Science.gov

Sample records for mtrc terminal reductases

  1. Isolation of a high-affinity functional protein complex between OmcA and MtrC: Two outer membrane decaheme c-type cytochromes of Shewanella oneidensis MR-1.

    PubMed

    Shi, Liang; Chen, Baowei; Wang, Zheming; Elias, Dwayne A; Mayer, M Uljana; Gorby, Yuri A; Ni, Shuison; Lower, Brian H; Kennedy, David W; Wunschel, David S; Mottaz, Heather M; Marshall, Matthew J; Hill, Eric A; Beliaev, Alexander S; Zachara, John M; Fredrickson, James K; Squier, Thomas C

    2006-07-01

    Shewanella oneidensis MR-1 is a facultatively anaerobic bacterium capable of using soluble and insoluble forms of manganese [Mn(III/IV)] and iron [Fe(III)] as terminal electron acceptors during anaerobic respiration. To assess the structural association of two outer membrane-associated c-type decaheme cytochromes (i.e., OmcA [SO1779] and MtrC [SO1778]) and their ability to reduce soluble Fe(III)-nitrilotriacetic acid (NTA), we expressed these proteins with a C-terminal tag in wild-type S. oneidensis and a mutant deficient in these genes (i.e., Delta omcA mtrC). Endogenous MtrC copurified with tagged OmcA in wild-type Shewanella, suggesting a direct association. To further evaluate their possible interaction, both proteins were purified to near homogeneity following the independent expression of OmcA and MtrC in the Delta omcA mtrC mutant. Each purified cytochrome was confirmed to contain 10 hemes and exhibited Fe(III)-NTA reductase activity. To measure binding, MtrC was labeled with the multiuse affinity probe 4',5'-bis(1,3,2-dithioarsolan-2-yl)fluorescein (1,2-ethanedithiol)2, which specifically associates with a tetracysteine motif engineered at the C terminus of MtrC. Upon titration with OmcA, there was a marked increase in fluorescence polarization indicating the formation of a high-affinity protein complex (Kd < 500 nM) between MtrC and OmcA whose binding was sensitive to changes in ionic strength. Following association, the OmcA-MtrC complex was observed to have enhanced Fe(III)-NTA reductase specific activity relative to either protein alone, demonstrating that OmcA and MtrC can interact directly with each other to form a stable complex that is consistent with their role in the electron transport pathway of S. oneidensis MR-1.

  2. Isolation of a High-Affinity Functional Protein Complex between OmcA and MtrC: Two Outer Membrane Decaheme c-Type Cytochromes of Shewanella oneidensis MR-1

    PubMed Central

    Shi, Liang; Chen, Baowei; Wang, Zheming; Elias, Dwayne A.; Mayer, M. Uljana; Gorby, Yuri A.; Ni, Shuison; Lower, Brian H.; Kennedy, David W.; Wunschel, David S.; Mottaz, Heather M.; Marshall, Matthew J.; Hill, Eric A.; Beliaev, Alexander S.; Zachara, John M.; Fredrickson, James K.; Squier, Thomas C.

    2006-01-01

    Shewanella oneidensis MR-1 is a facultatively anaerobic bacterium capable of using soluble and insoluble forms of manganese [Mn(III/IV)] and iron [Fe(III)] as terminal electron acceptors during anaerobic respiration. To assess the structural association of two outer membrane-associated c-type decaheme cytochromes (i.e., OmcA [SO1779] and MtrC [SO1778]) and their ability to reduce soluble Fe(III)-nitrilotriacetic acid (NTA), we expressed these proteins with a C-terminal tag in wild-type S. oneidensis and a mutant deficient in these genes (i.e., ΔomcA mtrC). Endogenous MtrC copurified with tagged OmcA in wild-type Shewanella, suggesting a direct association. To further evaluate their possible interaction, both proteins were purified to near homogeneity following the independent expression of OmcA and MtrC in the ΔomcA mtrC mutant. Each purified cytochrome was confirmed to contain 10 hemes and exhibited Fe(III)-NTA reductase activity. To measure binding, MtrC was labeled with the multiuse affinity probe 4′,5′-bis(1,3,2-dithioarsolan-2-yl)fluorescein (1,2-ethanedithiol)2, which specifically associates with a tetracysteine motif engineered at the C terminus of MtrC. Upon titration with OmcA, there was a marked increase in fluorescence polarization indicating the formation of a high-affinity protein complex (Kd < 500 nM) between MtrC and OmcA whose binding was sensitive to changes in ionic strength. Following association, the OmcA-MtrC complex was observed to have enhanced Fe(III)-NTA reductase specific activity relative to either protein alone, demonstrating that OmcA and MtrC can interact directly with each other to form a stable complex that is consistent with their role in the electron transport pathway of S. oneidensis MR-1. PMID:16788180

  3. Electrochemical interaction of Shewanella oneidensis MR-1 and its outer membrane cytochromes OmcA and MtrC with hematite electrodes

    SciTech Connect

    Meitl, Leisa A.; Eggleston, Carrick M.; Colberg, Patricia J.; Khare, Nidhi; Reardon, Catherine L.; Shi, Liang

    2009-09-15

    Bacterial metal reduction is an important biogeochemical process in anaerobic environments. An understanding of electron transfer pathways from dissimilatory metal reducing bacteria (DMRB) to solid phase metal (hydr)oxides is important for understanding metal redox cycling in soils and sediments, for utilizing DMRB in bioremedation, and for developing technologies such as microbial fuel cells. Here we hypothesize that the outer membrane cytochromes OmcA and MtrC from Shewanella oneidensis MR-1 are the only terminal reductases capable of direct electron transfer to a hematite working electrode. Cyclic voltammetry (CV) was used to study electron transfer between hematite electrodes and protein films, S. oneidensis MR-1 wild-type cell suspensions, and cytochrome deletion mutants. After controlling for hematite electrode dissolution at negative potential, the midpoint potentials of adsorbed OmcA and MtrC were measured (-201 mV and -163 mV vs. Ag/AgCl, respectively). Cell suspensions of wild-type MR-1, deletion mutants deficient in OmcA (ΔomcA), MtrC (ΔmtrC), and both OmcA and MtrC (ΔmtrC-ΔomcA) were also studied; voltammograms for ΔmtrC-ΔomcA were indistinguishable from the control. When the control was subtracted from the single deletion mutant voltammograms, redox peaks were consistent with the present cytochrome (i.e., ΔomcA consistent with MtrC and ΔmtrC consistent with OmcA). The results indicate that OmcA and MtrC are capable of direct electron exchange with hematite electrodes, consistent with a role as terminal reductases in the S. oneidensis MR-1 anaerobic respiratory pathway involving ferric minerals. There was no evidence for other terminal reductases operating under the conditions investigated. A Marcus-based approach to electron transfer kinetics indicated that the rate constant for electron transfer ket varies from 0.025 s-1 in the absence of a barrier to 63.5 s-1 with a 0.2 eV barrier.

  4. MTRC compensation in high-resolution ISAR imaging via improved polar format algorithm

    NASA Astrophysics Data System (ADS)

    Liu, Yang; Li, Hao; Li, Na; Xu, Shiyou; Chen, Zengping

    2014-10-01

    Migration through resolution cells (MTRC) is generated in high-resolution inverse synthetic aperture radar (ISAR) imaging. A MTRC compensation algorithm for high-resolution ISAR imaging based on improved polar format algorithm (PFA) is proposed in this paper. Firstly, in the situation that a rigid-body target stably flies, the initial value of the rotation angle and center of the target is obtained from the rotation of radar line of sight (RLOS) and high range resolution profile (HRRP). Then, the PFA is iteratively applied to the echo data to search the optimization solution based on minimum entropy criterion. The procedure starts with the estimated initial rotation angle and center, and terminated when the entropy of the compensated ISAR image is minimized. To reduce the computational load, the 2-D iterative search is divided into two 1-D search. One is carried along the rotation angle and the other one is carried along rotation center. Each of the 1-D searches is realized by using of the golden section search method. The accurate rotation angle and center can be obtained when the iterative search terminates. Finally, apply the PFA to compensate the MTRC by the use of the obtained optimized rotation angle and center. After MTRC compensation, the ISAR image can be best focused. Simulated and real data demonstrate the effectiveness and robustness of the proposed algorithm.

  5. Direct Involvement of Type II Secretion System in Extracellular Translocation of Shewanella Oneidensis Outer Membrane Cytochromes MtrC and OmcA

    SciTech Connect

    Shi, Liang; Deng, Shuang; Marshall, Matthew J.; Wang, Zheming; Kennedy, David W.; Dohnalkova, Alice; Mottaz, Heather M.; Hill, Eric A.; Gorby, Yuri A.; Beliaev, Alex S.; Richardson, David J.; Zachara, John M.; Fredrickson, Jim K.

    2008-08-01

    Outer membrane decaheme c-type cytochromes MtrC and OmcA of Shewanella oneidensis MR-1 are extracellular lipoproteins important for dissimilatory reduction of solid metal (hydr)oxides during anaerobic respiration. To investigate the roles of type II secretion system (T2S) in translocation of MtrC and OmcA across outer membrane, we measured the effects of deleting two T2S genes, gspD and gspG, on the secretion of MtrC and OmcA when cells were grown under anaerobic conditions. Deletion of gspD or gspG resulted in slightly yellowish supernatants, different from the pink supernatant of wild type (wt). Comparative proteomic analyses revealed that, although MtrC, OmcA and NrfA, a periplasmic nitrite reductase, were present the supernatants of wt and ΔgspD mutant, their peptides counts were much lower in ΔgspD than in wt. Subsequent analyses with heme-staining and Western blot not only confirmed that deletion of gspD or gspG reduced the abundances of MtrC and OmcA in the supernatants, but also revealed that the deletions consequently increased their abundances inside the cells. Complementation of ΔgspG mutant with functional GspG could reverse the effects of deleting gspG on the colors of the supernatants and the abundances of MtrC and OmcA. In contrast, Western results showed that the abundance of NrfA was reduced in the supernatant and the cells of ΔgspD mutant, suggesting that reduced NrfA in the periplasm, where MtrC and OmcA were accumulated, contributed to its reduction in the supernatant. Thus, our results demonstrate at the first time that T2S facilitates translocation of MtrC and OmcA across outer membrane.

  6. Flavin Binding to the Deca-heme Cytochrome MtrC: Insights from Computational Molecular Simulation.

    PubMed

    Breuer, Marian; Rosso, Kevin M; Blumberger, Jochen

    2015-12-15

    Certain dissimilatory bacteria have the remarkable ability to use extracellular metal oxide minerals instead of oxygen as terminal electron sinks, using a process known as "extracellular respiration". Specialized multiheme cytochromes located on the outer membrane of the microbe were shown to be crucial for electron transfer from the cell surface to the mineral. This process is facilitated by soluble, biogenic flavins secreted by the organism for the purpose of acting as an electron shuttle. However, their interactions with the outer-membrane cytochromes are not established on a molecular scale. Here, we study the interaction between the outer-membrane deca-heme cytochrome MtrC from Shewanella oneidensis and flavin mononucleotide (FMN in fully oxidized quinone form) using computational docking. We find that interaction of FMN with MtrC is significantly weaker than with known FMN-binding proteins, but identify a mildly preferred interaction site close to heme 2 with a dissociation constant (Kd) = 490 μM, in good agreement with recent experimental estimates, Kd = 255 μM. The weak interaction with MtrC can be qualitatively explained by the smaller number of hydrogen bonds that the planar headgroup of FMN can form with this protein compared to FMN-binding proteins. Molecular dynamics simulation gives indications for a possible conformational switch upon cleavage of the disulphide bond of MtrC, but without concomitant increase in binding affinities according to this docking study. Overall, our results suggest that binding of FMN to MtrC is reversible and not highly specific, which may be consistent with a role as redox shuttle that facilitates extracellular respiration.

  7. Flavin Binding to the Deca-heme Cytochrome MtrC: Insights from Computational Molecular Simulation

    PubMed Central

    Breuer, Marian; Rosso, Kevin M.; Blumberger, Jochen

    2015-01-01

    Certain dissimilatory bacteria have the remarkable ability to use extracellular metal oxide minerals instead of oxygen as terminal electron sinks, using a process known as “extracellular respiration”. Specialized multiheme cytochromes located on the outer membrane of the microbe were shown to be crucial for electron transfer from the cell surface to the mineral. This process is facilitated by soluble, biogenic flavins secreted by the organism for the purpose of acting as an electron shuttle. However, their interactions with the outer-membrane cytochromes are not established on a molecular scale. Here, we study the interaction between the outer-membrane deca-heme cytochrome MtrC from Shewanella oneidensis and flavin mononucleotide (FMN in fully oxidized quinone form) using computational docking. We find that interaction of FMN with MtrC is significantly weaker than with known FMN-binding proteins, but identify a mildly preferred interaction site close to heme 2 with a dissociation constant (Kd) = 490 μM, in good agreement with recent experimental estimates, Kd = 255 μM. The weak interaction with MtrC can be qualitatively explained by the smaller number of hydrogen bonds that the planar headgroup of FMN can form with this protein compared to FMN-binding proteins. Molecular dynamics simulation gives indications for a possible conformational switch upon cleavage of the disulphide bond of MtrC, but without concomitant increase in binding affinities according to this docking study. Overall, our results suggest that binding of FMN to MtrC is reversible and not highly specific, which may be consistent with a role as redox shuttle that facilitates extracellular respiration. PMID:26682818

  8. Characterization of Shewanella oneidensis MtrC: a cell-surface decaheme cytochrome involved in respiratory electron transport to extracellular electron acceptors

    SciTech Connect

    Hartshorne, Robert S.; Jepson, Brian N.; Clarke, Thomas A.; Field, Sarah J.; Fredrickson, Jim K.; Zachara, John M.; Shi, Liang; Butt, Julea N.; Richardson, David

    2007-09-04

    Abstract MtrC is a decaheme c-type cytochrome associated with the outer cell membrane of Fe(III)-respiring species of the Shewanella genus. It is proposed to play a role in anaerobic respiration by mediating electron transfer to extracellular mineral oxides that can serve as terminal electron acceptors. The present work presents the first spectropotentiometric and voltammetric characterization of MtrC, using protein purified from Shewanella oneidensis MR-1. Potentiometric titrations, monitored by UV–vis absorption and electron paramagnetic resonance (EPR) spectroscopy, reveal that the hemes within MtrC titrate over a broad potential range spanning between approximately +100 and approximately *500 mV (vs. the standard hydrogen electrode). Across this potential window the UV– vis absorption spectra are characteristic of low-spin c-type hemes and the EPR spectra reveal broad, complex features that suggest the presence of magnetically spin-coupled lowspin c-hemes. Non-catalytic protein film voltammetry of MtrC demonstrates reversible electrochemistry over a potential window similar to that disclosed spectroscopically. The voltammetry also allows definition of kinetic properties of MtrC in direct electron exchange with a solid electrode surface and during reduction of a model Fe(III) substrate. Taken together, the data provide quantitative information on the potential domain in which MtrC can operate.

  9. Kinetics of Reduction of Fe(III) Complexes by Outer Membrane Cytochromes MtrC and OmcA of Shewanella oneidensis MR-1

    SciTech Connect

    Wang, Zheming; Liu, Chongxuan; Wang, Xuelin; Marshall, Matthew J.; Zachara, John M.; Rosso, Kevin M.; Dupuis, Michel; Fredrickson, Jim K.; Heald, Steve M.; Shi, Liang

    2008-09-12

    Shewanella Oneidensis MR-1 possesses up to 42 c-type cytochromes with heme content varying between 1 to as many as 37. Among them, the outer-membrane cytochromes, particularly MtrC and OmcA, are suspected to function as terminal reductases and are responsible for its enzymatic catalysis capability. So far, the mechanisms of metal reduction by these outer-membrane cytochromes are unknown. In this work, we report the study of reduction kinetics of a series of Fe(III) complexes with citrate, NTA and EDTA by abiotically reduced MtrC and OmcA using a stopped-flow technique in combination with theoretical computation methods within the framework of the electron transfer theory of Marcus and speciation calculations based on the current thermodynamic database. Stopped-flow kinetic data showed that the reaction was very fast and appeared to proceed in two stages, a fast stage that completes in much less than a second and a slower stage afterwards. For a given complex, the reaction is faster by reduction with MtrC than OmcA, while for a given protein, the reaction completes in the decreasing order of Fe-EDTA > Fe-NTA > Fe-citrate. All the stopped-flow kinetic curves could be modeled by two parallel second-order bimolecular redox reactions with second-order rate constants ranging from 0.872 µM-1s-1 for the fast reaction between MtrC with Fe-EDTA complex to 0.012 µM-1s-1 for the slow reaction between OmcA and Fe-citrate complex. Speciation calculations indicated that at both metal:ligand ratios, 1:1.5 and 1:10, a single dominant ferric complex was responsible for the observed reaction for each ligand and, therefore, the observed dual-reaction pathways was attributed to the differences in the reduction behavior among various heme groups within each protein. The results of redox potential calculations with known thermodynamic data show only small differences on the scale of a few millivolts among the three complexes, suggested that

  10. Role of outer membrane c-type cytochromes MtrC and OmcA in Shewanella oneidensis MR-1 cell production, accumulation, and detachment during respiration on hematite.

    PubMed

    Mitchell, A C; Peterson, L; Reardon, C L; Reed, S B; Culley, D E; Romine, M R; Geesey, G G

    2012-07-01

    The iron-reducing bacterium Shewanella oneidensis MR-1 has the capacity to contribute to iron cycling over the long term by respiring on crystalline iron oxides such as hematite when poorly crystalline phases are depleted. The ability of outer membrane cytochromes OmcA and MtrC of MR-1 to bind to and transfer electrons to hematite has led to the suggestion that they function as terminal reductases when this mineral is used as a respiratory substrate. Differences in their redox behavior and hematite-binding properties, however, indicate that they play different roles in the electron transfer reaction. Here, we investigated how these differences in cytochrome behavior with respect to hematite affected biofilm development when the mineral served as terminal electron acceptor (TEA). Upon attachment to hematite, cells of the wild-type (WT) strain as well as those of a ΔomcA mutant but not those of a ΔmtrC mutant replicated and accumulated on the mineral surface. The results indicate that MtrC but not OmcA is required for growth when this mineral serves as TEA. While an OmcA deficiency did not impede cell replication and accumulation on hematite prior to achievement of a maximum surface cell density comparable to that established by WT cells, OmcA was required for efficient electron transfer and cell attachment to hematite once maximum surface cell density was achieved. OmcA may therefore play a role in overcoming barriers to electron transfer and cell attachment to hematite imposed by reductive dissolution of the mineral surface from cell respiration associated with achievement of high surface cell densities.

  11. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E

    1986-01-01

    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  12. The C-terminal extension of bacterial flavodoxin-reductases: involvement in the hydride transfer mechanism from the coenzyme.

    PubMed

    Bortolotti, Ana; Sánchez-Azqueta, Ana; Maya, Celia M; Velázquez-Campoy, Adrián; Hermoso, Juan A; Medina, Milagros; Cortez, Néstor

    2014-01-01

    To study the role of the mobile C-terminal extension present in bacterial class of plant type NADP(H):ferredoxin reductases during catalysis, we generated a series of mutants of the Rhodobacter capsulatus enzyme (RcFPR). Deletion of the six C-terminal amino acids beyond alanine 266 was combined with the replacement A266Y, emulating the structure present in plastidic versions of this flavoenzyme. Analysis of absorbance and fluorescence spectra suggests that deletion does not modify the general geometry of FAD itself, but increases exposure of the flavin to the solvent, prevents a productive geometry of FAD:NADP(H) complex and decreases the protein thermal stability. Although the replacement A266Y partially coats the isoalloxazine from solvent and slightly restores protein stability, this single change does not allow formation of active charge-transfer complexes commonly present in the wild-type FPR, probably due to restraints of C-terminus pliability. A proton exchange process is deduced from ITC measurements during coenzyme binding. All studied RcFPR variants display higher affinity for NADP(+) than wild-type, evidencing the contribution of the C-terminus in tempering a non-productive strong (rigid) interaction with the coenzyme. The decreased catalytic rate parameters confirm that the hydride transfer from NADPH to the flavin ring is considerably hampered in the mutants. Although the involvement of the C-terminal extension from bacterial FPRs in stabilizing overall folding and bent-FAD geometry has been stated, the most relevant contributions to catalysis are modulation of coenzyme entrance and affinity, promotion of the optimal geometry of an active complex and supply of a proton acceptor acting during coenzyme binding.

  13. Truncation of N-terminal regions of Digitalis lanata progesterone 5β-reductase alters catalytic efficiency and substrate preference.

    PubMed

    Rudolph, Kristin; Bauer, Peter; Schmid, Benedikt; Mueller-Uri, Frieder; Kreis, Wolfgang

    2014-06-01

    N-Terminal truncated forms of progesterone 5β-reductase (P5βR) were synthesized taking a full-length cDNA encoding for Digitalis lanata P5βR with a hexa-histidine tag attached at the C-terminus (rDlP5βRc) as the starting point. Four pETite-c-His/DlP5βR constructs coding for P5βR derivatives truncated in the N-terminal region, termed rDlP5βRcn-10, rDlP5βRcn-20, rDlP5βRcn-30, and rDlP5βRcn-40 were obtained by site-directed mutagenesis. The cDNAs coding for full-length rDlP5βRc, rDlP5βRcn-10 and rDlP5βRcn-20 were over-expressed in Escherichia coli and the respective enzymes were soluble and catalytically active (progesterone and 2-cyclohexen-1-one as substrates). GST-tagged recombinant DlP5βR (rDlP5βR-GST) and rDlP5βR-GSTr, with the GST-tag removed by protease treatment were produced as well and served as controls. The Km values and substrate preferences considerably differed between the various DlP5βR derivatives. As for the C-terminal His-tagged rDlP5βR the catalytic efficiency for progesterone was highest for the full-length rDlP5βRc whereas the N-terminal truncated forms preferred 2-cyclohexen-1-one as the substrate. Affinity tags and artifacts resulting from the cloning strategy used may alter substrate specificity. Therefore enzyme properties determined with recombinant proteins should not be used to infer in vivo scenarios and should be considered for each particular case.

  14. C-Terminal Region of Sulfite Reductase Is Important to Localize to Chloroplast Nucleoids in Land Plants

    PubMed Central

    Kobayashi, Yusuke; Otani, Takuto; Ishibashi, Kota; Shikanai, Toshiharu; Nishimura, Yoshiki

    2016-01-01

    Chloroplast (cp) DNA is compacted into cpDNA-protein complexes, called cp nucleoids. An abundant and extensively studied component of cp nucleoids is the bifunctional protein sulfite reductase (SiR). The preconceived role of SiR as the core cp nucleoid protein, however, is becoming less likely because of the recent findings that SiRs do not associate with cp nucleoids in some plant species, such as Zea mays and Arabidopsis thaliana. To address this discrepancy, we have performed a detailed phylogenetic analysis of SiRs, which shows that cp nucleoid-type SiRs share conserved C-terminally encoded peptides (CEPs). The CEPs are likely to form a bacterial ribbon–helix–helix DNA-binding motif, implying a potential role in attaching SiRs onto cp nucleoids. A proof-of-concept experiment was conducted by fusing the nonnucleoid-type SiR from A. thaliana (AtSiR) with the CEP from the cp nucleoid-type SiR of Phaseolus vulgaris. The addition of the CEP drastically altered the intra-cp localization of AtSiR to cp nucleoids. Our analysis supports the possible functions of CEPs in determining the localization of SiRs to cp nucleoids and illuminates a possible evolutionary scenario for SiR as a cp nucleoid protein. PMID:27189994

  15. Expression of chlorite dismutase and chlorate reductase in the presence of oxygen and/or chlorate as the terminal electron acceptor in Ideonella dechloratans.

    PubMed

    Lindqvist, Miriam Hellberg; Johansson, Nicklas; Nilsson, Thomas; Rova, Maria

    2012-06-01

    The ability of microorganisms to perform dissimilatory (per)chlorate reduction is, for most species, known to be oxygen sensitive. Consequently, bioremediation processes for the removal of oxochlorates will be disturbed if oxygen is present. We measured the expression of chlorite dismutase and chlorate reductase in the presence of different terminal electron acceptors in the chlorate reducer Ideonella dechloratans. Enzyme activity assays and mRNA analyses by real-time quantitative reverse transcription (qRT)-PCR were performed on cell extracts from cells grown aerobically with and without chlorate and on cells grown anaerobically in the presence of chlorate. Our results showed that both chlorite dismutase and chlorate reductase are expressed during aerobic growth. However, transfer to anaerobic conditions with chlorate resulted in significantly enhanced enzyme activities and mRNA levels for both enzymes. Absence of oxygen was necessary for the induction to occur, since chlorate addition under aerobic conditions produced neither increased enzyme activities nor higher relative levels of mRNA. For chlorite dismutase, the observed increase in activity was on the same order of magnitude as the increase in the relative mRNA level, indicating gene regulation at the transcriptional level. However, chlorate reductase showed about 200 times higher enzyme activity in anaerobically induced cells, whereas the increase in mRNA was only about 10-fold, suggesting additional mechanisms influence the enzyme activity.

  16. Thioredoxin reductase.

    PubMed Central

    Mustacich, D; Powis, G

    2000-01-01

    The mammalian thioredoxin reductases (TrxRs) are a family of selenium-containing pyridine nucleotide-disulphide oxidoreductases with mechanistic and sequence identity, including a conserved -Cys-Val-Asn-Val-Gly-Cys- redox catalytic site, to glutathione reductases. TrxRs catalyse the NADPH-dependent reduction of the redox protein thioredoxin (Trx), as well as of other endogenous and exogenous compounds. The broad substrate specificity of mammalian TrxRs is due to a second redox-active site, a C-terminal -Cys-SeCys- (where SeCys is selenocysteine), that is not found in glutathione reductase or Escherichia coli TrxR. There are currently two confirmed forms of mammalian TrxRs, TrxR1 and TrxR2, and it is possible that other forms will be identified. The availability of Se is a key factor determining TrxR activity both in cell culture and in vivo, and the mechanism(s) for the incorporation of Se into TrxRs, as well as the regulation of TrxR activity, have only recently begun to be investigated. The importance of Trx to many aspects of cell function make it likely that TrxRs also play a role in protection against oxidant injury, cell growth and transformation, and the recycling of ascorbate from its oxidized form. Since TrxRs are able to reduce a number of substrates other than Trx, it is likely that additional biological effects will be discovered for TrxR. Furthermore, inhibiting TrxR with drugs may lead to new treatments for human diseases such as cancer, AIDS and autoimmune diseases. PMID:10657232

  17. Multilocus Phylogenetic Study of the Scheffersomyces Yeast Clade and Characterization of the N-Terminal Region of Xylose Reductase Gene

    PubMed Central

    Urbina, Hector; Blackwell, Meredith

    2012-01-01

    Many of the known xylose-fermenting (X-F) yeasts are placed in the Scheffersomyces clade, a group of ascomycete yeasts that have been isolated from plant tissues and in association with lignicolous insects. We formally recognize fourteen species in this clade based on a maximum likelihood (ML) phylogenetic analysis using a multilocus dataset. This clade is divided into three subclades, each of which exhibits the biochemical ability to ferment cellobiose or xylose. New combinations are made for seven species of Candida in the clade, and three X-F taxa associated with rotted hardwood are described: Scheffersomyces illinoinensis (type strain NRRL Y-48827T  =  CBS 12624), Scheffersomyces quercinus (type strain NRRL Y-48825T  =  CBS 12625), and Scheffersomyces virginianus (type strain NRRL Y-48822T  =  CBS 12626). The new X-F species are distinctive based on their position in the multilocus phylogenetic analysis and biochemical and morphological characters. The molecular characterization of xylose reductase (XR) indicates that the regions surrounding the conserved domain contain mutations that may enhance the performance of the enzyme in X-F yeasts. The phylogenetic reconstruction using XYL1 or RPB1 was identical to the multilocus analysis, and these loci have potential for rapid identification of cryptic species in this clade. PMID:22720049

  18. Role of Outer Membrane C-Type Cytochromes MtrC and OmcA in Shewanella Oneidensis MR-1 Cell Production, Accumulation, and Detachment During Respiration on Hematite

    SciTech Connect

    Mitchell, Andrew C.; Peterson, L.; Reardon, Catherine L.; Reed, Samantha B.; Culley, David E.; Romine, Margaret F.; Geesey, Gill G.

    2012-07-01

    Solid phase iron oxides are considered to be important terminal electron acceptors for microbial respiration in many anoxic environments. Besides the knowledge that cells attach to and reduce these substrates, other aspects of surface-associated cell behavior and the related cell surface components that influence cell-mineral interactions are not well understood. In the present study, wild-type cells of the dissimilatory iron-reducing bacterium Shewanella oneidensis MR-1 formed thin biofilms one-to-two cell layers in thickness when respiring on natural specular hematite under flow conditions similar to those which exist in aquatic sediments and subsurface environments. The distribution of cells within the biofilm indicated that direct contact was not required for electron transfer from cells to the mineral surface. Detached biomass in the form of single cells represented >99% of the surface-associated wild-type cell production from respiration on hematite over the biofilm life cycle. A mutant deficient in the outer membrane c35 type cytochrome OmcA, while still able to respire and replicate on hematite, established a lower steady-state cell density on the mineral surface than that of the wild-type strain. A mutant deficient in MtrC, another outer membrane c-type cytochrome, and a mutant deficient in both cytochromes were unable to reduce sufficient amounts of hematite to support detectable growth on the mineral surface. When considered in the context of previous work, the results support a growing body of evidence that the relative importance of OmcA and MtrC to cell respiration and replication depends on the form of iron oxide available as terminal electron acceptor.

  19. The amino-terminal conserved domain of 4-hydroxy-3-methylbut-2-enyl diphosphate reductase is critical for its function in oxygen-evolving photosynthetic organisms

    PubMed Central

    Hsieh, Wei-Yu; Hsieh, Ming-Hsiun

    2015-01-01

    4-hydroxy-3-methylbut-2-enyl diphosphate reductase (HDR), also known as isoprenoid synthesis H (IspH) or lysis-tolerant B (LytB), catalyzes the last step of the methylerythritol phosphate pathway to synthesize isopentenyl diphosphate and dimethylallyl diphosphate. The structure and reaction mechanism of IspH have been actively investigated in Escherichia coli but little is known in plants. Compared with the bacterial IspH, cyanobacterial and plant HDRs all contain an extra N-terminal conserved domain (NCD) that is essential for their function. Tyr72 in the NCD and several plant-specific residues around the central active site are critical for Arabidopsis HDR function. These results suggest that the structure and reaction mechanism of HDR/IspH may be different between plants and bacteria. The E. coli IspH is an iron-sulfur protein that is sensitive to oxygen. It is possible that the cyanobacterial HDR may independently evolve from the common ancestor of prokaryotes to obtain the NCD, which may protect the enzyme from high concentration of oxygen during photosynthesis. PMID:25723575

  20. Changes in dihydrofolate reductase (DHFR) mRNA levels can account fully for changes in DHFR synthesis rates during terminal differentiation in a highly amplified myogenic cell line.

    PubMed Central

    Schmidt, E E; Merrill, G F

    1991-01-01

    Dihydrofolate reductase (DHFR) enzyme is preferentially synthesized in proliferative cells. A mouse muscle cell line resistant to 300 microM methotrexate was developed to investigate the molecular levels at which DHFR is down-regulated during myogenic withdrawal from the cell cycle. H- alpha R300T cells contained 540 copies of the endogenous DHFR gene and overexpressed DHFR mRNA and DHFR protein. Despite DHFR gene amplification, the cells remained diploid. As H- alpha R300T myoblasts withdrew from the cell cycle and committed to terminal differentiation, DHFR mRNA levels and DHFR synthesis rates decreased with closely matched kinetics. After 15 to 24 h, committed cells contained 5% the proliferative level of DHFR mRNA (80 molecules per committed cell) and synthesized DHFR protein at 6% the proliferative rate. At no point during the commitment process did the decrease in DHFR synthesis rate exceed the decrease in DHFR message. The decrease in DHFR mRNA levels during commitment was sufficient to account fully for the decrease in rates of DHFR synthesis. Furthermore, DHFR mRNA remained polysomal, and the average number of ribosomes per message remained constant (five to six ribosomes per DHFR mRNA). The constancy of polysome size, along with the uniform rate of DHFR synthesis per message, indicated that DHFR mRNA was efficiently translated in postreplicative cells. The results support a model wherein replication-dependent changes in DHFR synthesis rates are determined exclusively by changes in DHFR mRNA levels. Images PMID:2046674

  1. The N-terminal Domain of Escherichia coli Assimilatory NADPH-Sulfite Reductase Hemoprotein Is an Oligomerization Domain That Mediates Holoenzyme Assembly.

    PubMed

    Askenasy, Isabel; Pennington, Joseph M; Tao, Yeqing; Marshall, Alan G; Young, Nicolas L; Shang, Weifeng; Stroupe, M Elizabeth

    2015-07-31

    Assimilatory NADPH-sulfite reductase (SiR) from Escherichia coli is a structurally complex oxidoreductase that catalyzes the six-electron reduction of sulfite to sulfide. Two subunits, one a flavin-binding flavoprotein (SiRFP, the α subunit) and the other an iron-containing hemoprotein (SiRHP, the β subunit), assemble to make a holoenzyme of about 800 kDa. How the two subunits assemble is not known. The iron-rich cofactors in SiRHP are unique because they are a covalent arrangement of a Fe4S4 cluster attached through a cysteine ligand to an iron-containing porphyrinoid called siroheme. The link between cofactor biogenesis and SiR stability is also ill-defined. By use of hydrogen/deuterium exchange and biochemical analysis, we show that the α8β4 SiR holoenzyme assembles through the N terminus of SiRHP and the NADPH binding domain of SiRFP. By use of small angle x-ray scattering, we explore the structure of the SiRHP N-terminal oligomerization domain. We also report a novel form of the hemoprotein that occurs in the absence of its cofactors. Apo-SiRHP forms a homotetramer, also dependent on its N terminus, that is unable to assemble with SiRFP. From these results, we propose that homotetramerization of apo-SiRHP serves as a quality control mechanism to prevent formation of inactive holoenzyme in the case of limiting cellular siroheme.

  2. The N-terminal Domain of Escherichia coli Assimilatory NADPH-Sulfite Reductase Hemoprotein Is an Oligomerization Domain That Mediates Holoenzyme Assembly*

    PubMed Central

    Askenasy, Isabel; Pennington, Joseph M.; Tao, Yeqing; Marshall, Alan G.; Young, Nicolas L.; Shang, Weifeng; Stroupe, M. Elizabeth

    2015-01-01

    Assimilatory NADPH-sulfite reductase (SiR) from Escherichia coli is a structurally complex oxidoreductase that catalyzes the six-electron reduction of sulfite to sulfide. Two subunits, one a flavin-binding flavoprotein (SiRFP, the α subunit) and the other an iron-containing hemoprotein (SiRHP, the β subunit), assemble to make a holoenzyme of about 800 kDa. How the two subunits assemble is not known. The iron-rich cofactors in SiRHP are unique because they are a covalent arrangement of a Fe4S4 cluster attached through a cysteine ligand to an iron-containing porphyrinoid called siroheme. The link between cofactor biogenesis and SiR stability is also ill-defined. By use of hydrogen/deuterium exchange and biochemical analysis, we show that the α8β4 SiR holoenzyme assembles through the N terminus of SiRHP and the NADPH binding domain of SiRFP. By use of small angle x-ray scattering, we explore the structure of the SiRHP N-terminal oligomerization domain. We also report a novel form of the hemoprotein that occurs in the absence of its cofactors. Apo-SiRHP forms a homotetramer, also dependent on its N terminus, that is unable to assemble with SiRFP. From these results, we propose that homotetramerization of apo-SiRHP serves as a quality control mechanism to prevent formation of inactive holoenzyme in the case of limiting cellular siroheme. PMID:26088143

  3. Role of Outer-Membrane Cytochromes MtrC and OmcA in the Biomineralization of Ferrihydrite by Shewanella oneidensis MR-1.

    SciTech Connect

    Reardon, Catherine L.; Dohnalkova, Alice; Nachimuthu, Ponnusamy; Kennedy, David W.; Saffarini, Daad; Arey, Bruce W.; Shi, Liang; Wang, Zheming; Moore, Dean A.; Mclean, Jeffrey S.; Moyles, Dianne M.; Marshall, Matthew J.; Zachara, John M.; Fredrickson, Jim K.; Beliaev, Alex S.

