from cells grown aerobically with and without chlorate and on cells grown anaerobically in the presence of chlorate. Our results showed that both chlorite dismutase and chlorate reductase are expressed during aerobic growth. However, transfer to anaerobic conditions with chlorate resulted in significantly enhanced enzyme activities and mRNA levels for both enzymes. Absence of oxygen was necessary for the induction to occur, since chlorate addition under aerobic conditions produced neither increased enzyme activities nor higher relative levels of mRNA. For chlorite dismutase, the observed increase in activity was on the same order of magnitude as the increase in the relative mRNA level, indicating gene regulation at the transcriptional level. However, chlorate reductase showed about 200 times higher enzyme activity in anaerobically induced cells, whereas the increase in mRNA was only about 10-fold, suggesting additional mechanisms influence the enzyme activity.

  10. Reduction of the pea ferredoxin-NADP(H) reductase catalytic efficiency by the structuring of a carboxyl-terminal artificial metal binding site.


    Catalano-Dupuy, Daniela L; Orecchia, Martín; Rial, Daniela V; Ceccarelli, Eduardo A


    Ferredoxin (flavodoxin)-NADP(H) reductases (FNRs) are ubiquitous flavoenzymes that deliver NADPH or low-potential one-electron donors (ferredoxin, flavodoxin, and adrenodoxin) to redox-based metabolisms in plastids, mitochondria, and bacteria. The FNRs from plants and most eubacteria constitute a unique family, the plant-type ferredoxin-NADP(H) reductases. Plastidic FNRs are quite efficient at sustaining the demands of the photosynthetic process. At variance, FNRs from organisms with heterotrophic metabolisms or anoxygenic photosynthesis display turnover numbers that are 20-100-fold lower than those of their plastidic and cyanobacterial counterparts. To gain insight into the FNR structural features that modulate enzyme catalytic efficiency, we constructed a recombinant FNR in which the carboxyl-terminal amino acid (Tyr308) is followed by an artificial metal binding site of nine amino acids, including four histidine residues. This added structure binds Zn2+ or Co2+ and, as a consequence, significantly reduces the catalytic efficiency of the enzyme by decreasing its kcat. The Km for NADPH and the Kd for NADP+ were increased 2 and 3 times, respectively, by the addition of the amino acid extension in the absence of Zn2+. Nevertheless, the structuring of the metal binding site did not change the Km for NADPH or the Kd for NADP+ of the FNR-tail enzyme. Our results provide experimental evidence which indicates that mobility of the carboxyl-terminal backbone region of the FNR, mainly Tyr308, is essential for obtaining an FNR enzyme with high catalytic efficiency.

  11. Sepp1(UF) forms are N-terminal selenoprotein P truncations that have peroxidase activity when coupled with thioredoxin reductase-1.


    Kurokawa, Suguru; Eriksson, Sofi; Rose, Kristie L; Wu, Sen; Motley, Amy K; Hill, Salisha; Winfrey, Virginia P; McDonald, W Hayes; Capecchi, Mario R; Atkins, John F; Arnér, Elias S J; Hill, Kristina E; Burk, Raymond F


    Mouse selenoprotein P (Sepp1) consists of an N-terminal domain (residues 1-239) that contains one selenocysteine (U) as residue 40 in a proposed redox-active motif (-UYLC-) and a C-terminal domain (residues 240-361) that contains nine selenocysteines. Sepp1 transports selenium from the liver to other tissues by receptor-mediated endocytosis. It also reduces oxidative stress in vivo by an unknown mechanism. A previously uncharacterized plasma form of Sepp1 is filtered in the glomerulus and taken up by renal proximal convoluted tubule (PCT) cells via megalin-mediated endocytosis. We purified Sepp1 forms from the urine of megalin(-/-) mice using a monoclonal antibody to the N-terminal domain. Mass spectrometry revealed that the purified urinary Sepp1 consisted of N-terminal fragments terminating at 11 sites between residues 183 and 208. They were therefore designated Sepp1(UF). Because the N-terminal domain of Sepp1 has a thioredoxin fold, Sepp1(UF) were compared with full-length Sepp1, Sepp1(Δ240-361), and Sepp1(U40S) as a substrate of thioredoxin reductase-1 (TrxR1). All forms of Sepp1 except Sepp1(U40S), which contains serine in place of the selenocysteine, were TrxR1 substrates, catalyzing NADPH oxidation when coupled with H2O2 or tert-butylhydroperoxide as the terminal electron acceptor. These results are compatible with proteolytic cleavage freeing Sepp1(UF) from full-length Sepp1, the form that has the role of selenium transport, allowing Sepp1(UF) to function by itself as a peroxidase. Ultimately, plasma Sepp1(UF) and small selenium-containing proteins are filtered by the glomerulus and taken up by PCT cells via megalin-mediated endocytosis, preventing loss of selenium in the urine and providing selenium for the synthesis of glutathione peroxidase-3. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Analysis of Structural MtrC Models Based on Homology with the Crystal Structure of MtrF

    SciTech Connect

    Edwards, Marcus; Fredrickson, Jim K.; Zachara, John M.; Richardson, David; Clarke, Thomas A.


    The outer-membrane decahaem cytochrome MtrC is part of the transmembrane MtrCAB complex required for mineral respiration by Shewanella oneidensis. MtrC has significant sequence similarity to the paralogous decahaem cytochrome MtrF, which has been structurally solved through X-ray crystallography. This now allows for homology-based models of MtrC to be generated. The structure of these MtrC homology models contain ten bis-histidine-co-ordinated c-type haems arranged in a staggered cross through a four-domain structure. This model is consistent with current spectroscopic data and shows that the areas around haem 5 and haem 10, at the termini of an octahaem chain, are likely to have functions similar to those of the corresponding haems in MtrF. The electrostatic surfaces around haem 7, close to the β-barrels, are different in MtrF and MtrC, indicating that these haems may have different potentials and interact with substrates differently.

  13. Thioredoxin reductase.

    PubMed Central

    Mustacich, D; Powis, G


    The mammalian thioredoxin reductases (TrxRs) are a family of selenium-containing pyridine nucleotide-disulphide oxidoreductases with mechanistic and sequence identity, including a conserved -Cys-Val-Asn-Val-Gly-Cys- redox catalytic site, to glutathione reductases. TrxRs catalyse the NADPH-dependent reduction of the redox protein thioredoxin (Trx), as well as of other endogenous and exogenous compounds. The broad substrate specificity of mammalian TrxRs is due to a second redox-active site, a C-terminal -Cys-SeCys- (where SeCys is selenocysteine), that is not found in glutathione reductase or Escherichia coli TrxR. There are currently two confirmed forms of mammalian TrxRs, TrxR1 and TrxR2, and it is possible that other forms will be identified. The availability of Se is a key factor determining TrxR activity both in cell culture and in vivo, and the mechanism(s) for the incorporation of Se into TrxRs, as well as the regulation of TrxR activity, have only recently begun to be investigated. The importance of Trx to many aspects of cell function make it likely that TrxRs also play a role in protection against oxidant injury, cell growth and transformation, and the recycling of ascorbate from its oxidized form. Since TrxRs are able to reduce a number of substrates other than Trx, it is likely that additional biological effects will be discovered for TrxR. Furthermore, inhibiting TrxR with drugs may lead to new treatments for human diseases such as cancer, AIDS and autoimmune diseases. PMID:10657232

  14. Multilocus Phylogenetic Study of the Scheffersomyces Yeast Clade and Characterization of the N-Terminal Region of Xylose Reductase Gene

    PubMed Central

    Urbina, Hector; Blackwell, Meredith


    Many of the known xylose-fermenting (X-F) yeasts are placed in the Scheffersomyces clade, a group of ascomycete yeasts that have been isolated from plant tissues and in association with lignicolous insects. We formally recognize fourteen species in this clade based on a maximum likelihood (ML) phylogenetic analysis using a multilocus dataset. This clade is divided into three subclades, each of which exhibits the biochemical ability to ferment cellobiose or xylose. New combinations are made for seven species of Candida in the clade, and three X-F taxa associated with rotted hardwood are described: Scheffersomyces illinoinensis (type strain NRRL Y-48827T  =  CBS 12624), Scheffersomyces quercinus (type strain NRRL Y-48825T  =  CBS 12625), and Scheffersomyces virginianus (type strain NRRL Y-48822T  =  CBS 12626). The new X-F species are distinctive based on their position in the multilocus phylogenetic analysis and biochemical and morphological characters. The molecular characterization of xylose reductase (XR) indicates that the regions surrounding the conserved domain contain mutations that may enhance the performance of the enzyme in X-F yeasts. The phylogenetic reconstruction using XYL1 or RPB1 was identical to the multilocus analysis, and these loci have potential for rapid identification of cryptic species in this clade. PMID:22720049

  15. Functional Evidence for the Critical Amino-Terminal Conserved Domain and Key Amino Acids of Arabidopsis 4-HYDROXY-3-METHYLBUT-2-ENYL DIPHOSPHATE REDUCTASE1[W][OPEN

    PubMed Central

    Hsieh, Wei-Yu; Sung, Tzu-Ying; Wang, Hsin-Tzu; Hsieh, Ming-Hsiun


    The plant 4-HYDROXY-3-METHYLBUT-2-ENYL DIPHOSPHATE REDUCTASE (HDR) catalyzes the last step of the methylerythritol phosphate pathway to synthesize isopentenyl diphosphate and its allyl isomer dimethylallyl diphosphate, which are common precursors for the synthesis of plastid isoprenoids. The Arabidopsis (Arabidopsis thaliana) genomic HDR transgene-induced gene-silencing lines are albino, variegated, or pale green, confirming that HDR is essential for plants. We used Escherichia coli isoprenoid synthesis H (Protein Data Bank code 3F7T) as a template for homology modeling to identify key amino acids of Arabidopsis HDR. The predicted model reveals that cysteine (Cys)-122, Cys-213, and Cys-350 are involved in iron-sulfur cluster formation and that histidine (His)-152, His-241, glutamate (Glu)-242, Glu-243, threonine (Thr)-244, Thr-312, serine-379, and asparagine-381 are related to substrate binding or catalysis. Glu-242 and Thr-244 are conserved only in cyanobacteria, green algae, and land plants, whereas the other key amino acids are absolutely conserved from bacteria to plants. We used site-directed mutagenesis and complementation assay to confirm that these amino acids, except His-152 and His-241, were critical for Arabidopsis HDR function. Furthermore, the Arabidopsis HDR contains an extra amino-terminal domain following the transit peptide that is highly conserved from cyanobacteria, and green algae to land plants but not existing in the other bacteria. We demonstrated that the amino-terminal conserved domain was essential for Arabidopsis and cyanobacterial HDR function. Further analysis of conserved amino acids in the amino-terminal conserved domain revealed that the tyrosine-72 residue was critical for Arabidopsis HDR. These results suggest that the structure and reaction mechanism of HDR evolution have become specific for oxygen-evolving photosynthesis organisms and that HDR probably evolved independently in cyanobacteria versus other prokaryotes. PMID:25037211

  16. Roles of the species-specific subdomain and the N-terminal peptide of Toxoplasma gondii ferredoxin-NADP+ reductase in ferredoxin binding.


    Pandini, Vittorio; Caprini, Gianluca; Tedeschi, Gabriella; Seeber, Frank; Zanetti, Giuliana; Aliverti, Alessandro


    The plant-type ferredoxin/ferredoxin-NADP(+) reductase (Fd/FNR) redox system found in parasites of the phylum Apicomplexa has been proposed as a target for novel drugs used against life-threatening diseases such as malaria and toxoplasmosis. Like many proteins from these protists, apicomplexan FNRs are characterized by the presence of unique peptide insertions of variable length and yet unknown function. Since three-dimensional data are not available for any of the parasite FNRs, we used limited proteolysis to carry out an extensive study of the conformation of Toxoplasma gondii FNR. This led to identification of 11 peptide bonds susceptible to the action of four different proteases. Cleavage sites are clustered in four regions of the enzyme, which include two of its three species-specific insertions. Such regions are thus predicted to form flexible surface loops. The protein substrate Fd protected FNR against cleavage both at its N-terminal peptide and at its largest sequence insertion (28 residues). Deletion by protein engineering of the species-specific subdomain containing the latter insertion resulted in an enzyme form that, although catalytically active, displayed a 10-fold decreased affinity for Fd. In contrast, removal of the first 15 residues of the enzyme unexpectedly enhanced its interaction with Fd. Thus, two flexible polypeptide regions of T. gondii FNR are involved in Fd interaction but have opposite roles in modulating the binding affinity for the protein ligand. In this respect, T. gondii FNR differs from plant FNRs, where the N-terminal peptide contributes to the stabilization of their complex with Fd.

  17. The amino-terminal conserved domain of 4-hydroxy-3-methylbut-2-enyl diphosphate reductase is critical for its function in oxygen-evolving photosynthetic organisms

    PubMed Central

    Hsieh, Wei-Yu; Hsieh, Ming-Hsiun


    4-hydroxy-3-methylbut-2-enyl diphosphate reductase (HDR), also known as isoprenoid synthesis H (IspH) or lysis-tolerant B (LytB), catalyzes the last step of the methylerythritol phosphate pathway to synthesize isopentenyl diphosphate and dimethylallyl diphosphate. The structure and reaction mechanism of IspH have been actively investigated in Escherichia coli but little is known in plants. Compared with the bacterial IspH, cyanobacterial and plant HDRs all contain an extra N-terminal conserved domain (NCD) that is essential for their function. Tyr72 in the NCD and several plant-specific residues around the central active site are critical for Arabidopsis HDR function. These results suggest that the structure and reaction mechanism of HDR/IspH may be different between plants and bacteria. The E. coli IspH is an iron-sulfur protein that is sensitive to oxygen. It is possible that the cyanobacterial HDR may independently evolve from the common ancestor of prokaryotes to obtain the NCD, which may protect the enzyme from high concentration of oxygen during photosynthesis. PMID:25723575

  18. Changes in dihydrofolate reductase (DHFR) mRNA levels can account fully for changes in DHFR synthesis rates during terminal differentiation in a highly amplified myogenic cell line.

    PubMed Central

    Schmidt, E E; Merrill, G F


    Dihydrofolate reductase (DHFR) enzyme is preferentially synthesized in proliferative cells. A mouse muscle cell line resistant to 300 microM methotrexate was developed to investigate the molecular levels at which DHFR is down-regulated during myogenic withdrawal from the cell cycle. H- alpha R300T cells contained 540 copies of the endogenous DHFR gene and overexpressed DHFR mRNA and DHFR protein. Despite DHFR gene amplification, the cells remained diploid. As H- alpha R300T myoblasts withdrew from the cell cycle and committed to terminal differentiation, DHFR mRNA levels and DHFR synthesis rates decreased with closely matched kinetics. After 15 to 24 h, committed cells contained 5% the proliferative level of DHFR mRNA (80 molecules per committed cell) and synthesized DHFR protein at 6% the proliferative rate. At no point during the commitment process did the decrease in DHFR synthesis rate exceed the decrease in DHFR message. The decrease in DHFR mRNA levels during commitment was sufficient to account fully for the decrease in rates of DHFR synthesis. Furthermore, DHFR mRNA remained polysomal, and the average number of ribosomes per message remained constant (five to six ribosomes per DHFR mRNA). The constancy of polysome size, along with the uniform rate of DHFR synthesis per message, indicated that DHFR mRNA was efficiently translated in postreplicative cells. The results support a model wherein replication-dependent changes in DHFR synthesis rates are determined exclusively by changes in DHFR mRNA levels. Images PMID:2046674

  19. The N-terminal Domain of Escherichia coli Assimilatory NADPH-Sulfite Reductase Hemoprotein Is an Oligomerization Domain That Mediates Holoenzyme Assembly.


    Askenasy, Isabel; Pennington, Joseph M; Tao, Yeqing; Marshall, Alan G; Young, Nicolas L; Shang, Weifeng; Stroupe, M Elizabeth


    Assimilatory NADPH-sulfite reductase (SiR) from Escherichia coli is a structurally complex oxidoreductase that catalyzes the six-electron reduction of sulfite to sulfide. Two subunits, one a flavin-binding flavoprotein (SiRFP, the α subunit) and the other an iron-containing hemoprotein (SiRHP, the β subunit), assemble to make a holoenzyme of about 800 kDa. How the two subunits assemble is not known. The iron-rich cofactors in SiRHP are unique because they are a covalent arrangement of a Fe4S4 cluster attached through a cysteine ligand to an iron-containing porphyrinoid called siroheme. The link between cofactor biogenesis and SiR stability is also ill-defined. By use of hydrogen/deuterium exchange and biochemical analysis, we show that the α8β4 SiR holoenzyme assembles through the N terminus of SiRHP and the NADPH binding domain of SiRFP. By use of small angle x-ray scattering, we explore the structure of the SiRHP N-terminal oligomerization domain. We also report a novel form of the hemoprotein that occurs in the absence of its cofactors. Apo-SiRHP forms a homotetramer, also dependent on its N terminus, that is unable to assemble with SiRFP. From these results, we propose that homotetramerization of apo-SiRHP serves as a quality control mechanism to prevent formation of inactive holoenzyme in the case of limiting cellular siroheme.

  20. The N-terminal Domain of Escherichia coli Assimilatory NADPH-Sulfite Reductase Hemoprotein Is an Oligomerization Domain That Mediates Holoenzyme Assembly*

    PubMed Central

    Askenasy, Isabel; Pennington, Joseph M.; Tao, Yeqing; Marshall, Alan G.; Young, Nicolas L.; Shang, Weifeng; Stroupe, M. Elizabeth


    Assimilatory NADPH-sulfite reductase (SiR) from Escherichia coli is a structurally complex oxidoreductase that catalyzes the six-electron reduction of sulfite to sulfide. Two subunits, one a flavin-binding flavoprotein (SiRFP, the α subunit) and the other an iron-containing hemoprotein (SiRHP, the β subunit), assemble to make a holoenzyme of about 800 kDa. How the two subunits assemble is not known. The iron-rich cofactors in SiRHP are unique because they are a covalent arrangement of a Fe4S4 cluster attached through a cysteine ligand to an iron-containing porphyrinoid called siroheme. The link between cofactor biogenesis and SiR stability is also ill-defined. By use of hydrogen/deuterium exchange and biochemical analysis, we show that the α8β4 SiR holoenzyme assembles through the N terminus of SiRHP and the NADPH binding domain of SiRFP. By use of small angle x-ray scattering, we explore the structure of the SiRHP N-terminal oligomerization domain. We also report a novel form of the hemoprotein that occurs in the absence of its cofactors. Apo-SiRHP forms a homotetramer, also dependent on its N terminus, that is unable to assemble with SiRFP. From these results, we propose that homotetramerization of apo-SiRHP serves as a quality control mechanism to prevent formation of inactive holoenzyme in the case of limiting cellular siroheme. PMID:26088143

  1. Role of Outer Membrane C-Type Cytochromes MtrC and OmcA in Shewanella Oneidensis MR-1 Cell Production, Accumulation, and Detachment During Respiration on Hematite

    SciTech Connect

    Mitchell, Andrew C.; Peterson, L.; Reardon, Catherine L.; Reed, Samantha B.; Culley, David E.; Romine, Margaret F.; Geesey, Gill G.


    Solid phase iron oxides are considered to be important terminal electron acceptors for microbial respiration in many anoxic environments. Besides the knowledge that cells attach to and reduce these substrates, other aspects of surface-associated cell behavior and the related cell surface components that influence cell-mineral interactions are not well understood. In the present study, wild-type cells of the dissimilatory iron-reducing bacterium Shewanella oneidensis MR-1 formed thin biofilms one-to-two cell layers in thickness when respiring on natural specular hematite under flow conditions similar to those which exist in aquatic sediments and subsurface environments. The distribution of cells within the biofilm indicated that direct contact was not required for electron transfer from cells to the mineral surface. Detached biomass in the form of single cells represented >99% of the surface-associated wild-type cell production from respiration on hematite over the biofilm life cycle. A mutant deficient in the outer membrane c35 type cytochrome OmcA, while still able to respire and replicate on hematite, established a lower steady-state cell density on the mineral surface than that of the wild-type strain. A mutant deficient in MtrC, another outer membrane c-type cytochrome, and a mutant deficient in both cytochromes were unable to reduce sufficient amounts of hematite to support detectable growth on the mineral surface. When considered in the context of previous work, the results support a growing body of evidence that the relative importance of OmcA and MtrC to cell respiration and replication depends on the form of iron oxide available as terminal electron acceptor.

  2. Roles of UndA and MtrC of Shewanella putrefaciens W3-18-1 in iron reduction.


    Yang, Yunfeng; Chen, Jingrong; Qiu, Dongru; Zhou, Jizhong


    The completion of genome sequencing in a number of Shewanella species, which are most renowned for their metal reduction capacity, offers a basis for comparative studies. Previous work in Shewanella oneidensis MR-1 has indicated that some genes within a cluster (mtrBAC-omcA-mtrFED) were involved in iron reduction. To explore new features of iron reduction pathways, we experimentally analyzed Shewanella putrefaciens W3-18-1 since its gene cluster is considerably different from that of MR-1 in that the gene cluster encodes only four ORFs. Among the gene cluster, two genes (mtrC and undA) were shown to encode c-type cytochromes. The ΔmtrC deletion mutant revealed significant deficiencies in reducing metals of Fe2O3, α-FeO(OH), β-FeO(OH), ferric citrate, Mn(IV) and Co(III), but not organic compounds. In contrast, no deficiency of metal reduction was observed in the ΔundA deletion mutant. Nonetheless, undA deletion resulted in progressively slower iron reduction in the absence of mtrC and fitness loss under the iron-using condition, which was indicative of a functional role of UndA in iron reduction. These results provide physiological and biochemical evidences that UndA and MtrC of Shewanella putrefaciens W3-18-1 are involved in iron reduction.

  3. Roles of UndA and MtrC of Shewanella putrefaciens W3-18-1 in iron reduction

    PubMed Central


    Background The completion of genome sequencing in a number of Shewanella species, which are most renowned for their metal reduction capacity, offers a basis for comparative studies. Previous work in Shewanella oneidensis MR-1 has indicated that some genes within a cluster (mtrBAC-omcA-mtrFED) were involved in iron reduction. To explore new features of iron reduction pathways, we experimentally analyzed Shewanella putrefaciens W3-18-1 since its gene cluster is considerably different from that of MR-1 in that the gene cluster encodes only four ORFs. Results Among the gene cluster, two genes (mtrC and undA) were shown to encode c-type cytochromes. The ΔmtrC deletion mutant revealed significant deficiencies in reducing metals of Fe2O3, α-FeO(OH), β-FeO(OH), ferric citrate, Mn(IV) and Co(III), but not organic compounds. In contrast, no deficiency of metal reduction was observed in the ΔundA deletion mutant. Nonetheless, undA deletion resulted in progressively slower iron reduction in the absence of mtrC and fitness loss under the iron-using condition, which was indicative of a functional role of UndA in iron reduction. Conclusions These results provide physiological and biochemical evidences that UndA and MtrC of Shewanella putrefaciens W3-18-1 are involved in iron reduction. PMID:24274142

  4. Role of Outer-Membrane Cytochromes MtrC and OmcA in the Biomineralization of Ferrihydrite by Shewanella oneidensis MR-1.

    SciTech Connect

    Reardon, Catherine L.; Dohnalkova, Alice; Nachimuthu, Ponnusamy; Kennedy, David W.; Saffarini, Daad; Arey, Bruce W.; Shi, Liang; Wang, Zheming; Moore, Dean A.; Mclean, Jeffrey S.; Moyles, Dianne M.; Marshall, Matthew J.; Zachara, John M.; Fredrickson, Jim K.; Beliaev, Alex S.


    In an effort to improve the understanding of electron transfer mechanisms at the microbe-mineral interface, Shewanella oneidensis MR-1 mutants with in-frame deletions of outer membrane cytochrome genes mtrC, omcA, or both, were characterized for the ability to reduce metal oxides using a suite of microscopic, spectroscopic, and biochemicalr techniques. The results indicate that neither MtrC nor OmcA are essential for the reduction of soluble, complexed Fe(III)-citrate or Fe(III)-NTA; however, at least one of these outer membrane cytochromes is required for the reduction of Fe(III)- and Mn(III/IV)- oxides. In vitro analysis of purified, recombinant protein demonstrated that both cytochromes transfer electrons directly to metal-oxides; however, MtrC transfers electrons at a faster rate than OmcA. Immunolocalization of MtrC and OmcA reveal that both cytochromes are surface-exposed on the cell outer-membrane and co-localize with insoluble iron precipitates when respiring ferrihydrite or cultured aerobically with Fe(III)-citrate. Additionally, during prolonged incubation, wild-type cells promoted biotransformation of ferrihydrite to vivianite [Fe3(PO4)2•8H2O] while the double cytochrome mutant was unable to form any secondary mineral phases. Collectively, our results support a role for direct electron transfer from OMCs to metal oxides by establishing their in vitro electron transfer activities, confirming the requirement of either MtrC or OmcA for in vivo reductive biomineralization of ferrihydrite, and localizing the cytochromes to the cell exterior where they can directly contact mineral substrates.

  5. Specific Bonds between an Iron Oxide Surface and Outer Membrane Cytochromes MtrC and OmcA from Shewanella oneidensis MR-1▿

    PubMed Central

    Lower, Brian H.; Shi, Liang; Yongsunthon, Ruchirej; Droubay, Timothy C.; McCready, David E.; Lower, Steven K.


    Shewanella oneidensis MR-1 is purported to express outer membrane cytochromes (e.g., MtrC and OmcA) that transfer electrons directly to Fe(III) in a mineral during anaerobic respiration. A prerequisite for this type of reaction would be the formation of a stable bond between a cytochrome and an iron oxide surface. Atomic force microscopy (AFM) was used to detect whether a specific bond forms between a hematite (Fe2O3) thin film, created with oxygen plasma-assisted molecular beam epitaxy, and recombinant MtrC or OmcA molecules coupled to gold substrates. Force spectra displayed a unique force signature indicative of a specific bond between each cytochrome and the hematite surface. The strength of the OmcA-hematite bond was approximately twice that of the MtrC-hematite bond, but direct binding to hematite was twice as favorable for MtrC. Reversible folding/unfolding reactions were observed for mechanically denatured MtrC molecules bound to hematite. The force measurements for the hematite-cytochrome pairs were compared to spectra collected for an iron oxide and S. oneidensis under anaerobic conditions. There is a strong correlation between the whole-cell and pure-protein force spectra, suggesting that the unique binding attributes of each cytochrome complement one another and allow both MtrC and OmcA to play a prominent role in the transfer of electrons to Fe(III) in minerals. Finally, by comparing the magnitudes of binding force for the whole-cell versus pure-protein data, we were able to estimate that a single bacterium of S. oneidensis (2 by 0.5 μm) expresses ∼104 cytochromes on its outer surface. PMID:17468239

  6. Enhancement of cardenolide and phytosterol levels by expression of an N-terminally truncated 3-hydroxy-3-methylglutaryl CoA reductase in Transgenic digitalis minor.


    Sales, Ester; Muñoz-Bertomeu, Jesús; Arrillaga, Isabel; Segura, Juan


    Pathway engineering in medicinal plants attains a special significance in Digitalis species, the main industrial source of cardiac glycosides, steroidal metabolites derived from mevalonic acid via the triterpenoid pathway. In this work, the Arabidopsis thaliana HMG1 cDNA, coding the catalytic domain of 3-hydroxy-3-methylglutaryl CoA reductase (HMGR1S), a key enzyme of the MVA pathway, was expressed in the cardenolide-producing plant Digitalis minor. Transgenic plants were morphologically indistinguishable from control wild plants and displayed the same developmental pattern. Constitutive expression of HMG1 resulted in an increased sterol and cardenolide production in both in vitro- and greenhouse-grown plants. This work demonstrates that transgenic D. minor plants are a valuable system to study and achieve metabolic engineering of the cardenolide pathway and in consequence for the genetic improvement of Digitalis species.

  7. Up-regulation of an N-terminal truncated 3-hydroxy-3-methylglutaryl CoA reductase enhances production of essential oils and sterols in transgenic Lavandula latifolia.


    Muñoz-Bertomeu, Jesús; Sales, Ester; Ros, Roc; Arrillaga, Isabel; Segura, Juan


    Spike lavender (Lavandula latifolia) essential oil is widely used in the perfume, cosmetic, flavouring and pharmaceutical industries. Thus, modifications of yield and composition of this essential oil by genetic engineering should have important scientific and commercial applications. We generated transgenic spike lavender plants expressing the Arabidopsis thaliana HMG1 cDNA, encoding the catalytic domain of 3-hydroxy-3-methylglutaryl CoA reductase (HMGR1S), a key enzyme of the mevalonic acid (MVA) pathway. Transgenic T0 plants accumulated significantly more essential oil constituents as compared to controls (up to 2.1- and 1.8-fold in leaves and flowers, respectively). Enhanced expression of HMGR1S also increased the amount of the end-product sterols, beta-sitosterol and stigmasterol (average differences of 1.8- and 1.9-fold, respectively), but did not affect the accumulation of carotenoids or chlorophylls. We also analysed T1 plants derived from self-pollinated seeds of T0 lines that flowered after growing for 2 years in the greenhouse. The increased levels of essential oil and sterols observed in the transgenic T0 plants were maintained in the progeny that inherited the HMG1 transgene. Our results demonstrate that genetic manipulation of the MVA pathway increases essential oil yield in spike lavender, suggesting a contribution for this cytosolic pathway to monoterpene and sesquiterpene biosynthesis in leaves and flowers of the species.

  8. Enhancement of Ganoderic Acid Accumulation by Overexpression of an N-Terminally Truncated 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Gene in the Basidiomycete Ganoderma lucidum

    PubMed Central

    Xu, Jun-Wei; Xu, Yi-Ning


    Ganoderic acids produced by Ganoderma lucidum, a well-known traditional Chinese medicinal mushroom, exhibit antitumor and antimetastasis activities. Genetic modification of G. lucidum is difficult but critical for the enhancement of cellular accumulation of ganoderic acids. In this study, a homologous genetic transformation system for G. lucidum was developed for the first time using mutated sdhB, encoding the iron-sulfur protein subunit of succinate dehydrogenase, as a selection marker. The truncated G. lucidum gene encoding the catalytic domain of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) was overexpressed by using the Agrobacterium tumefaciens-mediated transformation system. The results showed that the mutated sdhB successfully conferred carboxin resistance upon transformation. Most of the integrated transfer DNA (T-DNA) appeared as a single copy in the genome. Moreover, deregulated constitutive overexpression of the HMGR gene led to a 2-fold increase in ganoderic acid content. It also increased the accumulation of intermediates (squalene and lanosterol) and the upregulation of downstream genes such as those of farnesyl pyrophosphate synthase, squalene synthase, and lanosterol synthase. This study demonstrates that transgenic basidiomycete G. lucidum is a promising system to achieve metabolic engineering of the ganoderic acid pathway. PMID:22941092

  9. Specific Bonds between an Iron Oxide Surface and Outer Membrane Cytochromes MtrC and OmcA from Shewanella oneidensis MR-1

    SciTech Connect

    Lower, Brian H.; Shi, Liang; Yongsunthon, Ruchirej; Droubay, Timothy C.; Mccready, David E.; Lower, Steven


    Shewanella oneidensis MR-1 is purported to express outer membrane cytochromes (e.g., MtrC and OmcA) that transfer electrons directly to Fe(III) in a mineral during anaerobic respiration.  A prerequisite for this type of reaction would be the formation of a stable bond between a cytochrome and an iron oxide surface.  Atomic force microscopy (AFM) was used to detect whether a specific bond forms between a hematite (Fe2O3) thin film, created with oxygen plasma assisted molecular beam epitaxy (MBE), and recombinant MtrC or OmcA molecules coupled to gold substrates.  Force spectra displayed a unique force signature indicative of a specific bond between each cytochrome and the hematite surface.  The strength of the OmcA-hematite bond was approximately twice as strong as the MtrC-hematite bond, but direct binding to hematite was twice as favorable for MtrC.  Reversible folding/unfolding reactions were observed for mechanically denatured MtrC molecules bound to hematite.  The force measurements for the hematite-cytochrome pairs were compared to spectra collected between an iron oxide and S. oneidensis under anaerobic conditions.  There is a strong correlation between the whole cell and pure protein force spectra suggesting that the unique binding attributes of each cytochrome complement one another and allow both MtrC and OmcA to play a prominent role in the transfer of electrons to Fe(III) in minerals.  Finally, by comparing the magnitude of binding force for the whole cell vs. pure protein data, we were able to estimate that a single bacterium of S. oneidensis (2 x 0.5 μm) expresses ~104 cytochromes on its outer surface. 

  10. Role of outer-membrane cytochromes MtrC and OmcA in the biomineralization of ferrihydrite by Shewanella oneidensis MR-1.


    Reardon, C L; Dohnalkova, A C; Nachimuthu, P; Kennedy, D W; Saffarini, D A; Arey, B W; Shi, L; Wang, Z; Moore, D; McLean, J S; Moyles, D; Marshall, M J; Zachara, J M; Fredrickson, J K; Beliaev, A S


    In an effort to improve the understanding of electron transfer mechanisms at the microbe-mineral interface, Shewanella oneidensis MR-1 mutants with in-frame deletions of outer-membrane cytochromes (OMCs), MtrC and OmcA, were characterized for the ability to reduce ferrihydrite (FH) using a suite of microscopic, spectroscopic, and biochemical techniques. Analysis of purified recombinant proteins demonstrated that both cytochromes undergo rapid electron exchange with FH in vitro with MtrC displaying faster transfer rates than OmcA. Immunomicroscopy with cytochrome-specific antibodies revealed that MtrC co-localizes with iron solids on the cell surface while OmcA exhibits a more diffuse distribution over the cell surface. After 3-day incubation of MR-1 with FH, pronounced reductive transformation mineral products were visible by electron microscopy. Upon further incubation, the predominant phases identified were ferrous phosphates including vivianite [Fe(3)(PO(4))(2)x8H(2)O] and a switzerite-like phase [Mn(3),Fe(3)(PO(4))(2)x7H(2)O] that were heavily colonized by MR-1 cells with surface-exposed outer-membrane cytochromes. In the absence of both MtrC and OmcA, the cells ability to reduce FH was significantly hindered and no mineral transformation products were detected. Collectively, these results highlight the importance of the outer-membrane cytochromes in the reductive transformation of FH and support a role for direct electron transfer from the OMCs at the cell surface to the mineral.

  11. X-ray Structure of a Hg2+ Complex of Mercuric Reductase (MerA) and Quantum Mechanical/Molecular Mechanical Study of Hg2+ Transfer between the C-Terminal and Buried Catalytic Site Cysteine Pairs

    PubMed Central


    Mercuric reductase, MerA, is a key enzyme in bacterial mercury resistance. This homodimeric enzyme captures and reduces toxic Hg2+ to Hg0, which is relatively unreactive and can exit the cell passively. Prior to reduction, the Hg2+ is transferred from a pair of cysteines (C558′ and C559′ using Tn501 numbering) at the C-terminus of one monomer to another pair of cysteines (C136 and C141) in the catalytic site of the other monomer. Here, we present the X-ray structure of the C-terminal Hg2+ complex of the C136A/C141A double mutant of the Tn501 MerA catalytic core and explore the molecular mechanism of this Hg transfer with quantum mechanical/molecular mechanical (QM/MM) calculations. The transfer is found to be nearly thermoneutral and to pass through a stable tricoordinated intermediate that is marginally less stable than the two end states. For the overall process, Hg2+ is always paired with at least two thiolates and thus is present at both the C-terminal and catalytic binding sites as a neutral complex. Prior to Hg2+ transfer, C141 is negatively charged. As Hg2+ is transferred into the catalytic site, a proton is transferred from C136 to C559′ while C558′ becomes negatively charged, resulting in the net transfer of a negative charge over a distance of ∼7.5 Å. Thus, the transport of this soft divalent cation is made energetically feasible by pairing a competition between multiple Cys thiols and/or thiolates for Hg2+ with a competition between the Hg2+ and protons for the thiolates. PMID:25343681

  12. X-ray Structure of a Hg2+ Complex of Mercuric Reductase (MerA) and Quantum Mechanical/Molecular Mechanical Study of Hg2+ Transfer between the C-Terminal and Buried Catalytic Site Cysteine Pairs


    Lian, Peng; Guo, Hao-Bo; Riccardi, Demian; ...


    Here we report that mercuric reductase, MerA, is a key enzyme in bacterial mercury resistance. This homodimeric enzyme captures and reduces toxic Hg2+ to Hg0, which is relatively unreactive and can exit the cell passively. Prior to reduction, the Hg2+ is transferred from a pair of cysteines (C558' and C559' using Tn501 numbering) at the C-terminus of one monomer to another pair of cysteines (C136 and C141) in the catalytic site of the other monomer. Here, we present the X-ray structure of the C-terminal Hg2+ complex of the C136A/C141A double mutant of the Tn501 MerA catalytic core and explore themore » molecular mechanism of this Hg transfer with quantum mechanical/molecular mechanical (QM/MM) calculations. The transfer is found to be nearly thermoneutral and to pass through a stable tricoordinated intermediate that is marginally less stable than the two end states. For the overall process, Hg2+ is always paired with at least two thiolates and thus is present at both the C-terminal and catalytic binding sites as a neutral complex. Prior to Hg2+ transfer, C141 is negatively charged. As Hg2+ is transferred into the catalytic site, a proton is transferred from C136 to C559' while C558' becomes negatively charged, resulting in the net transfer of a negative charge over a distance of ~7.5 Å. Thus, the transport of this soft divalent cation is made energetically feasible by pairing a competition between multiple Cys thiols and/or thiolates for Hg2+ with a competition between the Hg2+ and protons for the thiolates.« less

  13. Aldose reductase-deficient mice are protected from delayed motor nerve conduction velocity, increased c-Jun NH2-terminal kinase activation, depletion of reduced glutathione, increased superoxide accumulation, and DNA damage.


    Ho, Eric C M; Lam, Karen S L; Chen, Yuk Shan; Yip, Johnny C W; Arvindakshan, Meena; Yamagishi, Shin-Ichiro; Yagihashi, Soroku; Oates, Peter J; Ellery, Craig A; Chung, Stephen S M; Chung, Sookja K


    The exaggerated flux through polyol pathway during diabetes is thought to be a major cause of lesions in the peripheral nerves. Here, we used aldose reductase (AR)-deficient (AR(-/-)) and AR inhibitor (ARI)-treated mice to further understand the in vivo role of polyol pathway in the pathogenesis of diabetic neuropathy. Under normal conditions, there were no obvious differences in the innervation patterns between wild-type AR (AR(+/+)) and AR(-/-) mice. Under short-term diabetic conditions, AR(-/-) mice were protected from the reduction of motor and sensory nerve conduction velocities observed in diabetic AR(+/+) mice. Sorbitol levels in the sciatic nerves of diabetic AR(+/+) mice were increased significantly, whereas sorbitol levels in the diabetic AR(-/-) mice were significantly lower than those in diabetic AR(+/+) mice. In addition, signs of oxidative stress, such as increased activation of c-Jun NH(2)-terminal kinase (JNK), depletion of reduced glutathione, increase of superoxide formation, and DNA damage, observed in the sciatic nerves of diabetic AR(+/+) mice were not observed in the diabetic AR(-/-) mice, indicating that the diabetic AR(-/-) mice were protected from oxidative stress in the sciatic nerve. The diabetic AR(-/-) mice also excreted less 8-hydroxy-2'-deoxyguanosine in urine than diabetic AR(+/+) mice. The structural abnormalities observed in the sural nerve of diabetic AR(+/+) mice were less severe in the diabetic AR(-/-) mice, although it was only mildly protected by AR deficiency under short-term diabetic conditions. Signs of oxidative stress and functional and structural abnormalities were also inhibited by the ARI fidarestat in diabetic AR(+/+) nerves, similar to those in diabetic AR(-/-) mice. Taken together, increased polyol pathway flux through AR is a major contributing factor in the early signs of diabetic neuropathy, possibly through depletion of glutathione, increased superoxide accumulation, increased JNK activation, and DNA damage.

  14. Reduction of Brain β-Amyloid (Aβ) by Fluvastatin, a Hydroxymethylglutaryl-CoA Reductase Inhibitor, through Increase in Degradation of Amyloid Precursor Protein C-terminal Fragments (APP-CTFs) and Aβ Clearance*

    PubMed Central

    Shinohara, Mitsuru; Sato, Naoyuki; Kurinami, Hitomi; Takeuchi, Daisuke; Takeda, Shuko; Shimamura, Munehisa; Yamashita, Toshihide; Uchiyama, Yasuo; Rakugi, Hiromi; Morishita, Ryuichi


    Epidemiological studies suggest that statins (hydroxymethylglutaryl-CoA reductase inhibitors) could reduce the risk of Alzheimer disease. Although one possible explanation is through an effect on β-amyloid (Aβ) metabolism, its effect remains to be elucidated. Here, we explored the molecular mechanisms of how statins influence Aβ metabolism. Fluvastatin at clinical doses significantly reduced Aβ and amyloid precursor protein C-terminal fragment (APP-CTF) levels among APP metabolites in the brain of C57BL/6 mice. Chronic intracerebroventricular infusion of lysosomal inhibitors blocked these effects, indicating that up-regulation of the lysosomal degradation of endogenous APP-CTFs is involved in reduced Aβ production. Biochemical analysis suggested that this was mediated by enhanced trafficking of APP-CTFs from endosomes to lysosomes, associated with marked changes of Rab proteins, which regulate endosomal function. In primary neurons, fluvastatin enhanced the degradation of APP-CTFs through an isoprenoid-dependent mechanism. Because our previous study suggests additive effects of fluvastatin on Aβ metabolism, we examined Aβ clearance rates by using the brain efflux index method and found its increased rates at high Aβ levels from brain. As LRP1 in brain microvessels was increased, up-regulation of LRP1-mediated Aβ clearance at the blood-brain barrier might be involved. In cultured brain microvessel endothelial cells, fluvastatin increased LRP1 and the uptake of Aβ, which was blocked by LRP1 antagonists, through an isoprenoid-dependent mechanism. Overall, the present study demonstrated that fluvastatin reduced Aβ level by an isoprenoid-dependent mechanism. These results have important implications for the development of disease-modifying therapy for Alzheimer disease as well as understanding of Aβ metabolism. PMID:20472556

  15. Deletion of mtrC in Haemophilus ducreyi increases sensitivity to human antimicrobial peptides and activates the CpxRA regulon.


    Rinker, Sherri D; Trombley, Michael P; Gu, Xiaoping; Fortney, Kate R; Bauer, Margaret E


    Haemophilus ducreyi resists killing by antimicrobial peptides encountered during human infection, including cathelicidin LL-37, α-defensins, and β-defensins. In this study, we examined the role of the proton motive force-dependent multiple transferable resistance (MTR) transporter in antimicrobial peptide resistance in H. ducreyi. We found a proton motive force-dependent effect on H. ducreyi's resistance to LL-37 and β-defensin HBD-3, but not α-defensin HNP-2. Deletion of the membrane fusion protein MtrC rendered H. ducreyi more sensitive to LL-37 and human β-defensins but had relatively little effect on α-defensin resistance. The mtrC mutant 35000HPmtrC exhibited phenotypic changes in outer membrane protein profiles, colony morphology, and serum sensitivity, which were restored to wild type by trans-complementation with mtrC. Similar phenotypes were reported in a cpxA mutant; activation of the two-component CpxRA regulator was confirmed by showing transcriptional effects on CpxRA-regulated genes in 35000HPmtrC. A cpxR mutant had wild-type levels of antimicrobial peptide resistance; a cpxA mutation had little effect on defensin resistance but led to increased sensitivity to LL-37. 35000HPmtrC was more sensitive than the cpxA mutant to LL-37, indicating that MTR contributed to LL-37 resistance independent of the CpxRA regulon. The CpxRA regulon did not affect proton motive force-dependent antimicrobial peptide resistance; however, 35000HPmtrC had lost proton motive force-dependent peptide resistance, suggesting that the MTR transporter promotes proton motive force-dependent resistance to LL-37 and human β-defensins. This is the first report of a β-defensin resistance mechanism in H. ducreyi and shows that LL-37 resistance in H. ducreyi is multifactorial.

  16. Role of outer membrane c-type cytochromes MtrC and OmcA in Shewanella oneidensis MR-1 cell production, accumulation and detachment during respiration on hematite

    USDA-ARS?s Scientific Manuscript database

    The iron-reducing bacterium Shewanella oneidensis MR-1 has the capacity to contribute to iron cycling over the long term by respiring on crystalline iron oxides such as hematite when poorly crystalline phases are depleted. The ability of outer membrane cytochromes OmcA and MtrC of MR-1 to bind to an...

  17. Functional and Phylogenetic Divergence of Fungal Adenylate-Forming Reductases

    PubMed Central

    Kalb, Daniel; Lackner, Gerald


    A key step in fungal l-lysine biosynthesis is catalyzed by adenylate-forming l-α-aminoadipic acid reductases, organized in domains for adenylation, thiolation, and the reduction step. However, the genomes of numerous ascomycetes and basidiomycetes contain an unexpectedly large number of additional genes encoding similar but functionally distinct enzymes. Here, we describe the functional in vitro characterization of four reductases which were heterologously produced in Escherichia coli. The Ceriporiopsis subvermispora serine reductase Nps1 features a terminal ferredoxin-NADP+ reductase (FNR) domain and thus belongs to a hitherto undescribed class of fungal multidomain enzymes. The second major class is characterized by the canonical terminal short-chain dehydrogenase/reductase domain and represented by Ceriporiopsis subvermispora Nps3 as the first biochemically characterized l-α-aminoadipic acid reductase of basidiomycete origin. Aspergillus flavus l-tyrosine reductases LnaA and LnbA are members of a distinct phylogenetic clade. Phylogenetic analysis supports the view that fungal adenylate-forming reductases are more diverse than previously recognized and belong to four distinct classes. PMID:25085485

  18. Structure of an integral membrane sterol reductase from Methylomicrobium alcaliphilum

    PubMed Central

    Li, Xiaochun; Roberti, Rita; Blobel, Günter


    Sterols are essential biological molecules in the majority of life forms. Sterol reductases1 including Delta-14 sterol reductase (C14SR), 7-dehydrocholesterol reductase (DHCR7) and 24-dehydrocholesterol reductase (DHCR24) reduce specific carbon-carbon double bonds of the sterol moiety using a reducing cofactor during sterol biosynthesis. Lamin B Receptor2 (LBR), an integral inner nuclear membrane protein, also contains a functional C14SR domain. Here we report the crystal structure of a Delta-14 sterol reductase (maSR1) from the methanotrophic bacterium Methylomicrobium alcaliphilum 20Z, a homolog of human C14SR, LBR, and DHCR7, with the cofactor NADPH. The enzyme contains 10 transmembrane segments (TM). Its catalytic domain comprises the C-terminal half (containing TM6-10) and envelops two interconnected pockets, one of which faces the cytoplasm and houses NADPH, while the other one is accessible from the lipid bilayer. Comparison with a soluble steroid 5β-reductase structure3 suggests that the reducing end of NADPH meets the sterol substrate at the juncture of the two pockets. A sterol reductase activity assay proves maSR1 can reduce the double bond of a cholesterol biosynthetic intermediate demonstrating functional conservation to human C14SR. Therefore, our structure as a prototype of integral membrane sterol reductases provides molecular insight into mutations in DHCR7 and LBR for inborn human diseases. PMID:25307054

  19. Quinone Reductase 2 Is a Catechol Quinone Reductase

    SciTech Connect

    Fu, Yue; Buryanovskyy, Leonid; Zhang, Zhongtao


    The functions of quinone reductase 2 have eluded researchers for decades even though a genetic polymorphism is associated with various neurological disorders. Employing enzymatic studies using adrenochrome as a substrate, we show that quinone reductase 2 is specific for the reduction of adrenochrome, whereas quinone reductase 1 shows no activity. We also solved the crystal structure of quinone reductase 2 in complexes with dopamine and adrenochrome, two compounds that are structurally related to catecholamine quinones. Detailed structural analyses delineate the mechanism of quinone reductase 2 specificity toward catechol quinones in comparison with quinone reductase 1; a side-chain rotational difference between quinone reductase 1 and quinone reductase 2 of a single residue, phenylalanine 106, determines the specificity of enzymatic activities. These results infer functional differences between two homologous enzymes and indicate that quinone reductase 2 could play important roles in the regulation of catecholamine oxidation processes that may be involved in the etiology of Parkinson disease.

  20. Engineering Styrene Monooxygenase for Biocatalysis: Reductase-Epoxidase Fusion Proteins.


    Heine, Thomas; Tucker, Kathryn; Okonkwo, Nonye; Assefa, Berhanegebriel; Conrad, Catleen; Scholtissek, Anika; Schlömann, Michael; Gassner, George; Tischler, Dirk


    The enantioselective epoxidation of styrene and related compounds by two-component styrene monooxygenases (SMOs) has targeted these enzymes for development as biocatalysts. In the present work, we prepare genetically engineered fusion proteins that join the C-terminus of the epoxidase (StyA) to the N-terminus of the reductase (StyB) through a linker peptide and demonstrate their utility as biocatalysts in the synthesis of Tyrain purple and other indigoid dyes. A single-vector expression system offers a simplified platform for transformation and expansion of the catalytic function of styrene monooxygenases, and the resulting fusion proteins are self-regulated and couple efficiently NADH oxidation to styrene epoxidation. We find that the reductase domain proceeds through a sequential ternary-complex mechanism at low FAD concentration and a double-displacement mechanism at higher concentrations of FAD. Single-turnover studies indicate an observed rate constant for FAD-to-FAD hydride transfer of ~8 s(-1). This step is rate limiting in the styrene epoxidation reaction and helps to ensure that flavin reduction and styrene epoxidation reactions proceed without wasteful side reactions. Comparison of the reductase activity of the fusion proteins with the naturally occurring reductase, SMOB, and N-terminally histidine-tagged reductase, NSMOB, suggests that the observed changes in catalytic mechanism are due in part to an increase in flavin-binding affinity associated with the N-terminal extension of the reductase.

  1. Comparative anatomy of the aldo-keto reductase superfamily.

    PubMed Central

    Jez, J M; Bennett, M J; Schlegel, B P; Lewis, M; Penning, T M


    The aldo-keto reductases metabolize a wide range of substrates and are potential drug targets. This protein superfamily includes aldose reductases, aldehyde reductases, hydroxysteroid dehydrogenases and dihydrodiol dehydrogenases. By combining multiple sequence alignments with known three-dimensional structures and the results of site-directed mutagenesis studies, we have developed a structure/function analysis of this superfamily. Our studies suggest that the (alpha/beta)8-barrel fold provides a common scaffold for an NAD(P)(H)-dependent catalytic activity, with substrate specificity determined by variation of loops on the C-terminal side of the barrel. All the aldo-keto reductases are dependent on nicotinamide cofactors for catalysis and retain a similar cofactor binding site, even among proteins with less than 30% amino acid sequence identity. Likewise, the aldo-keto reductase active site is highly conserved. However, our alignments indicate that variation ofa single residue in the active site may alter the reaction mechanism from carbonyl oxidoreduction to carbon-carbon double-bond reduction, as in the 3-oxo-5beta-steroid 4-dehydrogenases (Delta4-3-ketosteroid 5beta-reductases) of the superfamily. Comparison of the proposed substrate binding pocket suggests residues 54 and 118, near the active site, as possible discriminators between sugar and steroid substrates. In addition, sequence alignment and subsequent homology modelling of mouse liver 17beta-hydroxysteroid dehydrogenase and rat ovary 20alpha-hydroxysteroid dehydrogenase indicate that three loops on the C-terminal side of the barrel play potential roles in determining the positional and stereo-specificity of the hydroxysteroid dehydrogenases. Finally, we propose that the aldo-keto reductase superfamily may represent an example of divergent evolution from an ancestral multifunctional oxidoreductase and an example of convergent evolution to the same active-site constellation as the short

  2. Comparative anatomy of the aldo-keto reductase superfamily.


    Jez, J M; Bennett, M J; Schlegel, B P; Lewis, M; Penning, T M


    The aldo-keto reductases metabolize a wide range of substrates and are potential drug targets. This protein superfamily includes aldose reductases, aldehyde reductases, hydroxysteroid dehydrogenases and dihydrodiol dehydrogenases. By combining multiple sequence alignments with known three-dimensional structures and the results of site-directed mutagenesis studies, we have developed a structure/function analysis of this superfamily. Our studies suggest that the (alpha/beta)8-barrel fold provides a common scaffold for an NAD(P)(H)-dependent catalytic activity, with substrate specificity determined by variation of loops on the C-terminal side of the barrel. All the aldo-keto reductases are dependent on nicotinamide cofactors for catalysis and retain a similar cofactor binding site, even among proteins with less than 30% amino acid sequence identity. Likewise, the aldo-keto reductase active site is highly conserved. However, our alignments indicate that variation ofa single residue in the active site may alter the reaction mechanism from carbonyl oxidoreduction to carbon-carbon double-bond reduction, as in the 3-oxo-5beta-steroid 4-dehydrogenases (Delta4-3-ketosteroid 5beta-reductases) of the superfamily. Comparison of the proposed substrate binding pocket suggests residues 54 and 118, near the active site, as possible discriminators between sugar and steroid substrates. In addition, sequence alignment and subsequent homology modelling of mouse liver 17beta-hydroxysteroid dehydrogenase and rat ovary 20alpha-hydroxysteroid dehydrogenase indicate that three loops on the C-terminal side of the barrel play potential roles in determining the positional and stereo-specificity of the hydroxysteroid dehydrogenases. Finally, we propose that the aldo-keto reductase superfamily may represent an example of divergent evolution from an ancestral multifunctional oxidoreductase and an example of convergent evolution to the same active-site constellation as the short

  3. Characterization of the Reversible Inactivation of Ankistrodesmus braunii Nitrate Reductase by Hydroxylamine.


    Balandin, T; Fernández, V M; Aparicio, P J


    The photoreversible nature of the regulation of nitrate reductase is one of the most interesting features of this enzyme. As well as other chemicals, NH(2)OH reversibly inactivates the reduced form of nitrate reductase from Ankistrodesmus braunii. From the partial activities of the enzyme, only terminal nitrate reductase is affected by NH(2)OH. To demonstrate that the terminal activity was readily inactivted by NH(2)OH, the necessary reductants of the terminal part of the enzyme had to be cleared of dithionite since this compound reacts chemically with NH(2)OH. Photoreduced flavins and electrochemically reduced methyl viologen sustain very effective inactivation of terminal nitrate reductase activity, even if the enzyme was previously deprived of its NADH-dehydrogenase activity. The early inhibition of nitrate reductase by NH(2)OH appears to be competitive versus NO(3) (-). Since NO(3) (-), as well as cyanate, carbamyl phosphate and azide (competitive inhibitors of nitrate reductase versus NO(3) (-)), protect the enzyme from NH(2)OH inactivation, it is suggested that NH(2)OH binds to the nitrate active site. The NH(2)OH-inactivated enzyme was photoreactivated in the presence of flavins, although slower than when the enzyme was previously inactivated with CN(-). NH(2)OH and NADH concentrations required for full inactivation of nitrate reductase appear to be low enough to potentially consider this inactivation process of physiological significance.

  4. Characterization of the Reversible Inactivation of Ankistrodesmus braunii Nitrate Reductase by Hydroxylamine 1

    PubMed Central

    Balandin, Teresa; Fernández, Victor M.; Aparicio, Pedro J.


    The photoreversible nature of the regulation of nitrate reductase is one of the most interesting features of this enzyme. As well as other chemicals, NH2OH reversibly inactivates the reduced form of nitrate reductase from Ankistrodesmus braunii. From the partial activities of the enzyme, only terminal nitrate reductase is affected by NH2OH. To demonstrate that the terminal activity was readily inactivted by NH2OH, the necessary reductants of the terminal part of the enzyme had to be cleared of dithionite since this compound reacts chemically with NH2OH. Photoreduced flavins and electrochemically reduced methyl viologen sustain very effective inactivation of terminal nitrate reductase activity, even if the enzyme was previously deprived of its NADH-dehydrogenase activity. The early inhibition of nitrate reductase by NH2OH appears to be competitive versus NO3−. Since NO3−, as well as cyanate, carbamyl phosphate and azide (competitive inhibitors of nitrate reductase versus NO3−), protect the enzyme from NH2OH inactivation, it is suggested that NH2OH binds to the nitrate active site. The NH2OH-inactivated enzyme was photoreactivated in the presence of flavins, although slower than when the enzyme was previously inactivated with CN−. NH2OH and NADH concentrations required for full inactivation of nitrate reductase appear to be low enough to potentially consider this inactivation process of physiological significance. PMID:16665024

  5. Isolation of ascorbate free radical reductase from rabbit lens soluble fraction.


    Bando, Masayasu; Inoue, Takashi; Oka, Mikako; Nakamura, Kayako; Kawai, Kenji; Obazawa, Hajime; Kobayashi, Shizuko; Takehana, Makoto


    Ascorbate free radical (AFR) reductase with diaphorase activity was isolated from the rabbit lens soluble fraction to characterise some molecular properties of the enzyme. The isolation was accomplished using gel filtration (Sephadex G-75 superfine or Sephacryl S-200 HR), affinity chromatography (Affi-Gel Blue), native isoelectric focusing and two-dimensional gel electrophoresis. A major soluble AFR reductase was found at an isoelectric point of 8.4 and a molecular weight of 31 kDa, and a few minor enzymes were also detected in the range of pI 7.0-8.6. An unknown N-terminal partial amino acid sequence was determined in one peptide fragment prepared from the major enzyme fraction. From the sequence analysis, it is discussed that the lens soluble AFR reductase may differ from NADH-cytochrome b5 reductase reported to be involved in the membrane-bound AFR reductase activity of mitochondria, microsomes and plasma membrane.

  6. Nitrate and periplasmic nitrate reductases

    PubMed Central

    Sparacino-Watkins, Courtney; Stolz, John F.; Basu, Partha


    The nitrate anion is a simple, abundant and relatively stable species, yet plays a significant role in global cycling of nitrogen, global climate change, and human health. Although it has been known for quite some time that nitrate is an important species environmentally, recent studies have identified potential medical applications. In this respect the nitrate anion remains an enigmatic species that promises to offer exciting science in years to come. Many bacteria readily reduce nitrate to nitrite via nitrate reductases. Classified into three distinct types – periplasmic nitrate reductase (Nap), respiratory nitrate reductase (Nar) and assimilatory nitrate reductase (Nas), they are defined by their cellular location, operon organization and active site structure. Of these, Nap proteins are the focus of this review. Despite similarities in the catalytic and spectroscopic properties Nap from different Proteobacteria are phylogenetically distinct. This review has two major sections: in the first section, nitrate in the nitrogen cycle and human health, taxonomy of nitrate reductases, assimilatory and dissimilatory nitrate reduction, cellular locations of nitrate reductases, structural and redox chemistry are discussed. The second section focuses on the features of periplasmic nitrate reductase where the catalytic subunit of the Nap and its kinetic properties, auxiliary Nap proteins, operon structure and phylogenetic relationships are discussed. PMID:24141308

  7. Reduction of mitochondrial protein mitoNEET [2Fe-2S] clusters by human glutathione reductase.


    Landry, Aaron P; Cheng, Zishuo; Ding, Huangen


    The human mitochondrial outer membrane protein mitoNEET is a newly discovered target of the type 2 diabetes drug pioglitazone. Structurally, mitoNEET is a homodimer with each monomer containing an N-terminal transmembrane α helix tethered to the mitochondrial outer membrane and a C-terminal cytosolic domain hosting a redox-active [2Fe-2S] cluster. Genetic studies have shown that mitoNEET has a central role in regulating energy metabolism in mitochondria. However, the specific function of mitoNEET remains largely elusive. Here we find that the mitoNEET [2Fe-2S] clusters can be efficiently reduced by Escherichia coli thioredoxin reductase and glutathione reductase in an NADPH-dependent reaction. Purified human glutathione reductase has the same activity as E. coli thioredoxin reductase and glutathione reductase to reduce the mitoNEET [2Fe-2S] clusters. However, rat thioredoxin reductase, a human thioredoxin reductase homolog that contains selenocysteine in the catalytic center, has very little or no activity to reduce the mitoNEET [2Fe-2S] clusters. N-ethylmaleimide, a potent thiol modifier, completely inhibits human glutathione reductase from reducing the mitoNEET [2Fe-2S] clusters, indicating that the redox-active disulfide in the catalytic center of human glutathione reductase may be directly involved in reducing the mitoNEET [2Fe-2S] clusters. Additional studies reveal that the reduced mitoNEET [2Fe-2S] clusters in mouse heart cell extracts can be reversibly oxidized by hydrogen peroxide without disruption of the clusters, suggesting that the mitoNEET [2Fe-2S] clusters may undergo redox transition to regulate energy metabolism in mitochondria in response to oxidative signals. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Reduction of mitochondrial protein mitoNEET [2Fe-2S] clusters by human glutathione reductase

    PubMed Central

    Landry, Aaron P.; Cheng, Zishuo; Ding, Huangen


    Human mitochondrial outer membrane protein mitoNEET is a newly discovered target of type II diabetes drug pioglitazone. Structurally, mitoNEET is a homodimer with each monomer containing an N-terminal transmembrane alpha helix tethered to mitochondrial outer membrane and a C-terminal cytosolic domain hosting a redox active [2Fe-2S] cluster. Genetic studies have shown that mitoNEET has a central role in regulating energy metabolism in mitochondria. However, specific function of mitoNEET remains largely elusive. Here we find that the mitoNEET [2Fe-2S] clusters can be efficiently reduced by Escherichia coli thioredoxin reductase and glutathione reductase in an NADPH-dependent reaction. Purified human glutathione reductase has the same activity as E. coli thioredoxin reductase and glutathione reductase to reduce the mitoNEET [2Fe-2S] clusters. However, rat thioredoxin reductase, a human thioredoxin reductase homolog that contains selenocysteine in the catalytic center, has very little or no activity to reduce the mitoNEET [2Fe-2S] clusters. N-ethylmaleimide, a potent thiol modifier, completely inhibits human glutathione reductase to reduce the mitoNEET [2Fe-2S] clusters, indicating that the redox active disulfide in the catalytic center of human glutathione reductase may be directly involved in reducing the mitoNEET [2Fe-2S] clusters. Additional studies reveal that the reduced mitoNEET [2Fe-2S] clusters in mouse heart cell extracts can be reversibly oxidized by hydrogen peroxide without disruption of the clusters, suggesting that the mitoNEET [2Fe-2S] clusters may undergo redox transition to regulate energy metabolism in mitochondria in response to oxidative signals. PMID:25645953

  9. Zeatin reductase in Phaseolus embryos

    SciTech Connect

    Martin, R.C.; Mok, David, W.S.; Mok, M.C. )


    Zeatin was converted to O-xylosylzeatin in embryos of Phaseolus vulgaris . O-xylosyldihydrozeatin was also identified as a zeatin metabolite. Incubation of embryo extracts with {sup 14}C-zeatin and {sup 14}C-O-xylosylzeatin revealed that reduction preceeds the O-xylosylation of zeatin. An enzyme responsible for reducing the N{sup 6}-side chain was isolated and partially purified using ammonium sulfate fractionation and affinity, gel filtration and anion exchange chromatography. The NADPH dependent reductase was zeatin specific and did not recognize cis-zeatin, ribosylzeatin, i{sup 6}Ade or i{sup 6}Ado. Two forms of the reductase could be separated by either gel filtration or anion exchange HPLC. The HMW isozyme (Mr. 55,000) eluted from the anion exchange column later than the LMW isozyme (Mr. 25,000). Interspecific differences in zeatin reductase activity were also detected.

  10. Isolated menthone reductase and nucleic acid molecules encoding same


    Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L


    The present invention provides isolated menthone reductase proteins, isolated nucleic acid molecules encoding menthone reductase proteins, methods for expressing and isolating menthone reductase proteins, and transgenic plants expressing elevated levels of menthone reductase protein.

  11. Structures of carboxylic acid reductase reveal domain dynamics underlying catalysis.


    Gahloth, Deepankar; Dunstan, Mark S; Quaglia, Daniela; Klumbys, Evaldas; Lockhart-Cairns, Michael P; Hill, Andrew M; Derrington, Sasha R; Scrutton, Nigel S; Turner, Nicholas J; Leys, David


    Carboxylic acid reductase (CAR) catalyzes the ATP- and NADPH-dependent reduction of carboxylic acids to the corresponding aldehydes. The enzyme is related to the nonribosomal peptide synthetases, consisting of an adenylation domain fused via a peptidyl carrier protein (PCP) to a reductase termination domain. Crystal structures of the CAR adenylation-PCP didomain demonstrate that large-scale domain motions occur between the adenylation and thiolation states. Crystal structures of the PCP-reductase didomain reveal that phosphopantetheine binding alters the orientation of a key Asp, resulting in a productive orientation of the bound nicotinamide. This ensures that further reduction of the aldehyde product does not occur. Combining crystallography with small-angle X-ray scattering (SAXS), we propose that molecular interactions between initiation and termination domains are limited to competing PCP docking sites. This theory is supported by the fact that (R)-pantetheine can support CAR activity for mixtures of the isolated domains. Our model suggests directions for further development of CAR as a biocatalyst.

  12. Histochemical localization of nitrate reductase.


    Vaughn, K C; Duke, S O


    NADH-dependent nitrate reductase (E.C. was ultrastructurally localized in norflurazon-treated and control soybean cotyledons [Glycine max (L.) Merr.] by a method based upon the increase in osmiophilia due to the formation of an azo dye. The reaction product was observed in small vesicles throughout the cytoplasm. An apparent transport of nitrite to the plastid, the site of nitrite reduction, may occur through fusion of the nitrite-containing vesicles with the chloroplast envelope. Plants grown in tungstate lacked nitrate reductase activity as measured by standard assay procedures, and showed no increase in osmiophilia, suggesting a degree of specificity of this cytochemical procedure.

  13. Active sites of thioredoxin reductases: why selenoproteins?


    Gromer, Stephan; Johansson, Linda; Bauer, Holger; Arscott, L David; Rauch, Susanne; Ballou, David P; Williams, Charles H; Schirmer, R Heiner; Arnér, Elias S J


    Selenium, an essential trace element for mammals, is incorporated into a selected class of selenoproteins as selenocysteine. All known isoenzymes of mammalian thioredoxin (Trx) reductases (TrxRs) employ selenium in the C-terminal redox center -Gly-Cys-Sec-Gly-COOH for reduction of Trx and other substrates, whereas the corresponding sequence in Drosophila melanogaster TrxR is -Ser-Cys-Cys-Ser-COOH. Surprisingly, the catalytic competence of these orthologous enzymes is similar, whereas direct Sec-to-Cys substitution of mammalian TrxR, or other selenoenzymes, yields almost inactive enzyme. TrxRs are therefore ideal for studying the biology of selenocysteine by comparative enzymology. Here we show that the serine residues flanking the C-terminal Cys residues of Drosophila TrxRs are responsible for activating the cysteines to match the catalytic efficiency of a selenocysteine-cysteine pair as in mammalian TrxR, obviating the need for selenium. This finding suggests that the occurrence of selenoenzymes, which implies that the organism is selenium-dependent, is not necessarily associated with improved enzyme efficiency. Our data suggest that the selective advantage of selenoenzymes is a broader range of substrates and a broader range of microenvironmental conditions in which enzyme activity is possible.

  14. A cytochrome cd1-type nitrite reductase mediates the first step of denitrification in Alcaligenes eutrophus.


    Sann, R; Kostka, S; Friedrich, B


    Respiratory nitrite reductase (NIR) has been purified from the soluble extract of denitrifying cells of Alcaligenes eutrophus strain H16 to apparent electrophoretic homogeneity. The enzyme was induced under anoxic conditions in the presence of nitrite. Purified NIR showed typical features of a cytochrome cd1-type nitrite reductase. It appeared to be a dimer of kDa subunits, its activity was only weakly inhibited by the copper chelator diethyldithiocarbamate, and spectral analysis revealed absorption maxima which were characteristic for the presence of heme c and heme d1. The isoelectric point of 8.6 was considerably higher than the pI determined for cd1 nitrite reductases from pseudomonads. Eighteen amino acids at the N-terminus of the A. eutrophus NIR, obtained by protein sequencing, showed no significant homology to the N-terminal region of nitrite reductases from Pseudomonas stutzeri and Pseudomonas aeruginosa.

  15. Termination Documentation

    ERIC Educational Resources Information Center

    Duncan, Mike; Hill, Jillian


    In this study, we examined 11 workplaces to determine how they handle termination documentation, an empirically unexplored area in technical communication and rhetoric. We found that the use of termination documentation is context dependent while following a basic pattern of infraction, investigation, intervention, and termination. Furthermore,…

  16. Termination Documentation

    ERIC Educational Resources Information Center

    Duncan, Mike; Hill, Jillian


    In this study, we examined 11 workplaces to determine how they handle termination documentation, an empirically unexplored area in technical communication and rhetoric. We found that the use of termination documentation is context dependent while following a basic pattern of infraction, investigation, intervention, and termination. Furthermore,…

  17. Assignment of the human dihydrofolate reductase gene to the q11. -->. q22 region of chromosome 5

    SciTech Connect

    Funanage, V.L.; Myoda, T.T.; Moses, P.A.; Cowell, H.R.


    Cells from a dihydrofolate reductase-deficit Chinese hamster ovary cell line were hybridized to human fetal skin fibroblast cells. Nineteen dihydrofolate reductase-positive hybrid clones were isolated and characterized. Cytogenetic and biochemical analyses of these clones have shown that the human dihydrofolate reductase (DHFR) gene is located on chromosome 5. Three of these hybrid cell lines contained different terminal deletions of chromosome 5. An analysis of the breakpoints of these deletions has demonstrated that the DHFR gene resides in the q11..-->..q22 region.

  18. The haem-copper oxygen reductase of Desulfovibrio vulgaris contains a dihaem cytochrome c in subunit II.


    Lobo, Susana A L; Almeida, Claúdia C; Carita, João N; Teixeira, Miguel; Saraiva, Lígia M


    The genome of the sulphate reducing bacterium Desulfovibrio vulgaris Hildenborough, still considered a strict anaerobe, encodes two oxygen reductases of the bd and haem-copper types. The haem-copper oxygen reductase deduced amino acid sequence reveals that it is a Type A2 enzyme, which in its subunit II contains two c-type haem binding motifs. We have characterized the cytochrome c domain of subunit II and confirmed the binding of two haem groups, both with Met-His iron coordination. Hence, this enzyme constitutes the first example of a ccaa3 haem-copper oxygen reductase. The expression of D. vulgaris haem-copper oxygen reductase was found to be independent of the electron donor and acceptor source and is not altered by stress factors such as oxygen exposure, nitrite, nitrate, and iron; therefore the haem-copper oxygen reductase seems to be constitutive. The KCN sensitive oxygen reduction by D. vulgaris membranes demonstrated in this work indicates the presence of an active haem-copper oxygen reductase. D. vulgaris membranes perform oxygen reduction when accepting electrons from the monohaem cytochrome c553, thus revealing the first possible electron donor to the terminal oxygen reductase of D. vulgaris. The physiological implication of the presence of the oxygen reductase in this organism is discussed.