    2010-01-01

    In an effort to improve the understanding of electron transfer mechanisms at the microbe-mineral interface, Shewanella oneidensis MR-1 mutants with in-frame deletions of outer membrane cytochrome genes mtrC, omcA, or both, were characterized for the ability to reduce metal oxides using a suite of microscopic, spectroscopic, and biochemicalr techniques. The results indicate that neither MtrC nor OmcA are essential for the reduction of soluble, complexed Fe(III)-citrate or Fe(III)-NTA; however, at least one of these outer membrane cytochromes is required for the reduction of Fe(III)- and Mn(III/IV)- oxides. In vitro analysis of purified, recombinant protein demonstrated that both cytochromes transfer electrons directly to metal-oxides; however, MtrC transfers electrons at a faster rate than OmcA. Immunolocalization of MtrC and OmcA reveal that both cytochromes are surface-exposed on the cell outer-membrane and co-localize with insoluble iron precipitates when respiring ferrihydrite or cultured aerobically with Fe(III)-citrate. Additionally, during prolonged incubation, wild-type cells promoted biotransformation of ferrihydrite to vivianite [Fe3(PO4)2•8H2O] while the double cytochrome mutant was unable to form any secondary mineral phases. Collectively, our results support a role for direct electron transfer from OMCs to metal oxides by establishing their in vitro electron transfer activities, confirming the requirement of either MtrC or OmcA for in vivo reductive biomineralization of ferrihydrite, and localizing the cytochromes to the cell exterior where they can directly contact mineral substrates.

  4. Specific Bonds between an Iron Oxide Surface and Outer Membrane Cytochromes MtrC and OmcA from Shewanella oneidensis MR-1

    SciTech Connect

    Lower, Brian H.; Shi, Liang; Yongsunthon, Ruchirej; Droubay, Timothy C.; Mccready, David E.; Lower, Steven

    2007-07-31

    Shewanella oneidensis MR-1 is purported to express outer membrane cytochromes (e.g., MtrC and OmcA) that transfer electrons directly to Fe(III) in a mineral during anaerobic respiration.  A prerequisite for this type of reaction would be the formation of a stable bond between a cytochrome and an iron oxide surface.  Atomic force microscopy (AFM) was used to detect whether a specific bond forms between a hematite (Fe2O3) thin film, created with oxygen plasma assisted molecular beam epitaxy (MBE), and recombinant MtrC or OmcA molecules coupled to gold substrates.  Force spectra displayed a unique force signature indicative of a specific bond between each cytochrome and the hematite surface.  The strength of the OmcA-hematite bond was approximately twice as strong as the MtrC-hematite bond, but direct binding to hematite was twice as favorable for MtrC.  Reversible folding/unfolding reactions were observed for mechanically denatured MtrC molecules bound to hematite.  The force measurements for the hematite-cytochrome pairs were compared to spectra collected between an iron oxide and S. oneidensis under anaerobic conditions.  There is a strong correlation between the whole cell and pure protein force spectra suggesting that the unique binding attributes of each cytochrome complement one another and allow both MtrC and OmcA to play a prominent role in the transfer of electrons to Fe(III) in minerals.  Finally, by comparing the magnitude of binding force for the whole cell vs. pure protein data, we were able to estimate that a single bacterium of S. oneidensis (2 x 0.5 μm) expresses ~104 cytochromes on its outer surface. 

  5. Enhancement of cardenolide and phytosterol levels by expression of an N-terminally truncated 3-hydroxy-3-methylglutaryl CoA reductase in Transgenic digitalis minor.

    PubMed

    Sales, Ester; Muñoz-Bertomeu, Jesús; Arrillaga, Isabel; Segura, Juan

    2007-06-01

    Pathway engineering in medicinal plants attains a special significance in Digitalis species, the main industrial source of cardiac glycosides, steroidal metabolites derived from mevalonic acid via the triterpenoid pathway. In this work, the Arabidopsis thaliana HMG1 cDNA, coding the catalytic domain of 3-hydroxy-3-methylglutaryl CoA reductase (HMGR1S), a key enzyme of the MVA pathway, was expressed in the cardenolide-producing plant Digitalis minor. Transgenic plants were morphologically indistinguishable from control wild plants and displayed the same developmental pattern. Constitutive expression of HMG1 resulted in an increased sterol and cardenolide production in both in vitro- and greenhouse-grown plants. This work demonstrates that transgenic D. minor plants are a valuable system to study and achieve metabolic engineering of the cardenolide pathway and in consequence for the genetic improvement of Digitalis species.

  6. Enhancement of Ganoderic Acid Accumulation by Overexpression of an N-Terminally Truncated 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Gene in the Basidiomycete Ganoderma lucidum

    PubMed Central

    Xu, Jun-Wei; Xu, Yi-Ning

    2012-01-01

    Ganoderic acids produced by Ganoderma lucidum, a well-known traditional Chinese medicinal mushroom, exhibit antitumor and antimetastasis activities. Genetic modification of G. lucidum is difficult but critical for the enhancement of cellular accumulation of ganoderic acids. In this study, a homologous genetic transformation system for G. lucidum was developed for the first time using mutated sdhB, encoding the iron-sulfur protein subunit of succinate dehydrogenase, as a selection marker. The truncated G. lucidum gene encoding the catalytic domain of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) was overexpressed by using the Agrobacterium tumefaciens-mediated transformation system. The results showed that the mutated sdhB successfully conferred carboxin resistance upon transformation. Most of the integrated transfer DNA (T-DNA) appeared as a single copy in the genome. Moreover, deregulated constitutive overexpression of the HMGR gene led to a 2-fold increase in ganoderic acid content. It also increased the accumulation of intermediates (squalene and lanosterol) and the upregulation of downstream genes such as those of farnesyl pyrophosphate synthase, squalene synthase, and lanosterol synthase. This study demonstrates that transgenic basidiomycete G. lucidum is a promising system to achieve metabolic engineering of the ganoderic acid pathway. PMID:22941092

  7. Up-regulation of an N-terminal truncated 3-hydroxy-3-methylglutaryl CoA reductase enhances production of essential oils and sterols in transgenic Lavandula latifolia.

    PubMed

    Muñoz-Bertomeu, Jesús; Sales, Ester; Ros, Roc; Arrillaga, Isabel; Segura, Juan

    2007-11-01

    Spike lavender (Lavandula latifolia) essential oil is widely used in the perfume, cosmetic, flavouring and pharmaceutical industries. Thus, modifications of yield and composition of this essential oil by genetic engineering should have important scientific and commercial applications. We generated transgenic spike lavender plants expressing the Arabidopsis thaliana HMG1 cDNA, encoding the catalytic domain of 3-hydroxy-3-methylglutaryl CoA reductase (HMGR1S), a key enzyme of the mevalonic acid (MVA) pathway. Transgenic T0 plants accumulated significantly more essential oil constituents as compared to controls (up to 2.1- and 1.8-fold in leaves and flowers, respectively). Enhanced expression of HMGR1S also increased the amount of the end-product sterols, beta-sitosterol and stigmasterol (average differences of 1.8- and 1.9-fold, respectively), but did not affect the accumulation of carotenoids or chlorophylls. We also analysed T1 plants derived from self-pollinated seeds of T0 lines that flowered after growing for 2 years in the greenhouse. The increased levels of essential oil and sterols observed in the transgenic T0 plants were maintained in the progeny that inherited the HMG1 transgene. Our results demonstrate that genetic manipulation of the MVA pathway increases essential oil yield in spike lavender, suggesting a contribution for this cytosolic pathway to monoterpene and sesquiterpene biosynthesis in leaves and flowers of the species.

  8. Deletion of mtrC in Haemophilus ducreyi increases sensitivity to human antimicrobial peptides and activates the CpxRA regulon.

    PubMed

    Rinker, Sherri D; Trombley, Michael P; Gu, Xiaoping; Fortney, Kate R; Bauer, Margaret E

    2011-06-01

    Haemophilus ducreyi resists killing by antimicrobial peptides encountered during human infection, including cathelicidin LL-37, α-defensins, and β-defensins. In this study, we examined the role of the proton motive force-dependent multiple transferable resistance (MTR) transporter in antimicrobial peptide resistance in H. ducreyi. We found a proton motive force-dependent effect on H. ducreyi's resistance to LL-37 and β-defensin HBD-3, but not α-defensin HNP-2. Deletion of the membrane fusion protein MtrC rendered H. ducreyi more sensitive to LL-37 and human β-defensins but had relatively little effect on α-defensin resistance. The mtrC mutant 35000HPmtrC exhibited phenotypic changes in outer membrane protein profiles, colony morphology, and serum sensitivity, which were restored to wild type by trans-complementation with mtrC. Similar phenotypes were reported in a cpxA mutant; activation of the two-component CpxRA regulator was confirmed by showing transcriptional effects on CpxRA-regulated genes in 35000HPmtrC. A cpxR mutant had wild-type levels of antimicrobial peptide resistance; a cpxA mutation had little effect on defensin resistance but led to increased sensitivity to LL-37. 35000HPmtrC was more sensitive than the cpxA mutant to LL-37, indicating that MTR contributed to LL-37 resistance independent of the CpxRA regulon. The CpxRA regulon did not affect proton motive force-dependent antimicrobial peptide resistance; however, 35000HPmtrC had lost proton motive force-dependent peptide resistance, suggesting that the MTR transporter promotes proton motive force-dependent resistance to LL-37 and human β-defensins. This is the first report of a β-defensin resistance mechanism in H. ducreyi and shows that LL-37 resistance in H. ducreyi is multifactorial.

  9. X-ray Structure of a Hg2+ Complex of Mercuric Reductase (MerA) and Quantum Mechanical/Molecular Mechanical Study of Hg2+ Transfer between the C-Terminal and Buried Catalytic Site Cysteine Pairs

    PubMed Central

    2015-01-01

    Mercuric reductase, MerA, is a key enzyme in bacterial mercury resistance. This homodimeric enzyme captures and reduces toxic Hg2+ to Hg0, which is relatively unreactive and can exit the cell passively. Prior to reduction, the Hg2+ is transferred from a pair of cysteines (C558′ and C559′ using Tn501 numbering) at the C-terminus of one monomer to another pair of cysteines (C136 and C141) in the catalytic site of the other monomer. Here, we present the X-ray structure of the C-terminal Hg2+ complex of the C136A/C141A double mutant of the Tn501 MerA catalytic core and explore the molecular mechanism of this Hg transfer with quantum mechanical/molecular mechanical (QM/MM) calculations. The transfer is found to be nearly thermoneutral and to pass through a stable tricoordinated intermediate that is marginally less stable than the two end states. For the overall process, Hg2+ is always paired with at least two thiolates and thus is present at both the C-terminal and catalytic binding sites as a neutral complex. Prior to Hg2+ transfer, C141 is negatively charged. As Hg2+ is transferred into the catalytic site, a proton is transferred from C136 to C559′ while C558′ becomes negatively charged, resulting in the net transfer of a negative charge over a distance of ∼7.5 Å. Thus, the transport of this soft divalent cation is made energetically feasible by pairing a competition between multiple Cys thiols and/or thiolates for Hg2+ with a competition between the Hg2+ and protons for the thiolates. PMID:25343681

  10. Role of outer membrane c-type cytochromes MtrC and OmcA in Shewanella oneidensis MR-1 cell production, accumulation and detachment during respiration on hematite

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The iron-reducing bacterium Shewanella oneidensis MR-1 has the capacity to contribute to iron cycling over the long term by respiring on crystalline iron oxides such as hematite when poorly crystalline phases are depleted. The ability of outer membrane cytochromes OmcA and MtrC of MR-1 to bind to an...

  11. Functional and Phylogenetic Divergence of Fungal Adenylate-Forming Reductases

    PubMed Central

    Kalb, Daniel; Lackner, Gerald

    2014-01-01

    A key step in fungal l-lysine biosynthesis is catalyzed by adenylate-forming l-α-aminoadipic acid reductases, organized in domains for adenylation, thiolation, and the reduction step. However, the genomes of numerous ascomycetes and basidiomycetes contain an unexpectedly large number of additional genes encoding similar but functionally distinct enzymes. Here, we describe the functional in vitro characterization of four reductases which were heterologously produced in Escherichia coli. The Ceriporiopsis subvermispora serine reductase Nps1 features a terminal ferredoxin-NADP+ reductase (FNR) domain and thus belongs to a hitherto undescribed class of fungal multidomain enzymes. The second major class is characterized by the canonical terminal short-chain dehydrogenase/reductase domain and represented by Ceriporiopsis subvermispora Nps3 as the first biochemically characterized l-α-aminoadipic acid reductase of basidiomycete origin. Aspergillus flavus l-tyrosine reductases LnaA and LnbA are members of a distinct phylogenetic clade. Phylogenetic analysis supports the view that fungal adenylate-forming reductases are more diverse than previously recognized and belong to four distinct classes. PMID:25085485

  12. Quinone Reductase 2 Is a Catechol Quinone Reductase

    SciTech Connect

    Fu, Yue; Buryanovskyy, Leonid; Zhang, Zhongtao

    2008-09-05

    The functions of quinone reductase 2 have eluded researchers for decades even though a genetic polymorphism is associated with various neurological disorders. Employing enzymatic studies using adrenochrome as a substrate, we show that quinone reductase 2 is specific for the reduction of adrenochrome, whereas quinone reductase 1 shows no activity. We also solved the crystal structure of quinone reductase 2 in complexes with dopamine and adrenochrome, two compounds that are structurally related to catecholamine quinones. Detailed structural analyses delineate the mechanism of quinone reductase 2 specificity toward catechol quinones in comparison with quinone reductase 1; a side-chain rotational difference between quinone reductase 1 and quinone reductase 2 of a single residue, phenylalanine 106, determines the specificity of enzymatic activities. These results infer functional differences between two homologous enzymes and indicate that quinone reductase 2 could play important roles in the regulation of catecholamine oxidation processes that may be involved in the etiology of Parkinson disease.

  13. Comparative anatomy of the aldo-keto reductase superfamily.

    PubMed

    Jez, J M; Bennett, M J; Schlegel, B P; Lewis, M; Penning, T M

    1997-09-15

    The aldo-keto reductases metabolize a wide range of substrates and are potential drug targets. This protein superfamily includes aldose reductases, aldehyde reductases, hydroxysteroid dehydrogenases and dihydrodiol dehydrogenases. By combining multiple sequence alignments with known three-dimensional structures and the results of site-directed mutagenesis studies, we have developed a structure/function analysis of this superfamily. Our studies suggest that the (alpha/beta)8-barrel fold provides a common scaffold for an NAD(P)(H)-dependent catalytic activity, with substrate specificity determined by variation of loops on the C-terminal side of the barrel. All the aldo-keto reductases are dependent on nicotinamide cofactors for catalysis and retain a similar cofactor binding site, even among proteins with less than 30% amino acid sequence identity. Likewise, the aldo-keto reductase active site is highly conserved. However, our alignments indicate that variation ofa single residue in the active site may alter the reaction mechanism from carbonyl oxidoreduction to carbon-carbon double-bond reduction, as in the 3-oxo-5beta-steroid 4-dehydrogenases (Delta4-3-ketosteroid 5beta-reductases) of the superfamily. Comparison of the proposed substrate binding pocket suggests residues 54 and 118, near the active site, as possible discriminators between sugar and steroid substrates. In addition, sequence alignment and subsequent homology modelling of mouse liver 17beta-hydroxysteroid dehydrogenase and rat ovary 20alpha-hydroxysteroid dehydrogenase indicate that three loops on the C-terminal side of the barrel play potential roles in determining the positional and stereo-specificity of the hydroxysteroid dehydrogenases. Finally, we propose that the aldo-keto reductase superfamily may represent an example of divergent evolution from an ancestral multifunctional oxidoreductase and an example of convergent evolution to the same active-site constellation as the short

  14. Isolation of ascorbate free radical reductase from rabbit lens soluble fraction.

    PubMed

    Bando, Masayasu; Inoue, Takashi; Oka, Mikako; Nakamura, Kayako; Kawai, Kenji; Obazawa, Hajime; Kobayashi, Shizuko; Takehana, Makoto

    2004-12-01

    Ascorbate free radical (AFR) reductase with diaphorase activity was isolated from the rabbit lens soluble fraction to characterise some molecular properties of the enzyme. The isolation was accomplished using gel filtration (Sephadex G-75 superfine or Sephacryl S-200 HR), affinity chromatography (Affi-Gel Blue), native isoelectric focusing and two-dimensional gel electrophoresis. A major soluble AFR reductase was found at an isoelectric point of 8.4 and a molecular weight of 31 kDa, and a few minor enzymes were also detected in the range of pI 7.0-8.6. An unknown N-terminal partial amino acid sequence was determined in one peptide fragment prepared from the major enzyme fraction. From the sequence analysis, it is discussed that the lens soluble AFR reductase may differ from NADH-cytochrome b5 reductase reported to be involved in the membrane-bound AFR reductase activity of mitochondria, microsomes and plasma membrane.

  15. Nitrate and periplasmic nitrate reductases

    PubMed Central

    Sparacino-Watkins, Courtney; Stolz, John F.; Basu, Partha

    2014-01-01

    The nitrate anion is a simple, abundant and relatively stable species, yet plays a significant role in global cycling of nitrogen, global climate change, and human health. Although it has been known for quite some time that nitrate is an important species environmentally, recent studies have identified potential medical applications. In this respect the nitrate anion remains an enigmatic species that promises to offer exciting science in years to come. Many bacteria readily reduce nitrate to nitrite via nitrate reductases. Classified into three distinct types – periplasmic nitrate reductase (Nap), respiratory nitrate reductase (Nar) and assimilatory nitrate reductase (Nas), they are defined by their cellular location, operon organization and active site structure. Of these, Nap proteins are the focus of this review. Despite similarities in the catalytic and spectroscopic properties Nap from different Proteobacteria are phylogenetically distinct. This review has two major sections: in the first section, nitrate in the nitrogen cycle and human health, taxonomy of nitrate reductases, assimilatory and dissimilatory nitrate reduction, cellular locations of nitrate reductases, structural and redox chemistry are discussed. The second section focuses on the features of periplasmic nitrate reductase where the catalytic subunit of the Nap and its kinetic properties, auxiliary Nap proteins, operon structure and phylogenetic relationships are discussed. PMID:24141308

  16. Reduction of mitochondrial protein mitoNEET [2Fe-2S] clusters by human glutathione reductase

    PubMed Central

    Landry, Aaron P.; Cheng, Zishuo; Ding, Huangen

    2015-01-01

    Human mitochondrial outer membrane protein mitoNEET is a newly discovered target of type II diabetes drug pioglitazone. Structurally, mitoNEET is a homodimer with each monomer containing an N-terminal transmembrane alpha helix tethered to mitochondrial outer membrane and a C-terminal cytosolic domain hosting a redox active [2Fe-2S] cluster. Genetic studies have shown that mitoNEET has a central role in regulating energy metabolism in mitochondria. However, specific function of mitoNEET remains largely elusive. Here we find that the mitoNEET [2Fe-2S] clusters can be efficiently reduced by Escherichia coli thioredoxin reductase and glutathione reductase in an NADPH-dependent reaction. Purified human glutathione reductase has the same activity as E. coli thioredoxin reductase and glutathione reductase to reduce the mitoNEET [2Fe-2S] clusters. However, rat thioredoxin reductase, a human thioredoxin reductase homolog that contains selenocysteine in the catalytic center, has very little or no activity to reduce the mitoNEET [2Fe-2S] clusters. N-ethylmaleimide, a potent thiol modifier, completely inhibits human glutathione reductase to reduce the mitoNEET [2Fe-2S] clusters, indicating that the redox active disulfide in the catalytic center of human glutathione reductase may be directly involved in reducing the mitoNEET [2Fe-2S] clusters. Additional studies reveal that the reduced mitoNEET [2Fe-2S] clusters in mouse heart cell extracts can be reversibly oxidized by hydrogen peroxide without disruption of the clusters, suggesting that the mitoNEET [2Fe-2S] clusters may undergo redox transition to regulate energy metabolism in mitochondria in response to oxidative signals. PMID:25645953

  17. Zeatin reductase in Phaseolus embryos

    SciTech Connect

    Martin, R.C.; Mok, David, W.S.; Mok, M.C. )

    1989-04-01

    Zeatin was converted to O-xylosylzeatin in embryos of Phaseolus vulgaris . O-xylosyldihydrozeatin was also identified as a zeatin metabolite. Incubation of embryo extracts with {sup 14}C-zeatin and {sup 14}C-O-xylosylzeatin revealed that reduction preceeds the O-xylosylation of zeatin. An enzyme responsible for reducing the N{sup 6}-side chain was isolated and partially purified using ammonium sulfate fractionation and affinity, gel filtration and anion exchange chromatography. The NADPH dependent reductase was zeatin specific and did not recognize cis-zeatin, ribosylzeatin, i{sup 6}Ade or i{sup 6}Ado. Two forms of the reductase could be separated by either gel filtration or anion exchange HPLC. The HMW isozyme (Mr. 55,000) eluted from the anion exchange column later than the LMW isozyme (Mr. 25,000). Interspecific differences in zeatin reductase activity were also detected.

  18. Isolated menthone reductase and nucleic acid molecules encoding same

    DOEpatents

    Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L

    2013-04-23

    The present invention provides isolated menthone reductase proteins, isolated nucleic acid molecules encoding menthone reductase proteins, methods for expressing and isolating menthone reductase proteins, and transgenic plants expressing elevated levels of menthone reductase protein.

  19. Active sites of thioredoxin reductases: why selenoproteins?

    PubMed

    Gromer, Stephan; Johansson, Linda; Bauer, Holger; Arscott, L David; Rauch, Susanne; Ballou, David P; Williams, Charles H; Schirmer, R Heiner; Arnér, Elias S J

    2003-10-28

    Selenium, an essential trace element for mammals, is incorporated into a selected class of selenoproteins as selenocysteine. All known isoenzymes of mammalian thioredoxin (Trx) reductases (TrxRs) employ selenium in the C-terminal redox center -Gly-Cys-Sec-Gly-COOH for reduction of Trx and other substrates, whereas the corresponding sequence in Drosophila melanogaster TrxR is -Ser-Cys-Cys-Ser-COOH. Surprisingly, the catalytic competence of these orthologous enzymes is similar, whereas direct Sec-to-Cys substitution of mammalian TrxR, or other selenoenzymes, yields almost inactive enzyme. TrxRs are therefore ideal for studying the biology of selenocysteine by comparative enzymology. Here we show that the serine residues flanking the C-terminal Cys residues of Drosophila TrxRs are responsible for activating the cysteines to match the catalytic efficiency of a selenocysteine-cysteine pair as in mammalian TrxR, obviating the need for selenium. This finding suggests that the occurrence of selenoenzymes, which implies that the organism is selenium-dependent, is not necessarily associated with improved enzyme efficiency. Our data suggest that the selective advantage of selenoenzymes is a broader range of substrates and a broader range of microenvironmental conditions in which enzyme activity is possible.

  20. A cytochrome cd1-type nitrite reductase mediates the first step of denitrification in Alcaligenes eutrophus.

    PubMed

    Sann, R; Kostka, S; Friedrich, B

    1994-01-01

    Respiratory nitrite reductase (NIR) has been purified from the soluble extract of denitrifying cells of Alcaligenes eutrophus strain H16 to apparent electrophoretic homogeneity. The enzyme was induced under anoxic conditions in the presence of nitrite. Purified NIR showed typical features of a cytochrome cd1-type nitrite reductase. It appeared to be a dimer of kDa subunits, its activity was only weakly inhibited by the copper chelator diethyldithiocarbamate, and spectral analysis revealed absorption maxima which were characteristic for the presence of heme c and heme d1. The isoelectric point of 8.6 was considerably higher than the pI determined for cd1 nitrite reductases from pseudomonads. Eighteen amino acids at the N-terminus of the A. eutrophus NIR, obtained by protein sequencing, showed no significant homology to the N-terminal region of nitrite reductases from Pseudomonas stutzeri and Pseudomonas aeruginosa.

  1. Termination Documentation

    ERIC Educational Resources Information Center

    Duncan, Mike; Hill, Jillian

    2014-01-01

    In this study, we examined 11 workplaces to determine how they handle termination documentation, an empirically unexplored area in technical communication and rhetoric. We found that the use of termination documentation is context dependent while following a basic pattern of infraction, investigation, intervention, and termination. Furthermore,…

  2. Assignment of the human dihydrofolate reductase gene to the q11. -->. q22 region of chromosome 5

    SciTech Connect

    Funanage, V.L.; Myoda, T.T.; Moses, P.A.; Cowell, H.R.

    1984-10-01

    Cells from a dihydrofolate reductase-deficit Chinese hamster ovary cell line were hybridized to human fetal skin fibroblast cells. Nineteen dihydrofolate reductase-positive hybrid clones were isolated and characterized. Cytogenetic and biochemical analyses of these clones have shown that the human dihydrofolate reductase (DHFR) gene is located on chromosome 5. Three of these hybrid cell lines contained different terminal deletions of chromosome 5. An analysis of the breakpoints of these deletions has demonstrated that the DHFR gene resides in the q11..-->..q22 region.

  3. Nitrate reductase from Rhodopseudomonas sphaeroides.

    PubMed Central

    Kerber, N L; Cardenas, J

    1982-01-01

    The facultative phototroph Rhodopseudomonas sphaeroides DSM158 was incapable of either assimilating or dissimilating nitrate, although the organism could reduce it enzymatically to nitrite either anaerobically in the light or aerobically in the dark. Reduction of nitrate was mediated by a nitrate reductase bound to chromatophores that could be easily solubilized and functioned with chemically reduced viologens or photochemically reduced flavins as electron donors. The enzyme was solubilized, and some of its kinetic and molecular parameters were determined. It seemed to be nonadaptive, ammonia did not repress its synthesis, and its activity underwent a rapid decline when the cells entered the stationary growth phase. Studies with inhibitors and with metal antagonists indicated that molybdenum and possibly iron participate in the enzymatic reduction of nitrate. The conjectural significance of this nitrate reductase in phototrophic bacteria is discussed. PMID:6978883

  4. The haem-copper oxygen reductase of Desulfovibrio vulgaris contains a dihaem cytochrome c in subunit II.

    PubMed

    Lobo, Susana A L; Almeida, Claúdia C; Carita, João N; Teixeira, Miguel; Saraiva, Lígia M

    2008-12-01

    The genome of the sulphate reducing bacterium Desulfovibrio vulgaris Hildenborough, still considered a strict anaerobe, encodes two oxygen reductases of the bd and haem-copper types. The haem-copper oxygen reductase deduced amino acid sequence reveals that it is a Type A2 enzyme, which in its subunit II contains two c-type haem binding motifs. We have characterized the cytochrome c domain of subunit II and confirmed the binding of two haem groups, both with Met-His iron coordination. Hence, this enzyme constitutes the first example of a ccaa3 haem-copper oxygen reductase. The expression of D. vulgaris haem-copper oxygen reductase was found to be independent of the electron donor and acceptor source and is not altered by stress factors such as oxygen exposure, nitrite, nitrate, and iron; therefore the haem-copper oxygen reductase seems to be constitutive. The KCN sensitive oxygen reduction by D. vulgaris membranes demonstrated in this work indicates the presence of an active haem-copper oxygen reductase. D. vulgaris membranes perform oxygen reduction when accepting electrons from the monohaem cytochrome c553, thus revealing the first possible electron donor to the terminal oxygen reductase of D. vulgaris. The physiological implication of the presence of the oxygen reductase in this organism is discussed.

  5. Selenite reduction by Shewanella oneidensis MR-1 is mediated by fumarate reductase in periplasm

    PubMed Central

    Li, Dao-Bo; Cheng, Yuan-Yuan; Wu, Chao; Li, Wen-Wei; Li, Na; Yang, Zong-Chuang; Tong, Zhong-Hua; Yu, Han-Qing

    2014-01-01

    In situ reduction of selenite to elemental selenium (Se(0)), by microorganisms in sediments and soils is an important process and greatly affects the environmental distribution and the biological effects of selenium. However, the mechanism behind such a biological process remains unrevealed yet. Here we use Shewanella oneidensis MR-1, a widely-distributed dissimilatory metal-reducing bacterium with a powerful and diverse respiration capability, to evaluate the involvement of anaerobic respiration system in the microbial selenite reduction. With mutants analysis, we identify fumarate reductase FccA as the terminal reductase of selenite in periplasm. Moreover, we find that such a reduction is dependent on central respiration c-type cytochrome CymA. In contrast, nitrate reductase, nitrite reductase, and the Mtr electron transfer pathway do not work as selenite reductases. These findings reveal a previously unrecognized role of anaerobic respiration reductases of S. oneidensis MR-1 in selenite reduction and geochemical cycles of selenium in sediments and soils. PMID:24435070

  6. Cloning and Sequence Analysis of Two Pseudomonas Flavoprotein Xenobiotic Reductases

    PubMed Central

    Blehert, David S.; Fox, Brian G.; Chambliss, Glenn H.

    1999-01-01

    The genes encoding flavin mononucleotide-containing oxidoreductases, designated xenobiotic reductases, from Pseudomonas putida II-B and P. fluorescens I-C that removed nitrite from nitroglycerin (NG) by cleavage of the nitroester bond were cloned, sequenced, and characterized. The P. putida gene, xenA, encodes a 39,702-Da monomeric, NAD(P)H-dependent flavoprotein that removes either the terminal or central nitro groups from NG and that reduces 2-cyclohexen-1-one but did not readily reduce 2,4,6-trinitrotoluene (TNT). The P. fluorescens gene, xenB, encodes a 37,441-Da monomeric, NAD(P)H-dependent flavoprotein that exhibits fivefold regioselectivity for removal of the central nitro group from NG and that transforms TNT but did not readily react with 2-cyclohexen-1-one. Heterologous expression of xenA and xenB was demonstrated in Escherichia coli DH5α. The transcription initiation sites of both xenA and xenB were identified by primer extension analysis. BLAST analyses conducted with the P. putida xenA and the P. fluorescens xenB sequences demonstrated that these genes are similar to several other bacterial genes that encode broad-specificity flavoprotein reductases. The prokaryotic flavoprotein reductases described herein likely shared a common ancestor with old yellow enzyme of yeast, a broad-specificity enzyme which may serve a detoxification role in antioxidant defense systems. PMID:10515912

  7. Fatty acyl-CoA reductase

    SciTech Connect

    Reiser, Steven E.; Somerville, Chris R.

    1998-12-01

    The present invention relates to bacterial enzymes, in particular to an acyl-CoA reductase and a gene encoding an acyl-CoA reductase, the amino acid and nucleic acid sequences corresponding to the reductase polypeptide and gene, respectively, and to methods of obtaining such enzymes, amino acid sequences and nucleic acid sequences. The invention also relates to the use of such sequences to provide transgenic host cells capable of producing fatty alcohols and fatty aldehydes.

  8. Identification of structural domains within the large subunit of herpes simplex virus ribonucleotide reductase.

    PubMed

    Conner, J; Cross, A; Murray, J; Marsden, H

    1994-12-01

    The large subunit (R1) of herpes simplex virus (HSV) ribonucleotide reductase is a bifunctional protein consisting of a unique N-terminal protein kinase domain and a ribonucleotide reductase domain. Previous studies showed that the two functional domains are linked by a protease sensitive site. Here we provide evidence for two subdomains, of 30K and 53K, within the reductase domain. The two fragments, which were produced by limited proteolysis and were resistant to further degradation, remained tightly associated in a complex containing two molecules of each. They were capable of binding the R2 subunit of HSV ribonucleotide reductase with approximately the same affinity as the intact protein but the complex did not complement the small subunit (R2) to give an active enzyme. At low concentrations (0.4 micrograms/ml) of trypsin or V8 protease, cleavage between the subdomains was prevented by the presence of the N-terminal protein kinase domain. At higher protease concentrations (1 micrograms/ml) the N-terminal domain is extensively proteolysed and the 30K and 53K domains were generated. Identical results were obtained using purified R1 isolated from infected cell extracts or following expression in Escherichia coli. The origin of the two domains was investigated by N-terminal sequencing of the 53K fragment and by examining their reactivity with a panel of R1-specific monoclonal antibodies which we isolated and epitope mapped for that purpose. The trypsin cleavage site was found to lie between arginine 575 and asparagine 576, and proteolysis in this region was not prevented by the presence of R2 or the nonapeptide YAGAVVNDL. We propose that the ribonucleotide reductase region of HSV R1 exists in a two domain structure, and that the interdomain linking region is protected by the unique N terminus.

  9. Nitrate Reductase Regulates Expression of Nitrite Uptake and Nitrite Reductase Activities in Chlamydomonas reinhardtii 1

    PubMed Central

    Galván, Aurora; Cárdenas, Jacobo; Fernández, Emilio

    1992-01-01

    In Chlamydomonas reinhardtii mutants defective at the structural locus for nitrate reductase (nit-1) or at loci for biosynthesis of the molybdopterin cofactor (nit-3, nit-4, or nit-5 and nit-6), both nitrite uptake and nitrite reductase activities were repressed in ammonium-grown cells and expressed at high amounts in nitrogen-free media or in media containing nitrate or nitrite. In contrast, wild-type cells required nitrate induction for expression of high levels of both activities. In mutants defective at the regulatory locus for nitrate reductase (nit-2), very low levels of nitrite uptake and nitrite reductase activities were expressed even in the presence of nitrate or nitrite. Both restoration of nitrate reductase activity in mutants defective at nit-1, nit-3, and nit-4 by isolating diploid strains among them and transformation of a structural mutant upon integration of the wild-type nit-1 gene gave rise to the wild-type expression pattern for nitrite uptake and nitrite reductase activities. Conversely, inactivation of nitrate reductase by tungstate treatment in nitrate, nitrite, or nitrogen-free media made wild-type cells respond like nitrate reductase-deficient mutants with respect to the expression of nitrite uptake and nitrite reductase activities. Our results indicate that nit-2 is a regulatory locus for both the nitrite uptake system and nitrite reductase, and that the nitrate reductase enzyme plays an important role in the regulation of the expression of both enzyme activities. PMID:16668656

  10. Crystal Structure of Saccharomyces Cerevisiae 3'-Phosphoadenosine-5'-Phosphosulfate Reductase Complexed With Adenosine 3',5'-Bisphosphate

    SciTech Connect

    Yu, Z.; Lemongello, D.; Segel, I.H.; Fisher, A.J.

    2009-05-28

    Most assimilatory bacteria, fungi, and plants species reduce sulfate (in the activated form of APS or PAPS) to produce reduced sulfur. In yeast, PAPS reductase reduces PAPS to sulfite and PAP. Despite the difference in substrate specificity and catalytic cofactor, PAPS reductase is homologous to APS reductase in both sequence and structure, and they are suggested to share the same catalytic mechanism. Metazoans do not possess the sulfate reduction pathway, which makes APS/PAPS reductases potential drug targets for human pathogens. Here, we present the 2.05 A resolution crystal structure of the yeast PAPS reductase binary complex with product PAP bound. The N-terminal region mediates dimeric interactions resulting in a unique homodimer assembly not seen in previous APS/PAPS reductase structures. The 'pyrophosphate-binding' sequence (47)TTAFGLTG(54) defines the substrate 3'-phosphate binding pocket. In yeast, Gly54 replaces a conserved aspartate found in APS reductases vacating space and charge to accommodate the 3'-phosphate of PAPS, thus regulating substrate specificity. Also, for the first time, the complete C-terminal catalytic motif (244)ECGIH(248) is revealed in the active site. The catalytic residue Cys245 is ideally positioned for an in-line attack on the beta-sulfate of PAPS. In addition, the side chain of His248 is only 4.2 A from the Sgamma of Cys245 and may serve as a catalytic base to deprotonate the active site cysteine. A hydrophobic sequence (252)RFAQFL(257) at the end of the C-terminus may provide anchoring interactions preventing the tail from swinging away from the active site as seen in other APS/PAPS reductases.

  11. Bank Terminals

    NASA Technical Reports Server (NTRS)

    1978-01-01

    In the photo, employees of the UAB Bank, Knoxville, Tennessee, are using Teller Transaction Terminals manufactured by SCI Systems, Inc., Huntsville, Alabama, an electronics firm which has worked on a number of space projects under contract with NASA. The terminals are part of an advanced, computerized financial transaction system that offers high efficiency in bank operations. The key to the system's efficiency is a "multiplexing" technique developed for NASA's Space Shuttle. Multiplexing is simultaneous transmission of large amounts of data over a single transmission link at very high rates of speed. In the banking application, a small multiplex "data bus" interconnects all the terminals and a central computer which stores information on clients' accounts. The data bus replaces the maze-of wiring that would be needed to connect each terminal separately and it affords greater speed in recording transactions. The SCI system offers banks real-time data management through constant updating of the central computer. For example, a check is immediately cancelled at the teller's terminal and the computer is simultaneously advised of the transaction; under other methods, the check would be cancelled and the transaction recorded at the close of business. Teller checkout at the end of the day, conventionally a time-consuming matter of processing paper, can be accomplished in minutes by calling up a summary of the day's transactions. SCI manufactures other types of terminals for use in the system, such as an administrative terminal that provides an immediate printout of a client's account, and another for printing and recording savings account deposits and withdrawals. SCI systems have been installed in several banks in Tennessee, Arizona, and Oregon and additional installations are scheduled this year.

  12. Neuroprotective role for carbonyl reductase?

    PubMed

    Maser, Edmund

    2006-02-24

    Oxidative stress is increasingly implicated in neurodegenerative disorders including Alzheimer's, Parkinson's, Huntington's, and Creutzfeld-Jakob diseases or amyotrophic lateral sclerosis. Reactive oxygen species seem to play a significant role in neuronal cell death in that they generate reactive aldehydes from membrane lipid peroxidation. Several neuronal diseases are associated with increased accumulation of abnormal protein adducts of reactive aldehydes, which mediate oxidative stress-linked pathological events, including cellular growth inhibition and apoptosis induction. Combining findings on neurodegeneration and oxidative stress in Drosophila with studies on the metabolic characteristics of the human enzyme carbonyl reductase (CR), it is clear now that CR has a potential physiological role for neuroprotection in humans. Several lines of evidence suggest that CR represents a significant pathway for the detoxification of reactive aldehydes derived from lipid peroxidation and that CR in humans is essential for neuronal cell survival and to confer protection against oxidative stress-induced brain degeneration.

  13. Characteristic analysis of the luxG gene encoding the probable flavin reductase that resides in the lux operon of Photobacterium leiognathi.

    PubMed

    Lin, J W; Chao, Y F; Weng, S F

    1998-05-19

    Nucleotide sequence of the luxG gene (GenBank Accession No. AF053227) from Photobacterium leiognathi PL741 has been determined, and the encoded probable flavin reductase is deduced. The probable flavin reductase encoded by the luxG gene has a calculated M(r) 26,544 and comprises 235 amino acid residues. The probable flavin reductase like the NAD(P)H-flavin reductase might catalyze the reduction of flavins. Alignment and comparison of the probable flavin reductases from P. leiognathi PL741, ATCC 25521, P. phosphoreum, Vibrio fischeri, and V. harveyi show that they are homologous; there is 66% homologous (29.4% identity and 36.6% similarity). Also, the probable flavin reductase is homologous to the NAD(P)H-flavin reductase; it is perceived that the probable flavin reductase and the NAD(P)H-flavin reductase could be enzyme isoforms encoded by two genes of a multigene family for differential response functions. Functional analysis illustrates that the specific segment sequence lay inside and behind the luxG gene might form the potential hairpin loops omega gI, omega gII, omega o, and omega oT as mRNA stability loop or/and as the attenuator-like loop or the dynamic terminator-like block for sub-regulation in the lux operon. The gene order of the luxG gene in the lux operon and the lum operon is <--ter-lumQ-lumP-R&R-luxC-luxD-luxA-luxB-+ ++luxN-luxE-luxG--> (R&R: regulatory region; ter: transcriptional terminator), whereas the R&R is the regulatory region for the lum operon and the lux operon, and ter is the transcriptional terminator for the lum operon.

  14. Covalent Adducts Between Thioredoxin Reductase and Endogenous Electrophiles in Human Breast Cancer

    DTIC Science & Technology

    2005-09-01

    S, Lee S-R, Rhee SG. Identification of proteins containing cysteine residues that are sensitive to hydrogen peroxide at neutral pH. Anal. Biochem...of chemoprevention trials utilizing agents such as NSAIDs, selenium supplements, inducers of Phase 2 detoxification enzymes such as curcumin , and...metabolite, LTA4, the lipid peroxidation combination of a C-terminal thioredoxin product, 4-HNE, and a quinone metabolite of reductase mutant and small

  15. Production of a recombinant hybrid hemoflavoprotein: engineering a functional NADH:cytochrome c reductase.

    PubMed

    Barber, M J; Quinn, G B

    2001-11-01

    A gene has been constructed coding for a unique fusion protein, NADH:cytochrome c reductase, that comprises the soluble heme-containing domain of rat hepatic cytochrome b(5) as the amino-terminal portion of the protein and the soluble flavin-containing domain of rat hepatic cytochrome b(5) reductase as the carboxyl terminus. The gene has been expressed in Escherichia coli resulting in the highly efficient production of a functional hybrid hemoflavoprotein which has been purified to homogeneity by a combination of ammonium sulfate precipitation, affinity chromatography on 5'-ADP agarose, and size-exclusion chromatography. The purified protein exhibited a molecular mass of approximately 46 kDa by polyacrylamide gel electrophoresis and 40,875 Da, for the apoprotein, using mass spectrometry which also confirmed the presence of both heme and FAD prosthetic groups. The fusion protein showed immunological cross-reactivity with both anti-rat cytochrome b(5) and anti-rat cytochrome b(5) reductase antibodies indicating the conservation of antigenic determinants from both native domains. Spectroscopic analysis indicated the fusion protein contained both a b-type cytochrome and flavin chromophors with properties identical to those of the native proteins. Amino-terminal and internal amino acid sequencing confirmed the identity of peptides derived from both the heme- and flavin-binding domains with sequences identical to the deduced amino acid sequence. The isolated fusion protein retained NADH:ferricyanide reductase activity (k(cat) = 8.00 x 10(2) s(-1), K(NADH)(m) = 4 microM, K(FeCN(6))(m) = 11 microM) comparable to that of that of native NADH:cytochrome b(5) reductase and also exhibited both NADH:cytochrome c reductase activity (k(cat) = 2.17 x 10(2) s(-1), K(NADH)(m) = 2 microM, K(FeCN(6))(m) = 11 microM, K(Cyt.c)(m) = 1 microM) and NADH:methemoglobin reductase activity (k(cat) = 4.40 x 10(-1) s(-1), K(NADH)(m) = 3 microM, K(mHb)(m) = 47 microM), the latter two activities

  16. Genetics Home Reference: 5-alpha reductase deficiency

    MedlinePlus

    ... About half of these individuals adopt a male gender role in adolescence or early adulthood. Related Information ... 1730-5. Citation on PubMed Cohen-Kettenis PT. Gender change in 46,XY persons with 5alpha-reductase- ...

  17. A dissimilatory nitrite reductase in Paracoccus halodenitrificans

    NASA Technical Reports Server (NTRS)

    Grant, M. A.; Hochstein, L. I.

    1984-01-01

    Paracoccus halodenitrificans produced a membrane-associated nitrite reductase. Spectrophotometric analysis showed it to be associated with a cd-cytochrome and located on the inner side of the cytoplasmic membrane. When supplied with nitrite, membrane preparations produced nitrous oxide and nitric oxide in different ratios depending on the electron donor employed. The nitrite reductase was maximally active at relatively low concentrations of sodium chloride and remained attached to the membranes at 100 mM sodium chloride.

  18. Heterogeneity of rat type I 5 alpha-reductase cDNA: cloning, expression and regulation by pituitary implants and dihydrotestosterone.

    PubMed

    Lopez-Solache, I; Luu-The, V; Séralini, G E; Labrie, F

    1996-03-01

    Primer extension analysis reveals the presence of different forms of mRNA species for rat type I 5 alpha-reductase. Using a 5 alpha-reductase cDNA probe to screen the rat liver lambda gt11 cDNA library, we isolated cDNA clones that have 4 additional amino acids in the NH2-terminal region as compared with the previously reported sequence for rat type I 5 alpha-reductase. These four additional amino acids elongate the rat type I 5 alpha-reductase amino acid sequence to 259 amino acids, the same number as in human type I 5 alpha-reductase, with which it shares 60% identity. Expression of the long and short rat type I 5 alpha-reductase by transfection in human adrenal adenocarcinoma cells, SW-13 cells, indicated that the long cDNA encoded a protein with a higher affinity for the substrate than the short cDNA. To determine the effect of pituitary hormones and dihydrotestosterone (DHT), the mRNA levels in the livers of rats treated with pituitary implants, hypophysectomized, castrated, and castrated coupled with DHT treatment were quantified by dot-blot hybridization assay using rat type I 5 alpha-reductase cDNA as probes. The results demonstrated that rat type I 5 alpha-reductase mRNA is stimulated by pituitary hormones and castration but is decreased by DHT and hypophysectomy.

  19. Characterization of thyroidal glutathione reductase

    SciTech Connect

    Raasch, R.J.

    1989-01-01

    Glutathione levels were determined in bovine and rat thyroid tissue by enzymatic conjugation with 1-chloro-2,4-dinitrobenzene using glutathione S-transferase. Bovine thyroid tissue contained 1.31 {+-} 0.04 mM reduced glutathione (GSH) and 0.14 {+-} 0.02 mM oxidized glutathione (GSSG). In the rat, the concentration of GSH was 2.50 {+-} 0.05 mM while GSSG was 0.21 {+-} 0.03 mM. Glutathione reductase (GR) was purified from bovine thyroid to electrophoretic homogeneity by ion exchange, affinity and molecular exclusion chromatography. A molecular weight range of 102-109 kDa and subunit size of 55 kDa were determined for GR. Thyroidal GR was shown to be a favoprotein with one FAD per subunit. The Michaelis constants of bovine thyroidal GR were determined to be 21.8 {mu}M for NADPH and 58.8 {mu}M for GSSG. The effect of thyroid stimulating hormone (TSH) and thyroxine (T{sub 4}) on in vivo levels of GR and glucose 6-phosphate dehydrogenase were determined in rat thyroid homogenates. Both enzymes were stimulated by TSH treatment and markedly reduced following T{sub 4} treatment. Lysosomal hydrolysis of ({sup 125}I)-labeled and unlabeled thyroglobulin was examined using size exclusion HPLC.

  20. Purification and characterization of 5-ketofructose reductase from Erwinia citreus.

    PubMed Central

    Schrimsher, J L; Wingfield, P T; Bernard, A; Mattaliano, R; Payton, M A

    1988-01-01

    5-Ketofructose reductase [D(-)fructose:(NADP+) 5-oxidoreductase] was purified to homogeneity from Erwinia citreus and demonstrated to catalyse the reversible NADPH-dependent reduction of 5-ketofructose (D-threo-2,5-hexodiulose) to D-fructose. The enzyme appeared as a single species upon analyses by SDS/polyacrylamide-gel electrophoresis and isoelectric focusing with an apparent relative molecular mass of 40,000 and an isoelectric point of 4.4. The amino acid composition of the enzyme and the N-terminal sequence of the first 39 residues are described. The steady-state kinetic mechanism was an ordered one with NADPH binding first to the enzyme and then to 5-ketofructose, and the order of product release was D-fructose followed by NADP+. The reversible nature of the reaction offers the possibility of using this enzyme for the determination of D-fructose. Images Fig. 1. Fig. 2. PMID:3178725

  1. Terminal structure

    DOEpatents

    Schmidt, Frank; Allais, Arnaud; Mirebeau, Pierre; Ganhungu, Francois; Lallouet, Nicolas

    2009-10-20

    A terminal structure (2) for a superconducting cable (1) is described. It consists of a conductor (2a) and an insulator (2b) that surrounds the conductor (2a), wherein the superconducting cable (1) has a core with a superconducting conductor (5) and a layer of insulation that surrounds the conductor (5), and wherein the core is arranged in such a way that it can move longitudinally in a cryostat. The conductor (2a) of the terminal structure (2) is electrically connected with the superconducting conductor (5) or with a normal conductor (6) that is connected with the superconducting conductor (5) by means of a tubular part (7) made of an electrically conductive material, wherein the superconducting conductor (5) or the normal conductor (6) can slide in the part (7) in the direction of the superconductor.

  2. Terminal Ballistics

    DTIC Science & Technology

    1976-02-01

    ballistics doe, little to c~plaini the workings of explosike pro jectiles. The termni,iaf phase (of di esplodling tbalfftic weapon is comiposed of esents...citterior, and terminal baillistic phases, and the study of this n’!w systemn hius useful parallel% it) the proiecoile ballistic sysStem. The...charge liner collapse Vi Jet velocity V, Slug velocity W Work Wp Weight of projecti!e Z A length variable a, bi Empirical constants. (In Chap. 5, Eq

  3. Termination unit

    DOEpatents

    Traeholt, Chresten; Willen, Dag; Roden, Mark; Tolbert, Jerry C.; Lindsay, David; Fisher, Paul W.; Nielsen, Carsten Thidemann

    2016-05-03

    Cable end section comprises end-parts of N electrical phases/neutral, and a thermally-insulation envelope comprising cooling fluid. The end-parts each comprises a conductor and are arranged with phase 1 innermost, N outermost surrounded by the neutral, electrical insulation being between phases and N and neutral. The end-parts comprise contacting surfaces located sequentially along the longitudinal extension of the end-section. A termination unit has an insulating envelope connected to a cryostat, special parts at both ends comprising an adapter piece at the cable interface and a closing end-piece terminating the envelope in the end-section. The special parts houses an inlet and/or outlet for cooling fluid. The space between an inner wall of the envelope and a central opening of the cable is filled with cooling fluid. The special part at the end connecting to the cryostat houses an inlet or outlet, splitting cooling flow into cable annular flow and termination annular flow.

  4. The aldo-keto reductase superfamily homepage.

    PubMed

    Hyndman, David; Bauman, David R; Heredia, Vladi V; Penning, Trevor M

    2003-02-01

    The aldo-keto reductases (AKRs) are one of the three enzyme superfamilies that perform oxidoreduction on a wide variety of natural and foreign substrates. A systematic nomenclature for the AKR superfamily was adopted in 1996 and was updated in September 2000 (visit www.med.upenn.edu/akr). Investigators have been diligent in submitting sequences of functional proteins to the Web site. With the new additions, the superfamily contains 114 proteins expressed in prokaryotes and eukaryotes that are distributed over 14 families (AKR1-AKR14). The AKR1 family contains the aldose reductases, the aldehyde reductases, the hydroxysteroid dehydrogenases and steroid 5beta-reductases, and is the largest. Other families of interest include AKR6, which includes potassium channel beta-subunits, and AKR7 the aflatoxin aldehyde reductases. Two new families include AKR13 (yeast aldose reductase) and AKR14 (Escherichia coli aldehyde reductase). Crystal structures of many AKRs and their complexes with ligands are available in the PDB and accessible through the Web site. Each structure has the characteristic (alpha/beta)(8)-barrel motif of the superfamily, a conserved cofactor binding site and a catalytic tetrad, and variable loop structures that define substrate specificity. Although the majority of AKRs are monomeric proteins of about 320 amino acids in length, the AKR2, AKR6 and AKR7 family may form multimers. To expand the nomenclature to accommodate multimers, we recommend that the composition and stoichiometry be listed. For example, AKR7A1:AKR7A4 (1:3) would designate a tetramer of the composition indicated. The current nomenclature is recognized by the Human Genome Project (HUGO) and the Web site provides a link to genomic information including chromosomal localization, gene boundaries, human ESTs and SNPs and much more.

  5. Selenium in thioredoxin reductase: a mechanistic perspective.

    PubMed

    Lacey, Brian M; Eckenroth, Brian E; Flemer, Stevenson; Hondal, Robert J

    2008-12-02

    Most high M(r) thioredoxin reductases (TRs) have the unusual feature of utilizing a vicinal disulfide bond (Cys(1)-Cys(2)) which forms an eight-membered ring during the catalytic cycle. Many eukaryotic TRs have replaced the Cys(2) position of the dyad with the rare amino acid selenocysteine (Sec). Here we demonstrate that Cys- and Sec-containing TRs are distinguished by the importance each class of enzymes places on the eight-membered ring structure in the catalytic cycle. This hypothesis was explored by studying the truncated enzyme missing the C-terminal ring structure in conjunction with oxidized peptide substrates to investigate the reduction and opening of this dyad. The peptide substrates were identical in sequence to the missing part of the enzyme, containing either a disulfide or selenylsulfide linkage, but were differentiated by the presence (cyclic) and absence (acyclic) of the ring structure. The ratio of these turnover rates informs that the ring is only of modest importance for the truncated mouse mitochondrial Sec-TR (ring/no ring = 32), while the ring structure is highly important for the truncated Cys-TRs from Drosophila melanogaster and Caenorhabditis elegans (ring/no ring > 1000). All three enzymes exhibit a similar dependence upon leaving group pK(a) as shown by the use of the acyclic peptides as substrates. These two factors can be reconciled for Cys-TRs if the ring functions to simultaneously allow for attack by a nearby thiolate while correctly positioning the leaving group sulfur atom to accept a proton from the enzymic general acid. For Sec-TRs the ring is unimportant because the lower pK(a) of the selenol relative to a thiol obviates its need to be protonated upon S-Se bond scission and permits physical separation of the selenol and the general acid. Further study of the biochemical properties of the truncated Cys and Sec TR enzymes demonstrates that the chemical advantage conferred on the eukaryotic enzyme by a selenol is the ability to

  6. Chicken muscle aldose reductase: purification, properties and relationship to other chicken aldo/keto reductases.

    PubMed

    Murphy, D G; Davidson, W S

    1986-01-01

    An enzyme that catalyzes the NADPH-dependent reduction of a wide range of aromatic and hydroxy-aliphatic aldehydes was purified from chicken breast muscle. This enzyme shares many properties with mammalian aldose reductases including molecular weight, relative substrate specificity, Michaelis constants, an inhibitor specificity. Therefore, it seems appropriate to call this enzyme an aldose reductase (EC 1.1.1.21). Chicken muscle aldose reductase appears to be kinetically identical to an aldose reductase that has been purified from chicken kidney (Hara et al., Eur. J. Biochem. 133, 207-214) and to hen muscle L-glycol dehydrogenase (Bernado et al., Biochim. biophys. Acta 659, 189-198). The association of this aldose reductase with muscular dystrophy in the chick is discussed.

  7. Part of respiratory nitrate reductase of Klebsiella aerogenes is intimately associated with the peptidoglycan.

    PubMed

    Abraham, P R; Wientjes, F B; Nanninga, N; Van't Riet, J

    1987-02-01

    Lysozyme digestion and sonication of sodium dodecyl sulfate (SDS)-purified Klebsiella aerogenes murein sacculi resulted in the quantitative release of both subunits of nitrate reductase, as well as a number of other cytoplasmic membrane polypeptides (5.2%, by weight, of the total membrane proteins). Similar results were obtained after lysozyme digestion of SDS-prepared peptidoglycan fragments, which excluded the phenomenon of simple trapping of the polypeptides by the surrounding peptidoglycan matrix. About 28% of membrane-bound nitrate reductase appears to be tightly associated with the peptidoglycan. Additional evidence for this association was demonstrated by positive immunogold labeling of SDS-murein sacculi and thin sections of plasmolyzed bacteria. Qualitative amino acid analysis of trypsin-treated sacculi, a tryptic product of holo-nitrate reductase, and amino- and carboxypeptidase digests of both nitrate reductase subunits indicated the possible existence of a terminal anchoring peptide containing the following amino acids: (Gly)n, Trp, Ser, Pro, Ile, Leu, Phe, Cys, Tyr, Asp, and Lys.

  8. Copper-dependent inhibition and oxidative inactivation with affinity cleavage of yeast glutathione reductase.

    PubMed

    Murakami, Keiko; Tsubouchi, Ryoko; Fukayama, Minoru; Yoshino, Masataka

    2014-06-01

    Effects of copper on the activity and oxidative inactivation of yeast glutathione reductase were analyzed. Glutathione reductase from yeast was inhibited by cupric ion and more potently by cuprous ion. Copper ion inhibited the enzyme noncompetitively with respect to the substrate GSSG and NADPH. The Ki values of the enzyme for Cu(2+) and Cu(+) ion were determined to be 1 and 0.35 μM, respectively. Copper-dependent inactivation of glutathione reductase was also analyzed. Hydrogen peroxide and copper/ascorbate also caused an inactivation with the cleavage of peptide bond of the enzyme. The inactivation/fragmentation of the enzyme was prevented by addition of catalase, suggesting that hydroxyl radical produced through the cuprous ion-dependent reduction of oxygen is responsible for the inactivation/fragmentation of the enzyme. SDS-PAGE and TOF-MS analysis confirmed eight fragments, which were further determined to result from the cleavage of the Met17-Ser18, Asn20-Thr21, Glu251-Gly252, Ser420-Pro421, Pro421-Thr422 bonds of the enzyme by amino-terminal sequencing analysis. Based on the kinetic analysis and no protective effect of the substrates, GSSG and NADPH on the copper-mediated inactivation/fragmentation of the enzyme, copper binds to the sites apart from the substrate-sites, causing the peptide cleavage by hydroxyl radical. Copper-dependent oxidative inactivation/fragmentation of glutathione reductase can explain the prooxidant properties of copper under the in vivo conditions.

  9. Aldose reductase induced by hyperosmotic stress mediates cardiomyocyte apoptosis: differential effects of sorbitol and mannitol.

    PubMed

    Galvez, Anita S; Ulloa, Juan Alberto; Chiong, Mario; Criollo, Alfredo; Eisner, Verónica; Barros, Luis Felipe; Lavandero, Sergio

    2003-10-03

    Cells adapt to hyperosmotic conditions by several mechanisms, including accumulation of sorbitol via induction of the polyol pathway. Failure to adapt to osmotic stress can result in apoptotic cell death. In the present study, we assessed the role of aldose reductase, the key enzyme of the polyol pathway, in cardiac myocyte apoptosis. Hyperosmotic stress, elicited by exposure of cultured rat cardiac myocytes to the nonpermeant solutes sorbitol and mannitol, caused identical cell shrinkage and adaptive hexose uptake stimulation. In contrast, only sorbitol induced the polyol pathway and triggered stress pathways as well as apoptosis-related signaling events. Sorbitol resulted in activation of the extracellular signal-regulated kinase (ERK), p54 c-Jun N-terminal kinase (JNK), and protein kinase B. Furthermore, sorbitol treatment resulting in induction and activation of aldose reductase, decreased expression of the antiapoptotic protein Bcl-xL, increased DNA fragmentation, and glutathione depletion. Apoptosis was attenuated by aldose reductase inhibition with zopolrestat and also by glutathione replenishment with N-acetylcysteine. In conclusion, our data show that hypertonic shrinkage of cardiac myocytes alone is not sufficient to induce cardiac myocyte apoptosis. Hyperosmolarity-induced cell death is sensitive to the nature of the osmolyte and requires induction of aldose reductase as well as a decrease in intracellular glutathione levels.

  10. Biochemical and crystallographic characterization of ferredoxin-NADP(+) reductase from nonphotosynthetic tissues.

    PubMed

    Aliverti, A; Faber, R; Finnerty, C M; Ferioli, C; Pandini, V; Negri, A; Karplus, P A; Zanetti, G

    2001-12-04

    Distinct forms of ferredoxin-NADP(+) reductase are expressed in photosynthetic and nonphotosynthetic plant tissues. Both enzymes catalyze electron transfer between NADP(H) and ferredoxin; whereas in leaves the enzyme transfers reducing equivalents from photoreduced ferredoxin to NADP(+) in photosynthesis, in roots it has the opposite physiological role, reducing ferredoxin at the expense of NADPH mainly for use in nitrate assimilation. Here, structural and kinetic properties of a nonphotosynthetic isoform were analyzed to define characteristics that may be related to tissue-specific function. Compared with spinach leaf ferredoxin-NADP(+) reductase, the recombinant corn root isoform showed a slightly altered absorption spectrum, a higher pI, a >30-fold higher affinity for NADP(+), greater susceptibility to limited proteolysis, and an approximately 20 mV more positive redox potential. The 1.7 A resolution crystal structure is very similar to the structures of ferredoxin-NADP(+) reductases from photosynthetic tissues. Four distinct structural features of this root ferredoxin-NADP(+) reductases are an alternate conformation of the bound FAD molecule, an alternate path for the amino-terminal extension, a disulfide bond in the FAD-binding domain, and changes in the surface that binds ferredoxin.

  11. Respiratory arsenate reductase as a bidirectional enzyme

    USGS Publications Warehouse

    Richey, C.; Chovanec, P.; Hoeft, S.E.; Oremland, R.S.; Basu, P.; Stolz, J.F.

    2009-01-01

    The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe–S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

  12. The role of multihaem cytochromes in the respiration of nitrite in Escherichia coli and Fe(III) in Shewanella oneidensis.

    PubMed

    Clarke, Thomas A; Holley, Tracey; Hartshorne, Robert S; Fredrickson, Jim K; Zachara, John M; Shi, Liang; Richardson, David J

    2008-10-01

    The periplasmic nitrite reductase system from Escherichia coli and the extracellular Fe(III) reductase system from Shewanella oneidensis contain multihaem c-type cytochromes as electron carriers and terminal reductases. The position and orientation of the haem cofactors in multihaem cytochromes from different bacteria often show significant conservation despite different arrangements of the polypeptide chain. We propose that the decahaem cytochromes of the iron reductase system MtrA, MtrC and OmcA comprise pentahaem 'modules' similar to the electron donor protein, NrfB, from E. coli. To demonstrate this, we have isolated and characterized the N-terminal pentahaem module of MtrA by preparing a truncated form containing five covalently attached haems. UV-visible spectroscopy indicated that all five haems were low-spin, consistent with the presence of bis-His ligand co-ordination as found in full-length MtrA.

  13. The role of multihaem cytochromes in the respiration of nitrite in Escherichia coli and Fe(III) in Shewanella oneidensis

    SciTech Connect

    Clarke, Thomas A.; Holley, Tracey; Hartshorne, Robert S.; Fredrickson, Jim K.; Zachara, John M.; Shi, Liang; Richardson, David

    2008-10-01

    The periplasmic nitrite reductase system from Escherichia coli and the extracellular Fe(III) reductase system from Shewanella oneidensis contain multihaem c-type cytochromes as electron carriers and terminal reductases. The position and orientation of the haem cofactors in multihaem cytochromes from different bacteria often show significant conservation despite different arrangements of the polypeptide chain. We propose that the decahaem cytochromes of the iron reductase system MtrA, MtrC and OmcA comprise pentahaem ‘modules’ similar to the electron donor protein, NrfB, from E. coli. To demonstrate this, we have isolated and characterized the N-terminal pentahaem module of MtrA by preparing a truncated form containing five covalently attached haems. UV–visible spectroscopy indicated that all five haems were low-spin, consistent with the presence of bis-His ligand co-ordination as found in full-length MtrA.

  14. The tyrosyl free radical in ribonucleotide reductase.

    PubMed Central

    Gräslund, A; Sahlin, M; Sjöberg, B M

    1985-01-01

    The enzyme, ribonucleotide reductase, catalyses the formation of deoxyribonucleotides from ribonucleotides, a reaction essential for DNA synthesis in all living cells. The Escherichia coli ribonucleotide reductase, which is the prototype of all known eukaryotic and virus-coded enzymes, consists of two nonidentical subunits, proteins B1 and B2. The B2 subunit contains an antiferromagnetically coupled pair of ferric ions and a stable tyrosyl free radical. EPR studies show that the tyrosyl radical, formed by loss of ferric ions and a stable tyrosyl free radical. EPR studies show that the tyrosyl radical, formed by loss of an electron, has its unpaired spin density delocalized in the aromatic ring of tyrosine. Effects of iron-radical interaction indicate a relatively close proximity between the iron center and the radical. The EPR signal of the radical can be studied directly in frozen packed cells of E. coli or mammalian origin, if the cells are made to overproduce ribonucleotide reductase. The hypothetic role of the tyrosyl free radical in the enzymatic reaction is not yet elucidated, except in the reaction with the inhibiting substrate analogue 2'-azido-CDP. In this case, the normal tyrosyl radical is destroyed with concomitant appearance of a 2'-azido-CDP-localized radical intermediate. Attempts at spin trapping of radical reaction intermediates have turned out negative. In E. coli the activity of ribonucleotide reductase may be regulated by enzymatic activities that interconvert a nonradical containing form and the fully active protein B2. In synchronized mammalian cells, however, the cell cycle variation of ribonucleotide reductase, studied by EPR, was shown to be due to de novo protein synthesis. Inhibitors of ribonucleotide reductase are of medical interest because of their ability to control DNA synthesis. One example is hydroxyurea, used in cancer therapy, which selectively destroys the tyrosyl free radical. PMID:3007085

  15. Molecular dissection of a putative iron reductase from Desulfotomaculum reducens MI-1

    PubMed Central

    Li, Zhi; Kim, David D.; Nelson, Ornella D.; Otwell, Anne E.; Richardson, Ruth E.; Callister, Stephen J.; Lin, Hening

    2015-01-01

    Desulfotomaculum reducens MI-1 is a Firmicute strain capable of reducing a variety of heavy metal ions and has a great potential in heavy metal bioremediation. We recently identified Dred_2421 as a potential iron reductase through proteomic study of D. reducens. The current study examines its iron-reduction mechanism. Dred_2421, like its close homolog from Escherichia coli (2, 4-dienoyl-CoA reductase), has an FMN-binding N-terminal domain (NTD), an FAD-binding C-terminal domain (CTD), and a 4Fe-4S cluster between the two domains. To understand the mechanism of the iron-reduction activity and the role of each domain, we generated a series of variants for each domain and investigated their iron-reduction activity. Our results suggest that CTD is the main contributor of the iron-reduction activity, and that NTD and the 4Fe-4S cluster are not directly involved in such activity. This study provides a mechanistic understanding of the iron-reductase activity of Dred_2421 and may also help to elucidate other physiological activities this enzyme may have. PMID:26454174

  16. Molecular dissection of a putative iron reductase from Desulfotomaculum reducens MI-1.

    PubMed

    Li, Zhi; Kim, David D; Nelson, Ornella D; Otwell, Anne E; Richardson, Ruth E; Callister, Stephen J; Lin, Hening

    2015-11-20

    Desulfotomaculum reducens MI-1 is a Firmicute strain capable of reducing a variety of heavy metal ions and has a great potential in heavy metal bioremediation. We recently identified Dred_2421 as a potential iron reductase through proteomic study of D. reducens. The current study examines its iron-reduction mechanism. Dred_2421, like its close homolog from Escherichia coli (2, 4-dienoyl-CoA reductase), has an FMN-binding N-terminal domain (NTD), an FAD-binding C-terminal domain (CTD), and a 4Fe-4S cluster between the two domains. To understand the mechanism of the iron-reduction activity and the role of each domain, we generated a series of variants for each domain and investigated their iron-reduction activity. Our results suggest that CTD is the main contributor of the iron-reduction activity, and that NTD and the 4Fe-4S cluster are not directly involved in such activity. This study provides a mechanistic understanding of the iron-reductase activity of Dred_2421 and may also help to elucidate other physiological activities this enzyme may have.

  17. Evaluation of nitrate reductase activity in Rhizobium japonicum

    SciTech Connect

    Streeter, J.G.; DeVine, P.J.

    1983-08-01

    Nitrate reductase activity was evaluated by four approaches, using four strains of Rhizobium japonicum and 11 chlorate-resistant mutants of the four strains. It was concluded that in vitro assays with bacteria or bacteroids provide the most simple and reliable assessment of the presence or absence of nitrate reductase. Nitrite reductase activity with methyl viologen and dithionite was found, but the enzyme activity does not confound the assay of nitrate reductase. 18 references

  18. Isolation, sequence identification and tissue expression profile of two novel soybean (glycine max) genes-vestitone reductase and chalcone reductase.

    PubMed

    Liu, G Y

    2009-09-01

    The complete mRNA sequences of two soybean (glycine max) genes-vestitone reductase and chalcone reductase, were amplified using the rapid amplification of cDNA ends methods. The sequence analysis of these two genes revealed that soybean vestitone reductase gene encodes a protein of 327 amino acids which has high homology with the vestitone reductase of Medicago sativa (77%). The soybean chalcone reductase gene encodes a protein of 314 amino acids that has high homology with the chalcone reductase of kudzu vine (88%) and medicago sativa (83%). The expression profiles of the soybean vestitone reductase and chalcone reductase genes were studied and the results indicated that these two soybean genes were differentially expressed in detected soybean tissues including leaves, stems, roots, inflorescences, embryos and endosperm. Our experiment established the foundation for further research on these two soybean genes.

  19. Purification, Characterization, and Overexpression of Flavin Reductase Involved in Dibenzothiophene Desulfurization by Rhodococcus erythropolis D-1

    PubMed Central

    Matsubara, Toshiyuki; Ohshiro, Takashi; Nishina, Yoshihiro; Izumi, Yoshikazu

    2001-01-01

    The dibenzothiophene (DBT)-desulfurizing bacterium, Rhodococcus erythropolis D-1, removes sulfur from DBT to form 2-hydroxybiphenyl using four enzymes, DszC, DszA, DszB, and flavin reductase. In this study, we purified and characterized the flavin reductase from R. erythropolis D-1 grown in a medium containing DBT as the sole source of sulfur. It is conceivable that the enzyme is essential for two monooxygenase (DszC and DszA) reactions in vivo. The purified flavin reductase contains no chromogenic cofactors and was found to have a molecular mass of 86 kDa and four identical 22-kDa subunits. The enzyme catalyzed NADH-dependent reduction of flavin mononucleotide (FMN), and the Km values for NADH and FMN were 208 and 10.8 μM, respectively. Flavin adenine dinucleotide was a poor substrate, and NADPH was inert. The enzyme did not catalyze reduction of any nitroaromatic compound. The optimal temperature and optimal pH for enzyme activity were 35°C and 6.0, respectively, and the enzyme retained 30% of its activity after heat treatment at 80°C for 30 min. The N-terminal amino acid sequence of the purified flavin reductase was identical to that of DszD of R. erythropolis IGTS8 (K. A. Gray, O. S. Pogrebinsky, G. T. Mrachko, L. Xi, D. J. Monticello, and C. H. Squires, Nat. Biotechnol. 14:1705–1709, 1996). The flavin reductase gene was amplified with primers designed by using dszD of R. erythropolis IGTS8, and the enzyme was overexpressed in Escherichia coli. The specific activity in crude extracts of the overexpressed strain was about 275-fold that of the wild-type strain. PMID:11229908

  20. Post-translational Regulation of Nitrate Reductase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nitrate reductase (NR) catalyzes the reduction of nitrate to nitrite, which is the first step in the nitrate assimilation pathway, but can also reduce nitrite to nitric oxide (NO), an important signaling molecule that is thought to mediate a wide array of of developmental and physiological processes...

  1. Fumarate Reductase Activity of Streptococcus faecalis

    PubMed Central

    Aue, B. J.; Diebel, R. H.

    1967-01-01

    Some characteristics of a fumarate reductase from Streptococcus faecalis are described. The enzyme had a pH optimum of 7.4; optimal activity was observed when the ionic strength of the phosphate buffer was adjusted to 0.088. The Km value of the enzyme for reduced flavin mononucleotide was 2 × 10−4 m as determined with a 26-fold preparation. In addition to fumarate, the enzyme reduced maleate and mesaconate. No succinate dehydrogenase activity was detected, but succinate did act as an inhibitor of the fumarate reductase activity. Other inhibitors were malonate, citraconate, and trans-, trans-muconate. Metal-chelating agents did not inhibit the enzyme. A limited inhibition by sulfhydryl-binding agents was observed, and the preparations were sensitive to air oxidation and storage. Glycine, alanine, histidine, and possibly lysine stimulated fumarate reductase activity in the cell-free extracts. However, growth in media supplemented with glycine did not enhance fumarate reductase activity. The enzymatic activity appears to be constitutive. PMID:4960892

  2. Control of dihydrofolate reductase messenger ribonucleic acid production

    SciTech Connect

    Leys, E.J.; Kellems, R.E.

    1981-11-01

    The authors used methotrexate-resistant mouse cells in which dihydrofolate reductase levels are approximately 500 times normal to study the effect of growth stimulation on dihydrofolate reductase gene expression. As a result of growth stimulation, the relative rate of dihydrofolate reductase protein synthesis increased threefold, reaching a maximum between 25 and 30 h after stimulation. The relative rate of dihydrofolate reductase messenger ribonucleic acid production (i.e., the appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm) increased threefold after growth stimulation and was accompanied by a corresponding increase in the relative steady-state level of dihydrofolate reductase ribonucleic acid in the nucleus. However, the increase in the nuclear level of dihydrofolate reductase ribonucleic acid was not accompanied by a significant increase in the relative rate of transcription of the dihydrofolate reductase genes. These data indicated that the relative rate of appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm depends on the relative stability of the dihydrofolate reductase ribonucleic acid sequences in the nucleus and is not dependent on the relative rate of transcription of the dihydrofolate reductase genes.

  3. Augmentation of CFTR maturation by S-nitrosoglutathione reductase

    PubMed Central

    Sawczak, Victoria; Zaidi, Atiya; Butler, Maya; Bennett, Deric; Getsy, Paulina; Zeinomar, Maryam; Greenberg, Zivi; Forbes, Michael; Rehman, Shagufta; Jyothikumar, Vinod; DeRonde, Kim; Sattar, Abdus; Smith, Laura; Corey, Deborah; Straub, Adam; Sun, Fei; Palmer, Lisa; Periasamy, Ammasi; Randell, Scott; Kelley, Thomas J.; Lewis, Stephen J.