  19. Nitrate reductase from Rhodopseudomonas sphaeroides.

    PubMed Central

    Kerber, N L; Cardenas, J


    The facultative phototroph Rhodopseudomonas sphaeroides DSM158 was incapable of either assimilating or dissimilating nitrate, although the organism could reduce it enzymatically to nitrite either anaerobically in the light or aerobically in the dark. Reduction of nitrate was mediated by a nitrate reductase bound to chromatophores that could be easily solubilized and functioned with chemically reduced viologens or photochemically reduced flavins as electron donors. The enzyme was solubilized, and some of its kinetic and molecular parameters were determined. It seemed to be nonadaptive, ammonia did not repress its synthesis, and its activity underwent a rapid decline when the cells entered the stationary growth phase. Studies with inhibitors and with metal antagonists indicated that molybdenum and possibly iron participate in the enzymatic reduction of nitrate. The conjectural significance of this nitrate reductase in phototrophic bacteria is discussed. PMID:6978883

  20. Selenite reduction by Shewanella oneidensis MR-1 is mediated by fumarate reductase in periplasm

    PubMed Central

    Li, Dao-Bo; Cheng, Yuan-Yuan; Wu, Chao; Li, Wen-Wei; Li, Na; Yang, Zong-Chuang; Tong, Zhong-Hua; Yu, Han-Qing


    In situ reduction of selenite to elemental selenium (Se(0)), by microorganisms in sediments and soils is an important process and greatly affects the environmental distribution and the biological effects of selenium. However, the mechanism behind such a biological process remains unrevealed yet. Here we use Shewanella oneidensis MR-1, a widely-distributed dissimilatory metal-reducing bacterium with a powerful and diverse respiration capability, to evaluate the involvement of anaerobic respiration system in the microbial selenite reduction. With mutants analysis, we identify fumarate reductase FccA as the terminal reductase of selenite in periplasm. Moreover, we find that such a reduction is dependent on central respiration c-type cytochrome CymA. In contrast, nitrate reductase, nitrite reductase, and the Mtr electron transfer pathway do not work as selenite reductases. These findings reveal a previously unrecognized role of anaerobic respiration reductases of S. oneidensis MR-1 in selenite reduction and geochemical cycles of selenium in sediments and soils. PMID:24435070

  1. Rat liver thioredoxin and thioredoxin reductase: purification and characterization.


    Luthman, M; Holmgren, A


    A reproducible scheme has been developed for the preparation of rat liver thioredoxin and thioredoxin reductase (EC by using assays based on reduction of insulin and 5,5'-dithiobis(2-nitrobenzoic acid), respectively. Both proteins were purified to homogeneity, as judged from polyacrylamide gel electrophoresis. Thioredoxin had a molecular weight of 12 000 and contained about 110 amino acids including 4 half-cystines and an NH2-terminal valine. Peptide maps of reduced and carboxymethylated thioredoxin showed that the protein had the active center sequence -Cys-Gly-Pro-Cys-Lys-Met- characteristic of thioredoxins also from procaryotes. Prolonged air oxidation of fully reduced thioredoxin created inactive, aggregated disulfide-containing molecules. Thioredoxin reductase showed a subunit molecular weight of 58 000 and a native molecular weight of 116 000. The enzyme was highly specific for NADPH with a Km of 6 microM. It contained FAD as prosthetic group and was sensitive to inhibition by arsenite. Thioredoxin reductase had a Km of 2.5 microM for rat and calf liver thioredoxin and a Kcat of 3000 min-1.

  2. Cloning and Sequence Analysis of Two Pseudomonas Flavoprotein Xenobiotic Reductases

    PubMed Central

    Blehert, David S.; Fox, Brian G.; Chambliss, Glenn H.


    The genes encoding flavin mononucleotide-containing oxidoreductases, designated xenobiotic reductases, from Pseudomonas putida II-B and P. fluorescens I-C that removed nitrite from nitroglycerin (NG) by cleavage of the nitroester bond were cloned, sequenced, and characterized. The P. putida gene, xenA, encodes a 39,702-Da monomeric, NAD(P)H-dependent flavoprotein that removes either the terminal or central nitro groups from NG and that reduces 2-cyclohexen-1-one but did not readily reduce 2,4,6-trinitrotoluene (TNT). The P. fluorescens gene, xenB, encodes a 37,441-Da monomeric, NAD(P)H-dependent flavoprotein that exhibits fivefold regioselectivity for removal of the central nitro group from NG and that transforms TNT but did not readily react with 2-cyclohexen-1-one. Heterologous expression of xenA and xenB was demonstrated in Escherichia coli DH5α. The transcription initiation sites of both xenA and xenB were identified by primer extension analysis. BLAST analyses conducted with the P. putida xenA and the P. fluorescens xenB sequences demonstrated that these genes are similar to several other bacterial genes that encode broad-specificity flavoprotein reductases. The prokaryotic flavoprotein reductases described herein likely shared a common ancestor with old yellow enzyme of yeast, a broad-specificity enzyme which may serve a detoxification role in antioxidant defense systems. PMID:10515912

  3. Fatty acyl-CoA reductase

    SciTech Connect

    Reiser, Steven E.; Somerville, Chris R.


    The present invention relates to bacterial enzymes, in particular to an acyl-CoA reductase and a gene encoding an acyl-CoA reductase, the amino acid and nucleic acid sequences corresponding to the reductase polypeptide and gene, respectively, and to methods of obtaining such enzymes, amino acid sequences and nucleic acid sequences. The invention also relates to the use of such sequences to provide transgenic host cells capable of producing fatty alcohols and fatty aldehydes.

  4. Identification of structural domains within the large subunit of herpes simplex virus ribonucleotide reductase.


    Conner, J; Cross, A; Murray, J; Marsden, H


    The large subunit (R1) of herpes simplex virus (HSV) ribonucleotide reductase is a bifunctional protein consisting of a unique N-terminal protein kinase domain and a ribonucleotide reductase domain. Previous studies showed that the two functional domains are linked by a protease sensitive site. Here we provide evidence for two subdomains, of 30K and 53K, within the reductase domain. The two fragments, which were produced by limited proteolysis and were resistant to further degradation, remained tightly associated in a complex containing two molecules of each. They were capable of binding the R2 subunit of HSV ribonucleotide reductase with approximately the same affinity as the intact protein but the complex did not complement the small subunit (R2) to give an active enzyme. At low concentrations (0.4 micrograms/ml) of trypsin or V8 protease, cleavage between the subdomains was prevented by the presence of the N-terminal protein kinase domain. At higher protease concentrations (1 micrograms/ml) the N-terminal domain is extensively proteolysed and the 30K and 53K domains were generated. Identical results were obtained using purified R1 isolated from infected cell extracts or following expression in Escherichia coli. The origin of the two domains was investigated by N-terminal sequencing of the 53K fragment and by examining their reactivity with a panel of R1-specific monoclonal antibodies which we isolated and epitope mapped for that purpose. The trypsin cleavage site was found to lie between arginine 575 and asparagine 576, and proteolysis in this region was not prevented by the presence of R2 or the nonapeptide YAGAVVNDL. We propose that the ribonucleotide reductase region of HSV R1 exists in a two domain structure, and that the interdomain linking region is protected by the unique N terminus.

  5. Bank Terminals

    NASA Technical Reports Server (NTRS)


    In the photo, employees of the UAB Bank, Knoxville, Tennessee, are using Teller Transaction Terminals manufactured by SCI Systems, Inc., Huntsville, Alabama, an electronics firm which has worked on a number of space projects under contract with NASA. The terminals are part of an advanced, computerized financial transaction system that offers high efficiency in bank operations. The key to the system's efficiency is a "multiplexing" technique developed for NASA's Space Shuttle. Multiplexing is simultaneous transmission of large amounts of data over a single transmission link at very high rates of speed. In the banking application, a small multiplex "data bus" interconnects all the terminals and a central computer which stores information on clients' accounts. The data bus replaces the maze-of wiring that would be needed to connect each terminal separately and it affords greater speed in recording transactions. The SCI system offers banks real-time data management through constant updating of the central computer. For example, a check is immediately cancelled at the teller's terminal and the computer is simultaneously advised of the transaction; under other methods, the check would be cancelled and the transaction recorded at the close of business. Teller checkout at the end of the day, conventionally a time-consuming matter of processing paper, can be accomplished in minutes by calling up a summary of the day's transactions. SCI manufactures other types of terminals for use in the system, such as an administrative terminal that provides an immediate printout of a client's account, and another for printing and recording savings account deposits and withdrawals. SCI systems have been installed in several banks in Tennessee, Arizona, and Oregon and additional installations are scheduled this year.

  6. Nitrate Reductase Regulates Expression of Nitrite Uptake and Nitrite Reductase Activities in Chlamydomonas reinhardtii 1

    PubMed Central

    Galván, Aurora; Cárdenas, Jacobo; Fernández, Emilio


    In Chlamydomonas reinhardtii mutants defective at the structural locus for nitrate reductase (nit-1) or at loci for biosynthesis of the molybdopterin cofactor (nit-3, nit-4, or nit-5 and nit-6), both nitrite uptake and nitrite reductase activities were repressed in ammonium-grown cells and expressed at high amounts in nitrogen-free media or in media containing nitrate or nitrite. In contrast, wild-type cells required nitrate induction for expression of high levels of both activities. In mutants defective at the regulatory locus for nitrate reductase (nit-2), very low levels of nitrite uptake and nitrite reductase activities were expressed even in the presence of nitrate or nitrite. Both restoration of nitrate reductase activity in mutants defective at nit-1, nit-3, and nit-4 by isolating diploid strains among them and transformation of a structural mutant upon integration of the wild-type nit-1 gene gave rise to the wild-type expression pattern for nitrite uptake and nitrite reductase activities. Conversely, inactivation of nitrate reductase by tungstate treatment in nitrate, nitrite, or nitrogen-free media made wild-type cells respond like nitrate reductase-deficient mutants with respect to the expression of nitrite uptake and nitrite reductase activities. Our results indicate that nit-2 is a regulatory locus for both the nitrite uptake system and nitrite reductase, and that the nitrate reductase enzyme plays an important role in the regulation of the expression of both enzyme activities. PMID:16668656

  7. Crystal Structure of Saccharomyces Cerevisiae 3'-Phosphoadenosine-5'-Phosphosulfate Reductase Complexed With Adenosine 3',5'-Bisphosphate

    SciTech Connect

    Yu, Z.; Lemongello, D.; Segel, I.H.; Fisher, A.J.


    Most assimilatory bacteria, fungi, and plants species reduce sulfate (in the activated form of APS or PAPS) to produce reduced sulfur. In yeast, PAPS reductase reduces PAPS to sulfite and PAP. Despite the difference in substrate specificity and catalytic cofactor, PAPS reductase is homologous to APS reductase in both sequence and structure, and they are suggested to share the same catalytic mechanism. Metazoans do not possess the sulfate reduction pathway, which makes APS/PAPS reductases potential drug targets for human pathogens. Here, we present the 2.05 A resolution crystal structure of the yeast PAPS reductase binary complex with product PAP bound. The N-terminal region mediates dimeric interactions resulting in a unique homodimer assembly not seen in previous APS/PAPS reductase structures. The 'pyrophosphate-binding' sequence (47)TTAFGLTG(54) defines the substrate 3'-phosphate binding pocket. In yeast, Gly54 replaces a conserved aspartate found in APS reductases vacating space and charge to accommodate the 3'-phosphate of PAPS, thus regulating substrate specificity. Also, for the first time, the complete C-terminal catalytic motif (244)ECGIH(248) is revealed in the active site. The catalytic residue Cys245 is ideally positioned for an in-line attack on the beta-sulfate of PAPS. In addition, the side chain of His248 is only 4.2 A from the Sgamma of Cys245 and may serve as a catalytic base to deprotonate the active site cysteine. A hydrophobic sequence (252)RFAQFL(257) at the end of the C-terminus may provide anchoring interactions preventing the tail from swinging away from the active site as seen in other APS/PAPS reductases.

  8. Human aldose reductase and human small intestine aldose reductase are efficient retinal reductases: consequences for retinoid metabolism.


    Crosas, Bernat; Hyndman, David J; Gallego, Oriol; Martras, Sílvia; Parés, Xavier; Flynn, T Geoffrey; Farrés, Jaume


    Aldo-keto reductases (AKRs) are NAD(P)H-dependent oxidoreductases that catalyse the reduction of a variety of carbonyl compounds, such as carbohydrates, aliphatic and aromatic aldehydes and steroids. We have studied the retinal reductase activity of human aldose reductase (AR), human small-intestine (HSI) AR and pig aldehyde reductase. Human AR and HSI AR were very efficient in the reduction of all- trans -, 9- cis - and 13- cis -retinal ( k (cat)/ K (m)=1100-10300 mM(-1).min(-1)), constituting the first cytosolic NADP(H)-dependent retinal reductases described in humans. Aldehyde reductase showed no activity with these retinal isomers. Glucose was a poor inhibitor ( K (i)=80 mM) of retinal reductase activity of human AR, whereas tolrestat, a classical AKR inhibitor used pharmacologically to treat diabetes, inhibited retinal reduction by human AR and HSI AR. All- trans -retinoic acid failed to inhibit both enzymes. In this paper we present the AKRs as an emergent superfamily of retinal-active enzymes, putatively involved in the regulation of retinoid biological activity through the assimilation of retinoids from beta-carotene and the control of retinal bioavailability.

  9. Purification and characterization of morphinone reductase from Pseudomonas putida M10.


    French, C E; Bruce, N C


    The NADH-dependent morphinone reductase from Pseudomonas putida M10 catalyses the reduction of morphinone and codeinone to hydromorphone and hydrocodone respectively. Morphinone reductase was purified from crude cell extracts to apparent homogeneity in a single affinity-chromatography step using Mimetic Yellow 2. The purified enzyme was a dimeric flavoprotein with two identical subunits of M(r) 41,100, binding non-covalently one molecule of FMN per subunit. The N-terminal sequence was PDTSFSNPGLFTPLQ. Morphinone reductase was active against morphinone, codeinone, neopinone and 2-cyclohexen-1-one, but not against morphine, codeine or isocodeine. The apparent Km values for codeinone and 2-cyclohexen-1-one were 0.26 mM and 5.5 mM respectively. The steroids progesterone and cortisone were potent competitive inhibitors; the apparent K1 for cortisone was 35 microM. The pH optimum for codeinone reduction was 8.0 in phosphate buffer. No reverse reaction could be detected, and NADPH could not be used as a reducing substrate in place of NADH. Morphinone reductase activity was strongly inhibited by 0.01 mM CuSO4 and p-hydroxymercuribenzoate, suggesting the presence of a vital thiol group. Steady-state kinetic studies suggested a Ping Pong (substituted enzyme) kinetic mechanism; however, product-inhibition patterns were inconsistent with a classical Ping Pong mechanism. Morphinone reductase may, like several other flavoprotein dehydrogenases, operate by a hybrid two-site Ping Pong mechanism.

  10. Neuroprotective role for carbonyl reductase?


    Maser, Edmund


    Oxidative stress is increasingly implicated in neurodegenerative disorders including Alzheimer's, Parkinson's, Huntington's, and Creutzfeld-Jakob diseases or amyotrophic lateral sclerosis. Reactive oxygen species seem to play a significant role in neuronal cell death in that they generate reactive aldehydes from membrane lipid peroxidation. Several neuronal diseases are associated with increased accumulation of abnormal protein adducts of reactive aldehydes, which mediate oxidative stress-linked pathological events, including cellular growth inhibition and apoptosis induction. Combining findings on neurodegeneration and oxidative stress in Drosophila with studies on the metabolic characteristics of the human enzyme carbonyl reductase (CR), it is clear now that CR has a potential physiological role for neuroprotection in humans. Several lines of evidence suggest that CR represents a significant pathway for the detoxification of reactive aldehydes derived from lipid peroxidation and that CR in humans is essential for neuronal cell survival and to confer protection against oxidative stress-induced brain degeneration.

  11. Characteristic analysis of the luxG gene encoding the probable flavin reductase that resides in the lux operon of Photobacterium leiognathi.


    Lin, J W; Chao, Y F; Weng, S F


    Nucleotide sequence of the luxG gene (GenBank Accession No. AF053227) from Photobacterium leiognathi PL741 has been determined, and the encoded probable flavin reductase is deduced. The probable flavin reductase encoded by the luxG gene has a calculated M(r) 26,544 and comprises 235 amino acid residues. The probable flavin reductase like the NAD(P)H-flavin reductase might catalyze the reduction of flavins. Alignment and comparison of the probable flavin reductases from P. leiognathi PL741, ATCC 25521, P. phosphoreum, Vibrio fischeri, and V. harveyi show that they are homologous; there is 66% homologous (29.4% identity and 36.6% similarity). Also, the probable flavin reductase is homologous to the NAD(P)H-flavin reductase; it is perceived that the probable flavin reductase and the NAD(P)H-flavin reductase could be enzyme isoforms encoded by two genes of a multigene family for differential response functions. Functional analysis illustrates that the specific segment sequence lay inside and behind the luxG gene might form the potential hairpin loops omega gI, omega gII, omega o, and omega oT as mRNA stability loop or/and as the attenuator-like loop or the dynamic terminator-like block for sub-regulation in the lux operon. The gene order of the luxG gene in the lux operon and the lum operon is <--ter-lumQ-lumP-R&R-luxC-luxD-luxA-luxB-+ ++luxN-luxE-luxG--> (R&R: regulatory region; ter: transcriptional terminator), whereas the R&R is the regulatory region for the lum operon and the lux operon, and ter is the transcriptional terminator for the lum operon.

  12. Terminal structure


    Schmidt, Frank [Langenhagen, DE; Allais, Arnaud [Hannover, DE; Mirebeau, Pierre [Villebon sur Yvette, FR; Ganhungu, Francois [Vieux-Reng, FR; Lallouet, Nicolas [Saint Martin Boulogne, FR


    A terminal structure (2) for a superconducting cable (1) is described. It consists of a conductor (2a) and an insulator (2b) that surrounds the conductor (2a), wherein the superconducting cable (1) has a core with a superconducting conductor (5) and a layer of insulation that surrounds the conductor (5), and wherein the core is arranged in such a way that it can move longitudinally in a cryostat. The conductor (2a) of the terminal structure (2) is electrically connected with the superconducting conductor (5) or with a normal conductor (6) that is connected with the superconducting conductor (5) by means of a tubular part (7) made of an electrically conductive material, wherein the superconducting conductor (5) or the normal conductor (6) can slide in the part (7) in the direction of the superconductor.

  13. Covalent Adducts Between Thioredoxin Reductase and Endogenous Electrophiles in Human Breast Cancer

    DTIC Science & Technology


    S, Lee S-R, Rhee SG. Identification of proteins containing cysteine residues that are sensitive to hydrogen peroxide at neutral pH. Anal. Biochem...of chemoprevention trials utilizing agents such as NSAIDs, selenium supplements, inducers of Phase 2 detoxification enzymes such as curcumin , and...metabolite, LTA4, the lipid peroxidation combination of a C-terminal thioredoxin product, 4-HNE, and a quinone metabolite of reductase mutant and small

  14. Purification and characterization of Fe(III)-EDTA reductase from Bacillus sp. B-3.


    Shinagawa, Emiko


    Fe(III)-EDTA reductase was purified from Bacillus sp. B-3 isolated as a Fe(III)-EDTA-degrading bacterium. The purified enzyme showed a single protein band corresponding to a molecular mass of 19 kDa on SDS-PAGE, and had FMN as cofactor. It was alkali-thermostable. Its N-terminal amino acid sequence was identical with that of NADPH azoreductase from several species of Bacillus.

  15. Terminal Ballistics

    DTIC Science & Technology


    ballistics doe, little to c~plaini the workings of explosike pro jectiles. The termni,iaf phase (of di esplodling tbalfftic weapon is comiposed of esents...citterior, and terminal baillistic phases, and the study of this n’!w systemn hius useful parallel% it) the proiecoile ballistic sysStem. The...charge liner collapse Vi Jet velocity V, Slug velocity W Work Wp Weight of projecti!e Z A length variable a, bi Empirical constants. (In Chap. 5, Eq

  16. Production of a recombinant hybrid hemoflavoprotein: engineering a functional NADH:cytochrome c reductase.


    Barber, M J; Quinn, G B


    A gene has been constructed coding for a unique fusion protein, NADH:cytochrome c reductase, that comprises the soluble heme-containing domain of rat hepatic cytochrome b(5) as the amino-terminal portion of the protein and the soluble flavin-containing domain of rat hepatic cytochrome b(5) reductase as the carboxyl terminus. The gene has been expressed in Escherichia coli resulting in the highly efficient production of a functional hybrid hemoflavoprotein which has been purified to homogeneity by a combination of ammonium sulfate precipitation, affinity chromatography on 5'-ADP agarose, and size-exclusion chromatography. The purified protein exhibited a molecular mass of approximately 46 kDa by polyacrylamide gel electrophoresis and 40,875 Da, for the apoprotein, using mass spectrometry which also confirmed the presence of both heme and FAD prosthetic groups. The fusion protein showed immunological cross-reactivity with both anti-rat cytochrome b(5) and anti-rat cytochrome b(5) reductase antibodies indicating the conservation of antigenic determinants from both native domains. Spectroscopic analysis indicated the fusion protein contained both a b-type cytochrome and flavin chromophors with properties identical to those of the native proteins. Amino-terminal and internal amino acid sequencing confirmed the identity of peptides derived from both the heme- and flavin-binding domains with sequences identical to the deduced amino acid sequence. The isolated fusion protein retained NADH:ferricyanide reductase activity (k(cat) = 8.00 x 10(2) s(-1), K(NADH)(m) = 4 microM, K(FeCN(6))(m) = 11 microM) comparable to that of that of native NADH:cytochrome b(5) reductase and also exhibited both NADH:cytochrome c reductase activity (k(cat) = 2.17 x 10(2) s(-1), K(NADH)(m) = 2 microM, K(FeCN(6))(m) = 11 microM, K(Cyt.c)(m) = 1 microM) and NADH:methemoglobin reductase activity (k(cat) = 4.40 x 10(-1) s(-1), K(NADH)(m) = 3 microM, K(mHb)(m) = 47 microM), the latter two activities

  17. Termination unit


    Traeholt, Chresten; Willen, Dag; Roden, Mark; Tolbert, Jerry C.; Lindsay, David; Fisher, Paul W.; Nielsen, Carsten Thidemann


    Cable end section comprises end-parts of N electrical phases/neutral, and a thermally-insulation envelope comprising cooling fluid. The end-parts each comprises a conductor and are arranged with phase 1 innermost, N outermost surrounded by the neutral, electrical insulation being between phases and N and neutral. The end-parts comprise contacting surfaces located sequentially along the longitudinal extension of the end-section. A termination unit has an insulating envelope connected to a cryostat, special parts at both ends comprising an adapter piece at the cable interface and a closing end-piece terminating the envelope in the end-section. The special parts houses an inlet and/or outlet for cooling fluid. The space between an inner wall of the envelope and a central opening of the cable is filled with cooling fluid. The special part at the end connecting to the cryostat houses an inlet or outlet, splitting cooling flow into cable annular flow and termination annular flow.

  18. Genetics Home Reference: 5-alpha reductase deficiency


    ... About half of these individuals adopt a male gender role in adolescence or early adulthood. Related Information ... 1730-5. Citation on PubMed Cohen-Kettenis PT. Gender change in 46,XY persons with 5alpha-reductase- ...

  19. Heterogeneity of rat type I 5 alpha-reductase cDNA: cloning, expression and regulation by pituitary implants and dihydrotestosterone.


    Lopez-Solache, I; Luu-The, V; Séralini, G E; Labrie, F


    Primer extension analysis reveals the presence of different forms of mRNA species for rat type I 5 alpha-reductase. Using a 5 alpha-reductase cDNA probe to screen the rat liver lambda gt11 cDNA library, we isolated cDNA clones that have 4 additional amino acids in the NH2-terminal region as compared with the previously reported sequence for rat type I 5 alpha-reductase. These four additional amino acids elongate the rat type I 5 alpha-reductase amino acid sequence to 259 amino acids, the same number as in human type I 5 alpha-reductase, with which it shares 60% identity. Expression of the long and short rat type I 5 alpha-reductase by transfection in human adrenal adenocarcinoma cells, SW-13 cells, indicated that the long cDNA encoded a protein with a higher affinity for the substrate than the short cDNA. To determine the effect of pituitary hormones and dihydrotestosterone (DHT), the mRNA levels in the livers of rats treated with pituitary implants, hypophysectomized, castrated, and castrated coupled with DHT treatment were quantified by dot-blot hybridization assay using rat type I 5 alpha-reductase cDNA as probes. The results demonstrated that rat type I 5 alpha-reductase mRNA is stimulated by pituitary hormones and castration but is decreased by DHT and hypophysectomy.

  20. A dissimilatory nitrite reductase in Paracoccus halodenitrificans

    NASA Technical Reports Server (NTRS)

    Grant, M. A.; Hochstein, L. I.


    Paracoccus halodenitrificans produced a membrane-associated nitrite reductase. Spectrophotometric analysis showed it to be associated with a cd-cytochrome and located on the inner side of the cytoplasmic membrane. When supplied with nitrite, membrane preparations produced nitrous oxide and nitric oxide in different ratios depending on the electron donor employed. The nitrite reductase was maximally active at relatively low concentrations of sodium chloride and remained attached to the membranes at 100 mM sodium chloride.

  1. A dissimilatory nitrite reductase in Paracoccus halodenitrificans

    NASA Technical Reports Server (NTRS)

    Grant, M. A.; Hochstein, L. I.


    Paracoccus halodenitrificans produced a membrane-associated nitrite reductase. Spectrophotometric analysis showed it to be associated with a cd-cytochrome and located on the inner side of the cytoplasmic membrane. When supplied with nitrite, membrane preparations produced nitrous oxide and nitric oxide in different ratios depending on the electron donor employed. The nitrite reductase was maximally active at relatively low concentrations of sodium chloride and remained attached to the membranes at 100 mM sodium chloride.

  2. Purification and characterization of 5-ketofructose reductase from Erwinia citreus.

    PubMed Central

    Schrimsher, J L; Wingfield, P T; Bernard, A; Mattaliano, R; Payton, M A


    5-Ketofructose reductase [D(-)fructose:(NADP+) 5-oxidoreductase] was purified to homogeneity from Erwinia citreus and demonstrated to catalyse the reversible NADPH-dependent reduction of 5-ketofructose (D-threo-2,5-hexodiulose) to D-fructose. The enzyme appeared as a single species upon analyses by SDS/polyacrylamide-gel electrophoresis and isoelectric focusing with an apparent relative molecular mass of 40,000 and an isoelectric point of 4.4. The amino acid composition of the enzyme and the N-terminal sequence of the first 39 residues are described. The steady-state kinetic mechanism was an ordered one with NADPH binding first to the enzyme and then to 5-ketofructose, and the order of product release was D-fructose followed by NADP+. The reversible nature of the reaction offers the possibility of using this enzyme for the determination of D-fructose. Images Fig. 1. Fig. 2. PMID:3178725

  3. Substrate Recognition, Protein Dynamics, and Iron-Sulfur Cluster in Pseudomonas aeruginosa Adenosine 5′-Phosphosulfate Reductase

    PubMed Central

    Chartron, Justin; Carroll, Kate S.; Shiau, Carrie; Gao, Hong; Leary, Julie A.; Bertozzi, Carolyn R.; Stout, C. David


    APS reductase catalyzes the first committed step of reductive sulfate assimilation in pathogenic bacteria, including Mycobacterium tuberculosis, and is a promising target for drug development. We report the 2.7 Å resolution crystal structure of Pseudomonas aeruginosa APS reductase in the thiosulfonate intermediate form of the catalytic cycle and with substrate bound. The structure, high-resolution FT-ICR mass spectrometry, and quantitative kinetic analysis, establish that the two chemically discrete steps of the overall reaction take place at distinct sites on the enzyme, mediated via conformational flexibility of the C-terminal 18 residues. The results address the mechanism by which sulfonucleotide reductases protect the covalent but labile enzyme-intermediate prior to release of sulfite by the protein cofactor thioredoxin. Pseudomonas aeruginosa APS reductase contains an [4Fe-4S] cluster that is essential for catalysis. The structure reveals an unusual mode of cluster coordination by tandem cysteines and suggests how this arrangement might facilitate conformational change and cluster interaction with substrate. Assimilatory PAPS reductases are evolutionarily related, homologous enzymes that catalyze the same overall reaction, but do so in the absence of an [Fe-S] cluster. The APS reductase structure reveals adaptive use of a phosphate-binding loop for recognition of the APS O3′ hydroxyl, or alternatively, the PAPS 3′-phosphate. PMID:17010373

  4. Characterization of thyroidal glutathione reductase

    SciTech Connect

    Raasch, R.J.


    Glutathione levels were determined in bovine and rat thyroid tissue by enzymatic conjugation with 1-chloro-2,4-dinitrobenzene using glutathione S-transferase. Bovine thyroid tissue contained 1.31 {+-} 0.04 mM reduced glutathione (GSH) and 0.14 {+-} 0.02 mM oxidized glutathione (GSSG). In the rat, the concentration of GSH was 2.50 {+-} 0.05 mM while GSSG was 0.21 {+-} 0.03 mM. Glutathione reductase (GR) was purified from bovine thyroid to electrophoretic homogeneity by ion exchange, affinity and molecular exclusion chromatography. A molecular weight range of 102-109 kDa and subunit size of 55 kDa were determined for GR. Thyroidal GR was shown to be a favoprotein with one FAD per subunit. The Michaelis constants of bovine thyroidal GR were determined to be 21.8 {mu}M for NADPH and 58.8 {mu}M for GSSG. The effect of thyroid stimulating hormone (TSH) and thyroxine (T{sub 4}) on in vivo levels of GR and glucose 6-phosphate dehydrogenase were determined in rat thyroid homogenates. Both enzymes were stimulated by TSH treatment and markedly reduced following T{sub 4} treatment. Lysosomal hydrolysis of ({sup 125}I)-labeled and unlabeled thyroglobulin was examined using size exclusion HPLC.

  5. Thioredoxin Reductase and its Inhibitors

    PubMed Central

    Saccoccia, Fulvio; Angelucci, Francesco; Boumis, Giovanna; Carotti, Daniela; Desiato, Gianni; Miele, Adriana E; Bellelli, Andrea


    Thioredoxin plays a crucial role in a wide number of physiological processes, which span from reduction of nucleotides to deoxyriboucleotides to the detoxification from xenobiotics, oxidants and radicals. The redox function of Thioredoxin is critically dependent on the enzyme Thioredoxin NADPH Reductase (TrxR). In view of its indirect involvement in the above mentioned physio/pathological processes, inhibition of TrxR is an important clinical goal. As a general rule, the affinities and mechanisms of binding of TrxR inhibitors to the target enzyme are known with scarce precision and conflicting results abound in the literature. A relevant analysis of published results as well as the experimental procedures is therefore needed, also in view of the critical interest of TrxR inhibitors. We review the inhibitors of TrxR and related flavoreductases and the classical treatment of reversible, competitive, non competitive and uncompetitive inhibition with respect to TrxR, and in some cases we are able to reconcile contradictory results generated by oversimplified data analysis. PMID:24875642

  6. The aldo-keto reductase superfamily homepage.


    Hyndman, David; Bauman, David R; Heredia, Vladi V; Penning, Trevor M


    The aldo-keto reductases (AKRs) are one of the three enzyme superfamilies that perform oxidoreduction on a wide variety of natural and foreign substrates. A systematic nomenclature for the AKR superfamily was adopted in 1996 and was updated in September 2000 (visit Investigators have been diligent in submitting sequences of functional proteins to the Web site. With the new additions, the superfamily contains 114 proteins expressed in prokaryotes and eukaryotes that are distributed over 14 families (AKR1-AKR14). The AKR1 family contains the aldose reductases, the aldehyde reductases, the hydroxysteroid dehydrogenases and steroid 5beta-reductases, and is the largest. Other families of interest include AKR6, which includes potassium channel beta-subunits, and AKR7 the aflatoxin aldehyde reductases. Two new families include AKR13 (yeast aldose reductase) and AKR14 (Escherichia coli aldehyde reductase). Crystal structures of many AKRs and their complexes with ligands are available in the PDB and accessible through the Web site. Each structure has the characteristic (alpha/beta)(8)-barrel motif of the superfamily, a conserved cofactor binding site and a catalytic tetrad, and variable loop structures that define substrate specificity. Although the majority of AKRs are monomeric proteins of about 320 amino acids in length, the AKR2, AKR6 and AKR7 family may form multimers. To expand the nomenclature to accommodate multimers, we recommend that the composition and stoichiometry be listed. For example, AKR7A1:AKR7A4 (1:3) would designate a tetramer of the composition indicated. The current nomenclature is recognized by the Human Genome Project (HUGO) and the Web site provides a link to genomic information including chromosomal localization, gene boundaries, human ESTs and SNPs and much more.

  7. Selenium in thioredoxin reductase: a mechanistic perspective.


    Lacey, Brian M; Eckenroth, Brian E; Flemer, Stevenson; Hondal, Robert J


    Most high M(r) thioredoxin reductases (TRs) have the unusual feature of utilizing a vicinal disulfide bond (Cys(1)-Cys(2)) which forms an eight-membered ring during the catalytic cycle. Many eukaryotic TRs have replaced the Cys(2) position of the dyad with the rare amino acid selenocysteine (Sec). Here we demonstrate that Cys- and Sec-containing TRs are distinguished by the importance each class of enzymes places on the eight-membered ring structure in the catalytic cycle. This hypothesis was explored by studying the truncated enzyme missing the C-terminal ring structure in conjunction with oxidized peptide substrates to investigate the reduction and opening of this dyad. The peptide substrates were identical in sequence to the missing part of the enzyme, containing either a disulfide or selenylsulfide linkage, but were differentiated by the presence (cyclic) and absence (acyclic) of the ring structure. The ratio of these turnover rates informs that the ring is only of modest importance for the truncated mouse mitochondrial Sec-TR (ring/no ring = 32), while the ring structure is highly important for the truncated Cys-TRs from Drosophila melanogaster and Caenorhabditis elegans (ring/no ring > 1000). All three enzymes exhibit a similar dependence upon leaving group pK(a) as shown by the use of the acyclic peptides as substrates. These two factors can be reconciled for Cys-TRs if the ring functions to simultaneously allow for attack by a nearby thiolate while correctly positioning the leaving group sulfur atom to accept a proton from the enzymic general acid. For Sec-TRs the ring is unimportant because the lower pK(a) of the selenol relative to a thiol obviates its need to be protonated upon S-Se bond scission and permits physical separation of the selenol and the general acid. Further study of the biochemical properties of the truncated Cys and Sec TR enzymes demonstrates that the chemical advantage conferred on the eukaryotic enzyme by a selenol is the ability to

  8. Chicken muscle aldose reductase: purification, properties and relationship to other chicken aldo/keto reductases.


    Murphy, D G; Davidson, W S


    An enzyme that catalyzes the NADPH-dependent reduction of a wide range of aromatic and hydroxy-aliphatic aldehydes was purified from chicken breast muscle. This enzyme shares many properties with mammalian aldose reductases including molecular weight, relative substrate specificity, Michaelis constants, an inhibitor specificity. Therefore, it seems appropriate to call this enzyme an aldose reductase (EC Chicken muscle aldose reductase appears to be kinetically identical to an aldose reductase that has been purified from chicken kidney (Hara et al., Eur. J. Biochem. 133, 207-214) and to hen muscle L-glycol dehydrogenase (Bernado et al., Biochim. biophys. Acta 659, 189-198). The association of this aldose reductase with muscular dystrophy in the chick is discussed.

  9. Structural Basis of Free Reduced Flavin Generation by Flavin Reductase from Thermus thermophilus HB8*

    PubMed Central

    Imagawa, Takahito; Tsurumura, Toshiharu; Sugimoto, Yasushi; Aki, Kenji; Ishidoh, Kazumi; Kuramitsu, Seiki; Tsuge, Hideaki


    Free reduced flavins are involved in a variety of biological functions. They are generated from NAD(P)H by flavin reductase via co-factor flavin bound to the enzyme. Although recent findings on the structure and function of flavin reductase provide new information about co-factor FAD and substrate NAD, there have been no reports on the substrate flavin binding site. Here we report the structure of TTHA0420 from Thermus thermophilus HB8, which belongs to flavin reductase, and describe the dual binding mode of the substrate and co-factor flavins. We also report that TTHA0420 has not only the flavin reductase motif GDH but also a specific motif YGG in C terminus as well as Phe-41 and Arg-11, which are conserved in its subclass. From the structure, these motifs are important for the substrate flavin binding. On the contrary, the C terminus is stacked on the NADH binding site, apparently to block NADH binding to the active site. To identify the function of the C-terminal region, we designed and expressed a mutant TTHA0420 enzyme in which the C-terminal five residues were deleted (TTHA0420-ΔC5). Notably, the activity of TTHA0420-ΔC5 was about 10 times higher than that of the wild-type enzyme at 20–40 °C. Our findings suggest that the C-terminal region of TTHA0420 may regulate the alternative binding of NADH and substrate flavin to the enzyme. PMID:22052907

  10. Structural basis of free reduced flavin generation by flavin reductase from Thermus thermophilus HB8.


    Imagawa, Takahito; Tsurumura, Toshiharu; Sugimoto, Yasushi; Aki, Kenji; Ishidoh, Kazumi; Kuramitsu, Seiki; Tsuge, Hideaki


    Free reduced flavins are involved in a variety of biological functions. They are generated from NAD(P)H by flavin reductase via co-factor flavin bound to the enzyme. Although recent findings on the structure and function of flavin reductase provide new information about co-factor FAD and substrate NAD, there have been no reports on the substrate flavin binding site. Here we report the structure of TTHA0420 from Thermus thermophilus HB8, which belongs to flavin reductase, and describe the dual binding mode of the substrate and co-factor flavins. We also report that TTHA0420 has not only the flavin reductase motif GDH but also a specific motif YGG in C terminus as well as Phe-41 and Arg-11, which are conserved in its subclass. From the structure, these motifs are important for the substrate flavin binding. On the contrary, the C terminus is stacked on the NADH binding site, apparently to block NADH binding to the active site. To identify the function of the C-terminal region, we designed and expressed a mutant TTHA0420 enzyme in which the C-terminal five residues were deleted (TTHA0420-ΔC5). Notably, the activity of TTHA0420-ΔC5 was about 10 times higher than that of the wild-type enzyme at 20-40 °C. Our findings suggest that the C-terminal region of TTHA0420 may regulate the alternative binding of NADH and substrate flavin to the enzyme.

  11. Involvement and specificity of Shewanella oneidensis outer membrane cytochromes in the reduction of soluble and solid-phase terminal electron acceptors.


    Bücking, Clemens; Popp, Felix; Kerzenmacher, Sven; Gescher, Johannes


    The formation of outer membrane (OM) cytochromes seems to be a key step in the evolution of dissimilatory iron-reducing bacteria. They are believed to be the endpoints of an extended respiratory chain to the surface of the cell that establishes the connection to insoluble electron acceptors such as iron or manganese oxides. The gammaproteobacterium Shewanella oneidensis MR-1 contains the genetic information for five putative OM cytochromes. In this study, the role and specificity of these proteins were investigated. All experiments were conducted using a markerless deletion mutant in all five OM cytochromes that was complemented via the expression of single, plasmid-encoded genes. MtrC and MtrF were shown to be potent reductases of chelated ferric iron, birnessite, and a carbon anode in a microbial fuel cell. OmcA-producing cells were unable to catalyze iron and electrode reduction, although the protein was correctly produced and oriented. However, OmcA production resulted in a higher birnessite reduction rate compared with the mutant. The presence of the decaheme cytochrome SO_2931 as well as the diheme cytochrome SO_1659 did not rescue the phenotype of the deletion mutant.

  12. Functional characterization of a soluble NADPH-cytochrome P450 reductase from Fusarium graminearum.


    Etzerodt, Thomas; Wetterhorn, Karl; Dionisio, Giuseppe; Rayment, Ivan


    Fusarium head blight is a devastating disease in wheat caused by some fungal pathogens of the Fusarium genus mainly F. graminearum, due to accumulation of toxic trichothecenes. Most of the trichothecene biosynthetic pathway has been mapped, although some proteins of the pathway remain uncharacterized, including an NADPH-cytochrome P450 reductase. We subcloned a F. graminearum cytochrome P450 reductase that might be involved in the trichothecene biosynthesis. It was expressed heterologously in E. coli as N-terminal truncated form with an octahistidine tag for purification. The construct yielded a soluble apoprotein and its incubation with flavins yielded the corresponding monomeric holoprotein. It was characterized for activity in the pH range 5.5-9.5, using thiazolyl blue tetrazolium bromide (MTT) or cytochrome c as substrates. Binding of the small molecule MTT was weaker than for cytochrome c, however, the rate of MTT reduction was faster. Contrary to other studies of cytochrome reductase proteins, MTT reduction proceeded in a cooperative manner in our studies. Optimum kinetic activity was found at pH 7.5-8.5 for bothMTT and cytochrome c. This is the first paper presenting characterization of a cytochrome P450 reductase from F. graminearum which most likely is involved in mycotoxin biosynthesis or some primary metabolic pathway such as sterol biosynthesis in F. graminearum. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Copper-dependent inhibition and oxidative inactivation with affinity cleavage of yeast glutathione reductase.


    Murakami, Keiko; Tsubouchi, Ryoko; Fukayama, Minoru; Yoshino, Masataka


    Effects of copper on the activity and oxidative inactivation of yeast glutathione reductase were analyzed. Glutathione reductase from yeast was inhibited by cupric ion and more potently by cuprous ion. Copper ion inhibited the enzyme noncompetitively with respect to the substrate GSSG and NADPH. The Ki values of the enzyme for Cu(2+) and Cu(+) ion were determined to be 1 and 0.35 μM, respectively. Copper-dependent inactivation of glutathione reductase was also analyzed. Hydrogen peroxide and copper/ascorbate also caused an inactivation with the cleavage of peptide bond of the enzyme. The inactivation/fragmentation of the enzyme was prevented by addition of catalase, suggesting that hydroxyl radical produced through the cuprous ion-dependent reduction of oxygen is responsible for the inactivation/fragmentation of the enzyme. SDS-PAGE and TOF-MS analysis confirmed eight fragments, which were further determined to result from the cleavage of the Met17-Ser18, Asn20-Thr21, Glu251-Gly252, Ser420-Pro421, Pro421-Thr422 bonds of the enzyme by amino-terminal sequencing analysis. Based on the kinetic analysis and no protective effect of the substrates, GSSG and NADPH on the copper-mediated inactivation/fragmentation of the enzyme, copper binds to the sites apart from the substrate-sites, causing the peptide cleavage by hydroxyl radical. Copper-dependent oxidative inactivation/fragmentation of glutathione reductase can explain the prooxidant properties of copper under the in vivo conditions.

  14. Aldose reductase induced by hyperosmotic stress mediates cardiomyocyte apoptosis: differential effects of sorbitol and mannitol.


    Galvez, Anita S; Ulloa, Juan Alberto; Chiong, Mario; Criollo, Alfredo; Eisner, Verónica; Barros, Luis Felipe; Lavandero, Sergio


    Cells adapt to hyperosmotic conditions by several mechanisms, including accumulation of sorbitol via induction of the polyol pathway. Failure to adapt to osmotic stress can result in apoptotic cell death. In the present study, we assessed the role of aldose reductase, the key enzyme of the polyol pathway, in cardiac myocyte apoptosis. Hyperosmotic stress, elicited by exposure of cultured rat cardiac myocytes to the nonpermeant solutes sorbitol and mannitol, caused identical cell shrinkage and adaptive hexose uptake stimulation. In contrast, only sorbitol induced the polyol pathway and triggered stress pathways as well as apoptosis-related signaling events. Sorbitol resulted in activation of the extracellular signal-regulated kinase (ERK), p54 c-Jun N-terminal kinase (JNK), and protein kinase B. Furthermore, sorbitol treatment resulting in induction and activation of aldose reductase, decreased expression of the antiapoptotic protein Bcl-xL, increased DNA fragmentation, and glutathione depletion. Apoptosis was attenuated by aldose reductase inhibition with zopolrestat and also by glutathione replenishment with N-acetylcysteine. In conclusion, our data show that hypertonic shrinkage of cardiac myocytes alone is not sufficient to induce cardiac myocyte apoptosis. Hyperosmolarity-induced cell death is sensitive to the nature of the osmolyte and requires induction of aldose reductase as well as a decrease in intracellular glutathione levels.

  15. Biochemical and crystallographic characterization of ferredoxin-NADP(+) reductase from nonphotosynthetic tissues.


    Aliverti, A; Faber, R; Finnerty, C M; Ferioli, C; Pandini, V; Negri, A; Karplus, P A; Zanetti, G


    Distinct forms of ferredoxin-NADP(+) reductase are expressed in photosynthetic and nonphotosynthetic plant tissues. Both enzymes catalyze electron transfer between NADP(H) and ferredoxin; whereas in leaves the enzyme transfers reducing equivalents from photoreduced ferredoxin to NADP(+) in photosynthesis, in roots it has the opposite physiological role, reducing ferredoxin at the expense of NADPH mainly for use in nitrate assimilation. Here, structural and kinetic properties of a nonphotosynthetic isoform were analyzed to define characteristics that may be related to tissue-specific function. Compared with spinach leaf ferredoxin-NADP(+) reductase, the recombinant corn root isoform showed a slightly altered absorption spectrum, a higher pI, a >30-fold higher affinity for NADP(+), greater susceptibility to limited proteolysis, and an approximately 20 mV more positive redox potential. The 1.7 A resolution crystal structure is very similar to the structures of ferredoxin-NADP(+) reductases from photosynthetic tissues. Four distinct structural features of this root ferredoxin-NADP(+) reductases are an alternate conformation of the bound FAD molecule, an alternate path for the amino-terminal extension, a disulfide bond in the FAD-binding domain, and changes in the surface that binds ferredoxin.

  16. Part of respiratory nitrate reductase of Klebsiella aerogenes is intimately associated with the peptidoglycan.


    Abraham, P R; Wientjes, F B; Nanninga, N; Van't Riet, J


    Lysozyme digestion and sonication of sodium dodecyl sulfate (SDS)-purified Klebsiella aerogenes murein sacculi resulted in the quantitative release of both subunits of nitrate reductase, as well as a number of other cytoplasmic membrane polypeptides (5.2%, by weight, of the total membrane proteins). Similar results were obtained after lysozyme digestion of SDS-prepared peptidoglycan fragments, which excluded the phenomenon of simple trapping of the polypeptides by the surrounding peptidoglycan matrix. About 28% of membrane-bound nitrate reductase appears to be tightly associated with the peptidoglycan. Additional evidence for this association was demonstrated by positive immunogold labeling of SDS-murein sacculi and thin sections of plasmolyzed bacteria. Qualitative amino acid analysis of trypsin-treated sacculi, a tryptic product of holo-nitrate reductase, and amino- and carboxypeptidase digests of both nitrate reductase subunits indicated the possible existence of a terminal anchoring peptide containing the following amino acids: (Gly)n, Trp, Ser, Pro, Ile, Leu, Phe, Cys, Tyr, Asp, and Lys.

  17. Respiratory arsenate reductase as a bidirectional enzyme

    SciTech Connect

    Richey, Christine; Chovanec, Peter; Hoeft, Shelley E.; Oremland, Ronald S.; Basu, Partha; Stolz, John F.


    The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe-S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

  18. Respiratory arsenate reductase as a bidirectional enzyme

    USGS Publications Warehouse

    Richey, C.; Chovanec, P.; Hoeft, S.E.; Oremland, R.S.; Basu, P.; Stolz, J.F.


    The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe–S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

  19. Molecular dissection of a putative iron reductase from Desulfotomaculum reducens MI-1

    PubMed Central

    Li, Zhi; Kim, David D.; Nelson, Ornella D.; Otwell, Anne E.; Richardson, Ruth E.; Callister, Stephen J.; Lin, Hening


    Desulfotomaculum reducens MI-1 is a Firmicute strain capable of reducing a variety of heavy metal ions and has a great potential in heavy metal bioremediation. We recently identified Dred_2421 as a potential iron reductase through proteomic study of D. reducens. The current study examines its iron-reduction mechanism. Dred_2421, like its close homolog from Escherichia coli (2, 4-dienoyl-CoA reductase), has an FMN-binding N-terminal domain (NTD), an FAD-binding C-terminal domain (CTD), and a 4Fe-4S cluster between the two domains. To understand the mechanism of the iron-reduction activity and the role of each domain, we generated a series of variants for each domain and investigated their iron-reduction activity. Our results suggest that CTD is the main contributor of the iron-reduction activity, and that NTD and the 4Fe-4S cluster are not directly involved in such activity. This study provides a mechanistic understanding of the iron-reductase activity of Dred_2421 and may also help to elucidate other physiological activities this enzyme may have. PMID:26454174

  20. Molecular dissection of a putative iron reductase from Desulfotomaculum reducens MI-1.


    Li, Zhi; Kim, David D; Nelson, Ornella D; Otwell, Anne E; Richardson, Ruth E; Callister, Stephen J; Lin, Hening


    Desulfotomaculum reducens MI-1 is a Firmicute strain capable of reducing a variety of heavy metal ions and has a great potential in heavy metal bioremediation. We recently identified Dred_2421 as a potential iron reductase through proteomic study of D. reducens. The current study examines its iron-reduction mechanism. Dred_2421, like its close homolog from Escherichia coli (2, 4-dienoyl-CoA reductase), has an FMN-binding N-terminal domain (NTD), an FAD-binding C-terminal domain (CTD), and a 4Fe-4S cluster between the two domains. To understand the mechanism of the iron-reduction activity and the role of each domain, we generated a series of variants for each domain and investigated their iron-reduction activity. Our results suggest that CTD is the main contributor of the iron-reduction activity, and that NTD and the 4Fe-4S cluster are not directly involved in such activity. This study provides a mechanistic understanding of the iron-reductase activity of Dred_2421 and may also help to elucidate other physiological activities this enzyme may have.

  1. Termination unit


    Traeholt, Chresten [Frederiksberg, DK; Willen, Dag [Klagshamn, SE; Roden, Mark [Newnan, GA; Tolbert, Jerry C [Carrollton, GA; Lindsay, David [Carrollton, GA; Fisher, Paul W [Heiskell, TN; Nielsen, Carsten Thidemann [Jaegerspris, DK


    This invention relates to a termination unit comprising an end-section of a cable. The end section of the cable defines a central longitudinal axis and comprising end-parts of N electrical phases, an end-part of a neutral conductor and a surrounding thermally insulation envelope adapted to comprising a cooling fluid. The end-parts of the N electrical phases and the end-part of the neutral conductor each comprising at least one electrical conductor and being arranged in the cable concentrically around a core former with a phase 1 located relatively innermost, and phase N relatively outermost in the cable, phase N being surrounded by the neutral conductor, electrical insulation being arrange between neighboring electrical phases and between phase N and the neutral conductor, and wherein the end-parts of the neutral conductor and the electrical phases each comprise a contacting surface electrically connected to at least one branch current lead to provide an electrical connection: The contacting surfaces each having a longitudinal extension, and being located sequentially along the longitudinal extension of the end-section of the cable. The branch current leads being individually insulated from said thermally insulation envelope by individual electrical insulators.

  2. The tyrosyl free radical in ribonucleotide reductase.

    PubMed Central

    Gräslund, A; Sahlin, M; Sjöberg, B M


    The enzyme, ribonucleotide reductase, catalyses the formation of deoxyribonucleotides from ribonucleotides, a reaction essential for DNA synthesis in all living cells. The Escherichia coli ribonucleotide reductase, which is the prototype of all known eukaryotic and virus-coded enzymes, consists of two nonidentical subunits, proteins B1 and B2. The B2 subunit contains an antiferromagnetically coupled pair of ferric ions and a stable tyrosyl free radical. EPR studies show that the tyrosyl radical, formed by loss of ferric ions and a stable tyrosyl free radical. EPR studies show that the tyrosyl radical, formed by loss of an electron, has its unpaired spin density delocalized in the aromatic ring of tyrosine. Effects of iron-radical interaction indicate a relatively close proximity between the iron center and the radical. The EPR signal of the radical can be studied directly in frozen packed cells of E. coli or mammalian origin, if the cells are made to overproduce ribonucleotide reductase. The hypothetic role of the tyrosyl free radical in the enzymatic reaction is not yet elucidated, except in the reaction with the inhibiting substrate analogue 2'-azido-CDP. In this case, the normal tyrosyl radical is destroyed with concomitant appearance of a 2'-azido-CDP-localized radical intermediate. Attempts at spin trapping of radical reaction intermediates have turned out negative. In E. coli the activity of ribonucleotide reductase may be regulated by enzymatic activities that interconvert a nonradical containing form and the fully active protein B2. In synchronized mammalian cells, however, the cell cycle variation of ribonucleotide reductase, studied by EPR, was shown to be due to de novo protein synthesis. Inhibitors of ribonucleotide reductase are of medical interest because of their ability to control DNA synthesis. One example is hydroxyurea, used in cancer therapy, which selectively destroys the tyrosyl free radical. PMID:3007085

  3. Evaluation of nitrate reductase activity in Rhizobium japonicum

    SciTech Connect

    Streeter, J.G.; DeVine, P.J.


    Nitrate reductase activity was evaluated by four approaches, using four strains of Rhizobium japonicum and 11 chlorate-resistant mutants of the four strains. It was concluded that in vitro assays with bacteria or bacteroids provide the most simple and reliable assessment of the presence or absence of nitrate reductase. Nitrite reductase activity with methyl viologen and dithionite was found, but the enzyme activity does not confound the assay of nitrate reductase. 18 references

  4. Isolation, sequence identification and tissue expression profile of two novel soybean (glycine max) genes-vestitone reductase and chalcone reductase.


    Liu, G Y


    The complete mRNA sequences of two soybean (glycine max) genes-vestitone reductase and chalcone reductase, were amplified using the rapid amplification of cDNA ends methods. The sequence analysis of these two genes revealed that soybean vestitone reductase gene encodes a protein of 327 amino acids which has high homology with the vestitone reductase of Medicago sativa (77%). The soybean chalcone reductase gene encodes a protein of 314 amino acids that has high homology with the chalcone reductase of kudzu vine (88%) and medicago sativa (83%). The expression profiles of the soybean vestitone reductase and chalcone reductase genes were studied and the results indicated that these two soybean genes were differentially expressed in detected soybean tissues including leaves, stems, roots, inflorescences, embryos and endosperm. Our experiment established the foundation for further research on these two soybean genes.

  5. The role of multihaem cytochromes in the respiration of nitrite in Escherichia coli and Fe(III) in Shewanella oneidensis

    SciTech Connect

    Clarke, Thomas A.; Holley, Tracey; Hartshorne, Robert S.; Fredrickson, Jim K.; Zachara, John M.; Shi, Liang; Richardson, David


    The periplasmic nitrite reductase system from Escherichia coli and the extracellular Fe(III) reductase system from Shewanella oneidensis contain multihaem c-type cytochromes as electron carriers and terminal reductases. The position and orientation of the haem cofactors in multihaem cytochromes from different bacteria often show significant conservation despite different arrangements of the polypeptide chain. We propose that the decahaem cytochromes of the iron reductase system MtrA, MtrC and OmcA comprise pentahaem ‘modules’ similar to the electron donor protein, NrfB, from E. coli. To demonstrate this, we have isolated and characterized the N-terminal pentahaem module of MtrA by preparing a truncated form containing five covalently attached haems. UV–visible spectroscopy indicated that all five haems were low-spin, consistent with the presence of bis-His ligand co-ordination as found in full-length MtrA.

  6. The role of multihaem cytochromes in the respiration of nitrite in Escherichia coli and Fe(III) in Shewanella oneidensis.


    Clarke, Thomas A; Holley, Tracey; Hartshorne, Robert S; Fredrickson, Jim K; Zachara, John M; Shi, Liang; Richardson, David J


    The periplasmic nitrite reductase system from Escherichia coli and the extracellular Fe(III) reductase system from Shewanella oneidensis contain multihaem c-type cytochromes as electron carriers and terminal reductases. The position and orientation of the haem cofactors in multihaem cytochromes from different bacteria often show significant conservation despite different arrangements of the polypeptide chain. We propose that the decahaem cytochromes of the iron reductase system MtrA, MtrC and OmcA comprise pentahaem 'modules' similar to the electron donor protein, NrfB, from E. coli. To demonstrate this, we have isolated and characterized the N-terminal pentahaem module of MtrA by preparing a truncated form containing five covalently attached haems. UV-visible spectroscopy indicated that all five haems were low-spin, consistent with the presence of bis-His ligand co-ordination as found in full-length MtrA.

  7. Molecular Underpinnings of Fe(III) Oxide Reduction by Shewanella Oneidensis MR-1

    PubMed Central

    Shi, Liang; Rosso, Kevin M.; Clarke, Tomas A.; Richardson, David J.; Zachara, John M.; Fredrickson, James K.


    In the absence of O2 and other electron acceptors, the Gram-negative bacterium Shewanella oneidensis MR-1 can use ferric [Fe(III)] (oxy)(hydr)oxide minerals as the terminal electron acceptors for anaerobic respiration. At circumneutral pH and in the absence of strong complexing ligands, Fe(III) oxides are relatively insoluble and thus are external to the bacterial cells. S. oneidensis MR-1 and related strains of metal-reducing Shewanella have evolved machinery (i.e., metal-reducing or Mtr pathway) for transferring electrons from the inner-membrane, through the periplasm and across the outer-membrane to the surface of extracellular Fe(III) oxides. The protein components identified to date for the Mtr pathway include CymA, MtrA, MtrB, MtrC, and OmcA. CymA is an inner-membrane tetraheme c-type cytochrome (c-Cyt) that belongs to the NapC/NrfH family of quinol dehydrogenases. It is proposed that CymA oxidizes the quinol in the inner-membrane and transfers the released electrons to MtrA either directly or indirectly through other periplasmic proteins. A decaheme c-Cyt, MtrA is thought to be embedded in the trans outer-membrane and porin-like protein MtrB. Together, MtrAB deliver the electrons through the outer-membrane to the MtrC and OmcA on the outmost bacterial surface. MtrC and OmcA are the outer-membrane decaheme c-Cyts that are translocated across the outer-membrane by the bacterial type II secretion system. Functioning as terminal reductases, MtrC and OmcA can bind the surface of Fe(III) oxides and transfer electrons directly to these minerals via their solvent-exposed hemes. To increase their reaction rates, MtrC and OmcA can use the flavins secreted by S. oneidensis MR-1 cells as diffusible co-factors for reduction of Fe(III) oxides. Because of their extracellular location and broad redox potentials, MtrC and OmcA can also serve as the terminal reductases for soluble forms of Fe(III). In addition to Fe(III) oxides, Mtr pathway is also involved in reduction of

  8. Purification of glutamyl-tRNA reductase from Synechocystis sp. PCC 6803

    SciTech Connect

    Rieble, S.; Beale, S.I. )


    {delta}-Aminolevulinic acid (ALA) is the universal precursor for all tetrapyrroles including hemes, chlorophylls, and bilins. In plants, algae, cyanobacteria, and many other bacteria, ALA is synthesized from glutamate in a reaction sequence that requires three enzymes, ATP, NADPH, and tRNA{sup Glu}. The three enzymes have been characterized as glutamyl-tRNA synthetase, glutamyl-tRNA reductase, and glutamate-1-semialdehyde (GSA) aminotransferase. All three enzymes have been separated and partially characterized from plants and algae. In prokaryotic phototrophs, only the glutamyl-tRNA synthetase and GSA aminotransferase have been described. The authors report here the purification and some properties of the glutamyl-tRNA reductase from extracts of the unicellular cyanobacterium, Synechocystis sp. PCC 6803. The glutamyl-tRNA reductase has been purified over 370 fold to apparent homogeneity. Its native molecular mass was determined to be 350 kDa by SDS-PAGE. The N-terminal amino acid sequence was determined for 42 residues. Much higher activity occurred with NADPH than with NADH as the reduced pyridine nucleotide substrate. Half-maximal rates occurred at 5 {mu}M NADPH, whereas saturation was not reached even at 10 mM NADH. Purified Synechocystis glutamyl-tRNA reductase was inhibited 50% by 5 {mu}M heme. Activity was unaffected by 10 {mu}M gabaculine. No flavin, pyridine nucleotide, or other light-absorbing prosthetic group was detected on the purified enzyme. The catalytic turnover number of purified Synechocystis glutamyl-tRNA reductase is comparable to those of prokaryotic and plastidic glutamyl-tRNA synthetases.

  9. Purification, Characterization, and Overexpression of Flavin Reductase Involved in Dibenzothiophene Desulfurization by Rhodococcus erythropolis D-1

    PubMed Central

    Matsubara, Toshiyuki; Ohshiro, Takashi; Nishina, Yoshihiro; Izumi, Yoshikazu


    The dibenzothiophene (DBT)-desulfurizing bacterium, Rhodococcus erythropolis D-1, removes sulfur from DBT to form 2-hydroxybiphenyl using four enzymes, DszC, DszA, DszB, and flavin reductase. In this study, we purified and characterized the flavin reductase from R. erythropolis D-1 grown in a medium containing DBT as the sole source of sulfur. It is conceivable that the enzyme is essential for two monooxygenase (DszC and DszA) reactions in vivo. The purified flavin reductase contains no chromogenic cofactors and was found to have a molecular mass of 86 kDa and four identical 22-kDa subunits. The enzyme catalyzed NADH-dependent reduction of flavin mononucleotide (FMN), and the Km values for NADH and FMN were 208 and 10.8 μM, respectively. Flavin adenine dinucleotide was a poor substrate, and NADPH was inert. The enzyme did not catalyze reduction of any nitroaromatic compound. The optimal temperature and optimal pH for enzyme activity were 35°C and 6.0, respectively, and the enzyme retained 30% of its activity after heat treatment at 80°C for 30 min. The N-terminal amino acid sequence of the purified flavin reductase was identical to that of DszD of R. erythropolis IGTS8 (K. A. Gray, O. S. Pogrebinsky, G. T. Mrachko, L. Xi, D. J. Monticello, and C. H. Squires, Nat. Biotechnol. 14:1705–1709, 1996). The flavin reductase gene was amplified with primers designed by using dszD of R. erythropolis IGTS8, and the enzyme was overexpressed in Escherichia coli. The specific activity in crude extracts of the overexpressed strain was about 275-fold that of the wild-type strain. PMID:11229908

  10. Fumarate Reductase Activity of Streptococcus faecalis

    PubMed Central

    Aue, B. J.; Diebel, R. H.


    Some characteristics of a fumarate reductase from Streptococcus faecalis are described. The enzyme had a pH optimum of 7.4; optimal activity was observed when the ionic strength of the phosphate buffer was adjusted to 0.088. The Km value of the enzyme for reduced flavin mononucleotide was 2 × 10−4 m as determined with a 26-fold preparation. In addition to fumarate, the enzyme reduced maleate and mesaconate. No succinate dehydrogenase activity was detected, but succinate did act as an inhibitor of the fumarate reductase activity. Other inhibitors were malonate, citraconate, and trans-, trans-muconate. Metal-chelating agents did not inhibit the enzyme. A limited inhibition by sulfhydryl-binding agents was observed, and the preparations were sensitive to air oxidation and storage. Glycine, alanine, histidine, and possibly lysine stimulated fumarate reductase activity in the cell-free extracts. However, growth in media supplemented with glycine did not enhance fumarate reductase activity. The enzymatic activity appears to be constitutive. PMID:4960892

  11. Post-translational Regulation of Nitrate Reductase

    USDA-ARS?s Scientific Manuscript database

    Nitrate reductase (NR) catalyzes the reduction of nitrate to nitrite, which is the first step in the nitrate assimilation pathway, but can also reduce nitrite to nitric oxide (NO), an important signaling molecule that is thought to mediate a wide array of of developmental and physiological processes...

  12. Synthesis of symmetric disulfides as potential alternative substrates for trypanothione reductase and glutathione reductase: Part 1.


    Jaouhari, R; Besheya, T; McKie, J H; Douglas, K T


    The synthesis of a series of symmetrical disulfides as potential substrates of trypanothione reductase and glutathione reductase was described. The key intermediate in the synthetic approach was the choice of S-(t)butylmercapto-L-cysteine (1). The spermidine ring in the native substrate, trypanothione disulfide (TSST), was replaced with 3-dimethyl-aminopropylamine (DMAPA), while theγ-Glu moiety was replaced by phenylalanyl or tryptophanyl residues. The same modifications in theγ-Glu moiety of glutathione disulfide (GSSG) were applied.

  13. Aging, Terminal Decline, and Terminal Drop

    ERIC Educational Resources Information Center

    Palmore, Erdman; Cleveland, William


    Data from a 20-year longitudinal study of persons over 60 were analyzed by step-wise multiple regression to test for declines in function with age, for terminal decline (linear relationship to time before death), and for terminal drop (curvilinear relationship to time before death). There were no substantial terminal drop effects. (Author)

  14. Control of dihydrofolate reductase messenger ribonucleic acid production

    SciTech Connect

    Leys, E.J.; Kellems, R.E.


    The authors used methotrexate-resistant mouse cells in which dihydrofolate reductase levels are approximately 500 times normal to study the effect of growth stimulation on dihydrofolate reductase gene expression. As a result of growth stimulation, the relative rate of dihydrofolate reductase protein synthesis increased threefold, reaching a maximum between 25 and 30 h after stimulation. The relative rate of dihydrofolate reductase messenger ribonucleic acid production (i.e., the appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm) increased threefold after growth stimulation and was accompanied by a corresponding increase in the relative steady-state level of dihydrofolate reductase ribonucleic acid in the nucleus. However, the increase in the nuclear level of dihydrofolate reductase ribonucleic acid was not accompanied by a significant increase in the relative rate of transcription of the dihydrofolate reductase genes. These data indicated that the relative rate of appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm depends on the relative stability of the dihydrofolate reductase ribonucleic acid sequences in the nucleus and is not dependent on the relative rate of transcription of the dihydrofolate reductase genes.

  15. Augmentation of CFTR maturation by S-nitrosoglutathione reductase

    PubMed Central

    Sawczak, Victoria; Zaidi, Atiya; Butler, Maya; Bennett, Deric; Getsy, Paulina; Zeinomar, Maryam; Greenberg, Zivi; Forbes, Michael; Rehman, Shagufta; Jyothikumar, Vinod; DeRonde, Kim; Sattar, Abdus; Smith, Laura; Corey, Deborah; Straub, Adam; Sun, Fei; Palmer, Lisa; Periasamy, Ammasi; Randell, Scott; Kelley, Thomas J.; Lewis, Stephen J.


    S-nitrosoglutathione (GSNO) reductase regulates novel endogenous S-nitrosothiol signaling pathways, and mice deficient in GSNO reductase are protected from airways hyperreactivity. S-nitrosothiols are present in the airway, and patients with cystic fibrosis (CF) tend to have low S-nitrosothiol levels that may be attributed to upregulation of GSNO reductase activity. The present study demonstrates that 1) GSNO reductase activity is increased in the cystic fibrosis bronchial epithelial (CFBE41o−) cells expressing mutant F508del-cystic fibrosis transmembrane regulator (CFTR) compared with the wild-type CFBE41o− cells, 2) GSNO reductase expression level is increased in the primary human bronchial epithelial cells expressing mutant F508del-CFTR compared with the wild-type cells, 3) GSNO reductase colocalizes with cochaperone Hsp70/Hsp90 organizing protein (Hop; Stip1) in human airway epithelial cells, 4) GSNO reductase knockdown with siRNA increases the expression and maturation of CFTR and decreases Stip1 expression in human airway epithelial cells, 5) increased levels of GSNO reductase cause a decrease in maturation of CFTR, and 6) a GSNO reductase inhibitor effectively reverses the effects of GSNO reductase on CFTR maturation. These studies provide a novel approach to define the subcellular location of the interactions between Stip1 and GSNO reductase and the role of S-nitrosothiols in these interactions. PMID:26637637

  16. Structural Insight into Dihydrodipicolinate Reductase from Corybebacterium glutamicum for Lysine Biosynthesis.


    Sagong, Hye-Young; Kim, Kyung-Jin


    Dihydrodipicolinate reductase is an enzyme that converts dihydrodipicolinate to tetrahydrodipicolinate using an NAD(P)H cofactor in L-lysine biosynthesis. To increase the understanding of the molecular mechanisms of lysine biosynthesis, we determined the crystal structure of dihydrodipicolinate reductase from Corynebacterium glutamicum (CgDapB). CgDapB functions as a tetramer, and each protomer is composed of two domains, an Nterminal domain and a C-terminal domain. The N-terminal domain mainly contributes to nucleotide binding, whereas the C-terminal domain is involved in substrate binding. We elucidated the mode of cofactor binding to CgDapB by determining the crystal structure of the enzyme in complex with NADP(+) and found that CgDapB utilizes both NADH and NADPH as cofactors. Moreover, we determined the substrate binding mode of the enzyme based on the coordination mode of two sulfate ions in our structure. Compared with Mycobacterium tuberculosis DapB in complex with its cofactor and inhibitor, we propose that the domain movement for active site constitution occurs when both cofactor and substrate bind to the enzyme.

  17. Differential cytochrome content and reductase activity in Geospirillum barnesii strain SeS3

    USGS Publications Warehouse

    Stolz, J.F.; Gugliuzza, T.; Switzer, Blum J.; Oremland, R.; Martinez, Murillo F.


    The protein composition, cytochrome content, and reductase activity in the dissimilatory selenate-reducing bacterium Geospirillum barnesii strain SeS3, grown with thiosulfate, nitrate, selenate, or fumarate as the terminal electron acceptor, was investigated. Comparison of seven high-molecular-mass membrane proteins (105.3, 90.3, 82.6, 70.2, 67.4, 61.1, and 57.3 kDa) by SDS-PAGE showed that their detection was dependent on the terminal electron acceptor used. Membrane fractions from cells grown on thiosulfate contained a 70.2-kDa c-type cytochrome with absorbance maxima at 552, 522, and 421 nm. A 61.1-kDa c-type cytochrome with absorption maxima at 552, 523, and 423 nm was seen in membrane fractions from cells grown on nitrate. No c-type cytochromes were detected in membrane fractions of either selenate- or fumarate-grown cells. Difference spectra, however, revealed the presence of a cytochrome b554 (absorption maxima at 554, 523, and 422 nm) in membrane fractions from selenate-grown cells and a cytochrome b556 (absorption maxima at 556, 520, and 416 nm) in membrane fractions from fumarate-grown cells. Analysis of reductase activity in the different membrane fractions showed variability in substrate specificity. However, enzyme activity was greatest for the substrate on which the cells had been grown (e.g., membranes from nitrate-grown cells exhibited the greatest activity with nitrate). These results show that protein composition, cytochrome content, and reductase activity are dependent on the terminal electron acceptor used for growth.

  18. The unique N terminus of the herpes simplex virus type 1 large subunit is not required for ribonucleotide reductase activity.