    2015-01-01

    S-nitrosoglutathione (GSNO) reductase regulates novel endogenous S-nitrosothiol signaling pathways, and mice deficient in GSNO reductase are protected from airways hyperreactivity. S-nitrosothiols are present in the airway, and patients with cystic fibrosis (CF) tend to have low S-nitrosothiol levels that may be attributed to upregulation of GSNO reductase activity. The present study demonstrates that 1) GSNO reductase activity is increased in the cystic fibrosis bronchial epithelial (CFBE41o−) cells expressing mutant F508del-cystic fibrosis transmembrane regulator (CFTR) compared with the wild-type CFBE41o− cells, 2) GSNO reductase expression level is increased in the primary human bronchial epithelial cells expressing mutant F508del-CFTR compared with the wild-type cells, 3) GSNO reductase colocalizes with cochaperone Hsp70/Hsp90 organizing protein (Hop; Stip1) in human airway epithelial cells, 4) GSNO reductase knockdown with siRNA increases the expression and maturation of CFTR and decreases Stip1 expression in human airway epithelial cells, 5) increased levels of GSNO reductase cause a decrease in maturation of CFTR, and 6) a GSNO reductase inhibitor effectively reverses the effects of GSNO reductase on CFTR maturation. These studies provide a novel approach to define the subcellular location of the interactions between Stip1 and GSNO reductase and the role of S-nitrosothiols in these interactions. PMID:26637637

  4. Differential cytochrome content and reductase activity in Geospirillum barnesii strain SeS3

    USGS Publications Warehouse

    Stolz, J.F.; Gugliuzza, T.; Switzer, Blum J.; Oremland, R.; Martinez, Murillo F.

    1997-01-01

    The protein composition, cytochrome content, and reductase activity in the dissimilatory selenate-reducing bacterium Geospirillum barnesii strain SeS3, grown with thiosulfate, nitrate, selenate, or fumarate as the terminal electron acceptor, was investigated. Comparison of seven high-molecular-mass membrane proteins (105.3, 90.3, 82.6, 70.2, 67.4, 61.1, and 57.3 kDa) by SDS-PAGE showed that their detection was dependent on the terminal electron acceptor used. Membrane fractions from cells grown on thiosulfate contained a 70.2-kDa c-type cytochrome with absorbance maxima at 552, 522, and 421 nm. A 61.1-kDa c-type cytochrome with absorption maxima at 552, 523, and 423 nm was seen in membrane fractions from cells grown on nitrate. No c-type cytochromes were detected in membrane fractions of either selenate- or fumarate-grown cells. Difference spectra, however, revealed the presence of a cytochrome b554 (absorption maxima at 554, 523, and 422 nm) in membrane fractions from selenate-grown cells and a cytochrome b556 (absorption maxima at 556, 520, and 416 nm) in membrane fractions from fumarate-grown cells. Analysis of reductase activity in the different membrane fractions showed variability in substrate specificity. However, enzyme activity was greatest for the substrate on which the cells had been grown (e.g., membranes from nitrate-grown cells exhibited the greatest activity with nitrate). These results show that protein composition, cytochrome content, and reductase activity are dependent on the terminal electron acceptor used for growth.

  5. Aging, Terminal Decline, and Terminal Drop

    ERIC Educational Resources Information Center

    Palmore, Erdman; Cleveland, William

    1976-01-01

    Data from a 20-year longitudinal study of persons over 60 were analyzed by step-wise multiple regression to test for declines in function with age, for terminal decline (linear relationship to time before death), and for terminal drop (curvilinear relationship to time before death). There were no substantial terminal drop effects. (Author)

  6. FRUCTOSE-6-PHOSPHATE REDUCTASE FROM SALMONELLA GALLINARUM

    PubMed Central

    Zancan, Glaci T.; Bacila, Metry

    1964-01-01

    Zancan, Glaci T. (Universidade do Paraná, Curitiba, Paraná, Brazil), and Metry Bacila. Fructose-6-phosphate reductase from Salmonella gallinarum. J. Bacteriol. 87:614–618. 1964.—A fructose-6-phosphate reductase present in cell-free extracts of Salmonella gallinarum was purified approximately 42 times. The optimal pH for this enzyme is 8.0. The enzyme is specific for fructose-6-phosphate and reduced nicotinamide adenine dinucleotide (NADH). The dissociation constants are 1.78 × 10−4m for fructose-6-phosphate and 8.3 × 10−5m for NADH. The Q10, reaction order, and equilibrium constant were determined. The enzyme is sensitive to p-chloromercuribenzoic acid, but not to o-iodosobenzoic acid nor to N-ethylmaleimide. PMID:14127579

  7. The unique N terminus of the herpes simplex virus type 1 large subunit is not required for ribonucleotide reductase activity.

    PubMed

    Conner, J; Macfarlane, J; Lankinen, H; Marsden, H

    1992-01-01

    Using purified bacterially expressed herpes simplex virus type 1 ribonucleotide reductase large subunit (R1) and the proteolytic enzymes chymotrypsin and trypsin, we have generated stable N-terminal truncations. Chymotrypsin removes 246 amino acids from the amino terminus to produce a fragment (dN246R1) which retains full enzymic activity and affinity for the small subunit (R2). Treatment of R1 with trypsin produces a 120K protein and a cleavage at amino acid residue 305 to produce a fragment (dN305R1) which remains associated with a 33K N-terminal polypeptide. Although this 33K-dN305R1 complex retains full binding affinity for R2 its reductase activity is reduced by approximately 50%. Increasing the concentration of trypsin removes the 33K N-terminal polypeptide resulting in dN305R1 which, when bound to R2, has full ribonucleotide reductase activity. Like R1, dN246R1 and dN305R1 each exist as dimers showing that the first 305 amino acids of R1 are not necessary for dimer formation. These results indicate that, in structural studies of subunit interaction, dN246R1 or dN305R1 can be considered as suitable replacements for intact R1.

  8. A structural account of substrate and inhibitor specificity differences between two Naphthol reductases

    SciTech Connect

    Liao, D.-I.; Thompson, J.E.; Fahnestock, S.; Valent, B.; Jordan, D.B.

    2010-03-08

    Two short chain dehydrogenase/reductases mediate naphthol reduction reactions in fungal melanin biosynthesis. An X-ray structure of 1,3,6,8-tetrahydroxynaphthalene reductase (4HNR) complexed with NADPH and pyroquilon was determined for examining substrate and inhibitor specificities that differ from those of 1,3,8-trihydroxynaphthalene reductase (3HNR). The 1.5 {angstrom} resolution structure allows for comparisons with the 1.7 {angstrom} resolution structure of 3HNR complexed with the same ligands. The sequences of the two proteins are 46% identical, and they have the same fold. The 30-fold lower affinity of the 4HNR-NADPH complex for pyroquilon (a commercial fungicide that targets 3HNR) in comparison to that of the 3HNR-NADPH complex can be explained by unfavorable interactions between the anionic carboxyl group of the C-terminal Ile282 of 4HNR and CH and CH{sub 2} groups of the inhibitor that are countered by favorable inhibitor interactions with 3HNR. 1,3,8-Trihydroxynaphthalene (3HN) and 1,3,6,8-tetrahydroxynaphthalene (4HN) were modeled onto the cyclic structure of pyroquilon in the 4HNR-NADPH-pyroquilon complex to examine the 300-fold preference of the enzyme for 4HN over 3HN. The models suggest that the C-terminal carboxyl group of Ile282 has a favorable hydrogen bonding interaction with the C6 hydroxyl group of 4HN and an unfavorable interaction with the C6 CH group of 3HN. Models of 3HN and 4HN in the 3HNR active site suggest a favorable interaction of the sulfur atom of the C-terminal Met283 with the C6 CH group of 3HN and an unfavorable one with the C6 hydroxyl group of 4HN, accounting for the 4-fold difference in substrate specificities. Thus, the C-terminal residues of the two naphthol reductase are determinants of inhibitor and substrate specificities.

  9. A founder mutation causing a severe methylenetetrahydrofolate reductase (MTHFR) deficiency in Bukharian Jews.

    PubMed

    Ben-Shachar, Shay; Zvi, Tal; Rolfs, Arndt; Breda Klobus, Andrea; Yaron, Yuval; Bar-Shira, Anat; Orr-Urtreger, Avi

    2012-11-01

    Methylenetetrahydrofolate reductase (MTHFR) deficiency is a rare autosomal recessive disorder. A novel homozygous MTHFR c.474A>T (p.G158G) mutation was detected in two unrelated children of Jewish Bukharian origin. This mutation generates an abnormal splicing and early termination codon. A carrier frequency of 1:39 (5/196) was determined among unrelated healthy Bukharian Jews. Given the disease severity and allele frequency, a population screening for individuals of this ancestry is warranted in order to allow prenatal, or preimplantation diagnosis.

  10. Characterization of erythrose reductases from filamentous fungi

    PubMed Central

    2013-01-01

    Proteins with putative erythrose reductase activity have been identified in the filamentous fungi Trichoderma reesei, Aspergillus niger, and Fusarium graminearum by in silico analysis. The proteins found in T. reesei and A. niger had earlier been characterized as glycerol dehydrogenase and aldehyde reductase, respectively. Corresponding genes from all three fungi were cloned, heterologously expressed in Escherichia coli, and purified. Subsequently, they were used to establish optimal enzyme assay conditions. All three enzymes strictly require NADPH as cofactor, whereas with NADH no activity could be observed. The enzymatic characterization of the three enzymes using ten substrates revealed high substrate specificity and activity with D-erythrose and D-threose. The enzymes from T. reesei and A. niger herein showed comparable activities, whereas the one from F. graminearum reached only about a tenth of it for all tested substrates. In order to proof in vivo the proposed enzyme function, we overexpressed the erythrose reductase-encoding gene in T. reesei. An increased production of erythritol by the recombinant strain compared to the parental strain could be detected. PMID:23924507

  11. Production of a highly active, soluble form of the cytochrome P450 reductase (CPR A) from Candida tropicalis

    DOEpatents

    Donnelly, Mark

    2006-08-01

    The present invention provides soluble cytochrome p450 reductase (CPR) proteins from Candida sp. having an altered N-terminal region which results in reduced hydrophobicity of the N-terminal region. Also provided are host cells comprising the subject soluble CPR proteins. In addition, the present invention provides nucleotide and corresponding amino acid sequences for soluble CPR proteins and vectors comprising the nucleotide sequences. Methods for producing a soluble CPR, for increasing production of a dicarboxylic acid, and for detecting a cytochrome P450 are also provided.

  12. A role for N-myristoylation in protein targeting: NADH-cytochrome b5 reductase requires myristic acid for association with outer mitochondrial but not ER membranes

    PubMed Central

    1996-01-01

    N-myristoylation is a cotranslational modification involved in protein- protein interactions as well as in anchoring polypeptides to phospholipid bilayers; however, its role in targeting proteins to specific subcellular compartments has not been clearly defined. The mammalian myristoylated flavoenzyme NADH-cytochrome b5 reductase is integrated into ER and mitochondrial outer membranes via an anchor containing a stretch of 14 uncharged amino acids downstream to the NH2- terminal myristoylate glycine. Since previous studies suggested that the anchoring function could be adequately carried out by the 14 uncharged residues, we investigated a possible role for myristic acid in reductase targeting. The wild type (wt) and a nonmyristoylatable reductase mutant (gly2-->ala) were stably expressed in MDCK cells, and their localization was investigated by immunofluorescence, immuno-EM, and cell fractionation. By all three techniques, the wt protein localized to ER and mitochondria, while the nonmyristoylated mutant was found only on ER membranes. Pulse-chase experiments indicated that this altered steady state distribution was due to the mutant's inability to target to mitochondria, and not to its enhanced instability in that location. Both wt and mutant reductase were resistant to Na2CO3 extraction and partitioned into the detergent phase after treatment of a membrane fraction with Triton X-114, demonstrating that myristic acid is not required for tight anchoring of reductase to membranes. Our results indicate that myristoylated reductase localizes to ER and mitochondria by different mechanisms, and reveal a novel role for myristic acid in protein targeting. PMID:8978818

  13. Nitrate, nitrite and nitric oxide reductases: from the last universal common ancestor to modern bacterial pathogens.

    PubMed

    Vázquez-Torres, Andrés; Bäumler, Andreas J

    2016-02-01

    The electrochemical gradient that ensues from the enzymatic activity of cytochromes such as nitrate reductase, nitric oxide reductase, and quinol oxidase contributes to the bioenergetics of the bacterial cell. Reduction of nitrogen oxides by bacterial pathogens can, however, be uncoupled from proton translocation and biosynthesis of ATP or NH4(+), but still linked to quinol and NADH oxidation. Ancestral nitric oxide reductases, as well as cytochrome c oxidases and quinol bo oxidases evolved from the former, are capable of binding and detoxifying nitric oxide to nitrous oxide. The NO-metabolizing activity associated with these cytochromes can be a sizable source of antinitrosative defense in bacteria during their associations with host cells. Nitrosylation of terminal cytochromes arrests respiration, reprograms bacterial metabolism, stimulates antioxidant defenses and alters antibiotic cytotoxicity. Collectively, the bioenergetics and regulation of redox homeostasis that accompanies the utilization of nitrogen oxides and detoxification of nitric oxide by cytochromes of the electron transport chain increases fitness of many Gram-positive and -negative pathogens during their associations with invertebrate and vertebrate hosts.

  14. A Ferredoxin Disulfide Reductase Delivers Electrons to the Methanosarcina barkeri Class III Ribonucleotide Reductase

    PubMed Central

    2015-01-01

    Two subtypes of class III anaerobic ribonucleotide reductases (RNRs) studied so far couple the reduction of ribonucleotides to the oxidation of formate, or the oxidation of NADPH via thioredoxin and thioredoxin reductase. Certain methanogenic archaea contain a phylogenetically distinct third subtype of class III RNR, with distinct active-site residues. Here we report the cloning and recombinant expression of the Methanosarcina barkeri class III RNR and show that the electrons required for ribonucleotide reduction can be delivered by a [4Fe-4S] protein ferredoxin disulfide reductase, and a conserved thioredoxin-like protein NrdH present in the RNR operon. The diversity of class III RNRs reflects the diversity of electron carriers used in anaerobic metabolism. PMID:26536144

  15. Three spinach leaf nitrate reductase-3-hydroxy-3-methylglutaryl-CoA reductase kinases that are required by reversible phosphorylation and/or Ca2+ ions.

    PubMed Central

    Douglas, P; Pigaglio, E; Ferrer, A; Halfords, N G; MacKintosh, C

    1997-01-01

    In spinach (Spinacea oleracea L.) leaf extracts, three protein kinases (PKI, PKII and PKIII) were identified each of which phosphorylated spinach nitrate reductase on serine-543, and inactivated the enzyme in the presence of nitrate reductase inhibitor, 14-3-3. PKIII was also very active in phosphorylating and inactivating Arabidopsis (Landsberg erecta) 3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 (HMGR1). PKI and PKII phosphorylated HMGR1 more slowly than PKIII, compared with their relative rates of phosphorylation of nitrate reductase. HMGR1 identical with those that are seen after phosphorylation of serine-577 by the sucrose non-fermenting (SNF1)-like PK, 3-hydroxy-3-methylglutaryl-Co A reductase kinase A (HRK-A), from cauliflower [Dale, Arró, Becerra, Morrice, Boronat, Hardie and Ferrer (1995) Eur. J. Biochem. 233, 506-513]. PKI was Ca2+-dependent when prepared in the absence of protein phosphatase (PP) inhibitors, and largely Ca2+-dependent when prepared in the presence of PP inhibitors (NaF and EGTA). The Ca2+-independent portion of PKI was inactivated by either PP2A or PP2C, while the Ca2+-dependent portion of PKI became increasingly activated during storage, which we presume was mimicking the effect of an unidentified PP. These findings indicate that PK1 is regulated by two functionally distinct phosphorylations. PKI had a molecular mass of 45 kDa on gel filtration and was active towards substrate peptides that terminated at the +2 residue from the phosphorylation site, whereas PKIII was inactive towards these peptides. PKII was Ca2+-stimulated under all conditions tested. PKIII was Ca2+-indepdented, inactivated by PP2A or PP2C, had a requirement for a hydrophobic residue in the +4 position of peptide substrates, had a molecular mass by gel filtration of approximately 140 kDa, and an antibody against the rye SNF1-related PK (RKIN1) recognized a 58 kDa subunit in fractions containing PKIII. These properties of PKIII are identical with those reported

  16. Methionine sulfoxide reductase contributes to meeting dietary methionine requirements

    PubMed Central

    Zhao, Hang; Kim, Geumsoo; Levine, Rodney L.

    2012-01-01

    Methionine sulfoxide reductases are present in all aerobic organisms. They contribute to antioxidant defenses by reducing methionine sulfoxide in proteins back to methionine. However, the actual in vivo roles of these reductases are not well defined. Since methionine is an essential amino acid in mammals, we hypothesized that methionine sulfoxide reductases may provide a portion of the dietary methionine requirement by recycling methionine sulfoxide. We used a classical bioassay, the growth of weanling mice fed diets varying in methionine, and applied it to mice genetically engineered to alter the levels of methionine sulfoxide reductase A or B1. Mice of all genotypes were growth retarded when raised on chow containing 0.10% methionine instead of the standard 0.45% methionine. Retardation was significantly greater in knockout mice lacking both reductases. We conclude that the methionine sulfoxide reductases can provide methionine for growth in mice with limited intake of methionine, such as may occur in the wild. PMID:22521563

  17. Structural Elucidation of Chalcone Reductase and Implications for Deoxychalcone Biosynthesis

    PubMed Central

    Bomati, Erin K.; Austin, Michael B.; Bowman, Marianne E.; Dixon, Richard A.; Noel, Joseph P.

    2010-01-01

    4,2′,4′,6′-tetrahydroxychalcone (chalcone) and 4,2′,4′-trihydroxychalcone (deoxychalcone) serve as precursors of ecologically important flavonoids and isoflavonoids. Deoxychalcone formation depends on chalcone synthase and chalcone reductase; however, the identity of the chalcone reductase substrate out of the possible substrates formed during the multistep reaction catalyzed by chalcone synthase remains experimentally elusive. We report here the three-dimensional structure of alfalfa chalcone reductase bound to the NADP+ cofactor and propose the identity and binding mode of its substrate, namely the non-aromatized coumaryl-trione intermediate of the chalcone synthase-catalyzed cyclization of the fully extended coumaryl-tetraketide thioester intermediate. In the absence of a ternary complex, the quality of the refined NADP+-bound chalcone reductase structure serves as a template for computer-assisted docking to evaluate the likelihood of possible substrates. Interestingly, chalcone reductase adopts the three-dimensional structure of the aldo/keto reductase superfamily. The aldo/keto reductase fold is structurally distinct from all known ketoreductases of fatty acid biosynthesis, which instead belong to the short-chain dehydrogenase/reductase superfamily. The results presented here provide structural support for convergent functional evolution of these two ketoreductases that share similar roles in the biosynthesis of fatty acids/polyketides. In addition, the chalcone reductase structure represents the first protein structure of a member of the aldo/ketoreductase 4 family. Therefore, the chalcone reductase structure serves as a template for the homology modeling of other aldo/ketoreductase 4 family members, including the reductase involved in morphine biosynthesis, namely codeinone reductase. PMID:15970585

  18. A Plasma Display Terminal.

    ERIC Educational Resources Information Center

    Stifle, Jack

    A graphics terminal designed for use as a remote computer input/output terminal is described. Although the terminal is intended for use in teaching applications, it has several features which make it useful in many other computer terminal applications. These features include: a 10-inch square plasma display panel, permanent storage of information…

  19. Limited proteolysis of the nitrate reductase from spinach leaves.

    PubMed

    Kubo, Y; Ogura, N; Nakagawa, H

    1988-12-25

    The functional structure of assimilatory NADH-nitrate reductase from spinach leaves was studied by limited proteolysis experiments. After incubation of purified nitrate reductase with trypsin, two stable products of 59 and 45 kDa were observed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The fragment of 45 kDa was purified by Blue Sepharose chromatography. NADH-ferricyanide reductase and NADH-cytochrome c reductase activities were associated with this 45-kDa fragment which contains FAD, heme, and NADH binding fragment. After incubation of purified nitrate reductase with Staphylococcus aureus V8 protease, two major peaks were observed by high performance liquid chromatography size exclusion gel filtration. FMNH2-nitrate reductase and reduced methyl viologen-nitrate reductase activities were associated with the first peak of 170 kDa which consists of two noncovalently associated (75-90-kDa) fragments. NADH-ferricyanide reductase activity, however, was associated with the second peak which consisted of FAD and NADH binding sites. Incubation of the 45-kDa fragment with S. aureus V8 protease produced two major fragments of 28 and 14 kDa which contained FAD and heme, respectively. These results indicate that the molybdenum, heme, and FAD components of spinach nitrate reductase are contained in distinct domains which are covalently linked by exposed hinge regions. The molybdenum domain appears to be important in the maintenance of subunit interactions in the enzyme complex.

  20. Chemical Ligation and Isotope Labeling to Locate Dynamic Effects during Catalysis by Dihydrofolate Reductase.

    PubMed

    Luk, Louis Y P; Ruiz-Pernía, J Javier; Adesina, Aduragbemi S; Loveridge, E Joel; Tuñón, Iñaki; Moliner, Vincent; Allemann, Rudolf K

    2015-07-27

    Chemical ligation has been used to alter motions in specific regions of dihydrofolate reductase from E. coli and to investigate the effects of localized motional changes on enzyme catalysis. Two isotopic hybrids were prepared; one with the mobile N-terminal segment containing heavy isotopes ((2) H, (13) C, (15) N) and the remainder of the protein with natural isotopic abundance, and the other one with only the C-terminal segment isotopically labeled. Kinetic investigations indicated that isotopic substitution of the N-terminal segment affected only a physical step of catalysis, whereas the enzyme chemistry was affected by protein motions from the C-terminal segment. QM/MM studies support the idea that dynamic effects on catalysis mostly originate from the C-terminal segment. The use of isotope hybrids provides insights into the microscopic mechanism of dynamic coupling, which is difficult to obtain with other studies, and helps define the dynamic networks of intramolecular interactions central to enzyme catalysis.

  1. Cloning, sequence determination, and regulation of the ribonucleotide reductase subunits from Plasmodium falciparum: a target for antimalarial therapy.

    PubMed Central

    Rubin, H; Salem, J S; Li, L S; Yang, F D; Mama, S; Wang, Z M; Fisher, A; Hamann, C S; Cooperman, B S

    1993-01-01

    Malaria remains a leading cause of morbidity and mortality worldwide, accounting for more than one million deaths annually. We have focused on the reduction of ribonucleotides to 2'-deoxyribonucleotides, catalyzed by ribonucleotide reductase, which represents the rate-determining step in DNA replication as a target for antimalarial agents. We report the full-length DNA sequence corresponding to the large (PfR1) and small (PfR2) subunits of Plasmodium falciparum ribonucleotide reductase. The small subunit (PfR2) contains the major catalytic motif consisting of a tyrosyl radical and a dinuclear Fe site. Whereas PfR2 shares 59% amino acid identity with human R2, a striking sequence divergence between human R2 and PfR2 at the C terminus may provide a selective target for inhibition of the malarial enzyme. A synthetic oligopeptide corresponding to the C-terminal 7 residues of PfR2 inhibits mammalian ribonucleotide reductase at concentrations approximately 10-fold higher than that predicted to inhibit malarial R2. The gene encoding the large subunit (PfR1) contains a single intron. The cysteines thought to be involved in the reduction mechanism are conserved. In contrast to mammalian ribonucleotide reductase, the genes for PfR1 and PfR2 are located on the same chromosome and the accumulation of mRNAs for the two subunits follow different temporal patterns during the cell cycle. Images Fig. 2 Fig. 4 Fig. 5 PMID:8415692

  2. Evidence for a Ustilago maydis steroid 5alpha-reductase by functional expression in Arabidopsis det2-1 mutants.

    PubMed

    Basse, Christoph W; Kerschbamer, Christine; Brustmann, Markus; Altmann, Thomas; Kahmann, Regine

    2002-06-01

    We have identified a gene (udh1) in the basidiomycete Ustilago maydis that is induced during the parasitic interaction with its host plant maize (Zea mays). udh1 encodes a protein with high similarity to mammalian and plant 5alpha-steroid reductases. Udh1 differs from those of known 5alpha-steroid reductases by six additional domains, partially predicted to be membrane-spanning. A fusion protein of Udh1 and the green fluorescent protein provided evidence for endoplasmic reticulum localization in U. maydis. The function of the Udh1 protein was demonstrated by complementing Arabidopsis det2-1 mutants, which display a dwarf phenotype due to a mutation in the 5alpha-steroid reductase encoding DET2 gene. det2-1 mutant plants expressing either the udh1 or the DET2 gene controlled by the cauliflower mosaic virus 35S promoter differed from wild-type Columbia plants by accelerated stem growth, flower and seed development and a reduction in size and number of rosette leaves. The accelerated growth phenotype of udh1 transgenic plants was stably inherited and was favored under reduced light conditions. Truncation of the N-terminal 70 amino acids of the Udh1 protein abolished the ability to restore growth in det2-1 plants. Our results demonstrate the existence of a 5alpha-steroid reductase encoding gene in fungi and suggest a common ancestor between fungal, plant, and mammalian proteins.

  3. A study of chromosomal changes associated with amplified dihydrofolate reductase genes in rat hepatoma cells and their dedifferentiated variants

    PubMed Central

    1984-01-01

    We have examined the karyological consequences of dihydrofolate reductase gene amplification in a series of six rat hepatoma cell lines, all derived from the same clone. Cells of three of these lines express a series of liver-specific functions whereas those of three others fail to express these functions. Cells of each line have been subjected to stepwise selection for methotrexate resistance and, in most cases, resistance is associated with a 40-50-fold amplification of sequences hybridizing to a dihydrofolate reductase cDNA probe. In one line no modified chromosome is observed, whereas in two others the amplified genes are associated with an expanded chromosomal region. R- banding analysis of these karyotypes showed that few changes have occurred. These observations apply to two of the well-differentiated lines, and to a variant able to revert to the differentiated state. In contrast, in the two stably dedifferentiated hepatoma cell lines, amplified dihydrofolate reductase genes are found on large chromosomes of variable size, on ring chromosomes, and on chromosomes containing terminal, median, or multiple centromeres. We conclude that the nature of the chromosomal changes associated with dihydrofolate reductase gene amplification are the result of differences in cell lines rather than in the protocols employed for selection. PMID:6746737

  4. Purification and properties of Escherichia coli dimethyl sulfoxide reductase, an iron-sulfur molybdoenzyme with broad substrate specificity.

    PubMed

    Weiner, J H; MacIsaac, D P; Bishop, R E; Bilous, P T

    1988-04-01

    Dimethyl sulfoxide reductase, a terminal electron transfer enzyme, was purified from anaerobically grown Escherichia coli harboring a plasmid which codes for dimethyl sulfoxide reductase. The enzyme was purified to greater than 90% homogeneity from cell envelopes by a three-step purification procedure involving extraction with the detergent Triton X-100, chromatofocusing, and DEAE ion-exchange chromatography. The purified enzyme was composed of three subunits with molecular weights of 82,600, 23,600, and 22,700 as identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The native molecular weight was determined by gel electrophoresis to be 155,000. The purified enzyme contained 7.5 atoms of iron and 0.34 atom of molybdenum per mol of enzyme. The presence of molybdopterin cofactor in dimethyl sulfoxide reductase was identified by reconstitution of cofactor-deficient NADPH nitrate reductase activity from Neurospora crassa nit-I mutant and by UV absorption and fluorescence emission spectra. The enzyme displayed a very broad substrate specificity, reducing various N-oxide and sulfoxide compounds as well as chlorate and hydroxylamine.

  5. Production of (R)-Ethyl-4-Chloro-3-Hydroxybutanoate Using Saccharomyces cerevisiae YOL151W Reductase Immobilized onto Magnetic Microparticles.

    PubMed

    Choo, Jin Woo; Kim, Hyung Kwoun

    2015-11-01

    For the synthesis of various pharmaceuticals, chiral alcohols are useful intermediates. Among them, (R)-ethyl-4-chloro-3-hydroxybutanoate ((R)-ECHB) is an important building block for the synthesis of L-carnitine. (R)-ECHB is produced from ethyl-4-chloro-3-oxobutanoate (ECOB) by a reductase-mediated, enantioselective reduction reaction. The Saccharomyces cerevisiae YOL151W reductase that is expressed in Escherichia coli cells exhibited an enantioselective reduction reaction toward ECOB. By virtue of the C-terminal His-tag, the YOL151W reductase was purified from the cell-free extract using Ni(2+)-NTA column chromatography and immobilized onto Ni(2+)-magnetic microparticles. The physical properties of the immobilized reductase (Imm-Red) were measured using electron microscopy, a magnetic property measurement system, and a zeta potential system; the average size of the particles was approximately 1 μm and the saturated magnetic value was 31.76 emu/g. A neodymium magnet was used to recover the immobilized enzyme within 2 min. The Imm-Red showed an optimum temperature at 45°C and an optimum pH at 6.0. In addition, Bacillus megaterium glucose dehydrogenase (GDH) was produced in the E. coli cells and was used in the coupling reaction to regenerate the NADPH cofactor. The reduction/oxidation coupling reaction composed of the Imm-Red and GDH converted 20 mM ECOB exclusively into (R)- ECHB with an e.e.p value of 98%.

  6. Molecular dissection of a putative iron reductase from Desulfotomaculum reducens MI-1

    SciTech Connect

    Li, Zhi; Kim, David D.; Nelson, Ornella D.; Otwell, Annie E.; Richardson, Ruth E.; Callister, Stephen J.; Lin, Hening

    2015-10-08

    Desulfotomaculum reducens MI-1 is a Firmicute strain capable of reducing a variety of heavy metal ions and has a great potential in heavy metal bioremediation.We recently identified Dred_2421 as a potential iron reductase through proteomic study of D. reducens. The current study examines its iron-reduction mechanism. Dred_2421, like its close homolog from Escherichia coli (2, 4-dienoyl-CoA reductase), has an FMN-binding N-terminal domain (NTD), an FAD-binding C-terminal domain (CTD), and a 4Fee4S cluster between the two domains. To understand the mechanism of the iron-reduction activity and the role of each domain, we generated a series of variants for each domain and investigated their iron reduction activity. Our results suggest that CTD is the main contributor of the iron-reduction activity, and that NTD and the 4Fee4S cluster are not directly involved in such activity. This study provides a mechanistic understanding of the ironereductase activity of Dred_2421 and may also help to elucidate other physiological activities this enzyme may have.

  7. Enrichment of Functional Redox Reactive Proteins and Identification by Mass Spectrometry Results in Several Terminal Fe(III)-reducing Candidate Proteins in Shewanella oneidensis MR-1.

    SciTech Connect

    Elias, Dwayne A.; Yang, Feng; Mottaz, Heather M.; Beliaev, Alex S.; Lipton, Mary S.

    2007-02-01

    Identification of the proteins directly involved in microbial metal-reduction is important to understanding the biochemistry involved in heavy metal reduction/immobilization and the ultimate cleanup of DOE contaminated sites. Although previous strategies for the identification of these proteins have traditionally required laborious protein purification/characterization of metal-reducing capability, activity is often lost before the final purification step, thus creating a significant knowledge gap. In the current study, subcellular fractions of S. oneidensis MR-1 were enriched for Fe(III)-NTA reducing proteins in a single step using several orthogonal column matrices. The protein content of eluted fractions that demonstrated activity were determined by ultra high pressure liquid chromatography coupled with tandem mass spectrometry (LCMS/ MS). A comparison of the proteins identified from active fractions in all separations produced 30 proteins that may act as the terminal electron-accepting protein for Fe(III)-reduction. These include MtrA, MtrB, MtrC and OmcA as well as a number of other proteins not previously associated with Fe(III)-reduction. This is the first report of such an approach where the laborious procedures for protein purification are not required for identification of metal-reducing proteins. Such work provides the basis for a similar approach with other cultured organisms as well as analysis of sediment and groundwater samples from biostimulation efforts at contaminated sites.

  8. Single-Cell Imaging and Spectroscopic Analyses of Cr(VI) Reduction on the Surface of Bacterial Cells

    SciTech Connect

    Wang, Yuanmin; Sevinc, Papatya C.; Belchik, Sara M.; Fredrickson, Jim K.; Shi, Liang; Lu, H. Peter

    2013-01-22

    We investigate single-cell reduction of toxic Cr(VI) by the dissimilatory metal-reducing bacterium Shewanella oneidensis MR-1 (MR-1), an important bioremediation process, using Raman spectroscopy and scanning electron microscopy (SEM) combined with energy-dispersive X-ray spectroscopy (EDX). Our experiments indicate that the toxic and highly soluble Cr(VI) can be efficiently reduced to the less toxic and non-soluble Cr2O3 nanoparticles by MR-1. Cr2O3 is observed to emerge as nanoparticles adsorbed on the cell surface and its chemical nature is identified by EDX imaging and Raman spectroscopy. Co-localization of Cr2O3 and cytochromes by EDX imaging and Raman spectroscopy suggests a terminal reductase role for MR-1 surface-exposed cytochromes MtrC and OmcA. Our experiments revealed that the cooperation of surface proteins OmcA and MtrC makes the reduction reaction most efficient, and the sequence of the reducing reactivity of the MR-1 is: wild type > single mutant @mtrC or mutant @omcA > double mutant (@omcA-@mtrC). Moreover, our results also suggest that the direct microbial Cr(VI) reduction and Fe(II) (hematite)-mediated Cr(VI) reduction mechanisms may co-exist in the reduction processes.

  9. Enzyme toolbox: novel enantiocomplementary imine reductases.

    PubMed

    Scheller, Philipp N; Fademrecht, Silvia; Hofelzer, Sebastian; Pleiss, Jürgen; Leipold, Friedemann; Turner, Nicholas J; Nestl, Bettina M; Hauer, Bernhard

    2014-10-13

    Reducing reactions are among the most useful transformations for the generation of chiral compounds in the fine-chemical industry. Because of their exquisite selectivities, enzymatic approaches have emerged as the method of choice for the reduction of C=O and activated C=C bonds. However, stereoselective enzymatic reduction of C=N bonds is still in its infancy-it was only recently described after the discovery of enzymes capable of imine reduction. In our work, we increased the spectrum of imine-reducing enzymes by database analysis. By combining the currently available knowledge about the function of imine reductases with the experimentally uncharacterized diversity stored in protein sequence databases, three novel imine reductases with complementary enantiopreference were identified along with amino acids important for catalysis. Furthermore, their reducing capability was demonstrated by the reduction of the pharmaceutically relevant prochiral imine 2-methylpyrroline. These novel enzymes exhibited comparable to higher catalytic efficiencies than previously described enzymes, and their biosynthetic potential is highlighted by the full conversion of 2-methylpyrroline in whole cells with excellent selectivities.

  10. Soluble ascorbate free radical reductase in the human lens.

    PubMed

    Bando, M; Obazawa, H

    1994-01-01

    A major and a minor ascorbate free radical (AFR) reductase were separated from the soluble fraction in the human lens cortex by DEAE-cellulose ion-exchange column chromatography. These AFR reductases also exhibited diaphorase activity using dichlorophenolindophenol and ferricyanide as electron acceptors. The major AFR reductase was partially purified by 5'AMP-Sepharose 4B affinity column chromatography. This partially purified AFR reductase showed a single band of diaphorase activity in native polyacrylamide disc gel electrophoresis. This activity band corresponded to the major protein observed in protein staining by Coomassie Brilliant Blue. However, the protein staining by Coomassie Brilliant Blue showed this activity band surrounded by diffused staining. Molecular weight of the partially purified AFR reductase was determined to be 32 kDa by gel filtration, and the apparent Km value for AFR was about 15 microM. This major lens AFR reductase could be distinguished from soluble Neurospora, Euglena and cucumber AFR reductases, and from two ubiquitous enzymes with reduction activity of AFR and/or foreign compounds, ie, NADH-cytochrome b5 reductase and DT-diaphorase, by their molecular weights, Km values and/or ion-exchange chromatographic behaviors.

  11. Circularly permuted dihydrofolate reductase possesses all the properties of the molten globule state, but can resume functional tertiary structure by interaction with its ligands.

    PubMed Central

    Uversky, V. N.; Kutyshenko, V. P.; Protasova NYu; Rogov, V. V.; Vassilenko, K. S.; Gudkov, A. T.

    1996-01-01

    It is obvious that functional activity of a protein molecule is closely related to its structure. On the other hand, the understanding of structure-function relationship still remains one of the intriguing problems of molecular biology. There is widespread belief that mutagenesis presents a real way to solve this problem. Following this assumption, we have investigated the effect of circular permutation in dihydrofolate reductase from E. coli on protein structure and functioning. It has been shown that in the absence of ligands two circularly permuted variants of dihydrofolate reductase possess all the properties of the molten globule state. However, after addition of ligands they gain the native-like structural properties and specific activity. This means that the in vitro folding of permuted dihydrofolate reductase is terminated at the stage of the molten globule formation. Interaction of permuted protein with ligands leads to the structural adjustment and formation of active protein molecules. PMID:8880908

  12. The crystal structure of NADPH:ferredoxin reductase from Azotobacter vinelandii.

    PubMed Central

    Sridhar Prasad, G.; Kresge, N.; Muhlberg, A. B.; Shaw, A.; Jung, Y. S.; Burgess, B. K.; Stout, C. D.