    Conner, J; Macfarlane, J; Lankinen, H; Marsden, H


    Using purified bacterially expressed herpes simplex virus type 1 ribonucleotide reductase large subunit (R1) and the proteolytic enzymes chymotrypsin and trypsin, we have generated stable N-terminal truncations. Chymotrypsin removes 246 amino acids from the amino terminus to produce a fragment (dN246R1) which retains full enzymic activity and affinity for the small subunit (R2). Treatment of R1 with trypsin produces a 120K protein and a cleavage at amino acid residue 305 to produce a fragment (dN305R1) which remains associated with a 33K N-terminal polypeptide. Although this 33K-dN305R1 complex retains full binding affinity for R2 its reductase activity is reduced by approximately 50%. Increasing the concentration of trypsin removes the 33K N-terminal polypeptide resulting in dN305R1 which, when bound to R2, has full ribonucleotide reductase activity. Like R1, dN246R1 and dN305R1 each exist as dimers showing that the first 305 amino acids of R1 are not necessary for dimer formation. These results indicate that, in structural studies of subunit interaction, dN246R1 or dN305R1 can be considered as suitable replacements for intact R1.

  19. A structural account of substrate and inhibitor specificity differences between two Naphthol reductases

    SciTech Connect

    Liao, D.-I.; Thompson, J.E.; Fahnestock, S.; Valent, B.; Jordan, D.B.


    Two short chain dehydrogenase/reductases mediate naphthol reduction reactions in fungal melanin biosynthesis. An X-ray structure of 1,3,6,8-tetrahydroxynaphthalene reductase (4HNR) complexed with NADPH and pyroquilon was determined for examining substrate and inhibitor specificities that differ from those of 1,3,8-trihydroxynaphthalene reductase (3HNR). The 1.5 {angstrom} resolution structure allows for comparisons with the 1.7 {angstrom} resolution structure of 3HNR complexed with the same ligands. The sequences of the two proteins are 46% identical, and they have the same fold. The 30-fold lower affinity of the 4HNR-NADPH complex for pyroquilon (a commercial fungicide that targets 3HNR) in comparison to that of the 3HNR-NADPH complex can be explained by unfavorable interactions between the anionic carboxyl group of the C-terminal Ile282 of 4HNR and CH and CH{sub 2} groups of the inhibitor that are countered by favorable inhibitor interactions with 3HNR. 1,3,8-Trihydroxynaphthalene (3HN) and 1,3,6,8-tetrahydroxynaphthalene (4HN) were modeled onto the cyclic structure of pyroquilon in the 4HNR-NADPH-pyroquilon complex to examine the 300-fold preference of the enzyme for 4HN over 3HN. The models suggest that the C-terminal carboxyl group of Ile282 has a favorable hydrogen bonding interaction with the C6 hydroxyl group of 4HN and an unfavorable interaction with the C6 CH group of 3HN. Models of 3HN and 4HN in the 3HNR active site suggest a favorable interaction of the sulfur atom of the C-terminal Met283 with the C6 CH group of 3HN and an unfavorable one with the C6 hydroxyl group of 4HN, accounting for the 4-fold difference in substrate specificities. Thus, the C-terminal residues of the two naphthol reductase are determinants of inhibitor and substrate specificities.

  20. A founder mutation causing a severe methylenetetrahydrofolate reductase (MTHFR) deficiency in Bukharian Jews.


    Ben-Shachar, Shay; Zvi, Tal; Rolfs, Arndt; Breda Klobus, Andrea; Yaron, Yuval; Bar-Shira, Anat; Orr-Urtreger, Avi


    Methylenetetrahydrofolate reductase (MTHFR) deficiency is a rare autosomal recessive disorder. A novel homozygous MTHFR c.474A>T (p.G158G) mutation was detected in two unrelated children of Jewish Bukharian origin. This mutation generates an abnormal splicing and early termination codon. A carrier frequency of 1:39 (5/196) was determined among unrelated healthy Bukharian Jews. Given the disease severity and allele frequency, a population screening for individuals of this ancestry is warranted in order to allow prenatal, or preimplantation diagnosis. Copyright © 2012 Elsevier Inc. All rights reserved.


    PubMed Central

    Zancan, Glaci T.; Bacila, Metry


    Zancan, Glaci T. (Universidade do Paraná, Curitiba, Paraná, Brazil), and Metry Bacila. Fructose-6-phosphate reductase from Salmonella gallinarum. J. Bacteriol. 87:614–618. 1964.—A fructose-6-phosphate reductase present in cell-free extracts of Salmonella gallinarum was purified approximately 42 times. The optimal pH for this enzyme is 8.0. The enzyme is specific for fructose-6-phosphate and reduced nicotinamide adenine dinucleotide (NADH). The dissociation constants are 1.78 × 10−4m for fructose-6-phosphate and 8.3 × 10−5m for NADH. The Q10, reaction order, and equilibrium constant were determined. The enzyme is sensitive to p-chloromercuribenzoic acid, but not to o-iodosobenzoic acid nor to N-ethylmaleimide. PMID:14127579

  2. Characterization of human platelet glutathione reductase.


    Moroff, G; Kosow, D P


    Glutathione reductase (NAD(P)h:oxidized glutathione oxidoreductase, EC has been purified 1000-fold from the cytoplasmic fraction of human platelets. Salts, including the heretofore unreported effect of sodium citrate, activate the NADPH-dependent reduction of oxidized glutathione. Sodium citrate and monovalent salt activation appears to involve multiple sites having different binding affinities. At sub-saturating sodium phosphate, non-linear double reciprocal plots indicative of substrate activation by oxidized glutathione were observed. Initial velocity double reciprocal plots at sub-saturating and saturating concentrations of phosphate generate a family of converging lines. NADP+ is a partial inhibitor, indicating that the reduction of oxidized glutathione can proceed by more than one pathway. FMN, FAD, and riboflavin inhibit platelet glutathione reductase by influencing only the V while nitrofurantoin inhibition is associated with an increase Koxidized glutathione and a decreased V.

  3. A Plasma Display Terminal.

    ERIC Educational Resources Information Center

    Stifle, Jack

    A graphics terminal designed for use as a remote computer input/output terminal is described. Although the terminal is intended for use in teaching applications, it has several features which make it useful in many other computer terminal applications. These features include: a 10-inch square plasma display panel, permanent storage of information…

  4. Terminals for Education.

    ERIC Educational Resources Information Center

    Bork, Alfred M.

    The effectiveness of different types of computer terminals in programing learning is discussed with special reference to the experience of the Physics Computer Development Project. Experience with ten types of terminals including hardcopy terminals of several speeds, alphanumeric and graphic terminals is reviewed. Special consideration is given to…

  5. Production of a highly active, soluble form of the cytochrome P450 reductase (CPR A) from Candida tropicalis


    Donnelly, Mark


    The present invention provides soluble cytochrome p450 reductase (CPR) proteins from Candida sp. having an altered N-terminal region which results in reduced hydrophobicity of the N-terminal region. Also provided are host cells comprising the subject soluble CPR proteins. In addition, the present invention provides nucleotide and corresponding amino acid sequences for soluble CPR proteins and vectors comprising the nucleotide sequences. Methods for producing a soluble CPR, for increasing production of a dicarboxylic acid, and for detecting a cytochrome P450 are also provided.

  6. Characterization of erythrose reductases from filamentous fungi

    PubMed Central


    Proteins with putative erythrose reductase activity have been identified in the filamentous fungi Trichoderma reesei, Aspergillus niger, and Fusarium graminearum by in silico analysis. The proteins found in T. reesei and A. niger had earlier been characterized as glycerol dehydrogenase and aldehyde reductase, respectively. Corresponding genes from all three fungi were cloned, heterologously expressed in Escherichia coli, and purified. Subsequently, they were used to establish optimal enzyme assay conditions. All three enzymes strictly require NADPH as cofactor, whereas with NADH no activity could be observed. The enzymatic characterization of the three enzymes using ten substrates revealed high substrate specificity and activity with D-erythrose and D-threose. The enzymes from T. reesei and A. niger herein showed comparable activities, whereas the one from F. graminearum reached only about a tenth of it for all tested substrates. In order to proof in vivo the proposed enzyme function, we overexpressed the erythrose reductase-encoding gene in T. reesei. An increased production of erythritol by the recombinant strain compared to the parental strain could be detected. PMID:23924507

  7. A role for N-myristoylation in protein targeting: NADH-cytochrome b5 reductase requires myristic acid for association with outer mitochondrial but not ER membranes

    PubMed Central


    N-myristoylation is a cotranslational modification involved in protein- protein interactions as well as in anchoring polypeptides to phospholipid bilayers; however, its role in targeting proteins to specific subcellular compartments has not been clearly defined. The mammalian myristoylated flavoenzyme NADH-cytochrome b5 reductase is integrated into ER and mitochondrial outer membranes via an anchor containing a stretch of 14 uncharged amino acids downstream to the NH2- terminal myristoylate glycine. Since previous studies suggested that the anchoring function could be adequately carried out by the 14 uncharged residues, we investigated a possible role for myristic acid in reductase targeting. The wild type (wt) and a nonmyristoylatable reductase mutant (gly2-->ala) were stably expressed in MDCK cells, and their localization was investigated by immunofluorescence, immuno-EM, and cell fractionation. By all three techniques, the wt protein localized to ER and mitochondria, while the nonmyristoylated mutant was found only on ER membranes. Pulse-chase experiments indicated that this altered steady state distribution was due to the mutant's inability to target to mitochondria, and not to its enhanced instability in that location. Both wt and mutant reductase were resistant to Na2CO3 extraction and partitioned into the detergent phase after treatment of a membrane fraction with Triton X-114, demonstrating that myristic acid is not required for tight anchoring of reductase to membranes. Our results indicate that myristoylated reductase localizes to ER and mitochondria by different mechanisms, and reveal a novel role for myristic acid in protein targeting. PMID:8978818

  8. The crystal structure of the bifunctional deaminase/reductase RibD of the riboflavin biosynthetic pathway in Escherichia coli: implications for the reductive mechanism.


    Stenmark, Pål; Moche, Martin; Gurmu, Daniel; Nordlund, Pär


    We have determined the crystal structure of the bi-functional deaminase/reductase enzyme from Escherichia coli (EcRibD) that catalyzes two consecutive reactions during riboflavin biosynthesis. The polypeptide chain of EcRibD is folded into two domains where the 3D structure of the N-terminal domain (1-145) is similar to cytosine deaminase and the C-terminal domain (146-367) is similar to dihydrofolate reductase. We showed that EcRibD is dimeric and compared our structure to tetrameric RibG, an ortholog from Bacillus subtilis (BsRibG). We have also determined the structure of EcRibD in two binary complexes with the oxidized cofactor (NADP(+)) and with the substrate analogue ribose-5-phosphate (RP5) and superposed these two in order to mimic the ternary complex. Based on this superposition we propose that the invariant Asp200 initiates the reductive reaction by abstracting a proton from the bound substrate and that the pro-R proton from C4 of the cofactor is transferred to C1 of the substrate. A highly flexible loop is found in the reductase active site (159-173) that appears to control cofactor and substrate binding to the reductase active site and was therefore compared to the corresponding Met20 loop of E. coli dihydrofolate reductase (EcDHFR). Lys152, identified by comparing substrate analogue (RP5) coordination in the reductase active site of EcRibD with the homologous reductase from Methanocaldococcus jannaschii (MjaRED), is invariant among bacterial RibD enzymes and could contribute to the various pathways taken during riboflavin biosynthesis in bacteria and yeast.

  9. Nitrate, nitrite and nitric oxide reductases: from the last universal common ancestor to modern bacterial pathogens.


    Vázquez-Torres, Andrés; Bäumler, Andreas J


    The electrochemical gradient that ensues from the enzymatic activity of cytochromes such as nitrate reductase, nitric oxide reductase, and quinol oxidase contributes to the bioenergetics of the bacterial cell. Reduction of nitrogen oxides by bacterial pathogens can, however, be uncoupled from proton translocation and biosynthesis of ATP or NH4(+), but still linked to quinol and NADH oxidation. Ancestral nitric oxide reductases, as well as cytochrome c oxidases and quinol bo oxidases evolved from the former, are capable of binding and detoxifying nitric oxide to nitrous oxide. The NO-metabolizing activity associated with these cytochromes can be a sizable source of antinitrosative defense in bacteria during their associations with host cells. Nitrosylation of terminal cytochromes arrests respiration, reprograms bacterial metabolism, stimulates antioxidant defenses and alters antibiotic cytotoxicity. Collectively, the bioenergetics and regulation of redox homeostasis that accompanies the utilization of nitrogen oxides and detoxification of nitric oxide by cytochromes of the electron transport chain increases fitness of many Gram-positive and -negative pathogens during their associations with invertebrate and vertebrate hosts.

  10. The Interaction of Respiration and Photosynthesis in Induction of Nitrate Reductase Activity 1

    PubMed Central

    Aslam, M.; Huffaker, R. C.; Travis, R. L.


    The respiration and photosynthesis requirement for induction and maintenance of nitrate reductase activity was determined on leaves of Hordeum vulgare L. In this induction, glucose substituted for light in both dark-grown and carbohydrate-depleted green leaves. Oxygen appeared to be required for induction in all cases studied. In light and under N2, 3-(3,4-dichlorophenyl)-1,1-dimethylurea completely inhibited induction, presumably by inhibiting the production of O2, Hence, under N2 the leaves appeared to utilize both the O2 produced by photosynthesis and the CO2 produced by respiration. CO2 fixation can then produce both photosynthate to drive the induction and terminal electron acceptors to allow photosynthetic electron flow. This possibility was further suggested by the observation that CO2 was an absolute requirement for induction in carbohydrate-depleted barley leaves. Results obtained with respiratory inhibitors also indicated that respiration drove the induction of nitrate reductase. Exogenously supplied glucose also substantially slowed the loss of nitrate reductase that occurred when barley leaves were placed in darkness. It is presumed that glucose allowed the synthetic or activation phase of the induction to proceed more rapidly. Our results support the hypothesis that one of the main effects of light may be to supply photosynthate to support respiration, which then drives the induction process. PMID:16658514

  11. Role of Campylobacter jejuni Respiratory Oxidases and Reductases in Host Colonization▿

    PubMed Central

    Weingarten, Rebecca A.; Grimes, Jesse L.; Olson, Jonathan W.


    Campylobacter jejuni is the leading cause of human food-borne bacterial gastroenteritis. The C. jejuni genome sequence predicts a branched electron transport chain capable of utilizing multiple electron acceptors. Mutants were constructed by disrupting the coding regions of the respiratory enzymes nitrate reductase (napA::Cm), nitrite reductase (nrfA::Cm), dimethyl sulfoxide, and trimethylamine N-oxide reductase (termed Cj0264::Cm) and the two terminal oxidases, a cyanide-insensitive oxidase (cydA::Cm) and cbb3-type oxidase (ccoN::Cm). Each strain was characterized for the loss of the associated enzymatic function in vitro. The strains were then inoculated into 1-week-old chicks, and the cecal contents were assayed for the presence of C. jejuni 2 weeks postinoculation. cydA::Cm and Cj0264c::Cm strains colonized as well as the wild type; napA::Cm and nrfA::Cm strains colonized at levels significantly lower than the wild type. The ccoN::Cm strain was unable to colonize the chicken; no colonies were recovered at the end of the experiment. While there appears to be a role for anaerobic respiration in host colonization, oxygen is the most important respiratory acceptor for C. jejuni in the chicken cecum. PMID:18192421

  12. Purification and Characterization of (Per)Chlorate Reductase from the Chlorate-Respiring Strain GR-1

    PubMed Central

    Kengen, Servé W. M.; Rikken, Geoffrey B.; Hagen, Wilfred R.; van Ginkel, Cees G.; Stams, Alfons J. M.


    Strain GR-1 is one of several recently isolated bacterial species that are able to respire by using chlorate or perchlorate as the terminal electron acceptor. The organism performs a complete reduction of chlorate or perchlorate to chloride and oxygen, with the intermediate formation of chlorite. This study describes the purification and characterization of the key enzyme of the reductive pathway, the chlorate and perchlorate reductase. A single enzyme was found to catalyze both the chlorate- and perchlorate-reducing activity. The oxygen-sensitive enzyme was located in the periplasm and had an apparent molecular mass of 420 kDa, with subunits of 95 and 40 kDa in an α3β3 composition. Metal analysis showed the presence of 11 mol of iron, 1 mol of molybdenum, and 1 mol of selenium per mol of heterodimer. In accordance, quantitative electron paramagnetic resonance spectroscopy showed the presence of one [3Fe-4S] cluster and two [4Fe-4S] clusters. Furthermore, two different signals were ascribed to Mo(V). The Kmvalues for perchlorate and chlorate were 27 and <5 μM, respectively. Besides perchlorate and chlorate, nitrate, iodate, and bromate were also reduced at considerable rates. The resemblance of the enzyme to nitrate reductases, formate dehydrogenases, and selenate reductase is discussed. PMID:10542172

  13. Nitrate, nitrite and nitric oxide reductases: from the last universal common ancestor to modern bacterial pathogens

    PubMed Central

    Vázquez-Torres, Andrés; Bäumler, Andreas


    The electrochemical gradient that ensues from the enzymatic activity of cytochromes such as nitrate reductase, nitric oxide reductase, and quinol oxidase contributes to the bioenergetics of the bacterial cell. Reduction of nitrogen oxides by bacterial pathogens can, however, be uncoupled from proton translocation and biosynthesis of ATP or NH4+, but still linked to quinol and NADH oxidation. Ancestral nitric oxide reductases, as well as cytochrome coxidases and quinol bo oxidases evolved from the former, are capable of binding and detoxifying nitric oxide to nitrous oxide. The NO-metabolizing activity associated with these cytochromes can be a sizable source of antinitrosative defense in bacteria during their associations with host cells. Nitrosylation of terminal cytochromes arrests respiration, reprograms bacterial metabolism, stimulates antioxidant defenses and alters antibiotic cytotoxicity. Collectively, the bioenergetics and regulation of redox homeostasis that accompanies the utilization of nitrogen oxides and detoxification of nitric oxide by cytochromes of the electron transport chain increases fitness of many Gram-positive and –negative pathogens during their associations with invertebrate and vertebrate hosts. PMID:26426528

  14. 3-Oxoacyl-(acyl-carrier protein) reductase from avocado (Persea americana) fruit mesocarp.

    PubMed Central

    Sheldon, P S; Kekwick, R G; Sidebottom, C; Smith, C G; Slabas, A R


    The NADPH-linked 3-oxoacyl-(acyl-carrier protein) (ACP) reductase (EC, also known as 'beta-ketoacyl-ACP reductase', has been purified from the mesocarp of mature avocado pears (Persea americana). The enzyme is inactivated by low ionic strength and low temperature. On SDS/PAGE under reducing conditions, purified 3-oxoacyl-ACP reductase migrated as a single polypeptide giving a molecular mass of 28 kDa. Gel-filtration chromatography gave an apparent native molecular mass of 130 kDa, suggesting that the enzyme is tetrameric. The enzyme is inactivated by dilution, but some protection is afforded by the presence of NADPH. Kinetic constants have been determined using synthetic analogues as well as the natural ACP substrate. It exhibits a broad pH optimum around neutrality. Phenylglyoxal inactivates the enzyme, and partial protection is given by 1 mM-NADPH. Antibodies have been raised against the protein, which were used to localize it using immunogold electron microscopy. It is localized in plastids. N-Terminal amino-acid-sequence analysis was performed on the enzyme, and it shows close structural similarity with cytochrome f. Internal amino-acid-sequence data, derived from tryptic peptides, shows similarity with the putative gene products encoded by the nodG gene from the nitrogen-fixing bacterium Rhizobium meliloti and the gra III act III genes from Streptomyces spp. Images Fig. 2. Fig. 5. Fig. 6. PMID:2244875

  15. A Ferredoxin Disulfide Reductase Delivers Electrons to the Methanosarcina barkeri Class III Ribonucleotide Reductase

    PubMed Central


    Two subtypes of class III anaerobic ribonucleotide reductases (RNRs) studied so far couple the reduction of ribonucleotides to the oxidation of formate, or the oxidation of NADPH via thioredoxin and thioredoxin reductase. Certain methanogenic archaea contain a phylogenetically distinct third subtype of class III RNR, with distinct active-site residues. Here we report the cloning and recombinant expression of the Methanosarcina barkeri class III RNR and show that the electrons required for ribonucleotide reduction can be delivered by a [4Fe-4S] protein ferredoxin disulfide reductase, and a conserved thioredoxin-like protein NrdH present in the RNR operon. The diversity of class III RNRs reflects the diversity of electron carriers used in anaerobic metabolism. PMID:26536144

  16. Three spinach leaf nitrate reductase-3-hydroxy-3-methylglutaryl-CoA reductase kinases that are required by reversible phosphorylation and/or Ca2+ ions.

    PubMed Central

    Douglas, P; Pigaglio, E; Ferrer, A; Halfords, N G; MacKintosh, C


    In spinach (Spinacea oleracea L.) leaf extracts, three protein kinases (PKI, PKII and PKIII) were identified each of which phosphorylated spinach nitrate reductase on serine-543, and inactivated the enzyme in the presence of nitrate reductase inhibitor, 14-3-3. PKIII was also very active in phosphorylating and inactivating Arabidopsis (Landsberg erecta) 3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 (HMGR1). PKI and PKII phosphorylated HMGR1 more slowly than PKIII, compared with their relative rates of phosphorylation of nitrate reductase. HMGR1 identical with those that are seen after phosphorylation of serine-577 by the sucrose non-fermenting (SNF1)-like PK, 3-hydroxy-3-methylglutaryl-Co A reductase kinase A (HRK-A), from cauliflower [Dale, Arró, Becerra, Morrice, Boronat, Hardie and Ferrer (1995) Eur. J. Biochem. 233, 506-513]. PKI was Ca2+-dependent when prepared in the absence of protein phosphatase (PP) inhibitors, and largely Ca2+-dependent when prepared in the presence of PP inhibitors (NaF and EGTA). The Ca2+-independent portion of PKI was inactivated by either PP2A or PP2C, while the Ca2+-dependent portion of PKI became increasingly activated during storage, which we presume was mimicking the effect of an unidentified PP. These findings indicate that PK1 is regulated by two functionally distinct phosphorylations. PKI had a molecular mass of 45 kDa on gel filtration and was active towards substrate peptides that terminated at the +2 residue from the phosphorylation site, whereas PKIII was inactive towards these peptides. PKII was Ca2+-stimulated under all conditions tested. PKIII was Ca2+-indepdented, inactivated by PP2A or PP2C, had a requirement for a hydrophobic residue in the +4 position of peptide substrates, had a molecular mass by gel filtration of approximately 140 kDa, and an antibody against the rye SNF1-related PK (RKIN1) recognized a 58 kDa subunit in fractions containing PKIII. These properties of PKIII are identical with those reported

  17. Methionine sulfoxide reductase contributes to meeting dietary methionine requirements

    PubMed Central

    Zhao, Hang; Kim, Geumsoo; Levine, Rodney L.


    Methionine sulfoxide reductases are present in all aerobic organisms. They contribute to antioxidant defenses by reducing methionine sulfoxide in proteins back to methionine. However, the actual in vivo roles of these reductases are not well defined. Since methionine is an essential amino acid in mammals, we hypothesized that methionine sulfoxide reductases may provide a portion of the dietary methionine requirement by recycling methionine sulfoxide. We used a classical bioassay, the growth of weanling mice fed diets varying in methionine, and applied it to mice genetically engineered to alter the levels of methionine sulfoxide reductase A or B1. Mice of all genotypes were growth retarded when raised on chow containing 0.10% methionine instead of the standard 0.45% methionine. Retardation was significantly greater in knockout mice lacking both reductases. We conclude that the methionine sulfoxide reductases can provide methionine for growth in mice with limited intake of methionine, such as may occur in the wild. PMID:22521563

  18. 49 CFR 1242.27 - Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals, motor...

    Code of Federal Regulations, 2014 CFR


    ... 49 Transportation 9 2014-10-01 2014-10-01 false Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals, motor vehicle loading and distribution facilities, and... Structures § 1242.27 Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals...

  19. 49 CFR 1242.27 - Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals, motor...

    Code of Federal Regulations, 2011 CFR


    ... 49 Transportation 9 2011-10-01 2011-10-01 false Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals, motor vehicle loading and distribution facilities, and... Structures § 1242.27 Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals...

  20. 49 CFR 1242.27 - Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals, motor...

    Code of Federal Regulations, 2013 CFR


    ... 49 Transportation 9 2013-10-01 2013-10-01 false Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals, motor vehicle loading and distribution facilities, and... Structures § 1242.27 Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals...

  1. 49 CFR 1242.27 - Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals, motor...

    Code of Federal Regulations, 2012 CFR


    ... 49 Transportation 9 2012-10-01 2012-10-01 false Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals, motor vehicle loading and distribution facilities, and... Structures § 1242.27 Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals...

  2. Structural Elucidation of Chalcone Reductase and Implications for Deoxychalcone Biosynthesis

    PubMed Central

    Bomati, Erin K.; Austin, Michael B.; Bowman, Marianne E.; Dixon, Richard A.; Noel, Joseph P.


    4,2′,4′,6′-tetrahydroxychalcone (chalcone) and 4,2′,4′-trihydroxychalcone (deoxychalcone) serve as precursors of ecologically important flavonoids and isoflavonoids. Deoxychalcone formation depends on chalcone synthase and chalcone reductase; however, the identity of the chalcone reductase substrate out of the possible substrates formed during the multistep reaction catalyzed by chalcone synthase remains experimentally elusive. We report here the three-dimensional structure of alfalfa chalcone reductase bound to the NADP+ cofactor and propose the identity and binding mode of its substrate, namely the non-aromatized coumaryl-trione intermediate of the chalcone synthase-catalyzed cyclization of the fully extended coumaryl-tetraketide thioester intermediate. In the absence of a ternary complex, the quality of the refined NADP+-bound chalcone reductase structure serves as a template for computer-assisted docking to evaluate the likelihood of possible substrates. Interestingly, chalcone reductase adopts the three-dimensional structure of the aldo/keto reductase superfamily. The aldo/keto reductase fold is structurally distinct from all known ketoreductases of fatty acid biosynthesis, which instead belong to the short-chain dehydrogenase/reductase superfamily. The results presented here provide structural support for convergent functional evolution of these two ketoreductases that share similar roles in the biosynthesis of fatty acids/polyketides. In addition, the chalcone reductase structure represents the first protein structure of a member of the aldo/ketoreductase 4 family. Therefore, the chalcone reductase structure serves as a template for the homology modeling of other aldo/ketoreductase 4 family members, including the reductase involved in morphine biosynthesis, namely codeinone reductase. PMID:15970585

  3. Chemical Ligation and Isotope Labeling to Locate Dynamic Effects during Catalysis by Dihydrofolate Reductase.


    Luk, Louis Y P; Ruiz-Pernía, J Javier; Adesina, Aduragbemi S; Loveridge, E Joel; Tuñón, Iñaki; Moliner, Vincent; Allemann, Rudolf K


    Chemical ligation has been used to alter motions in specific regions of dihydrofolate reductase from E. coli and to investigate the effects of localized motional changes on enzyme catalysis. Two isotopic hybrids were prepared; one with the mobile N-terminal segment containing heavy isotopes ((2) H, (13) C, (15) N) and the remainder of the protein with natural isotopic abundance, and the other one with only the C-terminal segment isotopically labeled. Kinetic investigations indicated that isotopic substitution of the N-terminal segment affected only a physical step of catalysis, whereas the enzyme chemistry was affected by protein motions from the C-terminal segment. QM/MM studies support the idea that dynamic effects on catalysis mostly originate from the C-terminal segment. The use of isotope hybrids provides insights into the microscopic mechanism of dynamic coupling, which is difficult to obtain with other studies, and helps define the dynamic networks of intramolecular interactions central to enzyme catalysis. © 2015 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

  4. Limited proteolysis of the nitrate reductase from spinach leaves.


    Kubo, Y; Ogura, N; Nakagawa, H


    The functional structure of assimilatory NADH-nitrate reductase from spinach leaves was studied by limited proteolysis experiments. After incubation of purified nitrate reductase with trypsin, two stable products of 59 and 45 kDa were observed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The fragment of 45 kDa was purified by Blue Sepharose chromatography. NADH-ferricyanide reductase and NADH-cytochrome c reductase activities were associated with this 45-kDa fragment which contains FAD, heme, and NADH binding fragment. After incubation of purified nitrate reductase with Staphylococcus aureus V8 protease, two major peaks were observed by high performance liquid chromatography size exclusion gel filtration. FMNH2-nitrate reductase and reduced methyl viologen-nitrate reductase activities were associated with the first peak of 170 kDa which consists of two noncovalently associated (75-90-kDa) fragments. NADH-ferricyanide reductase activity, however, was associated with the second peak which consisted of FAD and NADH binding sites. Incubation of the 45-kDa fragment with S. aureus V8 protease produced two major fragments of 28 and 14 kDa which contained FAD and heme, respectively. These results indicate that the molybdenum, heme, and FAD components of spinach nitrate reductase are contained in distinct domains which are covalently linked by exposed hinge regions. The molybdenum domain appears to be important in the maintenance of subunit interactions in the enzyme complex.

  5. Investigation of an octapeptide inhibitor of Escherichia coli ribonucleotide reductase by transferred nuclear Overhauser effect spectroscopy

    SciTech Connect

    Bushweller, J.H.; Bartlett, P.A. )


    Several peptides contained within the C-terminal sequence of the B2 subunit of Escherichia coli ribonucleotide reductase (RNR) were investigated for their ability to inhibit the enzyme, presumably by interfering with association of the B1 and B2 subunits. AcYLVGQIDSE, corresponding by sequence homology to a nonapeptide that inhibits herpes simplex RNR shows no inhibition of the E. cole enzyme, whereas AcDDLSNFQL, the C-terminal octapeptide of the E. coli B2 subunit, is a noncompetitive inhibitor. Neither bradykinin (RPPGFSPER) nor the pentapeptide AcSNFQL inhibits the E. coli enzyme. Transferred nuclear Overhauser enhancement spectroscopy was used to probe the conformation of AcDDLSNFQL when it is bound to the B1 subunit. These experiments suggest that the peptide adopts a turn in the region of Asn{sub 5} and Phe{sub 6} and that a hydrophobic cluster of the phenylalanine and leucine side chains is involved in the interaction surface.

  6. Cloning, sequence determination, and regulation of the ribonucleotide reductase subunits from Plasmodium falciparum: a target for antimalarial therapy.

    PubMed Central

    Rubin, H; Salem, J S; Li, L S; Yang, F D; Mama, S; Wang, Z M; Fisher, A; Hamann, C S; Cooperman, B S


    Malaria remains a leading cause of morbidity and mortality worldwide, accounting for more than one million deaths annually. We have focused on the reduction of ribonucleotides to 2'-deoxyribonucleotides, catalyzed by ribonucleotide reductase, which represents the rate-determining step in DNA replication as a target for antimalarial agents. We report the full-length DNA sequence corresponding to the large (PfR1) and small (PfR2) subunits of Plasmodium falciparum ribonucleotide reductase. The small subunit (PfR2) contains the major catalytic motif consisting of a tyrosyl radical and a dinuclear Fe site. Whereas PfR2 shares 59% amino acid identity with human R2, a striking sequence divergence between human R2 and PfR2 at the C terminus may provide a selective target for inhibition of the malarial enzyme. A synthetic oligopeptide corresponding to the C-terminal 7 residues of PfR2 inhibits mammalian ribonucleotide reductase at concentrations approximately 10-fold higher than that predicted to inhibit malarial R2. The gene encoding the large subunit (PfR1) contains a single intron. The cysteines thought to be involved in the reduction mechanism are conserved. In contrast to mammalian ribonucleotide reductase, the genes for PfR1 and PfR2 are located on the same chromosome and the accumulation of mRNAs for the two subunits follow different temporal patterns during the cell cycle. Images Fig. 2 Fig. 4 Fig. 5 PMID:8415692

  7. Production of (R)-Ethyl-4-Chloro-3-Hydroxybutanoate Using Saccharomyces cerevisiae YOL151W Reductase Immobilized onto Magnetic Microparticles.


    Choo, Jin Woo; Kim, Hyung Kwoun


    For the synthesis of various pharmaceuticals, chiral alcohols are useful intermediates. Among them, (R)-ethyl-4-chloro-3-hydroxybutanoate ((R)-ECHB) is an important building block for the synthesis of L-carnitine. (R)-ECHB is produced from ethyl-4-chloro-3-oxobutanoate (ECOB) by a reductase-mediated, enantioselective reduction reaction. The Saccharomyces cerevisiae YOL151W reductase that is expressed in Escherichia coli cells exhibited an enantioselective reduction reaction toward ECOB. By virtue of the C-terminal His-tag, the YOL151W reductase was purified from the cell-free extract using Ni(2+)-NTA column chromatography and immobilized onto Ni(2+)-magnetic microparticles. The physical properties of the immobilized reductase (Imm-Red) were measured using electron microscopy, a magnetic property measurement system, and a zeta potential system; the average size of the particles was approximately 1 μm and the saturated magnetic value was 31.76 emu/g. A neodymium magnet was used to recover the immobilized enzyme within 2 min. The Imm-Red showed an optimum temperature at 45°C and an optimum pH at 6.0. In addition, Bacillus megaterium glucose dehydrogenase (GDH) was produced in the E. coli cells and was used in the coupling reaction to regenerate the NADPH cofactor. The reduction/oxidation coupling reaction composed of the Imm-Red and GDH converted 20 mM ECOB exclusively into (R)- ECHB with an e.e.p value of 98%.

  8. Purification and properties of Escherichia coli dimethyl sulfoxide reductase, an iron-sulfur molybdoenzyme with broad substrate specificity.


    Weiner, J H; MacIsaac, D P; Bishop, R E; Bilous, P T


    Dimethyl sulfoxide reductase, a terminal electron transfer enzyme, was purified from anaerobically grown Escherichia coli harboring a plasmid which codes for dimethyl sulfoxide reductase. The enzyme was purified to greater than 90% homogeneity from cell envelopes by a three-step purification procedure involving extraction with the detergent Triton X-100, chromatofocusing, and DEAE ion-exchange chromatography. The purified enzyme was composed of three subunits with molecular weights of 82,600, 23,600, and 22,700 as identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The native molecular weight was determined by gel electrophoresis to be 155,000. The purified enzyme contained 7.5 atoms of iron and 0.34 atom of molybdenum per mol of enzyme. The presence of molybdopterin cofactor in dimethyl sulfoxide reductase was identified by reconstitution of cofactor-deficient NADPH nitrate reductase activity from Neurospora crassa nit-I mutant and by UV absorption and fluorescence emission spectra. The enzyme displayed a very broad substrate specificity, reducing various N-oxide and sulfoxide compounds as well as chlorate and hydroxylamine.

  9. A study of chromosomal changes associated with amplified dihydrofolate reductase genes in rat hepatoma cells and their dedifferentiated variants

    PubMed Central


    We have examined the karyological consequences of dihydrofolate reductase gene amplification in a series of six rat hepatoma cell lines, all derived from the same clone. Cells of three of these lines express a series of liver-specific functions whereas those of three others fail to express these functions. Cells of each line have been subjected to stepwise selection for methotrexate resistance and, in most cases, resistance is associated with a 40-50-fold amplification of sequences hybridizing to a dihydrofolate reductase cDNA probe. In one line no modified chromosome is observed, whereas in two others the amplified genes are associated with an expanded chromosomal region. R- banding analysis of these karyotypes showed that few changes have occurred. These observations apply to two of the well-differentiated lines, and to a variant able to revert to the differentiated state. In contrast, in the two stably dedifferentiated hepatoma cell lines, amplified dihydrofolate reductase genes are found on large chromosomes of variable size, on ring chromosomes, and on chromosomes containing terminal, median, or multiple centromeres. We conclude that the nature of the chromosomal changes associated with dihydrofolate reductase gene amplification are the result of differences in cell lines rather than in the protocols employed for selection. PMID:6746737

  10. Evidence for a Ustilago maydis steroid 5alpha-reductase by functional expression in Arabidopsis det2-1 mutants.


    Basse, Christoph W; Kerschbamer, Christine; Brustmann, Markus; Altmann, Thomas; Kahmann, Regine


    We have identified a gene (udh1) in the basidiomycete Ustilago maydis that is induced during the parasitic interaction with its host plant maize (Zea mays). udh1 encodes a protein with high similarity to mammalian and plant 5alpha-steroid reductases. Udh1 differs from those of known 5alpha-steroid reductases by six additional domains, partially predicted to be membrane-spanning. A fusion protein of Udh1 and the green fluorescent protein provided evidence for endoplasmic reticulum localization in U. maydis. The function of the Udh1 protein was demonstrated by complementing Arabidopsis det2-1 mutants, which display a dwarf phenotype due to a mutation in the 5alpha-steroid reductase encoding DET2 gene. det2-1 mutant plants expressing either the udh1 or the DET2 gene controlled by the cauliflower mosaic virus 35S promoter differed from wild-type Columbia plants by accelerated stem growth, flower and seed development and a reduction in size and number of rosette leaves. The accelerated growth phenotype of udh1 transgenic plants was stably inherited and was favored under reduced light conditions. Truncation of the N-terminal 70 amino acids of the Udh1 protein abolished the ability to restore growth in det2-1 plants. Our results demonstrate the existence of a 5alpha-steroid reductase encoding gene in fungi and suggest a common ancestor between fungal, plant, and mammalian proteins.

  11. Molecular dissection of a putative iron reductase from Desulfotomaculum reducens MI-1

    SciTech Connect

    Li, Zhi; Kim, David D.; Nelson, Ornella D.; Otwell, Annie E.; Richardson, Ruth E.; Callister, Stephen J.; Lin, Hening


    Desulfotomaculum reducens MI-1 is a Firmicute strain capable of reducing a variety of heavy metal ions and has a great potential in heavy metal bioremediation.We recently identified Dred_2421 as a potential iron reductase through proteomic study of D. reducens. The current study examines its iron-reduction mechanism. Dred_2421, like its close homolog from Escherichia coli (2, 4-dienoyl-CoA reductase), has an FMN-binding N-terminal domain (NTD), an FAD-binding C-terminal domain (CTD), and a 4Fee4S cluster between the two domains. To understand the mechanism of the iron-reduction activity and the role of each domain, we generated a series of variants for each domain and investigated their iron reduction activity. Our results suggest that CTD is the main contributor of the iron-reduction activity, and that NTD and the 4Fee4S cluster are not directly involved in such activity. This study provides a mechanistic understanding of the ironereductase activity of Dred_2421 and may also help to elucidate other physiological activities this enzyme may have.

  12. Crystallographic analysis of a novel aldo-keto reductase from Thermotoga maritima in complex with NADP+

    PubMed Central

    Hou, Hai; Li, Ruiying; Wang, Xiaoyan; Yuan, Zhen; Liu, Xuemeng; Chen, Zhenmin; Xu, Xiaoling


    Aldo-keto reductases (AKRs) are a superfamily of NAD(P)H-dependent oxidoreductases that catalyse the asymmetric reduction of aldehydes and ketones to chiral alcohols in various organisms. The novel aldo-keto reductase Tm1743 from Thermotoga maritima was identified to have a broad substrate specificity and high thermostability, serving as an important enzyme in biocatalysis and fine-chemical synthesis. In this study, Tm1743 was overexpressed in Escherichia coli BL21(DE3) cells with an N-terminal His6 tag and was purified by Ni2+-chelating affinity and size-exclusion chromatography. Purified recombinant enzyme was incubated with its cofactor NADP+ and its substrate ethyl 2-oxo-4-phenylbutyrate (EOPB) for crystallization. Two X-ray diffraction data sets were collected at 2.0 and 1.7 Å resolution from dodecahedral crystals grown from samples containing Tm1743–NADP+–EOPB and Tm1743–NADP+, respectively. Both crystals belonged to space group P3121, with similar unit-cell parameters. However, in the refined structure model only NADP+ was observed in the active site of the full-length Tm1743 enzyme. Degradation of the N-terminal vector-derived amino acids during crystallization was confirmed by Western blot and mass-spectrometric analyses. PMID:26144229

  13. Structure and function of NADPH-cytochrome P450 reductase and nitric oxide synthase reductase domain

    SciTech Connect

    Iyanagi, Takashi . E-mail:


    NADPH-cytochrome P450 reductase (CPR) and the nitric oxide synthase (NOS) reductase domains are members of the FAD-FMN family of proteins. The FAD accepts two reducing equivalents from NADPH (dehydrogenase flavin) and FMN acts as a one-electron carrier (flavodoxin-type flavin) for the transfer from NADPH to the heme protein, in which the FMNH {sup {center_dot}}/FMNH{sub 2} couple donates electrons to cytochrome P450 at constant oxidation-reduction potential. Although the interflavin electron transfer between FAD and FMN is not strictly regulated in CPR, electron transfer is activated in neuronal NOS reductase domain upon binding calmodulin (CaM), in which the CaM-bound activated form can function by a similar mechanism to that of CPR. The oxygenated form and spin state of substrate-bound cytochrome P450 in perfused rat liver are also discussed in terms of stepwise one-electron transfer from CPR. This review provides a historical perspective of the microsomal mixed-function oxidases including CPR and P450. In addition, a new model for the redox-linked conformational changes during the catalytic cycle for both CPR and NOS reductase domain is also discussed.

  14. The orphan protein bis-γ-glutamylcystine reductase joins the pyridine nucleotide-disulfide reductase family

    PubMed Central

    Kim, Juhan; Copley, Shelley D.


    Facile DNA sequencing became possible decades after many enzymes had been purified and characterized. Consequently, there are still “orphan” enyzmes whose activity is known but the genes that encode them have not been identified. Identification of the genes encoding orphan enzymes is important because it allows correct annotation of genes of unknown function or with mis-assigned function. Bis-γ-glutamylcystine reductase (GCR) is an orphan protein that was purified in 1988. This enzyme catalyzes the reduction of bis-γ-glutamylcystine. γ-Glutamylcysteine (γ-Glu-Cys) is the major low molecular weight thiol in halobacteria. We purified GCR from Halobacterium sp. NRC-1 and identified the sequence of 23 tryptic peptides by NanoLC electrospray ionization tandem mass spectrometry. These peptides cover 62% of the protein predicted to be encoded by a gene in Halobacterium sp. NRC-1 that is annotated as mercuric reductase. GCR and mercuric reductase activities were assayed using enzyme that was expressed in E. coli and re-folded from inclusion bodies. The enzyme had robust GCR activity, but no mercuric reductase activity. The genomes of most, but not all, halobacteria for which whole genome sequences are available have close homologs of GCR, suggesting that there is more to be learned about the low molecular weight thiols used in halobacteria. PMID:23560638

  15. ACTS Mobile Terminals

    NASA Technical Reports Server (NTRS)

    Abbe, Brian S.; Agan, Martin J.; Jedrey, Thomas C.


    The development of the Advanced Communications Technology Satellite (ACTS) Mobile Terminal (AMT) and its follow-on, the Broadband Aeronautical Terminal (BAT), have provided an excellent testbed for the evaluation of K- and Ka-band mobile satellite communications systems. An overview of both of these terminals is presented in this paper.

  16. ACTS Mobile Terminals

    NASA Technical Reports Server (NTRS)

    Abbe, Brian S.; Agan, Martin J.; Jedrey, Thomas C.


    The development of the Advanced Communications Technology Satellite (ACTS) Mobile Terminal (AMT) and its follow-on, the Broadband Aeronautical Terminal (BAT), have provided an excellent testbed for the evaluation of K- and Ka-band mobile satellite communications systems. An overview of both of these terminals is presented in this paper.

  17. The PLATO V Terminal.

    ERIC Educational Resources Information Center

    Stifle, J. E.

    This report provides a detailed description of the architecture and programming of the PLATO V terminal, which contains an 8080 microprocessor and is capable of being operated by programs located in a host computer. The terminal contains 8k of memory for storing local programs, a 4k ROM resident program which supervises terminal operation, a 2k…

  18. Circularly permuted dihydrofolate reductase possesses all the properties of the molten globule state, but can resume functional tertiary structure by interaction with its ligands.

    PubMed Central

    Uversky, V. N.; Kutyshenko, V. P.; Protasova NYu; Rogov, V. V.; Vassilenko, K. S.; Gudkov, A. T.


    It is obvious that functional activity of a protein molecule is closely related to its structure. On the other hand, the understanding of structure-function relationship still remains one of the intriguing problems of molecular biology. There is widespread belief that mutagenesis presents a real way to solve this problem. Following this assumption, we have investigated the effect of circular permutation in dihydrofolate reductase from E. coli on protein structure and functioning. It has been shown that in the absence of ligands two circularly permuted variants of dihydrofolate reductase possess all the properties of the molten globule state. However, after addition of ligands they gain the native-like structural properties and specific activity. This means that the in vitro folding of permuted dihydrofolate reductase is terminated at the stage of the molten globule formation. Interaction of permuted protein with ligands leads to the structural adjustment and formation of active protein molecules. PMID:8880908

  19. 3-Methyleneoxindole Reductase of Peas 1

    PubMed Central

    Moyed, H. S.; Williamson, Valerie


    A 100-fold purification of a reduced triphosphopyridine nucleotide/3-methyleneoxindole reductase of peas has been achieved using conventional protein fractionation procedures. Reduced diphosphopyridine nucleotide is 25-fold less effective than reduced triphosphopyridine nucleotide as the reductant. The preparation is free of other reductase activities including those linking the oxidation of reduced pyridine nucleotide coenzymes to the reduction of cytochrome c; vitamins K1, K2, and K3; O2; nitrate; oxidized glutathione; and thiazolyl blue tetrazolium. The affinity of the enzyme for 3-methyleneoxindole (Ks = 0.5 mm 3-methyleneoxindole) is relatively high. It is, therefore, reasonable to assume that 3-methyleneoxindole is the normal substrate. The enzyme is inhibited by indole-3-acetic acid, indole-3-aldehyde, and by l-naph-thaleneacetic acid. While these are not especially powerful inhibitors (K1 = 1.9-4.0 mm) the competitive relationship with 3-methyleneoxindole indicates that significant inhibition might occur at low intracellular concentrations of the substrate. PMID:6042360

  20. Enzyme toolbox: novel enantiocomplementary imine reductases.


    Scheller, Philipp N; Fademrecht, Silvia; Hofelzer, Sebastian; Pleiss, Jürgen; Leipold, Friedemann; Turner, Nicholas J; Nestl, Bettina M; Hauer, Bernhard


    Reducing reactions are among the most useful transformations for the generation of chiral compounds in the fine-chemical industry. Because of their exquisite selectivities, enzymatic approaches have emerged as the method of choice for the reduction of C=O and activated C=C bonds. However, stereoselective enzymatic reduction of C=N bonds is still in its infancy-it was only recently described after the discovery of enzymes capable of imine reduction. In our work, we increased the spectrum of imine-reducing enzymes by database analysis. By combining the currently available knowledge about the function of imine reductases with the experimentally uncharacterized diversity stored in protein sequence databases, three novel imine reductases with complementary enantiopreference were identified along with amino acids important for catalysis. Furthermore, their reducing capability was demonstrated by the reduction of the pharmaceutically relevant prochiral imine 2-methylpyrroline. These novel enzymes exhibited comparable to higher catalytic efficiencies than previously described enzymes, and their biosynthetic potential is highlighted by the full conversion of 2-methylpyrroline in whole cells with excellent selectivities.

  1. Soluble ascorbate free radical reductase in the human lens.


    Bando, M; Obazawa, H


    A major and a minor ascorbate free radical (AFR) reductase were separated from the soluble fraction in the human lens cortex by DEAE-cellulose ion-exchange column chromatography. These AFR reductases also exhibited diaphorase activity using dichlorophenolindophenol and ferricyanide as electron acceptors. The major AFR reductase was partially purified by 5'AMP-Sepharose 4B affinity column chromatography. This partially purified AFR reductase showed a single band of diaphorase activity in native polyacrylamide disc gel electrophoresis. This activity band corresponded to the major protein observed in protein staining by Coomassie Brilliant Blue. However, the protein staining by Coomassie Brilliant Blue showed this activity band surrounded by diffused staining. Molecular weight of the partially purified AFR reductase was determined to be 32 kDa by gel filtration, and the apparent Km value for AFR was about 15 microM. This major lens AFR reductase could be distinguished from soluble Neurospora, Euglena and cucumber AFR reductases, and from two ubiquitous enzymes with reduction activity of AFR and/or foreign compounds, ie, NADH-cytochrome b5 reductase and DT-diaphorase, by their molecular weights, Km values and/or ion-exchange chromatographic behaviors.

  2. Structural and biochemical characterization of cinnamoyl-coa reductases

    USDA-ARS?s Scientific Manuscript database

    Cinnamoyl-coenzyme A reductase (CCR) catalyzes the reduction of hydroxycinnamoyl-coenzyme A (CoA) esters using NADPH to produce hydroxycinnamyl aldehyde precursors in lignin synthesis. The catalytic mechanism and substrate specificity of cinnamoyl-CoA reductases from sorghum (Sorghum bicolor), a str...

  3. The crystal structure of NADPH:ferredoxin reductase from Azotobacter vinelandii.

    PubMed Central

    Sridhar Prasad, G.; Kresge, N.; Muhlberg, A. B.; Shaw, A.; Jung, Y. S.; Burgess, B. K.; Stout, C. D.


    NADPH:ferredoxin reductase (AvFPR) is involved in the response to oxidative stress in Azotobacter vinelandii. The crystal structure of AvFPR has been determined at 2.0 A resolution. The polypeptide fold is homologous with six other oxidoreductases whose structures have been solved including Escherichia coli flavodoxin reductase (EcFldR) and spinach, and Anabaena ferredoxin:NADP+ reductases (FNR). AvFPR is overall most homologous to EcFldR. The structure is comprised of a N-terminal six-stranded antiparallel beta-barrel domain, which binds FAD, and a C-terminal five-stranded parallel beta-sheet domain, which binds NADPH/NADP+ and has a classical nucleotide binding fold. The two domains associate to form a deep cleft where the NADPH and FAD binding sites are juxtaposed. The structure displays sequence conserved motifs in the region surrounding the two dinucleotide binding sites, which are characteristic of the homologous enzymes. The folded over conformation of FAD in AvFPR is similar to that in EcFldR due to stacking of Phe255 on the adenine ring of FAD, but it differs from that in the FNR enzymes, which lack a homologous aromatic residue. The structure of AvFPR displays three unique features in the environment of the bound FAD. Two features may affect the rate of reduction of FAD: the absence of an aromatic residue stacked on the isoalloxazine ring in the NADPH binding site; and the interaction of a carbonyl group with N10 of the flavin. Both of these features are due to the substitution of a conserved C-terminal tyrosine residue with alanine (Ala254) in AvFPR. An additional unique feature may affect the interaction of AvFPR with its redox partner ferredoxin I (FdI). This is the extension of the C-terminus by three residues relative to EcFldR and by four residues relative to FNR. The C-terminal residue, Lys258, interacts with the AMP phosphate of FAD. Consequently, both phosphate groups are paired with a basic group due to the simultaneous interaction of the FMN

  4. Thioredoxin and its reductase are present on synaptic vesicles, and their inhibition prevents the paralysis induced by botulinum neurotoxins.


    Pirazzini, Marco; Azarnia Tehran, Domenico; Zanetti, Giulia; Megighian, Aram; Scorzeto, Michele; Fillo, Silvia; Shone, Clifford C; Binz, Thomas; Rossetto, Ornella; Lista, Florigio; Montecucco, Cesare


    Botulinum neurotoxins consist of a metalloprotease linked via a conserved interchain disulfide bond to a heavy chain responsible for neurospecific binding and translocation of the enzymatic domain in the nerve terminal cytosol. The metalloprotease activity is enabled upon disulfide reduction and causes neuroparalysis by cleaving the SNARE proteins. Here, we show that the thioredoxin reductase-thioredoxin protein disulfide-reducing system is present on synaptic vesicles and that it is functional and responsible for the reduction of the interchain disulfide of botulinum neurotoxin serotypes A, C, and E. Specific inhibitors of thioredoxin reductase or thioredoxin prevent intoxication of cultured neurons in a dose-dependent manner and are also very effective inhibitors of the paralysis of the neuromuscular junction. We found that this group of inhibitors of botulinum neurotoxins is very effective in vivo. Most of them are nontoxic and are good candidates as preventive and therapeutic drugs for human botulism.

  5. Characterization of a New Type of Dissimilatory Sulfite Reductase Present in Thermodesulfobacterium commune

    PubMed Central

    Hatchikian, E. C.; Zeikus, J. G.


    A new type of dissimilatory bisulfite reductase, desulfofuscidin, was isolated from the nonsporeforming thermophilic sulfate-reducing microorganism Thermodesulfobacterium commune. The molecular weight of the enzyme was estimated at 167,000 by sedimentation equilibrium, and the protein was pure by both disc electrophoresis and ultracentrifugation. The bisulfite reductase was a tetramer and had two types of subunits with an α2β2 structure and an individual molecular weight of 47,000. The enzyme exhibited absorption maxima at 576, 389, and 279 nm, with a weak band at 693 nm. Upon the addition of dithionite, the absorption maxima at 576 and 693 nm were weakened, and a new band appeared at 605 nm. The protein reacted with CO in the presence of dithionite to give a complex with absorption peaks at 593, 548, and 395 nm. The extinction coefficients of the purified enzyme at 576, 389, and 279 nm were 89,000, 310,000, and 663,000 M−1 cm−1, respectively. Siroheme was detected as the prosthetic group. The protein contains 20 to 21 nonheme iron atoms and 16 to 17 acid-labile sulfur groups per molecule. The data suggest the presence of four sirohemes and probably four (4Fe-4S) centers per molecule by comparison with desulfoviridin, the dissimilatory sulfite reductase from Desulfovibrio species. The protein contains 36 cysteine residues and is high in acidic and aromatic amino acids. The N-terminal amino acids of the α and β subunits were threonine and serine, respectively. With reduced methyl viologen as electron donor, the major product of sulfite reduction was trithionate, and the pH optimum for activity was 6.0. The enzyme was stable to 70°C and denatured rapidly above this temperature. The dependence of T. commune bisulfite reductase activity on temperature was linear between 35 and 65°C, and the Q10 values observed were above 3. The presence of this new type of dissimilatory bisulfite reductase in T. commune is discussed in terms of taxonomic significance. PMID

  6. Nitrate reductases of Escherichia coli: sequence of the second nitrate reductase and comparison with that encoded by the narGHJI operon.


    Blasco, F; Iobbi, C; Ratouchniak, J; Bonnefoy, V; Chippaux, M


    The structural genes for NRZ, the second nitrate reductase of Escherichia coli, have been sequenced. They are organized in a transcription unit, narZYWV, encoding four subunits, NarZ, NarY, NarW and NarV. The transcription unit is homologous (73% identity) to the narGHJI operon which encodes the genes for NRA, the better characterized nitrate reductase of this organism. The level of homology between the corresponding polypeptides ranges from 69% for the NarW/NarJ pair to 86% for the NarV/NarI pair. The NarZ polypeptide contains the five conserved regions present in all other known molybdoproteins of E. coli and their relative order is the same. The NarY polypeptide, which contains the same four cysteine clusters in the same order as NarH, is probably an electron transfer unit of the complex. Upstream of narZ, an open reading frame, ORFA, is present which could encode a product which has homology (73% identity) with the COOH-terminal end of NarK. The ORFA-narZ intergenic region, however, is about 80 nucleotides long and does not contain the cis-acting elements, NarL and Fnr boxes, nor the terC4 terminator sequence present in the 500 nucleotide narK-narG intergenic region. This might explain why the narZYWV and the narGHJI operons are regulated differently. Our results tend to support the hypothesis that a DNA fragment larger than that encompassing the narGHJI genes has been duplicated.

  7. Enzymatic properties and effect of ionic strength on periplasmic nitrate reductase (NAP) from Desulfovibrio desulfuricans ATCC 27774.


    Bursakov, S A; Carneiro, C; Almendra, M J; Duarte, R O; Caldeira, J; Moura, I; Moura, J J


    Some sulfate reducing bacteria can induce nitrate reductase when grown on nitrate containing media being involved in dissimilatory reduction of nitrate, an important step of the nitrogen cycle. Previously, it was reported the purification of the first soluble nitrate reductase from a sulfate-reducing bacteria Desulfovibrio desulfuricans ATCC 27774 (S.A. Bursakov, M.-Y. Liu, W.J. Payne, J. LeGall, I. Moura, and J.J.G. Moura (1995) Anaerobe 1, 55-60). The present work provides further information about this monomeric periplasmic nitrate reductase (Dd NAP). It has a molecular mass of 74 kDa, 18.6 U specific activity, KM (nitrate) = 32 microM and a pHopt in the range 8-9.5. Dd NAP has peculiar properties relatively to ionic strength and cation/anion activity responses. It is shown that monovalent cations (potassium and sodium) stimulate NAP activity and divalent (magnesium and calcium) inhibited it. Sulfate anion also acts as an activator in KPB buffer. NAP native form is protected by phosphate anion from cyanide inactivation. In the presence of phosphate, cyanide even stimulates NAP activity (up to 15 mM). This effect was used in the purification procedure to differentiate between nitrate and nitrite reductase activities, since the later is effectively blocked by cyanide. Ferricyanide has an inhibitory effect at concentrations higher than 1 mM. The N-terminal amino acid sequence has a cysteine motive C-X2-C-X3-C that is most probably involved in the coordination of the [4Fe-4S] center detected by EPR spectroscopy. The active site of the enzyme consists in a molybdopterin, which is capable for the activation of apo-nit-1 nitrate reductase of Neurospora crassa. The oxidized product of the pterin cofactor obtained by acidic hidrolysis of native NAP with sulfuric acid was identified by HPLC chromatography and characterized as a molybdopterin guanine dinucleotide (MGD).

  8. Identification and Characterization of the Missing Pyrimidine Reductase in the Plant Riboflavin Biosynthesis Pathway1[W][OA

    PubMed Central

    Hasnain, Ghulam; Frelin, Océane; Roje, Sanja; Ellens, Kenneth W.; Ali, Kashif; Guan, Jiahn-Chou; Garrett, Timothy J.; de Crécy-Lagard, Valérie; Gregory, Jesse F.; McCarty, Donald R.; Hanson, Andrew D.


    Riboflavin (vitamin B2) is the precursor of the flavin coenzymes flavin mononucleotide and flavin adenine dinucleotide. In Escherichia coli and other bacteria, sequential deamination and reduction steps in riboflavin biosynthesis are catalyzed by RibD, a bifunctional protein with distinct pyrimidine deaminase and reductase domains. Plants have two diverged RibD homologs, PyrD and PyrR; PyrR proteins have an extra carboxyl-terminal domain (COG3236) of unknown function. Arabidopsis (Arabidopsis thaliana) PyrD (encoded by At4g20960) is known to be a monofunctional pyrimidine deaminase, but no pyrimidine reductase has been identified. Bioinformatic analyses indicated that plant PyrR proteins have a catalytically competent reductase domain but lack essential zinc-binding residues in the deaminase domain, and that the Arabidopsis PyrR gene (At3g47390) is coexpressed with riboflavin synthesis genes. These observations imply that PyrR is a pyrimidine reductase without deaminase activity. Consistent with this inference, Arabidopsis or maize (Zea mays) PyrR (At3g47390 or GRMZM2G090068) restored riboflavin prototrophy to an E. coli ribD deletant strain when coexpressed with the corresponding PyrD protein (At4g20960 or GRMZM2G320099) but not when expressed alone; the COG3236 domain was unnecessary for complementing activity. Furthermore, recombinant maize PyrR mediated NAD(P)H-dependent pyrimidine reduction in vitro. Import assays with pea (Pisum sativum) chloroplasts showed that PyrR and PyrD are taken up and proteolytically processed. Ablation of the maize PyrR gene caused early seed lethality. These data argue that PyrR is the missing plant pyrimidine reductase, that it is plastid localized, and that it is essential. The role of the COG3236 domain remains mysterious; no evidence was obtained for the possibility that it catalyzes the dephosphorylation that follows pyrimidine reduction. PMID:23150645

  9. The aldo-keto reductases (AKRs): Overview.


    Penning, Trevor M


    The aldo-keto reductase (AKR) protein superfamily contains >190 members that fall into 16 families and are found in all phyla. These enzymes reduce carbonyl substrates such as: sugar aldehydes; keto-steroids, keto-prostaglandins, retinals, quinones, and lipid peroxidation by-products. Exceptions include the reduction of steroid double bonds catalyzed by AKR1D enzymes (5β-reductases); and the oxidation of proximate carcinogen trans-dihydrodiol polycyclic aromatic hydrocarbons; while the β-subunits of potassium gated ion channels (AKR6 family) control Kv channel opening. AKRs are usually 37kDa monomers, have an (α/β)8-barrel motif, display large loops at the back of the barrel which govern substrate specificity, and have a conserved cofactor binding domain. AKRs catalyze an ordered bi bi kinetic mechanism in which NAD(P)H cofactor binds first and leaves last. In enzymes that favor NADPH, the rate of release of NADP(+) is governed by a slow isomerization step which places an upper limit on kcat. AKRs retain a conserved catalytic tetrad consisting of Tyr55, Asp50, Lys84, and His117 (AKR1C9 numbering). There is conservation of the catalytic mechanism with short-chain dehydrogenases/reductases (SDRs) even though they show different protein folds. There are 15 human AKRs of these AKR1B1, AKR1C1-1C3, AKR1D1, and AKR1B10 have been implicated in diabetic complications, steroid hormone dependent malignancies, bile acid deficiency and defects in retinoic acid signaling, respectively. Inhibitor programs exist world-wide to target each of these enzymes to treat the aforementioned disorders. Inherited mutations in AKR1C and AKR1D1 enzymes are implicated in defects in the development of male genitalia and bile acid deficiency, respectively, and occur in evolutionarily conserved amino acids. The human AKRs have a large number of nsSNPs and splice variants, but in many instances functional genomics is lacking. AKRs and their variants are now poised to be interrogated using

  10. Oxygen-Insensitive Nitroreductases NfsA and NfsB of Escherichia coli Function under Anaerobic Conditions as Lawsone-Dependent Azo Reductases

    PubMed Central

    Rau, Jörg; Stolz, Andreas


    Quinones can function as redox mediators in the unspecific anaerobic reduction of azo compounds by various bacterial species. These quinones are enzymatically reduced by the bacteria and the resulting hydroquinones then reduce in a purely chemical redox reaction the azo compounds outside of the cells. Recently, it has been demonstrated that the addition of lawsone (2-hydroxy-1,4-naphthoquinone) to anaerobically incubated cells of Escherichia coli resulted in a pronounced increase in the reduction rates of different sulfonated and polymeric azo compounds. In the present study it was attempted to identify the enzyme system(s) responsible for the reduction of lawsone by E. coli and thus for the lawsone-dependent anaerobic azo reductase activity. An NADH-dependent lawsone reductase activity was found in the cytosolic fraction of the cells. The enzyme was purified by column chromatography and the amino-terminal amino acid sequence of the protein was determined. The sequence obtained was identical to the sequence of an oxygen-insensitive nitroreductase (NfsB) described earlier from this organism. Subsequent biochemical tests with the purified lawsone reductase activity confirmed that the lawsone reductase activity detected was identical with NfsB. In addition it was proven that also a second oxygen-insensitive nitroreductase of E. coli (NfsA) is able to reduce lawsone and thus to function under adequate conditions as quinone-dependent azo reductase. PMID:12788749

  11. Transcripts of Anthocyanidin Reductase and Leucoanthocyanidin Reductase and Measurement of Catechin and Epicatechin in Tartary Buckwheat

    PubMed Central

    Kim, Yeon Bok; Thwe, Aye Aye; Kim, YeJi; Li, Xiaohua; Cho, Jin Woong; Park, Phun Bum; Valan Arasu, Mariadhas; Abdullah Al-Dhabi, Naif; Kim, Sun-Ju; Suzuki, Tastsuro; Hyun Jho, Kwang; Park, Sang Un


    Anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR) play an important role in the monomeric units biosynthesis of proanthocyanidins (PAs) such as catechin and epicatechin in several plants. The aim of this study was to clone ANR and LAR genes involved in PAs biosynthesis and examine the expression of these two genes in different organs under different growth conditions in two tartary buckwheat cultivars, Hokkai T8 and T10. Gene expression was carried out by quantitative real-time RT-PCR, and catechin and epicatechin content was analyzed by high performance liquid chromatography. The expression pattern of ANR and LAR did not match the accumulation pattern of PAs in different organs of two cultivars. Epicatechin content was the highest in the flowers of both cultivars and it was affected by light in only Hokkai T8 sprouts. ANR and LAR levels in tartary buckwheat might be regulated by different mechanisms for catechin and epicatechin biosynthesis under light and dark conditions. PMID:24605062

  12. Transcripts of anthocyanidin reductase and leucoanthocyanidin reductase and measurement of catechin and epicatechin in tartary buckwheat.


    Kim, Yeon Bok; Thwe, Aye Aye; Kim, Yeji; Li, Xiaohua; Cho, Jin Woong; Park, Phun Bum; Valan Arasu, Mariadhas; Abdullah Al-Dhabi, Naif; Kim, Sun-Ju; Suzuki, Tastsuro; Hyun Jho, Kwang; Park, Sang Un


    Anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR) play an important role in the monomeric units biosynthesis of proanthocyanidins (PAs) such as catechin and epicatechin in several plants. The aim of this study was to clone ANR and LAR genes involved in PAs biosynthesis and examine the expression of these two genes in different organs under different growth conditions in two tartary buckwheat cultivars, Hokkai T8 and T10. Gene expression was carried out by quantitative real-time RT-PCR, and catechin and epicatechin content was analyzed by high performance liquid chromatography. The expression pattern of ANR and LAR did not match the accumulation pattern of PAs in different organs of two cultivars. Epicatechin content was the highest in the flowers of both cultivars and it was affected by light in only Hokkai T8 sprouts. ANR and LAR levels in tartary buckwheat might be regulated by different mechanisms for catechin and epicatechin biosynthesis under light and dark conditions.

  13. Docking and molecular dynamics studies at trypanothione reductase and glutathione reductase active sites.


    Iribarne, Federico; Paulino, Margot; Aguilera, Sara; Murphy, Miguel; Tapia, Orlando


    A theoretical docking study on the active sites of trypanothione reductase (TR) and glutathione reductase (GR) with the corresponding natural substrates, trypanothione disulfide (T[S]2) and glutathione disulfide (GSSG), is reported. Molecular dynamics simulations were carried out in order to check the robustness of the docking results. The energetic results are in agreement with previous experimental findings and show the crossed complexes have lower stabilization energies than the natural ones. To test DOCK3.5, four nitro furanic compounds, previously designed as potentially active anti-chagasic molecules, were docked at the GR and TR active sites with the DOCK3.5 procedure. A good correlation was found between differential inhibitory activity and relative interaction energy (affinity). The results provide a validation test for the use of DOCK3.5 in connection with the design of anti-chagasic drugs.

  14. A high-throughput assay format for determination of nitrate reductase and nitrite reductase enzyme activities

    SciTech Connect

    McNally, N.; Liu, Xiang Yang; Choudary, P.V.


    The authors describe a microplate-based high-throughput procedure for rapid assay of the enzyme activities of nitrate reductase and nitrite reductase, using extremely small volumes of reagents. The new procedure offers the advantages of rapidity, small sample size-nanoliter volumes, low cost, and a dramatic increase in the throughput sample number that can be analyzed simultaneously. Additional advantages can be accessed by using microplate reader application software packages that permit assigning a group type to the wells, recording of the data on exportable data files and exercising the option of using the kinetic or endpoint reading modes. The assay can also be used independently for detecting nitrite residues/contamination in environmental/food samples. 10 refs., 2 figs.

  15. Restricted Role for Methionine Synthase Reductase Defined by Subcellular Localization

    PubMed Central

    Froese, DS; Wu, X; Zhang, J; Dumas, R; Schoel, WM; Amrein, M; Gravel, RA


    Methionine synthase reductase (MSR; gene name MTRR) is responsible for the reductive activation of methionine synthase. Cloning of the MTRR gene had revealed two major transcription start sites which, by alternative splicing, allows for two potential translation products of 698 and 725 amino acids. While the shorter protein was expected to target to the cytosol where methionine synthase is located, the additional sequence in the longer protein was consistent with a role as a mitochondrial leader sequence. The possibility that MSR might target to mitochondria was also suggested by the work of Leal et al. (2004) who showed that it can act as the reducing enzyme in combination with MMAB (ATP:cob(I)alamin adenosyltransferase) to generate adenosylcobalamin from cob(II)alamin in vitro. Here we examined directly whether MSR protein is found in mitochondria. We show that, while two transcripts are produced by alternative splicing, the N-terminal segment of the putative mitochondrial form of MSR fused to GFP does not contain a sufficiently strong mitochondrial leader sequence to direct the fusion protein to the mitochondria of human fibroblasts. Further, antibodies to MSR protein localized MSR to the cytosol but not to the mitochondria of human fibroblasts or the human hepatoma line Huh-1, as determined by Western blot analysis and immunofluorescence of cells in situ. These data confirm that MSR protein is restricted to the cytosol but, based on the Leal study, suggest that a similar protein may interact with MMAB to reduce the mitochondrial cobalamin substrate in the generation of adenosylcobalamin. PMID:18221906

  16. Swapping FAD binding motifs between plastidic and bacterial ferredoxin-NADP(H) reductases.


    Musumeci, Matías A; Botti, Horacio; Buschiazzo, Alejandro; Ceccarelli, Eduardo A


    Plant-type ferredoxin-NADP(H) reductases (FNRs) are grouped in two classes, plastidic with an extended FAD conformation and high catalytic rates and bacterial with a folded flavin nucleotide and low turnover rates. The 112-123 β-hairpin from a plastidic FNR and the carboxy-terminal tryptophan of a bacterial FNR, suggested to be responsible for the FAD differential conformation, were mutually exchanged. The plastidic FNR lacking the β-hairpin was unable to fold properly. An extra tryptophan at the carboxy terminus, emulating the bacterial FNR, resulted in an enzyme with decreased affinity for FAD and reduced diaphorase and ferredoxin-dependent cytochrome c reductase activities. The insertion of the β-hairpin into the corresponding position of the bacterial FNR increased FAD affinity but did not affect its catalytic properties. The same insertion with simultaneous deletion of the carboxy-terminal tryptophan produced a bacterial chimera emulating the plastidic architecture with an increased k(cat) and an increased catalytic efficiency for the diaphorase activity and a decrease in the enzyme's ability to react with its substrates ferredoxin and flavodoxin. Crystallographic structures of the chimeras showed no significant changes in their overall structure, although alterations in the FAD conformations were observed. Plastidic and bacterial FNRs thus reveal differential effects of key structural elements. While the 112-123 β-hairpin modulates the catalytic efficiency of plastidic FNR, it seems not to affect the bacterial FNR behavior, which instead can be improved by the loss of the C-terminal tryptophan. This report highlights the role of the FAD moiety conformation and the structural determinants involved in stabilizing it, ultimately modulating the functional output of FNRs.

  17. Expression in Escherichia coli of Cytochrome c Reductase Activity from a Maize NADH:Nitrate Reductase Complementary DNA 1

    PubMed Central

    Campbell, Wilbur H.