    1998-01-01

    NADPH:ferredoxin reductase (AvFPR) is involved in the response to oxidative stress in Azotobacter vinelandii. The crystal structure of AvFPR has been determined at 2.0 A resolution. The polypeptide fold is homologous with six other oxidoreductases whose structures have been solved including Escherichia coli flavodoxin reductase (EcFldR) and spinach, and Anabaena ferredoxin:NADP+ reductases (FNR). AvFPR is overall most homologous to EcFldR. The structure is comprised of a N-terminal six-stranded antiparallel beta-barrel domain, which binds FAD, and a C-terminal five-stranded parallel beta-sheet domain, which binds NADPH/NADP+ and has a classical nucleotide binding fold. The two domains associate to form a deep cleft where the NADPH and FAD binding sites are juxtaposed. The structure displays sequence conserved motifs in the region surrounding the two dinucleotide binding sites, which are characteristic of the homologous enzymes. The folded over conformation of FAD in AvFPR is similar to that in EcFldR due to stacking of Phe255 on the adenine ring of FAD, but it differs from that in the FNR enzymes, which lack a homologous aromatic residue. The structure of AvFPR displays three unique features in the environment of the bound FAD. Two features may affect the rate of reduction of FAD: the absence of an aromatic residue stacked on the isoalloxazine ring in the NADPH binding site; and the interaction of a carbonyl group with N10 of the flavin. Both of these features are due to the substitution of a conserved C-terminal tyrosine residue with alanine (Ala254) in AvFPR. An additional unique feature may affect the interaction of AvFPR with its redox partner ferredoxin I (FdI). This is the extension of the C-terminus by three residues relative to EcFldR and by four residues relative to FNR. The C-terminal residue, Lys258, interacts with the AMP phosphate of FAD. Consequently, both phosphate groups are paired with a basic group due to the simultaneous interaction of the FMN

  13. Thioredoxin and its reductase are present on synaptic vesicles, and their inhibition prevents the paralysis induced by botulinum neurotoxins.

    PubMed

    Pirazzini, Marco; Azarnia Tehran, Domenico; Zanetti, Giulia; Megighian, Aram; Scorzeto, Michele; Fillo, Silvia; Shone, Clifford C; Binz, Thomas; Rossetto, Ornella; Lista, Florigio; Montecucco, Cesare

    2014-09-25

    Botulinum neurotoxins consist of a metalloprotease linked via a conserved interchain disulfide bond to a heavy chain responsible for neurospecific binding and translocation of the enzymatic domain in the nerve terminal cytosol. The metalloprotease activity is enabled upon disulfide reduction and causes neuroparalysis by cleaving the SNARE proteins. Here, we show that the thioredoxin reductase-thioredoxin protein disulfide-reducing system is present on synaptic vesicles and that it is functional and responsible for the reduction of the interchain disulfide of botulinum neurotoxin serotypes A, C, and E. Specific inhibitors of thioredoxin reductase or thioredoxin prevent intoxication of cultured neurons in a dose-dependent manner and are also very effective inhibitors of the paralysis of the neuromuscular junction. We found that this group of inhibitors of botulinum neurotoxins is very effective in vivo. Most of them are nontoxic and are good candidates as preventive and therapeutic drugs for human botulism.

  14. ACTS Mobile Terminals

    NASA Technical Reports Server (NTRS)

    Abbe, Brian S.; Agan, Martin J.; Jedrey, Thomas C.

    1997-01-01

    The development of the Advanced Communications Technology Satellite (ACTS) Mobile Terminal (AMT) and its follow-on, the Broadband Aeronautical Terminal (BAT), have provided an excellent testbed for the evaluation of K- and Ka-band mobile satellite communications systems. An overview of both of these terminals is presented in this paper.

  15. Characterization of a New Type of Dissimilatory Sulfite Reductase Present in Thermodesulfobacterium commune

    PubMed Central

    Hatchikian, E. C.; Zeikus, J. G.

    1983-01-01

    A new type of dissimilatory bisulfite reductase, desulfofuscidin, was isolated from the nonsporeforming thermophilic sulfate-reducing microorganism Thermodesulfobacterium commune. The molecular weight of the enzyme was estimated at 167,000 by sedimentation equilibrium, and the protein was pure by both disc electrophoresis and ultracentrifugation. The bisulfite reductase was a tetramer and had two types of subunits with an α2β2 structure and an individual molecular weight of 47,000. The enzyme exhibited absorption maxima at 576, 389, and 279 nm, with a weak band at 693 nm. Upon the addition of dithionite, the absorption maxima at 576 and 693 nm were weakened, and a new band appeared at 605 nm. The protein reacted with CO in the presence of dithionite to give a complex with absorption peaks at 593, 548, and 395 nm. The extinction coefficients of the purified enzyme at 576, 389, and 279 nm were 89,000, 310,000, and 663,000 M−1 cm−1, respectively. Siroheme was detected as the prosthetic group. The protein contains 20 to 21 nonheme iron atoms and 16 to 17 acid-labile sulfur groups per molecule. The data suggest the presence of four sirohemes and probably four (4Fe-4S) centers per molecule by comparison with desulfoviridin, the dissimilatory sulfite reductase from Desulfovibrio species. The protein contains 36 cysteine residues and is high in acidic and aromatic amino acids. The N-terminal amino acids of the α and β subunits were threonine and serine, respectively. With reduced methyl viologen as electron donor, the major product of sulfite reduction was trithionate, and the pH optimum for activity was 6.0. The enzyme was stable to 70°C and denatured rapidly above this temperature. The dependence of T. commune bisulfite reductase activity on temperature was linear between 35 and 65°C, and the Q10 values observed were above 3. The presence of this new type of dissimilatory bisulfite reductase in T. commune is discussed in terms of taxonomic significance. PMID

  16. Nitrate reductases of Escherichia coli: sequence of the second nitrate reductase and comparison with that encoded by the narGHJI operon.

    PubMed

    Blasco, F; Iobbi, C; Ratouchniak, J; Bonnefoy, V; Chippaux, M

    1990-06-01

    The structural genes for NRZ, the second nitrate reductase of Escherichia coli, have been sequenced. They are organized in a transcription unit, narZYWV, encoding four subunits, NarZ, NarY, NarW and NarV. The transcription unit is homologous (73% identity) to the narGHJI operon which encodes the genes for NRA, the better characterized nitrate reductase of this organism. The level of homology between the corresponding polypeptides ranges from 69% for the NarW/NarJ pair to 86% for the NarV/NarI pair. The NarZ polypeptide contains the five conserved regions present in all other known molybdoproteins of E. coli and their relative order is the same. The NarY polypeptide, which contains the same four cysteine clusters in the same order as NarH, is probably an electron transfer unit of the complex. Upstream of narZ, an open reading frame, ORFA, is present which could encode a product which has homology (73% identity) with the COOH-terminal end of NarK. The ORFA-narZ intergenic region, however, is about 80 nucleotides long and does not contain the cis-acting elements, NarL and Fnr boxes, nor the terC4 terminator sequence present in the 500 nucleotide narK-narG intergenic region. This might explain why the narZYWV and the narGHJI operons are regulated differently. Our results tend to support the hypothesis that a DNA fragment larger than that encompassing the narGHJI genes has been duplicated.

  17. Transcripts of anthocyanidin reductase and leucoanthocyanidin reductase and measurement of catechin and epicatechin in tartary buckwheat.

    PubMed

    Kim, Yeon Bok; Thwe, Aye Aye; Kim, Yeji; Li, Xiaohua; Cho, Jin Woong; Park, Phun Bum; Valan Arasu, Mariadhas; Abdullah Al-Dhabi, Naif; Kim, Sun-Ju; Suzuki, Tastsuro; Hyun Jho, Kwang; Park, Sang Un

    2014-01-01

    Anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR) play an important role in the monomeric units biosynthesis of proanthocyanidins (PAs) such as catechin and epicatechin in several plants. The aim of this study was to clone ANR and LAR genes involved in PAs biosynthesis and examine the expression of these two genes in different organs under different growth conditions in two tartary buckwheat cultivars, Hokkai T8 and T10. Gene expression was carried out by quantitative real-time RT-PCR, and catechin and epicatechin content was analyzed by high performance liquid chromatography. The expression pattern of ANR and LAR did not match the accumulation pattern of PAs in different organs of two cultivars. Epicatechin content was the highest in the flowers of both cultivars and it was affected by light in only Hokkai T8 sprouts. ANR and LAR levels in tartary buckwheat might be regulated by different mechanisms for catechin and epicatechin biosynthesis under light and dark conditions.

  18. Docking and molecular dynamics studies at trypanothione reductase and glutathione reductase active sites.

    PubMed

    Iribarne, Federico; Paulino, Margot; Aguilera, Sara; Murphy, Miguel; Tapia, Orlando

    2002-05-01

    A theoretical docking study on the active sites of trypanothione reductase (TR) and glutathione reductase (GR) with the corresponding natural substrates, trypanothione disulfide (T[S]2) and glutathione disulfide (GSSG), is reported. Molecular dynamics simulations were carried out in order to check the robustness of the docking results. The energetic results are in agreement with previous experimental findings and show the crossed complexes have lower stabilization energies than the natural ones. To test DOCK3.5, four nitro furanic compounds, previously designed as potentially active anti-chagasic molecules, were docked at the GR and TR active sites with the DOCK3.5 procedure. A good correlation was found between differential inhibitory activity and relative interaction energy (affinity). The results provide a validation test for the use of DOCK3.5 in connection with the design of anti-chagasic drugs.

  19. Transcripts of Anthocyanidin Reductase and Leucoanthocyanidin Reductase and Measurement of Catechin and Epicatechin in Tartary Buckwheat

    PubMed Central

    Kim, Yeon Bok; Thwe, Aye Aye; Kim, YeJi; Li, Xiaohua; Cho, Jin Woong; Park, Phun Bum; Valan Arasu, Mariadhas; Abdullah Al-Dhabi, Naif; Kim, Sun-Ju; Suzuki, Tastsuro; Hyun Jho, Kwang; Park, Sang Un

    2014-01-01

    Anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR) play an important role in the monomeric units biosynthesis of proanthocyanidins (PAs) such as catechin and epicatechin in several plants. The aim of this study was to clone ANR and LAR genes involved in PAs biosynthesis and examine the expression of these two genes in different organs under different growth conditions in two tartary buckwheat cultivars, Hokkai T8 and T10. Gene expression was carried out by quantitative real-time RT-PCR, and catechin and epicatechin content was analyzed by high performance liquid chromatography. The expression pattern of ANR and LAR did not match the accumulation pattern of PAs in different organs of two cultivars. Epicatechin content was the highest in the flowers of both cultivars and it was affected by light in only Hokkai T8 sprouts. ANR and LAR levels in tartary buckwheat might be regulated by different mechanisms for catechin and epicatechin biosynthesis under light and dark conditions. PMID:24605062

  20. Oxygen-Insensitive Nitroreductases NfsA and NfsB of Escherichia coli Function under Anaerobic Conditions as Lawsone-Dependent Azo Reductases

    PubMed Central

    Rau, Jörg; Stolz, Andreas

    2003-01-01

    Quinones can function as redox mediators in the unspecific anaerobic reduction of azo compounds by various bacterial species. These quinones are enzymatically reduced by the bacteria and the resulting hydroquinones then reduce in a purely chemical redox reaction the azo compounds outside of the cells. Recently, it has been demonstrated that the addition of lawsone (2-hydroxy-1,4-naphthoquinone) to anaerobically incubated cells of Escherichia coli resulted in a pronounced increase in the reduction rates of different sulfonated and polymeric azo compounds. In the present study it was attempted to identify the enzyme system(s) responsible for the reduction of lawsone by E. coli and thus for the lawsone-dependent anaerobic azo reductase activity. An NADH-dependent lawsone reductase activity was found in the cytosolic fraction of the cells. The enzyme was purified by column chromatography and the amino-terminal amino acid sequence of the protein was determined. The sequence obtained was identical to the sequence of an oxygen-insensitive nitroreductase (NfsB) described earlier from this organism. Subsequent biochemical tests with the purified lawsone reductase activity confirmed that the lawsone reductase activity detected was identical with NfsB. In addition it was proven that also a second oxygen-insensitive nitroreductase of E. coli (NfsA) is able to reduce lawsone and thus to function under adequate conditions as quinone-dependent azo reductase. PMID:12788749

  1. Methylenetetrahydrofolate reductase: biochemical characterization and medical significance.

    PubMed

    Trimmer, Elizabeth E

    2013-01-01

    Methylenetetrahydrofolate reductase (MTHFR) catalyzes the reduction of 5,10-methylenetetrahydofolate (CH2-H4folate) to 5-methyltetrahydrofolate (CH3-H4folate). The enzyme employs a noncovalently-bound flavin adenine dinucleotide (FAD), which accepts reducing equivalents from NAD(P)H and transfers them to CH2-H4folate. The reaction provides the sole source of CH3-H4folate, which is utilized by methionine synthase in the synthesis of methionine from homocysteine. MTHFR plays a key role in folate metabolism and in the homeostasis of homocysteine; mutations in the enzyme lead to hyperhomocyst(e)inemia. A common C677T polymorphism in MTHFR has been associated with an increased risk for the development of cardiovascular disease, Alzheimer's disease, and depression in adults, and of neural tube defects in the fetus. The mutation also confers protection for certain types of cancers. This review presents the current knowledge of the enzyme, its biochemical characterization, and medical significance.

  2. Enhanced silver nanoparticle synthesis by optimization of nitrate reductase activity.

    PubMed

    Vaidyanathan, Ramanathan; Gopalram, Shubaash; Kalishwaralal, Kalimuthu; Deepak, Venkataraman; Pandian, Sureshbabu Ram Kumar; Gurunathan, Sangiliyandi

    2010-01-01

    Nanostructure materials are attracting a great deal of attention because of their potential for achieving specific processes and selectivity, especially in biological and pharmaceutical applications. The generation of silver nanoparticles using optimized nitrate reductase for the reduction of Ag(+) with the retention of enzymatic activity in the complex is being reported. This report involves the optimization of enzyme activity to bring about enhanced nanoparticle synthesis. Response surface methodology and central composite rotary design (CCRD) were employed to optimize a fermentation medium for the production of nitrate reductase by Bacillus licheniformis at pH 8. The four variables involved in the study of nitrate reductase were Glucose, Peptone, Yeast extract and KNO(3). Glucose had a significant effect on nitrate reductase production. The optimized medium containing (%) Glucose: 1.5, Peptone: 1, Yeast extract: 0.35 and KNO(3): 0.35 resulted in a nitrate reductase activity of 452.206 U/ml which is same as that of the central level. The medium A (showing least nitrate reductase activity) and the medium B (showing maximum nitrate reductase activity) were compared for the synthesis. Spectrophotometric analysis revealed that the particles exhibited a peak at 431 nm and the A(431) for the medium B was 2-fold greater than that of the medium A. The particles were also characterized using TEM. The particles synthesized using the optimized enzyme activity ranged from 10 to 80 nm and therefore can be extended to various medicinal applications.

  3. The structure of apo and holo forms of xylose reductase, a dimeric aldo-keto reductase from Candida tenuis.

    PubMed

    Kavanagh, Kathryn L; Klimacek, Mario; Nidetzky, Bernd; Wilson, David K

    2002-07-16

    Xylose reductase is a homodimeric oxidoreductase dependent on NADPH or NADH and belongs to the largely monomeric aldo-keto reductase superfamily of proteins. It catalyzes the first step in the assimilation of xylose, an aldose found to be a major constituent monosaccharide of renewable plant hemicellulosic material, into yeast metabolic pathways. It does this by reducing open chain xylose to xylitol, which is reoxidized to xylulose by xylitol dehydrogenase and metabolically integrated via the pentose phosphate pathway. No structure has yet been determined for a xylose reductase, a dimeric aldo-keto reductase or a family 2 aldo-keto reductase. The structures of the Candida tenuis xylose reductase apo- and holoenzyme, which crystallize in spacegroup C2 with different unit cells, have been determined to 2.2 A resolution and an R-factor of 17.9 and 20.8%, respectively. Residues responsible for mediating the novel dimeric interface include Asp-178, Arg-181, Lys-202, Phe-206, Trp-313, and Pro-319. Alignments with other superfamily members indicate that these interactions are conserved in other dimeric xylose reductases but not throughout the remainder of the oligomeric aldo-keto reductases, predicting alternate modes of oligomerization for other families. An arrangement of side chains in a catalytic triad shows that Tyr-52 has a conserved function as a general acid. The loop that folds over the NAD(P)H cosubstrate is disordered in the apo form but becomes ordered upon cosubstrate binding. A slow conformational isomerization of this loop probably accounts for the observed rate-limiting step involving release of cosubstrate. Xylose binding (K(m) = 87 mM) is mediated by interactions with a binding pocket that is more polar than a typical aldo-keto reductase. Modeling of xylose into the active site of the holoenzyme using ordered waters as a guide for sugar hydroxyls suggests a convincing mode of substrate binding.

  4. Detoxification of hexavalent chromium by Leucobacter sp. uses a reductase with specificity for dihydrolipoamide.

    PubMed

    Sarangi, Abhipsa; Krishnan, Chandraraj

    2016-02-01

    Leucobacter sp. belongs to the metal stressed community and possesses higher tolerance to metals including chromium and can detoxify toxic hexavalent chromium by reduction to less toxic trivalent chromium. But, the mechanism of reduction of hexavalent chromium by Leucobacter sp. has not been studied. Understanding the enzyme catalyzing reduction of chromium is important to improve the species for application in bioremediation. Hence, a soluble reductase catalyzing the reduction of hexavalent chromium was purified from a Leucobacter sp. and characterized. The pure chromate reductase was obtained from the cell-free extract through hydrophobic interaction and gel filtration column chromatographic methods. It was a monomeric enzyme and showed similar molecular weights in both gel filtration (∼68 KDa) and SDS-PAGE (64 KDa). It reduced Cr(VI) using both NADH and NADPH as the electron donor, but exhibited higher activity with NADH. The optimal activity was found at pH 5.5 and 30 °C. The K(m) and V(max) for Cr(VI) reduction with NADH were 46.57 μM and 0.37 μmol min(-1) (mg protein) (-1), respectively. The activity was inhibited by p-hydroxy mercury benzoate, Ag(2+) and Hg(2+) indicating the role of thiol groups in the catalysis. The spectrophotometric analysis of the purified enzyme showed the absence of bound flavin in the enzyme. The N-terminal amino acid sequence and LC/MS analysis of trypsin digested purified enzyme showed similarity to dihydrolipoyl dehydrogenase. The purified enzyme had dihydrolipoyl dehydrogenase activity with dihydrolipoamide as the substrate, which suggested that Leucobacter sp. uses reductase with multiple substrate specificity for reduction of Cr(VI) detoxification.

  5. Clostridium sticklandii glycine reductase selenoprotein A gene: cloning, sequencing, and expression in Escherichia coli.

    PubMed Central

    Garcia, G E; Stadtman, T C

    1992-01-01

    Gene grdA, which encodes selenoprotein A of the glycine reductase complex from Clostridium sticklandii, was identified and characterized. This gene encodes a protein of 158 amino acids with a calculated M(r) of 17,142. The known sequence of 15 amino acids around the selenocysteine residue and the known carboxy terminus of the protein are correctly predicted by the nucleotide sequence. An opal termination codon (TGA) corresponding to the location of the single selenocysteine residue in the polypeptide was found in frame at position 130. The C. sticklandii grdA gene was inserted behind the tac promotor of an Escherichia coli expression vector. An E. coli strain transformed with this vector produced an 18-kDa polypeptide that was not detected in extracts of nontransformed cells. Affinity-purified anti-C. sticklandii selenoprotein A immunoglobulin G reacted specifically with this polypeptide, which was indistinguishable from authentic C. sticklandii selenoprotein A by immunological analysis. Addition of the purified expressed protein to glycine reductase protein components B and C reconstituted the active glycine reductase complex. Although synthesis of enzymically active protein A depended on the presence of selenium in the growth medium, formation of immunologically reactive protein did not. Moreover, synthesis of enzymically active protein in a transformed E. coli selD mutant strain indicated that there is a nonspecific mechanism of selenocysteine incorporation. These findings imply that mRNA secondary structures of C. sticklandii grdA are not functional for UGA-directed selenocysteine insertion in the E. coli expression system. Images PMID:1429431

  6. Clostridium sticklandii glycine reductase selenoprotein A gene: cloning, sequencing, and expression in Escherichia coli.

    PubMed

    Garcia, G E; Stadtman, T C

    1992-11-01

    Gene grdA, which encodes selenoprotein A of the glycine reductase complex from Clostridium sticklandii, was identified and characterized. This gene encodes a protein of 158 amino acids with a calculated M(r) of 17,142. The known sequence of 15 amino acids around the selenocysteine residue and the known carboxy terminus of the protein are correctly predicted by the nucleotide sequence. An opal termination codon (TGA) corresponding to the location of the single selenocysteine residue in the polypeptide was found in frame at position 130. The C. sticklandii grdA gene was inserted behind the tac promotor of an Escherichia coli expression vector. An E. coli strain transformed with this vector produced an 18-kDa polypeptide that was not detected in extracts of nontransformed cells. Affinity-purified anti-C. sticklandii selenoprotein A immunoglobulin G reacted specifically with this polypeptide, which was indistinguishable from authentic C. sticklandii selenoprotein A by immunological analysis. Addition of the purified expressed protein to glycine reductase protein components B and C reconstituted the active glycine reductase complex. Although synthesis of enzymically active protein A depended on the presence of selenium in the growth medium, formation of immunologically reactive protein did not. Moreover, synthesis of enzymically active protein in a transformed E. coli selD mutant strain indicated that there is a nonspecific mechanism of selenocysteine incorporation. These findings imply that mRNA secondary structures of C. sticklandii grdA are not functional for UGA-directed selenocysteine insertion in the E. coli expression system.

  7. Structure of the detoxification catalyst mercuric ion reductase from Bacillus sp. strain RC607

    NASA Astrophysics Data System (ADS)

    Schiering, N.; Kabsch, W.; Moore, M. J.; Distefano, M. D.; Walsh, C. T.; Pai, E. F.

    1991-07-01

    SEVERAL hundred million tons of toxic mercurials are dispersed in the biosphere1. Microbes can detoxify organo-mercurials and mercury salts through sequential action of two enzymes, organomercury lyase2 and mercuric ion reductase (MerA) 3-5. The latter, a homodimer with homology to the FAD-dependent disulphide oxidoreductases6, catalyses the reaction NADPH + Hg(II) --> NADP+ + H+Hg(0), one of the very rare enzymic reactions with metal substrates. Human glutathione reductase7,8 serves as a reference molecule for FAD-dependent disulphide reductases and between its primary structure9 and that of MerA from Tn501 (Pseudomonas), Tn21 (Shigella), pI258 (Staphylococcus) and Bacillus, 25-30% of the residues have been conserved10,11. All MerAs have a C-terminal extension about 15 residues long but have very varied N termini. Although the enzyme from Streptomyces lividans has no addition, from Pseudomonas aeruginosa Tn5Ol and Bacillus sp. strain RC607 it has one and two copies respectively of a domain of 80-85 residues, highly homologous to MerP, the periplasmic component of proteins encoded by the mer operon11. These domains can be proteolytically cleaved off without changing the catalytic efficiency3. We report here the crystal structure of MerA from the Gram-positive bacterium Bacillus sp. strain RC607. Analysis of its complexes with nicotinamide dinucleotide substrates and the inhibitor Cd(II) reveals how limited structural changes enable an enzyme to accept as substrate what used to be a dangerous inhibitor. Knowledge of the mode of mercury ligation is a prerequisite for understanding this unique detoxification mechanism.

  8. Structure of the detoxification catalyst mercuric ion reductase from Bacillus sp. strain RC607.

    PubMed

    Schiering, N; Kabsch, W; Moore, M J; Distefano, M D; Walsh, C T; Pai, E F

    1991-07-11

    Several hundred million tons of toxic mercurials are dispersed in the biosphere. Microbes can detoxify organo-mercurials and mercury salts through sequential action of two enzymes, organomercury lyase and mercuric ion reductase (MerA). The latter, a homodimer with homology to the FAD-dependent disulphide oxidoreductases, catalyses the reaction NADPH + Hg(II)----NADP+ + H+ + Hg(0), one of the very rare enzymic reactions with metal substrates. Human glutathione reductase serves as a reference molecule for FAD-dependent disulphide reductases and between its primary structure and that of MerA from Tn501 (Pseudomonas), Tn21 (Shigella), p1258 (Staphylococcus) and Bacillus, 25-30% of the residues have been conserved. All MerAs have a C-terminal extension about 15 residues long but have very varied N termini. Although the enzyme from Streptomyces lividans has no addition, from Pseudomonas aeruginosa Tn501 and Bacillus sp. strain RC607 it has one and two copies respectively of a domain of 80-85 residues, highly homologous to MerP, the periplasmic component of proteins encoded by the mer operon. These domains can be proteolytically cleaved off without changing the catalytic efficiency. We report here the crystal structure of MerA from the Gram-positive bacterium Bacillus sp. strain RC607. Analysis of its complexes with nicotinamide dinucleotide substrates and the inhibitor Cd(II) reveals how limited structural changes enable an enzyme to accept as substrate what used to be a dangerous inhibitor. Knowledge of the mode of mercury ligation is a prerequisite for understanding this unique detoxification mechanism.

  9. Solubilization and Resolution of the Membrane-Bound Nitrite Reductase from Paracoccus Halodenitrificans into Nitrite and Nitric Oxide Reductases

    NASA Technical Reports Server (NTRS)

    Grant, Michael A.; Cronin, Sonja E.; Hochstein, Lawrence I.

    1984-01-01

    Membranes prepared from Paracoccus halodenitrificans reduced nitrite or nitric oxide to nitrous oxide. Extraction of these membranes with the detergent CHAPSO [3-(3-Chlolamidoporopyldimethylammonio)-1-(2- hydroxy-1-propanesulfonate)], followed by ammonium sulfate fractionation of the solubilized proteins, resulted in the separation of nitrite and nitric oxide reductase activities. The fraction containing nitrite reductase activity spectrally resembled a cd-type cytochrome. Several cytochromes were detected in the nitric oxide reductase fraction. Which, if any, of these cytochromes is associated with the reduction of nitric oxide is not clear at this time.

  10. Terminal automation system maintenance

    SciTech Connect

    Coffelt, D.; Hewitt, J.

    1997-01-01

    Nothing has improved petroleum product loading in recent years more than terminal automation systems. The presence of terminal automation systems (TAS) at loading racks has increased operational efficiency and safety and enhanced their accounting and management capabilities. However, like all finite systems, they occasionally malfunction or fail. Proper servicing and maintenance can minimize this. And in the unlikely event a TAS breakdown does occur, prompt and effective troubleshooting can reduce its impact on terminal productivity. To accommodate around-the-clock loading at racks, increasingly unattended by terminal personnel, TAS maintenance, servicing and troubleshooting has become increasingly demanding. It has also become increasingly important. After 15 years of trial and error at petroleum and petrochemical storage and transfer terminals, a number of successful troubleshooting programs have been developed. These include 24-hour {open_quotes}help hotlines,{close_quotes} internal (terminal company) and external (supplier) support staff, and {open_quotes}layered{close_quotes} support. These programs are described.

  11. Enantioselective imine reduction catalyzed by imine reductases and artificial metalloenzymes.

    PubMed

    Gamenara, Daniela; Domínguez de María, Pablo

    2014-05-21

    Adding value to organic synthesis. Novel imine reductases enable the enantioselective reduction of imines to afford optically active amines. Likewise, novel bioinspired artificial metalloenzymes can perform the same reaction as well. Emerging proof-of-concepts are herein discussed.

  12. Exploration of Nitrate Reductase Metabolic Pathway in Corynebacterium pseudotuberculosis

    PubMed Central

    Abreu, Vinícius; Diniz, Carlos; Dorneles, Elaine M. S.; Barh, Debmalya

    2017-01-01

    Based on the ability of nitrate reductase synthesis, Corynebacterium pseudotuberculosis is classified into two biovars: Ovis and Equi. Due to the presence of nitrate reductase, the Equi biovar can survive in absence of oxygen. On the other hand, Ovis biovar that does not have nitrate reductase is able to adapt to various ecological niches and can grow on certain carbon sources. Apart from these two biovars, some other strains are also able to carry out the reduction of nitrate. The enzymes that are involved in electron transport chain are also identified by in silico methods. Findings about pathogen metabolism can contribute to the identification of relationship between nitrate reductase and the C. pseudotuberculosis pathogenicity, virulence factors, and discovery of drug targets. PMID:28316974

  13. 21 CFR 864.7375 - Glutathione reductase assay.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... activity of the enzyme glutathione reductase in serum, plasma, or erythrocytes by such techniques as fluorescence and photometry. The results of this assay are used in the diagnosis of liver disease,...

  14. Characterization of the lys2 gene of Penicillium chrysogenum encoding alpha-aminoadipic acid reductase.

    PubMed

    Casqueiro, J; Gutiérrez, S; Bañuelos, O; Fierro, F; Velasco, J; Martín, J F

    1998-09-01

    A DNA fragment containing a gene homologous to LYS2 gene of Saccharomyces cerevisiae was cloned from a genomic DNA library of Penicillium chrysogenum AS-P-78. It encodes a protein of 1409 amino acids (Mr 154859) with strong similarity to the S. cerevisiae (49.9% identity) Schizosaccharomyces pombe (51.3% identity) and Candida albicans (48.12% identity) alpha-aminoadipate reductases and a lesser degree of identity to the amino acid-activating domains of the non-ribosomal peptide synthetases, including the alpha-aminoadipate-activating domain of the alpha-aminoadipyl-cysteinyl-valine synthetase of P. chrysogenum (12.4% identical amino acids). The lys2 gene contained one intron in the 5'-region and other in the 3'-region, as shown by comparing the nucleotide sequences of the cDNA and genomic DNA, and was transcribed as a 4.7-kb monocistronic mRNA. The lys2 gene was localized on chromosome III (7.5 Mb) in P. chrysogenum AS-P-78 and on chromosome IV (5.6 Mb) in strain P2, whereas the penicillin gene cluster is known to be located in chromosome I in both strains. The lys2-encoded protein is a member of the aminoacyladenylate-forming enzyme family with a reductase domain in its C-terminal region.

  15. Purification and characterization of assimilatory nitrite reductase from Candida utilis.

    PubMed

    Sengupta, S; Shaila, M S; Rao, G R

    1996-07-01

    Nitrate assimilation in many plants, algae, yeasts and bacteria is mediated by two enzymes, nitrate reductase (EC 1.6.6.2) and nitrite reductase (EC 1.7.7.1). They catalyse the stepwise reduction of nitrate to nitrite and nitrite to ammonia respectively. The nitrite reductase from an industrially important yeast, Candida utilis, has been purified to homogeneity. Purified nitrite reductase is a heterodimer and the molecular masses of the two subunits are 58 and 66 kDa. The native enzyme exhibits a molecular mass of 126 kDa as analysed by gel filtration. The identify of the two subunits of nitrite reductase was confirmed by immunoblotting using antibody for Cucurbita pepo leaf nitrite reductase. The presence of two different sized transcripts coding for the two subunits was confirmed by (a) in vitro translation of mRNA from nitrate-induced C. utilis followed by immunoprecipitation of the in vitro translated products with heterologous nitrite reductase antibody and (b) Northern-blot analysis. The 66 kDa subunit is acidic in nature which is probably due to its phosphorylated status. The enzyme is stable over a range of temperatures. Both subunits can catalyse nitrite reduction, and the reconstituted enzyme, at a higher protein concentration, shows an activity similar to that of the purified enzyme. Each of these subunits has been shown to contain a few unique peptides in addition to a large number of common peptides. Reduced Methyl Viologen has been found to be as effective an electron donor as NADPH in the catalytic process, a phenomenon not commonly seen for nitrite reductases from other systems.

  16. Molybdenum effector of fumarate reductase repression and nitrate reductase induction in Escherichia coli.

    PubMed Central

    Iuchi, S; Lin, E C

    1987-01-01

    In Escherichia coli the presence of nitrate prevents the utilization of fumarate as an anaerobic electron acceptor. The induction of the narC operon encoding the nitrate reductase is coupled to the repression of the frd operon encoding the fumarate reductase. This coupling is mediated by nitrate as an effector and the narL product as the regulatory protein (S. Iuchi and E. C. C. Lin, Proc. Natl. Acad. Sci. USA 84:3901-3905, 1987). The protein-ligand complex appears to control narC positively but frd negatively. In the present study we found that a molybdenum coeffector acted synergistically with nitrate in the regulation of frd and narC. In chlD mutants believed to be impaired in molybdate transport (or processing), full repression of phi(frd-lac) and full induction of phi(narC-lac) by nitrate did not occur unless the growth medium was directly supplemented with molybdate (1 microM). This requirement was not clearly manifested in wild-type cells, apparently because it was met by the trace quantities of molybdate present as a contaminant in the mineral medium. In chlB mutants, which are known to accumulate the Mo cofactor because of its failure to be inserted as a prosthetic group into proteins such as nitrate reductase, nitrate repression of frd and induction of narC were also intensified by molybdate supplementation. In this case a deficiency of the molybdenum coeffector might have resulted from enhanced feedback inhibition of molybdate transport (or processing) by the elevated level of the unutilized Mo cofactor. In addition, mutations in chlE, which are known to block the synthesis of the organic moiety of the Mo cofactor, lowered the threshold concentration of nitrate (< 1 micromole) necessary for frd repression and narC induction. These changes could be explained simply by the higher intracellular nitrate attainable in cells lacking the ability to destroy the effector. PMID:3301812

  17. Distribution of Prx-linked hydroperoxide reductase activity among microorganisms.

    PubMed

    Takeda, Kouji; Nishiyama, Yoshitaka; Yoda, Koji; Watanabe, Toshihiro; Nimura-Matsune, Kaori; Mura, Kiyoshi; Tokue, Chiyoko; Katoh, Tetzuya; Kawasaki, Shinji; Niimura, Youichi

    2004-01-01

    Peroxiredoxin (Prx) constitutes a large family of enzymes found in microorganisms, animals, and plants, but the detection of the activities of Prx-linked hydroperoxide reductases (peroxiredoxin reductases) in cell extracts, and the purification based on peroxide reductase activity, have only been done in bacteria and Trypanosomatidae. A peroxiredoxin reductase (NADH oxidase) from a bacterium, Amphibacillus, displayed only poor activities in the presence of purified Prx from Saccharomyces or Synechocystis, while it is highly active in the presence of bacterial Prx. These results suggested that an enzyme system different from that in bacteria might exist for the reduction of Prx in yeast and cyanobacteria. Prx-linked hydroperoxide reductase activities were detected in cell extracts of Saccharomyces, Synechocystis, and Chlorella, and the enzyme activities of Saccharomyces and Chlorella were induced under vigorously aerated culture conditions and intensive light exposure conditions, respectively. Partial purification of Prx-linked peroxidase from the induced yeast cells indicated that the Prx-linked peroxidase system consists of two protein components, namely, thioredoxin and thioredoxin reductase. This finding is consistent with the previous report on its purification based on its protein protection activity against oxidation [Chae et al., J. Biol. Chem., 269, 27670-27678 (1994)]. In this study we have confirmed that Prx-linked peroxidase activity are widely distributed, not only in bacteria species and Trypanosomatidae, but also in yeast and photosynthetic microorganisms, and showed reconstitution of the activity from partially purified interspecies components.

  18. Carbon-carbon double-bond reductases in nature.

    PubMed

    Huang, Minmin; Hu, Haihong; Ma, Li; Zhou, Quan; Yu, Lushan; Zeng, Su

    2014-08-01

    Reduction of C = C bonds by reductases, found in a variety of microorganisms (e.g. yeasts, bacteria, and lower fungi), animals, and plants has applications in the production of metabolites that include pharmacologically active drugs and other chemicals. Therefore, the reductase enzymes that mediate this transformation have become important therapeutic targets and biotechnological tools. These reductases are broad-spectrum, in that, they can act on isolation/conjugation C = C-bond compounds, α,β-unsaturated carbonyl compounds, carboxylic acids, acid derivatives, and nitro compounds. In addition, several mutations in the reductase gene have been identified, some associated with diseases. Several of these reductases have been cloned and/or purified, and studies to further characterize them and determine their structure in order to identify potential industrial biocatalysts are still in progress. In this study, crucial reductases for bioreduction of C = C bonds have been reviewed with emphasis on their principal substrates and effective inhibitors, their distribution, genetic polymorphisms, and implications in human disease and treatment.