    A cDNA clone was isolated from a maize (Zea mays L. cv W64A×W183E) scutellum λgt11 library using maize leaf NADH:nitrate reductase Zmnr1 cDNA clone as a hybridization probe; it was designated Zmnr1S. Zmnr1S was shown to be an NADH:nitrate reductase clone by nucleotide sequencing and comparison of its deduced amino acid sequence to Zmnr1. Zmnr1S, which is 1.8 kilobases in length and contains the code for both the cytochrome b and flavin adenine dinucleotide domains of nitrate reductase, was cloned into the EcoRI site of the Escherichia coli expression vector pET5b and expressed. The cell lysate contained NADH:cytochrome c reductase activity, which is a characteristic partial activity of NADH:nitrate reductase dependent on the cytochrome b and flavin adenine dinucleotide domains. Recombinant cytochrome c reductase was purified by immunoaffinity chromatography on monoclonal antibody Zm2(69) Sepharose. The purified cytochrome c reductase, which had a major size of 43 kilodaltons, was inhibited by polyclonal antibodies for maize leaf NADH:nitrate reductase and bound these antibodies when blotted to nitrocellulose. Ultraviolet and visible spectra of oxidized and NADH-reduced recombinant cytochrome c reductase were nearly identical with those of maize leaf NADH:nitrate reductase. These two enzyme forms also had very similar kinetic properties with respect to NADH-dependent cytochrome c and ferricyanide reduction. ImagesFigure 2Figure 3 PMID:16668941

  18. Kinetic mechanism of pulmonary carbonyl reductase.


    Matsuura, K; Nakayama, T; Nakagawa, M; Hara, A; Sawada, H


    The kinetic mechanism of guinea-pig lung carbonyl reductase was studied at pH 7 in the forward reaction with five carbonyl substrates and NAD(P)H and in the reverse reaction with propan-2-ol and NAD(P)+. In each case the enzyme mechanism was sequential, and product-inhibition studies were consistent with a di-iso ordered bi bi mechanism, in which NAD(P)H binds to the enzyme first and NAD(P)+ leaves last and the binding of cofactor induces isomerization. The kinetic and binding studies of the cofactors and several inhibitors such as pyrazole, benzoic acid, Cibacron Blue and benzamide indicate that the cofactor and Cibacron Blue bind to the free enzyme whereas the other inhibitors bind to the binary and/or ternary complexes.

  19. Kinetic mechanism of pulmonary carbonyl reductase.

    PubMed Central

    Matsuura, K; Nakayama, T; Nakagawa, M; Hara, A; Sawada, H


    The kinetic mechanism of guinea-pig lung carbonyl reductase was studied at pH 7 in the forward reaction with five carbonyl substrates and NAD(P)H and in the reverse reaction with propan-2-ol and NAD(P)+. In each case the enzyme mechanism was sequential, and product-inhibition studies were consistent with a di-iso ordered bi bi mechanism, in which NAD(P)H binds to the enzyme first and NAD(P)+ leaves last and the binding of cofactor induces isomerization. The kinetic and binding studies of the cofactors and several inhibitors such as pyrazole, benzoic acid, Cibacron Blue and benzamide indicate that the cofactor and Cibacron Blue bind to the free enzyme whereas the other inhibitors bind to the binary and/or ternary complexes. PMID:3048244

  20. Methylenetetrahydrofolate reductase: biochemical characterization and medical significance.


    Trimmer, Elizabeth E


    Methylenetetrahydrofolate reductase (MTHFR) catalyzes the reduction of 5,10-methylenetetrahydofolate (CH2-H4folate) to 5-methyltetrahydrofolate (CH3-H4folate). The enzyme employs a noncovalently-bound flavin adenine dinucleotide (FAD), which accepts reducing equivalents from NAD(P)H and transfers them to CH2-H4folate. The reaction provides the sole source of CH3-H4folate, which is utilized by methionine synthase in the synthesis of methionine from homocysteine. MTHFR plays a key role in folate metabolism and in the homeostasis of homocysteine; mutations in the enzyme lead to hyperhomocyst(e)inemia. A common C677T polymorphism in MTHFR has been associated with an increased risk for the development of cardiovascular disease, Alzheimer's disease, and depression in adults, and of neural tube defects in the fetus. The mutation also confers protection for certain types of cancers. This review presents the current knowledge of the enzyme, its biochemical characterization, and medical significance.

  1. Terminal automation system maintenance

    SciTech Connect

    Coffelt, D.; Hewitt, J.


    Nothing has improved petroleum product loading in recent years more than terminal automation systems. The presence of terminal automation systems (TAS) at loading racks has increased operational efficiency and safety and enhanced their accounting and management capabilities. However, like all finite systems, they occasionally malfunction or fail. Proper servicing and maintenance can minimize this. And in the unlikely event a TAS breakdown does occur, prompt and effective troubleshooting can reduce its impact on terminal productivity. To accommodate around-the-clock loading at racks, increasingly unattended by terminal personnel, TAS maintenance, servicing and troubleshooting has become increasingly demanding. It has also become increasingly important. After 15 years of trial and error at petroleum and petrochemical storage and transfer terminals, a number of successful troubleshooting programs have been developed. These include 24-hour {open_quotes}help hotlines,{close_quotes} internal (terminal company) and external (supplier) support staff, and {open_quotes}layered{close_quotes} support. These programs are described.

  2. Single-Cell Imaging and Spectroscopic Analyses of Cr(VI) Reduction on the Surface of Bacterial Cells

    SciTech Connect

    Wang, Yuanmin; Sevinc, Papatya C.; Belchik, Sara M.; Fredrickson, Jim K.; Shi, Liang; Lu, H. Peter


    We investigate single-cell reduction of toxic Cr(VI) by the dissimilatory metal-reducing bacterium Shewanella oneidensis MR-1 (MR-1), an important bioremediation process, using Raman spectroscopy and scanning electron microscopy (SEM) combined with energy-dispersive X-ray spectroscopy (EDX). Our experiments indicate that the toxic and highly soluble Cr(VI) can be efficiently reduced to the less toxic and non-soluble Cr2O3 nanoparticles by MR-1. Cr2O3 is observed to emerge as nanoparticles adsorbed on the cell surface and its chemical nature is identified by EDX imaging and Raman spectroscopy. Co-localization of Cr2O3 and cytochromes by EDX imaging and Raman spectroscopy suggests a terminal reductase role for MR-1 surface-exposed cytochromes MtrC and OmcA. Our experiments revealed that the cooperation of surface proteins OmcA and MtrC makes the reduction reaction most efficient, and the sequence of the reducing reactivity of the MR-1 is: wild type > single mutant @mtrC or mutant @omcA > double mutant (@omcA-@mtrC). Moreover, our results also suggest that the direct microbial Cr(VI) reduction and Fe(II) (hematite)-mediated Cr(VI) reduction mechanisms may co-exist in the reduction processes.

  3. The cytochrome bd respiratory oxygen reductases.


    Borisov, Vitaliy B; Gennis, Robert B; Hemp, James; Verkhovsky, Michael I


    Cytochrome bd is a respiratory quinol: O₂ oxidoreductase found in many prokaryotes, including a number of pathogens. The main bioenergetic function of the enzyme is the production of a proton motive force by the vectorial charge transfer of protons. The sequences of cytochromes bd are not homologous to those of the other respiratory oxygen reductases, i.e., the heme-copper oxygen reductases or alternative oxidases (AOX). Generally, cytochromes bd are noteworthy for their high affinity for O₂ and resistance to inhibition by cyanide. In E. coli, for example, cytochrome bd (specifically, cytochrome bd-I) is expressed under O₂-limited conditions. Among the members of the bd-family are the so-called cyanide-insensitive quinol oxidases (CIO) which often have a low content of the eponymous heme d but, instead, have heme b in place of heme d in at least a majority of the enzyme population. However, at this point, no sequence motif has been identified to distinguish cytochrome bd (with a stoichiometric complement of heme d) from an enzyme designated as CIO. Members of the bd-family can be subdivided into those which contain either a long or a short hydrophilic connection between transmembrane helices 6 and 7 in subunit I, designated as the Q-loop. However, it is not clear whether there is a functional consequence of this difference. This review summarizes current knowledge on the physiological functions, genetics, structural and catalytic properties of cytochromes bd. Included in this review are descriptions of the intermediates of the catalytic cycle, the proposed site for the reduction of O₂, evidence for a proton channel connecting this active site to the bacterial cytoplasm, and the molecular mechanism by which a membrane potential is generated. 2011 Elsevier B.V. All rights reserved.

  4. The cytochrome bd respiratory oxygen reductases

    PubMed Central

    Borisov, Vitaliy B.; Gennis, Robert B.; Hemp, James; Verkhovsky, Michael I.


    Summary Cytochrome bd is a respiratory quinol:O2 oxidoreductase found in many prokaryotes, including a number of pathogens. The main bioenergetic function of the enzyme is the production of a proton motive force by the vectorial charge transfer of protons. The sequences of cytochromes bd are not homologous to those of the other respiratory oxygen reductases, i.e., the heme-copper oxygen reductases or alternative oxidases (AOX). Generally, cytochromes bd are noteworthy for their high affinity for O2 and resistance to inhibition by cyanide. In E. coli, for example, cytochrome bd (specifically, cytochrome bd-I) is expressed under O2-limited conditions. Among the members of the bd-family are the so-called cyanide-insensitive quinol oxidases (CIO) which often have a low content of the eponymous heme d but, instead, have heme b in place of heme d in at least a majority of the enzyme population. However, at this point, no sequence motif has been identified to distinguish cytochrome bd (with a stoichiometric complement of heme d) from an enzyme designated as CIO. Members of the bd-family can be subdivided into those which contain either a long or a short hydrophilic connection between transmembrane helices 6 and 7 in subunit I, designated as the Q-loop. However, it is not clear whether there is a functional consequence of this difference. This review summarizes current knowledge on the physiological functions, genetics, structural and catalytic properties of cytochromes bd. Included in this review are descriptions of the intermediates of the catalytic cycle, the proposed site for the reduction of O2, evidence for a proton channel connecting this active site to the bacterial cytoplasm, and the molecular mechanism by which a membrane potential is generated. PMID:21756872

  5. Enhanced silver nanoparticle synthesis by optimization of nitrate reductase activity.


    Vaidyanathan, Ramanathan; Gopalram, Shubaash; Kalishwaralal, Kalimuthu; Deepak, Venkataraman; Pandian, Sureshbabu Ram Kumar; Gurunathan, Sangiliyandi


    Nanostructure materials are attracting a great deal of attention because of their potential for achieving specific processes and selectivity, especially in biological and pharmaceutical applications. The generation of silver nanoparticles using optimized nitrate reductase for the reduction of Ag(+) with the retention of enzymatic activity in the complex is being reported. This report involves the optimization of enzyme activity to bring about enhanced nanoparticle synthesis. Response surface methodology and central composite rotary design (CCRD) were employed to optimize a fermentation medium for the production of nitrate reductase by Bacillus licheniformis at pH 8. The four variables involved in the study of nitrate reductase were Glucose, Peptone, Yeast extract and KNO(3). Glucose had a significant effect on nitrate reductase production. The optimized medium containing (%) Glucose: 1.5, Peptone: 1, Yeast extract: 0.35 and KNO(3): 0.35 resulted in a nitrate reductase activity of 452.206 U/ml which is same as that of the central level. The medium A (showing least nitrate reductase activity) and the medium B (showing maximum nitrate reductase activity) were compared for the synthesis. Spectrophotometric analysis revealed that the particles exhibited a peak at 431 nm and the A(431) for the medium B was 2-fold greater than that of the medium A. The particles were also characterized using TEM. The particles synthesized using the optimized enzyme activity ranged from 10 to 80 nm and therefore can be extended to various medicinal applications.

  6. Structure of the detoxification catalyst mercuric ion reductase from Bacillus sp. strain RC607.


    Schiering, N; Kabsch, W; Moore, M J; Distefano, M D; Walsh, C T; Pai, E F


    Several hundred million tons of toxic mercurials are dispersed in the biosphere. Microbes can detoxify organo-mercurials and mercury salts through sequential action of two enzymes, organomercury lyase and mercuric ion reductase (MerA). The latter, a homodimer with homology to the FAD-dependent disulphide oxidoreductases, catalyses the reaction NADPH + Hg(II)----NADP+ + H+ + Hg(0), one of the very rare enzymic reactions with metal substrates. Human glutathione reductase serves as a reference molecule for FAD-dependent disulphide reductases and between its primary structure and that of MerA from Tn501 (Pseudomonas), Tn21 (Shigella), p1258 (Staphylococcus) and Bacillus, 25-30% of the residues have been conserved. All MerAs have a C-terminal extension about 15 residues long but have very varied N termini. Although the enzyme from Streptomyces lividans has no addition, from Pseudomonas aeruginosa Tn501 and Bacillus sp. strain RC607 it has one and two copies respectively of a domain of 80-85 residues, highly homologous to MerP, the periplasmic component of proteins encoded by the mer operon. These domains can be proteolytically cleaved off without changing the catalytic efficiency. We report here the crystal structure of MerA from the Gram-positive bacterium Bacillus sp. strain RC607. Analysis of its complexes with nicotinamide dinucleotide substrates and the inhibitor Cd(II) reveals how limited structural changes enable an enzyme to accept as substrate what used to be a dangerous inhibitor. Knowledge of the mode of mercury ligation is a prerequisite for understanding this unique detoxification mechanism.

  7. Clostridium sticklandii glycine reductase selenoprotein A gene: cloning, sequencing, and expression in Escherichia coli.

    PubMed Central

    Garcia, G E; Stadtman, T C


    Gene grdA, which encodes selenoprotein A of the glycine reductase complex from Clostridium sticklandii, was identified and characterized. This gene encodes a protein of 158 amino acids with a calculated M(r) of 17,142. The known sequence of 15 amino acids around the selenocysteine residue and the known carboxy terminus of the protein are correctly predicted by the nucleotide sequence. An opal termination codon (TGA) corresponding to the location of the single selenocysteine residue in the polypeptide was found in frame at position 130. The C. sticklandii grdA gene was inserted behind the tac promotor of an Escherichia coli expression vector. An E. coli strain transformed with this vector produced an 18-kDa polypeptide that was not detected in extracts of nontransformed cells. Affinity-purified anti-C. sticklandii selenoprotein A immunoglobulin G reacted specifically with this polypeptide, which was indistinguishable from authentic C. sticklandii selenoprotein A by immunological analysis. Addition of the purified expressed protein to glycine reductase protein components B and C reconstituted the active glycine reductase complex. Although synthesis of enzymically active protein A depended on the presence of selenium in the growth medium, formation of immunologically reactive protein did not. Moreover, synthesis of enzymically active protein in a transformed E. coli selD mutant strain indicated that there is a nonspecific mechanism of selenocysteine incorporation. These findings imply that mRNA secondary structures of C. sticklandii grdA are not functional for UGA-directed selenocysteine insertion in the E. coli expression system. Images PMID:1429431

  8. Clostridium sticklandii glycine reductase selenoprotein A gene: cloning, sequencing, and expression in Escherichia coli.


    Garcia, G E; Stadtman, T C


    Gene grdA, which encodes selenoprotein A of the glycine reductase complex from Clostridium sticklandii, was identified and characterized. This gene encodes a protein of 158 amino acids with a calculated M(r) of 17,142. The known sequence of 15 amino acids around the selenocysteine residue and the known carboxy terminus of the protein are correctly predicted by the nucleotide sequence. An opal termination codon (TGA) corresponding to the location of the single selenocysteine residue in the polypeptide was found in frame at position 130. The C. sticklandii grdA gene was inserted behind the tac promotor of an Escherichia coli expression vector. An E. coli strain transformed with this vector produced an 18-kDa polypeptide that was not detected in extracts of nontransformed cells. Affinity-purified anti-C. sticklandii selenoprotein A immunoglobulin G reacted specifically with this polypeptide, which was indistinguishable from authentic C. sticklandii selenoprotein A by immunological analysis. Addition of the purified expressed protein to glycine reductase protein components B and C reconstituted the active glycine reductase complex. Although synthesis of enzymically active protein A depended on the presence of selenium in the growth medium, formation of immunologically reactive protein did not. Moreover, synthesis of enzymically active protein in a transformed E. coli selD mutant strain indicated that there is a nonspecific mechanism of selenocysteine incorporation. These findings imply that mRNA secondary structures of C. sticklandii grdA are not functional for UGA-directed selenocysteine insertion in the E. coli expression system.

  9. Detoxification of hexavalent chromium by Leucobacter sp. uses a reductase with specificity for dihydrolipoamide.


    Sarangi, Abhipsa; Krishnan, Chandraraj


    Leucobacter sp. belongs to the metal stressed community and possesses higher tolerance to metals including chromium and can detoxify toxic hexavalent chromium by reduction to less toxic trivalent chromium. But, the mechanism of reduction of hexavalent chromium by Leucobacter sp. has not been studied. Understanding the enzyme catalyzing reduction of chromium is important to improve the species for application in bioremediation. Hence, a soluble reductase catalyzing the reduction of hexavalent chromium was purified from a Leucobacter sp. and characterized. The pure chromate reductase was obtained from the cell-free extract through hydrophobic interaction and gel filtration column chromatographic methods. It was a monomeric enzyme and showed similar molecular weights in both gel filtration (∼68 KDa) and SDS-PAGE (64 KDa). It reduced Cr(VI) using both NADH and NADPH as the electron donor, but exhibited higher activity with NADH. The optimal activity was found at pH 5.5 and 30 °C. The K(m) and V(max) for Cr(VI) reduction with NADH were 46.57 μM and 0.37 μmol min(-1) (mg protein) (-1), respectively. The activity was inhibited by p-hydroxy mercury benzoate, Ag(2+) and Hg(2+) indicating the role of thiol groups in the catalysis. The spectrophotometric analysis of the purified enzyme showed the absence of bound flavin in the enzyme. The N-terminal amino acid sequence and LC/MS analysis of trypsin digested purified enzyme showed similarity to dihydrolipoyl dehydrogenase. The purified enzyme had dihydrolipoyl dehydrogenase activity with dihydrolipoamide as the substrate, which suggested that Leucobacter sp. uses reductase with multiple substrate specificity for reduction of Cr(VI) detoxification.

  10. Structure of the detoxification catalyst mercuric ion reductase from Bacillus sp. strain RC607

    NASA Astrophysics Data System (ADS)

    Schiering, N.; Kabsch, W.; Moore, M. J.; Distefano, M. D.; Walsh, C. T.; Pai, E. F.


    SEVERAL hundred million tons of toxic mercurials are dispersed in the biosphere1. Microbes can detoxify organo-mercurials and mercury salts through sequential action of two enzymes, organomercury lyase2 and mercuric ion reductase (MerA) 3-5. The latter, a homodimer with homology to the FAD-dependent disulphide oxidoreductases6, catalyses the reaction NADPH + Hg(II) --> NADP+ + H+Hg(0), one of the very rare enzymic reactions with metal substrates. Human glutathione reductase7,8 serves as a reference molecule for FAD-dependent disulphide reductases and between its primary structure9 and that of MerA from Tn501 (Pseudomonas), Tn21 (Shigella), pI258 (Staphylococcus) and Bacillus, 25-30% of the residues have been conserved10,11. All MerAs have a C-terminal extension about 15 residues long but have very varied N termini. Although the enzyme from Streptomyces lividans has no addition, from Pseudomonas aeruginosa Tn5Ol and Bacillus sp. strain RC607 it has one and two copies respectively of a domain of 80-85 residues, highly homologous to MerP, the periplasmic component of proteins encoded by the mer operon11. These domains can be proteolytically cleaved off without changing the catalytic efficiency3. We report here the crystal structure of MerA from the Gram-positive bacterium Bacillus sp. strain RC607. Analysis of its complexes with nicotinamide dinucleotide substrates and the inhibitor Cd(II) reveals how limited structural changes enable an enzyme to accept as substrate what used to be a dangerous inhibitor. Knowledge of the mode of mercury ligation is a prerequisite for understanding this unique detoxification mechanism.

  11. Carboxylation mechanism and stereochemistry of crotonyl-CoA carboxylase/reductase, a carboxylating enoyl-thioester reductase

    PubMed Central

    Erb, Tobias J.; Brecht, Volker; Fuchs, Georg; Müller, Michael; Alber, Birgit E.


    Chemo- and stereoselective reductions are important reactions in chemistry and biology, and reductases from biological sources are increasingly applied in organic synthesis. In contrast, carboxylases are used only sporadically. We recently described crotonyl-CoA carboxylase/reductase, which catalyzes the reduction of (E)-crotonyl-CoA to butyryl-CoA but also the reductive carboxylation of (E)-crotonyl-CoA to ethylmalonyl-CoA. In this study, the complete stereochemical course of both reactions was investigated in detail. The pro-(4R) hydrogen of NADPH is transferred in both reactions to the re face of the C3 position of crotonyl-CoA. In the course of the carboxylation reaction, carbon dioxide is incorporated in anti fashion at the C2 atom of crotonyl-CoA. For the reduction reaction that yields butyryl-CoA, a solvent proton is added in anti fashion instead of the CO2. Amino acid sequence analysis showed that crotonyl-CoA carboxylase/reductase is a member of the medium-chain dehydrogenase/reductase superfamily and shares the same phylogenetic origin. The stereospecificity of the hydride transfer from NAD(P)H within this superfamily is highly conserved, although the substrates and reduction reactions catalyzed by its individual representatives differ quite considerably. Our findings led to a reassessment of the stereospecificity of enoyl(-thioester) reductases and related enzymes with respect to their amino acid sequence, revealing a general pattern of stereospecificity that allows the prediction of the stereochemistry of the hydride transfer for enoyl reductases of unknown specificity. Further considerations on the reaction mechanism indicated that crotonyl-CoA carboxylase/reductase may have evolved from enoyl-CoA reductases. This may be useful for protein engineering of enoyl reductases and their application in biocatalysis. PMID:19458256

  12. The structure of apo and holo forms of xylose reductase, a dimeric aldo-keto reductase from Candida tenuis.


    Kavanagh, Kathryn L; Klimacek, Mario; Nidetzky, Bernd; Wilson, David K


    Xylose reductase is a homodimeric oxidoreductase dependent on NADPH or NADH and belongs to the largely monomeric aldo-keto reductase superfamily of proteins. It catalyzes the first step in the assimilation of xylose, an aldose found to be a major constituent monosaccharide of renewable plant hemicellulosic material, into yeast metabolic pathways. It does this by reducing open chain xylose to xylitol, which is reoxidized to xylulose by xylitol dehydrogenase and metabolically integrated via the pentose phosphate pathway. No structure has yet been determined for a xylose reductase, a dimeric aldo-keto reductase or a family 2 aldo-keto reductase. The structures of the Candida tenuis xylose reductase apo- and holoenzyme, which crystallize in spacegroup C2 with different unit cells, have been determined to 2.2 A resolution and an R-factor of 17.9 and 20.8%, respectively. Residues responsible for mediating the novel dimeric interface include Asp-178, Arg-181, Lys-202, Phe-206, Trp-313, and Pro-319. Alignments with other superfamily members indicate that these interactions are conserved in other dimeric xylose reductases but not throughout the remainder of the oligomeric aldo-keto reductases, predicting alternate modes of oligomerization for other families. An arrangement of side chains in a catalytic triad shows that Tyr-52 has a conserved function as a general acid. The loop that folds over the NAD(P)H cosubstrate is disordered in the apo form but becomes ordered upon cosubstrate binding. A slow conformational isomerization of this loop probably accounts for the observed rate-limiting step involving release of cosubstrate. Xylose binding (K(m) = 87 mM) is mediated by interactions with a binding pocket that is more polar than a typical aldo-keto reductase. Modeling of xylose into the active site of the holoenzyme using ordered waters as a guide for sugar hydroxyls suggests a convincing mode of substrate binding.

  13. Superconducting Cable Termination


    Sinha, Uday K.; Tolbert, Jerry


    Disclosed is a termination that connects high temperature superconducting (HTS) cable immersed in pressurized liquid nitrogen to high voltage and neutral (shield) external bushings at ambient temperature and pressure. The termination consists of a splice between the HTS power (inner) and shield (outer) conductors and concentric copper pipes which are the conductors in the termination. There is also a transition from the dielectric tape insulator used in the HTS cable to the insulators used between and around the copper pipe conductors in the termination. At the warm end of the termination the copper pipes are connected via copper braided straps to the conventional warm external bushings which have low thermal stresses. This termination allows for a natural temperature gradient in the copper pipe conductors inside the termination which enables the controlled flashing of the pressurized liquid coolant (nitrogen) to the gaseous state. Thus the entire termination is near the coolant supply pressure and the high voltage and shield cold bushings, a highly stressed component used in most HTS cables, are eliminated. A sliding seal allows for cable contraction as it is cooled from room temperature to ˜72-82 K. Seals, static vacuum, and multi-layer superinsulation minimize radial heat leak to the environment.

  14. Flight termination receiver catalog

    NASA Astrophysics Data System (ADS)


    This catalog provides reference information on ultra-high frequency flight termination receivers used at various U.S. missile ranges and test facilities. It is not intended to be a comprehensive review of all available flight termination receivers. Inclusion in this catalog does not constitute approval or endorsement for use at any government installation. Information in this catalog was extracted from manufacturers' specifications.

  15. Solubilization and Resolution of the Membrane-Bound Nitrite Reductase from Paracoccus Halodenitrificans into Nitrite and Nitric Oxide Reductases

    NASA Technical Reports Server (NTRS)

    Grant, Michael A.; Cronin, Sonja E.; Hochstein, Lawrence I.


    Membranes prepared from Paracoccus halodenitrificans reduced nitrite or nitric oxide to nitrous oxide. Extraction of these membranes with the detergent CHAPSO [3-(3-Chlolamidoporopyldimethylammonio)-1-(2- hydroxy-1-propanesulfonate)], followed by ammonium sulfate fractionation of the solubilized proteins, resulted in the separation of nitrite and nitric oxide reductase activities. The fraction containing nitrite reductase activity spectrally resembled a cd-type cytochrome. Several cytochromes were detected in the nitric oxide reductase fraction. Which, if any, of these cytochromes is associated with the reduction of nitric oxide is not clear at this time.

  16. Solubilization and Resolution of the Membrane-Bound Nitrite Reductase from Paracoccus Halodenitrificans into Nitrite and Nitric Oxide Reductases

    NASA Technical Reports Server (NTRS)

    Grant, Michael A.; Cronin, Sonja E.; Hochstein, Lawrence I.


    Membranes prepared from Paracoccus halodenitrificans reduced nitrite or nitric oxide to nitrous oxide. Extraction of these membranes with the detergent CHAPSO [3-(3-Chlolamidoporopyldimethylammonio)-1-(2- hydroxy-1-propanesulfonate)], followed by ammonium sulfate fractionation of the solubilized proteins, resulted in the separation of nitrite and nitric oxide reductase activities. The fraction containing nitrite reductase activity spectrally resembled a cd-type cytochrome. Several cytochromes were detected in the nitric oxide reductase fraction. Which, if any, of these cytochromes is associated with the reduction of nitric oxide is not clear at this time.

  17. Ice crystal terminal velocities

    NASA Technical Reports Server (NTRS)

    Heymsfield, A.


    Terminal velocities of different ice crystal forms were calculated using the most recent ice crystal drag coefficients, aspect ratios, and densities. The equations derived were primarily for use in calculating precipitation rates by sampling particles with an aircraft in cirrus clouds, and determining particle size in cirrus clouds by Doppler radar. However, the equations are sufficiently general for determining particle terminal velocity at any altitude, and most any crystal type. Two sets of equations were derived. The general equations provide a good estimate of terminal velocities at any altitude. The specific equations are a set of equations for ice crystal terminal velocities at 1000 mb. The calculations are in good agreement with terminal velocity measurements. The results from the present study were also compared to prior calculations by others and seem to give more reasonable results, particularly at higher altitudes.

  18. Ice crystal terminal velocities.

    NASA Technical Reports Server (NTRS)

    Heymsfield, A.


    Terminal velocities of different ice crystal forms were calculated, using the most recent ice crystal drag coefficients, aspect ratios, and densities. The equations derived were primarily for use in calculating precipitation rates by sampling particles with an aircraft in cirrus clouds, and determining particle size in cirrus clouds by Doppler radar. However, the equations are sufficiently general for determining particle terminal velocity at any altitude, and almost any crystal type. Two sets of equations were derived. The 'general' equations provide a good estimate of terminal velocities at any altitude. The 'specific' equations are a set of equations for ice crystal terminal velocities at 1000 mb. The calculations are in good agreement with terminal velocity measurements. The results from the present study were also compared to prior calculations by others and seem to give more reasonable results, particularly at higher altitudes.

  19. Exploration of Nitrate Reductase Metabolic Pathway in Corynebacterium pseudotuberculosis

    PubMed Central

    Abreu, Vinícius; Diniz, Carlos; Dorneles, Elaine M. S.; Barh, Debmalya


    Based on the ability of nitrate reductase synthesis, Corynebacterium pseudotuberculosis is classified into two biovars: Ovis and Equi. Due to the presence of nitrate reductase, the Equi biovar can survive in absence of oxygen. On the other hand, Ovis biovar that does not have nitrate reductase is able to adapt to various ecological niches and can grow on certain carbon sources. Apart from these two biovars, some other strains are also able to carry out the reduction of nitrate. The enzymes that are involved in electron transport chain are also identified by in silico methods. Findings about pathogen metabolism can contribute to the identification of relationship between nitrate reductase and the C. pseudotuberculosis pathogenicity, virulence factors, and discovery of drug targets. PMID:28316974

  20. Exploration of Nitrate Reductase Metabolic Pathway in Corynebacterium pseudotuberculosis.


    Almeida, Sintia; Sousa, Cassiana; Abreu, Vinícius; Diniz, Carlos; Dorneles, Elaine M S; Lage, Andrey P; Barh, Debmalya; Azevedo, Vasco


    Based on the ability of nitrate reductase synthesis, Corynebacterium pseudotuberculosis is classified into two biovars: Ovis and Equi. Due to the presence of nitrate reductase, the Equi biovar can survive in absence of oxygen. On the other hand, Ovis biovar that does not have nitrate reductase is able to adapt to various ecological niches and can grow on certain carbon sources. Apart from these two biovars, some other strains are also able to carry out the reduction of nitrate. The enzymes that are involved in electron transport chain are also identified by in silico methods. Findings about pathogen metabolism can contribute to the identification of relationship between nitrate reductase and the C. pseudotuberculosis pathogenicity, virulence factors, and discovery of drug targets.

  1. Enantioselective imine reduction catalyzed by imine reductases and artificial metalloenzymes.


    Gamenara, Daniela; Domínguez de María, Pablo


    Adding value to organic synthesis. Novel imine reductases enable the enantioselective reduction of imines to afford optically active amines. Likewise, novel bioinspired artificial metalloenzymes can perform the same reaction as well. Emerging proof-of-concepts are herein discussed.

  2. Characterization of the lys2 gene of Penicillium chrysogenum encoding alpha-aminoadipic acid reductase.


    Casqueiro, J; Gutiérrez, S; Bañuelos, O; Fierro, F; Velasco, J; Martín, J F


    A DNA fragment containing a gene homologous to LYS2 gene of Saccharomyces cerevisiae was cloned from a genomic DNA library of Penicillium chrysogenum AS-P-78. It encodes a protein of 1409 amino acids (Mr 154859) with strong similarity to the S. cerevisiae (49.9% identity) Schizosaccharomyces pombe (51.3% identity) and Candida albicans (48.12% identity) alpha-aminoadipate reductases and a lesser degree of identity to the amino acid-activating domains of the non-ribosomal peptide synthetases, including the alpha-aminoadipate-activating domain of the alpha-aminoadipyl-cysteinyl-valine synthetase of P. chrysogenum (12.4% identical amino acids). The lys2 gene contained one intron in the 5'-region and other in the 3'-region, as shown by comparing the nucleotide sequences of the cDNA and genomic DNA, and was transcribed as a 4.7-kb monocistronic mRNA. The lys2 gene was localized on chromosome III (7.5 Mb) in P. chrysogenum AS-P-78 and on chromosome IV (5.6 Mb) in strain P2, whereas the penicillin gene cluster is known to be located in chromosome I in both strains. The lys2-encoded protein is a member of the aminoacyladenylate-forming enzyme family with a reductase domain in its C-terminal region.

  3. Purification and characterization of assimilatory nitrite reductase from Candida utilis.


    Sengupta, S; Shaila, M S; Rao, G R


    Nitrate assimilation in many plants, algae, yeasts and bacteria is mediated by two enzymes, nitrate reductase (EC and nitrite reductase (EC They catalyse the stepwise reduction of nitrate to nitrite and nitrite to ammonia respectively. The nitrite reductase from an industrially important yeast, Candida utilis, has been purified to homogeneity. Purified nitrite reductase is a heterodimer and the molecular masses of the two subunits are 58 and 66 kDa. The native enzyme exhibits a molecular mass of 126 kDa as analysed by gel filtration. The identify of the two subunits of nitrite reductase was confirmed by immunoblotting using antibody for Cucurbita pepo leaf nitrite reductase. The presence of two different sized transcripts coding for the two subunits was confirmed by (a) in vitro translation of mRNA from nitrate-induced C. utilis followed by immunoprecipitation of the in vitro translated products with heterologous nitrite reductase antibody and (b) Northern-blot analysis. The 66 kDa subunit is acidic in nature which is probably due to its phosphorylated status. The enzyme is stable over a range of temperatures. Both subunits can catalyse nitrite reduction, and the reconstituted enzyme, at a higher protein concentration, shows an activity similar to that of the purified enzyme. Each of these subunits has been shown to contain a few unique peptides in addition to a large number of common peptides. Reduced Methyl Viologen has been found to be as effective an electron donor as NADPH in the catalytic process, a phenomenon not commonly seen for nitrite reductases from other systems.

  4. Targeting and topology in the membrane of plant 3-hydroxy-3-methylglutaryl coenzyme A reductase.

    PubMed Central

    Campos, N; Boronat, A


    The enzyme 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) catalyzes the synthesis of mevalonate. This is the first committed step of isoprenoid biosynthesis. A common feature of all known plant HMGR isoforms is the presence of two highly conserved hydrophobic sequences in the N-terminal quarter of the protein. Using an in vitro system, we showed that the two hydrophobic sequences of Arabidopsis HMGR1S function as internal signal sequences. Specific recognition of these sequences by the signal recognition particle mediates the targeting of the protein to microsomes derived from the endoplasmic reticulum. Arabidopsis HMGR is inserted into the microsomal membrane, and the two hydrophobic sequences become membrane-spanning segments. The N-terminal end and the C-terminal catalytic domain of Arabidopsis HMGR are positioned on the cytosolic side of the membrane, whereas only a short hydrophilic sequence is exposed to the lumen. Our results suggest that the plant HMGR isoforms known to date are primarily targeted to the endoplasmic reticulum and have the same topology in the membrane. This reinforces the hypothesis that mevalonate is synthesized only in the cytosol. The possibility that plant HMGRs might be located in different regions of the endomembrane system is discussed. PMID:8718626

  5. Carbon-carbon double-bond reductases in nature.


    Huang, Minmin; Hu, Haihong; Ma, Li; Zhou, Quan; Yu, Lushan; Zeng, Su


    Reduction of C = C bonds by reductases, found in a variety of microorganisms (e.g. yeasts, bacteria, and lower fungi), animals, and plants has applications in the production of metabolites that include pharmacologically active drugs and other chemicals. Therefore, the reductase enzymes that mediate this transformation have become important therapeutic targets and biotechnological tools. These reductases are broad-spectrum, in that, they can act on isolation/conjugation C = C-bond compounds, α,β-unsaturated carbonyl compounds, carboxylic acids, acid derivatives, and nitro compounds. In addition, several mutations in the reductase gene have been identified, some associated with diseases. Several of these reductases have been cloned and/or purified, and studies to further characterize them and determine their structure in order to identify potential industrial biocatalysts are still in progress. In this study, crucial reductases for bioreduction of C = C bonds have been reviewed with emphasis on their principal substrates and effective inhibitors, their distribution, genetic polymorphisms, and implications in human disease and treatment.

  6. Distribution of Prx-linked hydroperoxide reductase activity among microorganisms.


    Takeda, Kouji; Nishiyama, Yoshitaka; Yoda, Koji; Watanabe, Toshihiro; Nimura-Matsune, Kaori; Mura, Kiyoshi; Tokue, Chiyoko; Katoh, Tetzuya; Kawasaki, Shinji; Niimura, Youichi


    Peroxiredoxin (Prx) constitutes a large family of enzymes found in microorganisms, animals, and plants, but the detection of the activities of Prx-linked hydroperoxide reductases (peroxiredoxin reductases) in cell extracts, and the purification based on peroxide reductase activity, have only been done in bacteria and Trypanosomatidae. A peroxiredoxin reductase (NADH oxidase) from a bacterium, Amphibacillus, displayed only poor activities in the presence of purified Prx from Saccharomyces or Synechocystis, while it is highly active in the presence of bacterial Prx. These results suggested that an enzyme system different from that in bacteria might exist for the reduction of Prx in yeast and cyanobacteria. Prx-linked hydroperoxide reductase activities were detected in cell extracts of Saccharomyces, Synechocystis, and Chlorella, and the enzyme activities of Saccharomyces and Chlorella were induced under vigorously aerated culture conditions and intensive light exposure conditions, respectively. Partial purification of Prx-linked peroxidase from the induced yeast cells indicated that the Prx-linked peroxidase system consists of two protein components, namely, thioredoxin and thioredoxin reductase. This finding is consistent with the previous report on its purification based on its protein protection activity against oxidation [Chae et al., J. Biol. Chem., 269, 27670-27678 (1994)]. In this study we have confirmed that Prx-linked peroxidase activity are widely distributed, not only in bacteria species and Trypanosomatidae, but also in yeast and photosynthetic microorganisms, and showed reconstitution of the activity from partially purified interspecies components.

  7. Molybdenum effector of fumarate reductase repression and nitrate reductase induction in Escherichia coli.

    PubMed Central

    Iuchi, S; Lin, E C


    In Escherichia coli the presence of nitrate prevents the utilization of fumarate as an anaerobic electron acceptor. The induction of the narC operon encoding the nitrate reductase is coupled to the repression of the frd operon encoding the fumarate reductase. This coupling is mediated by nitrate as an effector and the narL product as the regulatory protein (S. Iuchi and E. C. C. Lin, Proc. Natl. Acad. Sci. USA 84:3901-3905, 1987). The protein-ligand complex appears to control narC positively but frd negatively. In the present study we found that a molybdenum coeffector acted synergistically with nitrate in the regulation of frd and narC. In chlD mutants believed to be impaired in molybdate transport (or processing), full repression of phi(frd-lac) and full induction of phi(narC-lac) by nitrate did not occur unless the growth medium was directly supplemented with molybdate (1 microM). This requirement was not clearly manifested in wild-type cells, apparently because it was met by the trace quantities of molybdate present as a contaminant in the mineral medium. In chlB mutants, which are known to accumulate the Mo cofactor because of its failure to be inserted as a prosthetic group into proteins such as nitrate reductase, nitrate repression of frd and induction of narC were also intensified by molybdate supplementation. In this case a deficiency of the molybdenum coeffector might have resulted from enhanced feedback inhibition of molybdate transport (or processing) by the elevated level of the unutilized Mo cofactor. In addition, mutations in chlE, which are known to block the synthesis of the organic moiety of the Mo cofactor, lowered the threshold concentration of nitrate (< 1 micromole) necessary for frd repression and narC induction. These changes could be explained simply by the higher intracellular nitrate attainable in cells lacking the ability to destroy the effector. PMID:3301812

  8. Flight Termination Criteria

    NASA Astrophysics Data System (ADS)

    Haber, Jerold M.; Larson, Erik


    The first line of defense in protecting the public against the threat of injury from a failing space booster is the flight termination system. Consequently, these systems must be highly reliable and the criteria for flight termination must be carefully formulated. Criteria must be developed based on observable data that allows adequate time for the data to be assessed and a flight termination action to be triggered. Criteria should be set so that 1) the chance a good vehicle will be terminated is small, 2) the chance of failing to terminate an errant vehicle before it can hazard population centers or valuable assets is minimal, and 3) there is assurance that the combination of the planned trajectory and mission rules do not induce excessive risks to land based populations, air lanes, and shipping lanes should the vehicle need to be terminated [1].This paper provides an overview of the approaches to developing and implement flight termination criteria and a tool for understanding risk implications of proposed criteria.

  9. Isolation and characterization of two ferredoxin-NADP+ reductases from Spirulina platensis.


    Masaki, R; Wada, K; Matsubara, H


    Two ferredoxin-NADP+ reductases (FNRs I and II) [EC] were purified from a blue-green alga, Spirulina platensis, by (NH4)2SO4 fractionation, gel filtration on Sephadex G-100 and DEAE-Sephadex A-50 chromatography. FNRs I and II were both FAD-containing enzymes with molecular weights of 33,000, and could photochemically reduce NADP+ to the same extent in the presence of S. platensis ferredoxin, using FNR-depleted membrane fragments of S. platensis. They had similar physical and enzymatic properties, except for chemical properties such as the amino (N)-terminal sequences and the patterns of their peptide maps. The significance of the presence of two FNRs in S. platensis as as of the multiple forms found in other organisms is discussed.

  10. narI region of the Escherichia coli nitrate reductase (nar) operon contains two genes.

    PubMed Central

    Sodergren, E J; DeMoss, J A


    In previous studies it has been established that in Escherichia coli the three known subunits of anaerobic nitrate reductase are encoded by the narGHI operon. From the nucleotide sequence of the narI region of the operon we conclude that, in addition to the narG and narH genes, the nar operon contains two other open reading frames (ORFs), ORF1 and ORF2, that encode proteins of 26.5 and 25.5 kilodaltons, respectively. Protein fusions to each of the genes in the operon showed that expression of all four genes was similarly regulated. The reading frames of ORF1 and ORF2 were verified, and the N-terminal sequence for the ORF1 fusion protein was determined. The nar operon therefore contains four genes designated and ordered as narGHJI. Images PMID:2832376

  11. Expanding the Imine Reductase Toolbox by Exploring the Bacterial Protein-Sequence Space.


    Wetzl, Dennis; Berrera, Marco; Sandon, Nicolas; Fishlock, Dan; Ebeling, Martin; Müller, Michael; Hanlon, Steven; Wirz, Beat; Iding, Hans


    Recent investigations on imine reductases (IREDs) have enriched the toolbox of potential catalysts for accessing chiral amines, which are important building blocks for the pharmaceutical industry. Herein, we describe the characterization of 20 new IREDs. A C-terminal domain clustering of the bacterial protein-sequence space was performed to identify the novel IRED candidates. Each of the identified enzymes was characterized against a set of nine cyclic imine model substrates. A refined clustering towards putative active-site residues was performed and was consistent both with our screening and previously reported results. Finally, preparative scale experiments on a 100 mg scale with two purified IREDs, IR_20 from Streptomyces tsukubaensis and IR_23 from Streptomyces vidiochromogenes, were carried out to provide (R)-2-methylpiperidine in 98% ee (71% yield) and (R)-1-methyl-1,2,3,4-tetrahydroisoquinoline in >98% ee (82% yield).

  12. Microsecond subdomain folding in dihydrofolate reductase.


    Arai, Munehito; Iwakura, Masahiro; Matthews, C Robert; Bilsel, Osman


    The characterization of microsecond dynamics in the folding of multisubdomain proteins has been a major challenge in understanding their often complex folding mechanisms. Using a continuous-flow mixing device coupled with fluorescence lifetime detection, we report the microsecond folding dynamics of dihydrofolate reductase (DHFR), a two-subdomain α/β/α sandwich protein known to begin folding in this time range. The global dimensions of early intermediates were monitored by Förster resonance energy transfer, and the dynamic properties of the local Trp environments were monitored by fluorescence lifetime detection. We found that substantial collapse occurs in both the locally connected adenosine binding subdomain and the discontinuous loop subdomain within 35 μs of initiation of folding from the urea unfolded state. During the fastest observable ∼550 μs phase, the discontinuous loop subdomain further contracts, concomitant with the burial of Trp residue(s), as both subdomains achieve a similar degree of compactness. Taken together with previous studies in the millisecond time range, a hierarchical assembly of DHFR--in which each subdomain independently folds, subsequently docks, and then anneals into the native conformation after an initial heterogeneous global collapse--emerges. The progressive acquisition of structure, beginning with a continuously connected subdomain and spreading to distal regions, shows that chain entropy is a significant organizing principle in the folding of multisubdomain proteins and single-domain proteins. Subdomain folding also provides a rationale for the complex kinetics often observed.

  13. Aldose reductase mediates retinal microglia activation

    SciTech Connect

    Chang, Kun-Che; Shieh, Biehuoy; Petrash, J. Mark


    Retinal microglia (RMG) are one of the major immune cells in charge of surveillance of inflammatory responses in the eye. In the absence of an inflammatory stimulus, RMG reside predominately in the ganglion layer and inner or outer plexiform layers. However, under stress RMG become activated and migrate into the inner nuclear layer (INL) or outer nuclear layer (ONL). Activated RMG in cell culture secrete pro-inflammatory cytokines in a manner sensitive to downregulation by aldose reductase inhibitors. In this study, we utilized CX3CR1{sup GFP} mice carrying AR mutant alleles to evaluate the role of AR on RMG activation and migration in vivo. When tested on an AR{sup WT} background, IP injection of LPS induced RMG activation and migration into the INL and ONL. However, this phenomenon was largely prevented by AR inhibitors or in AR null mice, or was exacerbated in transgenic mice that over-express AR. LPS-induced increases in ocular levels of TNF-α and CX3CL-1 in WT mice were substantially lower in AR null mice or were reduced by AR inhibitor treatment. These studies demonstrate that AR expression in RMG may contribute to the proinflammatory phenotypes common to various eye diseases such as uveitis and diabetic retinopathy. - Highlights: • AR inhibition prevents retinal microglial activation. • Endotoxin-induced ocular cytokine production is reduced in AR null mice. • Overexpression of AR spontaneously induces retinal microglial activation.

  14. Phenylethynyl terminated imide oligomers

    NASA Technical Reports Server (NTRS)

    Hergenrother, Paul M. (Inventor); Bryant, Robert G. (Inventor); Jensen, Brian J. (Inventor); Havens, Stephen J. (Inventor)


    Four phenylethynyl amine compounds - 3 and 4-aminophenoxy-4'-phenylethynylbenzophenone, and 3 and 4-amino-4'-phenylethynylbenzophenone - were readily prepared and were used to endcap imide oligomers. Phenylethynyl-terminated amide acid oligomers and phenylethynyl-terminated imide oligomers with various molecular weights and compositions were prepared and characterized. These oligomers were cured at 300 to 400 C to provide crosslinked polyimides with excellent solvent resistance, high strength and modulus, and good high temperature properties. Adhesive panels, composites, films, and moldings from these phenylethynyl terminated imide oligomers gave excellent mechanical performance.

  15. Nonleaking battery terminals.

    NASA Technical Reports Server (NTRS)

    Snider, W. E.; Nagle, W. J.


    Three different terminals were designed for usage in a 40 ampere/hour silver zinc battery which has a 45% KOH by weight electrolyte in a plastic battery case. Life tests, including thermal cycling, electrical charge and discharge for up to three years duration, were conducted on these three different terminal designs. Tests for creep rate and tensile strength were conducted on the polyphenylene oxide plastic battery cases. Some cases were unused and others containing KOH electrolyte were placed on life tests. The design and testing of nonleaking battery terminals for use with a KOH electrolyte in a plastic case are considered.

  16. Nonleaking battery terminals

    NASA Technical Reports Server (NTRS)

    Snider, W. E.; Nagle, W. J.


    Three different terminals were designed for usage in a 40 ampere/hour silver zinc battery which has a 45 percent KOH by weight electrolyte in a plastic battery case. Life tests, including thermal cycling, electrical charge and discharge for up to three years duration, were conducted on these three different terminal designs. Tests for creep rate and tensile strength were conducted on the polyphenylene oxide (PPO) plastic battery cases. Some cases were unused and others containing KOH electrolyte were placed on life tests. The design and testing of nonleaking battery terminals for use with a potassium hydroxide (KOH) electrolyte in a plastic case are discussed.

  17. Intimacy and terminal care

    PubMed Central

    Gilley, Judy


    Four cases are summarized in which the general practitioner is involved in the terminal care of one partner of a stable marital relationship. The need to conceptualize the expectations of the patient, the family and the doctor in terminal care is stressed. An attempt is made to illustrate how the quality of the pre-existing sexual relationship, the dying person's own sexuality, and ultimately the capacity for physical expression of intimacy in the marriage profoundly influence choices in terminal care and the quality of dying. PMID:3204583

  18. Terminal Supraparticle Assemblies from Similarly Charged Protein Molecules and Nanoparticles

    PubMed Central

    Park, Jai Il; Nguyen, Trung Dac; de Queirós Silveira, Gleiciani; Bahng, Joong Hwan; Srivastava, Sudhanshu; Sun, Kai; Zhao, Gongpu; Zhang, Peijun; Glotzer, Sharon C.; Kotov, Nicholas A.


    Self-assembly of proteins and inorganic nanoparticles into terminal assemblies makes possible a large family of uniformly sized hybrid colloids. These particles can be compared in terms of utility, versatility and multifunctionality to other known types of terminal assemblies. They are simple to make and offer theoretical tools for designing their structure and function. To demonstrate such assemblies, we combine cadmium telluride nanoparticles with cytochrome C protein and observe spontaneous formation of spherical supraparticles with a narrow size distribution. Such self-limiting behaviour originates from the competition between electrostatic repulsion and non-covalent attractive interactions. Experimental variation of supraparticle diameters for several assembly conditions matches predictions obtained in simulations. Similar to micelles, supraparticles can incorporate other biological components as exemplified by incorporation of nitrate reductase. Tight packing of nanoscale components enables effective charge and exciton transport in supraparticles as demonstrated by enzymatic nitrate reduction initiated by light absorption in the nanoparticle. PMID:24845400

  19. Terminal supraparticle assemblies from similarly charged protein molecules and nanoparticles

    NASA Astrophysics Data System (ADS)

    Park, Jai Il; Nguyen, Trung Dac; de Queirós Silveira, Gleiciani; Bahng, Joong Hwan; Srivastava, Sudhanshu; Zhao, Gongpu; Sun, Kai; Zhang, Peijun; Glotzer, Sharon C.; Kotov, Nicholas A.


    Self-assembly of proteins and inorganic nanoparticles into terminal assemblies makes possible a large family of uniformly sized hybrid colloids. These particles can be compared in terms of utility, versatility and multifunctionality to other known types of terminal assemblies. They are simple to make and offer theoretical tools for designing their structure and function. To demonstrate such assemblies, we combine cadmium telluride nanoparticles with cytochrome C protein and observe spontaneous formation of spherical supraparticles with a narrow size distribution. Such self-limiting behaviour originates from the competition between electrostatic repulsion and non-covalent attractive interactions. Experimental variation of supraparticle diameters for several assembly conditions matches predictions obtained in simulations. Similar to micelles, supraparticles can incorporate other biological components as exemplified by incorporation of nitrate reductase. Tight packing of nanoscale components enables effective charge and exciton transport in supraparticles and bionic combination of properties as demonstrated by enzymatic nitrate reduction initiated by light absorption in the nanoparticle.

  20. Nontraumatic terminal ileal perforation

    PubMed Central

    Wani, Rauf A; Parray, Fazl Q; Bhat, Nadeem A; Wani, Mehmood A; Bhat, Tasaduq H; Farzana, Fowzia


    Background There is still confusion and controversy over the diagnosis and optimal surgical treatment of non traumatic terminal ileal perforation-a cause of obscure peritonitis. Methods This study was a prospective study aimed at evaluating the clinical profile, etiology and optimal surgical management of patients with nontraumatic terminal ileal perforation. Results There were 79 cases of nontraumatic terminal ileal perforation; the causes for perforation were enteric fever(62%), nonspecific inflammation(26%), obstruction(6%), tuberculosis(4%) and radiation enteritis (1%). Simple closure of the perforation (49%) and end to side ileotransverse anastomosis(42%) were the mainstay of the surgical management. Conclusion Terminal ileal perforation should be suspected in all cases of peritonitis especially in developing countries and surgical treatment should be optimized taking various accounts like etiology, delay in surgery and operative findings into consideration to reduce the incidence of deadly complications like fecal fistula. PMID:16759405

  1. Tirawa on the Terminator

    NASA Image and Video Library


    Rhea sports an immense impact scar on its leading hemisphere, like several other major Saturnian moons. The impact basin, seen above center on the day-night dividing line, or terminator, is named Tirawa

  2. Aldose reductase expression as a risk factor for cataract.


    Snow, Anson; Shieh, Biehuoy; Chang, Kun-Che; Pal, Arttatrana; Lenhart, Patricia; Ammar, David; Ruzycki, Philip; Palla, Suryanarayana; Reddy, G Bhanuprakesh; Petrash, J Mark


    Aldose reductase (AR) is thought to play a role in the pathogenesis of diabetic eye diseases, including cataract and retinopathy. However, not all diabetics develop ocular complications. Paradoxically, some diabetics with poor metabolic control appear to be protected against retinopathy, while others with a history of excellent metabolic control develop severe complications. These observations indicate that one or more risk factors may influence the likelihood that an individual with diabetes will develop cataracts and/or retinopathy. We hypothesize that an elevated level of AR gene expression could confer higher risk for development of diabetic eye disease. To investigate this hypothesis, we examined the onset and severity of diabetes-induced cataract in transgenic mice, designated AR-TG, that were either heterozygous or homozygous for the human AR (AKR1B1) transgene construct. AR-TG mice homozygous for the transgene demonstrated a conditional cataract phenotype, whereby they developed lens vacuoles and cataract-associated structural changes only after induction of experimental diabetes; no such changes were observed in AR-TG heterozygotes or nontransgenic mice with or without experimental diabetes induction. We observed that nondiabetic AR-TG mice did not show lens structural changes even though they had lenticular sorbitol levels almost as high as the diabetic AR-TG lenses that showed early signs of cataract. Over-expression of AR led to increases in the ratio of activated to total levels of extracellular signal-regulated kinase (ERK1/2) and c-Jun N-terminal (JNK1/2), which are known to be involved in cell growth and apoptosis, respectively. After diabetes induction, AR-TG but not WT controls had decreased levels of phosphorylated as well as total ERK1/2 and JNK1/2 compared to their nondiabetic counterparts. These results indicate that high AR expression in the context of hyperglycemia and insulin deficiency may constitute a risk factor that could predispose the

  3. Sulfite reductase protects plants against sulfite toxicity.


    Yarmolinsky, Dmitry; Brychkova, Galina; Fluhr, Robert; Sagi, Moshe


    Plant sulfite reductase (SiR; Enzyme Commission catalyzes the reduction of sulfite to sulfide in the reductive sulfate assimilation pathway. Comparison of SiR expression in tomato (Solanum lycopersicum 'Rheinlands Ruhm') and Arabidopsis (Arabidopsis thaliana) plants revealed that SiR is expressed in a different tissue-dependent manner that likely reflects dissimilarity in sulfur metabolism between the plant species. Using Arabidopsis and tomato SiR mutants with modified SiR expression, we show here that resistance to ectopically applied sulfur dioxide/sulfite is a function of SiR expression levels and that plants with reduced SiR expression exhibit higher sensitivity than the wild type, as manifested in pronounced leaf necrosis and chlorophyll bleaching. The sulfite-sensitive mutants accumulate applied sulfite and show a decline in glutathione levels. In contrast, mutants that overexpress SiR are more tolerant to sulfite toxicity, exhibiting little or no damage. Resistance to high sulfite application is manifested by fast sulfite disappearance and an increase in glutathione levels. The notion that SiR plays a role in the protection of plants against sulfite is supported by the rapid up-regulation of SiR transcript and activity within 30 min of sulfite injection into Arabidopsis and tomato leaves. Peroxisomal sulfite oxidase transcripts and activity levels are likewise promoted by sulfite application as compared with water injection controls. These results indicate that, in addition to participating in the sulfate assimilation reductive pathway, SiR also plays a role in protecting leaves against the toxicity of sulfite accumulation.

  4. A novel homozygous disruptive mutation in the SRD5A2-gene in a partially virilized patient with 5alpha-reductase deficiency.


    Hiort, Olaf; Schütt, Snjezana M; Bals-Pratsch, Monika; Holterhus, Paul-Martin; Marschke, Christine; Struve, Dagmar


    Steroid 5alpha-reductase deficiency is a rare autosomal recessive disorder caused by mutations in the SRD5A2-gene, resulting in diminished dihydrotestosterone (DHT) formation and, hence, in a severe virilization deficit of the external genitalia in patients with 46,XY karyotype. The phenotype of affected individuals is variable and has been reported to range from completely female over genital ambiguity to normal male, depending on the type of mutation and its effect on enzyme activity. Here we report an adolescent 46,XY patient with predominantly female appearance, who had been gonadectomized in early infancy. Genital status revealed a urogenital sinus equivalent to Prader stage III. Molecular genetic analysis demonstrated a homozygous point mutation in exon 2 of the SRD5A2-gene, leading to a premature termination in codon position 111 of the 5alpha-reductase 2 enzyme, and not allowing formation of a functional 5alpha-reductase type 2 enzyme. This case demonstrates that even despite a complete loss of function of 5alpha-reductase type 2, marked virilization is possible, most likely the result of a testosterone (T) effect during foetal life.

  5. Importance of the substrate-binding loop region of human monomeric carbonyl reductases in catalysis and coenzyme binding.


    Miura, Takeshi; Nishinaka, Toru; Terada, Tomoyuki


    Monomeric carbonyl reductase 1 (CBR1) and 3 (CBR3) are members of the short-chain dehydrogenase/reductase superfamily, and metabolize endogenous and xenobiotic compounds using NADPH as a coenzyme. CBR3 exhibits a higher K(m) value toward NADPH and more limited carbonyl reductase activities than CBR1, although they are highly homologous to each other in amino acid sequence levels. In the present study, we investigated the origin of the different properties of the enzymes by analyses using several chimeric enzymes. Harr-plot analysis of the amino acid sequences was conducted and as a result, two low-identity regions between human CBR1 and CBR3 were found: these were designated as the N-terminal low-identity region (LirN) and the C-terminal low-identity region (LirC; the substrate-binding region). We genetically constructed chimeric enzymes while focusing on these regions. Chimeric CBR1 possessing LirN of CBR3 (CBR1LirN3) exhibited CBR1-like activities but a low coenzyme affinity probably due to a structural alteration in a micro domain, whereas chimeric CBR1 including LirC of CBR3 (CBR1LirC3) was enzymatically similar to CBR3. Furthermore, CBR3LirC1 was similar to CBR1 in both enzymatic activities and coenzyme binding. These results suggested that LirC, i.e., the substrate-binding loop region, is the origin of the difference between human CBR1 and CBR3 in both catalytic and coenzyme-binding properties.

  6. Purification and properties of proline reductase from Clostridium sticklandii.


    Seto, B; Stadtman, T C


    Proline reductase of Clostridium sticklandii is a membrane-bound protein and is released by treatment with detergents. The enzyme has been purified to homogeneity and is estimated by gel filtration and sedimentation equilibrium centrifugation to have a molecular weight of 298,000 to 327,000. A minimum molecular weight of 30,000 to 31,000 was calculated on the basis of sodium dodecyl sulfate-acrylamide gel electrophoresis and amino acid composition. Amino acid analysis showed a preponderance of acidic amino acids. No tryptophan was detected in the protein either spectrophotometrically or by amino acid analysis. A total of 20 sulfhydryl groups measured by titration of the reduced protein with 5,5'-dithiobis(2-nitrobenzoic acid) is in agreement with 20 cystic acid residues determined in hydrolysates of performic acid-oxidized protein. No molybdenum, iron, or selenium was found in the pure protein. Although NADH is the physiological electron donor for the proline reductase complex, the purified 300,000 molecular weight reductase component is inactive in the presence of NADH in vitro. Dithiothreitol, in contrast, can serve as electron donor both for unpurified (putative proline reductase complex) and purified proline reductase in vitro.

  7. Potential use of aldose reductase inhibitors to prevent diabetic complications.


    Zenon, G J; Abobo, C V; Carter, B L; Ball, D W


    Reviewed are (1) the biochemical basis and pathophysiology of diabetic complications and (2) the structure-activity relationships, pharmacology, pharmacokinetics, clinical trials, and adverse effects of aldose reductase inhibitors (ARIs). ARIs are a new class of drugs potentially useful in preventing diabetic complications, the most widely studied of which have been cataracts and neuropathy. ARIs inhibit aldose reductase, the first, rate-limiting enzyme in the polyol metabolic pathway. In nonphysiological hyperglycemia the activity of hexokinase becomes saturated while that of aldose reductase is enhanced, resulting in intracellular accumulation of sorbitol. Because sorbitol does not readily penetrate the cell membrane it can persist within cells, which may lead to diabetic complications. ARIs are a class of structurally dissimilar compounds that include carboxylic acid derivatives, flavonoids, and spirohydantoins. The major pharmacologic action of an ARI involves competitive binding to aldose reductase and consequent blocking of sorbitol production. ARIs delay cataract formation in animals, but the role of aldose reductase in cataract formation in human diabetics has not been established. The adverse effects of ARIs include hypersensitivity reactions. Although the polyol pathway may not be solely responsible for diabetic complications, studies suggest that therapy with ARIs could be beneficial. Further research is needed to determine the long-term impact and adverse effects of ARIs in the treatment of diabetic complications.

  8. Uterine glutathione reductase activity: modulation by estrogens and progesterone.


    Díaz-Flores, M; Baiza-Gutman, L A; Pedrón, N N; Hicks, J J


    The aim of this study was to determine whether glutathione reductase activity in uterine tissue is regulated by sex hormones. In spayed rats uterine glutathione reductase was significantly increased by exogenous estrogen (P< 0.01), progesterone (P< 0.01) or estrogen plus progesterone (P<0.01). When enzyme activity is expressed per mg protein, daily administration of estrogen or progesterone induces a progressive increase of this enzyme between 24 to 48 h or 24 to 72 h of treatment, respectively. Whereas the combination of both steroids causes an earlier and higher increase in glutathione reductase activity at 24 h of treatment. Estradiol singly or in combination with progesterone induced the highest protein concentration in the uterus. Whereas uterine DNA concentration is only significantly affected by estradiol. Our results suggest that uterine glutathione reductase is regulated by estradiol and progesterone and may be involved in maintaining levels of reduced glutathione in the uterus. This compound may be required for control of the redox state of thiol groups and in detoxification reactions involving H2O2 and electrophylic substances. The antioxidant action of estrogens is partially due to the stimulation of glutathione reductase.

  9. Bacterial morphinone reductase is related to Old Yellow Enzyme.

    PubMed Central

    French, C E; Bruce, N C


    Morphinone reductase, produced by Pseudomonas putida M10, catalyses the NADH-dependent saturation of the carbon-carbon double bond of morphinone and codeinone, and is believed to be involved in the metabolism of morphine and codeine. The structural gene encoding morphinone reductase, designated morB, was cloned from Ps. putida M10 genomic DNA by the use of degenerate oligonucleotide probes based on elements of the amino acid sequence of the purified enzyme. Sequence analysis and structural characteristics indicated that morphinone reductase is related to the flavoprotein alpha/beta-barrel oxidoreductases, and is particularly similar to Old Yellow Enzyme of Saccharomyces spp. and the related oestrogen-binding protein of Candida albicans. Expressed sequence tags from several plant species show high homology to these enzymes, suggesting the presence of a family of enzymes conserved in plants and fungi. Although related bacterial proteins are known, morphinone reductase appears to be more similar to the eukaryotic proteins. Morphinone reductase was overexpressed in Escherichia coli, and has potential applications for the industrial preparation of semisynthetic opiates. Images Figure 1 Figure 5 PMID:8554504

  10. HMG-CoA reductase guides migrating primordial germ cells.


    Van Doren, M; Broihier, H T; Moore, L A; Lehmann, R


    The enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase is best known for catalysing a rate-limiting step in cholesterol biosynthesis, but it also participates in the production of a wide variety of other compounds. Some clinical benefits attributed to inhibitors of HMG-CoA reductase are now thought to be independent of any serum cholesterol-lowering effect. Here we describe a new cholesterol-independent role for HMG-CoA reductase, in regulating a developmental process: primordial germ cell migration. We show that in Drosophila this enzyme is highly expressed in the somatic gonad and that it is necessary for primordial germ cells to migrate to this tissue. Misexpression of HMG-CoA reductase is sufficient to attract primordial germ cells to tissues other than the gonadal mesoderm. We conclude that the regulated expression of HMG-CoA reductase has a critical developmental function in providing spatial information to guide migrating primordial germ cells.

  11. Dynamic Control of Electron Transfers in Diflavin Reductases

    PubMed Central

    Aigrain, Louise; Fatemi, Fataneh; Frances, Oriane; Lescop, Ewen; Truan, Gilles


    Diflavin reductases are essential proteins capable of splitting the two-electron flux from reduced pyridine nucleotides to a variety of one electron acceptors. The primary sequence of diflavin reductases shows a conserved domain organization harboring two catalytic domains bound to the FAD and FMN flavins sandwiched by one or several non-catalytic domains. The catalytic domains are analogous to existing globular proteins: the FMN domain is analogous to flavodoxins while the FAD domain resembles ferredoxin reductases. The first structural determination of one member of the diflavin reductases family raised some questions about the architecture of the enzyme during catalysis: both FMN and FAD were in perfect position for interflavin transfers but the steric hindrance of the FAD domain rapidly prompted more complex hypotheses on the possible mechanisms for the electron transfer from FMN to external acceptors. Hypotheses of domain reorganization during catalysis in the context of the different members of this family were given by many groups during the past twenty years. This review will address the recent advances in various structural approaches that have highlighted specific dynamic features of diflavin reductases. PMID:23203109

  12. [Methylenetetrahydrofolate reductase and methionine synthase reductase gene polymorphisms in ethnic Han women from Linyi].


    Zhang, Yan-li; Lu, Yan-qiang; Li, Hua-feng; Rui, Xin-yi; Zhang, Li-jun; Wu, Chuan-ye; Fang, Ai-min; Wang, Gui-xi


    To explore the distribution of genetic polymorphisms of methylenetetrahydrofolate reductase (MTHFR) 677C/T, 1298A/C and methionine synthase reductase (MTRR) 66A/G among ethnic Han females from Linyi, and to correlate it with serum level of homocysteine (Hcy). A cross-sectional study was carried out. Oral epithelial cell samples were collected from 825 subjects. MTHFR and MTRR gene polymorphisms were determined with a Taqman-Minor Groove Binder (MGB) method. Distribution of gene polymorphisms was analyzed and compared with others regions of China including Weifang, Zhengzhou, Deyang and Hainan. A biochemical assay was also carried out to determine the total Hcy in plasma of 281 subjects. The reductase activity of MTHFR was classified into decreased and stable groups according to genetic polymorphism of MTHFR. Correlation between MTHFR groups and total Hcy level were also explored. (1) The frequencies of MTHFR677CC, CT and TT genotypes of the selected subjects were 16.7%, 48.3% and 35.0%, respectively. The frequencies of MTHFR 1298AA, AC and CC genotypes were 76.0%, 21.6% and 2.4%, respectively. And those of MTRR 66AA, AG and GG genotypes were 54.7%, 39.4% and 5.9%, respectively. For the selected subjects, their frequency of MTHFR 677TT genotype was higher than that of Deyang and Hainan (P< 0.01), whilst the frequency of MTHFR 1298CC genotype was lower than that of Deyang and Hainan (P < 0.01), and the frequency of MTRR 66 GG genotype was lower than that of Hainan (P< 0.01). (2) The Hcy level for those with decreased MTHFR activity was significantly higher than those with stable MTHFR activity (P< 0.05). MTHFR gene 677C/T, 1298A/C and MTRR 66A/G polymorphisms in ethnic Han women from Linyi have differed significantly from other regions of China. Decreased MTHFR activity caused by genetic polymorphisms is a risk factor for raised Hcy level.

  13. 29 CFR 4043.24 - Termination or partial termination.

    Code of Federal Regulations, 2010 CFR


    ... Secretary of the Treasury determines that there has been a termination or partial termination of a plan... 29 Labor 9 2010-07-01 2010-07-01 false Termination or partial termination. 4043.24 Section 4043.24 Labor Regulations Relating to Labor (Continued) PENSION BENEFIT GUARANTY CORPORATION PLAN...

  14. Tandem Terminal Ion Source

    SciTech Connect


    OAK-B135 Tandem Terminal Ion Source. The terminal ion source (TIS) was used in several experiments during this reporting period, all for the {sup 7}Be({gamma}){sup 8}B experiment. Most of the runs used {sup 1}H{sup +} at terminal voltages from 0.3 MV to 1.5 MV. One of the runs used {sup 2}H{sup +} at terminal voltage of 1.4 MV. The other run used {sup 4}He{sup +} at a terminal voltage of 1.37 MV. The list of experiments run with the TIS to date is given in table 1 below. The tank was opened four times for unscheduled source repairs. On one occasion the tank was opened to replace the einzel lens power supply which had failed. The 10 kV unit was replaced with a 15 kV unit. The second time the tank was opened to repair the extractor supply which was damaged by a tank spark. On the next occasion the tank was opened to replace a source canal which had sputtered away. Finally, the tank was opened to replace the discharge bottle which had been coated with aluminum sputtered from the exit canal.

  15. The last glacial termination.


    Denton, G H; Anderson, R F; Toggweiler, J R; Edwards, R L; Schaefer, J M; Putnam, A E


    A major puzzle of paleoclimatology is why, after a long interval of cooling climate, each late Quaternary ice age ended with a relatively short warming leg called a termination. We here offer a comprehensive hypothesis of how Earth emerged from the last global ice age. A prerequisite was the growth of very large Northern Hemisphere ice sheets, whose subsequent collapse created stadial conditions that disrupted global patterns of ocean and atmospheric circulation. The Southern Hemisphere westerlies shifted poleward during each northern stadial, producing pulses of ocean upwelling and warming that together accounted for much of the termination in the Southern Ocean and Antarctica. Rising atmospheric CO2 during southern upwelling pulses augmented warming during the last termination in both polar hemispheres.

  16. Phenylethynyl terminated reactive oligomer

    NASA Technical Reports Server (NTRS)

    Bryant, Robert G. (Inventor); Jensen, Brian J. (Inventor); Hergenrother, Paul M. (Inventor)


    A composition of matter having the general structure: ##STR1## (wherein X is F, Cl, or NO.sub.2, and Y is CO, SO.sub.2 or C(CF.sub.3).sub.2) is employed to terminate a nucleophilic reagent, resulting in the exclusive production of phenylethynyl terminated reactive oligomers which display unique thermal characteristics. A reactive diluent having the general structure: ##STR2## (wherein R is any aliphatic or aromatic moiety) is employed to decrease the melt viscosity of a phenylethynyl terminated reactive oligomer and to subsequently react therewith to provide a thermosetting material of enhanced density. These materials have features which make them attractive candidates for use as composite matrices and adhesives.

  17. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase

    PubMed Central


    Background The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. Results To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Conclusion Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo. PMID:24308601

  18. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.


    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J


    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  19. Sulfur Isotope Effects of Dissimilatory Sulfite Reductase.


    Leavitt, William D; Bradley, Alexander S; Santos, André A; Pereira, Inês A C; Johnston, David T


    The precise interpretation of environmental sulfur isotope records requires a quantitative understanding of the biochemical controls on sulfur isotope fractionation by the principle isotope-fractionating process within the S cycle, microbial sulfate reduction (MSR). Here we provide the only direct observation of the major ((34)S/(32)S) and minor ((33)S/(32)S, (36)S/(32)S) sulfur isotope fractionations imparted by a central enzyme in the energy metabolism of sulfate reducers, dissimilatory sulfite reductase (DsrAB). Results from in vitro sulfite reduction experiments allow us to calculate the in vitro DsrAB isotope effect in (34)S/(32)S (hereafter, [Formula: see text]) to be 15.3 ± 2‰, 2σ. The accompanying minor isotope effect in (33)S, described as [Formula: see text], is calculated to be 0.5150 ± 0.0012, 2σ. These observations facilitate a rigorous evaluation of the isotopic fractionation associated with the dissimilatory MSR pathway, as well as of the environmental variables that govern the overall magnitude of fractionation by natural communities of sulfate reducers. The isotope effect induced by DsrAB upon sulfite reduction is a factor of 0.3-0.6 times prior indirect estimates, which have ranged from 25 to 53‰ in (34)εDsrAB. The minor isotope fractionation observed from DsrAB is consistent with a kinetic or equilibrium effect. Our in vitro constraints on the magnitude of [Formula: see text] is similar to the median value of experimental observations compiled from all known published work, where (34)ε r-p = 16.1‰ (r-p indicates reactant vs. product, n = 648). This value closely matches those of MSR operating at high sulfate reduction rates in both laboratory chemostat experiments ([Formula: see text] 17.3 ± 1.5‰, 2σ) and in modern marine sediments ([Formula: see text] 17.3 ± 3.8‰). Targeting the direct isotopic consequences of a specific enzymatic processes is a fundamental step toward a biochemical foundation for reinterpreting the

  20. Sulfur Isotope Effects of Dissimilatory Sulfite Reductase

    PubMed Central

    Leavitt, William D.; Bradley, Alexander S.; Santos, André A.; Pereira, Inês A. C.; Johnston, David T.


    The precise interpretation of environmental sulfur isotope records requires a quantitative understanding of the biochemical controls on sulfur isotope fractionation by the principle isotope-fractionating process within the S cycle, microbial sulfate reduction (MSR). Here we provide the only direct observation of the major (34S/32S) and minor (33S/32S, 36S/32S) sulfur isotope fractionations imparted by a central enzyme in the energy metabolism of sulfate reducers, dissimilatory sulfite reductase (DsrAB). Results from in vitro sulfite reduction experiments allow us to calculate the in vitro DsrAB isotope effect in 34S/32S (hereafter, 34εDsrAB) to be 15.3 ± 2‰, 2σ. The accompanying minor isotope effect in 33S, described as 33λDsrAB, is calculated to be 0.5150 ± 0.0012, 2σ. These observations facilitate a rigorous evaluation of the isotopic fractionation associated with the dissimilatory MSR pathway, as well as of the environmental variables that govern the overall magnitude of fractionation by natural communities of sulfate reducers. The isotope effect induced by DsrAB upon sulfite reduction is a factor of 0.3–0.6 times prior indirect estimates, which have ranged from 25 to 53‰ in 34εDsrAB. The minor isotope fractionation observed from DsrAB is consistent with a kinetic or equilibrium effect. Our in vitro constraints on the magnitude of 34εDsrAB is similar to the median value of experimental observations compiled from all known published work, where 34εr−p = 16.1‰ (r–p indicates reactant vs. product, n = 648). This value closely matches those of MSR operating at high sulfate reduction rates in both laboratory chemostat experiments (34εSO4−H2S =  17.3 ± 1.5‰, 2σ) and in modern marine sediments (34εSO4−H2S =  17.3 ± 3.8‰). Targeting the direct isotopic consequences of a specific enzymatic processes is a fundamental step toward a biochemical foundation for reinterpreting the biogeochemical and geobiological sulfur isotope records in

  1. Tsc10p and FVT1: topologically distinct short-chain reductases required for long-chain base synthesis in yeast and mammals.


    Gupta, Sita D; Gable, Kenneth; Han, Gongshe; Borovitskaya, Anna; Selby, Luke; Dunn, Teresa M; Harmon, Jeffrey M


    In yeast, Tsc10p catalyzes reduction of 3-ketosphinganine to dihydrosphingosine. In mammals, it has been proposed that this reaction is catalyzed by FVT1, which despite limited homology and a different predicted topology, can replace Tsc10p in yeast. Silencing of FVT1 revealed a direct correlation between FVT1 levels and reductase activity, showing that FVT1 is the principal 3-ketosphinganine reductase in mammalian cells. Localization and topology studies identified an N-terminal membrane-spanning domain in FVT1 (absent in Tsc10p) oriented to place it in the endoplasmic reticulum (ER) lumen. In contrast, protease digestion studies showed that the N terminus of Tsc10p is cytoplasmic. Fusion of the N-terminal domain of FVT1 to green fluorescent protein directed the fusion protein to the ER, demonstrating that it is sufficient for targeting. Although both proteins have two predicted transmembrane domains C-terminal to a cytoplasmic catalytic domain, neither had an identifiable lumenal loop. Nevertheless, both Tsc10p and the residual fragment of FVT1 produced by removal of the N-terminal domain with factor Xa protease behave as integral membrane proteins. In addition to their topological differences, mutation of conserved catalytic residues had different effects on the activities of the two enzymes. Thus, while FVT1 can replace Tsc10p in yeast, there are substantial differences between the two enzymes that may be important for regulation of sphingolipid biosynthesis in higher eukaryotes.

  2. Tsc10p and FVT1: topologically distinct short-chain reductases required for long-chain base synthesis in yeast and mammals

    PubMed Central

    Gupta, Sita D.; Gable, Kenneth; Han, Gongshe; Borovitskaya, Anna; Selby, Luke; Dunn, Teresa M.; Harmon, Jeffrey M.


    In yeast, Tsc10p catalyzes reduction of 3-ketosphinganine to dihydrosphingosine. In mammals, it has been proposed that this reaction is catalyzed by FVT1, which despite limited homology and a different predicted topology, can replace Tsc10p in yeast. Silencing of FVT1 revealed a direct correlation between FVT1 levels and reductase activity, showing that FVT1 is the principal 3-ketosphinganine reductase in mammalian cells. Localization and topology studies identified an N-terminal membrane-spanning domain in FVT1 (absent in Tsc10p) oriented to place it in the endoplasmic reticulum (ER) lumen. In contrast, protease digestion studies showed that the N terminus of Tsc10p is cytoplasmic. Fusion of the N-terminal domain of FVT1 to green fluorescent protein directed the fusion protein to the ER, demonstrating that it is sufficient for targeting. Although both proteins have two predicted transmembrane domains C-terminal to a cytoplasmic catalytic domain, neither had an identifiable lumenal loop. Nevertheless, both Tsc10p and the residual fragment of FVT1 produced by removal of the N-terminal domain with factor Xa protease behave as integral membrane proteins. In addition to their topological differences, mutation of conserved catalytic residues had different effects on the activities of the two enzymes. Thus, while FVT1 can replace Tsc10p in yeast, there are substantial differences between the two enzymes that may be important for regulation of sphingolipid biosynthesis in higher eukaryotes. PMID:19141869

  3. ALSEP termination report

    NASA Technical Reports Server (NTRS)

    Bates, J. R.; Lauderdale, W. W.; Kernaghan, H.


    The Apollo Lunar Surface Experiments Package (ALSEP) final report was prepared when support operations were terminated September 30, 1977, and NASA discontinued the receiving and processing of scientific data transmitted from equipment deployed on the lunar surface. The ALSEP experiments (Apollo 11 to Apollo 17) are described and pertinent operational history is given for each experiment. The ALSEP data processing and distribution are described together with an extensive discussion on archiving. Engineering closeout tests and results are given, and the status and configuration of the experiments at termination are documented. Significant science findings are summarized by selected investigators. Significant operational data and recommendations are also included.

  4. Electrical termination techniques

    NASA Technical Reports Server (NTRS)

    Oakey, W. E.; Schleicher, R. R.


    A technical review of high reliability electrical terminations for electronic equipment was made. Seven techniques were selected from this review for further investigation, experimental work, and preliminary testing. From the preliminary test results, four techniques were selected for final testing and evaluation. These four were: (1) induction soldering, (2) wire wrap, (3) percussive arc welding, and (4) resistance welding. Of these four, induction soldering was selected as the best technique in terms of minimizing operator errors, controlling temperature and time, minimizing joint contamination, and ultimately producing a reliable, uniform, and reusable electrical termination.

  5. Do cytochromes function as oxygen sensors in the regulation of nitrate reductase biosynthesis?

    PubMed Central

    MacGregor, C H; Bishop, C W


    The observation that oxygen represses nitrate reductase biosynthesis in a hemA mutant grown aerobically with or without delta-aminolevulinic acid indicates that cytochromes are not responsible for nitrate reductase repression in aerobically grown cells. PMID:326768

  6. Studies on the regulation of assimilatory nitrate reductase in Ankistrodesmus braunii.


    Diez, J; Chaparro, A; Vega, J M; Relimpio, A


    In the green alga Ankistrodesmus braunii, all the activities associated with the nitrate reductase complex (i.e., NAD(P)H-nitrate reductase, NAD(P)H-cytochrome c reductase and FMNH2-or MVH-nitrate reductase) are nutritionally repressed by ammonia or methylamine. Besides, ammonia or methylamine promote in vivo the reversible inactivation of nitrate reductase, but not of NAD(P)H-cytochrome c reductase. Subsequent removal of the inactivating agent from the medium causes reactivation of the inactive enzyme. Menadione has a striking stimulation on the in vivo reactivation of the inactive enzyme. The nitrate reductase activities, but not the diaphorase activity, can be inactivated in vitro by preincubating a partially purified enzyme preparation with NADH or NADPH. ADP, in the presence of Mg(2+), presents a cooperative effect with NADH in the in vitro inactivation of nitrate reductase. This effect appears to be maximum at a concentration of ADP equimolecular with that of NADH.

  7. Structure and dynamics of a compact state of a multidomain protein, the mercuric ion reductase

    SciTech Connect

    Hong, Liang; Sharp, Melissa A.; Poblete, Simon; Biehle, Ralf; Zamponi, Michaela; Szekely, Noemi; Appavou, Marie -Sousai; Winkler, Roland G.; Nauss, Rachel E.; Johs, Alexander; Parks, Jerry M.; Yi, Zheng; Cheng, Xiaolin; Liang, Liyuan; Ohl, Michael; Miller, Susan M.; Richter, Dieter; Gompper, Gerhard; Smith, Jeremy C.


    Here, the functional efficacy of colocalized, linked protein domains is dependent on linker flexibility and system compaction. However, the detailed characterization of these properties in aqueous solution presents an enduring challenge. Here, we employ a novel, to our knowledge, combination of complementary techniques, including small-angle neutron scattering, neutron spin-echo spectroscopy, and all-atom molecular dynamics and coarse-grained simulation, to identify and characterize in detail the structure and dynamics of a compact form of mercuric ion reductase (MerA), an enzyme central to bacterial mercury resistance. MerA possesses metallochaperone-like N-terminal domains (NmerA) tethered to its catalytic core domain by linkers. The NmerA domains are found to interact principally through electrostatic interactions with the core, leashed by the linkers so as to subdiffuse on the surface over an area close to the core C-terminal Hg(II)-binding cysteines. How this compact, dynamical arrangement may facilitate delivery of Hg(II) from NmerA to the core domain is discussed.

  8. Structure and Dynamics of a Compact State of a Multidomain Protein, the Mercuric Ion Reductase

    PubMed Central

    Hong, Liang; Sharp, Melissa A.; Poblete, Simón; Biehl, Ralf; Zamponi, Michaela; Szekely, Noemi; Appavou, Marie-Sousai; Winkler, Roland G.; Nauss, Rachel E.; Johs, Alexander; Parks, Jerry M.; Yi, Zheng; Cheng, Xiaolin; Liang, Liyuan; Ohl, Michael; Miller, Susan M.; Richter, Dieter; Gompper, Gerhard; Smith, Jeremy C.


    The functional efficacy of colocalized, linked protein domains is dependent on linker flexibility and system compaction. However, the detailed characterization of these properties in aqueous solution presents an enduring challenge. Here, we employ a novel, to our knowledge, combination of complementary techniques, including small-angle neutron scattering, neutron spin-echo spectroscopy, and all-atom molecular dynamics and coarse-grained simulation, to identify and characterize in detail the structure and dynamics of a compact form of mercuric ion reductase (MerA), an enzyme central to bacterial mercury resistance. MerA possesses metallochaperone-like N-terminal domains (NmerA) tethered to its catalytic core domain by linkers. The NmerA domains are found to interact principally through electrostatic interactions with the core, leashed by the linkers so as to subdiffuse on the surface over an area close to the core C-terminal Hg(II)-binding cysteines. How this compact, dynamical arrangement may facilitate delivery of Hg(II) from NmerA to the core domain is discussed. PMID:25028881

  9. The structural basis for peptidomimetic inhibition of eukaryotic ribonucleotide reductase: a conformationally flexible pharmacophore.


    Xu, Hai; Fairman, James W; Wijerathna, Sanath R; Kreischer, Nathan R; LaMacchia, John; Helmbrecht, Elizabeth; Cooperman, Barry S; Dealwis, Chris


    Eukaryotic ribonucleotide reductase (RR) catalyzes nucleoside diphosphate conversion to deoxynucleoside diphosphate. Crucial for rapidly dividing cells, RR is a target for cancer therapy. RR activity requires formation of a complex between subunits R1 and R2 in which the R2 C-terminal peptide binds to R1. Here we report crystal structures of heterocomplexes containing mammalian R2 C-terminal heptapeptide, P7 (Ac-1FTLDADF7) and its peptidomimetic P6 (1Fmoc(Me)PhgLDChaDF7) bound to Saccharomyces cerevisiae R1 (ScR1). P7 and P6, both of which inhibit ScRR, each bind at two contiguous sites containing residues that are highly conserved among eukaryotes. Such binding is quite distinct from that reported for prokaryotes. The Fmoc group in P6 peptide makes several hydrophobic interactions that contribute to its enhanced potency in binding to ScR1. Combining all of our results, we observe three distinct conformations for peptide binding to ScR1. These structures provide pharmacophores for designing highly potent nonpeptide class I RR inhibitors.

  10. The Structural Basis for Peptidomimetic Inhibition of Eukaryotic Ribonucleotide Reductase: A Conformationally Flexible Pharmacophore

    SciTech Connect

    Xu, Hai; Fairman, James W.; Wijerathna, Sanath R.; Kreischer, Nathan R.; LaMacchia, John; Helmbrecht, Elizabeth; Cooperman, Barry S.; Dealwis, Chris


    Eukaryotic ribonucleotide reductase (RR) catalyzes nucleoside diphosphate conversion to deoxynucleoside diphosphate. Crucial for rapidly dividing cells, RR is a target for cancer therapy. RR activity requires formation of a complex between subunits R1 and R2 in which the R2 C-terminal peptide binds to R1. Here we report crystal structures of heterocomplexes containing mammalian R2 C-terminal heptapeptide, P7 (Ac-{sup 1}FTLDADF{sup 7}) and its peptidomimetic P6 ({sup 1}Fmoc(Me)PhgLDChaDF{sup 7}) bound to Saccharomyces cerevisiae R1 (ScR1). P7 and P6, both of which inhibit ScRR, each bind at two contiguous sites containing residues that are highly conserved among eukaryotes. Such binding is quite distinct from that reported for prokaryotes. The Fmoc group in P6 peptide makes several hydrophobic interactions that contribute to its enhanced potency in binding to ScR1. Combining all of our results, we observe three distinct conformations for peptide binding to ScR1. These structures provide pharmacophores for designing highly potent nonpeptide class I RR inhibitors.

  11. Studies on the Mechanism of p-Hydroxyphenylacetate 3-Hydroxylase from Pseudomonas aeruginosa – a System Composed of a Small Flavin Reductase and a Large Flavin-Dependent Oxygenase

    PubMed Central

    Chakraborty, Sumita; Ortiz-Maldonado, Mariliz; Entsch, Barrie; Ballou, David P.


    There are two known types of microbial two-component flavin-dependent monooxygenases that catalyze oxygenation of p-hydroxyphenylacetate (HPA), and they are distinguished by having structurally distinct reductases and oxygenases. This paper presents a detailed analysis of the properties of the enzyme from Pseudomonas aeruginosa, an example of one group, and compares its properties to those published for the Acinetobacter baumannii enzyme, an example of the alternative group. The reductase and oxygenase from P. aeruginosa were expressed in Escherichia coli. The reductase was purified as a stable C-terminal His-tagged yellow protein containing weakly bound FAD, and the oxygenase was purified as a stable colorless N-terminal His-tagged protein. The reductase catalyzes the reduction of FAD by NADH and releases the FADH− product into solution, but unlike the reductase from A. baumannii, this catalysis is not influenced by HPA. The oxygenase binds the released FADH− and catalyzes the oxygenation of HPA to form 3,4-dihydroxyphenylacetate, after which the FAD dissociates to be re-reduced by the reductase, a common overall pattern for two-component flavin-dependent oxygenases. With this system, it appears that interactions between the reductase and the oxygenase can facillitate the transfer of FADH− to the oxygenase, although they are not required. We show that the P. aeruginosa oxygenase system in complex with FADH− reacts with O2 to form a quasi-stable, unusually high-extinction flavin hydroperoxide species that binds HPA and reacts to form the product. The resultant flavin hydroxide decomposes to FAD and water while still bound to the oxygenase, and then releases product and FAD from the protein. Unlike the enzyme from A. baumannii, during normal catalysis involving both the reductase and oxygenase, the rate-determining step in catalysis is the dissociation of FAD from the oxygenase in a process that is independent of the concentration of HPA. Structures for the

  12. Modeling Terminal Velocity

    ERIC Educational Resources Information Center

    Brand, Neal; Quintanilla, John A.


    Using a simultaneously falling softball as a stopwatch, the terminal velocity of a whiffle ball can be obtained to surprisingly high accuracy with only common household equipment. This classroom activity engages students in an apparently daunting task that nevertheless is tractable, using a simple model and mathematical techniques at their…

  13. Settings for Terminal Care.

    ERIC Educational Resources Information Center

    Corless, Inge B.


    Examines topics related to delivery of terminal care services: ability of various hospice programs to survive financially, contributions of various models of hospice care, impact of Medicare legislation on hospice movement, demonstration of unique hospice intervention, integration of spiritual care into hospice, and role of hospice in care of…

  14. Trauma and termination.


    Ferraro, F


    The author suggests a particular reading of the thesis put forward by Freud in 'Analysis terminable and interminable' that an effective and more definitive conclusion may be expected in analyses of cases with traumatic aetiology. This reading shifts the emphasis from the patient's history to the possibility of its crystallising in focal nuclei emerging within the analytic relationship under the pressure of the termination. The revival of separation anxieties which cannot be worked through, and their crystallisation in precipitating traumatic events, may give rise to decisive psychic work allowing the analysis to be brought to a conclusion. Two case histories are presented to show how the end of the analysis assumes the form of a new trauma, which reactivates in the present, traumatic anxieties from the patient's own infantile history. In the first case a premature birth and in the second a miscarriage, originally experienced as isolated automatic events without time or history, are relived in the terminal phase as vicissitudes of the transference, so that new meaning can be assigned to them and they can be withdrawn from the somatic cycle of repetition. The powerful tendency to act out and the intense countertransference pressure on the analyst are discussed in the light of the specificities of this phase, which is crucial to the success of the analysis. This leads to a re-examination, in the concluding notes, of some theoretical questions inherent in the problem of the termination and, in particular, to a discussion of the ambiguous concept of a natural ending.

  15. Modeling Terminal Velocity

    ERIC Educational Resources Information Center

    Brand, Neal; Quintanilla, John A.


    Using a simultaneously falling softball as a stopwatch, the terminal velocity of a whiffle ball can be obtained to surprisingly high accuracy with only common household equipment. This classroom activity engages students in an apparently daunting task that nevertheless is tractable, using a simple model and mathematical techniques at their…

  16. Shipboard regasification terminal

    SciTech Connect

    Campbell, G.; Zednik, J.


    Mobil Technology Company and Mobil Shipping and Transportation Company have jointly developed a new combination of existing proven equipment to regasify LNG. Advantages of this Shipboard Regasification Terminal (SRT) include accelerated initial gas delivery schedule, low capital cost, delivery of smaller quantities of LNG at a competitive price and shorter term of LNG purchase and improved financing options. These advantages benefit both the supplier of LNG and the purchaser. SRT can be used as an interim supply to developing markets allowing the demand to grow while developing downstream infrastructure. This concept does not involve offshore transfer of cryogenic fluids while delivering near-ambient temperature pipeline quality gas at typical pipeline pressures. During times when gas is not required, the SRT ship can easily be returned to the trade of transporting and delivering LNG to conventional land based terminals. This paper will discuss the merits of Shipboard Regasification Terminals in general, cover the development of this concept and review the factors guiding the use of SRT vs. an onshore terminal.

  17. Prematurely terminated slug tests

    SciTech Connect

    Karasaki, K. )


    A solution of the well response to a prematurely terminated slug test (PTST) is presented. The advantages of a PTST over conventional slug tests are discussed. A systematized procedure of a PTST is proposed, where a slug test is terminated in the midpoint of the flow point, and the subsequent shut-in data is recorded and analyzed. This method requires a downhole shut-in device and a pressure transducer, which is no more than the conventional deep-well slug testing. As opposed to slug tests, which are ineffective when a skin is present, more accurate estimate of formation permeability can be made using a PTST. Premature termination also shortens the test duration considerably. Because in most cases no more information is gained by completing a slug test to the end, the author recommends that conventional slug tests be replaced by the premature termination technique. This study is part of an investigation of the feasibility of geologic isolation of nuclear wastes being carried out by the US Department of Energy and the National Cooperative for the Storage of Radioactive Waste of Switzerland.

  18. Iron-sulfur cluster biosynthesis: functional characterization of the N- and C-terminal domains of human NFU.


    Liu, Yushi; Qi, Wenbin; Cowan, J A


    Human NFU (also known as HIRIP5) has been implicated in cellular iron-sulfur cluster biosynthesis. Bacterial and yeast forms are smaller than the human protein and are homologous to the C-terminal domain of the latter. This C-terminal domain contains a pair of redox active cysteines and demonstrates thioredoxin-like activity by mediating persulfide bond cleavage of sulfur-loaded NifS (an IscS-type protein), the sulfide donor for [2Fe-2S] cluster assembly on ISU-type scaffold proteins. Herein, the affinity of full-length human NFU and the individual N- and C-terminal domains for sulfide donor and cluster scaffold proteins is assessed. The influence of the N-terminal domain on C-terminal NFU binding to NifS and persulfide reductase activity is also examined. Only the C-terminal domain is required for persulfide reductase activity, while complex formation of NifS with full-length NFU is similar to that of the C-terminal domain alone (K(D) approximately 9.7 +/- 0.7 and 10.1 +/- 0.6 microM, respectively). There is negligible affinity between the isolated C- and N-terminal domains, while the N-terminal domain has negligible affinity for either sulfide donor or cluster scaffold proteins. The temperature dependence of the binding enthalpy for formation of the complex between NifS and the C-terminal domain of NFU yields a change in molar heat capacity (DeltaC(p) approximately 138 cal mol(-1) K(-1)) that suggests bonding at the protein-protein interface is dominated by electrostatic interactions. This is consistent with electrostatic potential maps for bacterial homologues of the N- and C-terminal domains of human NFU, which most likely reflect the structural characteristics expected for full-length human NFU.

  19. NPOESS Field Terminal Updates

    NASA Astrophysics Data System (ADS)

    Heckmann, G.; Route, G.


    The National Oceanic and Atmospheric Administration (NOAA), Department of Defense (DoD), and National Aeronautics and Space Administration (NASA) are jointly acquiring the next-generation weather and environmental satellite system; the National Polar-orbiting Operational Environmental Satellite System (NPOESS). NPOESS replaces the current Polar-orbiting Operational Environmental Satellites (POES) managed by NOAA and the Defense Meteorological Satellite Program (DMSP) managed by the DoD. The NPOESS satellites carry a suite of sensors that collect meteorological, oceanographic, climatological, and solar-geophysical observations of the earth, atmosphere, and space. The ground data processing segment for NPOESS is the Interface Data Processing Segment (IDPS), developed by Raytheon Intelligence and Information Systems. The IDPS processes NPOESS satellite data to provide environmental data products (aka, Environmental Data Records or EDRs) to NOAA and DoD processing centers operated by the United States government. The IDPS will process EDRs beginning with the NPOESS Preparatory Project (NPP) and continuing through the lifetime of the NPOESS system. IDPS also provides the software and requirements for the Field Terminal Segment (FTS). NPOESS provides support to deployed field terminals by providing mission data in the Low Rate and High Rate downlinks (LRD/HRD), mission support data needed to generate EDRs and decryption keys needed to decrypt mission data during Selective data Encryption (SDE). Mission support data consists of globally relevant data, geographically constrained data, and two line element sets. NPOESS provides these mission support data via the Internet accessible Mission Support Data Server and HRD/LRD downlinks. This presentation will illustrate and describe the NPOESS capabilities in support of Field Terminal users. This discussion will include the mission support data available to Field Terminal users, content of the direct broadcast HRD and LRD


    PubMed Central

    Ghiretti, F.; Ghiretti-Magaldi, Anna; Tosi, Luisa


    The classic spectrophotometric method for identification and characterization of respiratory enzymes has been used for the study of the cytochrome system of Aplysia. Particles have been prepared from the buccal mass and the gizzard muscles. Difference spectra taken on isolated particle suspensions show the presence of a complete cytochrome system composed of five components: cytochrome a, b, c, c1, and a3. As indicated by the peaks of the sharp absorption bands of their reduced forms, they are very similar to the cytochromes of mammals and yeast. Cytochrome a3 has been identified as the terminal oxidase of Aplysia muscle by means of the spectrophotometric study of its carbon monoxide compound. Further evidence for the presence of a cytochrome system in Aplysia was obtained by assays of the catalytic activities of the isolated particles: succinic dehydrogenase, cytochrome oxidase, DPNH cytochrome c reductase. The cytochrome oxidase activity was strongly inhibited by carbon monoxide in the dark; the inhibition was totally relieved by light. Cytochrome c has been extracted and purified from muscle tissue. Its spectrum is almost identical with that of the mammalian pigment both in the oxidized and reduced forms. From the hepatopancreas a new respiratory enzyme has been extracted which has many physical and chemical properties in common with cytochrome h from terrestrial snails. PMID:13664920

  1. Characterisation and expression analysis of a nitrate transporter and nitrite reductase genes, two members of a gene cluster for nitrate assimilation from the symbiotic basidiomycete Hebeloma cylindrosporum.


    Jargeat, Patricia; Rekangalt, David; Verner, Marie-Christine; Gay, Gilles; Debaud, Jean-Claude; Marmeisse, Roland; Fraissinet-Tachet, Laurence


    Symbiotic ectomycorrhizal fungi contribute to the nitrogen nutrition of their host-plants but little information is available on the molecular control of their nitrogen metabolism. We cloned and characterised genes encoding a nitrite reductase and a nitrate transporter in the ectomycorrhizal basidiomycete Hebeloma cylindrosporum. These two genes are divergently transcribed and linked to a previously cloned nitrate reductase gene, thus demonstrating that nitrate assimilation gene clusters occur in homobasidiomycetes. The nitrate transporter polypeptide (NRT2) is characterised by 12 transmembrane domains and presents both a long putative intracellular loop and a short C-terminal tail, two structural features which distinguish fungal high-affinity transporters from their plant homologues. In different wild-type genetic backgrounds, transcription of the two genes was repressed by ammonium and was strongly stimulated not only in the presence of nitrate but also in the presence of organic nitrogen sources or under nitrogen deficiency.

  2. Dihydrofolate Reductase Activity in Strains of Streptococcus faecium var. durans Resistant to Methasquin and Amethopterin1

    PubMed Central

    Rader, Jeanne I.; Hutchison, Dorris J.


    Resistance to the antifolates methasquin and amethopterin has been studied in new strains of Streptococcus faecium var. durans. Two methasquin-resistant strains (SF/MQ, SF/MQT) and an amethopterin-resistant strain (SF/AM) were selected independently from the wild-type S. faecium var. durans (SF/O). SF/MQT is a thymine auxotroph. Total dihydrofolate reductase activity was elevated in each of the resistant strains. The greatest increase (36-fold) was observed in extracts of SF/AM. The methasquin-resistant strains, SF/MQ and SF/MQT, had 29-fold and 8-fold, respectively, more dihydrofolate reductase activity than the parental strain. Total dihydrofolate reductase activity of SF/O was separable by gel filtration into two components: a folate reductase (11%) and a specific dihydrofolate reductase (89%). Folate reductase activity was associated with 88% of the total dihydrofolate reductase activity of SF/MQT, with specific dihydrofolate reductase activity accounting for the remaining 12%. In SF/MQ and SF/AM, folate reductase activity was associated with 97% of the total dihydrofolate reductase activity. Studies of the inhibition by methasquin and amethopterin of partially purified folate reductase and specific dihydrofolate reductase of the mutant strains suggested that resistance was not accompanied by changes in the affinities of these enzymes for either antifolate. PMID:4401600

  3. A single mRNA, transcribed from an alternative, erythroid-specific, promoter, codes for two non-myristylated forms of NADH-cytochrome b5 reductase

    PubMed Central


    Two forms of NADH-cytochrome b5 reductase are produced from one gene: a myristylated membrane-bound enzyme, expressed in all tissues, and a soluble, erythrocyte-specific, isoform. The two forms are identical in a large cytoplasmic domain (Mr approximately 30,000) and differ at the NH2-terminus, which, in the membrane form, is responsible for binding to the bilayer, and which contains the myristylation consensus sequence and an additional 14 uncharged amino acids. To investigate how the two differently targeted forms of the reductase are produced, we cloned a reductase transcript from reticulocytes, and studied its relationship to the previously cloned liver cDNA. The reticulocyte transcript differs from the liver transcript in the 5' non-coding portion and at the beginning of the coding portion, where the seven codons specifying the myristoylation consensus are replaced by a reticulocyte-specific sequence which codes for 13 non-charged amino acids. Analysis of genomic reductase clones indicated that the ubiquitous transcript is generated from an upstream "housekeeping" type promoter, while the reticulocyte transcript originates from a downstream, erythroid- specific, promoter. In vitro translation of the reticulocyte-specific mRNA generated two products: a minor one originating from the first AUG, and a major one starting from a downstream AUG, as indicated by mutational analysis. Both the AUGs used as initiation codons were in an unfavorable sequence context. The major, lower relative molecular mass product behaved as a soluble protein, while the NH2-terminally extended minor product interacted with microsomes in vitro. The generation of soluble reductase from a downstream AUG was confirmed in vivo, in Xenopus oocytes. Thus, differently localized products, with respect both to tissues and to subcellular compartments, are generated from the same gene by a combination of transcriptional and translational mechanisms. PMID:1577871

  4. Spectroscopic and kinetic properties of a recombinant form of the flavin domain of spinach NADH: nitrate reductase.


    Quinn, G B; Trimboli, A J; Prosser, I M; Barber, M J


    The C-terminal 268 residues of the spinach assimilatory NADH:nitrate reductase amino acid sequence that correspond to the flavin-containing domain of the enzyme have been selectively amplified and expressed as a recombinant protein in Escherichia coli. The recombinant protein, which was produced in both soluble and insoluble forms, was purified to homogeneity using a combination of ammonium sulfate precipitation, affinity chromatography on 5'-ADP-agarose and FPLC gel filtration. The purified domain exhibited a molecular weight of approximately 30 kDa, estimated by polyacrylamide gel electrophoresis, and a molecular mass of 30,169 for the apoprotein determined by mass spectrometry, which also confirmed the presence of FAD. The UV/visible spectrum was typical of a flavoprotein, with maxima at 272, 386, and 461 nm in the oxidized form while CD spectroscopy yielded both positive and negative maxima at 313 and 382 nm and 461 and 484 nm, respectively. The purified domain showed immunological cross-reactivity with anti-spinach nitrate reductase polyclonal antibodies while both N-terminal and internal amino acid sequencing of isolated peptides confirmed the fidelity of the domain's primary sequence. The protein retained NADH-ferricyanide reductase activity (Vmax=84 micromol NADH consumer/min/nmol FAD) with Km's of 17 and 34 microM for NADH and ferricyanide, respectively, with a pH optimum of approximately 6.5 A variety of NADH-analogs could also function as electron donors, though with decreased efficiency, the most effective being reduced nicotinamide hypoxanthine dinucleotide (V(max) = 35 micromol NHDH consumer/min/nmol FAD) and Km = 22 microM). NAD+ was demonstrated to be a competitive inhibitor (Ki = 1.9 mM) while analysis of inhibition by a variety of NAD+-analogs indicated the most efficient inhibitor to be ADP (Ki = 0.2 mM), with analogs devoid of either the phosphate, ribose, or adenine moieties proving to be markedly less-efficient inhibitors. The isolated domain

  5. Induced fit and equilibrium dynamics for high catalytic efficiency in ferredoxin-NADP(H) reductases.


    Paladini, Darío H; Musumeci, Matías A; Carrillo, Néstor; Ceccarelli, Eduardo A


    Ferredoxin-NADP(H) reductase (FNR) is a FAD-containing protein that catalyzes the reversible transfer of electrons between NADP(H) and ferredoxin or flavodoxin. This enzyme participates in the redox-based metabolism of plastids, mitochondria, and bacteria. Plastidic plant-type FNRs are very efficient reductases in supporting photosynthesis. They have a strong preference for NADP(H) over NAD(H), consistent with the main physiological role of NADP(+) photoreduction. In contrast, FNRs from organisms with heterotrophic metabolisms or anoxygenic photosynthesis display turnover rates that are up to 100-fold lower than those of their plastidic and cyanobacterial counterparts. With the aim of elucidating the mechanisms by which plastidic enzymes achieve such high catalytic efficiencies and NADP(H) specificity, we investigated the manner in which the NADP(H) nicotinamide enters and properly binds to the catalytic site. Analyzing the interaction of different nucleotides, substrate analogues, and aromatic compounds with the wild type and the mutant Y308S-FNR from pea, we found that the interaction of the 2'-P-AMP moiety from NADP(+) induces a change that favors the interaction of the nicotinamide, thereby facilitating the catalytic process. Furthermore, the main role of the terminal tyrosine, Y308, is to destabilize the interaction of the nicotinamide with the enzyme, inducing product release and favoring discrimination of the nucleotide substrate. We determined that this function can be replaced by the addition of aromatic compounds that freely diffuse in solution and establish a dynamic equilibrium, reversing the effect of the mutation in the Y308S-FNR mutant.

  6. LuxG is a functioning flavin reductase for bacterial luminescence.


    Nijvipakul, Sarayut; Wongratana, Janewit; Suadee, Chutintorn; Entsch, Barrie; Ballou, David P; Chaiyen, Pimchai


    The luxG gene is part of the lux operon of marine luminous bacteria. luxG has been proposed to be a flavin reductase that supplies reduced flavin mononucleotide (FMN) for bacterial luminescence. However, this role has never been established because the gene product has not been successfully expressed and characterized. In this study, luxG from Photobacterium leiognathi TH1 was cloned and expressed in Escherichia coli in both native and C-terminal His6-tagged forms. Sequence analysis indicates that the protein consists of 237 amino acids, corresponding to a subunit molecular mass of 26.3 kDa. Both expressed forms of LuxG were purified to homogeneity, and their biochemical properties were characterized. Purified LuxG is homodimeric and has no bound prosthetic group. The enzyme can catalyze oxidation of NADH in the presence of free flavin, indicating that it can function as a flavin reductase in luminous bacteria. NADPH can also be used as a reducing substrate for the LuxG reaction, but with much less efficiency than NADH. With NADH and FMN as substrates, a Lineweaver-Burk plot revealed a series of convergent lines characteristic of a ternary-complex kinetic model. From steady-state kinetics data at 4 degrees C pH 8.0, Km for NADH, Km for FMN, and kcat were calculated to be 15.1 microM, 2.7 microM, and 1.7 s(-1), respectively. Coupled assays between LuxG and luciferases from P. leiognathi TH1 and Vibrio campbellii also showed that LuxG could supply FMNH- for light emission in vitro. A luxG gene knockout mutant of P. leiognathi TH1 exhibited a much dimmer luminescent phenotype compared to the native P. leiognathi TH1, implying that LuxG is the most significant source of FMNH- for the luminescence reaction in vivo.

  7. Physical interaction between human ribonucleotide reductase large subunit and thioredoxin increases colorectal cancer malignancy.


    Lou, Meng; Liu, Qian; Ren, Guoping; Zeng, Jiling; Xiang, Xueping; Ding, Yongfeng; Lin, Qinghui; Zhong, Tingting; Liu, Xia; Zhu, Lijun; Qi, Hongyan; Shen, Jing; Li, Haoran; Shao, Jimin


    Ribonucleotide reductase (RR) is the rate-limiting enzyme in DNA synthesis by catalyzing the reduction of ribonucleotides to deoxyribonucleotides. During each enzymatic turnover, reduction of the active site disulfide in the catalytic large subunit is performed by a pair of shuttle cysteine residues in its C-terminal tail. Thioredoxin (Trx) and Glutaredoxin (Grx) are ubiquitous redox proteins, catalyzing thiol-disulfide exchange reactions. Here, immunohistochemical examination of clinical colorectal cancer (CRC) specimens revealed that human thioredoxin1 (hTrx1), but not human glutaredoxin1 (hGrx1), was upregulated along with human RR large subunit (RRM1) in cancer tissues, and the expression levels of both proteins were correlated with cancer malignancy stage. Ectopically expressed hTrx1 significantly increased RR activity, DNA synthesis, and cell proliferation and migration. Importantly, inhibition of both hTrx1 and RRM1 produced a synergistic anti-cancer effect in CRC cells and xenograft mice. Furthermore, hTrx1 rather than hGrx1 was the efficient reductase for RRM1 regeneration. We also observed a direct protein-protein interaction between RRM1 and hTrx1 in CRC cells. Interestingly, besides the known two conserved cysteines, a third one (Cys779) in the RRM1 C-terminus was essential for RRM1 regeneration and binding to hTrx1, while both Cys32 and Cys35 in hTrx1 played a counterpart role. Our findings suggest that the upregulated RRM1 and hTrx1 in CRC directly interact with each other and promote RR activity, resulting in enhanced DNA synthesis and cancer malignancy. We propose that the RRM1-hTrx1 interaction might be a novel potential therapeutic target for cancer treatment.

  8. Indolin-2-one compounds targeting thioredoxin reductase as potential anticancer drug leads

    PubMed Central

    Kaminska, Kamila K.; Bertrand, Helene C.; Tajima, Hisashi; Stafford, William C.; Cheng, Qing; Chen, Wan; Wells, Geoffrey; Arner, Elias S.J.; Chew, Eng-Hui


    Several compounds bearing the indolinone chemical scaffold are known to possess anticancer properties. For example, the tyrosine kinase inhibitor sunitinib is an arylideneindolin-2-one compound. The chemical versatility associated with structural modifications of indolinone compounds underlies the potential to discover additional derivatives possessing anticancer properties. Previously synthesized 3-(2-oxoethylidene)indolin-2-one compounds, also known as supercinnamaldehyde (SCA) compounds in reference to the parent compound 1 [1-methyl-3(2-oxopropylidene)indolin-2-one], bear a nitrogen-linked α,β-unsaturated carbonyl (Michael acceptor) moiety. Here we found that analogs bearing N-substituents, in particular compound 4 and 5 carrying an N-butyl and N-benzyl substituent, respectively, were strongly cytotoxic towards human HCT 116 colorectal and MCF-7 breast carcinoma cells. These compounds also displayed strong thioredoxin reductase (TrxR) inhibitory activity that was likely attributed to the electrophilicity of the Michael acceptor moiety. Their selectivity towards cellular TrxR inhibition over related antioxidant enzymes glutathione reductase (GR), thioredoxin (Trx) and glutathione peroxidase (GPx) was mediated through targeting of the selenocysteine (Sec) residue in the highly accessible C-terminal active site of TrxR. TrxR inhibition mediated by indolin-2-one compounds led to cellular Trx oxidation, increased oxidative stress and activation of apoptosis signal-regulating kinase 1 (ASK1). These events also led to activation of p38 and JNK mitogen-activated protein kinase (MAPK) signaling pathways, and cell death with apoptotic features of PARP cleavage and caspase 3 activation. In conclusion, these results suggest that indolin-2-one-based compounds specifically targeting TrxR may serve as novel drug leads for anticancer therapy. PMID:27244886

  9. The crystal structure of maleylacetate reductase from Rhizobium sp. strain MTP-10005 provides insights into the reaction mechanism of enzymes in its original family.


    Fujii, Tomomi; Sato, Ai; Okamoto, Yuko; Yamauchi, Takae; Kato, Shiro; Yoshida, Masahiro; Oikawa, Tadao; Hata, Yasuo


    Maleylacetate reductase plays a crucial role in catabolism of resorcinol by catalyzing the NAD(P)H-dependent reduction of maleylacetate, at a carbon-carbon double bond, to 3-oxoadipate. The crystal structure of maleylacetate reductase from Rhizobium sp. strain MTP-10005, GraC, has been elucidated by the X-ray diffraction method at 1.5 Å resolution. GraC is a homodimer, and each subunit consists of two domains: an N-terminal NADH-binding domain adopting an α/β structure and a C-terminal functional domain adopting an α-helical structure. Such structural features show similarity to those of the two existing families of enzymes in dehydroquinate synthase-like superfamily. However, GraC is distinct in dimer formation and activity expression mechanism from the families of enzymes. Two subunits in GraC have different structures from each other in the present crystal. One subunit has several ligands mimicking NADH and the substrate in the cleft and adopts a closed domain arrangement. In contrast, the other subunit does not contain any ligand causing structural changes and adopts an open domain arrangement. The structure of GraC reveals those of maleylacetate reductase both in the coenzyme, substrate-binding state and in the ligand-free state. The comparison of both subunit structures reveals a conformational change of the Tyr326 loop for interaction with His243 on ligand binding. Structures of related enzymes suggest that His243 is likely a catalytic residue of GraC. Mutational analyses of His243 and Tyr326 support the catalytic roles proposed from structural information. The crystal structure of GraC characterizes the maleylacetate reductase family as a third family in the dehydroquinate synthase-like superfamily. Proteins 2016; 84:1029-1042. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.


    EPA Science Inventory


    S. Lin1, L. M. Del Razo1, M. Styblo1, C. Wang2, W. R. Cullen2, and D.J. Thomas3. 1Univ. North Carolina, Chapel Hill, NC; 2Univ. British Columbia, Vancouver, BC, Canada; 3National Health and En...

  11. 21 CFR 864.7375 - Glutathione reductase assay.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Glutathione reductase assay. 864.7375 Section 864.7375 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7375...

  12. 21 CFR 864.7375 - Glutathione reductase assay.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Glutathione reductase assay. 864.7375 Section 864.7375 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7375 Glutathione...

  13. 21 CFR 864.7375 - Glutathione reductase assay.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Glutathione reductase assay. 864.7375 Section 864.7375 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7375 Glutathione...

  14. 21 CFR 864.7375 - Glutathione reductase assay.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Glutathione reductase assay. 864.7375 Section 864.7375 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7375 Glutathione...

  15. 21 CFR 864.7375 - Glutathione reductase assay.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Glutathione reductase assay. 864.7375 Section 864.7375 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7375 Glutathione...

  16. Obtaining partial purified xylose reductase from Candida guilliermondii

    PubMed Central

    Tomotani, Ester Junko; de Arruda, Priscila Vaz; Vitolo, Michele; de Almeida Felipe, Maria das Graças


    The enzymatic bioconversion of xylose into xylitol by xylose reductase (XR) is an alternative for chemical and microbiological processes. The partial purified XR was obtained by using the following three procedures: an agarose column, a membrane reactor or an Amicon Ultra-15 50K Centrifugal Filter device at yields of 40%, 7% and 67%, respectively. PMID:24031408

  17. A detoxifying oxygen reductase in the anaerobic protozoan Entamoeba histolytica.


    Vicente, João B; Tran, Vy; Pinto, Liliana; Teixeira, Miguel; Singh, Upinder


    We report the characterization of a bacterial-type oxygen reductase abundant in the cytoplasm of the anaerobic protozoan parasite Entamoeba histolytica. Upon host infection, E. histolytica is confronted with various oxygen tensions in the host intestine, as well as increased reactive oxygen and nitrogen species at the site of local tissue inflammation. Resistance to oxygen-derived stress thus plays an important role in the pathogenic potential of E. histolytica. The genome of E. histolytica has four genes that encode flavodiiron proteins, which are bacterial-type oxygen or nitric oxide reductases and were likely acquired by lateral gene transfer from prokaryotes. The EhFdp1 gene has higher expression in virulent than in nonvirulent Entamoeba strains and species, hinting that the response to oxidative stress may be one correlate of virulence potential. We demonstrate that EhFdp1 is abundantly expressed in the cytoplasm of E. histolytica and that the protein levels are markedly increased (up to ~5-fold) upon oxygen exposure. Additionally, we produced fully functional recombinant EhFdp1 and demonstrated that this enzyme is a specific and robust oxygen reductase but has poor nitric oxide reductase activity. This observation represents a new mechanism of oxygen resistance in the anaerobic protozoan pathogen E. histolytica.

  18. The arsenic hyperaccumulating Pteris vittata expresses two arsenate reductases.


    Cesaro, Patrizia; Cattaneo, Chiara; Bona, Elisa; Berta, Graziella; Cavaletto, Maria


    Enzymatic reduction of arsenate to arsenite is the first known step in arsenate metabolism in all organisms. Although the presence of one mRNA arsenate reductase (PvACR2) has been characterized in gametophytes of P. vittata, no arsenate reductase protein has been directly observed in this arsenic hyperaccumulating fern, yet. In order to assess the possible presence of arsenate reductase in P. vittata, two recombinant proteins, ACR2-His6 and Trx-His6-S-Pv2.5-8 were prepared in Escherichia coli, purified and used to produce polyclonal antibodies. The presence of these two enzymes was evaluated by qRT-PCR, immunoblotting and direct MS analysis. Enzymatic activity was detected in crude extracts. For the first time we detected and identified two arsenate reductase proteins (PvACR2 and Pv2.5-8) in sporophytes and gametophytes of P. vittata. Despite an increase of the mRNA levels for both proteins in roots, no difference was observed at the protein level after arsenic treatment. Overall, our data demonstrate the constitutive protein expression of PvACR2 and Pv2.5-8 in P. vittata tissues and propose their specific role in the complex metabolic network of arsenic reduction.

  19. Dissimilatory Nitrite Reductase Genes from Autotrophic Ammonia-Oxidizing Bacteria

    PubMed Central

    Casciotti, Karen L.; Ward, Bess B.


    The presence of a copper-containing dissimilatory nitrite reductase gene (nirK) was discovered in several isolates of β-subdivision ammonia-oxidizing bacteria using PCR and DNA sequencing. PCR primers Cunir3 and Cunir4 were designed based on published nirK sequences from denitrifying bacteria and used to amplify a 540-bp fragment of the nirK gene from Nitrosomonas marina and five additional isolates of ammonia-oxidizing bacteria. Amplification products of the expected size were cloned and sequenced. Alignment of the nucleic acid and deduced amino acid (AA) sequences shows significant similarity (62 to 75% DNA, 58 to 76% AA) between nitrite reductases present in these nitrifiers and the copper-containing nitrite reductase found in classic heterotrophic denitrifiers. While the presence of a nitrite reductase in Nitrosomonas europaea is known from early biochemical work, preliminary sequence data from its genome indicate a rather low similarity to the denitrifier nirKs. Phylogenetic analysis of the partial nitrifier nirK sequences indicates that the topology of the nirK tree corresponds to the 16S rRNA and amoA trees. While the role of nitrite reduction in the metabolism of nitrifying bacteria is still uncertain, these data show that the nirK gene is present in closely related nitrifying isolates from many oceanographic regions and suggest that nirK sequences retrieved from the environment may include sequences from ammonia-oxidizing bacteria. PMID:11319103

  20. The arsenic hyperaccumulating Pteris vittata expresses two arsenate reductases

    PubMed Central

    Cesaro, Patrizia; Cattaneo, Chiara; Bona, Elisa; Berta, Graziella; Cavaletto, Maria


    Enzymatic reduction of arsenate to arsenite is the first known step in arsenate metabolism in all organisms. Although the presence of one mRNA arsenate reductase (PvACR2) has been characterized in gametophytes of P. vittata, no arsenate reductase protein has been directly observed in this arsenic hyperaccumulating fern, yet. In order to assess the possible presence of arsenate reductase in P. vittata, two recombinant proteins, ACR2-His6 and Trx-His6-S-Pv2.5–8 were prepared in Escherichia coli, purified and used to produce polyclonal antibodies. The presence of these two enzymes was evaluated by qRT-PCR, immunoblotting and direct MS analysis. Enzymatic activity was detected in crude extracts. For the first time we detected and identified two arsenate reductase proteins (PvACR2 and Pv2.5–8) in sporophytes and gametophytes of P. vittata. Despite an increase of the mRNA levels for both proteins in roots, no difference was observed at the protein level after arsenic treatment. Overall, our data demonstrate the constitutive protein expression of PvACR2 and Pv2.5–8 in P. vittata tissues and propose their specific role in the complex metabolic network of arsenic reduction. PMID:26412036


    EPA Science Inventory


    S. Lin1, L. M. Del Razo1, M. Styblo1, C. Wang2, W. R. Cullen2, and D.J. Thomas3. 1Univ. North Carolina, Chapel Hill, NC; 2Univ. British Columbia, Vancouver, BC, Canada; 3National Health and En...

  2. The Kinetics and Inhibition of the Enzyme Methemoglobin Reductase

    ERIC Educational Resources Information Center

    Splittgerber, A. G.; And Others


    Describes an undergraduate biochemistry experiment which involves the preparation and kinetics of an oxidation-reduction enzyme system, methemoglobin reductase. A crude enzyme extract is prepared and assayed spectrophotometrically. The enzyme system obeys Michaelis-Menton kinetics with respect to both substrate and the NADH cofactor. (MLH)

  3. Dihydrofolate reductase: A potential drug target in trypanosomes and leishmania

    NASA Astrophysics Data System (ADS)

    Zuccotto, Fabio; Martin, Andrew C. R.; Laskowski, Roman A.; Thornton, Janet M.; Gilbert, Ian H.


    Dihydrofolate reductase has successfully been used as a drug target in the area of anti-cancer, anti-bacterial and anti-malarial chemotherapy. Little has been done to evaluate it as a drug target for treatment of the trypanosomiases and leishmaniasis. A crystal structure of Leishmania major dihydrofolate reductase has been published. In this paper, we describe the modelling of Trypanosoma cruzi and Trypanosoma brucei dihydrofolate reductases based on this crystal structure. These structures and models have been used in the comparison of protozoan, bacterial and human enzymes in order to highlight the different features that can be used in the design of selective anti-protozoan agents. Comparison has been made between residues present in the active site, the accessibility of these residues, charge distribution in the active site, and the shape and size of the active sites. Whilst there is a high degree of similarity between protozoan, human and bacterial dihydrofolate reductase active sites, there are differences that provide potential for selective drug design. In particular, we have identified a set of residues which may be important for selective drug design and identified a larger binding pocket in the protozoan than the human and bacterial enzymes.

  4. Studies on Marek's Disease Virus Encoded Ribonucleotide Reductase

    USDA-ARS?s Scientific Manuscript database

    Ribonucleotide reductase (RR) is an essential enzyme for the conversion of ribonucleotides to deoxyribonucleotides in prokaryotic and eukaryotic cells. The enzyme consists of two subunits namely RR1 and RR2, both of which associate to form an active holoenzyme. Herpesviruses express a functional R...

  5. [Malate oxidation by mitochondrial succinate:ubiquinone-reductase].


    Belikova, Iu O; Kotliar, A B


    Succinate:ubiquinone reductase was shown to catalyze the oxidation of L- and D-stereoisomers of malate by artificial electron acceptors and ubiquinone. The rate of malate oxidation by succinate:ubiquinone reductase is by two orders of magnitude lower than that for the natural substrate--succinate. The values of kinetic constants for the oxidation of D- and L-stereoisomers of malate are equal to: V infinity = 0.1 mumol/min/mg protein, Km = 2 mM and V infinity = 0.05 mumol/min/mg protein, Km = 2 mM, respectively. The malate dehydrogenase activity is fully inhibited by the inhibitors of the dicarboxylate-binding site of the enzyme, i.e., N-ethylmaleimide and malonate and is practically insensitive to carboxin, a specific inhibitor of the ubiquinone-binding center. The enol form of oxaloacetate was shown to be the product of malate oxidation by succinate:ubiquinone reductase. The kinetics of inhibition of the enzyme activity by the ketone and enol forms of oxaloacetate was studied. Both forms of oxaloacetate effectively inhibit the succinate:ubiquinone reductase reaction.

  6. Molecular genetics of steroid 5 alpha-reductase 2 deficiency.

    PubMed Central

    Thigpen, A E; Davis, D L; Milatovich, A; Mendonca, B B; Imperato-McGinley, J; Griffin, J E; Francke, U; Wilson, J D; Russell, D W


    Two isozymes of steroid 5 alpha-reductase encoded by separate loci catalyze the conversion of testosterone to dihydrotestosterone. Inherited defects in the type 2 isozyme lead to male pseudohermaphroditism in which affected males have a normal internal urogenital tract but external genitalia resembling those of a female. The 5 alpha-reductase type 2 gene (gene symbol SRD5A2) was cloned and shown to contain five exons and four introns. The gene was localized to chromosome 2 band p23 by somatic cell hybrid mapping and chromosomal in situ hybridization. Molecular analysis of the SRD5A2 gene resulted in the identification of 18 mutations in 11 homozygotes, 6 compound heterozygotes, and 4 inferred compound heterozygotes from 23 families with 5 alpha-reductase deficiency. 6 apparent recurrent mutations were detected in 19 different ethnic backgrounds. In two patients, the catalytic efficiency of the mutant enzymes correlated with the severity of the disease. The high proportion of compound heterozygotes suggests that the carrier frequency of mutations in the 5 alpha-reductase type 2 gene may be higher than previously thought. Images PMID:1522235

  7. Molybdenum-containing nitrite reductases: Spectroscopic characterization and redox mechanism.


    Wang, Jun; Keceli, Gizem; Cao, Rui; Su, Jiangtao; Mi, Zhiyuan


    This review summarizes the spectroscopic results, which will provide useful suggestions for future research. In addition, the fields that urgently need more information are also advised. Nitrite-NO-cGMP has been considered as an important signaling pathway of NO in human cells. To date, all the four known human molybdenum-containing enzymes, xanthine oxidase, aldehyde oxidase, sulfite oxidase, and mitochondrial amidoxime-reducing component, have been shown to function as nitrite reductases under hypoxia by biochemical, cellular, or animal studies. Various spectroscopic techniques have been applied to investigate the structure and catalytic mechanism of these enzymes for more than 20 years. We summarize the published data on the applications of UV-vis and EPR spectroscopies, and X-ray crystallography in studying nitrite reductase activity of the four human molybdenum-containing enzymes. UV-vis has provided useful information on the redox active centers of these enzymes. The utilization of EPR spectroscopy has been critical in determining the coordination and redox status of the Mo center during catalysis. Despite the lack of substrate-bound crystal structures of these nitrite reductases, valuable structural information has been obtained by X-ray crystallography. To fully understand the catalytic mechanisms of these physiologically/pathologically important nitrite reductases, structural studies on substrate-redox center interaction are needed.

  8. The Kinetics and Inhibition of the Enzyme Methemoglobin Reductase

    ERIC Educational Resources Information Center

    Splittgerber, A. G.; And Others


    Describes an undergraduate biochemistry experiment which involves the preparation and kinetics of an oxidation-reduction enzyme system, methemoglobin reductase. A crude enzyme extract is prepared and assayed spectrophotometrically. The enzyme system obeys Michaelis-Menton kinetics with respect to both substrate and the NADH cofactor. (MLH)

  9. Thioredoxin and NADP-thioredoxin reductase from cultured carrot cells

    NASA Technical Reports Server (NTRS)

    Johnson, T. C.; Cao, R. Q.; Kung, J. E.; Buchanan, B. B.


    Dark-grown carrot (Daucus carota L.) tissue cultures were found to contain both protein components of the NADP/thioredoxin system--NADP-thioredoxin reductase and the thioredoxin characteristic of heterotrophic systems, thioredoxin h. Thioredoxin h was purified to apparent homogeneity and, like typical bacterial counterparts, was a 12-kdalton (kDa) acidic protein capable of activating chloroplast NADP-malate dehydrogenase (EC more effectively than fructose-1,6-bisphosphatase (EC NADP-thioredoxin reductase (EC was partially purified and found to be an arsenite-sensitive enzyme composed of two 34-kDa subunits. Carrot NADP-thioredoxin reductase resembled more closely its counterpart from bacteria rather than animal cells in acceptor (thioredoxin) specificity. Upon greening of the cells, the content of NADP-thioredoxin-reductase activity, and, to a lesser extent, thioredoxin h decreased. The results confirm the presence of a heterotrophic-type thioredoxin system in plant cells and raise the question of its physiological function.

  10. 5. cap alpha. -reductase activity in rat adipose tissue

    SciTech Connect

    Zyirek, M.; Flood, C.; Longcope, C.


    We measured the 5 ..cap alpha..-reductase activity in isolated cell preparations of rat adipose tissue using the formation of (/sup 3/H) dihydrotestosterone from (/sup 3/H) testosterone as an endpoint. Stromal cells were prepared from the epididymal fat pad, perinephric fat, and subcutaneous fat of male rats and from perinephric fat of female rats. Adipocytes were prepared from the epididymal fat pad and perinephric fat of male rats. Stromal cells from the epididymal fat pad and perinephric fat contained greater 5..cap alpha..-reductase activity than did the adipocytes from these depots. Stromal cells from the epididymal fat pad contained greater activity than those from perinephric and subcutaneous depots. Perinephric stromal cells from female rats were slightly more active than those from male rats. Estradiol (10/sup -8/ M), when added to the medium, caused a 90% decrease in 5..cap alpha..-reductase activity. Aromatase activity was minimal, several orders of magnitude less than 5..cap alpha..-reductase activity in each tissue studied.

  11. Characterization of mitochondrial thioredoxin reductase from C. elegans

    SciTech Connect

    Lacey, Brian M.; Hondal, Robert J. . E-mail:


    Thioredoxin reductase catalyzes the NADPH-dependent reduction of the catalytic disulfide bond of thioredoxin. In mammals and other higher eukaryotes, thioredoxin reductases contain the rare amino acid selenocysteine at the active site. The mitochondrial enzyme from Caenorhabditis elegans, however, contains a cysteine residue in place of selenocysteine. The mitochondrial C. elegans thioredoxin reductase was cloned from an expressed sequence tag and then produced in Escherichia coli as an intein-fusion protein. The purified recombinant enzyme has a k {sub cat} of 610 min{sup -1} and a K {sub m} of 610 {mu}M using E. coli thioredoxin as substrate. The reported k {sub cat} is 25% of the k {sub cat} of the mammalian enzyme and is 43-fold higher than a cysteine mutant of mammalian thioredoxin reductase. The enzyme would reduce selenocysteine, but not hydrogen peroxide or insulin. The flanking glycine residues of the GCCG motif were mutated to serine. The mutants improved substrate binding, but decreased the catalytic rate.

  12. The arsenic hyperaccumulating Pteris vittata expresses two arsenate reductases

    NASA Astrophysics Data System (ADS)

    Cesaro, Patrizia; Cattaneo, Chiara; Bona, Elisa; Berta, Graziella; Cavaletto, Maria


    Enzymatic reduction of arsenate to arsenite is the first known step in arsenate metabolism in all organisms. Although the presence of one mRNA arsenate reductase (PvACR2) has been characterized in gametophytes of P. vittata, no arsenate reductase protein has been directly observed in this arsenic hyperaccumulating fern, yet. In order to assess the possible presence of arsenate reductase in P. vittata, two recombinant proteins, ACR2-His6 and Trx-His6-S-Pv2.5-8 were prepared in Escherichia coli, purified and used to produce polyclonal antibodies. The presence of these two enzymes was evaluated by qRT-PCR, immunoblotting and direct MS analysis. Enzymatic activity was detected in crude extracts. For the first time we detected and identified two arsenate reductase proteins (PvACR2 and Pv2.5-8) in sporophytes and gametophytes of P. vittata. Despite an increase of the mRNA levels for both proteins in roots, no difference was observed at the protein level after arsenic treatment. Overall, our data demonstrate the constitutive protein expression of PvACR2 and Pv2.5-8 in P. vittata tissues and propose their specific role in the complex metabolic network of arsenic reduction.

  13. [Inhibition of aldose reductase by Chinese herbal medicine].


    Mao, X M; Zhang, J Q


    Seven Chinese herbal drugs were screened for experimental inhibition of lens aldose reductase activity, among which quercetin exhibited potent enzyme-inhibitory activities in vitro. Its IC50 value was 3.44 x 10(-7) mol/L. It may be helpful in the prophylaxis and treatment of diabetic complications.

  14. Thioredoxin and NADP-thioredoxin reductase from cultured carrot cells

    NASA Technical Reports Server (NTRS)

    Johnson, T. C.; Cao, R. Q.; Kung, J. E.; Buchanan, B. B.


    Dark-grown carrot (Daucus carota L.) tissue cultures were found to contain both protein components of the NADP/thioredoxin system--NADP-thioredoxin reductase and the thioredoxin characteristic of heterotrophic systems, thioredoxin h. Thioredoxin h was purified to apparent homogeneity and, like typical bacterial counterparts, was a 12-kdalton (kDa) acidic protein capable of activating chloroplast NADP-malate dehydrogenase (EC more effectively than fructose-1,6-bisphosphatase (EC NADP-thioredoxin reductase (EC was partially purified and found to be an arsenite-sensitive enzyme composed of two 34-kDa subunits. Carrot NADP-thioredoxin reductase resembled more closely its counterpart from bacteria rather than animal cells in acceptor (thioredoxin) specificity. Upon greening of the cells, the content of NADP-thioredoxin-reductase activity, and, to a lesser extent, thioredoxin h decreased. The results confirm the presence of a heterotrophic-type thioredoxin system in plant cells and raise the question of its physiological function.

  15. The polymorphisms in methylenetetrahydrofolate reductase, methionine synthase, methionine synthase reductase, and the risk of colorectal cancer.


    Zhou, Daijun; Mei, Qiang; Luo, Han; Tang, Bo; Yu, Peiwu


    Polymorphisms in genes involved in folate metabolism may modulate the risk of colorectal cancer (CRC), but data from published studies are conflicting. The current meta-analysis was performed to address a more accurate estimation. A total of 41 (17,552 cases and 26,238 controls), 24(8,263 cases and 12,033 controls), 12(3,758 cases and 5,646 controls), and 13 (5,511 cases and 7,265 controls) studies were finally included for the association between methylenetetrahydrofolate reductase (MTHFR) C677T and A1289C, methione synthase reductase (MTRR) A66G, methionine synthase (MTR) A2756G polymorphisms and the risk of CRC, respectively. The data showed that the MTHFR 677T allele was significantly associated with reduced risk of CRC (OR = 0.93, 95%CI 0.90-0.96), while the MTRR 66G allele was significantly associated with increased risk of CRC (OR = 1.11, 95%CI 1.01-1.18). Sub-group analysis by ethnicity revealed that MTHFR C677T polymorphism was significantly associated with reduced risk of CRC in Asians (OR = 0.80, 95%CI 0.72-0.89) and Caucasians (OR = 0.84, 95%CI 0.76-0.93) in recessive genetic model, while the MTRR 66GG genotype was found to significantly increase the risk of CRC in Caucasians (GG vs. AA: OR = 1.18, 95%CI 1.03-1.36). No significant association was found between MTHFR A1298C and MTR A2756G polymorphisms and the risk of CRC. Cumulative meta-analysis showed no particular time trend existed in the summary estimate. Probability of publication bias was low across all comparisons illustrated by the funnel plots and Egger's test. Collectively, this meta-analysis suggested that MTHFR 677T allele might provide protection against CRC in worldwide populations, while MTRR 66G allele might increase the risk of CRC in Caucasians. Since potential confounders could not be ruled out completely, further studies were needed to confirm these results.

  16. The Polymorphisms in Methylenetetrahydrofolate Reductase, Methionine Synthase, Methionine Synthase Reductase, and the Risk of Colorectal Cancer

    PubMed Central

    Zhou, Daijun; Mei, Qiang; Luo, Han; Tang, Bo; Yu, Peiwu


    Polymorphisms in genes involved in folate metabolism may modulate the risk of colorectal cancer (CRC), but data from published studies are conflicting. The current meta-analysis was performed to address a more accurate estimation. A total of 41 (17,552 cases and 26,238 controls), 24(8,263 cases and 12,033 controls), 12(3,758 cases and 5,646 controls), and 13 (5,511 cases and 7,265 controls) studies were finally included for the association between methylenetetrahydrofolate reductase (MTHFR) C677T and A1289C, methione synthase reductase (MTRR) A66G, methionine synthase (MTR) A2756G polymorphisms and the risk of CRC, respectively. The data showed that the MTHFR 677T allele was significantly associated with reduced risk of CRC (OR = 0.93, 95%CI 0.90-0.96), while the MTRR 66G allele was significantly associated with increased risk of CRC (OR = 1.11, 95%CI 1.01-1.18). Sub-group analysis by ethnicity revealed that MTHFR C677T polymorphism was significantly associated with reduced risk of CRC in Asians (OR = 0.80, 95%CI 0.72-0.89) and Caucasians (OR = 0.84, 95%CI 0.76-0.93) in recessive genetic model, while the MTRR 66GG genotype was found to significantly increase the risk of CRC in Caucasians (GG vs. AA: OR = 1.18, 95%CI 1.03-1.36). No significant association was found between MTHFR A1298C and MTR A2756G polymorphisms and the risk of CRC. Cumulative meta-analysis showed no particular time trend existed in the summary estimate. Probability of publication bias was low across all comparisons illustrated by the funnel plots and Egger's test. Collectively, this meta-analysis suggested that MTHFR 677T allele might provide protection against CRC in worldwide populations, while MTRR 66G allele might increase the risk of CRC in Caucasians. Since potential confounders could not be ruled out completely, further studies were needed to confirm these results. PMID:22719222

  17. Essential role of the flexible linker on the conformational equilibrium of bacterial peroxiredoxin reductase for effective regeneration of peroxiredoxin.


    Kamariah, Neelagandan; Eisenhaber, Birgit; Eisenhaber, Frank; Gruber, Gerhard


    Reactive oxygen species (ROS) can damage DNA, proteins, and lipids, so cells have antioxidant systems that regulate ROS. In many bacteria, a dedicated peroxiredoxin reductase, alkyl hydroperoxide reductase subunit F (AhpF), catalyzes the rapid reduction of the redox-active disulfide center of the antioxidant protein peroxiredoxin (AhpC) to detoxify ROS such as hydrogen peroxide, organic hydroperoxide, and peroxynitrite. AhpF is a flexible multi-domain protein that enables a series of electron transfers among the redox centers by accepting reducing equivalents from NADH. A flexible linker connecting the N-terminal domain (NTD) and C-terminal domain (CTD) of AhpF suggests that the enzyme adopts a large-scale domain motion that alternates between the closed and open states to shuttle electrons from the CTD via the NTD to AhpC. Here, we conducted comprehensive mutational, biochemical, and biophysical analyses to gain insights into the role of the flexible linker and the residues critical for the domain motions of Escherichia coli AhpF (EcAhpF) during electron transfer. Small-angle X-ray scattering studies of linker mutants revealed that a group of charged residues, 200EKR202, is crucial for the swiveling motion of the NTD. Moreover, NADH binding significantly affected EcAhpF flexibility and the movement of the NTD relative to the CTD. The mutants also exhibited a decrease in H2O2 reduction by the AhpF-AhpC ensemble. We propose that a concerted movement involving the NTD, C-terminal NADH and FAD domains, and the flexible linker between them is essential for optimal intra-domain crosstalk and for efficient electron transfer to the redox partner AhpC required for peroxidation.

  18. Graphics Software For VT Terminals

    NASA Technical Reports Server (NTRS)

    Wang, Caroline


    VTGRAPH graphics software tool for DEC/VT computer terminal or terminals compatible with it, widely used by government and industry. Callable in FORTRAN or C language, library program enabling user to cope with many computer environments in which VT terminals used for window management and graphic systems. Provides PLOT10-like package plus color or shade capability for VT240, VT241, and VT300 terminals. User can easily design more-friendly user-interface programs and design PLOT10 programs on VT terminals with different computer systems. Requires ReGis graphics set terminal and FORTRAN compiler.

  19. Comparative Studies on the Induction and Inactivation of Nitrate Reductase in Corn Roots and Leaves 1

    PubMed Central

    Aslam, Muhammad; Oaks, Ann


    A comparison of induction and inactivation of nitrate reductase and two of its component activities, namely FMNH2-nitrate reductase and NO3−-induced NADH-cytochrome c reductase, was made in roots and leaves of corn (Zea mays L. var. W64A × 182E). The three activities were induced in parallel in both tissues when NO3− was supplied. WO4= suppressed the induction of NADH- and FMNH2-nitrate reductase activities in root tips and leaves. The NO3−-induced NADH-cytochrome c reductase activity showed a normal increase in roots treated with WO4=. In leaves, on the other hand, there was a marked superinduction of the NO3−-induced NADH-cytochrome c reductase in the presence of WO4=. The half-life values of NADH-nitrate reductase and FMNH2-nitrate reductase measured by removing NO3− and adding WO4= to the medium, were 4 hours in root tips and 6 hours in excised leaves. Addition of NO3− in the induction medium together with WO4= gave partial protection of NADH-nitrate reductase and FMNH2-nitrate reductase activities in both root tips and leaves with a t0.5 of 6 and 8 hours, respectively. NO3− also reduced the loss of nitrate reductase activity from mature root sections. In the presence of cycloheximide, both NADH-nitrate reductase and NO3−-induced NADH-cytochrome c reductase activities were lost at similar rates in root tips. NO3− protected the loss of NO3−-induced NADH-cytochrome c reductase to the same extent as that of NADH-nitrate reductase. PMID:16659529

  20. Shipboard fisheries management terminals

    NASA Technical Reports Server (NTRS)

    Nagler, R. G.; Sager, E. V.


    The needs of the National Marine Fisheries Service (NMGS), National Weather Service, and the U.S. Coast Guard for locational, biological, and environmental data were assessed. The fisheries conservation zones and the yellowfin tuna jurisdiction of the NMFS operates observer programs on foreign and domestic fishing vessels. Data input terminal and data transfer and processing technology are reviewed to establish available capability. A matrix of implementation options is generated to identify the benefits of each option, and preliminary cost estimates are made. Recommendations are made for incremental application of available off the shelf hardware to obtain improved performance and benefits within a well bounded cost. Terminal recommendations are made for three interdependent shipboard units emphasizing: (1) the determination of location and fishing activity; (2) hand held data inputting and formatting in the fishing work areas; and (3) data manipulation, merging, and editing.