  19. Targeting and topology in the membrane of plant 3-hydroxy-3-methylglutaryl coenzyme A reductase.

    PubMed Central

    Campos, N; Boronat, A

    1995-01-01

    The enzyme 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) catalyzes the synthesis of mevalonate. This is the first committed step of isoprenoid biosynthesis. A common feature of all known plant HMGR isoforms is the presence of two highly conserved hydrophobic sequences in the N-terminal quarter of the protein. Using an in vitro system, we showed that the two hydrophobic sequences of Arabidopsis HMGR1S function as internal signal sequences. Specific recognition of these sequences by the signal recognition particle mediates the targeting of the protein to microsomes derived from the endoplasmic reticulum. Arabidopsis HMGR is inserted into the microsomal membrane, and the two hydrophobic sequences become membrane-spanning segments. The N-terminal end and the C-terminal catalytic domain of Arabidopsis HMGR are positioned on the cytosolic side of the membrane, whereas only a short hydrophilic sequence is exposed to the lumen. Our results suggest that the plant HMGR isoforms known to date are primarily targeted to the endoplasmic reticulum and have the same topology in the membrane. This reinforces the hypothesis that mevalonate is synthesized only in the cytosol. The possibility that plant HMGRs might be located in different regions of the endomembrane system is discussed. PMID:8718626

  20. Microsecond subdomain folding in dihydrofolate reductase.

    PubMed

    Arai, Munehito; Iwakura, Masahiro; Matthews, C Robert; Bilsel, Osman

    2011-07-08

    The characterization of microsecond dynamics in the folding of multisubdomain proteins has been a major challenge in understanding their often complex folding mechanisms. Using a continuous-flow mixing device coupled with fluorescence lifetime detection, we report the microsecond folding dynamics of dihydrofolate reductase (DHFR), a two-subdomain α/β/α sandwich protein known to begin folding in this time range. The global dimensions of early intermediates were monitored by Förster resonance energy transfer, and the dynamic properties of the local Trp environments were monitored by fluorescence lifetime detection. We found that substantial collapse occurs in both the locally connected adenosine binding subdomain and the discontinuous loop subdomain within 35 μs of initiation of folding from the urea unfolded state. During the fastest observable ∼550 μs phase, the discontinuous loop subdomain further contracts, concomitant with the burial of Trp residue(s), as both subdomains achieve a similar degree of compactness. Taken together with previous studies in the millisecond time range, a hierarchical assembly of DHFR--in which each subdomain independently folds, subsequently docks, and then anneals into the native conformation after an initial heterogeneous global collapse--emerges. The progressive acquisition of structure, beginning with a continuously connected subdomain and spreading to distal regions, shows that chain entropy is a significant organizing principle in the folding of multisubdomain proteins and single-domain proteins. Subdomain folding also provides a rationale for the complex kinetics often observed.

  1. narI region of the Escherichia coli nitrate reductase (nar) operon contains two genes.

    PubMed Central

    Sodergren, E J; DeMoss, J A

    1988-01-01

    In previous studies it has been established that in Escherichia coli the three known subunits of anaerobic nitrate reductase are encoded by the narGHI operon. From the nucleotide sequence of the narI region of the operon we conclude that, in addition to the narG and narH genes, the nar operon contains two other open reading frames (ORFs), ORF1 and ORF2, that encode proteins of 26.5 and 25.5 kilodaltons, respectively. Protein fusions to each of the genes in the operon showed that expression of all four genes was similarly regulated. The reading frames of ORF1 and ORF2 were verified, and the N-terminal sequence for the ORF1 fusion protein was determined. The nar operon therefore contains four genes designated and ordered as narGHJI. Images PMID:2832376

  2. Expanding the Imine Reductase Toolbox by Exploring the Bacterial Protein-Sequence Space.

    PubMed

    Wetzl, Dennis; Berrera, Marco; Sandon, Nicolas; Fishlock, Dan; Ebeling, Martin; Müller, Michael; Hanlon, Steven; Wirz, Beat; Iding, Hans

    2015-08-17

    Recent investigations on imine reductases (IREDs) have enriched the toolbox of potential catalysts for accessing chiral amines, which are important building blocks for the pharmaceutical industry. Herein, we describe the characterization of 20 new IREDs. A C-terminal domain clustering of the bacterial protein-sequence space was performed to identify the novel IRED candidates. Each of the identified enzymes was characterized against a set of nine cyclic imine model substrates. A refined clustering towards putative active-site residues was performed and was consistent both with our screening and previously reported results. Finally, preparative scale experiments on a 100 mg scale with two purified IREDs, IR_20 from Streptomyces tsukubaensis and IR_23 from Streptomyces vidiochromogenes, were carried out to provide (R)-2-methylpiperidine in 98% ee (71% yield) and (R)-1-methyl-1,2,3,4-tetrahydroisoquinoline in >98% ee (82% yield).

  3. Superconducting Cable Termination

    DOEpatents

    Sinha, Uday K.; Tolbert, Jerry

    2005-08-30

    Disclosed is a termination that connects high temperature superconducting (HTS) cable immersed in pressurized liquid nitrogen to high voltage and neutral (shield) external bushings at ambient temperature and pressure. The termination consists of a splice between the HTS power (inner) and shield (outer) conductors and concentric copper pipes which are the conductors in the termination. There is also a transition from the dielectric tape insulator used in the HTS cable to the insulators used between and around the copper pipe conductors in the termination. At the warm end of the termination the copper pipes are connected via copper braided straps to the conventional warm external bushings which have low thermal stresses. This termination allows for a natural temperature gradient in the copper pipe conductors inside the termination which enables the controlled flashing of the pressurized liquid coolant (nitrogen) to the gaseous state. Thus the entire termination is near the coolant supply pressure and the high voltage and shield cold bushings, a highly stressed component used in most HTS cables, are eliminated. A sliding seal allows for cable contraction as it is cooled from room temperature to ˜72-82 K. Seals, static vacuum, and multi-layer superinsulation minimize radial heat leak to the environment.

  4. Aldose reductase expression as a risk factor for cataract.

    PubMed

    Snow, Anson; Shieh, Biehuoy; Chang, Kun-Che; Pal, Arttatrana; Lenhart, Patricia; Ammar, David; Ruzycki, Philip; Palla, Suryanarayana; Reddy, G Bhanuprakesh; Petrash, J Mark

    2015-06-05

    Aldose reductase (AR) is thought to play a role in the pathogenesis of diabetic eye diseases, including cataract and retinopathy. However, not all diabetics develop ocular complications. Paradoxically, some diabetics with poor metabolic control appear to be protected against retinopathy, while others with a history of excellent metabolic control develop severe complications. These observations indicate that one or more risk factors may influence the likelihood that an individual with diabetes will develop cataracts and/or retinopathy. We hypothesize that an elevated level of AR gene expression could confer higher risk for development of diabetic eye disease. To investigate this hypothesis, we examined the onset and severity of diabetes-induced cataract in transgenic mice, designated AR-TG, that were either heterozygous or homozygous for the human AR (AKR1B1) transgene construct. AR-TG mice homozygous for the transgene demonstrated a conditional cataract phenotype, whereby they developed lens vacuoles and cataract-associated structural changes only after induction of experimental diabetes; no such changes were observed in AR-TG heterozygotes or nontransgenic mice with or without experimental diabetes induction. We observed that nondiabetic AR-TG mice did not show lens structural changes even though they had lenticular sorbitol levels almost as high as the diabetic AR-TG lenses that showed early signs of cataract. Over-expression of AR led to increases in the ratio of activated to total levels of extracellular signal-regulated kinase (ERK1/2) and c-Jun N-terminal (JNK1/2), which are known to be involved in cell growth and apoptosis, respectively. After diabetes induction, AR-TG but not WT controls had decreased levels of phosphorylated as well as total ERK1/2 and JNK1/2 compared to their nondiabetic counterparts. These results indicate that high AR expression in the context of hyperglycemia and insulin deficiency may constitute a risk factor that could predispose the

  5. Sulfite reductase protects plants against sulfite toxicity.

    PubMed

    Yarmolinsky, Dmitry; Brychkova, Galina; Fluhr, Robert; Sagi, Moshe

    2013-02-01

    Plant sulfite reductase (SiR; Enzyme Commission 1.8.7.1) catalyzes the reduction of sulfite to sulfide in the reductive sulfate assimilation pathway. Comparison of SiR expression in tomato (Solanum lycopersicum 'Rheinlands Ruhm') and Arabidopsis (Arabidopsis thaliana) plants revealed that SiR is expressed in a different tissue-dependent manner that likely reflects dissimilarity in sulfur metabolism between the plant species. Using Arabidopsis and tomato SiR mutants with modified SiR expression, we show here that resistance to ectopically applied sulfur dioxide/sulfite is a function of SiR expression levels and that plants with reduced SiR expression exhibit higher sensitivity than the wild type, as manifested in pronounced leaf necrosis and chlorophyll bleaching. The sulfite-sensitive mutants accumulate applied sulfite and show a decline in glutathione levels. In contrast, mutants that overexpress SiR are more tolerant to sulfite toxicity, exhibiting little or no damage. Resistance to high sulfite application is manifested by fast sulfite disappearance and an increase in glutathione levels. The notion that SiR plays a role in the protection of plants against sulfite is supported by the rapid up-regulation of SiR transcript and activity within 30 min of sulfite injection into Arabidopsis and tomato leaves. Peroxisomal sulfite oxidase transcripts and activity levels are likewise promoted by sulfite application as compared with water injection controls. These results indicate that, in addition to participating in the sulfate assimilation reductive pathway, SiR also plays a role in protecting leaves against the toxicity of sulfite accumulation.

  6. Flight Termination Criteria

    NASA Astrophysics Data System (ADS)

    Haber, Jerold M.; Larson, Erik

    2013-09-01

    The first line of defense in protecting the public against the threat of injury from a failing space booster is the flight termination system. Consequently, these systems must be highly reliable and the criteria for flight termination must be carefully formulated. Criteria must be developed based on observable data that allows adequate time for the data to be assessed and a flight termination action to be triggered. Criteria should be set so that 1) the chance a good vehicle will be terminated is small, 2) the chance of failing to terminate an errant vehicle before it can hazard population centers or valuable assets is minimal, and 3) there is assurance that the combination of the planned trajectory and mission rules do not induce excessive risks to land based populations, air lanes, and shipping lanes should the vehicle need to be terminated [1].This paper provides an overview of the approaches to developing and implement flight termination criteria and a tool for understanding risk implications of proposed criteria.

  7. Terminal supraparticle assemblies from similarly charged protein molecules and nanoparticles

    NASA Astrophysics Data System (ADS)

    Park, Jai Il; Nguyen, Trung Dac; de Queirós Silveira, Gleiciani; Bahng, Joong Hwan; Srivastava, Sudhanshu; Zhao, Gongpu; Sun, Kai; Zhang, Peijun; Glotzer, Sharon C.; Kotov, Nicholas A.

    2014-05-01

    Self-assembly of proteins and inorganic nanoparticles into terminal assemblies makes possible a large family of uniformly sized hybrid colloids. These particles can be compared in terms of utility, versatility and multifunctionality to other known types of terminal assemblies. They are simple to make and offer theoretical tools for designing their structure and function. To demonstrate such assemblies, we combine cadmium telluride nanoparticles with cytochrome C protein and observe spontaneous formation of spherical supraparticles with a narrow size distribution. Such self-limiting behaviour originates from the competition between electrostatic repulsion and non-covalent attractive interactions. Experimental variation of supraparticle diameters for several assembly conditions matches predictions obtained in simulations. Similar to micelles, supraparticles can incorporate other biological components as exemplified by incorporation of nitrate reductase. Tight packing of nanoscale components enables effective charge and exciton transport in supraparticles and bionic combination of properties as demonstrated by enzymatic nitrate reduction initiated by light absorption in the nanoparticle.

  8. Terminal Supraparticle Assemblies from Similarly Charged Protein Molecules and Nanoparticles

    PubMed Central

    Park, Jai Il; Nguyen, Trung Dac; de Queirós Silveira, Gleiciani; Bahng, Joong Hwan; Srivastava, Sudhanshu; Sun, Kai; Zhao, Gongpu; Zhang, Peijun; Glotzer, Sharon C.; Kotov, Nicholas A.

    2015-01-01

    Self-assembly of proteins and inorganic nanoparticles into terminal assemblies makes possible a large family of uniformly sized hybrid colloids. These particles can be compared in terms of utility, versatility and multifunctionality to other known types of terminal assemblies. They are simple to make and offer theoretical tools for designing their structure and function. To demonstrate such assemblies, we combine cadmium telluride nanoparticles with cytochrome C protein and observe spontaneous formation of spherical supraparticles with a narrow size distribution. Such self-limiting behaviour originates from the competition between electrostatic repulsion and non-covalent attractive interactions. Experimental variation of supraparticle diameters for several assembly conditions matches predictions obtained in simulations. Similar to micelles, supraparticles can incorporate other biological components as exemplified by incorporation of nitrate reductase. Tight packing of nanoscale components enables effective charge and exciton transport in supraparticles as demonstrated by enzymatic nitrate reduction initiated by light absorption in the nanoparticle. PMID:24845400

  9. Phenylethynyl terminated imide oligomers

    NASA Technical Reports Server (NTRS)

    Hergenrother, Paul M. (Inventor); Bryant, Robert G. (Inventor); Jensen, Brian J. (Inventor); Havens, Stephen J. (Inventor)

    1995-01-01

    Four phenylethynyl amine compounds - 3 and 4-aminophenoxy-4'-phenylethynylbenzophenone, and 3 and 4-amino-4'-phenylethynylbenzophenone - were readily prepared and were used to endcap imide oligomers. Phenylethynyl-terminated amide acid oligomers and phenylethynyl-terminated imide oligomers with various molecular weights and compositions were prepared and characterized. These oligomers were cured at 300 to 400 C to provide crosslinked polyimides with excellent solvent resistance, high strength and modulus, and good high temperature properties. Adhesive panels, composites, films, and moldings from these phenylethynyl terminated imide oligomers gave excellent mechanical performance.

  10. Nonleaking battery terminals

    NASA Technical Reports Server (NTRS)

    Snider, W. E.; Nagle, W. J.

    1972-01-01

    Three different terminals were designed for usage in a 40 ampere/hour silver zinc battery which has a 45 percent KOH by weight electrolyte in a plastic battery case. Life tests, including thermal cycling, electrical charge and discharge for up to three years duration, were conducted on these three different terminal designs. Tests for creep rate and tensile strength were conducted on the polyphenylene oxide (PPO) plastic battery cases. Some cases were unused and others containing KOH electrolyte were placed on life tests. The design and testing of nonleaking battery terminals for use with a potassium hydroxide (KOH) electrolyte in a plastic case are discussed.

  11. Nonleaking battery terminals.

    NASA Technical Reports Server (NTRS)

    Snider, W. E.; Nagle, W. J.

    1972-01-01

    Three different terminals were designed for usage in a 40 ampere/hour silver zinc battery which has a 45% KOH by weight electrolyte in a plastic battery case. Life tests, including thermal cycling, electrical charge and discharge for up to three years duration, were conducted on these three different terminal designs. Tests for creep rate and tensile strength were conducted on the polyphenylene oxide plastic battery cases. Some cases were unused and others containing KOH electrolyte were placed on life tests. The design and testing of nonleaking battery terminals for use with a KOH electrolyte in a plastic case are considered.

  12. Intimacy and terminal care

    PubMed Central

    Gilley, Judy

    1988-01-01

    Four cases are summarized in which the general practitioner is involved in the terminal care of one partner of a stable marital relationship. The need to conceptualize the expectations of the patient, the family and the doctor in terminal care is stressed. An attempt is made to illustrate how the quality of the pre-existing sexual relationship, the dying person's own sexuality, and ultimately the capacity for physical expression of intimacy in the marriage profoundly influence choices in terminal care and the quality of dying. PMID:3204583

  13. Uterine glutathione reductase activity: modulation by estrogens and progesterone.

    PubMed

    Díaz-Flores, M; Baiza-Gutman, L A; Pedrón, N N; Hicks, J J

    1999-10-29

    The aim of this study was to determine whether glutathione reductase activity in uterine tissue is regulated by sex hormones. In spayed rats uterine glutathione reductase was significantly increased by exogenous estrogen (P< 0.01), progesterone (P< 0.01) or estrogen plus progesterone (P<0.01). When enzyme activity is expressed per mg protein, daily administration of estrogen or progesterone induces a progressive increase of this enzyme between 24 to 48 h or 24 to 72 h of treatment, respectively. Whereas the combination of both steroids causes an earlier and higher increase in glutathione reductase activity at 24 h of treatment. Estradiol singly or in combination with progesterone induced the highest protein concentration in the uterus. Whereas uterine DNA concentration is only significantly affected by estradiol. Our results suggest that uterine glutathione reductase is regulated by estradiol and progesterone and may be involved in maintaining levels of reduced glutathione in the uterus. This compound may be required for control of the redox state of thiol groups and in detoxification reactions involving H2O2 and electrophylic substances. The antioxidant action of estrogens is partially due to the stimulation of glutathione reductase.

  14. HMG-CoA reductase guides migrating primordial germ cells.

    PubMed

    Van Doren, M; Broihier, H T; Moore, L A; Lehmann, R

    1998-12-03

    The enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase is best known for catalysing a rate-limiting step in cholesterol biosynthesis, but it also participates in the production of a wide variety of other compounds. Some clinical benefits attributed to inhibitors of HMG-CoA reductase are now thought to be independent of any serum cholesterol-lowering effect. Here we describe a new cholesterol-independent role for HMG-CoA reductase, in regulating a developmental process: primordial germ cell migration. We show that in Drosophila this enzyme is highly expressed in the somatic gonad and that it is necessary for primordial germ cells to migrate to this tissue. Misexpression of HMG-CoA reductase is sufficient to attract primordial germ cells to tissues other than the gonadal mesoderm. We conclude that the regulated expression of HMG-CoA reductase has a critical developmental function in providing spatial information to guide migrating primordial germ cells.

  15. Bacterial morphinone reductase is related to Old Yellow Enzyme.

    PubMed Central

    French, C E; Bruce, N C

    1995-01-01

    Morphinone reductase, produced by Pseudomonas putida M10, catalyses the NADH-dependent saturation of the carbon-carbon double bond of morphinone and codeinone, and is believed to be involved in the metabolism of morphine and codeine. The structural gene encoding morphinone reductase, designated morB, was cloned from Ps. putida M10 genomic DNA by the use of degenerate oligonucleotide probes based on elements of the amino acid sequence of the purified enzyme. Sequence analysis and structural characteristics indicated that morphinone reductase is related to the flavoprotein alpha/beta-barrel oxidoreductases, and is particularly similar to Old Yellow Enzyme of Saccharomyces spp. and the related oestrogen-binding protein of Candida albicans. Expressed sequence tags from several plant species show high homology to these enzymes, suggesting the presence of a family of enzymes conserved in plants and fungi. Although related bacterial proteins are known, morphinone reductase appears to be more similar to the eukaryotic proteins. Morphinone reductase was overexpressed in Escherichia coli, and has potential applications for the industrial preparation of semisynthetic opiates. Images Figure 1 Figure 5 PMID:8554504

  16. Purification and properties of proline reductase from Clostridium sticklandii.

    PubMed

    Seto, B; Stadtman, T C

    1976-04-25

    Proline reductase of Clostridium sticklandii is a membrane-bound protein and is released by treatment with detergents. The enzyme has been purified to homogeneity and is estimated by gel filtration and sedimentation equilibrium centrifugation to have a molecular weight of 298,000 to 327,000. A minimum molecular weight of 30,000 to 31,000 was calculated on the basis of sodium dodecyl sulfate-acrylamide gel electrophoresis and amino acid composition. Amino acid analysis showed a preponderance of acidic amino acids. No tryptophan was detected in the protein either spectrophotometrically or by amino acid analysis. A total of 20 sulfhydryl groups measured by titration of the reduced protein with 5,5'-dithiobis(2-nitrobenzoic acid) is in agreement with 20 cystic acid residues determined in hydrolysates of performic acid-oxidized protein. No molybdenum, iron, or selenium was found in the pure protein. Although NADH is the physiological electron donor for the proline reductase complex, the purified 300,000 molecular weight reductase component is inactive in the presence of NADH in vitro. Dithiothreitol, in contrast, can serve as electron donor both for unpurified (putative proline reductase complex) and purified proline reductase in vitro.

  17. Potential use of aldose reductase inhibitors to prevent diabetic complications.

    PubMed

    Zenon, G J; Abobo, C V; Carter, B L; Ball, D W

    1990-06-01

    Reviewed are (1) the biochemical basis and pathophysiology of diabetic complications and (2) the structure-activity relationships, pharmacology, pharmacokinetics, clinical trials, and adverse effects of aldose reductase inhibitors (ARIs). ARIs are a new class of drugs potentially useful in preventing diabetic complications, the most widely studied of which have been cataracts and neuropathy. ARIs inhibit aldose reductase, the first, rate-limiting enzyme in the polyol metabolic pathway. In nonphysiological hyperglycemia the activity of hexokinase becomes saturated while that of aldose reductase is enhanced, resulting in intracellular accumulation of sorbitol. Because sorbitol does not readily penetrate the cell membrane it can persist within cells, which may lead to diabetic complications. ARIs are a class of structurally dissimilar compounds that include carboxylic acid derivatives, flavonoids, and spirohydantoins. The major pharmacologic action of an ARI involves competitive binding to aldose reductase and consequent blocking of sorbitol production. ARIs delay cataract formation in animals, but the role of aldose reductase in cataract formation in human diabetics has not been established. The adverse effects of ARIs include hypersensitivity reactions. Although the polyol pathway may not be solely responsible for diabetic complications, studies suggest that therapy with ARIs could be beneficial. Further research is needed to determine the long-term impact and adverse effects of ARIs in the treatment of diabetic complications.

  18. Nontraumatic terminal ileal perforation

    PubMed Central

    Wani, Rauf A; Parray, Fazl Q; Bhat, Nadeem A; Wani, Mehmood A; Bhat, Tasaduq H; Farzana, Fowzia

    2006-01-01

    Background There is still confusion and controversy over the diagnosis and optimal surgical treatment of non traumatic terminal ileal perforation-a cause of obscure peritonitis. Methods This study was a prospective study aimed at evaluating the clinical profile, etiology and optimal surgical management of patients with nontraumatic terminal ileal perforation. Results There were 79 cases of nontraumatic terminal ileal perforation; the causes for perforation were enteric fever(62%), nonspecific inflammation(26%), obstruction(6%), tuberculosis(4%) and radiation enteritis (1%). Simple closure of the perforation (49%) and end to side ileotransverse anastomosis(42%) were the mainstay of the surgical management. Conclusion Terminal ileal perforation should be suspected in all cases of peritonitis especially in developing countries and surgical treatment should be optimized taking various accounts like etiology, delay in surgery and operative findings into consideration to reduce the incidence of deadly complications like fecal fistula. PMID:16759405

  19. Sulfur Isotope Effects of Dissimilatory Sulfite Reductase

    PubMed Central

    Leavitt, William D.; Bradley, Alexander S.; Santos, André A.; Pereira, Inês A. C.; Johnston, David T.

    2015-01-01

    The precise interpretation of environmental sulfur isotope records requires a quantitative understanding of the biochemical controls on sulfur isotope fractionation by the principle isotope-fractionating process within the S cycle, microbial sulfate reduction (MSR). Here we provide the only direct observation of the major (34S/32S) and minor (33S/32S, 36S/32S) sulfur isotope fractionations imparted by a central enzyme in the energy metabolism of sulfate reducers, dissimilatory sulfite reductase (DsrAB). Results from in vitro sulfite reduction experiments allow us to calculate the in vitro DsrAB isotope effect in 34S/32S (hereafter, 34εDsrAB) to be 15.3 ± 2‰, 2σ. The accompanying minor isotope effect in 33S, described as 33λDsrAB, is calculated to be 0.5150 ± 0.0012, 2σ. These observations facilitate a rigorous evaluation of the isotopic fractionation associated with the dissimilatory MSR pathway, as well as of the environmental variables that govern the overall magnitude of fractionation by natural communities of sulfate reducers. The isotope effect induced by DsrAB upon sulfite reduction is a factor of 0.3–0.6 times prior indirect estimates, which have ranged from 25 to 53‰ in 34εDsrAB. The minor isotope fractionation observed from DsrAB is consistent with a kinetic or equilibrium effect. Our in vitro constraints on the magnitude of 34εDsrAB is similar to the median value of experimental observations compiled from all known published work, where 34εr−p = 16.1‰ (r–p indicates reactant vs. product, n = 648). This value closely matches those of MSR operating at high sulfate reduction rates in both laboratory chemostat experiments (34εSO4−H2S =  17.3 ± 1.5‰, 2σ) and in modern marine sediments (34εSO4−H2S =  17.3 ± 3.8‰). Targeting the direct isotopic consequences of a specific enzymatic processes is a fundamental step toward a biochemical foundation for reinterpreting the biogeochemical and geobiological sulfur isotope records in

  20. Sulfur Isotope Effects of Dissimilatory Sulfite Reductase.

    PubMed

    Leavitt, William D; Bradley, Alexander S; Santos, André A; Pereira, Inês A C; Johnston, David T

    2015-01-01

    The precise interpretation of environmental sulfur isotope records requires a quantitative understanding of the biochemical controls on sulfur isotope fractionation by the principle isotope-fractionating process within the S cycle, microbial sulfate reduction (MSR). Here we provide the only direct observation of the major ((34)S/(32)S) and minor ((33)S/(32)S, (36)S/(32)S) sulfur isotope fractionations imparted by a central enzyme in the energy metabolism of sulfate reducers, dissimilatory sulfite reductase (DsrAB). Results from in vitro sulfite reduction experiments allow us to calculate the in vitro DsrAB isotope effect in (34)S/(32)S (hereafter, [Formula: see text]) to be 15.3 ± 2‰, 2σ. The accompanying minor isotope effect in (33)S, described as [Formula: see text], is calculated to be 0.5150 ± 0.0012, 2σ. These observations facilitate a rigorous evaluation of the isotopic fractionation associated with the dissimilatory MSR pathway, as well as of the environmental variables that govern the overall magnitude of fractionation by natural communities of sulfate reducers. The isotope effect induced by DsrAB upon sulfite reduction is a factor of 0.3-0.6 times prior indirect estimates, which have ranged from 25 to 53‰ in (34)εDsrAB. The minor isotope fractionation observed from DsrAB is consistent with a kinetic or equilibrium effect. Our in vitro constraints on the magnitude of [Formula: see text] is similar to the median value of experimental observations compiled from all known published work, where (34)ε r-p = 16.1‰ (r-p indicates reactant vs. product, n = 648). This value closely matches those of MSR operating at high sulfate reduction rates in both laboratory chemostat experiments ([Formula: see text] 17.3 ± 1.5‰, 2σ) and in modern marine sediments ([Formula: see text] 17.3 ± 3.8‰). Targeting the direct isotopic consequences of a specific enzymatic processes is a fundamental step toward a biochemical foundation for reinterpreting the

  1. 29 CFR 4043.24 - Termination or partial termination.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Secretary of the Treasury determines that there has been a termination or partial termination of a plan... 29 Labor 9 2010-07-01 2010-07-01 false Termination or partial termination. 4043.24 Section 4043.24 Labor Regulations Relating to Labor (Continued) PENSION BENEFIT GUARANTY CORPORATION PLAN...

  2. The Structural Basis for Peptidomimetic Inhibition of Eukaryotic Ribonucleotide Reductase: A Conformationally Flexible Pharmacophore

    SciTech Connect

    Xu, Hai; Fairman, James W.; Wijerathna, Sanath R.; Kreischer, Nathan R.; LaMacchia, John; Helmbrecht, Elizabeth; Cooperman, Barry S.; Dealwis, Chris

    2008-08-19

    Eukaryotic ribonucleotide reductase (RR) catalyzes nucleoside diphosphate conversion to deoxynucleoside diphosphate. Crucial for rapidly dividing cells, RR is a target for cancer therapy. RR activity requires formation of a complex between subunits R1 and R2 in which the R2 C-terminal peptide binds to R1. Here we report crystal structures of heterocomplexes containing mammalian R2 C-terminal heptapeptide, P7 (Ac-{sup 1}FTLDADF{sup 7}) and its peptidomimetic P6 ({sup 1}Fmoc(Me)PhgLDChaDF{sup 7}) bound to Saccharomyces cerevisiae R1 (ScR1). P7 and P6, both of which inhibit ScRR, each bind at two contiguous sites containing residues that are highly conserved among eukaryotes. Such binding is quite distinct from that reported for prokaryotes. The Fmoc group in P6 peptide makes several hydrophobic interactions that contribute to its enhanced potency in binding to ScR1. Combining all of our results, we observe three distinct conformations for peptide binding to ScR1. These structures provide pharmacophores for designing highly potent nonpeptide class I RR inhibitors.

  3. The structural basis for peptidomimetic inhibition of eukaryotic ribonucleotide reductase: a conformationally flexible pharmacophore.

    PubMed

    Xu, Hai; Fairman, James W; Wijerathna, Sanath R; Kreischer, Nathan R; LaMacchia, John; Helmbrecht, Elizabeth; Cooperman, Barry S; Dealwis, Chris

    2008-08-14

    Eukaryotic ribonucleotide reductase (RR) catalyzes nucleoside diphosphate conversion to deoxynucleoside diphosphate. Crucial for rapidly dividing cells, RR is a target for cancer therapy. RR activity requires formation of a complex between subunits R1 and R2 in which the R2 C-terminal peptide binds to R1. Here we report crystal structures of heterocomplexes containing mammalian R2 C-terminal heptapeptide, P7 (Ac-1FTLDADF7) and its peptidomimetic P6 (1Fmoc(Me)PhgLDChaDF7) bound to Saccharomyces cerevisiae R1 (ScR1). P7 and P6, both of which inhibit ScRR, each bind at two contiguous sites containing residues that are highly conserved among eukaryotes. Such binding is quite distinct from that reported for prokaryotes. The Fmoc group in P6 peptide makes several hydrophobic interactions that contribute to its enhanced potency in binding to ScR1. Combining all of our results, we observe three distinct conformations for peptide binding to ScR1. These structures provide pharmacophores for designing highly potent nonpeptide class I RR inhibitors.

  4. The last glacial termination.

    PubMed

    Denton, G H; Anderson, R F; Toggweiler, J R; Edwards, R L; Schaefer, J M; Putnam, A E

    2010-06-25

    A major puzzle of paleoclimatology is why, after a long interval of cooling climate, each late Quaternary ice age ended with a relatively short warming leg called a termination. We here offer a comprehensive hypothesis of how Earth emerged from the last global ice age. A prerequisite was the growth of very large Northern Hemisphere ice sheets, whose subsequent collapse created stadial conditions that disrupted global patterns of ocean and atmospheric circulation. The Southern Hemisphere westerlies shifted poleward during each northern stadial, producing pulses of ocean upwelling and warming that together accounted for much of the termination in the Southern Ocean and Antarctica. Rising atmospheric CO2 during southern upwelling pulses augmented warming during the last termination in both polar hemispheres.

  5. Phenylethynyl terminated reactive oligomer

    NASA Technical Reports Server (NTRS)

    Bryant, Robert G. (Inventor); Jensen, Brian J. (Inventor); Hergenrother, Paul M. (Inventor)

    1995-01-01

    A composition of matter having the general structure: ##STR1## (wherein X is F, Cl, or NO.sub.2, and Y is CO, SO.sub.2 or C(CF.sub.3).sub.2) is employed to terminate a nucleophilic reagent, resulting in the exclusive production of phenylethynyl terminated reactive oligomers which display unique thermal characteristics. A reactive diluent having the general structure: ##STR2## (wherein R is any aliphatic or aromatic moiety) is employed to decrease the melt viscosity of a phenylethynyl terminated reactive oligomer and to subsequently react therewith to provide a thermosetting material of enhanced density. These materials have features which make them attractive candidates for use as composite matrices and adhesives.

  6. Characterisation and expression analysis of a nitrate transporter and nitrite reductase genes, two members of a gene cluster for nitrate assimilation from the symbiotic basidiomycete Hebeloma cylindrosporum.

    PubMed

    Jargeat, Patricia; Rekangalt, David; Verner, Marie-Christine; Gay, Gilles; Debaud, Jean-Claude; Marmeisse, Roland; Fraissinet-Tachet, Laurence

    2003-06-01

    Symbiotic ectomycorrhizal fungi contribute to the nitrogen nutrition of their host-plants but little information is available on the molecular control of their nitrogen metabolism. We cloned and characterised genes encoding a nitrite reductase and a nitrate transporter in the ectomycorrhizal basidiomycete Hebeloma cylindrosporum. These two genes are divergently transcribed and linked to a previously cloned nitrate reductase gene, thus demonstrating that nitrate assimilation gene clusters occur in homobasidiomycetes. The nitrate transporter polypeptide (NRT2) is characterised by 12 transmembrane domains and presents both a long putative intracellular loop and a short C-terminal tail, two structural features which distinguish fungal high-affinity transporters from their plant homologues. In different wild-type genetic backgrounds, transcription of the two genes was repressed by ammonium and was strongly stimulated not only in the presence of nitrate but also in the presence of organic nitrogen sources or under nitrogen deficiency.

  7. ALSEP termination report

    NASA Technical Reports Server (NTRS)

    Bates, J. R.; Lauderdale, W. W.; Kernaghan, H.

    1979-01-01

    The Apollo Lunar Surface Experiments Package (ALSEP) final report was prepared when support operations were terminated September 30, 1977, and NASA discontinued the receiving and processing of scientific data transmitted from equipment deployed on the lunar surface. The ALSEP experiments (Apollo 11 to Apollo 17) are described and pertinent operational history is given for each experiment. The ALSEP data processing and distribution are described together with an extensive discussion on archiving. Engineering closeout tests and results are given, and the status and configuration of the experiments at termination are documented. Significant science findings are summarized by selected investigators. Significant operational data and recommendations are also included.

  8. Electrical termination techniques

    NASA Technical Reports Server (NTRS)

    Oakey, W. E.; Schleicher, R. R.

    1976-01-01

    A technical review of high reliability electrical terminations for electronic equipment was made. Seven techniques were selected from this review for further investigation, experimental work, and preliminary testing. From the preliminary test results, four techniques were selected for final testing and evaluation. These four were: (1) induction soldering, (2) wire wrap, (3) percussive arc welding, and (4) resistance welding. Of these four, induction soldering was selected as the best technique in terms of minimizing operator errors, controlling temperature and time, minimizing joint contamination, and ultimately producing a reliable, uniform, and reusable electrical termination.

  9. A detoxifying oxygen reductase in the anaerobic protozoan Entamoeba histolytica.

    PubMed

    Vicente, João B; Tran, Vy; Pinto, Liliana; Teixeira, Miguel; Singh, Upinder

    2012-09-01

    We report the characterization of a bacterial-type oxygen reductase abundant in the cytoplasm of the anaerobic protozoan parasite Entamoeba histolytica. Upon host infection, E. histolytica is confronted with various oxygen tensions in the host intestine, as well as increased reactive oxygen and nitrogen species at the site of local tissue inflammation. Resistance to oxygen-derived stress thus plays an important role in the pathogenic potential of E. histolytica. The genome of E. histolytica has four genes that encode flavodiiron proteins, which are bacterial-type oxygen or nitric oxide reductases and were likely acquired by lateral gene transfer from prokaryotes. The EhFdp1 gene has higher expression in virulent than in nonvirulent Entamoeba strains and species, hinting that the response to oxidative stress may be one correlate of virulence potential. We demonstrate that EhFdp1 is abundantly expressed in the cytoplasm of E. histolytica and that the protein levels are markedly increased (up to ~5-fold) upon oxygen exposure. Additionally, we produced fully functional recombinant EhFdp1 and demonstrated that this enzyme is a specific and robust oxygen reductase but has poor nitric oxide reductase activity. This observation represents a new mechanism of oxygen resistance in the anaerobic protozoan pathogen E. histolytica.

  10. 21 CFR 864.7375 - Glutathione reductase assay.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Glutathione reductase assay. 864.7375 Section 864.7375 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7375...

  11. Thioredoxin and NADP-thioredoxin reductase from cultured carrot cells

    NASA Technical Reports Server (NTRS)

    Johnson, T. C.; Cao, R. Q.; Kung, J. E.; Buchanan, B. B.

    1987-01-01

    Dark-grown carrot (Daucus carota L.) tissue cultures were found to contain both protein components of the NADP/thioredoxin system--NADP-thioredoxin reductase and the thioredoxin characteristic of heterotrophic systems, thioredoxin h. Thioredoxin h was purified to apparent homogeneity and, like typical bacterial counterparts, was a 12-kdalton (kDa) acidic protein capable of activating chloroplast NADP-malate dehydrogenase (EC 1.1.1.82) more effectively than fructose-1,6-bisphosphatase (EC 3.1.3.11). NADP-thioredoxin reductase (EC 1.6.4.5) was partially purified and found to be an arsenite-sensitive enzyme composed of two 34-kDa subunits. Carrot NADP-thioredoxin reductase resembled more closely its counterpart from bacteria rather than animal cells in acceptor (thioredoxin) specificity. Upon greening of the cells, the content of NADP-thioredoxin-reductase activity, and, to a lesser extent, thioredoxin h decreased. The results confirm the presence of a heterotrophic-type thioredoxin system in plant cells and raise the question of its physiological function.