  1. Ice age terminations.


    Cheng, Hai; Edwards, R Lawrence; Broecker, Wallace S; Denton, George H; Kong, Xinggong; Wang, Yongjin; Zhang, Rong; Wang, Xianfeng


    230Th-dated oxygen isotope records of stalagmites from Sanbao Cave, China, characterize Asian Monsoon (AM) precipitation through the ends of the third- and fourthmost recent ice ages. As a result, AM records for the past four glacial terminations can now be precisely correlated with those from ice cores and marine sediments, establishing the timing and sequence of major events. In all four cases, observations are consistent with a classic Northern Hemisphere summer insolation intensity trigger for an initial retreat of northern ice sheets. Meltwater and icebergs entering the North Atlantic alter oceanic and atmospheric circulation and associated fluxes of heat and carbon, causing increases in atmospheric CO2 and Antarctic temperatures that drive the termination in the Southern Hemisphere. Increasing CO2 and summer insolation drive recession of northern ice sheets, with probable positive feedbacks between sea level and CO2.

  2. Mobile Phone Terminal

    NASA Technical Reports Server (NTRS)


    In the photo, an employee of a real estate firm is contacting his office by means of HICOM, an advanced central terminal for mobile telephones. Developed by the Orlando Division of Martin Marietta Aerospace, Orlando, Florida, and manufactured by Harris Corporation's RF Division, Rochester, N.Y., HICOM upgrades service to users, provides better system management to telephone companies, and makes more efficient use of available mobile telephone channels through a computerized central control terminal. The real estate man, for example, was able to dial his office and he could also have direct-dialed a long distance number. Mobile phones in most areas not yet served by HICOM require an operator's assistance for both local and long distance calls. HICOM improves system management by automatically recording information on all calls for accurate billing, running continual performance checks on its own operation, and reporting any malfunctions to a central office.

  3. Dusty Termination Shocks

    SciTech Connect

    Ip, W.H.


    In astrophysical settings, termination shocks where strong stellar wind outflows interact with the surrounding environments tend to take place in dusty regions. Just to name a few, star formation regions, planetary nebulae, supernova remnants and active galactic nuclei are all good examples. Dynamics and evolution of the associated dust clouds could have important influences on the acceleration and composition of energetic particles resulting from the diffusive shock acceleration at the termination shocks. In this note we provide a brief review of previous work predating the recent detection of ACR Mg, Na, Si and S ions which might have originated from the Kuiper belt dust. Their compositional abundance might be diagnostic of the collisional history of the Kupier belt objects.

  4. Flight termination receiver catalog

    NASA Astrophysics Data System (ADS)


    This catalog provides reference information on ultrahigh-frequency flight termination receivers used at various U.S. missile ranges and test facilities. It is not intended to be a comprehensive review of all available flight termination receivers, and inclusion of hardware in this catalog does not constitute approval or endorsement for use at any government installation. Use of a specific receiver at a missile range or test facility requires the approval of the Commander of that installation. Approval for use of a particular receiver on a given missile at one installation does not constitute automatic approval for use of the same receiver on other missiles at the same installation or on the same missile at other installations. The information in this catalog has been extracted from manufacturers' specifications. It is provided as reference material only and is not intended as an endorsement of any model.

  5. Measurement of nitrous oxide reductase activity in aquatic sediments

    SciTech Connect

    Miller, L.G.; Oremland, R.S.; Paulsen, S.


    Denitrification in aquatic sediments was measured by an N/sub 2/O reductase assay. Sediments consumed small added quantities of N/sub 2/O over short periods (a few hours). In experiments with sediment slurries, N/sub 2/O reductase activity was inhibited by 0/sub 2/, C/sub 2/H/sub 2/, heat treatment, and by high levels of nitrate (1 mM) or sulfide (10 mM). However, ambient levels of nitrate (<100 did not influence activity, and moderate levels (about 150 induced only a short lag before reductase activity began. Moderate levels of sulfide (<1 mM) had no effect on N/sub 2/O reductase activity. Nitrous oxide reductase displayed Michaelis-Menten kinetics in sediments from freshwater, estuarine, and alkaline-saline environments. An in situ assay was devised in which a solution of N/sub 2/O was injected into sealed glass cores containing intact sediment. Two estimates of net rates of denitrification in San Francisco Bay under approximated in situ conditions were 0.009 and 0.041 mmol of N/sub 2/O per m/sup 2/ per h. Addition of chlorate to inhibit denitrification in these intact-core experiments (to estimate gross rates of N/sub 2/O consumption) resulted in approximately a 14% upward revision of estimates of net rates. These results were comparable to an in situ estimate of 0.022 mmol of N/sub 2/O per m/sup 2/ per h made with the acetylene block assay.

  6. Measurement of nitrous oxide reductase activity in aquatic sediments

    USGS Publications Warehouse

    Miller, L.G.; Oremland, R.S.; Paulsen, S.


    Denitrification in aquatic sediments was measured by an N2O reductase assay. Sediments consumed small added quantities of N2O over short periods (a few hours). In experiments with sediment slurries, N2O reductase activity was inhibited by O2, C2H2, heat treatment, and by high levels of nitrate (1 mM) or sulfide (10 mM). However, ambient levels of nitrate (<100 μM) did not influence activity, and moderate levels (about 150 μM) induced only a short lag before reductase activity began. Moderate levels of sulfide (<1 mM) had no effect on N2O reductase activity. Nitrous oxide reductase displayed Michaelis-Menten kinetics in sediments from freshwater (Km = 2.17 μM), estuarine (Km = 14.5 μM), and alkaline-saline (Km = 501 μM) environments. An in situ assay was devised in which a solution of N2O was injected into sealed glass cores containing intact sediment. Two estimates of net rates of denitrification in San Francisco Bay under approximated in situ conditions were 0.009 and 0.041 mmol of N2O per m2 per h. Addition of chlorate to inhibit denitrification in these intact-core experiments (to estimate gross rates of N2O consumption) resulted in approximately a 14% upward revision of estimates of net rates. These results were comparable to an in situ estimate of 0.022 mmol of N2O per m2 per h made with the acetylene block assay.

  7. Identification of 5α-reductase isoenzymes in canine skin.


    Bernardi de Souza, Lucilene; Paradis, Manon; Zamberlam, Gustavo; Benoit-Biancamano, Marie-Odile; Price, Christopher


    Alopecia X in dogs is a noninflammatory alopecia that may be caused by a hormonal dysfunction. It may be similar to androgenic alopecia in men that is caused by the effect of dihydrotestosterone (DHT). The 5α-reductase isoenzymes, 5αR1 and 5αR2, and a recently described 5αR3, are responsible for the conversion of testosterone into DHT. However, which 5α-reductases are present in canine skin has not yet been described. The main objective of this study was to determine the pattern of expression of 5α-reductase genes in canine skin. Skin biopsies were obtained from healthy, intact young-mature beagles (three males, four females) at three anatomical sites normally affected by alopecia X (dorsal neck, back of thighs and base of tail) and two sites generally unaffected (dorsal head and ventral thorax). Prostate samples (n = 3) were collected as positive controls for 5α-reductase mRNA abundance measurement by real-time PCR. We detected mRNA encoding 5αR1 and 5αR3 but not 5αR2. There were no significant differences in 5αR1 and 5αR3 mRNA levels between the different anatomical sites, irrespective of gender (P > 0.05). Moreover, the mean mRNA abundance in each anatomical site did not differ between males and females (P > 0.05). To the best of the authors' knowledge, this is the first study demonstrating the expression of 5α-reductases in canine skin and the expression of 5αR3 in this tissue. These results may help to elucidate the pathogenesis of alopecia X and to determine more appropriate treatments for this disorder. © 2015 ESVD and ACVD.

  8. Leukemia L1210 cell lines resistant to ribonucleotide reductase inhibitors.


    Cory, J G; Carter, G L


    Leukemia L1210 cell lines, ED1 and ED2, were generated which were resistant to the cytotoxic effects of deoxyadenosine/erythro-9-(2-hydroxyl-3-nonyl)adenine and deoxyadenosine/erythro-9-(2-hydroxyl-3-nonyl)adenine plus 2,3-dihydro-1H-pyrazole[2,3a]imidazole/Desferal, respectively. The ED1 and ED2 were characterized to show that these cell lines had increased levels of ribonucleotide reductase as measured by CDP reduction. The reductase activity in crude cell-free extracts from the ED1 and ED2 cells was not inhibited by dATP. For CDP reductase, the activation by adenylylimido diphosphate and inhibition by dGTP and dTTP in these extracts from the ED1 and ED2 cells were the same as for the wild-type L1210 cells. The ED1 and ED2 cells were highly cross-resistant, as measured by growth inhibition, to deoxyguanosine/8-aminoguanosine, 2-fluorodeoxyadenosine, and 2-fluoroadenine arabinoside. While the ED2 cells showed resistance to 2,3-dihydro-1H-pyrazole-[2,3a]-imidazole/Desferal (6-fold), the ED1 and ED2 cell lines showed less resistance to hydroxyurea, 4-methyl-5-amino-1-formylisoquinoline thiosemicarbazone, and the dialdehyde of inosine. These data indicate that the mechanisms of resistance to the ribonucleotide reductase inhibitors are related to the increased level of ribonucleotide reductase activity and to the decreased sensitivity of the effector-binding subunit to dATP.

  9. Assimilatory nitrate reductase from the green alga Ankistrodesmus braunii.


    De la Rosa, M A


    Assimilatory nitrate reductase (NAD(P)H-nitrate oxidoreductase, EC from the green alga Ankistrodesmus braunii can be purified to homogeneity by dye-ligand chromatography on blue-Sepharose. The purified enzyme, whose turnover number is 623 s-1, presents an optimum pH of 7.5 and Km values of 13 microM, 23 microM and 0.15 mM for NADH, NADPH and nitrate, respectively. The NADH-nitrate reductase activity exhibits an iso ping pong bi bi kinetic mechanism. The molecular weight of the native nitrate reductase is 467 400, while that of its subunits is 58 750. These values suggest an octameric structure for the enzyme, which has been confirmed by electron microscopy. As deduced from spectrophotometric and fluorimetric studies, the enzyme contains FAD and cytochrome b-557 as prosthetic groups. FAD is not covalently bound to the protein and is easily dissociated in diluted solutions from the enzyme. Its apparent Km value is 4 nM, indicative of a high affinity of the enzyme for FAD. The results of the quantitative analyses of prosthetic groups indicate that nitrate reductase contains four molecules of flavin, four heme irons, and two atoms of molybdenum. The three components act sequentially transferring electrons from reduced pyridine nucleotides to nitrate, thus forming a short electron transport chain along the protein. A mechanism is proposed for the redox interconversion of the nitrate reductase activity. Inactivation seems to occur by formation of a stable complex of reduced enzyme with cyanide or superoxide, while reactivation is a consequence of reoxidation of the inactive enzyme. Both reactions imply the transfer of only one electron.

  10. Treatment of hirsutism with 5 alpha-reductase inhibitors.


    Brooks, J R


    Much os the evidence gathered from studies of 5 alpha-reductase activity levels and androgen metabolism in the skin of hirsute women and the excretion of androgen metabolites by hirsute women indicates that 5 alpha-reduced androgens are probably of primary importance in hirsutism. Unfortunately, until very recently, the lack of a suitable 5 alpha-reductase inhibitor made it very difficult to adequately test the hypothesis that such an inhibitor might be useful in the treatment of hirsutism and certain other androgen-related diseases. No substance was available which had good, unambiguous activity in vivo as a 5 alpha-reductase inhibitor. A number of 4-azasteroids have now been found to possess excellent 5 alpha-reductase inhibitory activity both in vitro and in vivo. Among other properties, several of these compounds show little or no affinity for the androgen receptor of rat prostate cytosol, they attenuate the growth promoting effect of T, but not DHT, on the ventral prostate of castrated male rats, they cause a marked reduction in prostatic DHT concentration in acutely treated rats and dogs and they bring about a significant decline in prostate size in chronically treated rats and dogs. It is expected that, in the near future, one or more of these highly active 5 alpha-reductase inhibitors will be tested in the clinic as a treatment for hirsutism. The results of those studies will be awaited with a great deal of interest since they should considerably advance our understanding of this disease and possibly contribute to its control.

  11. Amine terminated bisaspartimide polymer

    NASA Technical Reports Server (NTRS)

    Kumar, D. (Inventor); Fohlen, G. M. (Inventor); Parker, J. A. (Inventor)


    Novel amine terminated bisaspartimides are prepared by a Michael-type reaction of an aromatic bismalteimide and an aromatic diamine in an aprotic solvent. These bisaspartimides are thermally polymerized to yield tough, resinous polymers cross-lined through -NH- groups. Such polymers are useful in applications requiring materials with resistance to change at elevated temperatures, e.g., as lightweight laminates with graphite cloth, molding material prepregs, adhesives and insulating material.

  12. Remote terminal system evaluation

    NASA Technical Reports Server (NTRS)

    Phillips, T. L.; Grams, H. L.; Lindenlaub, J. C.; Schwingendorf, S. K.; Swain, P. H.; Simmons, W. R.


    An Earth Resources Data Processing System was developed to evaluate the system for training, technology transfer, and data processing. In addition to the five sites included in this project two other sites were connected to the system under separate agreements. The experience of these two sites is discussed. The results of the remote terminal project are documented in seven reports: one from each of the five project sites, Purdue University, and an overview report summarizing the other six reports.

  13. Navy Multiband Terminal (NMT)

    DTIC Science & Technology


    Acquisition Management Information Retrieval Dev Est - Development Estimate DoD - Department of Defense DSN - Defense Switched Network Econ - Economic Eng...Memo Note for Shore (for MTBF and MTBCF): Represents IOT &E and Verification of Correction of Deficiencies testing results; mission impact deemed...insignificant due to multiple terminals at Shore site. Note for Sub (for MTBF, MTBCF and MTTR): Represents IOT &E hours; test duration limit for

  14. Crystal structures of pinoresinol-lariciresinol and phenylcoumaran benzylic ether reductases and their relationship to isoflavone reductases

    NASA Technical Reports Server (NTRS)

    Min, Tongpil; Kasahara, Hiroyuki; Bedgar, Diana L.; Youn, Buhyun; Lawrence, Paulraj K.; Gang, David R.; Halls, Steven C.; Park, HaJeung; Hilsenbeck, Jacqueline L.; Davin, Laurence B.; hide


    Despite the importance of plant lignans and isoflavonoids in human health protection (e.g. for both treatment and prevention of onset of various cancers) as well as in plant biology (e.g. in defense functions and in heartwood development), systematic studies on the enzymes involved in their biosynthesis have only recently begun. In this investigation, three NADPH-dependent aromatic alcohol reductases were comprehensively studied, namely pinoresinol-lariciresinol reductase (PLR), phenylcoumaran benzylic ether reductase (PCBER), and isoflavone reductase (IFR), which are involved in central steps to the various important bioactive lignans and isoflavonoids. Of particular interest was in determining how differing regio- and enantiospecificities are achieved with the different enzymes, despite each apparently going through similar enone intermediates. Initially, the three-dimensional x-ray crystal structures of both PLR_Tp1 and PCBER_Pt1 were solved and refined to 2.5 and 2.2 A resolutions, respectively. Not only do they share high gene sequence similarity, but their structures are similar, having a continuous alpha/beta NADPH-binding domain and a smaller substrate-binding domain. IFR (whose crystal structure is not yet obtained) was also compared (modeled) with PLR and PCBER and was deduced to have the same overall basic structure. The basis for the distinct enantio-specific and regio-specific reactions of PCBER, PLR, and IFR, as well as the reaction mechanism and participating residues involved (as identified by site-directed mutagenesis), are discussed.

  15. Identification and characterization of 2-naphthoyl-coenzyme A reductase, the prototype of a novel class of dearomatizing reductases.


    Eberlein, Christian; Estelmann, Sebastian; Seifert, Jana; von Bergen, Martin; Müller, Michael; Meckenstock, Rainer U; Boll, Matthias


    The enzymatic dearomatization of aromatic ring systems by reduction represents a highly challenging redox reaction in biology and plays a key role in the degradation of aromatic compounds under anoxic conditions. In anaerobic bacteria, most monocyclic aromatic growth substrates are converted to benzoyl-coenzyme A (CoA), which is then dearomatized to a conjugated dienoyl-CoA by ATP-dependent or -independent benzoyl-CoA reductases. It was unresolved whether or not related enzymes are involved in the anaerobic degradation of environmentally relevant polycyclic aromatic hydrocarbons (PAHs). In this work, a previously unknown dearomatizing 2-naphthoyl-CoA reductase was purified from extracts of the naphthalene-degrading, sulphidogenic enrichment culture N47. The oxygen-tolerant enzyme dearomatized the non-activated ring of 2-naphthoyl-CoA by a four-electron reduction to 5,6,7,8-tetrahydro-2-naphthoyl-CoA. The dimeric 150 kDa enzyme complex was composed of a 72 kDa subunit showing sequence similarity to members of the flavin-containing 'old yellow enzyme' family. NCR contained FAD, FMN, and an iron-sulphur cluster as cofactors. Extracts of Escherichia coli expressing the encoding gene catalysed 2-naphthoyl-CoA reduction. The identified NCR is a prototypical enzyme of a previously unknown class of dearomatizing arylcarboxyl-CoA reductases that are involved in anaerobic PAH degradation; it fundamentally differs from known benzoyl-CoA reductases.

  16. Crystal structures of pinoresinol-lariciresinol and phenylcoumaran benzylic ether reductases and their relationship to isoflavone reductases

    NASA Technical Reports Server (NTRS)

    Min, Tongpil; Kasahara, Hiroyuki; Bedgar, Diana L.; Youn, Buhyun; Lawrence, Paulraj K.; Gang, David R.; Halls, Steven C.; Park, HaJeung; Hilsenbeck, Jacqueline L.; Davin, Laurence B.; Lewis, Norman G.; Kang, ChulHee


    Despite the importance of plant lignans and isoflavonoids in human health protection (e.g. for both treatment and prevention of onset of various cancers) as well as in plant biology (e.g. in defense functions and in heartwood development), systematic studies on the enzymes involved in their biosynthesis have only recently begun. In this investigation, three NADPH-dependent aromatic alcohol reductases were comprehensively studied, namely pinoresinol-lariciresinol reductase (PLR), phenylcoumaran benzylic ether reductase (PCBER), and isoflavone reductase (IFR), which are involved in central steps to the various important bioactive lignans and isoflavonoids. Of particular interest was in determining how differing regio- and enantiospecificities are achieved with the different enzymes, despite each apparently going through similar enone intermediates. Initially, the three-dimensional x-ray crystal structures of both PLR_Tp1 and PCBER_Pt1 were solved and refined to 2.5 and 2.2 A resolutions, respectively. Not only do they share high gene sequence similarity, but their structures are similar, having a continuous alpha/beta NADPH-binding domain and a smaller substrate-binding domain. IFR (whose crystal structure is not yet obtained) was also compared (modeled) with PLR and PCBER and was deduced to have the same overall basic structure. The basis for the distinct enantio-specific and regio-specific reactions of PCBER, PLR, and IFR, as well as the reaction mechanism and participating residues involved (as identified by site-directed mutagenesis), are discussed.

  17. Immunological approach to the regulation of nitrate reductase in Monoraphidium braunii.


    Díez, J; López-Ruiz, A


    The effects of different culture conditions on nitrate reductase activity and nitrate reductase protein from Monoraphidium braunii have been studied, using two different immunological techniques, rocket immunoelectrophoresis and an enzyme-linked immunosorbent assay, to determine nitrate reductase protein. The nitrogen sources ammonium and glutamine repressed nitrate reductase synthesis, while nitrite, alanine, and glutamate acted as derepressors. There was a four- to eightfold increase of nitrate reductase activity and a twofold increase of nitrate reductase protein under conditions of nitrogen starvation versus growth on nitrate. Nitrate reductase synthesis was repressed in darkness. However, when Monoraphidium was grown under heterotrophic conditions with glucose as the carbon and energy source, the synthesis of nitrate reductase was maintained. With ammonium or darkness, changes in nitrate reductase activity correlated fairly well with changes in nitrate reductase protein, indicating that in both cases loss of activity was due to repression and not to inactivation of the enzyme. Experiments using methionine sulfoximine, to inhibit ammonium assimilation, showed that ammonium per se and not a product of its metabolism was the corepressor of the enzyme. The appearance of nitrate reductase activity after transferring the cells to induction media was prevented by cycloheximide and by 6-methylpurine, although in this latter case the effect was observed only in cells preincubated with the inhibitor for 1 h before the induction period.

  18. Recominant Pinoresino-Lariciresinol Reductase, Recombinant Dirigent Protein And Methods Of Use


    Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki , Gang; David R. , Sarkanen; Simo , Ford; Joshua D.


    Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided from source species Forsythia intermedia, Thuja plicata, Tsuga heterophylla, Eucommia ulmoides, Linum usitatissimum, and Schisandra chinensis, which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

  19. Recombinant pinoresinol/lariciresinol reductase, recombinant dirigent protein, and methods of use


    Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki; Gang, David R.; Sarkanen, Simo; Ford, Joshua D.


    Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

  20. Eternal inflation with arrival terminals

    NASA Astrophysics Data System (ADS)

    Stoltenberg, Henry; Albrecht, Andreas


    We analyze the cosmological role of terminal vacua in the string theory landscape, and point out that existing work on this topic makes very strong assumptions about the properties of the terminal vacua. We explore the implications of relaxing these assumptions (by including "arrival" as well as "departure" terminals) and demonstrate that the results in earlier work are highly sensitive to their assumption of no arrival terminals. We use our discussion to make some general points about tuning and initial conditions in cosmology.

  1. The Ethics of Terminal Care

    ERIC Educational Resources Information Center

    Agich, George J.


    Need for a critical and analytical approach to ethics of terminal care is suggested by considering a series of unexamined questions regarding justification of terminal care. If terminal care is a moral and ethical enterprise, such considerations must be given a more prominent place in discussions of the hospice movement. (Author)

  2. Platyhelminth mitochondrial and cytosolic redox homeostasis is controlled by a single thioredoxin glutathione reductase and dependent on selenium and glutathione.


    Bonilla, Mariana; Denicola, Ana; Novoselov, Sergey V; Turanov, Anton A; Protasio, Anna; Izmendi, Darwin; Gladyshev, Vadim N; Salinas, Gustavo


    Platyhelminth parasites are a major health problem in developing countries. In contrast to their mammalian hosts, platyhelminth thiol-disulfide redox homeostasis relies on linked thioredoxin-glutathione systems, which are fully dependent on thioredoxin-glutathione reductase (TGR), a promising drug target. TGR is a homodimeric enzyme comprising a glutaredoxin domain and thioredoxin reductase (TR) domains with a C-terminal redox center containing selenocysteine (Sec). In this study, we demonstrate the existence of functional linked thioredoxin-glutathione systems in the cytosolic and mitochondrial compartments of Echinococcus granulosus, the platyhelminth responsible for hydatid disease. The glutathione reductase (GR) activity of TGR exhibited hysteretic behavior regulated by the [GSSG]/[GSH] ratio. This behavior was associated with glutathionylation by GSSG and abolished by deglutathionylation. The K(m) and k(cat) values for mitochondrial and cytosolic thioredoxins (9.5 microm and 131 s(-1), 34 microm and 197 s(-1), respectively) were higher than those reported for mammalian TRs. Analysis of TGR mutants revealed that the glutaredoxin domain is required for the GR activity but did not affect the TR activity. In contrast, both GR and TR activities were dependent on the Sec-containing redox center. The activity loss caused by the Sec-to-Cys mutation could be partially compensated by a Cys-to-Sec mutation of the neighboring residue, indicating that Sec can support catalysis at this alternative position. Consistent with the essential role of TGR in redox control, 2.5 microm auranofin, a known TGR inhibitor, killed larval worms in vitro. These studies establish the selenium- and glutathione-dependent regulation of cytosolic and mitochondrial redox homeostasis through a single TGR enzyme in platyhelminths.

  3. Enzyme phylogenies as markers for the oxidation state of the environment: the case of respiratory arsenate reductase and related enzymes.


    Duval, Simon; Ducluzeau, Anne-Lise; Nitschke, Wolfgang; Schoepp-Cothenet, Barbara


    Phylogenies of certain bioenergetic enzymes have proved to be useful tools for deducing evolutionary ancestry of bioenergetic pathways and their relationship to geochemical parameters of the environment. Our previous phylogenetic analysis of arsenite oxidase, the molybdopterin enzyme responsible for the biological oxidation of arsenite to arsenate, indicated its probable emergence prior to the Archaea/Bacteria split more than 3 billion years ago, in line with the geochemical fact that arsenite was present in biological habitats on the early Earth. Respiratory arsenate reductase (Arr), another molybdopterin enzyme involved in microbial arsenic metabolism, serves as terminal oxidase, and is thus situated at the opposite end of bioenergetic electron transfer chains as compared to arsenite oxidase. The evolutionary history of the Arr-enzyme has not been studied in detail so far. We performed a genomic search of genes related to arrA coding for the molybdopterin subunit. The multiple alignment of the retrieved sequences served to reconstruct a neighbor-joining phylogeny of Arr and closely related enzymes. Our analysis confirmed the previously proposed proximity of Arr to the cluster of polysulfide/thiosulfate reductases but also unravels a hitherto unrecognized clade even more closely related to Arr. The obtained phylogeny strongly suggests that Arr originated after the Bacteria/Archaea divergence in the domain Bacteria, and was subsequently laterally distributed within this domain. It further more indicates that, as a result of accumulation of arsenate in the environment, an enzyme related to polysulfide reductase and not to arsenite oxidase has evolved into Arr. These findings are paleogeochemically rationalized by the fact that the accumulation of arsenate over arsenite required the increase in oxidation state of the environment brought about by oxygenic photosynthesis.

  4. Location of the redox-active thiols of ribonucleotide reductase: sequences similarity between the Escherichia coli and Lactobacillus leichmannii enzymes

    SciTech Connect

    Lin, A.N.I.; Ashley, G.W.; Stubbe, J.


    The redox-active thiols of Escherichia coli ribonucleoside diphosphate reductase and of Lactobacillus leichmannii ribonucleoside triphosphate reductase have been located by a procedure involving (1) prereduction of enzyme with dithiothreitol, (2) specific oxidation of the redox-active thiols by treatment with substrate in the absence of exogenous reductant, (3) alkylation of other thiols with iodoacetamide, and (4) reduction of the disulfides with dithiothreitol and alkylation with (1-/sup 14/C)iodoacetamide. The dithiothreitol-reduce E. coli B1 subunit is able to convert 3 equiv of CDP to dCDP and is labeled with 5.4 equiv of /sup 14/C. Sequencing of tryptic peptides shows that 2.8 equiv of /sup 14/C is on cysteines-752 and -757 at the C-terminus of B1, while 1.0-1.5 equiv of /sup 14/C is on cysteines-222 and -227. It thus appears that two sets of redox-active dithiols are involved in substrate reduction. The L. leichmannii reductase is able to convert 1.1 equiv of CTP to dCTP and is labeled with 2.1 equiv of /sup 14/C. Sequencing of tryptic peptides shows that 1.4 equiv of /sup 14/C is located on the two cysteines of C-E-G-G-A-C-P-I-K. This peptide shows remarkable and unexpected similarity to the thiol-containing region of the C-terminal peptide of E. coli B1, C-E-S-G-A-C-K-I.

  5. The X-ray crystal structure of APR-B, an atypical adenosine 5'-phosphosulfate reductase from Physcomitrella patens.


    Stevenson, Clare E M; Hughes, Richard K; McManus, Michael T; Lawson, David M; Kopriva, Stanislav


    Sulfonucleotide reductases catalyse the first reductive step of sulfate assimilation. Their substrate specificities generally correlate with the requirement for a [Fe4S4] cluster, where adenosine 5'-phosphosulfate (APS) reductases possess a cluster and 3'-phosphoadenosine 5'-phosphosulfate reductases do not. The exception is the APR-B isoform of APS reductase from the moss Physcomitrella patens, which lacks a cluster. The crystal structure of APR-B, the first for a plant sulfonucleotide reductase, is consistent with a preference for APS. Structural conservation with bacterial APS reductase rules out a structural role for the cluster, but supports the contention that it enhances the activity of conventional APS reductases.

  6. Termination of employment.


    Quinlan, P J; Birt, K M


    The following questions and recommendations, taken from Jeffrey Hirsch & William Farrell's Labor and Employment in Rhode Island, provide a synopsis of the basic issues which employers should consider before making a decision to fire an employee: 1. Review all documentation and other company records considered when making the decision. Make sure all stated policies were followed by management. 2. Interview all managers who provided input on the decisions. 3. Be satisfied that the decision was made for the correct reason. 4. Was the employee aware that termination was likely? Can you document that awareness? 5. Was the individual given an opportunity to improve his or her performance? 6. Has the company discharged others for similar reasons in the past? 7. Has the company acted promptly and avoided relying on "stale" offense? 8. Is the employee protected by anti-discrimination statutes? (i.e. race, age, sex, national origin, handicapped or religion)? 9. Meet with the employee personally; do not discharge by phone or letter unless absolutely necessary. 10. Have a "passive" management witness at the meeting. 11. Conduct the meeting in a private area where other employees will not be able to see or hear the discussion. 12. Both the executive and management witness should prepare file memoranda concerning what is said at the discharge meeting. 13. Always tell the employee the reason for her or his discharge. 14. Discuss health insurance continuation (COBRA). 15. Discuss life and disability insurance, and pension/profit sharing status. 16. Discuss other issues, such as references and out placement policies. By taking the time to follow these suggestions and answer these questions, an employer can feel more secure that the termination has been conducted properly, and minimize the chances of becoming implicated in legal action related to the termination.

  7. Terminal weather information management

    NASA Technical Reports Server (NTRS)

    Lee, Alfred T.


    Since the mid-1960's, microburst/windshear events have caused at least 30 aircraft accidents and incidents and have killed more than 600 people in the United States alone. This study evaluated alternative means of alerting an airline crew to the presence of microburst/windshear events in the terminal area. Of particular interest was the relative effectiveness of conventional and data link ground-to-air transmissions of ground-based radar and low-level windshear sensing information on microburst/windshear avoidance. The Advanced Concepts Flight Simulator located at Ames Research Center was employed in a line oriented simulation of a scheduled round-trip airline flight from Salt Lake City to Denver Stapleton Airport. Actual weather en route and in the terminal area was simulated using recorded data. The microburst/windshear incident of July 11, 1988 was re-created for the Denver area operations. Six experienced airline crews currently flying scheduled routes were employed as test subjects for each of three groups: (1) A baseline group which received alerts via conventional air traffic control (ATC) tower transmissions; (2) An experimental group which received alerts/events displayed visually and aurally in the cockpit six miles (approx. 2 min.) from the microburst event; and (3) An additional experimental group received displayed alerts/events 23 linear miles (approx. 7 min.) from the microburst event. Analyses of crew communications and decision times showed a marked improvement in both situation awareness and decision-making with visually displayed ground-based radar information. Substantial reductions in the variability of decision times among crews in the visual display groups were also found. These findings suggest that crew performance will be enhanced and individual differences among crews due to differences in training and prior experience are significantly reduced by providing real-time, graphic display of terminal weather hazards.

  8. Terminal weather information management

    NASA Technical Reports Server (NTRS)

    Lee, Alfred T.


    Since the mid-1960's, microburst/windshear events have caused at least 30 aircraft accidents and incidents and have killed more than 600 people in the United States alone. This study evaluated alternative means of alerting an airline crew to the presence of microburst/windshear events in the terminal area. Of particular interest was the relative effectiveness of conventional and data link ground-to-air transmissions of ground-based radar and low-level windshear sensing information on microburst/windshear avoidance. The Advanced Concepts Flight Simulator located at Ames Research Center was employed in a line oriented simulation of a scheduled round-trip airline flight from Salt Lake City to Denver Stapleton Airport. Actual weather en route and in the terminal area was simulated using recorded data. The microburst/windshear incident of July 11, 1988 was re-created for the Denver area operations. Six experienced airline crews currently flying scheduled routes were employed as test subjects for each of three groups: (1) A baseline group which received alerts via conventional air traffic control (ATC) tower transmissions; (2) An experimental group which received alerts/events displayed visually and aurally in the cockpit six miles (approx. 2 min.) from the microburst event; and (3) An additional experimental group received displayed alerts/events 23 linear miles (approx. 7 min.) from the microburst event. Analyses of crew communications and decision times showed a marked improvement in both situation awareness and decision-making with visually displayed ground-based radar information. Substantial reductions in the variability of decision times among crews in the visual display groups were also found. These findings suggest that crew performance will be enhanced and individual differences among crews due to differences in training and prior experience are significantly reduced by providing real-time, graphic display of terminal weather hazards.

  9. Selenoprotein A component of the glycine reductase complex from Clostridium purinolyticum: nucleotide sequence of the gene shows that selenocysteine is encoded by UGA.

    PubMed Central

    Garcia, G E; Stadtman, T C


    The gene encoding the selenoprotein A component of glycine reductase was isolated from Clostridium purinolyticum. The nucleotide sequence of this gene (grdA) was determined. The opal termination codon (TGA) was found in-frame at the position corresponding to the location of the selenocysteine residue in the gene product. A comparison of the nucleotide sequences and secondary mRNA structures corresponding to the selenoprotein A gene and the fdhF gene of Escherichia coli formate dehydrogenase shows that there is a similar potential for regulation of the specific insertion of selenocysteine at the UGA codon. PMID:1825826

  10. Selenoprotein A component of the glycine reductase complex from Clostridium purinolyticum: nucleotide sequence of the gene shows that selenocysteine is encoded by UGA.


    Garcia, G E; Stadtman, T C


    The gene encoding the selenoprotein A component of glycine reductase was isolated from Clostridium purinolyticum. The nucleotide sequence of this gene (grdA) was determined. The opal termination codon (TGA) was found in-frame at the position corresponding to the location of the selenocysteine residue in the gene product. A comparison of the nucleotide sequences and secondary mRNA structures corresponding to the selenoprotein A gene and the fdhF gene of Escherichia coli formate dehydrogenase shows that there is a similar potential for regulation of the specific insertion of selenocysteine at the UGA codon.

  11. Insights into function, catalytic mechanism, and fold evolution of selenoprotein methionine sulfoxide reductase B1 through structural analysis.


    Aachmann, Finn L; Sal, Lena S; Kim, Hwa-Young; Marino, Stefano M; Gladyshev, Vadim N; Dikiy, Alexander


    Methionine sulfoxide reductases protect cells by repairing oxidatively damaged methionine residues in proteins. Here, we report the first three-dimensional structure of the mammalian selenoprotein methionine sulfoxide reductase B1 (MsrB1), determined by high resolution NMR spectroscopy. Heteronuclear multidimensional spectra yielded NMR spectral assignments for the reduced form of MsrB1 in which catalytic selenocysteine (Sec) was replaced with cysteine (Cys). MsrB1 consists of a central structured core of two β-sheets and a highly flexible, disordered N-terminal region. Analysis of pH dependence of NMR signals of catalytically relevant residues, comparison with the data for bacterial MsrBs, and NMR-based structural analysis of methionine sulfoxide (substrate) and methionine sulfone (inhibitor) binding to MsrB1 at the atomic level reveal a mechanism involving catalytic Sec(95) and resolving Cys(4) residues in catalysis. The MsrB1 structure differs from the structures of Cys-containing MsrBs in the use of distal selenenylsulfide, residues needed for catalysis, and the mode in which the active form of the enzyme is regenerated. In addition, this is the first structure of a eukaryotic zinc-containing MsrB, which highlights the structural role of this metal ion bound to four conserved Cys. We integrated this information into a structural model of evolution of MsrB superfamily.

  12. The nodulation protein NodG shows the enzymatic activity of an 3-oxoacyl-acyl carrier protein reductase.


    López-Lara, I M; Geiger, O


    The acyl carrier protein NodF is required for the synthesis of unusual polyunsaturated fatty acids that confer specificity to lipochitin oligosaccharide nodulation (Nod) factors of Rhizobium leguminosarum. In this study, homogeneous NodF protein was used as a ligand to identify proteins of R. leguminosarum that specifically interact with NodF and presumably are involved in the biosynthesis or transfer of the unusual fatty acids. The N-terminal amino acid sequence of a 29-kDa protein that interacts strongly with NodF revealed high similarity to NodG of Rhizobium sp. N33 and to NodG of Sinorhizobium meliloti We cloned and sequenced the gene coding for the NodG-like protein of R. leguminosarum and found it to be the product of the constitutively expressed gene fabG. FabG is the 3-oxoacyl-acyl carrier protein reductase that catalyzes the first reduction step in each cycle of fatty acid elongation. FabG of R. leguminosarum and NodG of Rhizobium sp. N33 were expressed in Escherichia coli. In both cases, the purified protein showed 3-oxoacyl-acyl carrier protein reductase activity in vitro. Therefore, NodG has the same biochemical function as FabG, and the high degree of similarity at the protein and DNA level suggest that nodG is a duplication of the housekeeping genefabG.

  13. Effects of an anti-androgen and 5 alpha-reductase inhibitors on estrus duration in the cycling female rat.


    Erskine, M S


    Five experiments examined the role of circulating androgens in the control of sexual behavior (lordosis) in the intact cycling rat. The androgen receptor blocker, flutamide (FLU), was administered daily to cycling rats beginning on the day of estrus, and lordotic responsiveness was measured on the 2nd subsequent proestrus day and on the day of estrus. FLU-treated females showed significantly higher levels of lordosis throughout the end of the period of estrus than controls (Experiment 1). Neither the maximal levels of lordosis seen on the evening of proestrus nor the time of onset of estrous responsiveness during the preceeding afternoon were affected by FLU (Experiment 2). Serum estradiol concentrations seen on the morning of proestrus (Experiment 3) did not differ between FLU- and vehicle-treated animals. The weak 5 alpha-reductase inhibitor, testosterone-17 beta-carboxylic acid (17 beta C), prolonged slightly, but did not significantly lengthen, the period of estrus (Experiment 4), while the highly potent steroidal 5 alpha-reductase inhibitor, 4 MA, significantly increased the rate at which estrous behavior declined on the day of estrus (Experiment 5). Circulating androgens do not appear to affect the maximal level of sexual receptivity displayed nor the time of estrus onset; however, they may govern the duration of the period of estrus by influencing the rate of estrus termination.

  14. A salt-inducible chloroplastic monodehydroascorbate reductase from halophyte Avicennia marina confers salt stress tolerance on transgenic plants.


    Kavitha, Kumaresan; George, Suja; Venkataraman, Gayatri; Parida, Ajay


    Plant growth and productivity are adversely affected by various abiotic stress factors. In our previous study, we used Avicennia marina, a halophytic mangrove, as a model plant system for isolating genes functioning in salt stress tolerance. A large scale random EST sequencing from a salt stressed leaf tissue cDNA library of one month old A. marina plants resulted in identification of a clone showing maximum homology to Monodehydroascorbate reductase (Am-MDAR). MDAR plays a key role in regeneration of ascorbate from monodehydroascorbate for ROS scavenging. In this paper, we report the cellular localization and the ability to confer salt stress tolerance in transgenic tobacco of this salt inducible Am-MDAR. A transit peptide at the N-terminal region of Am-MDAR suggested that it encodes a chloroplastic isoform. The chloroplastic localization was confirmed by stable transformation and expression of the Am-MDAR-GFP fusion protein in tobacco. Transgenic tobacco plants overexpressing Am-MDAR survived better under conditions of salt stress compared to untransformed control plants. Assays of enzymes involved in ascorbate-glutathione cycle revealed an enhanced activity of MDAR and ascorbate peroxidase whereas the activity of dehyroascorbate reductase was reduced under salt stressed and unstressed conditions in Am-MDAR transgenic lines. The transgenic lines showed an enhanced redox state of ascorbate and reduced levels of malondialdehyde indicating its enhanced tolerance to oxidative stress. The results of our studies could be used as a starting point for genetic engineering of economically important plants tolerant to salt stress.

  15. Ribonucleotide reductase small subunit p53R2 facilitates p21 induction of G1 arrest under UV irradiation.


    Xue, Lijun; Zhou, Bingsen; Liu, Xiyong; Heung, Yvonne; Chau, Jennifer; Chu, Emilie; Li, Shan; Jiang, Chunglin; Un, Frank; Yen, Yun


    p53R2, which is one of the two known ribonucleotide reductase small subunits (the other being M2), is suggested to play an important role in supplying deoxynucleotide triphosphates (dNTP) for DNA repair during the G(1) or G(2) phase of the cell cycle. The ability of p53R2 to supply dNTPs for repairing DNA damages requires the presence of a functional p53 tumor suppressor. Here, we report in vivo physical interaction and colocalization of p53R2 and p21 before DNA damage. Mammalian two-hybrid assay further indicates that the amino acids 1 to 113 of p53R2 are critical for interacting with the NH(2)-terminal region (amino acids 1-93) of p21. The binding between p21 and p53R2 decreases inside the nucleus in response to UV, the time point of which corresponds to the increased binding of p21 with cyclin-dependent kinase-2 (Cdk2), and the decreased Cdk2 activity in the nucleus at G(1). Interestingly, p53R2 dissociates from p21 but facilitates the accumulation of p21 in the nucleus in response to UV. On the other hand, the ribonucleotide reductase activity increases at the corresponding time in response to UV. These data suggest a new function of p53R2 of cooperating with p21 during DNA repair at G(1) arrest.

  16. Termination: A Case Study.


    Friedberg, Ahron L


    In this article I posit and examine certain criteria and qualities for ending an analysis. The case study describes the end phase of a four-year psychoanalysis in which the patient's decision to move to another area forced the end of his analysis. We continued to explore and work through his core neurotic conflicts that included issues of competitive rivalry, dominance and submission, control, and anxiety about birth and death. A shift in the transference from me as a negative father to me as a supportive but competitive older brother was also examined in the context of ending treatment as well as other aspects of the transference. In addition, we analyzed the meaning of his ending treatment based on an extra-analytic circumstance. In discussing this phase of treatment, the definition and history of the term "termination" and its connotations are reviewed. Various criteria for completing an analysis are examined, and technical observations about this phase of treatment are investigated. It was found that while a significant shift in the transference occurred in this phase of the patient's analysis, conflicts related to the transference were not "resolved" in the classical sense. Terminating treatment was considered as a practical matter in which the patient's autonomy and sense of choice were respected and analyzed.

  17. Acetylene terminated matrix resins

    NASA Technical Reports Server (NTRS)

    Goldfarb, I. J.; Lee, Y. C.; Arnold, F. E.; Helminiak, T. E.


    The synthesis of resins with terminal acetylene groups has provided a promising technology to yield high performance structural materials. Because these resins cure through an addition reaction, no volatile by-products are produced during the processing. The cured products have high thermal stability and good properties retention after exposure to humidity. Resins with a wide variety of different chemical structures between the terminal acetylene groups are synthesized and their mechanical properties studied. The ability of the acetylene cured polymers to give good mechanical properties is demonstrated by the resins with quinoxaline structures. Processibility of these resins can be manipulated by varying the chain length between the acetylene groups or by blending in different amounts of reactive deluents. Processing conditions similar to the state-of-the-art epoxy can be attained by using backbone structures like ether-sulfone or bis-phenol-A. The wide range of mechanical properties and processing conditions attainable by this class of resins should allow them to be used in a wide variety of applications.

  18. Terminator View of Mercury

    NASA Image and Video Library


    Date acquired: May 05, 2014 Today's color image features both Mercury's terminator and limb. The terminator is the striking separation of night and day on Mercury. It is seen in this image with the change from dark, on the left of the image, to light. Mercury's limb is also captured, as we can see the edge between sunlit Mercury and space. The MESSENGER spacecraft is the first ever to orbit the planet Mercury, and the spacecraft's seven scientific instruments and radio science investigation are unraveling the history and evolution of the Solar System's innermost planet. During the first two years of orbital operations, MESSENGER acquired over 150,000 images and extensive other data sets. MESSENGER is capable of continuing orbital operations until early 2015. Credit: NASA/Johns Hopkins University Applied Physics Laboratory/Carnegie Institution of Washington NASA image use policy. NASA Goddard Space Flight Center enables NASA’s mission through four scientific endeavors: Earth Science, Heliophysics, Solar System Exploration, and Astrophysics. Goddard plays a leading role in NASA’s accomplishments by contributing compelling scientific knowledge to advance the Agency’s mission. Follow us on Twitter Like us on Facebook Find us on Instagram

  19. The respiratory arsenate reductase from Bacillus selenitireducens strain MLS10

    USGS Publications Warehouse

    Afkar, E.; Lisak, J.; Saltikov, C.; Basu, P.; Oremland, R.S.; Stolz, J.F.


    The respiratory arsenate reductase from the Gram-positive, haloalkaliphile, Bacillus selenitireducens strain MLS10 was purified and characterized. It is a membrane bound heterodimer (150 kDa) composed of two subunits ArrA (110 kDa) and ArrB (34 kDa), with an apparent Km for arsenate of 34 ??M and Vmax of 2.5 ??mol min-1 mg-1. Optimal activity occurred at pH 9.5 and 150 g l-1 of NaCl. Metal analysis (inductively coupled plasma mass spectrometry) of the holoenzyme and sequence analysis of the catalytic subunit (ArrA; the gene for which was cloned and sequenced) indicate it is a member of the DMSO reductase family of molybdoproteins. ?? 2003 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

  20. Ranirestat as a therapeutic aldose reductase inhibitor for diabetic complications.


    Giannoukakis, Nick


    There are currently very few drugs available to directly treat diabetic complications. Those that are indicated clinically provide symptomatic relief and do not address the underlying biochemical problems. The involvement of the sorbitol pathway in complications has provided mechanistic insights into the biochemistry of complications and the key enzyme, aldose reductase, has become an attractive pharmacologic target. Among the aldose reductase inhibitors, the most promising is ranirestat. This review outlines the studies with ranirestat and compares its efficacy with other similar inhibitors. A survey of in vitro and in vivo studies was conducted, and with publicly available data from clinical trials, ranirestat efficacy was compared with other similar agents. Ranirestat is safe, exhibits some efficacy and is perhaps the only agent advanced enough in clinical trials to warrant further consideration for diabetic complications.

  1. Pyrroline-5-Carboxylate Reductase in Soybean Nodules 1

    PubMed Central

    Chilson, Oscar P.; Kelly-Chilson, Anne E.; Schneider, Julie D.


    Characteristics of pyrroline-5-carboxylate reductase (P5CR) from Bradyrhizobium japonicum bacteroids and cultured rhizobia were compared with those of the enzyme in soybean nodule host cytosol. Reductase from host cytosol differed from that in bacteroids in: (a) the effect of pH on enzymic activity, (b) the capacity to catalyze both reduction of pyrroline-5-carboxylic acid and NAD+-dependent proline oxidation, (c) apparent affinities for pyrroline-5-carboxylic acid, and (d) sensitivities to inhibition by NADP+ and proline. The K1 for proline inhibition of P5CR in bacteroid cytosol was 1.8 millimolar. The properties of P5CR in B. japonicum and bacteroid cytosol were similar. The specific activities of P5CR in the cytosolic fractions of the nodule host and the bacteroid compartment were also comparable. PMID:16668837

  2. Characterization of 12-Oxo-Phytodienoic Acid Reductase in Corn

    PubMed Central

    Vick, Brady A.; Zimmerman, Don C.


    12-Oxo-phytodienoic acid reductase, an enzyme of the biosynthetic pathway that converts linolenic acid to jasmonic acid, has been characterized from the kernel and seedlings of corn (Zea mays L.). The molecular weight of the enzyme, estimated by gel filtration, was 54,000. Optimum enzyme activity was observed over a broad pH range, from pH 6.8 to 9.0. The enzyme had a Km of 190 micromolar for its substrate, 12-oxo-phytodienoic acid. The preferred reductant was NADPH, for which the enzyme exhibited a Km of 13 micromolar, compared with 4.2 millimolar for NADH. Reductase activity was low in the corn kernel but increased five-fold by the fifth day after germination and then gradually declined. PMID:16664582

  3. [Properties of a nitrite reductase inhibitor protein from Pseudomonas aeruginosa].


    Karapetian, A V; Nalbandian, R M


    The amino acid composition and major physico-chemical properties of the "nonblue" copper protein isolated earlier from Pseudomonas aeruginosa have been determined. It has been found that the azurin oxidase, cytochrome c551 oxidase and superoxide dismutase activities of the enzyme are inhibited by this protein. The inhibition seems to be due to the protein interaction with the electron-accepting center of nitrite reductase.

  4. Expression and purification of thioredoxin (TrxA) and thioredoxin reductase (TrxB) from Brevibacillus choshinensis.


    Tanaka, Ryoichi; Kosugi, Kotaro; Mizukami, Makoto; Ishibashi, Matsujiro; Tokunaga, Hiroko; Tokunaga, Masao


    Brevibacillus choshinensis (formerly Bacillus brevis) is a protein-hyperproducing bacterium and has been used for commercial protein production. Here, we cloned thioredoxin (trxA) and thioredoxin reductase (trxB) genes from B. choshinensis, and expressed the gene products in Escherichia coli with an amino-terminal hexa-His-tag for purification and characterization. His-TrxA and His-TrxB were purified to homogeneity with one-step Ni-NTA affinity column chromatography, and the two recombinant proteins showed identical specific activity with or without removal of the amino-terminal His-tag, indicating that the extrasequence containing the hexa-His-tag did not affect their enzymatic activities. The E. coli expression system used here resulted in a 40-fold increase in production of His-TrxB protein compared to the level of native TrxB produced in non-recombinant B. choshinensis cells. TrxA and TrxB proteins with carboxy-terminal His-tag (TrxA-His and TrxB-His) were successfully expressed in B. choshinensis and were purified by Ni-NTA column chromatography. Co-expression of TrxA-His with recombinant human epidermal growth factor (hEGF) in B. choshinensis promoted the extracellular production of hEGF by up to about 200%.

  5. Differential expression of disulfide reductase enzymes in a free-living platyhelminth (Dugesia dorotocephala)

    PubMed Central

    Herrera-Juárez, Álvaro Miguel; Martínez-González, José de Jesús; del Arenal Mena, Irene Patricia; Flores-Herrera, Óscar


    A search of the disulfide reductase activities expressed in the adult stage of the free-living platyhelminth Dugesia dorotocephala was carried out. Using GSSG or DTNB as substrates, it was possible to obtain a purified fraction containing both GSSG and DTNB reductase activities. Through the purification procedure, both disulfide reductase activities were obtained in the same chromatographic peak. By mass spectrometry analysis of peptide fragments obtained after tryptic digestion of the purified fraction, the presence of glutathione reductase (GR), thioredoxin-glutathione reductase (TGR), and a putative thioredoxin reductase (TrxR) was detected. Using the gold compound auranofin to selectively inhibit the GSSG reductase activity of TGR, it was found that barely 5% of the total GR activity in the D. dorotocephala extract can be assigned to GR. Such strategy did allow us to determine the kinetic parameters for both GR and TGR. Although It was not possible to discriminate DTNB reductase activity due to TrxR from that of TGR, a chromatofocusing experiment with a D. dorotocephala extract resulted in the obtention of a minor protein fraction enriched in TrxR, strongly suggesting its presence as a functional protein. Thus, unlike its parasitic counterparts, in the free-living platyhelminth lineage the three disulfide reductases are present as functional proteins, albeit TGR is still the major disulfide reductase involved in the reduction of both Trx and GSSG. This fact suggests the development of TGR in parasitic flatworms was not linked to a parasitic mode of life. PMID:28787021

  6. Aldose and aldehyde reductases : structure-function studies on the coenzyme and inhibitor-binding sites.

    SciTech Connect

    El-Kabbani, O.; Old, S. E.; Ginell, S. L.; Carper, D. A.; Biosciences Division; Monash Univ.; NIH


    PURPOSE: To identify the structural features responsible for the differences in coenzyme and inhibitor specificities of aldose and aldehyde reductases. METHODS: The crystal structure of porcine aldehyde reductase in complex with NADPH and the aldose reductase inhibitor sorbinil was determined. The contribution of each amino acid lining the coenzyme-binding site to the binding of NADPH was calculated using the Discover package. In human aldose reductase, the role of the non-conserved Pro 216 (Ser in aldehyde reductase) in the binding of coenzyme was examined by site-directed mutagenesis. RESULTS: Sorbinil binds to the active site of aldehyde reductase and is hydrogen-bonded to Trp 22, Tyr 50, His 113, and the non-conserved Arg 312. Unlike tolrestat, the binding of sorbinil does not induce a change in the side chain conformation of Arg 312. Mutation of Pro 216 to Ser in aldose reductase makes the binding of coenzyme more similar to that of aldehyde reductase. CONCLUSIONS: The participation of non-conserved active site residues in the binding of inhibitors and the differences in the structural changes required for the binding to occur are responsible for the differences in the potency of inhibition of aldose and aldehyde reductases. We report that the non-conserved Pro 216 in aldose reductase contributes to the tight binding of NADPH.

  7. Autoregulation of the Synthesis of Nitrate Reductase in Aspergillus nidulans

    PubMed Central

    Cove, D. J.; Pateman, J. A.


    In Aspergillus nidulans, the syntheses of nitrate and nitrite reductases are induced by nitrate, and are repressed by ammonium. It is possible in wild-type strains to overcome partially the repressive effect of ammonium, by the addition of high concentrations of nitrate to the growth medium. Mutations which lead to the production of abnormal nitrate reductase affect in addition the control of the synthesis of the nitrate-metabolizing enzymes, which in these strains are produced constitutively. That this is not due to the accumulation of an internal inducer has now been shown, as these mutants have been found to be unable to respond to nitrate induction in the presence of ammonium in the same way as do wild-type strains. To explain these findings, we propose that the nitrate reductase molecule provides the recognition site for nitrate in the control system, such that when it is not complexed with nitrate it acts as a co-repressor, and, when it is complexed, as a co-inducer. PMID:5776531

  8. The effect of quercetin and galangin on glutathione reductase.


    Paulíková, Helena; Berczeliová, Elena


    Quercetin and galangin can change the activity of glutathione reductase. Quercetin (a catechol structure in the B-ring) and galangin (any hydroxyl group in the B-ring) have different biological activities but, both possess high antioxidant abilities. Quercetin during the antioxidative action, is converted into an oxidized products (o-semiquinone and o-quinone), and subsequently glutathionyl adducts may be formed or SH-enzyme can be inhibited. We have tried to see whether inhibition of glutathione reductase (GR) can be influenced by preincubation of enzyme with NADPH (a creation of reduced form of enzyme, GRH(2)) and whether diaphorase activity of the enzyme is decreased by these flavonoids. The results confirmed that quercetin inhibits GRH(2) and inhibition is reduced by addition of EDTA or N-acetylcysteine. Both of flavonoids have no effect on diaphorase activity of glutathione reductase and this enzyme could increase the production of free radicals by catalysis of reduction of o-quinone during action of quercetin in vivo.

  9. Structural and functional diversity of ferredoxin-NADP(+) reductases.


    Aliverti, Alessandro; Pandini, Vittorio; Pennati, Andrea; de Rosa, Matteo; Zanetti, Giuliana


    Although all ferredoxin-NADP(+) reductases (FNRs) catalyze the same reaction, i.e. the transfer of reducing equivalents between NADP(H) and ferredoxin, they belong to two unrelated families of proteins: the plant-type and the glutathione reductase-type of FNRs. Aim of this review is to provide a general classification scheme for these enzymes, to be used as a framework for the comparison of their properties. Furthermore, we report on some recent findings, which significantly increased the understanding of the structure-function relationships of FNRs, i.e. the ability of adrenodoxin reductase and its homologs to catalyze the oxidation of NADP(+) to its 4-oxo derivative, and the properties of plant-type FNRs from non-photosynthetic organisms. Plant-type FNRs from bacteria and Apicomplexan parasites provide examples of novel ways of FAD- and NADP(H)-binding. The recent characterization of an FNR from Plasmodium falciparum brings these enzymes into the field of drug design.

  10. Perchlorate Reductase Is Distinguished by Active Site Aromatic Gate Residues*

    PubMed Central

    Youngblut, Matthew D.; Tsai, Chi-Lin; Clark, Iain C.; Carlson, Hans K.; Maglaqui, Adrian P.; Gau-Pan, Phonchien S.; Redford, Steven A.; Wong, Alan; Tainer, John A.; Coates, John D.


    Perchlorate is an important ion on both Earth and Mars. Perchlorate reductase (PcrAB), a specialized member of the dimethylsulfoxide reductase superfamily, catalyzes the first step of microbial perchlorate respiration, but little is known about the biochemistry, specificity, structure, and mechanism of PcrAB. Here we characterize the biophysics and phylogeny of this enzyme and report the 1.86-Å resolution PcrAB complex crystal structure. Biochemical analysis revealed a relatively high perchlorate affinity (Km = 6 μm) and a characteristic substrate inhibition compared with the highly similar respiratory nitrate reductase NarGHI, which has a relatively much lower affinity for perchlorate (Km = 1.1 mm) and no substrate inhibition. Structural analysis of oxidized and reduced PcrAB with and without the substrate analog SeO32− bound to the active site identified key residues in the positively charged and funnel-shaped substrate access tunnel that gated substrate entrance and product release while trapping transiently produced chlorate. The structures suggest gating was associated with shifts of a Phe residue between open and closed conformations plus an Asp residue carboxylate shift between monodentate and bidentate coordination to the active site molybdenum atom. Taken together, structural and mutational analyses of gate residues suggest key roles of these gate residues for substrate entrance and product release. Our combined results provide the first detailed structural insight into the mechanism of biological perchlorate reduction, a critical component of the chlorine redox cycle on Earth. PMID:26940877

  11. Early diagnosis and management of 5 alpha-reductase deficiency.

    PubMed Central

    Odame, I; Donaldson, M D; Wallace, A M; Cochran, W; Smith, P J


    Two siblings of Pakistani origin, karyotype 46 XY, were born with predominantly female external genitalia with minute phallus, bifid scrotum, urogenital sinus, and palpable gonads. The older sibling at the age of 8 days showed an adequate testosterone response to human chorionic gonadotrophin (hCG) stimulation. The diagnosis of 5 alpha-reductase deficiency was made at age 6 years when no 5 alpha-reduced glucocorticoid metabolites were detectable in urine even after tetracosactrin (Synacthen) stimulation. In the younger sibling the diagnosis of 5 alpha-reductase deficiency was provisionally made at the early age of 3 days on the basis of high urinary tetrahydrocortisol (THF)/allotetrahydrocortisol (5 alpha-THF) ratio and this ratio increased with age confirming the diagnosis. Plasma testosterone: dihydrotestosterone (DHT) ratio before and after hCG stimulation was within normal limits at age 3 days but was raised at age 9 months. Topical DHT cream application to the external genitalia promoted significant phallic growth in both siblings and in the older sibling corrective surgery was facilitated. In prepubertal male pseudohermaphrodites with normal or raised testosterone concentrations, phallic growth in response to DHT cream treatment could be an indirect confirmation of 5 alpha-reductase deficiency. Images Figure 1 PMID:1626992

  12. Phosphoglycerate kinase acts in tumour angiogenesis as a disulphide reductase

    NASA Astrophysics Data System (ADS)

    Lay, Angelina J.; Jiang, Xing-Mai; Kisker, Oliver; Flynn, Evelyn; Underwood, Anne; Condron, Rosemary; Hogg, Philip J.


    Disulphide bonds in secreted proteins are considered to be inert because of the oxidizing nature of the extracellular milieu. An exception to this rule is a reductase secreted by tumour cells that reduces disulphide bonds in the serine proteinase plasmin. Reduction of plasmin initiates proteolytic cleavage in the kringle 5 domain and release of the tumour blood vessel inhibitor angiostatin. New blood vessel formation or angiogenesis is critical for tumour expansion and metastasis. Here we show that the plasmin reductase isolated from conditioned medium of fibrosarcoma cells is the glycolytic enzyme phosphoglycerate kinase. Recombinant phosphoglycerate kinase had the same specific activity as the fibrosarcoma-derived protein. Plasma of mice bearing fibrosarcoma tumours contained several-fold more phosphoglycerate kinase, as compared with mice without tumours. Administration of phosphoglycerate kinase to tumour-bearing mice caused an increase in plasma levels of angiostatin, and a decrease in tumour vascularity and rate of tumour growth. Our findings indicate that phosphoglycerate kinase not only functions in glycolysis but is secreted by tumour cells and participates in the angiogenic process as a disulphide reductase.

  13. Aldo-Keto Reductases 1B in Adrenal Cortex Physiology

    PubMed Central

    Pastel, Emilie; Pointud, Jean-Christophe; Martinez, Antoine; Lefrançois-Martinez, A. Marie


    Aldose reductase (AKR1B) proteins are monomeric enzymes, belonging to the aldo-keto reductase (AKR) superfamily. They perform oxidoreduction of carbonyl groups from a wide variety of substrates, such as aliphatic and aromatic aldehydes or ketones. Due to the involvement of human aldose reductases in pathologies, such as diabetic complications and cancer, AKR1B subgroup enzymatic properties have been extensively characterized. However, the issue of AKR1B function in non-pathologic conditions remains poorly resolved. Adrenal activities generated large amount of harmful aldehydes from lipid peroxidation and steroidogenesis, including 4-hydroxynonenal (4-HNE) and isocaproaldehyde (4-methylpentanal), which can both be reduced by AKR1B proteins. More recently, some AKR1B isoforms have been shown to be endowed with prostaglandin F synthase (PGFS) activity, suggesting that, in addition to possible scavenger function, they could instigate paracrine signals. Interestingly, the adrenal gland is one of the major sites for human and murine AKR1B expression, suggesting that their detoxifying/signaling activity could be specifically required for the correct handling of adrenal function. Moreover, chronic effects of ACTH result in a coordinated regulation of genes encoding the steroidogenic enzymes and some AKR1B isoforms. This review presents the molecular mechanisms accounting for the adrenal-specific expression of some AKR1B genes. Using data from recent mouse genetic models, we will try to connect their enzymatic properties and regulation with adrenal functions. PMID:27499746

  14. Quinone Reductase Induction as a Biomarker for Cancer Chemoprevention⊥

    PubMed Central

    Cuendet, Muriel; Oteham, Carol P.; Moon, Richard C.; Pezzuto, John M.


    Chemoprevention involves the use of natural or synthetic substances to reduce the risk of developing cancer. Strategies for protecting cells from initiation events include decreasing metabolic enzymes responsible for generating reactive species (phase I enzymes) while increasing phase II enzymes that can deactivate radicals and electrophiles known to intercede in normal cellular processes. Reduction of electrophilic quinones by quinone reductase is an important detoxification pathway. Following evaluation of approximately 3000 plant and marine organism extracts, the number characterized as “active” was established in the range of 12% of the total, and over 60 active compounds have been isolated as quinone reductase inducers. One of them, isoliquiritigenin (1), isolated from tonka bean, was shown to be a monofunctional inducer by having similar quinone reductase inducing ability in wild-type Hepa 1c1c7 cells and two mutant cell lines. To further investigate the mechanism of induction, HepG2 human hepatoma cells stably transfected with ARE-luciferase plasmid were used. Isoliquiritigenin (1) significantly induced the luciferase activity in a dose-dependent manner. On the basis of these results, a full-term cancer chemoprevention study was conducted with 7,12-dimethylbenz[a]anthracene (DMBA)-treated female Sprague-Dawley rats. Dietary administration of 1 increased tumor latency. Based on these promising preliminary results, additional mechanistic studies are underway, as well as full-term carcinogenesis studies with chronic administration schedules. PMID:16562858

  15. The existence and significance of a mitochondrial nitrite reductase.


    Nohl, Hans; Staniek, Katrin; Kozlov, Andrey V


    The physiological functions of nitric oxide (NO) are well established. The finding that the endothelium-derived relaxing factor (EDRF) is NO was totally unexpected. It was shown that NO is a reaction product of an enzymatically catalyzed, overall, 5-electron oxidation of guanidinium nitrogen from L-arginine followed by the release of the free radical species NO. NO is synthesized by a single protein complex supported by cofactors, coenzymes (such as tetrahydrobiopterin) and cytochrome P450. The latter can uncouple from substrate oxidation producing O2*- radicals. The research groups of Richter [Ghafourifar P, Richter C. Nitric oxide synthase activity in mitochondria. FEBS Lett 1997; 418: 291-296.] and Boveris [Giulivi C, Poderoso JJ, Boveris A. Production of nitric oxide by mitochondria. J Biol Chem 1998; 273: 11038-11043.] identified a mitochondrial NO synthase (NOS). There are, however, increasing reports demonstrating that mitochondrial NO is derived from cytosolic NOS belonging to the Ca2+-dependent enzymes. NO was thought to control cytochrome oxidase. This assumption is controversial due to the life-time of NO in biological systems (millisecond range). We found a nitrite reductase in mitochondria which is of major interest. Any increase of nitrite in the tissue which is the first oxidation product of NO, for instance following NO donors, will stimulate NO-recycling via mitochondrial nitrite reductase. In this paper, we describe the identity and the function of mitochondrial nitrite reductase and the consequences of NO-recycling in the metabolic compartment of mitochondria.

  16. A productive NADP+ binding mode of ferredoxin-NADP + reductase revealed by protein engineering and crystallographic studies.


    Deng, Z; Aliverti, A; Zanetti, G; Arakaki, A K; Ottado, J; Orellano, E G; Calcaterra, N B; Ceccarelli, E A; Carrillo, N; Karplus, P A


    The flavoenzyme ferredoxin-NADP+ reductase (FNR) catalyzes the production of NADPH during photosynthesis. Whereas the structures of FNRs from spinach leaf and a cyanobacterium as well as many of their homologs have been solved, none of these studies has yielded a productive geometry of the flavin-nicotinamide interaction. Here, we show that this failure occurs because nicotinamide binding to wild type FNR involves the energetically unfavorable displacement of the C-terminal Tyr side chain. We used mutants of this residue (Tyr 308) of pea FNR to obtain the structures of productive NADP+ and NADPH complexes. These structures reveal a unique NADP+ binding mode in which the nicotinamide ring is not parallel to the flavin isoalloxazine ring, but lies against it at an angle of approximately 30 degrees, with the C4 atom 3 A from the flavin N5 atom.

  17. Structure/Function Analysis of Protein-Protein Interactions and Role of Dynamic Motions in Mercuric Ion Reductase

    SciTech Connect

    Miller, Susan M.


    This report summarizes the activities and findings of our structure/function studies of the bacterial detoxification enzyme mercuric ion reductase. The objectives of the work were to obtain crystal structure information for the catalytic core of this enzyme, use the information to investigate the importance of specific parts of the enzyme to its function, and investigate the role of one domain of the enzyme in its function within cells. We describe the accomplishments towards these goals including many structures of the wild type and mutant forms of the enzyme that highlight its interactions with its Hg(II) substrate, elucidation of the role of the N-terminal domain in vitro and in vivo, and elucidation of the roles of at two conserved residues in the core in the mechanism of catalysis.

  18. Protein kinase activity associated with the large subunit of herpes simplex virus type 2 ribonucleotide reductase (ICP10).

    PubMed Central

    Chung, T D; Wymer, J P; Smith, C C; Kulka, M; Aurelian, L


    The large subunit of the herpes simplex virus type 2 (HSV-2) ribonucleotide reductase (RR1) is demonstrated to possess serine/threonine-specific kinase activity. Computer-assisted sequence analysis identified regions within the amino terminus of ICP10 that are homologous to the catalytic domain of known protein kinases (PKs). An in vitro kinase assay confirmed the ability of ICP10, immunoprecipitated from either HSV-2-infected cells or from cells transfected with an ICP10 expression vector, to autophosphorylate and transphosphorylate exogenous substrates in the presence of ATP and Mg2+. The HSV-1 RR1 was shown to be negative for PK activity under these conditions. PK activity was localized to a 57-kDa amino-terminal region within ICP10 that lacked RR activity. Images PMID:2545912

  19. Enzymatic reduction of disulfide bonds in lysosomes: Characterization of a Gamma-interferon-inducible lysosomal thiol reductase (GILT)

    NASA Astrophysics Data System (ADS)

    Arunachalam, Balasubramanian; Phan, Uyen T.; Geuze, Hans J.; Cresswell, Peter


    Proteins internalized into the endocytic pathway are usually degraded. Efficient proteolysis requires denaturation, induced by acidic conditions within lysosomes, and reduction of inter- and intrachain disulfide bonds. Cytosolic reduction is mediated enzymatically by thioredoxin, but the mechanism of lysosomal reduction is unknown. We describe here a lysosomal thiol reductase optimally active at low pH and capable of catalyzing disulfide bond reduction both in vivo and in vitro. The active site, determined by mutagenesis, consists of a pair of cysteine residues separated by two amino acids, similar to other enzymes of the thioredoxin family. The enzyme is a soluble glycoprotein that is synthesized as a precursor. After delivery into the endosomal/lysosomal system by the mannose 6-phosphate receptor, N- and C-terminal prosequences are removed. The enzyme is expressed constitutively in antigen-presenting cells and induced by IFN-γ in other cell types, suggesting a potentially important role in antigen processing.

  20. Catalytic mechanism and substrate selectivity of aldo-keto reductases: insights from structure-function studies of Candida tenuis xylose reductase.


    Kratzer, Regina; Wilson, David K; Nidetzky, Bernd


    Aldo-keto reductases (AKRs) constitute a large protein superfamily of mainly NAD(P)-dependent oxidoreductases involved in carbonyl metabolism. Catalysis is promoted by a conserved tetrad of active site residues (Tyr, Lys, Asp and His). Recent results of structure-function relationship studies for xylose reductase (AKR2B5) require an update of the proposed catalytic mechanism. Electrostatic stabilization by the epsilon-NH3+ group of Lys is a key source of catalytic power of xylose reductase. A molecular-level analysis of the substrate binding pocket of xylose reductase provides a case of how a very broadly specific AKR achieves the requisite selectivity for its physiological substrate and could serve as the basis for the design of novel reductases with improved specificities for biocatalytic applications.

  1. The effect of 5alpha-reductase inhibition with finasteride and dutasteride on bone mineral density in older men with benign prostatic hyperplasia.


    Mačukat, Indira Radin; Spanjol, Josip; Orlič, Zeljka Crncevič; Butorac, Marta Zuvič; Marinovič, Marin; Ćupič, Dora Fučkar


    Testosterone is converted to dihyrotestosterone by two isoenzymes of 5alpha-reductase. Finasteride and dutasteride are 5alpha-reductase inhibitors commonly used in the treatment of benign prostatic hyperplasia. We compared indices of bone mineral density in 50 men treated with finasteride, 50 men treated with dutasteride and 50 men as control. Bone mineral density of spine and hip were measured using dual energy X-ray absorptiometry. Bone formation was assessed by measuring serum osteocalcin and bone resorptionby measuring serum C-terminal telopeptide of collagen type 1. In addition serum total testosteron and estradiol were determined. The dutasteride group had significantly higher mean bone min- eral density, mean bone mineral content, mean T score, mean Z score at femoral neck and mean total hip Z score than control. Mean total testosterone and estradiol levels were higher in the dutasteride group. There were no significant dif- ferences between the groups in lumbar spine bone density parameters or bone turnover markers. Our results provide evidence that long-term 5alpha-reductase suppression does not adversely affect bone mineral density. Dutasteride therapy could have beneficial effect on bone density.

  2. Channel and terminal description of the ACTS mobile terminal

    NASA Technical Reports Server (NTRS)

    Abbe, B. S.; Agan, M. J.; Girardey, C. C.; Jedrey, T. C.