  12. Obtaining partial purified xylose reductase from Candida guilliermondii

    PubMed Central

    Tomotani, Ester Junko; de Arruda, Priscila Vaz; Vitolo, Michele; de Almeida Felipe, Maria das Graças

    2009-01-01

    The enzymatic bioconversion of xylose into xylitol by xylose reductase (XR) is an alternative for chemical and microbiological processes. The partial purified XR was obtained by using the following three procedures: an agarose column, a membrane reactor or an Amicon Ultra-15 50K Centrifugal Filter device at yields of 40%, 7% and 67%, respectively. PMID:24031408

  13. Dissimilatory Nitrite Reductase Genes from Autotrophic Ammonia-Oxidizing Bacteria

    PubMed Central

    Casciotti, Karen L.; Ward, Bess B.

    2001-01-01

    The presence of a copper-containing dissimilatory nitrite reductase gene (nirK) was discovered in several isolates of β-subdivision ammonia-oxidizing bacteria using PCR and DNA sequencing. PCR primers Cunir3 and Cunir4 were designed based on published nirK sequences from denitrifying bacteria and used to amplify a 540-bp fragment of the nirK gene from Nitrosomonas marina and five additional isolates of ammonia-oxidizing bacteria. Amplification products of the expected size were cloned and sequenced. Alignment of the nucleic acid and deduced amino acid (AA) sequences shows significant similarity (62 to 75% DNA, 58 to 76% AA) between nitrite reductases present in these nitrifiers and the copper-containing nitrite reductase found in classic heterotrophic denitrifiers. While the presence of a nitrite reductase in Nitrosomonas europaea is known from early biochemical work, preliminary sequence data from its genome indicate a rather low similarity to the denitrifier nirKs. Phylogenetic analysis of the partial nitrifier nirK sequences indicates that the topology of the nirK tree corresponds to the 16S rRNA and amoA trees. While the role of nitrite reduction in the metabolism of nitrifying bacteria is still uncertain, these data show that the nirK gene is present in closely related nitrifying isolates from many oceanographic regions and suggest that nirK sequences retrieved from the environment may include sequences from ammonia-oxidizing bacteria. PMID:11319103

  14. 21 CFR 864.7375 - Glutathione reductase assay.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Glutathione reductase assay. 864.7375 Section 864.7375 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7375...

  15. 21 CFR 864.7375 - Glutathione reductase assay.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Glutathione reductase assay. 864.7375 Section 864.7375 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7375...

  16. 21 CFR 864.7375 - Glutathione reductase assay.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Glutathione reductase assay. 864.7375 Section 864.7375 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7375...

  17. Dihydrofolate reductase: A potential drug target in trypanosomes and leishmania

    NASA Astrophysics Data System (ADS)

    Zuccotto, Fabio; Martin, Andrew C. R.; Laskowski, Roman A.; Thornton, Janet M.; Gilbert, Ian H.

    1998-05-01

    Dihydrofolate reductase has successfully been used as a drug target in the area of anti-cancer, anti-bacterial and anti-malarial chemotherapy. Little has been done to evaluate it as a drug target for treatment of the trypanosomiases and leishmaniasis. A crystal structure of Leishmania major dihydrofolate reductase has been published. In this paper, we describe the modelling of Trypanosoma cruzi and Trypanosoma brucei dihydrofolate reductases based on this crystal structure. These structures and models have been used in the comparison of protozoan, bacterial and human enzymes in order to highlight the different features that can be used in the design of selective anti-protozoan agents. Comparison has been made between residues present in the active site, the accessibility of these residues, charge distribution in the active site, and the shape and size of the active sites. Whilst there is a high degree of similarity between protozoan, human and bacterial dihydrofolate reductase active sites, there are differences that provide potential for selective drug design. In particular, we have identified a set of residues which may be important for selective drug design and identified a larger binding pocket in the protozoan than the human and bacterial enzymes.

  18. The Kinetics and Inhibition of the Enzyme Methemoglobin Reductase

    ERIC Educational Resources Information Center

    Splittgerber, A. G.; And Others

    1975-01-01

    Describes an undergraduate biochemistry experiment which involves the preparation and kinetics of an oxidation-reduction enzyme system, methemoglobin reductase. A crude enzyme extract is prepared and assayed spectrophotometrically. The enzyme system obeys Michaelis-Menton kinetics with respect to both substrate and the NADH cofactor. (MLH)

  19. [Malate oxidation by mitochondrial succinate:ubiquinone-reductase].

    PubMed

    Belikova, Iu O; Kotliar, A B

    1988-04-01

    Succinate:ubiquinone reductase was shown to catalyze the oxidation of L- and D-stereoisomers of malate by artificial electron acceptors and ubiquinone. The rate of malate oxidation by succinate:ubiquinone reductase is by two orders of magnitude lower than that for the natural substrate--succinate. The values of kinetic constants for the oxidation of D- and L-stereoisomers of malate are equal to: V infinity = 0.1 mumol/min/mg protein, Km = 2 mM and V infinity = 0.05 mumol/min/mg protein, Km = 2 mM, respectively. The malate dehydrogenase activity is fully inhibited by the inhibitors of the dicarboxylate-binding site of the enzyme, i.e., N-ethylmaleimide and malonate and is practically insensitive to carboxin, a specific inhibitor of the ubiquinone-binding center. The enol form of oxaloacetate was shown to be the product of malate oxidation by succinate:ubiquinone reductase. The kinetics of inhibition of the enzyme activity by the ketone and enol forms of oxaloacetate was studied. Both forms of oxaloacetate effectively inhibit the succinate:ubiquinone reductase reaction.

  20. The arsenic hyperaccumulating Pteris vittata expresses two arsenate reductases

    PubMed Central

    Cesaro, Patrizia; Cattaneo, Chiara; Bona, Elisa; Berta, Graziella; Cavaletto, Maria

    2015-01-01

    Enzymatic reduction of arsenate to arsenite is the first known step in arsenate metabolism in all organisms. Although the presence of one mRNA arsenate reductase (PvACR2) has been characterized in gametophytes of P. vittata, no arsenate reductase protein has been directly observed in this arsenic hyperaccumulating fern, yet. In order to assess the possible presence of arsenate reductase in P. vittata, two recombinant proteins, ACR2-His6 and Trx-His6-S-Pv2.5–8 were prepared in Escherichia coli, purified and used to produce polyclonal antibodies. The presence of these two enzymes was evaluated by qRT-PCR, immunoblotting and direct MS analysis. Enzymatic activity was detected in crude extracts. For the first time we detected and identified two arsenate reductase proteins (PvACR2 and Pv2.5–8) in sporophytes and gametophytes of P. vittata. Despite an increase of the mRNA levels for both proteins in roots, no difference was observed at the protein level after arsenic treatment. Overall, our data demonstrate the constitutive protein expression of PvACR2 and Pv2.5–8 in P. vittata tissues and propose their specific role in the complex metabolic network of arsenic reduction. PMID:26412036

  1. The arsenic hyperaccumulating Pteris vittata expresses two arsenate reductases.

    PubMed

    Cesaro, Patrizia; Cattaneo, Chiara; Bona, Elisa; Berta, Graziella; Cavaletto, Maria

    2015-09-28

    Enzymatic reduction of arsenate to arsenite is the first known step in arsenate metabolism in all organisms. Although the presence of one mRNA arsenate reductase (PvACR2) has been characterized in gametophytes of P. vittata, no arsenate reductase protein has been directly observed in this arsenic hyperaccumulating fern, yet. In order to assess the possible presence of arsenate reductase in P. vittata, two recombinant proteins, ACR2-His6 and Trx-His6-S-Pv2.5-8 were prepared in Escherichia coli, purified and used to produce polyclonal antibodies. The presence of these two enzymes was evaluated by qRT-PCR, immunoblotting and direct MS analysis. Enzymatic activity was detected in crude extracts. For the first time we detected and identified two arsenate reductase proteins (PvACR2 and Pv2.5-8) in sporophytes and gametophytes of P. vittata. Despite an increase of the mRNA levels for both proteins in roots, no difference was observed at the protein level after arsenic treatment. Overall, our data demonstrate the constitutive protein expression of PvACR2 and Pv2.5-8 in P. vittata tissues and propose their specific role in the complex metabolic network of arsenic reduction.

  2. [Inhibition of aldose reductase by Chinese herbal medicine].

    PubMed

    Mao, X M; Zhang, J Q

    1993-10-01

    Seven Chinese herbal drugs were screened for experimental inhibition of lens aldose reductase activity, among which quercetin exhibited potent enzyme-inhibitory activities in vitro. Its IC50 value was 3.44 x 10(-7) mol/L. It may be helpful in the prophylaxis and treatment of diabetic complications.

  3. Characterization of mitochondrial thioredoxin reductase from C. elegans

    SciTech Connect

    Lacey, Brian M.; Hondal, Robert J. . E-mail: Robert.Hondal@uvm.edu

    2006-08-04

    Thioredoxin reductase catalyzes the NADPH-dependent reduction of the catalytic disulfide bond of thioredoxin. In mammals and other higher eukaryotes, thioredoxin reductases contain the rare amino acid selenocysteine at the active site. The mitochondrial enzyme from Caenorhabditis elegans, however, contains a cysteine residue in place of selenocysteine. The mitochondrial C. elegans thioredoxin reductase was cloned from an expressed sequence tag and then produced in Escherichia coli as an intein-fusion protein. The purified recombinant enzyme has a k {sub cat} of 610 min{sup -1} and a K {sub m} of 610 {mu}M using E. coli thioredoxin as substrate. The reported k {sub cat} is 25% of the k {sub cat} of the mammalian enzyme and is 43-fold higher than a cysteine mutant of mammalian thioredoxin reductase. The enzyme would reduce selenocysteine, but not hydrogen peroxide or insulin. The flanking glycine residues of the GCCG motif were mutated to serine. The mutants improved substrate binding, but decreased the catalytic rate.

  4. The arsenic hyperaccumulating Pteris vittata expresses two arsenate reductases

    NASA Astrophysics Data System (ADS)

    Cesaro, Patrizia; Cattaneo, Chiara; Bona, Elisa; Berta, Graziella; Cavaletto, Maria

    2015-09-01

    Enzymatic reduction of arsenate to arsenite is the first known step in arsenate metabolism in all organisms. Although the presence of one mRNA arsenate reductase (PvACR2) has been characterized in gametophytes of P. vittata, no arsenate reductase protein has been directly observed in this arsenic hyperaccumulating fern, yet. In order to assess the possible presence of arsenate reductase in P. vittata, two recombinant proteins, ACR2-His6 and Trx-His6-S-Pv2.5-8 were prepared in Escherichia coli, purified and used to produce polyclonal antibodies. The presence of these two enzymes was evaluated by qRT-PCR, immunoblotting and direct MS analysis. Enzymatic activity was detected in crude extracts. For the first time we detected and identified two arsenate reductase proteins (PvACR2 and Pv2.5-8) in sporophytes and gametophytes of P. vittata. Despite an increase of the mRNA levels for both proteins in roots, no difference was observed at the protein level after arsenic treatment. Overall, our data demonstrate the constitutive protein expression of PvACR2 and Pv2.5-8 in P. vittata tissues and propose their specific role in the complex metabolic network of arsenic reduction.

  5. The polymorphisms in methylenetetrahydrofolate reductase, methionine synthase, methionine synthase reductase, and the risk of colorectal cancer.

    PubMed

    Zhou, Daijun; Mei, Qiang; Luo, Han; Tang, Bo; Yu, Peiwu

    2012-01-01

    Polymorphisms in genes involved in folate metabolism may modulate the risk of colorectal cancer (CRC), but data from published studies are conflicting. The current meta-analysis was performed to address a more accurate estimation. A total of 41 (17,552 cases and 26,238 controls), 24(8,263 cases and 12,033 controls), 12(3,758 cases and 5,646 controls), and 13 (5,511 cases and 7,265 controls) studies were finally included for the association between methylenetetrahydrofolate reductase (MTHFR) C677T and A1289C, methione synthase reductase (MTRR) A66G, methionine synthase (MTR) A2756G polymorphisms and the risk of CRC, respectively. The data showed that the MTHFR 677T allele was significantly associated with reduced risk of CRC (OR = 0.93, 95%CI 0.90-0.96), while the MTRR 66G allele was significantly associated with increased risk of CRC (OR = 1.11, 95%CI 1.01-1.18). Sub-group analysis by ethnicity revealed that MTHFR C677T polymorphism was significantly associated with reduced risk of CRC in Asians (OR = 0.80, 95%CI 0.72-0.89) and Caucasians (OR = 0.84, 95%CI 0.76-0.93) in recessive genetic model, while the MTRR 66GG genotype was found to significantly increase the risk of CRC in Caucasians (GG vs. AA: OR = 1.18, 95%CI 1.03-1.36). No significant association was found between MTHFR A1298C and MTR A2756G polymorphisms and the risk of CRC. Cumulative meta-analysis showed no particular time trend existed in the summary estimate. Probability of publication bias was low across all comparisons illustrated by the funnel plots and Egger's test. Collectively, this meta-analysis suggested that MTHFR 677T allele might provide protection against CRC in worldwide populations, while MTRR 66G allele might increase the risk of CRC in Caucasians. Since potential confounders could not be ruled out completely, further studies were needed to confirm these results.

  6. The Polymorphisms in Methylenetetrahydrofolate Reductase, Methionine Synthase, Methionine Synthase Reductase, and the Risk of Colorectal Cancer

    PubMed Central

    Zhou, Daijun; Mei, Qiang; Luo, Han; Tang, Bo; Yu, Peiwu

    2012-01-01

    Polymorphisms in genes involved in folate metabolism may modulate the risk of colorectal cancer (CRC), but data from published studies are conflicting. The current meta-analysis was performed to address a more accurate estimation. A total of 41 (17,552 cases and 26,238 controls), 24(8,263 cases and 12,033 controls), 12(3,758 cases and 5,646 controls), and 13 (5,511 cases and 7,265 controls) studies were finally included for the association between methylenetetrahydrofolate reductase (MTHFR) C677T and A1289C, methione synthase reductase (MTRR) A66G, methionine synthase (MTR) A2756G polymorphisms and the risk of CRC, respectively. The data showed that the MTHFR 677T allele was significantly associated with reduced risk of CRC (OR = 0.93, 95%CI 0.90-0.96), while the MTRR 66G allele was significantly associated with increased risk of CRC (OR = 1.11, 95%CI 1.01-1.18). Sub-group analysis by ethnicity revealed that MTHFR C677T polymorphism was significantly associated with reduced risk of CRC in Asians (OR = 0.80, 95%CI 0.72-0.89) and Caucasians (OR = 0.84, 95%CI 0.76-0.93) in recessive genetic model, while the MTRR 66GG genotype was found to significantly increase the risk of CRC in Caucasians (GG vs. AA: OR = 1.18, 95%CI 1.03-1.36). No significant association was found between MTHFR A1298C and MTR A2756G polymorphisms and the risk of CRC. Cumulative meta-analysis showed no particular time trend existed in the summary estimate. Probability of publication bias was low across all comparisons illustrated by the funnel plots and Egger's test. Collectively, this meta-analysis suggested that MTHFR 677T allele might provide protection against CRC in worldwide populations, while MTRR 66G allele might increase the risk of CRC in Caucasians. Since potential confounders could not be ruled out completely, further studies were needed to confirm these results. PMID:22719222

  7. Indolin-2-one compounds targeting thioredoxin reductase as potential anticancer drug leads

    PubMed Central

    Kaminska, Kamila K.; Bertrand, Helene C.; Tajima, Hisashi; Stafford, William C.; Cheng, Qing; Chen, Wan; Wells, Geoffrey; Arner, Elias S.J.; Chew, Eng-Hui

    2016-01-01

    Several compounds bearing the indolinone chemical scaffold are known to possess anticancer properties. For example, the tyrosine kinase inhibitor sunitinib is an arylideneindolin-2-one compound. The chemical versatility associated with structural modifications of indolinone compounds underlies the potential to discover additional derivatives possessing anticancer properties. Previously synthesized 3-(2-oxoethylidene)indolin-2-one compounds, also known as supercinnamaldehyde (SCA) compounds in reference to the parent compound 1 [1-methyl-3(2-oxopropylidene)indolin-2-one], bear a nitrogen-linked α,β-unsaturated carbonyl (Michael acceptor) moiety. Here we found that analogs bearing N-substituents, in particular compound 4 and 5 carrying an N-butyl and N-benzyl substituent, respectively, were strongly cytotoxic towards human HCT 116 colorectal and MCF-7 breast carcinoma cells. These compounds also displayed strong thioredoxin reductase (TrxR) inhibitory activity that was likely attributed to the electrophilicity of the Michael acceptor moiety. Their selectivity towards cellular TrxR inhibition over related antioxidant enzymes glutathione reductase (GR), thioredoxin (Trx) and glutathione peroxidase (GPx) was mediated through targeting of the selenocysteine (Sec) residue in the highly accessible C-terminal active site of TrxR. TrxR inhibition mediated by indolin-2-one compounds led to cellular Trx oxidation, increased oxidative stress and activation of apoptosis signal-regulating kinase 1 (ASK1). These events also led to activation of p38 and JNK mitogen-activated protein kinase (MAPK) signaling pathways, and cell death with apoptotic features of PARP cleavage and caspase 3 activation. In conclusion, these results suggest that indolin-2-one-based compounds specifically targeting TrxR may serve as novel drug leads for anticancer therapy. PMID:27244886

  8. LuxG is a functioning flavin reductase for bacterial luminescence.

    PubMed

    Nijvipakul, Sarayut; Wongratana, Janewit; Suadee, Chutintorn; Entsch, Barrie; Ballou, David P; Chaiyen, Pimchai

    2008-03-01

    The luxG gene is part of the lux operon of marine luminous bacteria. luxG has been proposed to be a flavin reductase that supplies reduced flavin mononucleotide (FMN) for bacterial luminescence. However, this role has never been established because the gene product has not been successfully expressed and characterized. In this study, luxG from Photobacterium leiognathi TH1 was cloned and expressed in Escherichia coli in both native and C-terminal His6-tagged forms. Sequence analysis indicates that the protein consists of 237 amino acids, corresponding to a subunit molecular mass of 26.3 kDa. Both expressed forms of LuxG were purified to homogeneity, and their biochemical properties were characterized. Purified LuxG is homodimeric and has no bound prosthetic group. The enzyme can catalyze oxidation of NADH in the presence of free flavin, indicating that it can function as a flavin reductase in luminous bacteria. NADPH can also be used as a reducing substrate for the LuxG reaction, but with much less efficiency than NADH. With NADH and FMN as substrates, a Lineweaver-Burk plot revealed a series of convergent lines characteristic of a ternary-complex kinetic model. From steady-state kinetics data at 4 degrees C pH 8.0, Km for NADH, Km for FMN, and kcat were calculated to be 15.1 microM, 2.7 microM, and 1.7 s(-1), respectively. Coupled assays between LuxG and luciferases from P. leiognathi TH1 and Vibrio campbellii also showed that LuxG could supply FMNH- for light emission in vitro. A luxG gene knockout mutant of P. leiognathi TH1 exhibited a much dimmer luminescent phenotype compared to the native P. leiognathi TH1, implying that LuxG is the most significant source of FMNH- for the luminescence reaction in vivo.

  9. The crystal structure of maleylacetate reductase from Rhizobium sp. strain MTP-10005 provides insights into the reaction mechanism of enzymes in its original family.

    PubMed

    Fujii, Tomomi; Sato, Ai; Okamoto, Yuko; Yamauchi, Takae; Kato, Shiro; Yoshida, Masahiro; Oikawa, Tadao; Hata, Yasuo

    2016-08-01

    Maleylacetate reductase plays a crucial role in catabolism of resorcinol by catalyzing the NAD(P)H-dependent reduction of maleylacetate, at a carbon-carbon double bond, to 3-oxoadipate. The crystal structure of maleylacetate reductase from Rhizobium sp. strain MTP-10005, GraC, has been elucidated by the X-ray diffraction method at 1.5 Å resolution. GraC is a homodimer, and each subunit consists of two domains: an N-terminal NADH-binding domain adopting an α/β structure and a C-terminal functional domain adopting an α-helical structure. Such structural features show similarity to those of the two existing families of enzymes in dehydroquinate synthase-like superfamily. However, GraC is distinct in dimer formation and activity expression mechanism from the families of enzymes. Two subunits in GraC have different structures from each other in the present crystal. One subunit has several ligands mimicking NADH and the substrate in the cleft and adopts a closed domain arrangement. In contrast, the other subunit does not contain any ligand causing structural changes and adopts an open domain arrangement. The structure of GraC reveals those of maleylacetate reductase both in the coenzyme, substrate-binding state and in the ligand-free state. The comparison of both subunit structures reveals a conformational change of the Tyr326 loop for interaction with His243 on ligand binding. Structures of related enzymes suggest that His243 is likely a catalytic residue of GraC. Mutational analyses of His243 and Tyr326 support the catalytic roles proposed from structural information. The crystal structure of GraC characterizes the maleylacetate reductase family as a third family in the dehydroquinate synthase-like superfamily. Proteins 2016; 84:1029-1042. © 2016 Wiley Periodicals, Inc.

  10. Essential role of the flexible linker on the conformational equilibrium of bacterial peroxiredoxin reductase for effective regeneration of peroxiredoxin.

    PubMed

    Kamariah, Neelagandan; Eisenhaber, Birgit; Eisenhaber, Frank; Gruber, Gerhard

    2017-03-07

    Reactive oxygen species (ROS) can damage DNA, proteins, and lipids, so cells have antioxidant systems that regulate ROS. In many bacteria, a dedicated peroxiredoxin reductase, alkyl hydroperoxide reductase subunit F (AhpF), catalyzes the rapid reduction of the redox-active disulfide center of the antioxidant protein peroxiredoxin (AhpC) to detoxify ROS such as hydrogen peroxide, organic hydroperoxide, and peroxynitrite. AhpF is a flexible multi-domain protein that enables a series of electron transfers among the redox centers by accepting reducing equivalents from NADH. A flexible linker connecting the N-terminal domain (NTD) and C-terminal domain (CTD) of AhpF suggests that the enzyme adopts a large-scale domain motion that alternates between the closed and open states to shuttle electrons from the CTD via the NTD to AhpC. Here, we conducted comprehensive mutational, biochemical, and biophysical analyses to gain insights into the role of the flexible linker and the residues critical for the domain motions of Escherichia coli AhpF (EcAhpF) during electron transfer. Small-angle X-ray scattering studies of linker mutants revealed that a group of charged residues, 200EKR202, is crucial for the swiveling motion of the NTD. Moreover, NADH binding significantly affected EcAhpF flexibility and the movement of the NTD relative to the CTD. The mutants also exhibited a decrease in H2O2 reduction by the AhpF-AhpC ensemble. We propose that a concerted movement involving the NTD, C-terminal NADH and FAD domains, and the flexible linker between them is essential for optimal intra-domain crosstalk and for efficient electron transfer to the redox partner AhpC required for peroxidation.

  11. Treatment of hirsutism with 5 alpha-reductase inhibitors.

    PubMed

    Brooks, J R

    1986-05-01

    Much os the evidence gathered from studies of 5 alpha-reductase activity levels and androgen metabolism in the skin of hirsute women and the excretion of androgen metabolites by hirsute women indicates that 5 alpha-reduced androgens are probably of primary importance in hirsutism. Unfortunately, until very recently, the lack of a suitable 5 alpha-reductase inhibitor made it very difficult to adequately test the hypothesis that such an inhibitor might be useful in the treatment of hirsutism and certain other androgen-related diseases. No substance was available which had good, unambiguous activity in vivo as a 5 alpha-reductase inhibitor. A number of 4-azasteroids have now been found to possess excellent 5 alpha-reductase inhibitory activity both in vitro and in vivo. Among other properties, several of these compounds show little or no affinity for the androgen receptor of rat prostate cytosol, they attenuate the growth promoting effect of T, but not DHT, on the ventral prostate of castrated male rats, they cause a marked reduction in prostatic DHT concentration in acutely treated rats and dogs and they bring about a significant decline in prostate size in chronically treated rats and dogs. It is expected that, in the near future, one or more of these highly active 5 alpha-reductase inhibitors will be tested in the clinic as a treatment for hirsutism. The results of those studies will be awaited with a great deal of interest since they should considerably advance our understanding of this disease and possibly contribute to its control.

  12. Assimilatory nitrate reductase from the green alga Ankistrodesmus braunii.

    PubMed

    De la Rosa, M A

    1983-01-01

    Assimilatory nitrate reductase (NAD(P)H-nitrate oxidoreductase, EC 1.6.6.2) from the green alga Ankistrodesmus braunii can be purified to homogeneity by dye-ligand chromatography on blue-Sepharose. The purified enzyme, whose turnover number is 623 s-1, presents an optimum pH of 7.5 and Km values of 13 microM, 23 microM and 0.15 mM for NADH, NADPH and nitrate, respectively. The NADH-nitrate reductase activity exhibits an iso ping pong bi bi kinetic mechanism. The molecular weight of the native nitrate reductase is 467 400, while that of its subunits is 58 750. These values suggest an octameric structure for the enzyme, which has been confirmed by electron microscopy. As deduced from spectrophotometric and fluorimetric studies, the enzyme contains FAD and cytochrome b-557 as prosthetic groups. FAD is not covalently bound to the protein and is easily dissociated in diluted solutions from the enzyme. Its apparent Km value is 4 nM, indicative of a high affinity of the enzyme for FAD. The results of the quantitative analyses of prosthetic groups indicate that nitrate reductase contains four molecules of flavin, four heme irons, and two atoms of molybdenum. The three components act sequentially transferring electrons from reduced pyridine nucleotides to nitrate, thus forming a short electron transport chain along the protein. A mechanism is proposed for the redox interconversion of the nitrate reductase activity. Inactivation seems to occur by formation of a stable complex of reduced enzyme with cyanide or superoxide, while reactivation is a consequence of reoxidation of the inactive enzyme. Both reactions imply the transfer of only one electron.

  13. Measurement of nitrous oxide reductase activity in aquatic sediments

    SciTech Connect

    Miller, L.G.; Oremland, R.S.; Paulsen, S.

    1986-01-01

    Denitrification in aquatic sediments was measured by an N/sub 2/O reductase assay. Sediments consumed small added quantities of N/sub 2/O over short periods (a few hours). In experiments with sediment slurries, N/sub 2/O reductase activity was inhibited by 0/sub 2/, C/sub 2/H/sub 2/, heat treatment, and by high levels of nitrate (1 mM) or sulfide (10 mM). However, ambient levels of nitrate (<100 ..mu..M) did not influence activity, and moderate levels (about 150 ..mu..M) induced only a short lag before reductase activity began. Moderate levels of sulfide (<1 mM) had no effect on N/sub 2/O reductase activity. Nitrous oxide reductase displayed Michaelis-Menten kinetics in sediments from freshwater, estuarine, and alkaline-saline environments. An in situ assay was devised in which a solution of N/sub 2/O was injected into sealed glass cores containing intact sediment. Two estimates of net rates of denitrification in San Francisco Bay under approximated in situ conditions were 0.009 and 0.041 mmol of N/sub 2/O per m/sup 2/ per h. Addition of chlorate to inhibit denitrification in these intact-core experiments (to estimate gross rates of N/sub 2/O consumption) resulted in approximately a 14% upward revision of estimates of net rates. These results were comparable to an in situ estimate of 0.022 mmol of N/sub 2/O per m/sup 2/ per h made with the acetylene block assay.

  14. Measurement of nitrous oxide reductase activity in aquatic sediments

    USGS Publications Warehouse

    Miller, L.G.; Oremland, R.S.; Paulsen, S.

    1986-01-01

    Denitrification in aquatic sediments was measured by an N2O reductase assay. Sediments consumed small added quantities of N2O over short periods (a few hours). In experiments with sediment slurries, N2O reductase activity was inhibited by O2, C2H2, heat treatment, and by high levels of nitrate (1 mM) or sulfide (10 mM). However, ambient levels of nitrate (<100 μM) did not influence activity, and moderate levels (about 150 μM) induced only a short lag before reductase activity began. Moderate levels of sulfide (<1 mM) had no effect on N2O reductase activity. Nitrous oxide reductase displayed Michaelis-Menten kinetics in sediments from freshwater (Km = 2.17 μM), estuarine (Km = 14.5 μM), and alkaline-saline (Km = 501 μM) environments. An in situ assay was devised in which a solution of N2O was injected into sealed glass cores containing intact sediment. Two estimates of net rates of denitrification in San Francisco Bay under approximated in situ conditions were 0.009 and 0.041 mmol of N2O per m2 per h. Addition of chlorate to inhibit denitrification in these intact-core experiments (to estimate gross rates of N2O consumption) resulted in approximately a 14% upward revision of estimates of net rates. These results were comparable to an in situ estimate of 0.022 mmol of N2O per m2 per h made with the acetylene block assay.

  15. Prematurely terminated slug tests

    SciTech Connect

    Karasaki, K. )

    1990-07-01

    A solution of the well response to a prematurely terminated slug test (PTST) is presented. The advantages of a PTST over conventional slug tests are discussed. A systematized procedure of a PTST is proposed, where a slug test is terminated in the midpoint of the flow point, and the subsequent shut-in data is recorded and analyzed. This method requires a downhole shut-in device and a pressure transducer, which is no more than the conventional deep-well slug testing. As opposed to slug tests, which are ineffective when a skin is present, more accurate estimate of formation permeability can be made using a PTST. Premature termination also shortens the test duration considerably. Because in most cases no more information is gained by completing a slug test to the end, the author recommends that conventional slug tests be replaced by the premature termination technique. This study is part of an investigation of the feasibility of geologic isolation of nuclear wastes being carried out by the US Department of Energy and the National Cooperative for the Storage of Radioactive Waste of Switzerland.

  16. Navy Multiband Terminal (NMT)

    DTIC Science & Technology

    2015-12-01

    Selected Acquisition Report (SAR) RCS: DD-A&T(Q&A)823-290 Navy Multiband Terminal (NMT) As of FY 2017 President’s Budget Defense Acquisition...Research, Development, Test, and Evaluation SAR - Selected Acquisition Report SCP - Service Cost Position TBD - To Be Determined TY - Then Year UCR

  17. Trauma and termination.

    PubMed

    Ferraro, F

    1995-02-01

    The author suggests a particular reading of the thesis put forward by Freud in 'Analysis terminable and interminable' that an effective and more definitive conclusion may be expected in analyses of cases with traumatic aetiology. This reading shifts the emphasis from the patient's history to the possibility of its crystallising in focal nuclei emerging within the analytic relationship under the pressure of the termination. The revival of separation anxieties which cannot be worked through, and their crystallisation in precipitating traumatic events, may give rise to decisive psychic work allowing the analysis to be brought to a conclusion. Two case histories are presented to show how the end of the analysis assumes the form of a new trauma, which reactivates in the present, traumatic anxieties from the patient's own infantile history. In the first case a premature birth and in the second a miscarriage, originally experienced as isolated automatic events without time or history, are relived in the terminal phase as vicissitudes of the transference, so that new meaning can be assigned to them and they can be withdrawn from the somatic cycle of repetition. The powerful tendency to act out and the intense countertransference pressure on the analyst are discussed in the light of the specificities of this phase, which is crucial to the success of the analysis. This leads to a re-examination, in the concluding notes, of some theoretical questions inherent in the problem of the termination and, in particular, to a discussion of the ambiguous concept of a natural ending.

  18. Modeling Terminal Velocity

    ERIC Educational Resources Information Center

    Brand, Neal; Quintanilla, John A.

    2013-01-01

    Using a simultaneously falling softball as a stopwatch, the terminal velocity of a whiffle ball can be obtained to surprisingly high accuracy with only common household equipment. This classroom activity engages students in an apparently daunting task that nevertheless is tractable, using a simple model and mathematical techniques at their…

  19. Settings for Terminal Care.

    ERIC Educational Resources Information Center

    Corless, Inge B.

    1988-01-01

    Examines topics related to delivery of terminal care services: ability of various hospice programs to survive financially, contributions of various models of hospice care, impact of Medicare legislation on hospice movement, demonstration of unique hospice intervention, integration of spiritual care into hospice, and role of hospice in care of…

  20. Shipboard regasification terminal

    SciTech Connect

    Campbell, G.; Zednik, J.

    1999-07-01

    Mobil Technology Company and Mobil Shipping and Transportation Company have jointly developed a new combination of existing proven equipment to regasify LNG. Advantages of this Shipboard Regasification Terminal (SRT) include accelerated initial gas delivery schedule, low capital cost, delivery of smaller quantities of LNG at a competitive price and shorter term of LNG purchase and improved financing options. These advantages benefit both the supplier of LNG and the purchaser. SRT can be used as an interim supply to developing markets allowing the demand to grow while developing downstream infrastructure. This concept does not involve offshore transfer of cryogenic fluids while delivering near-ambient temperature pipeline quality gas at typical pipeline pressures. During times when gas is not required, the SRT ship can easily be returned to the trade of transporting and delivering LNG to conventional land based terminals. This paper will discuss the merits of Shipboard Regasification Terminals in general, cover the development of this concept and review the factors guiding the use of SRT vs. an onshore terminal.

  1. Identification and characterization of 2-naphthoyl-coenzyme A reductase, the prototype of a novel class of dearomatizing reductases.

    PubMed

    Eberlein, Christian; Estelmann, Sebastian; Seifert, Jana; von Bergen, Martin; Müller, Michael; Meckenstock, Rainer U; Boll, Matthias

    2013-06-01

    The enzymatic dearomatization of aromatic ring systems by reduction represents a highly challenging redox reaction in biology and plays a key role in the degradation of aromatic compounds under anoxic conditions. In anaerobic bacteria, most monocyclic aromatic growth substrates are converted to benzoyl-coenzyme A (CoA), which is then dearomatized to a conjugated dienoyl-CoA by ATP-dependent or -independent benzoyl-CoA reductases. It was unresolved whether or not related enzymes are involved in the anaerobic degradation of environmentally relevant polycyclic aromatic hydrocarbons (PAHs). In this work, a previously unknown dearomatizing 2-naphthoyl-CoA reductase was purified from extracts of the naphthalene-degrading, sulphidogenic enrichment culture N47. The oxygen-tolerant enzyme dearomatized the non-activated ring of 2-naphthoyl-CoA by a four-electron reduction to 5,6,7,8-tetrahydro-2-naphthoyl-CoA. The dimeric 150 kDa enzyme complex was composed of a 72 kDa subunit showing sequence similarity to members of the flavin-containing 'old yellow enzyme' family. NCR contained FAD, FMN, and an iron-sulphur cluster as cofactors. Extracts of Escherichia coli expressing the encoding gene catalysed 2-naphthoyl-CoA reduction. The identified NCR is a prototypical enzyme of a previously unknown class of dearomatizing arylcarboxyl-CoA reductases that are involved in anaerobic PAH degradation; it fundamentally differs from known benzoyl-CoA reductases.

  2. Crystal structures of pinoresinol-lariciresinol and phenylcoumaran benzylic ether reductases and their relationship to isoflavone reductases

    NASA Technical Reports Server (NTRS)

    Min, Tongpil; Kasahara, Hiroyuki; Bedgar, Diana L.; Youn, Buhyun; Lawrence, Paulraj K.; Gang, David R.; Halls, Steven C.; Park, HaJeung; Hilsenbeck, Jacqueline L.; Davin, Laurence B.; Lewis, Norman G.; Kang, ChulHee

    2003-01-01

    Despite the importance of plant lignans and isoflavonoids in human health protection (e.g. for both treatment and prevention of onset of various cancers) as well as in plant biology (e.g. in defense functions and in heartwood development), systematic studies on the enzymes involved in their biosynthesis have only recently begun. In this investigation, three NADPH-dependent aromatic alcohol reductases were comprehensively studied, namely pinoresinol-lariciresinol reductase (PLR), phenylcoumaran benzylic ether reductase (PCBER), and isoflavone reductase (IFR), which are involved in central steps to the various important bioactive lignans and isoflavonoids. Of particular interest was in determining how differing regio- and enantiospecificities are achieved with the different enzymes, despite each apparently going through similar enone intermediates. Initially, the three-dimensional x-ray crystal structures of both PLR_Tp1 and PCBER_Pt1 were solved and refined to 2.5 and 2.2 A resolutions, respectively. Not only do they share high gene sequence similarity, but their structures are similar, having a continuous alpha/beta NADPH-binding domain and a smaller substrate-binding domain. IFR (whose crystal structure is not yet obtained) was also compared (modeled) with PLR and PCBER and was deduced to have the same overall basic structure. The basis for the distinct enantio-specific and regio-specific reactions of PCBER, PLR, and IFR, as well as the reaction mechanism and participating residues involved (as identified by site-directed mutagenesis), are discussed.