    The Advanced Communications Technology Satellite (ACTS) Mobile Terminal (AMT) is a proof-of-concept K/Ka-band mobile satellite communications terminal under development by NASA at JPL. Currently the AMT is undergoing systems integration and testing in preparation for a July 1993 ACTS launch and the subsequent commencement of mobile experiments in the fall of 1993. The AMT objectives are presented, followed by a discussion of the AMT communications channel and the mobile terminal's design and performance.

  3. Channel and terminal description of the ACTS mobile terminal

    NASA Technical Reports Server (NTRS)

    Abbe, B. S.; Agan, M. J.; Girardey, C. C.; Jedrey, T. C.


    The Advanced Communications Technology Satellite (ACTS) Mobile Terminal (AMT) is a proof-of-concept K/Ka-band mobile satellite communications terminal under development by NASA at JPL. Currently the AMT is undergoing system integration and test in preparation for a July 1993 ACTS launch and the subsequent commencement of mobile experiments in the fall of 1993. The AMT objectives are presented followed by a discussion of the AMT communications channel and mobile terminal design and performance.

  4. Molecular Underpinnings of Fe(III) Oxide Reduction by Shewanella oneidensis MR-1

    SciTech Connect

    Shi, Liang; Rosso, Kevin M.; Clarke, Thomas A.; Richardson, David J.; Zachara, John M.; Fredrickson, Jim K.


    In the absence of O2 and other electron acceptors, the Gram-negative bacterium Shewanella oneidensis MR-1 can use ferric [Fe(III)] (oxy)(hydr)oxide minerals as the terminal electron acceptors for anaerobic respiration. At circumneutral pH and in the absence of strong complexing ligands, Fe(III) oxides are relatively insoluble and thus are external to the bacterial cells. S. oneidensis MR-1 and related strains of metal-reducing Shewanella have evolved the machinery (i.e., metal-reducing or Mtr pathway) for transferring electrons from the inner-membrane, through the periplasm and across the outer-membrane to the surface of extracellular Fe(III) oxides. The protein components identified to date for the Mtr pathway include CymA, MtrA, MtrB, MtrC and OmcA. CymA is an inner-membrane tetraheme c-type cytochrome (c-Cyt) that belongs to the NapC/NrfH family of quinol dehydrogenases. It is proposed that CymA oxidizes the quinol in the inner-membrane and transfers the released electrons to redox proteins in the periplasm. Although the periplasmic proteins receiving electrons from CymA during Fe(III) oxidation have not been identified, they are believed to relay the electrons in the periplasm to MtrA. A decaheme c-Cyt, MtrA is thought to be embedded in the trans outer-membrane and porin-like protein MtrB. Together, MtrAB deliver the electrons through the outer-membrane to the MtrC and OmcA on the outmost bacterial surface. MtrC and OmcA are the outer-membrane decaheme c-Cyts that are translocated across the outer-membrane by the bacterial type II secretion system. Functioning as terminal reductases, MtrC and OmcA can bind the surface of Fe(III) oxides and transfer electrons directly to these minerals via their solvent-exposed hemes. To increase their reaction rates, MtrC and OmcA can use the flavins secreted by S. oneidensis MR-1 cells as diffusible co-factors for reduction of Fe(III) oxides. Because of their extracellular location and broad redox potentials, MtrC and OmcA can

  5. The Effects of Termination on the Menominee

    ERIC Educational Resources Information Center

    Deer, Ada E.


    Topics discussed in this article are: (1) a brief pre-termination history of the Menominee Indians; (2) the enactment of termination; (3) the effects of termination on the Menominee; and (4) the need to repudiate termination. (NQ)

  6. Evidence for the participation of Cys sub 558 and Cys sub 559 at the active site of mercuric reductase

    SciTech Connect

    Miller, S.M.; Moore, M.J.; Massey, V.; Williams, C.H. Jr.; Distefano, M.D.; Ballou, D.P.; Walsh, C.T. )


    Mercuric reductase, with FAD and a reducible disulfide at the active site, catalyzes the two-electron reduction of Hg(II) by NADPH. Addition of reducing equivalents rapidly produces a spectrally distinct EH{sub 2} form of the enzyme containing oxidized FAD and reduced active site thiols. Formation of EH{sub 2} has previously been reported to require only 2 electrons for reduction of the active site disulfide. The authors present results of anaerobic titrations of mercuric reductase with NADPH and dithionite showing that the equilibrium conversion of oxidized enzyme to EH{sub 2} actually requires 2 equiv of reducing agent or 4 electrons. Kinetic studies conducted both at 4{degree}C and at 25{degree}C indicate that reduction of the active site occurs rapidly, as previously reported; this is followed by a slower reduction of another redox group via reaction with the active site. ({sup 14}C)Iodoacetamide labeling experiments demonstrate that the C-terminal residues, Cys{sub 558} and Cys{sub 559}, are involved in this disulfide. The fluorescence, but not the absorbance, of the enzyme-bound FAD was found to be highly dependent on the redox state of the C-terminal thiols. Thus, E{sub ox} with Cys{sub 558} and Cys{sub 559} as thiols exhibits less than 50% of the fluorescence of E{sub ox} where these residues are present as a disulfide, indicating that the thiols remain intimately associated with the active site. Initial velocity measurements show that the auxiliary disulfide must be reduced before catalytic Hg(II) reduction can occur, consistent with the report of a preactivation phenomenon with NADPH or cysteine. A modified minimal catalytic mechanism is proposed as well as several chemical mechanisms for the Hg(II) reduction step.

  7. [Terminal ballistics. 3].


    Marini, F; Mangiante, G; Dagradi, V; Radin, S; Carolo, F; Giarolli, M; Della Giacoma, G; Tosi, D; Merico, G; Tenci, A


    This brief chapter, focusing essentially on a single topic, has been written in homage to Emile Theodor Kocker, a masterful exponent of the art of surgery and founder of the culture of terminal ballistics. For most of the literature we are indebted to Fackler and Dougherty, who, with the particular grasp, and fair of historians, act as guides on a trial which is only apparently retrograde, but which actually bears eloquent witness to the fact that even in the most physically tangible of arts, namely the art of surgery, inspired curiosity may help us to go well beyond the limits of our day and age. This chapter is also dedicated to the memory of another great surgeon, Vittorio Pettinari, who for one of the authors was an incomparable mentor and past-master of such curiosity.

  8. Methionine Sulfoxide Reductases Are Essential for Virulence of Salmonella Typhimurium

    PubMed Central

    Rouf, Syed Fazle; Kitowski, Vera; Böhm, Oliver M.; Rhen, Mikael; Jäger, Timo; Bange, Franz-Christoph


    Production of reactive oxygen species represents a fundamental innate defense against microbes in a diversity of host organisms. Oxidative stress, amongst others, converts peptidyl and free methionine to a mixture of methionine-S- (Met-S-SO) and methionine-R-sulfoxides (Met-R-SO). To cope with such oxidative damage, methionine sulfoxide reductases MsrA and MsrB are known to reduce MetSOs, the former being specific for the S-form and the latter being specific for the R-form. However, at present the role of methionine sulfoxide reductases in the pathogenesis of intracellular bacterial pathogens has not been fully detailed. Here we show that deletion of msrA in the facultative intracellular pathogen Salmonella (S.) enterica serovar Typhimurium increased susceptibility to exogenous H2O2, and reduced bacterial replication inside activated macrophages, and in mice. In contrast, a ΔmsrB mutant showed the wild type phenotype. Recombinant MsrA was active against free and peptidyl Met-S-SO, whereas recombinant MsrB was only weakly active and specific for peptidyl Met-R-SO. This raised the question of whether an additional Met-R-SO reductase could play a role in the oxidative stress response of S. Typhimurium. MsrC is a methionine sulfoxide reductase previously shown to be specific for free Met-R-SO in Escherichia (E.) coli. We tested a ΔmsrC single mutant and a ΔmsrBΔmsrC double mutant under various stress conditions, and found that MsrC is essential for survival of S. Typhimurium following exposure to H2O2, as well as for growth in macrophages, and in mice. Hence, this study demonstrates that all three methionine sulfoxide reductases, MsrA, MsrB and MsrC, facilitate growth of a canonical intracellular pathogen during infection. Interestingly MsrC is specific for the repair of free methionine sulfoxide, pointing to an important role of this pathway in the oxidative stress response of Salmonella Typhimurium. PMID:22073230

  9. Kinetic characteristics of ZENECA ZD5522, a potent inhibitor of human and bovine lens aldose reductase.


    Cook, P N; Ward, W H; Petrash, J M; Mirrlees, D J; Sennitt, C M; Carey, F; Preston, J; Brittain, D R; Tuffin, D P; Howe, R


    Aldose reductase (aldehyde reductase 2) catalyses the conversion of glucose to sorbitol, and methylglyoxal to acetol. Treatment with aldose reductase inhibitors (ARIs) is a potential approach to decrease the development of diabetic complications. The sulphonylnitromethanes are a recently discovered class of aldose reductase inhibitors, first exemplified by ICI215918. We now describe enzyme kinetic characterization of a second sulphonylnitromethane, 3',5'-dimethyl-4'-nitromethylsulphonyl-2-(2-tolyl)acetanilide (ZD5522), which is at least 10-fold more potent against bovine lens aldose reductase in vitro and which also has a greater efficacy for reduction of rat nerve sorbitol levels in vivo (ED95 = 2.8 mg kg-1 for ZD5522 and 20 mg kg-1 for ICI 215918). ZD5522 follows pure noncompetitive kinetics against bovine lens aldose reductase when either glucose or methylglyoxal is varied (K(is) = K(ii) = 7.2 and 4.3 nM, respectively). This contrasts with ICI 215918 which is an uncompetitive inhibitor (K(ii) = 100 nM) of bovine lens aldose reductase when glucose is varied. Against human recombinant aldose reductase, ZD5522 displays mixed noncompetitive kinetics with respect to both substrates (K(is) = 41 nM, K(ii) = 8 nM with glucose and K(is) = 52 nM, K(ii) = 3.8 nM with methylglyoxal). This is the first report of the effects of a sulphonylnitromethane on either human aldose reductase or utilization of methylglyoxal. These results are discussed with reference to a Di Iso Ordered Bi Bi mechanism for aldose reductase, where the inhibitors compete with binding of both the aldehyde substrate and alcohol product. This model may explain why aldose reductase inhibitors follow noncompetitive or uncompetitive kinetics with respect to aldehyde substrates, and X-ray crystallography paradoxically locates an ARI within the substrate binding site. Aldehyde reductase (aldehyde reductase 1) is closely related to aldose reductase. Inhibition of bovine kidney aldehyde reductase by ZD5522

  10. Distribution of isoforms of ferredoxin-NADP(+) reductase (FNR) in cyanobacteria in two growth conditions.


    Alcántara-Sánchez, Felipe; Leyva-Castillo, Lourdes Elizabeth; Chagolla-López, Alicia; González de la Vara, Luis; Gómez-Lojero, Carlos


    Ferredoxin-NADP(+) reductase (FNR) transfers reducing equivalents between ferredoxin and NADP(H) in the photosynthetic electron transport chains of chloroplasts and cyanobacteria. In most cyanobacteria, FNR is coded by a single petH gene. The structure of FNR in photosynthetic organisms can be constituted by FAD-binding and NADPH-binding domains (FNR-2D), or by these and an additional N-terminal domain (FNR-3D). In this article, biochemical evidence is provided supporting the induction of FNR-2D by iron or combined nitrogen deficiency in the cyanobacteria Synechocystis PCC 6803 and Anabaena variabilis ATCC 29413. In cell extracts of these cyanobacteria, most of FNR was associated to phycobilisomes (PBS) or phycocyanin (PC), and the rest was found as free enzyme. Free FNR activity increased in both cyanobacteria under iron stress and during diazotrophic conditions in A. variabilis. Characterization of FNR from both cyanobacteria showed that the PBS-associated enzyme was FNR-3D and the free enzyme was mostly a FNR-2D isoform. Predominant isoforms in heterocysts of A. variabilis were FNR-2D; where its N-terminal sequence lacked an initial (formyl)methionine. This means that FNR-3D is targeted to thylakoid membrane, and anchored to PBS, and FNR-2D is found as a soluble protein in the cytoplasm, when iron or fixed nitrogen deficiencies prevail in the environment. Moreover, given that Synechocystis and Anabaena variabilis are dissimilar in genotype, phenotype and ecology, the presence of these two-domain proteins in these species suggests that the mechanism of FNR induction is common among cyanobacteria regardless of their habitat and morphotype.

  11. NIa-pro of Papaya ringspot virus interacts with papaya methionine sulfoxide reductase B1.


    Gao, Le; Shen, Wentao; Yan, Pu; Tuo, Decai; Li, Xiaoying; Zhou, Peng


    A chloroplast-localized papaya methionine sulfoxide reductase B1 (PaMsrB1) interacting with Papaya ringspot virus (PRSV) NIa-Pro was identified using a Sos recruitment two-hybrid system (SRS). SRS analysis of several deletion mutants of PRSV NIa-Pro and PaMsrB1 demonstrated that the C-terminal (residues 133-239) fragment of PRSV NIa-Pro and residues 112-175 of PaMsrB1 were necessary for this interaction between PRSV NIa-Pro and PaMsrB1. MsrB1 can repair Met-oxidized proteins damaged by reactive oxygen species (ROS). We confirmed that PRSV infection leads to ROS accumulation and a slight upregulation of level PaMsrB1 mRNA in papaya. This interaction between PaMsrB1 with PRSV NIa-Pro may disturb the import of PaMsrB1 into the chloroplasts. These results suggest that this specific interaction could interfere with PaMsrB1 into the chloroplasts to scavenge ROS caused by PRSV infection. This may be a novel mechanism of PRSV towards the host defense.

  12. Surface orientation control of site-specifically immobilized nitro-reductase (NfsB).


    Shen, Lei; Schroeder, McKenna; Ogorzalek, Tadeusz L; Yang, Pei; Wu, Fu-Gen; Marsh, E Neil G; Chen, Zhan


    We demonstrate the control of enzyme orientation for enzymes chemically immobilized on surfaces. Nitro-reductase (NfsB) has the ability to reduce a broad range of nitro-containing compounds and has potential applications in a broad range of areas including the detection and decomposition of explosives. The enzyme was tethered through unique surface cysteine residues to a self-assembled monolayer (SAM) terminated with maleimide groups. One cysteine was introduced close to the active site (V424C), and the other, at a remote site (H360C). The surface-tethered NfsB variants were interrogated by a combination of surface-sensitive sum frequency generation (SFG) vibrational spectroscopy and attenuated total reflection-Fourier transform infrared spectroscopy (ATR-FTIR) to determine how the mode of attachment altered the enzyme's orientation. The activities of the two immobilized NfsB variants were measured and can be well correlated to the deduced orientations. The relationships among enzyme engineering, surface immobilization, enzyme orientation, and enzyme activity were revealed.

  13. Identification of Ser-543 as the major regulatory phosphorylation site in spinach leaf nitrate reductase

    NASA Technical Reports Server (NTRS)

    Bachmann, M.; Shiraishi, N.; Campbell, W. H.; Yoo, B. C.; Harmon, A. C.; Huber, S. C.; Davies, E. (Principal Investigator)


    Spinach leaf NADH:nitrate reductase (NR) responds to light/dark signals and photosynthetic activity in part as a result of rapid regulation by reversible protein phosphorylation. We have identified the major regulatory phosphorylation site as Ser-543, which is located in the hinge 1 region connecting the cytochrome b domain with the molybdenum-pterin cofactor binding domain of NR, using recombinant NR fragments containing or lacking the phosphorylation site sequence. Studies with NR partial reactions indicated that the block in electron flow caused by phosphorylation also could be localized to the hinge 1 region. A synthetic peptide (NR6) based on the phosphorylation site sequence was phosphorylated readily by NR kinase (NRk) in vitro. NR6 kinase activity tracked the ATP-dependent inactivation of NR during several chromatographic steps and completely inhibited inactivation/phosphorylation of native NR in vitro. Two forms of NRk were resolved by using anion exchange chromatography. Studies with synthetic peptide analogs indicated that both forms of NRk had similar specificity determinants, requiring a basic residue at P-3 (i.e., three amino acids N-terminal to the phosphorylated serine) and a hydrophobic residue at P-5. Both forms are strictly calcium dependent but belong to distinct families of protein kinases because they are distinct immunochemically.

  14. dNTP deficiency induced by HU via inhibiting ribonucleotide reductase affects neural tube development.


    Guan, Zhen; Wang, Xiuwei; Dong, Yanting; Xu, Lin; Zhu, Zhiqiang; Wang, Jianhua; Zhang, Ting; Niu, Bo


    Exposure to environmental toxic chemicals in utero during the neural tube development period can cause developmental disorders. To evaluate the disruption of neural tube development programming, the murine neural tube defects (NTDs) model was induced by interrupting folate metabolism using methotrexate in our previous study. The present study aimed to examine the effects of dNTP deficiency induced by hydroxyurea (HU), a specific ribonucleotide reductase (RNR) inhibitor, during murine neural tube development. Pregnant C57BL/6J mice were intraperitoneally injected with various doses of HU on gestation day (GD) 7.5, and the embryos were checked on GD 11.5. RNR activity and deoxynucleoside triphosphate (dNTP) levels were measured in the optimal dose. Additionally, DNA damage was examined by comet analysis and terminal deoxynucleotidyl transferase mediated dUTP nick end-labeling (TUNEL) assay. Cellular behaviors in NTDs embryos were evaluated with phosphorylation of histone H3 (PH-3) and caspase-3 using immunohistochemistry and western blot analysis. The results showed that NTDs were observed mostly with HU treatment at an optimal dose of 225 mg/kg b/w. RNR activity was inhibited and dNTP levels were decreased in HU-treated embryos with NTDs. Additionally, increased DNA damage, decreased proliferation, and increased caspase-3 were significant in NTDs embryos compared to the controls. Results indicated that HU induced murine NTDs model by disturbing dNTP metabolism and further led to the abnormal cell balance between proliferation and apoptosis.

  15. The bacteriophage T4 gene for the small subunit of ribonucleotide reductase contains an intron.

    PubMed Central

    Sjöberg, B M; Hahne, S; Mathews, C Z; Mathews, C K; Rand, K N; Gait, M J


    The bacteriophage T4 gene nrdB codes for the small subunit of the enzyme ribonucleotide reductase. The T4 nrdB gene was localized between 136.1 kb and 137.8 kb in the T4 genetic map according to the deduced structural homology of the protein to the amino acid sequence of its bacterial counterpart, the B2 subunit of Escherichia coli. This positions the C-terminal end of the T4 nrdB gene approximately 2 kb closer to the T4 gene 63 than earlier anticipated from genetic recombinational analyses. The most surprising feature of the T4 nrdB gene is the presence of an approximately 625 bp intron which divides the structural gene into two parts. This is the second example of a prokaryotic structural gene with an intron. The first prokaryotic intron was reported in the nearby td gene, coding for the bacteriophage T4-specific thymidylate synthase enzyme. The nucleotide sequence at the exon-intron junctions of the T4 nrdB gene is similar to that of the junctions of the T4 td gene: the anticipated exon-intron boundary at the donor site ends with a TAA stop codon and there is an ATG start codon at the putative downstream intron-exon boundary of the acceptor site. In the course of this work the denA gene of T4 (endonuclease II) was also located. PMID:3530746

  16. Identification of Ser-543 as the major regulatory phosphorylation site in spinach leaf nitrate reductase

    NASA Technical Reports Server (NTRS)

    Bachmann, M.; Shiraishi, N.; Campbell, W. H.; Yoo, B. C.; Harmon, A. C.; Huber, S. C.; Davies, E. (Principal Investigator)


    Spinach leaf NADH:nitrate reductase (NR) responds to light/dark signals and photosynthetic activity in part as a result of rapid regulation by reversible protein phosphorylation. We have identified the major regulatory phosphorylation site as Ser-543, which is located in the hinge 1 region connecting the cytochrome b domain with the molybdenum-pterin cofactor binding domain of NR, using recombinant NR fragments containing or lacking the phosphorylation site sequence. Studies with NR partial reactions indicated that the block in electron flow caused by phosphorylation also could be localized to the hinge 1 region. A synthetic peptide (NR6) based on the phosphorylation site sequence was phosphorylated readily by NR kinase (NRk) in vitro. NR6 kinase activity tracked the ATP-dependent inactivation of NR during several chromatographic steps and completely inhibited inactivation/phosphorylation of native NR in vitro. Two forms of NRk were resolved by using anion exchange chromatography. Studies with synthetic peptide analogs indicated that both forms of NRk had similar specificity determinants, requiring a basic residue at P-3 (i.e., three amino acids N-terminal to the phosphorylated serine) and a hydrophobic residue at P-5. Both forms are strictly calcium dependent but belong to distinct families of protein kinases because they are distinct immunochemically.

  17. The transient catalytically competent coenzyme allocation into the active site of Anabaena ferredoxin NADP+ -reductase.


    Peregrina, José Ramón; Lans, Isaías; Medina, Milagros


    Ferredoxin-NADP(+) reductase (FNR) catalyses the electron transfer from ferredoxin to NADP(+) via its flavin FAD cofactor. A molecular dynamics theoretical approach is applied here to visualise the transient catalytically competent interaction of Anabaena FNR with its coenzyme, NADP(+). The particular role of some of the residues identified as key in binding and accommodating the 2'P-AMP moiety of the coenzyme is confirmed in molecular terms. Simulations also indicate that the architecture of the active site precisely contributes to the orientation of the N5 of the FAD isoalloxazine ring and the C4 of the coenzyme nicotinamide ring in the conformation of the catalytically competent hydride transfer complex and, therefore, contributes to the efficiency of the process. In particular, the side chain of the C-terminal Y303 in Anabaena FNR appears key to providing the optimum geometry by reducing the stacking probability between the isoalloxazine and nicotinamide rings, thus providing the required co-linearity and distance among the N5 of the flavin cofactor, the C4 of the coenzyme nicotinamide and the hydride that has to be transferred between them. All these factors are highly related to the reaction efficiency, mechanism and reversibility of the process.

  18. Aldose reductase in keratinocytes attenuates cellular apoptosis and senescence induced by UV radiation.


    Kang, Eun Sil; Iwata, Kazumi; Ikami, Kanako; Ham, Sun Ah; Kim, Hye Jung; Chang, Ki Churl; Lee, Jae Heun; Kim, Jae-Hwan; Park, Soo-Bong; Kim, Jin-Hoi; Yabe-Nishimura, Chihiro; Seo, Han Geuk


    Although aldose reductase (AR) has been implicated in the cellular response to oxidative stress, the role of AR in ultraviolet-B (UVB)-induced cellular injury has not been investigated. Here, we show that an increased expression of AR in human keratinocytes modulates UVB-induced apoptotic cell death and senescence. Overexpression of AR in HaCaT cells significantly attenuated UVB-induced cellular damage and apoptosis, with a decreased generation of reactive oxygen species (ROS) and aldehydes. Ablation of AR with small interfering RNA or inhibition of AR activity abolished these effects. We also show that increased AR activity suppressed UVB-induced activation of the p38 and c-Jun N-terminal kinases, but did not affect the extracellular signal-regulated kinase and phosphatidylinositol 3-kinase pathways. Similarly, UVB-induced translocation of Bax and Bcl-2 to mitochondria and cytosol, respectively, was markedly attenuated in cells overexpressing AR. Knockdown or inhibition of AR activity in primary cultured keratinocytes enhanced UVB-induced cellular senescence and increased the level of a cell-cycle regulatory protein, p53. Finally, cellular apoptosis induced by UVB radiation was significantly reduced in the epidermis of transgenic mice overexpressing human AR. These findings suggest that AR plays an important role in the cellular response to oxidative stress by sequestering ROS and reactive aldehydes generated in keratinocytes. Copyright © 2010 Elsevier Inc. All rights reserved.

  19. Evolution of plant δ1-pyrroline-5-carboxylate reductases from phylogenetic and structural perspectives


    Forlani, Giuseppe; Makarova, Kira S.; Ruszkowski, Milosz; ...


    Proline plays a crucial role in cell growth and stress responses, and its accumulation is essential for the tolerance of adverse environmental conditions in plants. Two routes are used to biosynthesize proline in plants. The main route uses glutamate as a precursor, while in the other route proline is derived from ornithine. The terminal step of both pathways, the conversion of δ1-pyrroline-5-carboxylate (P5C) to L-proline, is catalyzed by P5C reductase (P5CR) using NADH or NADPH as a cofactor. Since P5CRs are important housekeeping enzymes, they are conserved across all domains of life and appear to be relatively unaffected throughout evolution.more » However, global analysis of these enzymes unveiled significant functional diversity in the preference for cofactors (NADPH vs. NADH), variation in metal dependence and the differences in the oligomeric state. In our study we investigated evolutionary patterns through phylogenetic and structural analysis of P5CR representatives from all kingdoms of life, with emphasis on the plant species. We attempted to correlate local sequence/structure variation among the functionally and structurally characterized members of the family.« less

  20. Ralstonia solanacearum fatty acid composition is determined by interaction of two 3-ketoacyl-acyl carrier protein reductases encoded on separate replicons.


    Feng, Sai-Xiang; Ma, Jin-Cheng; Yang, Ji; Hu, Zhe; Zhu, Lei; Bi, Hong-Kai; Sun, Yi-Rong; Wang, Hai-Hong


    FabG is the only known enzyme that catalyzes reduction of the 3-ketoacyl-ACP intermediates of bacterial fatty acid synthetic pathways. However, there are two Ralstonia solanacearum genes, RSc1052 (fabG1) and RSp0359 (fabG2), annotated as encoding putative 3-ketoacyl-ACP reductases. Both FabG homologues possess the conserved catalytic triad and the N-terminal cofactor binding sequence of the short chain dehydrogenase/reductase (SDR) family. Thus, it seems reasonable to hypothesize that RsfabG1 and RsfabG2 both encode functional 3-ketoacyl-ACP reductases and play important roles in R. solanacearum fatty acid synthesis and growth. Complementation of Escherichia coli fabG temperature-sensitive mutant with R. solanacearum fabGs encoded plasmids was carried out to test the function of RsfabGs in fatty acid biosynthesis. RsFabGs proteins were purified by nickel chelate chromatography and fatty acid biosynthetic reaction was reconstituted to investigate the 3-ketoacyl-ACP reductase activity of RsFabGs in vitro. Disruption of both RsfabG genes was done via DNA homologous recombination to test the function of both RsfabG in vivo. And more we also carried out pathogenicity tests on tomato plants using RsfabG mutant strains.  We report that expression of either of the two proteins (RsFabG1 and RsFabG2) restores growth of the E. coli fabG temperature-sensitive mutant CL104 under non-permissive conditions. In vitro assays demonstrate that both proteins restore fatty acid synthetic ability to extracts of the E. coli strain. The RsfabG1 gene carried on the R. solanacearum chromosome is essential for growth of the bacterium, as is the case for fabG in E. coli. In contrast, the null mutant strain with the megaplasmid-encoded RsfabG2 gene is viable but has a fatty acid composition that differs significantly from that of the wild type strain. Our study also shows that RsFabG2 plays a role in adaptation to high salt concentration and low pH, and in pathogenesis of disease in tomato

  1. Epoxy-Resin Cable Terminations

    DTIC Science & Technology


    of epoxy- resin terminations , or end -fittings, to small diameter cables. Test samples were made using steel, titanium, and amorphous metal cable...15 vi NSWC TR 88-400 CHAITER 1 INTROIDUCTION The general function of end fittings, also referred to as terminations , is to allow the attachment of...instructions require that the termination body (henceforth referred to as’body’) be slipped over the end of the cable which is then unlaid and cleaned

  2. Human biliverdin reductase suppresses Goodpasture antigen-binding protein (GPBP) kinase activity: the reductase regulates tumor necrosis factor-alpha-NF-kappaB-dependent GPBP expression.


    Miralem, Tihomir; Gibbs, Peter E M; Revert, Fernando; Saus, Juan; Maines, Mahin D


    The Ser/Thr/Tyr kinase activity of human biliverdin reductase (hBVR) and the expression of Goodpasture antigen-binding protein (GPBP), a nonconventional Ser/Thr kinase for the type IV collagen of basement membrane, are regulated by tumor necrosis factor (TNF-alpha). The pro-inflammatory cytokine stimulates kinase activity of hBVR and activates NF-kappaB, a transcriptional regulator of GPBP mRNA. Increased GPBP activity is associated with several autoimmune conditions, including Goodpasture syndrome. Here we show that in HEK293A cells hBVR binds to GPBP and down-regulates its TNF-alpha-stimulated kinase activity; this was not due to a decrease in GPBP expression. Findings with small interfering RNA to hBVR and to the p65 regulatory subunit of NF-kappaB show the hBVR role in the initial stimulation of GPBP expression by TNF-alpha-activated NF-kappaB; hBVR was not a factor in mediating GPBP mRNA stability. The interacting domain was mapped to the (281)CX(10)C motif in the C-terminal 24 residues of hBVR. A 7-residue peptide, KKRILHC(281), corresponding to the core of the consensus D(delta)-Box motif in the interacting domain, was as effective as the intact 296-residue hBVR polypeptide in inhibiting GPBP kinase activity. GPBP neither regulated hBVR expression nor TNF-alpha dependent NF-kappaB expression. Collectively, our data reveal that hBVR is a regulator of the TNF-alpha-GPBP-collagen type IV signaling cascade and uncover a novel biological interaction that may be of relevance in autoimmune pathogenesis.

  3. Compensating for the absence of selenocysteine in high-molecular weight thioredoxin reductases: the electrophilic activation hypothesis.


    Lothrop, Adam P; Snider, Gregg W; Flemer, Stevenson; Ruggles, Erik L; Davidson, Ronald S; Lamb, Audrey L; Hondal, Robert J


    Mammalian thioredoxin reductase (TR) is a pyridine disulfide oxidoreductase that uses the rare amino acid selenocysteine (Sec) in place of the more commonly used amino acid cysteine (Cys). Selenium is a Janus-faced element because it is both highly nucleophilic and highly electrophilic. Cys orthologs of Sec-containing enzymes may compensate for the absence of a Sec residue by making the active site Cys residue more (i) nucleophilic, (ii) electrophilic, or (iii) reactive by increasing both S-nucleophilicity and S-electrophilicity. It has already been shown that the Cys ortholog TR from Drosophila melanogaster (DmTR) has increased S-nucleophilicity [Gromer, S., Johansson, L., Bauer, H., Arscott, L. D., Rauch, S., Ballou, D. P., Williams, C. H., Jr., Schrimer, R. H., and Arnér, E. S (2003) Active sites of thioredoxin reductases: Why selenoproteins? Proc. Natl. Acad. Sci. U.S.A. 100, 12618-12623]. Here we present evidence that DmTR also enhances the electrophilicity of Cys490 through the use of an "electrophilic activation" mechanism. This mechanism is proposed to work by polarizing the disulfide bond that occurs between Cys489 and Cys490 in the C-terminal redox center by the placement of a positive charge near Cys489. This polarization renders the sulfur atom of Cys490 electron deficient and enhances the rate of thiol/disulfide exchange that occurs between the N- and C-terminal redox centers. Our hypothesis was developed by using a strategy of homocysteine (hCys) for Cys substitution in the Cys-Cys redox dyad of DmTR to differentiate the function of each Cys residue. The results show that hCys could substitute for Cys490 with little loss of thioredoxin reductase activity, but that substitution of hCys for Cys489 resulted in a 238-fold reduction in activity. We hypothesize that replacement of Cys489 with hCys destroys an interaction between the sulfur atom of Cys489 and His464 crucial for the proposed electrophilic activation mechanism. This electrophilic activation

  4. Compensating for the Absence of Selenocysteine in High-Molecular Weight Thioredoxin Reductases: The Electrophilic Activation Hypothesis

    PubMed Central


    Mammalian thioredoxin reductase (TR) is a pyridine disulfide oxidoreductase that uses the rare amino acid selenocysteine (Sec) in place of the more commonly used amino acid cysteine (Cys). Selenium is a Janus-faced element because it is both highly nucleophilic and highly electrophilic. Cys orthologs of Sec-containing enzymes may compensate for the absence of a Sec residue by making the active site Cys residue more (i) nucleophilic, (ii) electrophilic, or (iii) reactive by increasing both S-nucleophilicity and S-electrophilicity. It has already been shown that the Cys ortholog TR from Drosophila melanogaster (DmTR) has increased S-nucleophilicity [Gromer, S., Johansson, L., Bauer, H., Arscott, L. D., Rauch, S., Ballou, D. P., Williams, C. H., Jr., Schrimer, R. H., and Arnér, E. S (2003) Active sites of thioredoxin reductases: Why selenoproteins? Proc. Natl. Acad. Sci. U.S.A. 100, 12618–12623]. Here we present evidence that DmTR also enhances the electrophilicity of Cys490 through the use of an “electrophilic activation” mechanism. This mechanism is proposed to work by polarizing the disulfide bond that occurs between Cys489 and Cys490 in the C-terminal redox center by the placement of a positive charge near Cys489. This polarization renders the sulfur atom of Cys490 electron deficient and enhances the rate of thiol/disulfide exchange that occurs between the N- and C-terminal redox centers. Our hypothesis was developed by using a strategy of homocysteine (hCys) for Cys substitution in the Cys-Cys redox dyad of DmTR to differentiate the function of each Cys residue. The results show that hCys could substitute for Cys490 with little loss of thioredoxin reductase activity, but that substitution of hCys for Cys489 resulted in a 238-fold reduction in activity. We hypothesize that replacement of Cys489 with hCys destroys an interaction between the sulfur atom of Cys489 and His464 crucial for the proposed electrophilic activation mechanism. This electrophilic

  5. Structure of the Molybdenum Site of EEcherichia Coli Trimethylamine N-Oxide Reductase

    SciTech Connect

    Zhang, L.; Nelson, K.Johnson; Rajagopalan, K.V.; George, G.N.


    We report a structural characterization of the molybdenum site of recombinant Escherichia coli trimethylamine N-oxide (TMAO) reductase using X-ray absorption spectroscopy. The enzyme active site shows considerable similarity to that of dimethyl sulfoxide (DMSO) reductase, in that, like DMSO reductase, the TMAO reductase active site can exist in multiple forms. Examination of the published crystal structure of TMAO oxidase from Shewanella massilia indicates that the postulated Mo coordination structure is chemically impossible. The presence of multiple active site structures provides a potential explanation for the anomalous features reported from the crystal structure.

  6. A flavone from Manilkara indica as a specific inhibitor against aldose reductase in vitro.


    Haraguchi, Hiroyuki; Hayashi, Ryosuke; Ishizu, Takashi; Yagi, Akira


    Isoaffinetin (5,7,3',4',5'-pentahydroxyflavone-6-C-glucoside) was isolated from Manilkara indica as a potent inhibitor of lens aldose reductase by bioassay-directed fractionation. This C-glucosyl flavone showed specific inhibition against aldose reductases (rat lens, porcine lens and recombinant human) with no inhibition against aldehyde reductase and NADH oxidase. Kinetic analysis showed that isoaffinetin exhibited uncompetitive inhibition against both dl-glyceraldehyde and NADPH. A structure-activity relationship study revealed that the increasing number of hydroxy groups in the B-ring contributes to the increase in aldose reductase inhibition by C-glucosyl flavones.

  7. Ammonification in Bacillus subtilis Utilizing Dissimilatory Nitrite Reductase Is Dependent on resDE

    PubMed Central

    Hoffmann, Tamara; Frankenberg, Nicole; Marino, Marco; Jahn, Dieter


    During anaerobic nitrate respiration Bacillus subtilis reduces nitrate via nitrite to ammonia. No denitrification products were observed. B. subtilis wild-type cells and a nitrate reductase mutant grew anaerobically with nitrite as an electron acceptor. Oxygen-sensitive dissimilatory nitrite reductase activity was demonstrated in cell extracts prepared from both strains with benzyl viologen as an electron donor and nitrite as an electron acceptor. The anaerobic expression of the discovered nitrite reductase activity was dependent on the regulatory system encoded by resDE. Mutation of the gene encoding the regulatory Fnr had no negative effect on dissimilatory nitrite reductase formation. PMID:9422613

  8. Regulation of Nitrate Reductase Activity in Corn (Zea mays L.) Seedlings by Endogenous Metabolites 1

    PubMed Central

    Schrader, L. E.; Hageman, R. H.


    Primary and secondary metabolites of inorganic nitrogen metabolism were evaluated as inhibitors of nitrate reductase (EC induction in green leaf tissue of corn seedlings. Nitrite, nitropropionic acid, ammonium ions, and amino acids were not effective as inhibitors of nitrate reductase activity or synthesis. Increasing α-amino nitrogen and protein content of intact corn seedlings by culture techniques significantly enhanced rather than decreased the potential for induction of nitrate reductase activity in excised seedlings. Secondary metabolites, derived from phenylalanine and tyrosine, were tested as inhibitors of induction of nitrate reductase. Of the 9 different phenylpropanoid compounds tested, only coumarin, trans-cinnamic and trans-o-hydroxycinnamic acids inhibited induction of nitrate reductase. While coumarin alone exhibited a relatively greater inhibitory effect on enzyme induction than on general protein synthesis (the latter measured by incorporation of labeled amino acids), this differential effect may have been dependent upon unequal rates of synthesis and accumulation with respect to the initial levels of nitrate reductase and general proteins. Because of the short half-life of nitrate reductase, inhibitors of protein synthesis in general could still achieve differential regulation of nitrogen metabolism. Coumarin did not inhibit nitrate reductase activity when added directly to the assay mixture at 5 mm. Carbamyl phosphate and its chemical derivative, cyanate, were found to be competitive (with nitrate) inhibitors of nitrate reductase. The data suggest that cyanate is the active inhibitor in the carbamyl phosphate preparations. PMID:16656715

  9. The inhibitory activity of aldose reductase in vitro by constituents of Garcinia mangostana Linn.


    Fatmawati, Sri; Ersam, Taslim; Shimizu, Kuniyoshi


    We investigated aldose reductase inhibition of Garcinia mangostana Linn. from Indonesia. Dichloromethane extract of the root bark of this tree was found to demonstrate an IC50 value of 11.98 µg/ml for human aldose reductase in vitro. From the dichloromethane fraction, prenylated xanthones were isolated as potent human aldose reductase inhibitors. We discovered 3-isomangostin to be most potent against aldose reductase, with an IC50 of 3.48 µM. Copyright © 2014 Elsevier GmbH. All rights reserved.

  10. Identification of the 7-Hydroxymethyl Chlorophyll a Reductase of the Chlorophyll Cycle in Arabidopsis[W

    PubMed Central

    Meguro, Miki; Ito, Hisashi; Takabayashi, Atsushi; Tanaka, Ryouichi; Tanaka, Ayumi


    The interconversion of chlorophyll a and chlorophyll b, referred to as the chlorophyll cycle, plays a crucial role in the processes of greening, acclimation to light intensity, and senescence. The chlorophyll cycle consists of three reactions: the conversions of chlorophyll a to chlorophyll b by chlorophyllide a oxygenase, chlorophyll b to 7-hydroxymethyl chlorophyll a by chlorophyll b reductase, and 7-hydroxymethyl chlorophyll a to chlorophyll a by 7-hydroxymethyl chlorophyll a reductase. We identified 7-hydroxymethyl chlorophyll a reductase, which is the last remaining unidentified enzyme of the chlorophyll cycle, from Arabidopsis thaliana by genetic and biochemical methods. Recombinant 7-hydroxymethyl chlorophyll a reductase converted 7-hydroxymethyl chlorophyll a to chlorophyll a using ferredoxin. Both sequence and biochemical analyses showed that 7-hydroxymethyl chlorophyll a reductase contains flavin adenine dinucleotide and an iron-sulfur center. In addition, a phylogenetic analysis elucidated the evolution of 7-hydroxymethyl chlorophyll a reductase from divinyl chlorophyllide vinyl reductase. A mutant lacking 7-hydroxymethyl chlorophyll a reductase was found to accumulate 7-hydroxymethyl chlorophyll a and pheophorbide a. Furthermore, this accumulation of pheophorbide a in the mutant was rescued by the inactivation of the chlorophyll b reductase gene. The downregulation of pheophorbide a oxygenase activity is discussed in relation to 7-hydroxymethyl chlorophyll a accumulation. PMID:21934147

  11. Is Lake Tahoe Terminal?

    NASA Astrophysics Data System (ADS)

    Coats, R. N.; Reuter, J.; Heyvaert, A.; Lewis, J.; Sahoo, G. B.; Schladow, G.; Thorne, J. H.


    ) the climatic water deficit will increase, especially at high elevations that will be most affected by the loss of snow, with likely consequences for existing vegetation and fire frequency. Hydrologically, Lake Tahoe is intermittently terminal; in a medical sense it is not yet terminal, but its condition—especially its valued clarity and deep blue color--is serious.

  12. SCATHA mission termination report

    NASA Astrophysics Data System (ADS)

    Stakkestad, Kjell; Fennessey, Richard


    nearly complete lack of available telemetry data, large undamped motion of the long booms, inadequacies in attitude determination software, and an error in the fuel level calculation software. This paper discusses the various proposed termination plans and execution of the selected one. Attitude determination methodologies, nutation from maneuvers, and effects of the flexible booms on the termination mission are presented and analyzed from a satellite analyst point of view.

  13. SCATHA mission termination report

    NASA Technical Reports Server (NTRS)

    Stakkestad, Kjell; Fennessey, Richard


    nearly complete lack of available telemetry data, large undamped motion of the long booms, inadequacies in attitude determination software, and an error in the fuel level calculation software. This paper discusses the various proposed termination plans and execution of the selected one. Attitude determination methodologies, nutation from maneuvers, and effects of the flexible booms on the termination mission are presented and analyzed from a satellite analyst point of view.

  14. Components of glycine reductase from Eubacterium acidaminophilum. Cloning, sequencing and identification of the genes for thioredoxin reductase, thioredoxin and selenoprotein PA.


    Lübbers, M; Andreesen, J R


    The genes encoding thioredoxin reductase (trxB), thioredoxin (trxA), protein PA of glycine reductase (grdA) and the first 23 amino acids of the large subunit of protein PC of glycine reductase (grdC) belonging to the reductive deamination systems present in Eubacterium acidaminophilum were cloned and sequenced. The proteins were products of closely linked genes with 314 codons (thioredoxin reductase), 110 codons (thioredoxin), and 158 codons (protein PA). The protein previously called 'atypically small lipoamide dehydrogenase' or 'electron transferring flavoprotein' could now conclusively be identified as a thioredoxin reductase (subunit mass of 34781 Da) by the alignment with the enzyme of Escherichia coli showing the same typical order of the corresponding domains. The thioredoxin (molecular mass of 11742 Da) deviated considerably from the known consensus sequence, even in the most strongly conserved redox-active segment WCGPC that was now GCVPC. The selenocysteine of protein PA (molecular mass of 16609 Da) was encoded by TGA. The protein was highly similar to those of Clostridium purinolyticum and Clostridium sticklandii involved in glycine reductase. Thioredoxin reductase and thioredoxin of E. acidaminophilum could be successfully expressed in E. coli.

  15. [Terminal ballistics. 1].


    Mangiante, G; Dagradi, V; Radin, S; Carolo, F; Giarolli, M; Tenci, A; Merico, G; Tosi, D; Acerbi, A; Della Giacoma, G


    We have chosen to conceive of terminal ballistics as a violent and extremely rapid confrontation between two forms of resistance before the final state of rest is reached. This definition, which cannot help but don the admittedly loud and outlandish garb of physics, is the most promising for the purposes of biological interpretation. The main characters on this stage are two, but only one of these really plays the lead, namely the human target, which acts out the basic roles inherent in its physical make-up; the other, the bullet, remains a background figure, frozen in its walk-on part, and ready for the next performance. This modus operandi, which is no simplification, but rather an academic necessity, enables us to focus on images which stand out more clearly as a result of an intensive macroscopic spotlight which brings out the features of the individual phenomena, broken down into a succession of close-ups, and subtracts them from the cold physical nature of this or that form of inert matter, which here is merely an occasional, disagreeable witness, or even more, a standing from time to time for but one of the infinite facets of the biological composite being. Here, then, faced with a kind of exploded macrophotograph of a complex kaleidoscope, we see the animal universe, of which we capture so far the plasticity, the subdivisibility, the anisotropy and the cavitation.

  16. Terminal Descent Sensor Simulation

    NASA Technical Reports Server (NTRS)

    Chen, Curtis W.


    Sulcata software simulates the operation of the Mars Science Laboratory (MSL) radar terminal descent sensor (TDS). The program models TDS radar antennas, RF hardware, and digital processing, as well as the physics of scattering from a coherent ground surface. This application is specific to this sensor and is flexible enough to handle end-to-end design validation. Sulcata is a high-fidelity simulation and is used for performance evaluation, anomaly resolution, and design validation. Within the trajectory frame, almost all internal vectors are represented in whatever coordinate system is used to represent platform position. The trajectory frame must be planet-fixed. The platform body frame is specified relative to arbitrary reference points relative to the platform (spacecraft or test vehicle). Its rotation is a function of time from the trajectory coordinate system specified via dynamics input (file for open loop, callback for closed loop). Orientation of the frame relative to the body is arbitrary, but constant over time. The TDS frame must have a constant rotation and translation from the platform body frame specified at run time. The DEM frame has an arbitrary, but time-constant, rotation and translation with respect to the simulation frame specified at run time. It has the same orientation as sigma0 frame, but is possibly translated. Surface sigma0 has the same arbitrary rotation and translation as DEM frame.

  17. Terminal illness and suicide.


    Leikin, Sanford; McCormick, Richard A


    Case vignette: Henry, age 19, has been under medical care struggling for 5 months with a non-Hodgkin's lymphoma that has been resistant to treatment. Proven chemotherapy protocols have failed to sustain a remission, and it is evident that his condition is terminal, although not immediately so. When not in temporary remissions he is in extreme pain. The quantity of analgesic medication needed to control the pain also leaves him feeling, in his own words, "too snowed out to do anything." During his last hospital admission, a week ago, he had talked obliquely about ending his life when signs of another painful relapse become evident. Today he appeared in the outpatient clinic, although he had no appointment scheduled. He sought out several of the people who had cared for him over the past few months to thank them and to "say good-bye." He gave some prized personal possessions to one or two of the staff with whom he felt especially close. As this was happening, some of the staff members realized that Henry had a sufficient stock of narcotics at home to end his life. Our commentators are Sanford Leikin, MD, and Richard A. McCormick, SJ.

  18. Anchored terminal conductor

    SciTech Connect

    Milewski, M.A.; Delmolino, W.P.


    An electrochemical cell is described comprising a cell container which is closed by a resilient insulative cell top and an electrode conductor inserted through the cell top and into an electrode of the cell, with the electrode conductor being physically and electrically accessible to the exterior of the cell whereby it functions as a terminal for the electrode, and wherein a portion of the electrode conductor is enclosed within the cell top, characterized in that the cell further comprises means for substantially restraining movement of the electrode conductor relative to the cell top. The electrode conductor has a nail configuration comprising a head and a shank with the head of the nail providing the external physical and electrical accessibility, wherein the restraining means is integrated with the shank of the nail. The restraining means is positioned on the shank, interior to the cell container and below the interior surface of the cell top and in close juxtaposition to the interior surface. The restraining means comprises a circumferential barb longitudinally disposed on the shank and having an upper portion which engages the interior surface to provide the substantial restraining of movement.

  19. War Termination: A Selected Bibliography

    DTIC Science & Technology


    Peace Research 33, no. 4 (November 1996): 491-496. JSTOR Phinney, Catherine. "Enhancing Conflict Termination through Problem Solving...96." Journal of Peace Research 34, no. 3 (August 1997): 339-358. JSTOR Bibliographies Bibliography Branch, comp. Conflict Termination

  20. 49 CFR 1242.27 - Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals, motor...

    Code of Federal Regulations, 2010 CFR


    .../COFC terminals, other marine terminals, motor vehicle loading and distribution facilities, and facilities for other specialized service operations (accounts XX-13-29 to XX-13-35, inclusive). 1242.27..., motor vehicle loading and distribution facilities, and facilities for other specialized service...

  1. Good Endings: Managing Employee Terminations.

    ERIC Educational Resources Information Center

    Finnie, Robert A., Jr.; Sniffin, Paul B.

    A guide to managing employee terminations and resulting changes is presented for administrators. Three reasons for termination that are legitimate, nondiscriminatory, and acceptable in today's marketplace and courts are: cause (serious misconduct, dishonesty, unethical, or dangerous behavior); job elimination (reduction in force, economic…

  2. Chlorate reductase is cotranscribed with cytochrome c and other downstream genes in the gene cluster for chlorate respiration of Ideonella dechloratans.


    Hellberg Lindqvist, Miriam; Nilsson, Thomas; Sundin, Pontus; Rova, Maria


    The chlorate-respiring bacterium Ideonella dechloratans is a facultative anaerobe that can use both oxygen and chlorate as terminal electron acceptors. The genes for the enzymes chlorate reductase (clrABDC) and chlorite dismutase, necessary for chlorate metabolism and probably acquired by lateral gene transfer, are located in a gene cluster that also includes other genes potentially important for chlorate metabolism. Among those are a gene for cytochrome c (cyc) whose gene product may serve as an electron carrier during chlorate reduction, a cofactor biosynthesis gene (mobB) and a predicted transcriptional regulator (arsR). Only chlorate reductase and chlorite dismutase have been shown to be expressed in vivo. Here, we report the in vivo production of a single polycistronic transcript covering eight open reading frames including clrABDC, cyc, mobB and arsR. Transcription levels of the cyc and clrA genes were compared to each other by the use of qRT-PCR in RNA preparations from cells grown under aerobic or chlorate reducing anaerobic conditions. The two genes showed the same mRNA levels under both growth regimes, indicating that no transcription termination occurs between them. Higher transcription levels were observed at growth without external oxygen supply. Implications for electron pathway integration following lateral gene transfer are discussed.

  3. Perchlorate Reductase Is Distinguished by Active Site Aromatic Gate Residues.


    Youngblut, Matthew D; Tsai, Chi-Lin; Clark, Iain C; Carlson, Hans K; Maglaqui, Adrian P; Gau-Pan, Phonchien S; Redford, Steven A; Wong, Alan; Tainer, John A; Coates, John D


    Perchlorate is an important ion on both Earth and Mars. Perchlorate reductase (PcrAB), a specialized member of the dimethylsulfoxide reductase superfamily, catalyzes the first step of microbial perchlorate respiration, but little is known about the biochemistry, specificity, structure, and mechanism of PcrAB. Here we characterize the biophysics and phylogeny of this enzyme and report the 1.86-Å resolution PcrAB complex crystal structure. Biochemical analysis revealed a relatively high perchlorate affinity (Km = 6 μm) and a characteristic substrate inhibition compared with the highly similar respiratory nitrate reductase NarGHI, which has a relatively much lower affinity for perchlorate (Km = 1.1 mm) and no substrate inhibition. Structural analysis of oxidized and reduced PcrAB with and without the substrate analog SeO3 (2-) bound to the active site identified key residues in the positively charged and funnel-shaped substrate access tunnel that gated substrate entrance and product release while trapping transiently produced chlorate. The structures suggest gating was associated with shifts of a Phe residue between open and closed conformations plus an Asp residue carboxylate shift between monodentate and bidentate coordination to the active site molybdenum atom. Taken together, structural and mutational analyses of gate residues suggest key roles of these gate residues for substrate entrance and product release. Our combined results provide the first detailed structural insight into the mechanism of biological perchlorate reduction, a critical component of the chlorine redox cycle on Earth. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Structural and Biochemical Characterization of Cinnamoyl-CoA Reductases.


    Sattler, Steven A; Walker, Alexander M; Vermerris, Wilfred; Sattler, Scott E; Kang, ChulHee


    Cinnamoyl-coenzyme A reductase (CCR) catalyzes the reduction of hydroxycinnamoyl-coenzyme A (CoA) esters using NADPH to produce hydroxycinnamyl aldehyde precursors in lignin synthesis. The catalytic mechanism and substrate specificity of cinnamoyl-CoA reductases from sorghum (Sorghum bicolor), a strategic plant for bioenergy production, were deduced from crystal structures, site-directed mutagenesis, and kinetic and thermodynamic analyses. Although SbCCR1 displayed higher affinity for caffeoyl-CoA or p-coumaroyl-CoA than for feruloyl-CoA, the enzyme showed significantly higher activity for the latter substrate. Through molecular docking and comparisons between the crystal structures of the Vitis vinifera dihydroflavonol reductase and SbCCR1, residues threonine-154 and tyrosine-310 were pinpointed as being involved in binding CoA-conjugated phenylpropanoids. Threonine-154 of SbCCR1 and other CCRs likely confers strong substrate specificity for feruloyl-CoA over other cinnamoyl-CoA thioesters, and the T154Y mutation in SbCCR1 led to broader substrate specificity and faster turnover. Through data mining using our structural and biochemical information, four additional putative CCR genes were discovered from sorghum genomic data. One of these, SbCCR2, displayed greater activity toward p-coumaroyl-CoA than did SbCCR1, which could imply a role in the synthesis of defense-related lignin. Taken together, these findings provide knowledge about critical residues and substrate preference among CCRs and provide, to our knowledge, the first three-dimensional structure information for a CCR from a monocot species.

  5. Thioredoxin Glutathione Reductase-Dependent Redox Networks in Platyhelminth Parasites

    PubMed Central

    Bonilla, Mariana; Gladyshev, Vadim N.


    Abstract Significance: Platyhelminth parasites cause chronic infections that are a major cause of disability, mortality, and economic losses in developing countries. Maintaining redox homeostasis is a major adaptive problem faced by parasites and its disruption can shift the biochemical balance toward the host. Platyhelminth parasites possess a streamlined thiol-based redox system in which a single enzyme, thioredoxin glutathione reductase (TGR), a fusion of a glutaredoxin (Grx) domain to canonical thioredoxin reductase (TR) domains, supplies electrons to oxidized glutathione (GSSG) and thioredoxin (Trx). TGR has been validated as a drug target for schistosomiasis. Recent Advances: In addition to glutathione (GSH) and Trx reduction, TGR supports GSH-independent deglutathionylation conferring an additional advantage to the TGR redox array. Biochemical and structural studies have shown that the TR activity does not require the Grx domain, while the glutathione reductase and deglutathionylase activities depend on the Grx domain, which receives electrons from the TR domains. The search for TGR inhibitors has identified promising drug leads, notably oxadiazole N-oxides. Critical Issues: A conspicuous feature of platyhelminth TGRs is that their Grx-dependent activities are temporarily inhibited at high GSSG concentrations. The mechanism underlying the phenomenon and its biological relevance are not completely understood. Future Directions: The functional diversity of Trxs and Grxs encoded in platyhelminth genomes remains to be further assessed to thoroughly understand the TGR-dependent redox network. Optimization of TGR inhibitors and identification of compounds targeting other parasite redox enzymes are good options to clinically develop relevant drugs for these neglected, but important diseases. Antioxid. Redox Signal. 19, 735–745. PMID:22909029

  6. Purification and properties of nitrate reductase from Mitsuokella multiacidus.


    Yamamoto, I; Shimizu, H; Tsuji, T; Ishimoto, M


    Nitrate reductase of Mitsuokella multiacidus (formerly Bacteroides multiacidus) was solublized from the membrane fraction with 1% sodium deoxycholate and purified 40-fold by immunoaffinity chromatography on the antibody-Affi-Gel 10 column. The preparation showed a major band (86% of total protein) with enzyme activity and a minor band on polyacrylamide gel after disc electrophoresis in the presence of 0.1% Triton X-100. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis gave a major band, the relative mobility of which corresponded to a molecular weight of 160,000, and two minor bands. The molecular weight of the enzyme was determined to be 160,000 by gel filtration on Bio-Gel A-1.5 m in the presence of 0.1% deoxycholate. Molybdenum cofactor was detected in the enzyme by fluorescence spectroscopy and by complementation of nitrate reductase from the nit-1 mutant of Neurospora crassa. The M. multiacidus enzyme catalyzed reduction of nitrate, chlorate, and bromate using methyl viologen as an electron donor. The maximal activity was found at pH 6.2-7.5 for nitrate reduction. Either methyl or benzyl viologen served well as the electron donor, but FAD, FMN, and horse heart cytochrome c were not effective. Ferredoxin from Clostridium pasteurianum supplied electron to the nitrate reductase. The purified enzyme had Km values of 0.13 mM, 0.12 mM, and 0.22 mM for nitrate, methyl viologen, and ferredoxin, respectively. The enzyme activity was inhibited by cyanide (85% at 1 mM), azide (88% at 0.1 mM), and thiocyanate (75% at 10 mM).

  7. Modulating hemoglobin nitrite reductase activity through allostery: a mathematical model.


    Rong, Zimei; Alayash, Abdu I; Wilson, Michael T; Cooper, Chris E


    The production of nitric oxide by hemoglobin (Hb) has been proposed to play a major role in the control of blood flow. Because of the allosteric nature of hemoglobin, the nitrite reductase activity is a complex function of oxygen partial pressure PO2. We have previous developed a model to obtain the micro rate constants for nitrite reduction by R state (kR) and T state (kT) hemoglobin in terms of the experimental maximal macro rate constant kNmax and the corresponding oxygen concentration PO2max. However, because of the intrinsic difficulty in obtaining accurate macro rate constant kN, from available experiments, we have developed an alternative method to determine the micro reaction rate constants (kR and kT) by fitting the simulated macro reaction rate curve (kN versus PO2) to the experimental data. We then use our model to analyze the effect of pH (Bohr Effect) and blood ageing on the nitrite reductase activity, showing that the fall of bisphosphoglycerate (BPG) during red cell storage leads to increase NO production. Our model can have useful predictive and explanatory power. For example, the previously described enhanced nitrite reductase activity of ovine fetal Hb, in comparison to the adult protein, may be understood in terms of a weaker interaction with BPG and an increase in the value of kT from 0.0087M(-1)s(-1) to 0.083M(-1)s(-1). Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Regioselectivity of nitroglycerin denitration by flavoprotein nitroester reductases purified from two Pseudomonas species.

    PubMed Central

    Blehert, D S; Knoke, K L; Fox, B G; Chambliss, G H


    Two species of Pseudomonas capable of utilizing nitroglycerin (NG) as a sole nitrogen source were isolated from NG-contaminated soil and identified as Pseudomonas putida II-B and P. fluorescens I-C. While 9 of 13 laboratory bacterial strains that presumably had no previous exposure to NG could degrade low concentrations of NG (0.44 mM), the natural isolates tolerated concentrations of NG that were toxic to the lab strains (1.76 mM and higher). Whole-cell studies revealed that the two natural isolates produced different mixtures of the isomers of dinitroglycerol (DNG) and mononitroglycerol (MNG). A monomeric, flavin mononucleotide-containing NG reductase was purified from each natural isolate. These enzymes catalyzed the NADPH-dependent denitration of NG, yielding nitrite. Apparent kinetic constants were determined for both reductases. The P. putida enzyme had a Km for NG of 52 +/- 4 microM, a Km for NADPH of 28 +/- 2 microM, and a Vmax of 124 +/- 6 microM x min(-1), while the P. fluorescens enzyme had a Km for NG of 110 +/- 10 microM, a Km for NADPH of 5 +/- 1 microM, and a Vmax of 110 +/- 11 microM x min(-1). Anaerobic titration experiments confirmed the stoichiometry of NADPH consumption, changes in flavin oxidation state, and multiple steps of nitrite removal from NG. The products formed during time-dependent denitration reactions were consistent with a single enzyme being responsible for the in vivo product distributions. Simulation of the product formation kinetics by numerical integration showed that the P. putida enzyme produced an approximately 2-fold molar excess of 1,2-DNG relative to 1,3-DNG. This result could be fortuitous or could possibly be consistent with a random removal of the first nitro group from either the terminal (C-1 and C-3) positions or middle (C-2) position. However, during the denitration of 1,2-DNG, a 1.3-fold selectivity for the C-1 nitro group was determined. Comparable simulations of the product distributions from the P. fluorescens

  9. The practice of terminal discharge.


    Radha Krishna, Lalit Kumar; Murugam, Vengadasalam; Quah, Daniel Song Chiek


    'Terminal discharges' are carried out in Singapore for patients who wish to die at home. However, if due diligence is not exercised, parallels may be drawn with euthanasia. We present a theoretical discussion beginning with the definition of terminal discharges and the reasons why they are carried out in Singapore. By considering the intention behind terminal discharges and utilising a multidisciplinary team to deliberate on the clinical, social and ethical intricacies with a patient- and context-specific approach, euthanasia is avoided. It is hoped that this will provide a platform for professionals in palliative medicine to negotiate challenging issues when arranging a terminal discharge, so as to avoid the pitfall of committing euthanasia in a country such as Singapore where euthanasia is illegal. It is hoped that a set of guidelines for terminal discharges may someday be realised to assist professionals in Singapore and around the world.

  10. Terpenoids from Diplophyllum taxifolium with quinone reductase-inducing activity.


    Wang, Xiao; Zhang, Jiao-Zhen; Zhou, Jin-Chuan; Shen, Tao; Lou, Hong-Xiang


    Two new ent-prenylaromadendrane-type diterpenoids, diplotaxifols A (1) and B (2), a new ent-eudesmol, ent-eudesma-4(15),11(13)-dien-6α,12-diol (3), eight new eudesmanolides enantiomers (4-11) of the corresponding compounds from higher plants along with four known ent-eudesmanolides (12-15) were isolated from the 95% EtOH extract of Chinese liverwort Diplophyllum taxifolium. Their structures were elucidated on the basis of MS, NMR and IR spectral data, and confirmed by single-crystal X-ray diffraction analysis. The quinone reductase-inducing activity of the compounds was evaluated.

  11. Applications of Carboxylic Acid Reductases in Oleaginous Microbes

    SciTech Connect

    Resch, Michael G.; Linger, Jeffrey; McGeehan, John; Tyo, Keith; Beckham, Gregg


    Carboxylic acid reductases (CARs) are recently emerging reductive enzymes for the direct production of aldehydes from biologically-produced carboxylic acids. Recent work has demonstrated that these powerful enzymes are able to reduce a very broad range of volatile- to long-chain fatty acids as well as aromatic acids. Here, we express four CAR enzymes from different fungal origins to test their activity against fatty acids commonly produced in oleaginous microbes. These in vitro results will inform metabolic engineering strategies to conduct mild biological reduction of carboxylic acids in situ, which is conventionally done via hydrotreating catalysis at high temperatures and hydrogen pressures.

  12. The dynamic energy landscape of dihydrofolate reductase catalysis.


    Boehr, David D; McElheny, Dan; Dyson, H Jane; Wright, Peter E


    We used nuclear magnetic resonance relaxation dispersion to characterize higher energy conformational substates of Escherichia coli dihydrofolate reductase. Each intermediate in the catalytic cycle samples low-lying excited states whose conformations resemble the ground-state structures of preceding and following intermediates. Substrate and cofactor exchange occurs through these excited substates. The maximum hydride transfer and steady-state turnover rates are governed by the dynamics of transitions between ground and excited states of the intermediates. Thus, the modulation of the energy landscape by the bound ligands funnels the enzyme through its reaction cycle along a preferred kinetic path.

  13. Methylenetetrahydrofolate Reductase C677T: Hypoplastic Left Heart and Thrombosis.


    Spronk, Kimberly J; Olivero, Anthony D; Haw, Marcus P; Vettukattil, Joseph J


    The incidence of congenital heart defects is higher in infants with mutation of methylenetetrahydrofolate reductase (MTHFR) gene. The MTHFR C677T gene decreases the bioavailability of folate and increases plasma homocysteine, a risk factor for thrombosis. There have been no reported cases in the literature on the clinical implications of this procoagulable state in the setting of cyanotic heart disease, which itself has prothrombotic predisposition. Two patients with hypoplastic left heart syndrome developed postoperative thrombotic complications, both were homozygous for MTHFR C677T. We present these cases and highlight the implications of MTHFR mutation in the management of complex congenital heart disease. © The Author(s) 2015.

  14. Differential Light Induction of Nitrate Reductases in Greening and Photobleached Soybean Seedlings 1

    PubMed Central

    Kakefuda, Genichi; Duke, Stanley H.; Duke, Stephen O.


    Soybean (Glycine max [L.] Merr.) seeds were imbibed and germinated with or without NO3−, tungstate, and norflurazon (San 9789). Norflurazon is a herbicide which causes photobleaching of chlorophyll by inhibiting carotenoid synthesis and which impairs normal chloroplast development. After 3 days in the dark, seedlings were placed in white light to induce extractable nitrate reductase activity. The induction of maximal nitrate reductase activity in greening cotyledons did not require NO3− and was not inhibited by tungstate. Induction of nitrate reductase activity in norflurazon-treated cotyledons had an absolute requirement for NO3− and was completely inhibited by tungstate. Nitrate was not detected in seeds or seedlings which had not been treated with NO3−. The optimum pH for cotyledon nitrate reductase activity from norflurazon-treated seedlings was at pH 7.5, and near that for root nitrate reductase activity, whereas the optimum pH for nitrate reductase activity from greening cotyledons was pH 6.5. Induction of root nitrate reductase activity was also inhibited by tungstate and was dependent on the presence of NO3−, further indicating that the isoform of nitrate reductase induced in norflurazon-treated cotyledons is the same or similar to that found in roots. Nitrate reductases with and without a NO3− requirement for light induction appear to be present in developing leaves. In vivo kinetics (light induction and dark decay rates) and in vitro kinetics (Arrhenius energies of activation and NADH:NADPH specificities) of nitrate reductases with and without a NO3− requirement for induction were quite different. Km values for NO3− were identical for both nitrate reductases. PMID:16663185

  15. A Novel NADPH-dependent flavoprotein reductase from Bacillus megaterium acts as an efficient cytochrome P450 reductase.


    Milhim, Mohammed; Gerber, Adrian; Neunzig, Jens; Hannemann, Frank; Bernhardt, Rita


    Cytochromes P450 (P450s) require electron transfer partners to catalyze substrate conversions. With regard to biotechnological approaches, the elucidation of novel electron transfer proteins is of special interest, as they can influence the enzymatic activity and specificity of the P450s. In the current work we present the identification and characterization of a novel soluble NADPH-dependent diflavin reductase from Bacillus megaterium with activity towards a bacterial (CYP106A1) and a microsomal (CYP21A2) P450 and, therefore, we referred to it as B. megaterium cytochrome P450 reductase (BmCPR). Sequence analysis of the protein revealed besides the conserved FMN-, FAD- and NADPH-binding motifs, the presence of negatively charged cluster, which is thought to represent the interaction domain with P450s and/or cytochrome c. BmCPR was expressed and purified to homogeneity in Escherichia coli. The purified BmCPR exhibited a characteristic diflavin reductase spectrum, and showed a cytochrome c reducing activity. Furthermore, in an in vitro reconstituted system, the BmCPR was able to support the hydroxylation of testosterone and progesterone with CYP106A1 and CYP21A2, respectively. Moreover, in view of the biotechnological application, the BmCPR is very promising, as it could be successfully utilized to establish CYP106A1- and CYP21A2-based whole-cell biotransformation systems, which yielded 0.3g/L hydroxy-testosterone products within 8h and 0.16g/L 21-hydroxyprogesterone within 6h, respectively. In conclusion, the BmCPR reported herein owns a great potential for further applications and studies and should be taken into consideration for bacterial and/or microsomal CYP-dependent bioconversions.

  16. Crystallization of the C-terminal redox domain of the sulfur-assimilatory enzyme APR1 from Arabidopsis thaliana.


    Chen, Fang-Fang; Chang, Yu-Yung; Cho, Chao-Cheng; Hsu, Chun-Hua


    Plant-type APS reductase (APR), which catalyzes the reduction of activated sulfate to sulfite in plants, consists of a reductase domain and a C-terminal redox domain showing sequence homology to thioredoxin but possessing the activity of glutaredoxin. In order to understand the structural and biochemical properties of the redox domain of plant-type APS reductase, the C-terminal domain of APR1 (APR1C) from Arabidopsis thaliana was crystallized using the sitting-drop vapour-diffusion method. X-ray diffraction data were collected to a resolution of 2.70 Å on the SPXF beamline BL13B1 at the NSRRC, Taiwan. The crystals belonged to space group P43212 or P41212, with unit-cell parameters a = b = 58.2, c = 86.7 Å. With one molecule per asymmetric unit, the crystal volume per unit protein weight (VM) is 2.64 Å(3) Da(-1), which corresponds to a solvent content of approximately 53.49%. Further structure-based functional studies of APR1C would extend knowledge of the molecular mechanism and regulation of APR.

  17. Hydroxyurea-resistant vaccinia virus: overproduction of ribonucleotide reductase

    SciTech Connect

    Slabaugh, M.B.; Mathews, C.K.


    Repeated passage of vaccinia virus in increasing concentrations of hydroxyurea followed by plaque purification resulted in the isolation of variants capable of growth in 5 mM hydroxyurea, a drug concentration which inhibited the reproduction of wild-type vaccinia virus 1000-fold. Analyses of viral protein synthesis by using (/sup 35/S)methionine pulse-labeling at intervals throughout the infection cycle revealed that all isolates overproduced a 34,000-molecular-weight (MW) early polypeptide. Measurement of ribonucleoside-diphosphate reductase activity after infection indicated that 4- to 10-fold more activity was induced by hydroxyurea-resistant viruses than by the wild-type virus. A two-step partial purification resulted in a substantial enrichment for the 34,000-MW protein from extracts of wild-type and hydroxyurea-resistant-virus-infected, but not mock-infected, cells. In the presence of the drug, the isolates incorporated (/sup 3/H)thymidine into DNA earlier and a rate substantially greater than that of the wild type, although the onset of DNA synthesis was delayed in both cases. The drug resistance trait was markedly unstable in all isolates. In the absence of selective pressure, plaque-purified isolated readily segregated progeny that displayed a wide range of resistance phenotypes. The results of this study indicate that vaccinia virus encodes a subunit of ribonucleotide reductase which is 34,000-MW early protein whose overproduction confers hydroxyurea resistance on reproducing viruses.

  18. Increased nitrite reductase activity of fetal versus adult ovine hemoglobin

    PubMed Central

    Blood, Arlin B.; Tiso, Mauro; Verma, Shilpa T.; Lo, Jennifer; Joshi, Mahesh S.; Azarov, Ivan; Longo, Lawrence D.; Gladwin, Mark T.; Kim-Shapiro, Daniel B.; Power, Gordon G.


    Growing evidence indicates that nitrite, NO2−, serves as a circulating reservoir of nitric oxide (NO) bioactivity that is activated during physiological and pathological hypoxia. One of the intravascular mechanisms for nitrite conversion to NO is a chemical nitrite reductase activity of deoxyhemoglobin. The rate of NO production from this reaction is increased when hemoglobin is in the R conformation. Because the mammalian fetus exists in a low-oxygen environment compared with the adult and is exposed to episodes of severe ischemia during the normal birthing process, and because fetal hemoglobin assumes the R conformation more readily than adult hemoglobin, we hypothesized that nitrite reduction to NO may be enhanced in the fetal circulation. We found that the reaction was faster for fetal than maternal hemoglobin or blood and that the reactions were fastest at 50–80% oxygen saturation, consistent with an R-state catalysis that is predominant for fetal hemoglobin. Nitrite concentrations were similar in blood taken from chronically instrumented normoxic ewes and their fetuses but were elevated in response to chronic hypoxia. The findings suggest an augmented nitrite reductase activity of fetal hemoglobin and that the production of nitrite may participate in the regulation of vascular NO homeostasis in the fetus. PMID:19028797

  19. Bcl2 induces DNA replication stress by inhibiting ribonucleotide reductase.


    Xie, Maohua; Yen, Yun; Owonikoko, Taofeek K; Ramalingam, Suresh S; Khuri, Fadlo R; Curran, Walter J; Doetsch, Paul W; Deng, Xingming


    DNA replication stress is an inefficient DNA synthesis process that leads replication forks to progress slowly or stall. Two main factors that cause replication stress are alterations in pools of deoxyribonucleotide (dNTP) precursors required for DNA synthesis and changes in the activity of proteins required for synthesis of dNTPs. Ribonucleotide reductase (RNR), containing regulatory hRRM1 and catalytic hRRM2 subunits, is the enzyme that catalyzes the conversion of ribonucleoside diphosphates (NDP) to deoxyribonucleoside diphosphates (dNDP) and thereby provides dNTP precursors needed for the synthesis of DNA. Here, we demonstrate that either endogenous or exogenous expression of Bcl2 results in decreases in RNR activity and intracellular dNTP, retardation of DNA replication fork progression, and increased rate of fork asymmetry leading to DNA replication stress. Bcl2 colocalizes with hRRM1 and hRRM2 in the cytoplasm and directly interacts via its BH4 domain with hRRM2 but not hRRM1. Removal of the BH4 domain of Bcl2 abrogates its inhibitory effects on RNR activity, dNTP pool level, and DNA replication. Intriguingly, Bcl2 directly inhibits RNR activity by disrupting the functional hRRM1/hRRM2 complex via its BH4 domain. Our findings argue that Bcl2 reduces intracellular dNTPs by inhibiting ribonucleotide reductase activity, thereby providing insight into how Bcl2 triggers DNA replication stress.

  20. Nitrate metabolism in tobacco leaves overexpressing Arabidopsis nitrite reductase.


    Davenport, Susie; Le Lay, Pascaline; Sanchez-Tamburrrino, Juan Pablo


    Primary nitrogen assimilation in plants includes the reduction of nitrite to ammonium in the chloroplasts by the enzyme nitrite reductase (NiR EC: or in the plastids of non-photosynthetic organs. Here we report on a study overexpressing the Arabidopsis thaliana NiR (AtNiR) gene in tobacco plants under the control of a constitutive promoter (CERV - Carnation Etched Ring Virus). The aim was to overexpress AtNiR in an attempt to alter the level of residual nitrite in the leaf which can act as precursor to the formation of nitrosamines. The impact of increasing the activity of AtNiR produced an increase in leaf protein and a stay-green phenotype in the primary transformed AtNiR population. Investigation of the T1 homozygous population demonstrated elevated nitrate reductase (NR) activity, reductions in leaf nitrite and nitrate and the amino acids proline, glutamine and glutamate. Chlorophyl content of the transgenic lines was increased, as evidenced by the stay-green phenotype. This reveals the importance of NiR in primary nitrogen assimilation and how modification of this key enzyme affects both the nitrogen and carbon metabolism of tobacco plants.

  1. Dimethyl Fumarate Induces Glutathione Recycling by Upregulation of Glutathione Reductase

    PubMed Central

    Hoffmann, Christina; Dietrich, Michael; Herrmann, Ann-Kathrin; Schacht, Teresa


    Neuronal degeneration in multiple sclerosis has been linked to oxidative stress. Dimethyl fumarate (DMF) is an effective oral therapeutic option shown to reduce disease activity and progression in patients with relapsing-remitting multiple sclerosis. DMF activates the transcription factor nuclear factor erythroid 2-related factor 2 (NRF2) leading to increased synthesis of the major cellular antioxidant glutathione (GSH) and prominent neuroprotection in vitro. We previously demonstrated that DMF is capable of raising GSH levels even when glutathione synthesis is inhibited, suggesting enhanced GSH recycling. Here, we found that DMF indeed induces glutathione reductase (GSR), a homodimeric flavoprotein that catalyzes GSSG reduction to GSH by using NADPH as a reducing cofactor. Knockdown of GSR using a pool of E. coli RNase III-digested siRNAs or pharmacological inhibition of GSR, however, also induced the antioxidant response rendering it impossible to verify the suspected attenuation of DMF-mediated neuroprotection. However, in cystine-free medium, where GSH synthesis is abolished, pharmacological inhibition of GSR drastically reduced the effect of DMF on glutathione recycling. We conclude that DMF increases glutathione recycling through induction of glutathione reductase. PMID:28116039

  2. Metabolic regulation of aldose reductase activity by nitric oxide donors.


    Dixit, B L; Ramana, K V; Chandra, D; Jackson, E B; Srivastava, S; Bhatnagar, A; Srivastava, S K


    Regulation of aldose reductase (AR), a member of the aldo-keto reductase superfamily, by nitric oxide (NO) donors was examined. Incubation of human recombinant AR with S-nitrosoglutathione (GSNO) led to inactivation of the enzyme and the formation of an AR-glutathione adduct. In contrast, incubation with S-nitroso-N-acetyl penicillamine (SNAP) or N-(beta-D-glucopyranosyl)-SNAP (GlycoSNAP) led to an increase in enzyme activity which was accompanied by the direct nitrosation of the enzyme and the formation of a mixed disulfide with the NO-donor. To examine in vivo modification, red blood cells (RBC) and rat aortic vascular smooth muscle cells (VSMC) were incubated with 1 mM GSNO or SNAP. Exposure of VSMC to SNAP and GSNO for 2 h at 37 degrees C led to approximately 71% decrease in the enzyme activity with DL-glyceraldehyde as the substrate. Similarly, exposure of RBC in 5 mM glucose to NO-donors for 30 min at room temperature, followed by increasing the glucose concentration to 40 mM, resulted in >75% decrease in the formation of sorbitol. These investigations indicate that NO and/or its bioactive metabolites can regulate cellular AR, leading to either activation (by nitrosation) or inactivation (by S-thiolation).

  3. Two fatty acyl reductases involved in moth pheromone biosynthesis

    PubMed Central

    Antony, Binu; Ding, Bao-Jian; Moto, Ken’Ichi; Aldosari, Saleh A.; Aldawood, Abdulrahman S.


    Fatty acyl reductases (FARs) constitute an evolutionarily conserved gene family found in all kingdoms of life. Members of the FAR gene family play diverse roles, including seed oil synthesis, insect pheromone biosynthesis, and mammalian wax biosynthesis. In insects, FAR genes dedicated to sex pheromone biosynthesis (pheromone-gland-specific fatty acyl reductase, pgFAR) form a unique clade that exhibits substantial modifications in gene structure and possesses unique specificity and selectivity for fatty acyl substrates. Highly selective and semi-selective ‘single pgFARs’ produce single and multicomponent pheromone signals in bombycid, pyralid, yponomeutid and noctuid moths. An intriguing question is how a ‘single reductase’ can direct the synthesis of several fatty alcohols of various chain lengths and isomeric forms. Here, we report two active pgFARs in the pheromone gland of Spodoptera, namely a semi-selective, C14:acyl-specific pgFAR and a highly selective, C16:acyl-specific pgFAR, and demonstrate that these pgFARs play a pivotal role in the formation of species-specific signals, a finding that is strongly supported by functional gene expression data. The study envisages a new area of research for disclosing evolutionary changes associated with C14- and C16-specific FARs in moth pheromone biosynthesis. PMID:27427355

  4. Aldose Reductase-catalyzed Reduction of Aldehyde Phospholipids

    PubMed Central

    Srivastava, Sanjay; Spite, Matthew; Trent, John O.; West, Matthew B.; Ahmed, Yonis; Bhatnagar, Aruni


    SUMMARY Oxidation of unsaturated phospholipids results in the generation of aldehyde side chains that remain esterified to the phospholipid backbone. Such “core” aldehydes elicit immune responses and promote inflammation. However, the biochemical mechanisms by which phospholipid aldehydes are metabolized or detoxified are not well understood. In the studies reported here, we examined whether aldose reductase (AR), which reduces hydrophobic aldehydes, metabolizes phospholipid aldehydes. Incubation with AR led to the reduction of 5-oxovaleroyl, 7-oxo-5-heptenoyl, 5-hydroxy-6-oxo-caproyl, and 5-hydroxy-8-oxo-6-octenoyl phospholipids generated upon oxidation of 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphocholine (PAPC). The enzyme also catalyzed the reduction of phospholipid aldehydes generated from the oxidation of 1-alkyl, and 1-alkenyl analogs of PAPC, and 1-palmitoyl-2-arachidonoyl phosphatidic acid or phosphoglycerol. Aldose reductase catalyzed the reduction of chemically synthesized 1-palmitoyl-2-(5-oxovaleroyl)-sn-glycero-3-phosphatidylcholine (POVPC) with a Km of 10 μM. Addition of POVPC to the culture medium led to incorporation and reduction of the aldehyde in COS-7 and THP-1 cells. Reduction of POVPC in these cells was prevented by the AR inhibitors sorbinil and tolrestat and was increased in COS-7 cells overexpressing AR. Together, these observations suggest that AR may be a significant participant in the metabolism of several structurally diverse phospholipid aldehydes. This metabolism may be a critical regulator of the pro-inflammatory and immunogenic effects of oxidized phospholipids. PMID:15465833

  5. Synthesis and metabolism of inhibitors of ribonucleotide reductase

    SciTech Connect

    Smith, F.T.


    In an effort to prepare more effective inhibitors of ribo-nucleotide reductase a series of 2-substituted-4,6-dihydroxypyrimidines was prepared via the appropriately substituted benzamidine. None of the compounds exhibited in vivo activity against L1210 leukemia. No further testing was performed. In order to investigate the metabolism of 3,4-dihydroxybenzohydroxamic acid, a known inhibitor of ribonucleotide reductase, radiolabeled 3,4-dihydroxybenzohydroxamic acid was synthesized by a modification of the procedure of Pichat and Tostain. /sup 14/C-3,4-Dihydroxybenzoic acid was converted to the methyl ester and subsequently reacted with hydroxylamine to give the hydroxamic acid. /sup 14/C-3,4-Dihydroxybenzohydroxamic acid was given i.p. to Sprague-Dawley rats. Excretion occurred mainly (72%) via the urine. HPLC coupled with GC/MS analyses showed that the compound was excreted mainly unchanged. The compound was metabolized to 3,4-dihydroxybenzamide, 4-methoxy-3-hydroxybenzohydroxamic acid, and 4-hydroxy-3-methoxybenzohydroxamic acid. HPLC analysis also showed the lack of formation of any glucuronide or sulfate conjugates through either the hydroxamic acid or catechol functionalities.

  6. ADP-ribosylation of dinitrogenase reductase in Rhodobacter capsulatus

    SciTech Connect

    Jouanneau, Y.; Roby, C.; Meyer, C.M.; Vignais, P.M. )


    In the photosynthetic bacterium Rhodobacter capsulatus, nitrogenase is regulated by a reversible covalent modification of Fe protein or dinitrogenase reductase (Rc2). The linkage of the modifying group to inactive Rc2 was found to be sensitive to alkali and to neutral hydroxylamine. Complete release of the modifying group was achieved by incubation of inactive Rc2 in 0.4 or 1 M hydroxylamine. After hydroxylamine treatment of the Rc2 preparation, the modifying group could be isolated and purified by affinity chromatography and ion-exchange HPLC. The modifying group comigrated with ADP-ribose on both ion-exchange HPLC and thin-layer chromatography. Analyses by {sup 31}P NMR spectroscopy and mass spectrometry provided further evidence that the modifying group was ADP-ribose. The NMR spectrum of inactive Rc2 exhibited signals characteristic of ADP-ribose; integration of these signals allowed calculation of a molar ration ADP-ribose/Rc2 of 0.63. A hexapeptide carrying the ADP-ribose moiety was purified from a subtilisin digest of inactive Rc2. The structure of this peptide, determined by amino acid analysis and sequencing, is Gly-Arg(ADP-ribose)-Gly-Val-Ile-Thr. This structure allows identification of the binding site for ADP-ribose as Arg 101 of the polypeptide chain of Rc2. It is concluded that nitrogenase activity in R. capsulatus is regulated by reversible ADP-ribosylation of a specific arginyl residue of dinitrogenase reductase.

  7. Human Neuroglobin Functions as a Redox-regulated Nitrite Reductase*

    PubMed Central

    Tiso, Mauro; Tejero, Jesús; Basu, Swati; Azarov, Ivan; Wang, Xunde; Simplaceanu, Virgil; Frizzell, Sheila; Jayaraman, Thottala; Geary, Lisa; Shapiro, Calli; Ho, Chien; Shiva, Sruti; Kim-Shapiro, Daniel B.; Gladwin, Mark T.


    Neuroglobin is a highly conserved hemoprotein of uncertain physiological function that evolved from a common ancestor to hemoglobin and myoglobin. It possesses a six-coordinate heme geometry with proximal and distal histidines directly bound to the heme iron, although coordination of the sixth ligand is reversible. We show that deoxygenated human neuroglobin reacts with nitrite to form nitric oxide (NO). This reaction is regulated by redox-sensitive surface thiols, cysteine 55 and 46, which regulate the fraction of the five-coordinated heme, nitrite binding, and NO formation. Replacement of the distal histidine by leucine or glutamine leads to a stable five-coordinated geometry; these neuroglobin mutants reduce nitrite to NO ∼2000 times faster than the wild type, whereas mutation of either Cys-55 or Cys-46 to alanine stabilizes the six-coordinate structure and slows the reaction. Using lentivirus expression systems, we show that the nitrite reductase activity of neuroglobin inhibits cellular respiration via NO binding to cytochrome c oxidase and confirm that the six-to-five-coordinate status of neuroglobin regulates intracellular hypoxic NO-signaling pathways. These studies suggest that neuroglobin may function as a physiological oxidative stress sensor and a post-translationally redox-regulated nitrite reductase that generates NO under six-to-five-coordinate heme pocket control. We hypothesize that the six-coordinate heme globin superfamily may subserve a function as primordial hypoxic and redox-regulated NO-signaling proteins. PMID:21296891

  8. Fluorescent analogues of methotrexate: characterization and interaction with dihydrofolate reductase.


    Kumar, A A; Kempton, R J; Anstead, G M; Freisheim, J H


    The dansylated derivatives of lysine and ornithine analogues of methotrexate exhibit fluorescence properties characteristic of the dansyl moiety with an excitation at 328 nm and an emission maximum at 580 nm in aqueous media. As in the case of dansyl amino acids, the fluorescence emission is dependent upon the polarity of the medium. In solvents of low dielectric constant there is an enhancement of the dansyl fluorescence intensity as well as a shift to shorter wavelengths. The dansylated analogues show a reduction in the quantum yields as compared to N epsilon-dansyl-L-lysine and 5-(N,N-dimethylamino)-1-naphthalenesulfonic acid. The absorption spectra of the two dansyl analogues are similar to the spectra of the parent basic amino acid precursors but with reduced molar extinction values. The two fluorescent analogues of methotrexate were found to be potent inhibitors of purified dihydrofolate reductases from Lactobacillus casei and from chicken liver. The binding of these fluorescent analogues to either dihydrofolate reductase resulted in 10-15-nm blue shift of the ligand emission maxima and a 2-5-fold enhancement of the emission. These fluorescent properties of the bound ligands indicate a possible interaction of the dansyl moiety with a region on the enzyme molecule which is more hydrophobic relative to the surrounding solvent.

  9. Properties of the arsenate reductase of plasmid R773.


    Gladysheva, T B; Oden, K L; Rosen, B P


    Resistance to toxic oxyanions in Escherichia coli is conferred by the ars operon carried on plasmid R773. The gene products of this operon catalyze extrusion of antimonials and arsenicals from cells of E. coli, thus providing resistance to those toxic oxyanions. In addition, resistance to arsenate is conferred by the product of the arsC gene. In this report, purified ArsC protein was shown to catalyze reduction of arsenate to arsenite. The enzymatic activity of the ArsC protein required glutaredoxin as a source of reducing equivalents. Other reductants, including glutathione and thioredoxin, were not effective electron donors. A spectrophotometric assay was devised in which arsenate reduction was coupled to NADPH oxidation. The results obtained with the coupled assay corresponded to those found by direct reduction of radioactive arsenate to arsenite. The only substrate of the reaction was arsenate (Km = 8 mM); other oxyanions including phosphate, sulfate, and antimonate were not reduced. Phosphate and sulfate were weak inhibitors, while the product, arsenite, was a stronger inhibitor (Ki = 0.1 mM). Arsenate reductase activity exhibited a pH optimum of 6.3-6.8. These results indicate that the ArsC protein is a novel reductase, and elucidation of its enzymatic mechanism should be of interest.

  10. A mutant of barley lacking NADH-hydroxypyruvate reductase

    SciTech Connect

    Blackwell, R.; Lea, P. )


    A mutant of barley, LaPr 88/29, deficient in peroxisomal NADH-hydroxypyruvate reductase (HPR) activity has been identified. Compared to the wild type the activities of NADH-HPR and NADPH-HPR were severely reduced but the mutant was still capable of fixing CO{sub 2} at rates equivalent to 75% of that of the wild type in air. Although lacking an enzyme in the main photorespiratory pathway, there appeared to be little disruption to photorespiratory metabolism as ammonia release, CO{sub 2} efflux and {sup 14}CO{sub 2} release from L-(U-{sup 14}C) serine were similar in both mutant and wild type. LaPr 88/29 has been used to show that NADH-glyoxylate reductase (GR) and NADH-HPR are probably not catalyzed by the same enzyme in barley and that over 80% of the NADPH-HPR activity is due to the NADH-HPR enzyme. Immunological studies, using antibodies raised against spinach HPR, have shown that the NADH-dependent enzyme protein is absent in LaPr 88/29 but there appears to be enhanced synthesis of the NADPH-dependent enzyme protein.

  11. Low Earth Orbiter: Terminal

    NASA Technical Reports Server (NTRS)

    Kremer, Steven E.; Bundick, Steven N.


    In response to the current government budgetary environment that requires the National Aeronautics and Space Administration (NASA) to do more with less, NASA/Goddard Space Flight Center's Wallops Flight Facility has developed and implemented a class of ground stations known as a Low Earth Orbiter-Terminal (LEO-T). This development thus provides a low-cost autonomous ground tracking service for NASA's customers. More importantly, this accomplishment provides a commercial source to spacecraft customers around the world to purchase directly from the company awarded the NASA contract to build these systems. A few years ago, NASA was driven to provide more ground station capacity for spacecraft telemetry, tracking, and command (TT&C) services with a decreasing budget. NASA also made a decision to develop many smaller, cheaper satellites rather than a few large spacecraft as done in the past. In addition, university class missions were being driven to provide their own TT&C services due to the increasing load on the NASA ground-tracking network. NASA's solution for this ever increasing load was to use the existing large aperture systems to support those missions requiring that level of performance and to support the remainder of the missions with the autonomous LEO-T systems. The LEO-T antenna system is a smaller, cheaper, and fully autonomous unstaffed system that can operate without the existing NASA support infrastructure. The LEO-T provides a low-cost, reliable space communications service to the expanding number of low-earth orbiting missions around the world. The system is also fostering developments that improve cost-effectiveness of autonomous-class capabilities for NASA and commercial space use. NASA has installed three LEO-T systems. One station is at the University of Puerto Rico, the second system is installed at the Poker Flat Research Range near Fairbanks, Alaska, and the third system is installed at NASA's Wallops Flight Facility in Virginia. This paper

  12. Low Earth Orbiter: Terminal

    NASA Technical Reports Server (NTRS)

    Kremer, Steven E.; Bundick, Steven N.


    In response to the current government budgetary environment that requires the National Aeronautics and Space Administration (NASA) to do more with less, NASA/Goddard Space Flight Center's Wallops Flight Facility has developed and implemented a class of ground stations known as a Low Earth Orbiter-Terminal (LEO-T). This development thus provides a low-cost autonomous ground tracking service for NASA's customers. More importantly, this accomplishment provides a commercial source to spacecraft customers around the world to purchase directly from the company awarded the NASA contract to build these systems. A few years ago, NASA was driven to provide more ground station capacity for spacecraft telemetry, tracking, and command (TT&C) services with a decreasing budget. NASA also made a decision to develop many smaller, cheaper satellites rather than a few large spacecraft as done in the past. In addition, university class missions were being driven to provide their own TT&C services due to the increasing load on the NASA ground-tracking network. NASA's solution for this ever increasing load was to use the existing large aperture systems to support those missions requiring that level of performance and to support the remainder of the missions with the autonomous LEO-T systems. The LEO-T antenna system is a smaller, cheaper, and fully autonomous unstaffed system that can operate without the existing NASA support infrastructure. The LEO-T provides a low-cost, reliable space communications service to the expanding number of low-earth orbiting missions around the world. The system is also fostering developments that improve cost-effectiveness of autonomous-class capabilities for NASA and commercial space use. NASA has installed three LEO-T systems. One station is at the University of Puerto Rico, the second system is installed at the Poker Flat Research Range near Fairbanks, Alaska, and the third system is installed at NASA's Wallops Flight Facility in Virginia. This paper

  13. Determination of the specific activities of methionine sulfoxide reductase A and B by capillary electrophoresis

    USDA-ARS?s Scientific Manuscript database

    A capillary electrophoresis (CE) method for the determination of methionine sulfoxide reductase A and methionine sulfoxide reductase B activities in mouse liver is described. The method is based on detection of the 4-(dimethylamino)azobenzene-4’-sulfonyl derivative of L-methionine (dabsyl Met), the ...

  14. Nitrate transport is independent of NADH and NAD(P)H nitrate reductases in barley seedlings

    NASA Technical Reports Server (NTRS)

    Warner, R. L.; Huffaker, R. C.


    Barley (Hordeum vulgare L.) has NADH-specific and NAD(P)H-bispecific nitrate reductase isozymes. Four isogenic lines with different nitrate reductase isozyme combinations were used to determine the role of NADH and NAD(P)H nitrate reductases on nitrate transport and assimilation in barley seedlings. Both nitrate reductase isozymes were induced by nitrate and were required for maximum nitrate assimilation in barley seedlings. Genotypes lacking the NADH isozyme (Az12) or the NAD(P)H isozyme (Az70) assimilated 65 or 85%, respectively, as much nitrate as the wild type. Nitrate assimilation by genotype (Az12;Az70) which is deficient in both nitrate reductases, was only 13% of the wild type indicating that the NADH and NAD(P)H nitrate reductase isozymes are responsible for most of the nitrate reduction in barley seedlings. For all genotypes, nitrate assimilation rates in the dark were about 55% of the rates in light. Hypotheses that nitrate reductase has direct or indirect roles in nitrate uptake were not supported by this study. Induction of nitrate transporters and the kinetics of net nitrate uptake were the same for all four genotypes indicating that neither nitrate reductase isozyme has a direct role in nitrate uptake in barley seedlings.

  15. QTL analysis of ferric reductase activity in the model legume lotus japonicus

    USDA-ARS?s Scientific Manuscript database

    Physiological and molecular studies have demonstrated that iron accumulation from the soil into Strategy I plants can be limited by ferric reductase activity. An initial study of Lotus japonicus ecotypes Miyakojima MG-20 and Gifu B-129 identified significant leaf chlorosis and ferric reductase activ...

  16. Sequence and properties of pentaerythritol tetranitrate reductase from Enterobacter cloacae PB2.


    French, C E; Nicklin, S; Bruce, N C


    Pentaerythritol tetranitrate reductase, which reductively liberates nitrite from nitrate esters, is related to old yellow enzyme. Pentaerythritol tetranitrate reductase follows a ping-pong mechanism with competitive substrate inhibition by NADPH, is strongly inhibited by steroids, and is capable of reducing the unsaturated bond of 2-cyclohexen-1-one.

  17. Sequence and properties of pentaerythritol tetranitrate reductase from Enterobacter cloacae PB2.

    PubMed Central

    French, C E; Nicklin, S; Bruce, N C


    Pentaerythritol tetranitrate reductase, which reductively liberates nitrite from nitrate esters, is related to old yellow enzyme. Pentaerythritol tetranitrate reductase follows a ping-pong mechanism with competitive substrate inhibition by NADPH, is strongly inhibited by steroids, and is capable of reducing the unsaturated bond of 2-cyclohexen-1-one. PMID:8932320

  18. Nitrate transport is independent of NADH and NAD(P)H nitrate reductases in barley seedlings.


    Warner, R L; Huffaker, R C


    Barley (Hordeum vulgare L.) has NADH-specific and NAD(P)H-bispecific nitrate reductase isozymes. Four isogenic lines with different nitrate reductase isozyme combinations were used to determine the role of NADH and NAD(P)H nitrate reductases on nitrate transport and assimilation in barley seedlings. Both nitrate reductase isozymes were induced by nitrate and were required for maximum nitrate assimilation in barley seedlings. Genotypes lacking the NADH isozyme (Az12) or the NAD(P)H isozyme (Az70) assimilated 65 or 85%, respectively, as much nitrate as the wild type. Nitrate assimilation by genotype (Az12;Az70) which is deficient in both nitrate reductases, was only 13% of the wild type indicating that the NADH and NAD(P)H nitrate reductase isozymes are responsible for most of the nitrate reduction in barley seedlings. For all genotypes, nitrate assimilation rates in the dark were about 55% of the rates in light. Hypotheses that nitrate reductase has direct or indirect roles in nitrate uptake were not supported by this study. Induction of nitrate transporters and the kinetics of net nitrate uptake were the same for all four genotypes indicating that neither nitrate reductase isozyme has a direct role in nitrate uptake in barley seedlings.

  19. Biliverdin Reductase Mediates Hypoxia-Induced EMT via PI3-Kinase and Akt

    PubMed Central

    Zeng, Rui; Yao, Ying; Han, Min; Zhao, Xiaoqin; Liu, Xiao-Cheng; Wei, Juncheng; Luo, Yun; Zhang, Juan; Zhou, Jianfeng; Wang, Shixuan; Ma, Ding; Xu, Gang


    Chronic hypoxia in the renal parenchyma is thought to induce epithelial-to-mesenchymal transition (EMT), leading to fibrogenesis and ultimately end-stage renal failure. Biliverdin reductase, recently identified as a serine/threonine/tyrosine kinase that may activate phosphatidylinositol 3-kinase (PI3K) and Akt, is upregulated in response to reactive oxygen species that may accompany hypoxia. We investigated this potential role of biliverdin reductase in hypoxia-induced renal tubular EMT. Expression of biliverdin reductase was upregulated in a human proximal tubule cell line (HK-2) cultured in hypoxic conditions (1% O2), and this was accompanied by reduced expression of E-cadherin and increased expression of the mesenchymal marker vimentin. Inhibiting PI3K reversed these changes, consistent with EMT. In normoxic conditions, overexpression of biliverdin reductase promoted similar characteristics of EMT, which were also reversed by inhibiting PI3K. Furthermore, using small interfering RNA (siRNA) to knockdown biliverdin reductase, we demonstrated that the enzyme associates with phosphorylated Akt and mediates the hypoxia-induced EMT phenotype. In vivo, expression of biliverdin reductase increased in the tubular epithelia of 5/6-nephrectomized rats, and immunohistochemistry of serial sections demonstrated similar localization of phosphorylated Akt and biliverdin reductase. In conclusion, biliverdin reductase mediates hypoxia-induced EMT through a PI3K/Akt-dependent pathway. PMID:18184861

  20. Nitrate transport is independent of NADH and NAD(P)H nitrate reductases in barley seedlings

    NASA Technical Reports Server (NTRS)

    Warner, R. L.; Huffaker, R. C.


    Barley (Hordeum vulgare L.) has NADH-specific and NAD(P)H-bispecific nitrate reductase isozymes. Four isogenic lines with different nitrate reductase isozyme combinations were used to determine the role of NADH and NAD(P)H nitrate reductases on nitrate transport and assimilation in barley seedlings. Both nitrate reductase isozymes were induced by nitrate and were required for maximum nitrate assimilation in barley seedlings. Genotypes lacking the NADH isozyme (Az12) or the NAD(P)H isozyme (Az70) assimilated 65 or 85%, respectively, as much nitrate as the wild type. Nitrate assimilation by genotype (Az12;Az70) which is deficient in both nitrate reductases, was only 13% of the wild type indicating that the NADH and NAD(P)H nitrate reductase isozymes are responsible for most of the nitrate reduction in barley seedlings. For all genotypes, nitrate assimilation rates in the dark were about 55% of the rates in light. Hypotheses that nitrate reductase has direct or indirect roles in nitrate uptake were not supported by this study. Induction of nitrate transporters and the kinetics of net nitrate uptake were the same for all four genotypes indicating that neither nitrate reductase isozyme has a direct role in nitrate uptake in barley seedlings.

  1. Antitumor Indolequinones Induced Apoptosis in Human Pancreatic Cancer Cells via Inhibition of Thioredoxin Reductase and Activation of Redox Signaling

    PubMed Central

    Yan, Chao; Siegel, David; Newsome, Jeffery; Chilloux, Aurelie; Moody, Christopher J.


    Indolequinones (IQs) were developed as potential antitumor agents against human pancreatic cancer. IQs exhibited potent antitumor activity against the human pancreatic cancer cell line MIA PaCa-2 with growth inhibitory IC50 values in the low nanomolar range. IQs were found to induce time- and concentration-dependent apoptosis and to be potent inhibitors of thioredoxin reductase 1 (TR1) in MIA PaCa-2 cells at concentrations equivalent to those inducing growth-inhibitory effects. The mechanism of inhibition of TR1 by the IQs was studied in detail in cell-free systems using purified enzyme. The C-terminal selenocysteine of TR1 was characterized as the primary adduction site of the IQ-derived reactive iminium using liquid chromatography-tandem mass spectrometry analysis. Inhibition of TR1 by IQs in MIA PaCa-2 cells resulted in a shift of thioredoxin-1 redox state to the oxidized form and activation of the p38/c-Jun NH2-terminal kinase (JNK) mitogen-activated protein kinase (MAPK) signaling pathway. Oxidized thioredoxin is known to activate apoptosis signal-regulating kinase 1, an upstream activator of p38/JNK in the MAPK signaling cascade and this was confirmed in our study providing a potential mechanism for IQ-induced apoptosis. These data describe the redox and signaling events involved in the mechanism of growth inhibition induced by novel inhibitors of TR1 in human pancreatic cancer cells. PMID:22147753

  2. Insights into severe 5,10-methylenetetrahydrofolate reductase deficiency: molecular genetic and enzymatic characterization of 76 patients.


    Burda, Patricie; Schäfer, Alexandra; Suormala, Terttu; Rummel, Till; Bürer, Céline; Heuberger, Dorothea; Frapolli, Michele; Giunta, Cecilia; Sokolová, Jitka; Vlášková, Hana; Kožich, Viktor; Koch, Hans Georg; Fowler, Brian; Froese, D Sean; Baumgartner, Matthias R


    5,10-Methylenetetrahydrofolate reductase (MTHFR) deficiency is the most common inherited disorder of folate metabolism and causes severe hyperhomocysteinaemia. To better understand the relationship between mutation and function, we performed molecular genetic analysis of 76 MTHFR deficient patients, followed by extensive enzymatic characterization of fibroblasts from 72 of these. A deleterious mutation was detected on each of the 152 patient alleles, with one allele harboring two mutations. Sixty five different mutations (42 novel) were detected, including a common splicing mutation (c.1542G>A) found in 21 alleles. Using an enzyme assay in the physiological direction, we found residual activity (1.7%-42% of control) in 42 cell lines, of which 28 showed reduced affinity for nicotinamide adenine dinucleotide phosphate (NADPH), one reduced affinity for methylenetetrahydrofolate, five flavin adenine dinucleotide-responsiveness, and 24 abnormal kinetics of S-adenosylmethionine inhibition. Missense mutations causing virtually absent activity were found exclusively in the N-terminal catalytic domain, whereas missense mutations in the C-terminal regulatory domain caused decreased NADPH binding and disturbed inhibition by S-adenosylmethionine. Characterization of patients in this way provides a basis for improved diagnosis using expanded enzymatic criteria, increases understanding of the molecular basis of MTHFR dysfunction, and points to the possible role of cofactor or substrate in the treatment of patients with specific mutations.

  3. Cholesterol-dependent degradation of squalene monooxygenase, a control point in cholesterol synthesis beyond HMG-CoA reductase.


    Gill, Saloni; Stevenson, Julian; Kristiana, Ika; Brown, Andrew J


    Exquisite control of cholesterol synthesis is crucial for maintaining homeostasis of this vital yet potentially toxic lipid. Squalene monooxygenase (SM) catalyzes the first oxygenation step in cholesterol synthesis, acting on squalene before cyclization into the basic steroid structure. Using model cell systems, we found that cholesterol caused the accumulation of the substrate squalene, suggesting that SM may serve as a flux-controlling enzyme beyond 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGR, considered as rate limiting). Cholesterol accelerated the proteasomal degradation of SM which required the N-terminal domain, partially conserved in vertebrates but not in lower organisms. Unlike HMGR, SM degradation is not mediated by Insig, 24,25-dihydrolanosterol, or side-chain oxysterols, but rather by cholesterol itself. Importantly, SM's N-terminal domain conferred cholesterol-regulated turnover on heterologous fusion proteins. Furthermore, proteasomal inhibition almost totally eliminated squalene accumulation, highlighting the importance of this degradation mechanism for the control of SM and suggesting this as a possible control point in cholesterol synthesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Sen1p Contributes to Genomic Integrity by Regulating Expression of Ribonucleotide Reductase 1 (RNR1) in Saccharomyces cerevisiae

    PubMed Central

    Singh, Prabhat; Verma, Naveen; Mandal, Papita; Chauhan, Sakshi; Tomar, Raghuvir S.


    Gene expression is a multi-step process which requires recruitment of several factors to promoters. One of the factors, Sen1p is an RNA/DNA helicase implicated in transcriptional termination and RNA processing in yeast. In the present study, we have identified a novel function of Sen1p that regulates the expression of ribonucleotide reductase RNR1 gene, which is essential for maintaining genomic integrity. Cells with mutation in the helicase domain or lacking N-terminal domain of Sen1p displayed a drastic decrease in the basal level transcription of RNR1 gene and showed enhanced sensitivity to various DNA damaging agents. Moreover, SEN1 mutants [Sen1-1 (G1747D), Sen1-2 (Δ1-975)] exhibited defects in DNA damage checkpoint activation. Surprisingly, CRT1 deletion in Sen1p mutants (Sen1-1, Sen1-2) was partly able to rescue the slow growth phenotype upon genotoxic stress. Altogether, our observations suggest that Sen1p is required for cell protection against DNA damage by regulating the expression of DNA repair gene RNR1. Thus, the misregulation of Sen1p regulated genes can cause genomic instability that may lead to neurological disorders and premature aging. PMID:23741394

  5. The use of mobile satellite communication terminals

    NASA Astrophysics Data System (ADS)

    Law, P. A.

    The role of small portable terminals in military satellite systems is examined; the discussion embraces terminals with an antenna reflector diameter of seven meters or less. Emphasis is placed on the specification of MARMOSET (Marconi Mobile Satellite Earth Terminal). Also considered are ship-borne satellite terminals, the improved SCOT terminal, interoperability, reduced downlink power, and reliability and availability.

  6. 46 CFR 525.2 - Terminal schedules.

    Code of Federal Regulations, 2012 CFR


    ... 46 Shipping 9 2012-10-01 2012-10-01 false Terminal schedules. 525.2 Section 525.2 Shipping FEDERAL MARITIME COMMISSION REGULATIONS AFFECTING OCEAN SHIPPING IN FOREIGN COMMERCE MARINE TERMINAL OPERATOR SCHEDULES § 525.2 Terminal schedules. (a) Marine terminal operator schedules. A marine terminal operator, at...

  7. 32 CFR 34.51 - Termination.

    Code of Federal Regulations, 2010 CFR


    ..., in which case the two parties shall agree upon the termination conditions, including the effective date and, in the case of partial termination, the portion to be terminated. (3) By the recipient upon... effective date, and, in the case of partial termination, the portion to be terminated. The recipient...

  8. 32 CFR 32.61 - Termination.

    Code of Federal Regulations, 2010 CFR


    ... consent of the recipient, in which case the two parties shall agree upon the termination conditions, including the effective date and, in the case of partial termination, the portion to be terminated; or (3... for such termination, the effective date, and, in the case of partial termination, the portion to...

  9. Male Sterile2 Encodes a Plastid-Localized Fatty Acyl Carrier Protein Reductase Required for Pollen Exine Development in Arabidopsis

    SciTech Connect

    Chen, W.; Shanklin, J.; Yu, X.-H.; Zhang, K.; Shi, J.; De Oliveira, S.; Schreiber, L.; Zhang, D.


    Male Sterile2 (MS2) is predicted to encode a fatty acid reductase required for pollen wall development in Arabidopsis (Arabidopsis thaliana). Transient expression of MS2 in tobacco (Nicotiana benthamiana) leaves resulted in the accumulation of significant levels of C16 and C18 fatty alcohols. Expression of MS2 fused with green fluorescent protein revealed that an amino-terminal transit peptide targets the MS2 to plastids. The plastidial localization of MS2 is biologically important because genetic complementation of MS2 in ms2 homozygous plants was dependent on the presence of its amino-terminal transit peptide or that of the Rubisco small subunit protein amino-terminal transit peptide. In addition, two domains, NAD(P)H-binding domain and sterile domain, conserved in MS2 and its homologs were also shown to be essential for MS2 function in pollen exine development by genetic complementation testing. Direct biochemical analysis revealed that purified recombinant MS2 enzyme is able to convert palmitoyl-Acyl Carrier Protein to the corresponding C16:0 alcohol with NAD(P)H as the preferred electron donor. Using optimized reaction conditions (i.e. at pH 6.0 and 30 C), MS2 exhibits a K{sub m} for 16:0-Acyl Carrier Protein of 23.3 {+-} 4.0 {mu}m, a V{sub max} of 38.3 {+-} 4.5 nmol mg{sup -1} min{sup -1}, and a catalytic efficiency/K{sub m} of 1,873 m{sup -1} s{sup -1}. Based on the high homology of MS2 to other characterized fatty acid reductases, it was surprising that MS2 showed no activity against palmitoyl- or other acyl-coenzyme A; however, this is consistent with its plastidial localization. In summary, genetic and biochemical evidence demonstrate an MS2-mediated conserved plastidial pathway for the production of fatty alcohols that are essential for pollen wall biosynthesis in Arabidopsis.

  10. Selective termination of multiple gestations.


    Golbus, M S; Cunningham, N; Goldberg, J D; Anderson, R; Filly, R; Callen, P


    Twenty-two selective terminations in multiple gestations were performed by a number of different methods. In 17 dichorionic pregnancies there was a successful delivery in surviving singletons or twins. In five monochorionic pregnancies undergoing selective termination there was a successful delivery in only one and a pregnancy loss in the other four. Six of the 18 delivered pregnancies were complicated by premature labor and delivery. Among the several methods used for selective termination, intracardiac potassium chloride injection appears to be the procedure of choice in dichorionic pregnancies.

  11. Smart sensor for terminal homing

    NASA Astrophysics Data System (ADS)

    Panda, D.; Aggarwal, R.; Hummel, R.


    The practical scene matching problem is considered to present certain complications which must extend classical image processing capabilities. Certain aspects of the scene matching problem which must be addressed by a smart sensor for terminal homing are discussed. First a philosophy for treating the matching problem for the terminal homing scenario is outlined. Then certain aspects of the feature extraction process and symbolic pattern matching are considered. It is thought that in the future general ideas from artificial intelligence will be more useful for terminal homing requirements of fast scene recognition and pattern matching.

  12. Trypanothione Reductase: A Viable Chemotherapeutic Target for Antitrypanosomal and Antileishmanial Drug Design

    PubMed Central

    Khan, M. Omar F.


    Trypanosomiasis and leishmaniasis are two debilitating disease groups caused by parasites of Trypanosoma and Leishmania spp. and affecting millions of people worldwide. A brief outline of the potential targets for rational drug design against these diseases are presented, with an emphasis placed on the enzyme trypanothione reductase. Trypanothione reductase was identified as unique to parasites and proposed to be an effective target against trypanosomiasis and leishmaniasis. The biochemical basis of selecting this enzyme as a target, with reference to the simile and contrast to human analogous enzyme glutathione reductase, and the structural aspects of its active site are presented. The process of designing selective inhibitors for the enzyme trypanothione reductase has been discussed. An overview of the different chemical classes of inhibitors of trypanothione reductase with their inhibitory activities against the parasites and their prospects as future chemotherapeutic agents are briefly revealed. PMID:21901070

  13. Comparison of finasteride (Proscar), a 5 alpha reductase inhibitor, and various commercial plant extracts in in vitro and in vivo 5 alpha reductase inhibition.


    Rhodes, L; Primka, R L; Berman, C; Vergult, G; Gabriel, M; Pierre-Malice, M; Gibelin, B


    Human prostate was used as a source of 5 alpha reductase. Compounds were incubated with an enzyme preparation and [3H]testosterone. [3H]-dihydrotestosterone production was measured to calculate 5 alpha reductase activity. IC50 values (ng/ml) were finasteride = 1; Permixon = 5,600; Talso = 7,000; Strogen Forte = 31,000; Prostagutt = 40,000; and Tadenan = 63,000. Bazoton and Harzol had no activity at concentrations up to 500,000 ng/ml. In castrate rats stimulated with testosterone (T) or dihydrotestosterone (DHT), finasteride, but not Permixon or Bazoton, inhibited T stimulated prostate growth, while none of the three compounds inhibited DHT stimulated growth. These results demonstrate that finasteride inhibits 5 alpha reductase, while Permixon and Bazoton have neither anti-androgen nor 5 alpha reductase inhibitory activity. In addition, in a 7 day human clinical trial, finasteride, but not Permixon or placebo, decreased serum DHT in men, further confirming the lack of 5 alpha reductase inhibition by Permixon. Finasteride and the plant extracts listed above do not inhibit the binding of DHT to the rat prostatic androgen receptor (concentrations to 100 micrograms/ml). Based on these results, it is unlikely that these plant extracts would shrink the prostate by inhibiting androgen action or 5 alpha reductase.

  14. NADPH-dependent reductases and polyol formation in human leukemia cell lines.


    Sato, Sanai; Secchi, E Filippo; Sakurai, Shinichi; Ohta, Nobuo; Fukase, Shigeru; Lizak, Martin J


    Because of the limited availability of human tissues, leukemia cell lines are often utilized as the models for human leukocytes. In this study, we investigated the NADPH-dependent reductases and polyol pathway in commonly utilized human leukemia cell lines. The relative amounts of aldose and aldehyde reductases were estimated by separating two enzymes with chromatofocusing. The flux of glucose through the polyol pathway was examined by 19F-NMR using 3-fluoro-3-deoxy-D-glucose (3FG) as substrate. Sugar alcohol analysis was conducted by gas chromatography. In myelocytic leukemia cells, the major reductase was aldehyde reductase, and levels of aldose reductase were extremely low. Although lymphocytic cells also contained both aldose and aldehyde reductases, the levels of aldose reductase appeared to be higher in lymphocytic cells than myeolcytic cells. In two lymphocytic cells MOLT-4 and SKW6.4, aldose reductase is clearly dominant. When incubated in medium containing D-galactose, all cell lines quickly accumulated galactitol. There was correlation between galactitol levels and aldose reductase levels. The aldose reductase inhibitor FK 366 significantly reduced the formation of galactitol. 19F-NMR of the cells cultured with 3FG as substrate demonstrated the formation of 3-fluoro-3-dexoy-sorbitol in all the cell lines examined in this study. The relative amounts of sorbitol and fructose varied significantly among the cells. The data confirm that the polyol pathway is present in both myelocytic and lymphocytic leukemia cell lines. However, there is a large variation among the cell lines in the levels of enzymes and flux of glucose through the polyol pathway.

  15. Immunocytochemical localization of short-chain family reductases involved in menthol biosynthesis in peppermint.


    Turner, Glenn W; Davis, Edward M; Croteau, Rodney B


    Biosynthesis of the p-menthane monoterpenes in peppermint occurs in the secretory cells of the peltate glandular trichomes and results in the accumulation of primarily menthone and menthol. cDNAs and recombinant enzymes are well characterized for eight of the nine enzymatic steps leading from the 5-carbon precursors to menthol, and subcellular localization of several key enzymes suggests a complex network of substrate and product movement is required during oil biosynthesis. In addition, studies concerning the regulation of oil biosynthesis have demonstrated a temporal partition of the pathway into an early, biosynthetic program that results in the accumulation of menthone and a later, oil maturation program that leads to menthone reduction and concomitant menthol accumulation. The menthone reductase responsible for the ultimate pathway reduction step, menthone-menthol reductase (MMR), has been characterized and found to share significant sequence similarity with its counterpart reductase, a menthone-neomenthol reductase, which catalyzes a minor enzymatic reaction associated with oil maturation. Further, the menthone reductases share significant sequence similarity with the temporally separate and mechanistically different isopiperitenone reductase (IPR). Here we present immunocytochemical localizations for these reductases using a polyclonal antibody raised against menthone-menthol reductase. The polyclonal antibody used for this study showed little specificity between these three reductases, but by using it for immunostaining of tissues of different ages we were able to provisionally separate staining of an early biosynthetic enzyme, IPR, found in young, immature leaves from that of the oil maturation enzyme, MMR, found in older, mature leaves. Both reductases were localized to the cytoplasm and nucleoplasm of the secretory cells of peltate glandular trichomes, and were absent from all other cell types examined.

  16. Thioredoxin-thioredoxin reductase system of Streptomyces clavuligerus: sequences, expression, and organization of the genes.

    PubMed Central

    Cohen, G; Yanko, M; Mislovati, M; Argaman, A; Schreiber, R; Av-Gay, Y; Aharonowitz, Y


    The genes that encode thioredoxin and thioredoxin reductase of Streptomyces clavuligerus were cloned, and their DNA sequences were determined. Previously, we showed that S. clavuligerus possesses a disulfide reductase with broad substrate specificity that biochemically resembles the thioredoxin oxidoreductase system and may play a role in the biosynthesis of beta-lactam antibiotics. It consists consists of two components, a 70-kDa NADPH-dependent flavoprotein disulfide reductase with two identical subunits and a 12-kDa heat-stable protein general disulfide reductant. In this study, we found, by comparative analysis of their predicted amino acid sequences, that the 35-kDa protein is in fact thioredoxin reductase; it shares 48.7% amino acid sequence identity with Escherichia coli thioredoxin reductase, the 12-kDa protein is thioredoxin, and it shares 28 to 56% amino acid sequence identity with other thioredoxins. The streptomycete thioredoxin reductase has the identical cysteine redox-active region--Cys-Ala-Thr-Cys--and essentially the same flavin adenine dinucleotide- and NADPH dinucleotide-binding sites as E. coli thioredoxin reductase and is partially able to accept E. coli thioredoxin as a substrate. The streptomycete thioredoxin has the same cysteine redox-active segment--Trp-Cys-Gly-Pro-Cys--that is present in virtually all eucaryotic and procaryotic thioredoxins. However, in vivo it is unable to donate electrons to E. coli methionine sulfoxide reductase and does not serve as a substrate in vitro for E. coli thioredoxin reductase. The S. clavuligerus thioredoxin (trxA) and thioredoxin reductase (trxB) genes are organized in a cluster. They are transcribed in the same direction and separated by 33 nucleotides. In contrast, the trxA and trxB genes of E. coli, the only other organism in which both genes have been characterized, are physically widely separated. Images PMID:8349555

  17. Flavin reductase: sequence of cDNA from bovine liver and tissue distribution.

    PubMed Central

    Quandt, K S; Hultquist, D E


    Flavin reductase catalyzes electron transfer from reduced pyridine nucleotides to methylene blue or riboflavin, and this catalysis is the basis of the therapeutic use of methylene blue or riboflavin in the treatment of methemoglobinemia. A cDNA for a mammalian flavin reductase has been isolated and sequenced. Degenerate oligonucleotides, with sequences based on amino acid sequences of peptides derived from bovine erythrocyte flavin reductase, were used as primers in PCR to selectively amplify a partial cDNA that encodes the bovine reductase. The template used in the PCR was first strand cDNA synthesized from bovine liver total RNA using oligo(dT) primers. A PCR product was used as a specific probe to screen a bovine liver cDNA library. The sequence determined from two overlapping clones contains an open reading frame of 621 nucleotides and encodes 206 amino acids. The amino acid sequence deduced from the bovine liver flavin reductase cDNA matches the amino acid sequences determined for erythrocyte reductase-derived peptides, and the predicted molecular mass of 22,001 Da for the liver reductase agrees well with the molecular mass of 21,994 Da determined for the erythrocyte reductase by electrospray mass spectrometry. The amino acid sequence at the N terminus of the reductase has homology to sequences of pyridine nucleotide-dependent enzymes, and the predicted secondary structure, beta alpha beta, resembles the common nucleotide-binding structural motif. RNA blot analysis indicates a single 1-kilobase reductase transcript in human heart, kidney, liver, lung, pancreas, placenta, and skeletal muscle. Images PMID:7937764

  18. Terminal attractors in neural networks

    NASA Technical Reports Server (NTRS)

    Zak, Michail


    A new type of attractor (terminal attractors) for content-addressable memory, associative memory, and pattern recognition in artificial neural networks operating in continuous time is introduced. The idea of a terminal attractor is based upon a violation of the Lipschitz condition at a fixed point. As a result, the fixed point becomes a singular solution which envelopes the family of regular solutions, while each regular solution approaches such an attractor in finite time. It will be shown that terminal attractors can be incorporated into neural networks such that any desired set of these attractors with prescribed basins is provided by an appropriate selection of the synaptic weights. The applications of terminal attractors for content-addressable and associative memories, pattern recognition, self-organization, and for dynamical training are illustrated.

  19. Terminal attractors in neural networks

    NASA Technical Reports Server (NTRS)

    Zak, Michail


    A new type of attractor (terminal attractors) for content-addressable memory, associative memory, and pattern recognition in artificial neural networks operating in continuous time is introduced. The idea of a terminal attractor is based upon a violation of the Lipschitz condition at a fixed point. As a result, the fixed point becomes a singular solution which envelopes the family of regular solutions, while each regular solution approaches such an attractor in finite time. It will be shown that terminal attractors can be incorporated into neural networks such that any desired set of these attractors with prescribed basins is provided by an appropriate selection of the synaptic weights. The applications of terminal attractors for content-addressable and associative memories, pattern recognition, self-organization, and for dynamical training are illustrated.

  20. Mechanisms of DNA replication termination.


    Dewar, James M; Walter, Johannes C


    Genome duplication is carried out by pairs of replication forks that assemble at origins of replication and then move in opposite directions. DNA replication ends when converging replication forks meet. During this process, which is known as replication termination, DNA synthesis is completed, the replication machinery is disassembled and daughter molecules are resolved. In this Review, we outline the steps that are likely to be common to replication termination in most organisms, namely, fork convergence, synthesis completion, replisome disassembly and decatenation. We briefly review the mechanism of termination in the bacterium Escherichia coli and in simian virus 40 (SV40) and also focus on recent advances in eukaryotic replication termination. In particular, we discuss the recently discovered E3 ubiquitin ligases that control replisome disassembly in yeast and higher eukaryotes, and how their activity is regulated to avoid genome instability.

  1. Balanced Branching in Transcription Termination

    NASA Technical Reports Server (NTRS)

    Harrington, K. J.; Laughlin, R. B.; Liang, S.


    The theory of stochastic transcription termination based on free-energy competition requires two or more reaction rates to be delicately balanced over a wide range of physical conditions. A large body of work on glasses and large molecules suggests that this should be impossible in such a large system in the absence of a new organizing principle of matter. We review the experimental literature of termination and find no evidence for such a principle but many troubling inconsistencies, most notably anomalous memory effects. These suggest that termination has a deterministic component and may conceivably be not stochastic at all. We find that a key experiment by Wilson and von Hippel allegedly refuting deterministic termination was an incorrectly analyzed regulatory effect of Mg(2+) binding.

  2. Discovery Performs Terminal Initiation Burn

    NASA Image and Video Library

    The terminal initiation burn, a left Orbital Maneuvering System engine firing that gave Discovery one last big push toward the space station, took place Feb. 26, 2011 at 10:33 a.m. The burn lasted ...

  3. Kinetic studies of the induction of nitrate reductase and cytochrome c reductase in the fungus Aspergillus nidulans

    PubMed Central

    Cove, D. J.


    In an earlier paper (Cove, 1966) it was reported that the kinetics of appearance of nitrate reductase (NADPH–nitrate oxidoreductase, EC on the addition of nitrate to a growing culture of Aspergillus nidulans were different in certain respects from those found for many Escherichia coli enzymes. When urea is used as an initial nitrogen source, a further difference is found: enzyme synthesis is no longer continuous. This interruption of synthesis does not appear to be due to synchronous cell division in the culture, nor to be due to accumulation of ammonia. Fluctuations in the intracellular concentration of nitrate, though appearing to be partly responsible for the discontinuity of enzyme syntheses, cannot account for all the observations. Two related hypotheses are put forward to explain this discontinuity of synthesis; each suggests that nitrate reductase is intimately concerned with its own synthesis. One possibility is that the enzyme when it is not in the form of a complex with nitrate is a co-repressor of its own synthesis, and the other that the enzyme is its own repressor. PMID:6049855

  4. 5,10-Methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) gene polymorphisms and adult meningioma risk.


    Zhang, Jun; Zhou, Yan-Wen; Shi, Hua-Ping; Wang, Yan-Zhong; Li, Gui-Ling; Yu, Hai-Tao; Xie, Xin-You


    The causes of meningiomas are not well understood. Folate metabolism gene polymorphisms have been shown to be associated with various human cancers. It is still controversial and ambiguous between the functional polymorphisms of folate metabolism genes 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) and risk of adult meningioma. A population-based case–control study involving 600 meningioma patients (World Health Organization [WHO] Grade I, 391 cases; WHO Grade II, 167 cases; WHO Grade III, 42 cases) and 600 controls was done for the MTHFR C677T and A1298C, MTRR A66G, and MTR A2756G variants in Chinese Han population. The folate metabolism gene polymorphisms were determined by using a polymerase chain reaction–restriction fragment length polymorphism assay. Meningioma cases had a significantly lower frequency of MTHFR 677 TT genotype [odds ratio (OR) = 0.49, 95 % confidence interval (CI) 0.33–0.74; P = 0.001] and T allele (OR = 0.80, 95 % CI 0.67–0.95; P = 0.01) than controls. A significant association between risk of meningioma and MTRR 66 GG (OR = 1.41, 95 % CI 1.02–1.96; P = 0.04) was also observed. When stratifying by the WHO grade of meningioma, no association was found. Our study suggested that MTHFR C677T and MTRR A66G variants may affect the risk of adult meningioma in Chinese Han population.

  5. Individualized supplementation of folic acid according to polymorphisms of methylenetetrahydrofolate reductase (MTHFR), methionine synthase reductase (MTRR) reduced pregnant complications.


    Li, Xiujuan; Jiang, Jing; Xu, Min; Xu, Mei; Yang, Yan; Lu, Wei; Yu, Xuemei; Ma, Jianlin; Pan, Jiakui


    This study aimed to detect the genotype distributions and allele frequencies of methylenetetrahydrofolate reductase (MTHFR) C677T, A1298C and methionine synthase reductase (MTRR) A66G polymorphisms of pregnant women in Jiaodong region in China, and to investigate whether folic acid supplementation affect the pregnancy complications. A total of 7,812 pregnant women from the Jiaodong region in Shandong province in China. By using Taqman-MGB, 2,928 pregnant women (case group) were tested for the genotype distributions and allele frequencies of MTHFR C677T, A1298C and MTRR A66G polymorphisms. Folic acid metabolism ability was ranked at four levels and then pregnant women in different rank group were supplemented with different doses of folic acid. Their pregnancy complications were followed up and compared with 4,884 pregnant women without folic acid supplementation (control group) in the same hospital. The allele frequencies of MTHFR C677T were 49.1 and 50.9%; those of MTHFR A1298C were 80.2 and 19.8%, and those of MTRR A66G were 74.1 and 25.9%. After supplemented with folic acid, the complication rates in different age groups were significantly reduced, especially for gestational diabetes mellitus and hypertension. Periconceptional folic acid supplementation and healthcare following gene polymorphism testing may be a powerful measure to decrease congenital malformations. © 2015 S. Karger AG, Basel.

  6. Polymorphisms of methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTR), methionine synthase reductase (MTRR), and thymidylate synthase (TYMS) in multiple myeloma risk.


    Lima, Carmen S P; Ortega, Manoela M; Ozelo, Margareth C; Araujo, Renato C; De Souza, Cármino A; Lorand-Metze, Irene; Annichino-Bizzacchi, Joyce M; Costa, Fernando F


    We tested whether the polymorphisms of the methylenetetrahydrofolate reductase gene, MTHFR C677T and A1298C, the methionine synthase gene, MTR A2756G, the methionine synthase reductase gene, MTRR A66G, and the thymidylate synthase gene, TYMS 2R-->3R, involved in folate and methionine metabolism, altered the risk for multiple myeloma (MM). Genomic DNA from 123MM patients and 188 controls was analysed by polymerase chain reaction and restriction digestion for the polymorphism analyses. The frequency of the MTR 2756 AG plus GG genotype was higher in patients than in controls (39.8% versus 23.4%, P=0.001). Individual carriers of the variant allele G had a 2.31 (95% CI: 1.38-3.87)-fold increased risk for MM compared with others. In contrast, similar frequencies of the MTHFR, the MTRR and the TYMS genotypes were seen in patients and controls. These results suggest, for the first time, a role for the MTR A2756G polymorphism in MM risk in our country, but should be confirmed by large-scale epidemiological studies with patients and controls age matched.

  7. Curcumin is a tight-binding inhibitor of the most efficient human daunorubicin reductase--Carbonyl reductase 1.


    Hintzpeter, Jan; Hornung, Jan; Ebert, Bettina; Martin, Hans-Jörg; Maser, Edmund


    Curcumin is a major component of the plant Curcuma longa L. It is traditionally used as a spice and coloring in foods and is an important ingredient in curry. Curcuminoids have anti-oxidant and anti-inflammatory properties and gained increasing attention as potential neuroprotective and cancer preventive compounds. In the present study, we report that curcumin is a potent tight-binding inhibitor of human carbonyl reductase 1 (CBR1, Ki=223 nM). Curcumin acts as a non-competitive inhibitor with respect to the substrate 2,3-hexandione as revealed by plotting IC50-values against various substrate concentrations and most likely as a competitive inhibitor with respect to NADPH. Molecular modeling supports the finding that curcumin occupies the cofactor binding site of CBR1. Interestingly, CBR1 is one of the most effective human reductases in converting the anthracycline anti-tumor drug daunorubicin to daunorubicinol. The secondary alcohol metabolite daunorubicinol has significantly reduced anti-tumor activity and shows increased cardiotoxicity, thereby limiting the clinical use of daunorubicin. Thus, inhibition of CBR1 may increase the efficacy of daunorubicin in cancer tissue and simultaneously decrease its cardiotoxicity. Western-blots demonstrated basal expression of CBR1 in several cell lines. Significantly less daunorubicin reduction was detected after incubating A549 cell lysates with increasing concentrations of curcumin (up to 60% less with 50 μM curcumin), suggesting a beneficial effect in the co-treatment of anthracycline anti-tumor drugs together with curcumin.

  8. A new cotton SDR family gene encodes a polypeptide possessing aldehyde reductase and 3-ketoacyl-CoA reductase activities.


    Pang, Yu; Song, Wen-Qiang; Chen, Fang-Yuan; Qin, Yong-Mei


    To understand regulatory mechanisms of cotton fiber development, microarray analysis has been performed for upland cotton (Gossypium hirsutum). Based on this, a cDNA (GhKCR3) encoding a polypeptide belonging to short-chain alcohol dehydrogenase/reductase family was isolated and cloned. It contains an open reading frame of 987 bp encoding a polypeptide of 328 amino acid residues. Following its overexpression in bacterial cells, the purified recombinant protein specifically uses NADPH to reduce a variety of short-chain aldehydes. A fragment between Gly180 and Gly191 was found to be essential for its catalytic activity. Though the GhKCR3 gene shares low sequence similarities to the ortholog of Saccharomyces cerevisiae YBR159w that encodes 3-ketoacyl-CoA reductase (KCR) catalyzing the second step of fatty acid elongation, it was surprisingly able to complement the yeast ybr159wDelta mutant. Gas chromatography-mass spectrometry analysis showed that very long-chain fatty acids, especially C26:0, were produced in the ybr159wDelta mutant cells expressing GhKCR3. Applying palmitoyl-CoA and malonyl-CoA as substrates, GhKCR3 showed KCR activity in vitro. Quantitative real time-PCR analysis indicated GhKCR3 transcripts accumulated in rapidly elongating fibers, roots, and stems. Our results suggest that GhKCR3 is probably a novel KCR contributing to very long-chain fatty acid biosynthesis in plants.

  9. Purification of NADPH-cytochrome c reductase from swine testis microsomes by chromatofocusing and characterization of the purified reductase.


    Kuwada, M; Ohsawa, Y; Horie, S


    A purified NADPH-cytochrome c reductase (NADPH: ferricytochrome oxidoreductase, EC was prepared from swine testis microsomes by detergent solubilization followed by a procedure including chromatofocusing. The reductase was eluted at an isoelectric point of 4.8 from the chromatofocusing column. 730-fold purification was achieved with an overall yield of 1.2%. The preparation was found to be homogeneous upon polyacrylamide gel electrophoresis in the absence of sodium dodecyl sulfate (SDS). Upon SDS-polyacrylamide gel electrophoresis, however, the purified preparation resolved into one major band (Mr 78 000) and two minor bands (Mr 60 000 and 15 000). The enzyme contained about 1 mol each of FMN and FAD, which were both extractable with trichloroacetic acid and also boiling water. The oxidized form of the enzyme showed the absorption spectrum of a typical flavoprotein. Aerobic reduction with NADPH resulted in conversion of the spectrum into one of an air-stable semiquinone form. The activity of the purified preparation was 26 mumol cytochrome c reduced/min per mg protein under the standard assay conditions at 22 degrees C. The enzyme catalyzed the reaction through a ping-pong mechanism.

  10. Epigallocatechin-3-gallate potently inhibits the in vitro activity of hydroxy-3-methyl-glutaryl-CoA reductase[S

    PubMed Central

    Cuccioloni, Massimiliano; Mozzicafreddo, Matteo; Spina, Michele; Tran, Chi Nhan; Falconi, Maurizio; Eleuteri, Anna Maria; Angeletti, Mauro


    Hydroxy-3-methyl-glutaryl-CoA reductase (HMGR) is the rate-controlling enzyme of cholesterol synthesis, and owing to its biological and pharmacological relevance, researchers have investigated several compounds capable of modulating its activity with the hope of developing new hypocholesterolemic drugs. In particular, polyphenol-rich extracts were extensively tested for their cholesterol-lowering effect as alternatives, or adjuvants, to the conventional statin therapies, but a full understanding of the mechanism of their action has yet to be reached. Our work reports on a detailed kinetic and equilibrium study on the modulation of HMGR by the most-abundant catechin in green tea, epigallocatechin-3-gallate (EGCG). Using a concerted approach involving spectrophotometric, optical biosensor, and chromatographic analyses, molecular docking, and site-directed mutagenesis on the cofactor site of HMGR, we have demonstrated that EGCG potently inhibits the in vitro activity of HMGR (Ki in the nanomolar range) by competitively binding to the cofactor site of the reductase. Finally, we evaluated the effect of combined EGCG-statin administration. PMID:21357570

  11. Peach MYB7 activates transcription of the proanthocyanidin pathway gene encoding leucoanthocyanidin reductase, but not anthocyanidin reductase

    PubMed Central

    Zhou, Hui; Lin-Wang, Kui; Liao, Liao; Gu, Chao; Lu, Ziqi; Allan, Andrew C.; Han, Yuepeng


    Proanthocyanidins (PAs) are a group of natural phenolic compounds that have a great effect on both flavor and nutritious value of fruit. It has been shown that PA synthesis is regulated by R2R3-MYB transcription factors (TFs) via activation of PA-specific pathway genes encoding leucoanthocyanidin reductase and anthocyanidin reductase. Here, we report the isolation and characterization of a MYB gene designated PpMYB7 in peach. The peach PpMYB7 represents a new group of R2R3-MYB genes regulating PA synthesis in plants. It is able to activate transcription of PpLAR1 but not PpANR, and has a broader selection of potential bHLH partners compared with PpMYBPA1. Transcription of PpMYB7 can be activated by the peach basic leucine-zipper 5 TF (PpbZIP5) via response to ABA. Our study suggests a transcriptional network regulating PA synthesis in peach, with the results aiding the understanding of the functional divergence between R2R3-MYB TFs in plants. PMID:26579158

  12. Naegleria fowleri: a free-living highly pathogenic amoeba contains trypanothione/trypanothione reductase and glutathione/glutathione reductase systems.


    Ondarza, Raúl N; Hurtado, Gerardo; Tamayo, Elsa; Iturbe, Angélica; Hernández, Eva


    This paper presents definitive data showing that the thiol-bimane compound isolated and purified by HPLC from Naegleria fowleri trophozoites unequivocally corresponds by matrix assisted laser-desorption ionization-time-of-flight MS, to the characteristic monoprotonated ion of trypanothione-(bimane)(2) [M(+)H(+)] of m/z 1104.57 and to the trypanothione-(bimane) of m/z 914.46. The trypanothione disulfide T(S)(2) was also found to have a molecular ion of m/z 723.37. Additionally HPLC demonstrated that thiol-bimane compounds corresponding to cysteine and glutathione were present in Naegleria. The ion patterns of the thiol-bimane compounds prepared from commercial trypanothione standard, Entamoeba histolytica and Crithidia luciliae are identical to the Naegleria thiol-bimane compound. Partially purified extracts from N. fowleri showed the coexistence of glutathione and trypanothione reductases activities. There is not doubt that the thiol compound trypanothione, which was previously thought to occur only in Kinetoplastida, is also present in the human pathogens E. histolytica and N. fowleri, as well as in the non-pathogenic euglenozoan E. gracilis. The presence of the trypanothione/trypanothione reductase system in N. fowleri creates the possibility of using this enzyme as a new "drug target" for rationally designed drugs to eliminate the parasite, without affecting the human host.

  13. The fnr gene of Bacillus licheniformis and the cysteine ligands of the C-terminal FeS cluster.


    Klinger, A; Schirawski, J; Glaser, P; Unden, G


    In the facultatively anaerobic bacterium Bacillus licheniformis a gene encoding a protein of the fumarate nitrate reductase family of transcriptional regulators (Fnr) was isolated. Unlike Fnr proteins from gram-negative bacteria, but like Fnr from Bacillus subtilis, the protein contained a C-terminal cluster of cysteine residues. Unlike in Fnr from B. subtilis, this cluster (Cys226-X2-Cys229-X4-Cys234) is composed of only three Cys residues, which are supposed to serve together with an internal residue (Cys71) as the ligands for an FeS center. Transfer of the B. licheniformis gene to an fnr mutant of B. subtilis complemented the ability for synthesis of nitrate reductase during anaerobic growth.

  14. The fnr Gene of Bacillus licheniformis and the Cysteine Ligands of the C-Terminal FeS Cluster

    PubMed Central

    Klinger, Anette; Schirawski, Jan; Glaser, Philippe; Unden, Gottfried


    In the facultatively anaerobic bacterium Bacillus licheniformis a gene encoding a protein of the fumarate nitrate reductase family of transcriptional regulators (Fnr) was isolated. Unlike Fnr proteins from gram-negative bacteria, but like Fnr from Bacillus subtilis, the protein contained a C-terminal cluster of cysteine residues. Unlike in Fnr from B. subtilis, this cluster (Cys226-X2-Cys229-X4-Cys234) is composed of only three Cys residues, which are supposed to serve together with an internal residue (Cys71) as the ligands for an FeS center. Transfer of the B. licheniformis gene to an fnr mutant of B. subtilis complemented the ability for synthesis of nitrate reductase during anaerobic growth. PMID:9642208

  15. Propagation Terminal Design and Measurements

    NASA Technical Reports Server (NTRS)

    Nessel, James


    The NASA propagation terminal has been designed and developed by the Glenn Research Center and is presently deployed at over 5 NASA and partner ground stations worldwide collecting information on the effects of the atmosphere on Ka-band and millimeter wave communications links. This lecture provides an overview of the fundamentals and requirements of the measurement of atmospheric propagation effects and, specifically, the types of hardware and digital signal processing techniques employed by current state-of-the-art propagation terminal systems.

  16. Changes in glutathione redox cycle during diapause determination and termination in the bivoltine silkworm, Bombyx mori.


    Zhao, Lin-Chuan; Hou, Yi-Sheng; Sima, Yang-Hu


    To explore whether glutathione regulates diapause determination and termination in the bivoltine silkworm Bombyx mori, we monitored the changes in glutathione redox cycle in the ovary of both diapause- and nondiapause-egg producers, as well as those in diapause eggs incubated at different temperatures. The activity of thioredoxin reductase (TrxR) was detected in ovaries but not in eggs, while neither ovaries nor eggs showed activity of glutathione peroxidase. A lower reduced glutathione/oxidized glutathione (GSH/GSSG) ratio was observed in the ovary of diapause-egg producers, due to weaker reduction of oxidized glutathione (GSSG) to the reduced glutathione (GSH) catalyzed by glutathione reductase (GR) and TrxR. This indicates an oxidative shift in the glutathione redox cycle during diapause determination. Compared with the 25°C-treated diapause eggs, the 5°C-treated diapause eggs showed lower GSH/GSSG ratio, a result of stronger oxidation of GSH catalyzed by thioredoxin peroxidase and weaker reduction of GSSG catalyzed by GR. Our study demonstrated the important regulatory role of glutathione in diapause determination and termination of the bivoltine silkworm.

  17. External loops at the ferredoxin-NADP(+) reductase protein-partner binding cavity contribute to substrates allocation.


    Sánchez-Azqueta, Ana; Martínez-Júlvez, Marta; Hervás, Manuel; Navarro, José A; Medina, Milagros


    Ferredoxin-NADP(+) reductase (FNR) is the structural prototype of a family of FAD-containing reductases that catalyze electron transfer between low potential proteins and NAD(P)(+)/H, and that display a two-domain arrangement with an open cavity at their interface. The inner part of this cavity accommodates the reacting atoms during catalysis. Loops at its edge are highly conserved among plastidic FNRs, suggesting that they might contribute to both flavin stabilization and competent disposition of substrates. Here we pay attention to two of these loops in Anabaena FNR. The first is a sheet-loop-sheet motif, loop102-114, that allocates the FAD adenosine. It was thought to determine the extended FAD conformation, and, indirectly, to modulate isoalloxazine electronic properties, partners binding, catalytic efficiency and even coenzyme specificity. The second, loop261-269, contains key residues for the allocation of partners and coenzyme, including two glutamates, Glu267 and Glu268, proposed as candidates to facilitate the key displacement of the C-terminal tyrosine (Tyr303) from its stacking against the isoalloxazine ring during the catalytic cycle. Our data indicate that the main f