  3. Immunological approach to the regulation of nitrate reductase in Monoraphidium braunii.

    PubMed

    Díez, J; López-Ruiz, A

    1989-02-01

    The effects of different culture conditions on nitrate reductase activity and nitrate reductase protein from Monoraphidium braunii have been studied, using two different immunological techniques, rocket immunoelectrophoresis and an enzyme-linked immunosorbent assay, to determine nitrate reductase protein. The nitrogen sources ammonium and glutamine repressed nitrate reductase synthesis, while nitrite, alanine, and glutamate acted as derepressors. There was a four- to eightfold increase of nitrate reductase activity and a twofold increase of nitrate reductase protein under conditions of nitrogen starvation versus growth on nitrate. Nitrate reductase synthesis was repressed in darkness. However, when Monoraphidium was grown under heterotrophic conditions with glucose as the carbon and energy source, the synthesis of nitrate reductase was maintained. With ammonium or darkness, changes in nitrate reductase activity correlated fairly well with changes in nitrate reductase protein, indicating that in both cases loss of activity was due to repression and not to inactivation of the enzyme. Experiments using methionine sulfoximine, to inhibit ammonium assimilation, showed that ammonium per se and not a product of its metabolism was the corepressor of the enzyme. The appearance of nitrate reductase activity after transferring the cells to induction media was prevented by cycloheximide and by 6-methylpurine, although in this latter case the effect was observed only in cells preincubated with the inhibitor for 1 h before the induction period.

  4. Recominant Pinoresino-Lariciresinol Reductase, Recombinant Dirigent Protein And Methods Of Use

    DOEpatents

    Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki , Gang; David R. , Sarkanen; Simo , Ford; Joshua D.

    2003-10-21

    Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided from source species Forsythia intermedia, Thuja plicata, Tsuga heterophylla, Eucommia ulmoides, Linum usitatissimum, and Schisandra chinensis, which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

  5. Recombinant pinoresinol/lariciresinol reductase, recombinant dirigent protein, and methods of use

    DOEpatents

    Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki; Gang, David R.; Sarkanen, Simo; Ford, Joshua D.

    2001-04-03

    Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

  6. Molecular Underpinnings of Fe(III) Oxide Reduction by Shewanella oneidensis MR-1

    SciTech Connect

    Shi, Liang; Rosso, Kevin M.; Clarke, Thomas A.; Richardson, David J.; Zachara, John M.; Fredrickson, Jim K.

    2012-02-15

    In the absence of O2 and other electron acceptors, the Gram-negative bacterium Shewanella oneidensis MR-1 can use ferric [Fe(III)] (oxy)(hydr)oxide minerals as the terminal electron acceptors for anaerobic respiration. At circumneutral pH and in the absence of strong complexing ligands, Fe(III) oxides are relatively insoluble and thus are external to the bacterial cells. S. oneidensis MR-1 and related strains of metal-reducing Shewanella have evolved the machinery (i.e., metal-reducing or Mtr pathway) for transferring electrons from the inner-membrane, through the periplasm and across the outer-membrane to the surface of extracellular Fe(III) oxides. The protein components identified to date for the Mtr pathway include CymA, MtrA, MtrB, MtrC and OmcA. CymA is an inner-membrane tetraheme c-type cytochrome (c-Cyt) that belongs to the NapC/NrfH family of quinol dehydrogenases. It is proposed that CymA oxidizes the quinol in the inner-membrane and transfers the released electrons to redox proteins in the periplasm. Although the periplasmic proteins receiving electrons from CymA during Fe(III) oxidation have not been identified, they are believed to relay the electrons in the periplasm to MtrA. A decaheme c-Cyt, MtrA is thought to be embedded in the trans outer-membrane and porin-like protein MtrB. Together, MtrAB deliver the electrons through the outer-membrane to the MtrC and OmcA on the outmost bacterial surface. MtrC and OmcA are the outer-membrane decaheme c-Cyts that are translocated across the outer-membrane by the bacterial type II secretion system. Functioning as terminal reductases, MtrC and OmcA can bind the surface of Fe(III) oxides and transfer electrons directly to these minerals via their solvent-exposed hemes. To increase their reaction rates, MtrC and OmcA can use the flavins secreted by S. oneidensis MR-1 cells as diffusible co-factors for reduction of Fe(III) oxides. Because of their extracellular location and broad redox potentials, MtrC and OmcA can

  7. The X-ray crystal structure of APR-B, an atypical adenosine 5'-phosphosulfate reductase from Physcomitrella patens.

    PubMed

    Stevenson, Clare E M; Hughes, Richard K; McManus, Michael T; Lawson, David M; Kopriva, Stanislav

    2013-11-15

    Sulfonucleotide reductases catalyse the first reductive step of sulfate assimilation. Their substrate specificities generally correlate with the requirement for a [Fe4S4] cluster, where adenosine 5'-phosphosulfate (APS) reductases possess a cluster and 3'-phosphoadenosine 5'-phosphosulfate reductases do not. The exception is the APR-B isoform of APS reductase from the moss Physcomitrella patens, which lacks a cluster. The crystal structure of APR-B, the first for a plant sulfonucleotide reductase, is consistent with a preference for APS. Structural conservation with bacterial APS reductase rules out a structural role for the cluster, but supports the contention that it enhances the activity of conventional APS reductases.

  8. Dusty Termination Shocks

    SciTech Connect

    Ip, W.H.

    2004-09-15

    In astrophysical settings, termination shocks where strong stellar wind outflows interact with the surrounding environments tend to take place in dusty regions. Just to name a few, star formation regions, planetary nebulae, supernova remnants and active galactic nuclei are all good examples. Dynamics and evolution of the associated dust clouds could have important influences on the acceleration and composition of energetic particles resulting from the diffusive shock acceleration at the termination shocks. In this note we provide a brief review of previous work predating the recent detection of ACR Mg, Na, Si and S ions which might have originated from the Kuiper belt dust. Their compositional abundance might be diagnostic of the collisional history of the Kupier belt objects.

  9. Mobile Phone Terminal

    NASA Technical Reports Server (NTRS)

    1978-01-01

    In the photo, an employee of a real estate firm is contacting his office by means of HICOM, an advanced central terminal for mobile telephones. Developed by the Orlando Division of Martin Marietta Aerospace, Orlando, Florida, and manufactured by Harris Corporation's RF Division, Rochester, N.Y., HICOM upgrades service to users, provides better system management to telephone companies, and makes more efficient use of available mobile telephone channels through a computerized central control terminal. The real estate man, for example, was able to dial his office and he could also have direct-dialed a long distance number. Mobile phones in most areas not yet served by HICOM require an operator's assistance for both local and long distance calls. HICOM improves system management by automatically recording information on all calls for accurate billing, running continual performance checks on its own operation, and reporting any malfunctions to a central office.

  10. Shipboard fisheries management terminals

    NASA Technical Reports Server (NTRS)

    Nagler, R. G.; Sager, E. V.

    1980-01-01

    The needs of the National Marine Fisheries Service (NMGS), National Weather Service, and the U.S. Coast Guard for locational, biological, and environmental data were assessed. The fisheries conservation zones and the yellowfin tuna jurisdiction of the NMFS operates observer programs on foreign and domestic fishing vessels. Data input terminal and data transfer and processing technology are reviewed to establish available capability. A matrix of implementation options is generated to identify the benefits of each option, and preliminary cost estimates are made. Recommendations are made for incremental application of available off the shelf hardware to obtain improved performance and benefits within a well bounded cost. Terminal recommendations are made for three interdependent shipboard units emphasizing: (1) the determination of location and fishing activity; (2) hand held data inputting and formatting in the fishing work areas; and (3) data manipulation, merging, and editing.

  11. Ice age terminations.

    PubMed

    Cheng, Hai; Edwards, R Lawrence; Broecker, Wallace S; Denton, George H; Kong, Xinggong; Wang, Yongjin; Zhang, Rong; Wang, Xianfeng

    2009-10-09

    230Th-dated oxygen isotope records of stalagmites from Sanbao Cave, China, characterize Asian Monsoon (AM) precipitation through the ends of the third- and fourthmost recent ice ages. As a result, AM records for the past four glacial terminations can now be precisely correlated with those from ice cores and marine sediments, establishing the timing and sequence of major events. In all four cases, observations are consistent with a classic Northern Hemisphere summer insolation intensity trigger for an initial retreat of northern ice sheets. Meltwater and icebergs entering the North Atlantic alter oceanic and atmospheric circulation and associated fluxes of heat and carbon, causing increases in atmospheric CO2 and Antarctic temperatures that drive the termination in the Southern Hemisphere. Increasing CO2 and summer insolation drive recession of northern ice sheets, with probable positive feedbacks between sea level and CO2.

  12. Navy Multiband Terminal (NMT)

    DTIC Science & Technology

    2013-12-01

    Acquisition Management Information Retrieval Dev Est - Development Estimate DoD - Department of Defense DSN - Defense Switched Network Econ - Economic Eng...Memo Note for Shore (for MTBF and MTBCF): Represents IOT &E and Verification of Correction of Deficiencies testing results; mission impact deemed...insignificant due to multiple terminals at Shore site. Note for Sub (for MTBF, MTBCF and MTTR): Represents IOT &E hours; test duration limit for

  13. Amine terminated bisaspartimide polymer

    NASA Technical Reports Server (NTRS)

    Kumar, D. (Inventor); Fohlen, G. M. (Inventor); Parker, J. A. (Inventor)

    1986-01-01

    Novel amine terminated bisaspartimides are prepared by a Michael-type reaction of an aromatic bismalteimide and an aromatic diamine in an aprotic solvent. These bisaspartimides are thermally polymerized to yield tough, resinous polymers cross-lined through -NH- groups. Such polymers are useful in applications requiring materials with resistance to change at elevated temperatures, e.g., as lightweight laminates with graphite cloth, molding material prepregs, adhesives and insulating material.

  14. Remote terminal system evaluation

    NASA Technical Reports Server (NTRS)

    Phillips, T. L.; Grams, H. L.; Lindenlaub, J. C.; Schwingendorf, S. K.; Swain, P. H.; Simmons, W. R.

    1975-01-01

    An Earth Resources Data Processing System was developed to evaluate the system for training, technology transfer, and data processing. In addition to the five sites included in this project two other sites were connected to the system under separate agreements. The experience of these two sites is discussed. The results of the remote terminal project are documented in seven reports: one from each of the five project sites, Purdue University, and an overview report summarizing the other six reports.

  15. A salt-inducible chloroplastic monodehydroascorbate reductase from halophyte Avicennia marina confers salt stress tolerance on transgenic plants.

    PubMed

    Kavitha, Kumaresan; George, Suja; Venkataraman, Gayatri; Parida, Ajay

    2010-10-01

    Plant growth and productivity are adversely affected by various abiotic stress factors. In our previous study, we used Avicennia marina, a halophytic mangrove, as a model plant system for isolating genes functioning in salt stress tolerance. A large scale random EST sequencing from a salt stressed leaf tissue cDNA library of one month old A. marina plants resulted in identification of a clone showing maximum homology to Monodehydroascorbate reductase (Am-MDAR). MDAR plays a key role in regeneration of ascorbate from monodehydroascorbate for ROS scavenging. In this paper, we report the cellular localization and the ability to confer salt stress tolerance in transgenic tobacco of this salt inducible Am-MDAR. A transit peptide at the N-terminal region of Am-MDAR suggested that it encodes a chloroplastic isoform. The chloroplastic localization was confirmed by stable transformation and expression of the Am-MDAR-GFP fusion protein in tobacco. Transgenic tobacco plants overexpressing Am-MDAR survived better under conditions of salt stress compared to untransformed control plants. Assays of enzymes involved in ascorbate-glutathione cycle revealed an enhanced activity of MDAR and ascorbate peroxidase whereas the activity of dehyroascorbate reductase was reduced under salt stressed and unstressed conditions in Am-MDAR transgenic lines. The transgenic lines showed an enhanced redox state of ascorbate and reduced levels of malondialdehyde indicating its enhanced tolerance to oxidative stress. The results of our studies could be used as a starting point for genetic engineering of economically important plants tolerant to salt stress.

  16. Insights into function, catalytic mechanism, and fold evolution of selenoprotein methionine sulfoxide reductase B1 through structural analysis.

    PubMed

    Aachmann, Finn L; Sal, Lena S; Kim, Hwa-Young; Marino, Stefano M; Gladyshev, Vadim N; Dikiy, Alexander

    2010-10-22

    Methionine sulfoxide reductases protect cells by repairing oxidatively damaged methionine residues in proteins. Here, we report the first three-dimensional structure of the mammalian selenoprotein methionine sulfoxide reductase B1 (MsrB1), determined by high resolution NMR spectroscopy. Heteronuclear multidimensional spectra yielded NMR spectral assignments for the reduced form of MsrB1 in which catalytic selenocysteine (Sec) was replaced with cysteine (Cys). MsrB1 consists of a central structured core of two β-sheets and a highly flexible, disordered N-terminal region. Analysis of pH dependence of NMR signals of catalytically relevant residues, comparison with the data for bacterial MsrBs, and NMR-based structural analysis of methionine sulfoxide (substrate) and methionine sulfone (inhibitor) binding to MsrB1 at the atomic level reveal a mechanism involving catalytic Sec(95) and resolving Cys(4) residues in catalysis. The MsrB1 structure differs from the structures of Cys-containing MsrBs in the use of distal selenenylsulfide, residues needed for catalysis, and the mode in which the active form of the enzyme is regenerated. In addition, this is the first structure of a eukaryotic zinc-containing MsrB, which highlights the structural role of this metal ion bound to four conserved Cys. We integrated this information into a structural model of evolution of MsrB superfamily.

  17. The respiratory arsenate reductase from Bacillus selenitireducens strain MLS10

    USGS Publications Warehouse

    Afkar, E.; Lisak, J.; Saltikov, C.; Basu, P.; Oremland, R.S.; Stolz, J.F.

    2003-01-01

    The respiratory arsenate reductase from the Gram-positive, haloalkaliphile, Bacillus selenitireducens strain MLS10 was purified and characterized. It is a membrane bound heterodimer (150 kDa) composed of two subunits ArrA (110 kDa) and ArrB (34 kDa), with an apparent Km for arsenate of 34 ??M and Vmax of 2.5 ??mol min-1 mg-1. Optimal activity occurred at pH 9.5 and 150 g l-1 of NaCl. Metal analysis (inductively coupled plasma mass spectrometry) of the holoenzyme and sequence analysis of the catalytic subunit (ArrA; the gene for which was cloned and sequenced) indicate it is a member of the DMSO reductase family of molybdoproteins. ?? 2003 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

  18. Pyrroline-5-Carboxylate Reductase in Soybean Nodules 1

    PubMed Central

    Chilson, Oscar P.; Kelly-Chilson, Anne E.; Schneider, Julie D.

    1992-01-01

    Characteristics of pyrroline-5-carboxylate reductase (P5CR) from Bradyrhizobium japonicum bacteroids and cultured rhizobia were compared with those of the enzyme in soybean nodule host cytosol. Reductase from host cytosol differed from that in bacteroids in: (a) the effect of pH on enzymic activity, (b) the capacity to catalyze both reduction of pyrroline-5-carboxylic acid and NAD+-dependent proline oxidation, (c) apparent affinities for pyrroline-5-carboxylic acid, and (d) sensitivities to inhibition by NADP+ and proline. The K1 for proline inhibition of P5CR in bacteroid cytosol was 1.8 millimolar. The properties of P5CR in B. japonicum and bacteroid cytosol were similar. The specific activities of P5CR in the cytosolic fractions of the nodule host and the bacteroid compartment were also comparable. PMID:16668837

  19. Characterization of 12-Oxo-Phytodienoic Acid Reductase in Corn

    PubMed Central

    Vick, Brady A.; Zimmerman, Don C.

    1986-01-01

    12-Oxo-phytodienoic acid reductase, an enzyme of the biosynthetic pathway that converts linolenic acid to jasmonic acid, has been characterized from the kernel and seedlings of corn (Zea mays L.). The molecular weight of the enzyme, estimated by gel filtration, was 54,000. Optimum enzyme activity was observed over a broad pH range, from pH 6.8 to 9.0. The enzyme had a Km of 190 micromolar for its substrate, 12-oxo-phytodienoic acid. The preferred reductant was NADPH, for which the enzyme exhibited a Km of 13 micromolar, compared with 4.2 millimolar for NADH. Reductase activity was low in the corn kernel but increased five-fold by the fifth day after germination and then gradually declined. PMID:16664582

  20. Selenoprotein A component of the glycine reductase complex from Clostridium purinolyticum: nucleotide sequence of the gene shows that selenocysteine is encoded by UGA.

    PubMed Central

    Garcia, G E; Stadtman, T C

    1991-01-01

    The gene encoding the selenoprotein A component of glycine reductase was isolated from Clostridium purinolyticum. The nucleotide sequence of this gene (grdA) was determined. The opal termination codon (TGA) was found in-frame at the position corresponding to the location of the selenocysteine residue in the gene product. A comparison of the nucleotide sequences and secondary mRNA structures corresponding to the selenoprotein A gene and the fdhF gene of Escherichia coli formate dehydrogenase shows that there is a similar potential for regulation of the specific insertion of selenocysteine at the UGA codon. PMID:1825826

  1. Selenoprotein A component of the glycine reductase complex from Clostridium purinolyticum: nucleotide sequence of the gene shows that selenocysteine is encoded by UGA.

    PubMed

    Garcia, G E; Stadtman, T C

    1991-03-01

    The gene encoding the selenoprotein A component of glycine reductase was isolated from Clostridium purinolyticum. The nucleotide sequence of this gene (grdA) was determined. The opal termination codon (TGA) was found in-frame at the position corresponding to the location of the selenocysteine residue in the gene product. A comparison of the nucleotide sequences and secondary mRNA structures corresponding to the selenoprotein A gene and the fdhF gene of Escherichia coli formate dehydrogenase shows that there is a similar potential for regulation of the specific insertion of selenocysteine at the UGA codon.

  2. [Properties of a nitrite reductase inhibitor protein from Pseudomonas aeruginosa].

    PubMed

    Karapetian, A V; Nalbandian, R M

    1993-08-01

    The amino acid composition and major physico-chemical properties of the "nonblue" copper protein isolated earlier from Pseudomonas aeruginosa have been determined. It has been found that the azurin oxidase, cytochrome c551 oxidase and superoxide dismutase activities of the enzyme are inhibited by this protein. The inhibition seems to be due to the protein interaction with the electron-accepting center of nitrite reductase.

  3. The Ethics of Terminal Care

    ERIC Educational Resources Information Center

    Agich, George J.

    1978-01-01

    Need for a critical and analytical approach to ethics of terminal care is suggested by considering a series of unexamined questions regarding justification of terminal care. If terminal care is a moral and ethical enterprise, such considerations must be given a more prominent place in discussions of the hospice movement. (Author)

  4. Aldose and aldehyde reductases : structure-function studies on the coenzyme and inhibitor-binding sites.

    SciTech Connect

    El-Kabbani, O.; Old, S. E.; Ginell, S. L.; Carper, D. A.; Biosciences Division; Monash Univ.; NIH

    1999-09-03

    PURPOSE: To identify the structural features responsible for the differences in coenzyme and inhibitor specificities of aldose and aldehyde reductases. METHODS: The crystal structure of porcine aldehyde reductase in complex with NADPH and the aldose reductase inhibitor sorbinil was determined. The contribution of each amino acid lining the coenzyme-binding site to the binding of NADPH was calculated using the Discover package. In human aldose reductase, the role of the non-conserved Pro 216 (Ser in aldehyde reductase) in the binding of coenzyme was examined by site-directed mutagenesis. RESULTS: Sorbinil binds to the active site of aldehyde reductase and is hydrogen-bonded to Trp 22, Tyr 50, His 113, and the non-conserved Arg 312. Unlike tolrestat, the binding of sorbinil does not induce a change in the side chain conformation of Arg 312. Mutation of Pro 216 to Ser in aldose reductase makes the binding of coenzyme more similar to that of aldehyde reductase. CONCLUSIONS: The participation of non-conserved active site residues in the binding of inhibitors and the differences in the structural changes required for the binding to occur are responsible for the differences in the potency of inhibition of aldose and aldehyde reductases. We report that the non-conserved Pro 216 in aldose reductase contributes to the tight binding of NADPH.

  5. Early diagnosis and management of 5 alpha-reductase deficiency.

    PubMed Central

    Odame, I; Donaldson, M D; Wallace, A M; Cochran, W; Smith, P J

    1992-01-01

    Two siblings of Pakistani origin, karyotype 46 XY, were born with predominantly female external genitalia with minute phallus, bifid scrotum, urogenital sinus, and palpable gonads. The older sibling at the age of 8 days showed an adequate testosterone response to human chorionic gonadotrophin (hCG) stimulation. The diagnosis of 5 alpha-reductase deficiency was made at age 6 years when no 5 alpha-reduced glucocorticoid metabolites were detectable in urine even after tetracosactrin (Synacthen) stimulation. In the younger sibling the diagnosis of 5 alpha-reductase deficiency was provisionally made at the early age of 3 days on the basis of high urinary tetrahydrocortisol (THF)/allotetrahydrocortisol (5 alpha-THF) ratio and this ratio increased with age confirming the diagnosis. Plasma testosterone: dihydrotestosterone (DHT) ratio before and after hCG stimulation was within normal limits at age 3 days but was raised at age 9 months. Topical DHT cream application to the external genitalia promoted significant phallic growth in both siblings and in the older sibling corrective surgery was facilitated. In prepubertal male pseudohermaphrodites with normal or raised testosterone concentrations, phallic growth in response to DHT cream treatment could be an indirect confirmation of 5 alpha-reductase deficiency. Images Figure 1 PMID:1626992

  6. The existence and significance of a mitochondrial nitrite reductase.

    PubMed

    Nohl, Hans; Staniek, Katrin; Kozlov, Andrey V

    2005-01-01

    The physiological functions of nitric oxide (NO) are well established. The finding that the endothelium-derived relaxing factor (EDRF) is NO was totally unexpected. It was shown that NO is a reaction product of an enzymatically catalyzed, overall, 5-electron oxidation of guanidinium nitrogen from L-arginine followed by the release of the free radical species NO. NO is synthesized by a single protein complex supported by cofactors, coenzymes (such as tetrahydrobiopterin) and cytochrome P450. The latter can uncouple from substrate oxidation producing O2*- radicals. The research groups of Richter [Ghafourifar P, Richter C. Nitric oxide synthase activity in mitochondria. FEBS Lett 1997; 418: 291-296.] and Boveris [Giulivi C, Poderoso JJ, Boveris A. Production of nitric oxide by mitochondria. J Biol Chem 1998; 273: 11038-11043.] identified a mitochondrial NO synthase (NOS). There are, however, increasing reports demonstrating that mitochondrial NO is derived from cytosolic NOS belonging to the Ca2+-dependent enzymes. NO was thought to control cytochrome oxidase. This assumption is controversial due to the life-time of NO in biological systems (millisecond range). We found a nitrite reductase in mitochondria which is of major interest. Any increase of nitrite in the tissue which is the first oxidation product of NO, for instance following NO donors, will stimulate NO-recycling via mitochondrial nitrite reductase. In this paper, we describe the identity and the function of mitochondrial nitrite reductase and the consequences of NO-recycling in the metabolic compartment of mitochondria.

  7. Phosphoglycerate kinase acts in tumour angiogenesis as a disulphide reductase

    NASA Astrophysics Data System (ADS)

    Lay, Angelina J.; Jiang, Xing-Mai; Kisker, Oliver; Flynn, Evelyn; Underwood, Anne; Condron, Rosemary; Hogg, Philip J.

    2000-12-01

    Disulphide bonds in secreted proteins are considered to be inert because of the oxidizing nature of the extracellular milieu. An exception to this rule is a reductase secreted by tumour cells that reduces disulphide bonds in the serine proteinase plasmin. Reduction of plasmin initiates proteolytic cleavage in the kringle 5 domain and release of the tumour blood vessel inhibitor angiostatin. New blood vessel formation or angiogenesis is critical for tumour expansion and metastasis. Here we show that the plasmin reductase isolated from conditioned medium of fibrosarcoma cells is the glycolytic enzyme phosphoglycerate kinase. Recombinant phosphoglycerate kinase had the same specific activity as the fibrosarcoma-derived protein. Plasma of mice bearing fibrosarcoma tumours contained several-fold more phosphoglycerate kinase, as compared with mice without tumours. Administration of phosphoglycerate kinase to tumour-bearing mice caused an increase in plasma levels of angiostatin, and a decrease in tumour vascularity and rate of tumour growth. Our findings indicate that phosphoglycerate kinase not only functions in glycolysis but is secreted by tumour cells and participates in the angiogenic process as a disulphide reductase.

  8. The effect of quercetin and galangin on glutathione reductase.

    PubMed

    Paulíková, Helena; Berczeliová, Elena

    2005-12-01

    Quercetin and galangin can change the activity of glutathione reductase. Quercetin (a catechol structure in the B-ring) and galangin (any hydroxyl group in the B-ring) have different biological activities but, both possess high antioxidant abilities. Quercetin during the antioxidative action, is converted into an oxidized products (o-semiquinone and o-quinone), and subsequently glutathionyl adducts may be formed or SH-enzyme can be inhibited. We have tried to see whether inhibition of glutathione reductase (GR) can be influenced by preincubation of enzyme with NADPH (a creation of reduced form of enzyme, GRH(2)) and whether diaphorase activity of the enzyme is decreased by these flavonoids. The results confirmed that quercetin inhibits GRH(2) and inhibition is reduced by addition of EDTA or N-acetylcysteine. Both of flavonoids have no effect on diaphorase activity of glutathione reductase and this enzyme could increase the production of free radicals by catalysis of reduction of o-quinone during action of quercetin in vivo.

  9. Expression and purification of thioredoxin (TrxA) and thioredoxin reductase (TrxB) from Brevibacillus choshinensis.

    PubMed

    Tanaka, Ryoichi; Kosugi, Kotaro; Mizukami, Makoto; Ishibashi, Matsujiro; Tokunaga, Hiroko; Tokunaga, Masao

    2004-10-01

    Brevibacillus choshinensis (formerly Bacillus brevis) is a protein-hyperproducing bacterium and has been used for commercial protein production. Here, we cloned thioredoxin (trxA) and thioredoxin reductase (trxB) genes from B. choshinensis, and expressed the gene products in Escherichia coli with an amino-terminal hexa-His-tag for purification and characterization. His-TrxA and His-TrxB were purified to homogeneity with one-step Ni-NTA affinity column chromatography, and the two recombinant proteins showed identical specific activity with or without removal of the amino-terminal His-tag, indicating that the extrasequence containing the hexa-His-tag did not affect their enzymatic activities. The E. coli expression system used here resulted in a 40-fold increase in production of His-TrxB protein compared to the level of native TrxB produced in non-recombinant B. choshinensis cells. TrxA and TrxB proteins with carboxy-terminal His-tag (TrxA-His and TrxB-His) were successfully expressed in B. choshinensis and were purified by Ni-NTA column chromatography. Co-expression of TrxA-His with recombinant human epidermal growth factor (hEGF) in B. choshinensis promoted the extracellular production of hEGF by up to about 200%.

  10. Catalytic mechanism and substrate selectivity of aldo-keto reductases: insights from structure-function studies of Candida tenuis xylose reductase.

    PubMed

    Kratzer, Regina; Wilson, David K; Nidetzky, Bernd

    2006-09-01

    Aldo-keto reductases (AKRs) constitute a large protein superfamily of mainly NAD(P)-dependent oxidoreductases involved in carbonyl metabolism. Catalysis is promoted by a conserved tetrad of active site residues (Tyr, Lys, Asp and His). Recent results of structure-function relationship studies for xylose reductase (AKR2B5) require an update of the proposed catalytic mechanism. Electrostatic stabilization by the epsilon-NH3+ group of Lys is a key source of catalytic power of xylose reductase. A molecular-level analysis of the substrate binding pocket of xylose reductase provides a case of how a very broadly specific AKR achieves the requisite selectivity for its physiological substrate and could serve as the basis for the design of novel reductases with improved specificities for biocatalytic applications.

  11. Structure/Function Analysis of Protein-Protein Interactions and Role of Dynamic Motions in Mercuric Ion Reductase

    SciTech Connect

    Miller, Susan M.

    2005-05-18

    This report summarizes the activities and findings of our structure/function studies of the bacterial detoxification enzyme mercuric ion reductase. The objectives of the work were to obtain crystal structure information for the catalytic core of this enzyme, use the information to investigate the importance of specific parts of the enzyme to its function, and investigate the role of one domain of the enzyme in its function within cells. We describe the accomplishments towards these goals including many structures of the wild type and mutant forms of the enzyme that highlight its interactions with its Hg(II) substrate, elucidation of the role of the N-terminal domain in vitro and in vivo, and elucidation of the roles of at two conserved residues in the core in the mechanism of catalysis.

  12. Protein kinase activity associated with the large subunit of herpes simplex virus type 2 ribonucleotide reductase (ICP10).

    PubMed Central

    Chung, T D; Wymer, J P; Smith, C C; Kulka, M; Aurelian, L

    1989-01-01

    The large subunit of the herpes simplex virus type 2 (HSV-2) ribonucleotide reductase (RR1) is demonstrated to possess serine/threonine-specific kinase activity. Computer-assisted sequence analysis identified regions within the amino terminus of ICP10 that are homologous to the catalytic domain of known protein kinases (PKs). An in vitro kinase assay confirmed the ability of ICP10, immunoprecipitated from either HSV-2-infected cells or from cells transfected with an ICP10 expression vector, to autophosphorylate and transphosphorylate exogenous substrates in the presence of ATP and Mg2+. The HSV-1 RR1 was shown to be negative for PK activity under these conditions. PK activity was localized to a 57-kDa amino-terminal region within ICP10 that lacked RR activity. Images PMID:2545912

  13. The effect of 5alpha-reductase inhibition with finasteride and dutasteride on bone mineral density in older men with benign prostatic hyperplasia.

    PubMed

    Mačukat, Indira Radin; Spanjol, Josip; Orlič, Zeljka Crncevič; Butorac, Marta Zuvič; Marinovič, Marin; Ćupič, Dora Fučkar

    2014-09-01

    Testosterone is converted to dihyrotestosterone by two isoenzymes of 5alpha-reductase. Finasteride and dutasteride are 5alpha-reductase inhibitors commonly used in the treatment of benign prostatic hyperplasia. We compared indices of bone mineral density in 50 men treated with finasteride, 50 men treated with dutasteride and 50 men as control. Bone mineral density of spine and hip were measured using dual energy X-ray absorptiometry. Bone formation was assessed by measuring serum osteocalcin and bone resorptionby measuring serum C-terminal telopeptide of collagen type 1. In addition serum total testosteron and estradiol were determined. The dutasteride group had significantly higher mean bone min- eral density, mean bone mineral content, mean T score, mean Z score at femoral neck and mean total hip Z score than control. Mean total testosterone and estradiol levels were higher in the dutasteride group. There were no significant dif- ferences between the groups in lumbar spine bone density parameters or bone turnover markers. Our results provide evidence that long-term 5alpha-reductase suppression does not adversely affect bone mineral density. Dutasteride therapy could have beneficial effect on bone density.

  14. Terminal weather information management

    NASA Technical Reports Server (NTRS)

    Lee, Alfred T.

    1990-01-01

    Since the mid-1960's, microburst/windshear events have caused at least 30 aircraft accidents and incidents and have killed more than 600 people in the United States alone. This study evaluated alternative means of alerting an airline crew to the presence of microburst/windshear events in the terminal area. Of particular interest was the relative effectiveness of conventional and data link ground-to-air transmissions of ground-based radar and low-level windshear sensing information on microburst/windshear avoidance. The Advanced Concepts Flight Simulator located at Ames Research Center was employed in a line oriented simulation of a scheduled round-trip airline flight from Salt Lake City to Denver Stapleton Airport. Actual weather en route and in the terminal area was simulated using recorded data. The microburst/windshear incident of July 11, 1988 was re-created for the Denver area operations. Six experienced airline crews currently flying scheduled routes were employed as test subjects for each of three groups: (1) A baseline group which received alerts via conventional air traffic control (ATC) tower transmissions; (2) An experimental group which received alerts/events displayed visually and aurally in the cockpit six miles (approx. 2 min.) from the microburst event; and (3) An additional experimental group received displayed alerts/events 23 linear miles (approx. 7 min.) from the microburst event. Analyses of crew communications and decision times showed a marked improvement in both situation awareness and decision-making with visually displayed ground-based radar information. Substantial reductions in the variability of decision times among crews in the visual display groups were also found. These findings suggest that crew performance will be enhanced and individual differences among crews due to differences in training and prior experience are significantly reduced by providing real-time, graphic display of terminal weather hazards.

  15. Terminal Analysis Study

    DTIC Science & Technology

    1976-06-01

    processor cannot provide data at a rate which is fast enough to fill the link, fill bits are inserted until the next line is ready. Each line has the...JWICROPRCXESSOR r^Zl*" MODERATELV MODERATE 7 l I FAST I HIGH Figure 3.19. General Data Proofing Trode-Of* ^peed than the...standard, .p.cify the p.oper manner > which terminals may Interface this store- and- forword message switching network. A2.3 AUTOSEVOCOM The current

  16. Methionine Sulfoxide Reductases Are Essential for Virulence of Salmonella Typhimurium

    PubMed Central

    Rouf, Syed Fazle; Kitowski, Vera; Böhm, Oliver M.; Rhen, Mikael; Jäger, Timo; Bange, Franz-Christoph

    2011-01-01

    Production of reactive oxygen species represents a fundamental innate defense against microbes in a diversity of host organisms. Oxidative stress, amongst others, converts peptidyl and free methionine to a mixture of methionine-S- (Met-S-SO) and methionine-R-sulfoxides (Met-R-SO). To cope with such oxidative damage, methionine sulfoxide reductases MsrA and MsrB are known to reduce MetSOs, the former being specific for the S-form and the latter being specific for the R-form. However, at present the role of methionine sulfoxide reductases in the pathogenesis of intracellular bacterial pathogens has not been fully detailed. Here we show that deletion of msrA in the facultative intracellular pathogen Salmonella (S.) enterica serovar Typhimurium increased susceptibility to exogenous H2O2, and reduced bacterial replication inside activated macrophages, and in mice. In contrast, a ΔmsrB mutant showed the wild type phenotype. Recombinant MsrA was active against free and peptidyl Met-S-SO, whereas recombinant MsrB was only weakly active and specific for peptidyl Met-R-SO. This raised the question of whether an additional Met-R-SO reductase could play a role in the oxidative stress response of S. Typhimurium. MsrC is a methionine sulfoxide reductase previously shown to be specific for free Met-R-SO in Escherichia (E.) coli. We tested a ΔmsrC single mutant and a ΔmsrBΔmsrC double mutant under various stress conditions, and found that MsrC is essential for survival of S. Typhimurium following exposure to H2O2, as well as for growth in macrophages, and in mice. Hence, this study demonstrates that all three methionine sulfoxide reductases, MsrA, MsrB and MsrC, facilitate growth of a canonical intracellular pathogen during infection. Interestingly MsrC is specific for the repair of free methionine sulfoxide, pointing to an important role of this pathway in the oxidative stress response of Salmonella Typhimurium. PMID:22073230

  17. Evidence for the participation of Cys sub 558 and Cys sub 559 at the active site of mercuric reductase

    SciTech Connect

    Miller, S.M.; Moore, M.J.; Massey, V.; Williams, C.H. Jr.; Distefano, M.D.; Ballou, D.P.; Walsh, C.T. )

    1989-02-07

    Mercuric reductase, with FAD and a reducible disulfide at the active site, catalyzes the two-electron reduction of Hg(II) by NADPH. Addition of reducing equivalents rapidly produces a spectrally distinct EH{sub 2} form of the enzyme containing oxidized FAD and reduced active site thiols. Formation of EH{sub 2} has previously been reported to require only 2 electrons for reduction of the active site disulfide. The authors present results of anaerobic titrations of mercuric reductase with NADPH and dithionite showing that the equilibrium conversion of oxidized enzyme to EH{sub 2} actually requires 2 equiv of reducing agent or 4 electrons. Kinetic studies conducted both at 4{degree}C and at 25{degree}C indicate that reduction of the active site occurs rapidly, as previously reported; this is followed by a slower reduction of another redox group via reaction with the active site. ({sup 14}C)Iodoacetamide labeling experiments demonstrate that the C-terminal residues, Cys{sub 558} and Cys{sub 559}, are involved in this disulfide. The fluorescence, but not the absorbance, of the enzyme-bound FAD was found to be highly dependent on the redox state of the C-terminal thiols. Thus, E{sub ox} with Cys{sub 558} and Cys{sub 559} as thiols exhibits less than 50% of the fluorescence of E{sub ox} where these residues are present as a disulfide, indicating that the thiols remain intimately associated with the active site. Initial velocity measurements show that the auxiliary disulfide must be reduced before catalytic Hg(II) reduction can occur, consistent with the report of a preactivation phenomenon with NADPH or cysteine. A modified minimal catalytic mechanism is proposed as well as several chemical mechanisms for the Hg(II) reduction step.

  18. Kinetic characteristics of ZENECA ZD5522, a potent inhibitor of human and bovine lens aldose reductase.

    PubMed

    Cook, P N; Ward, W H; Petrash, J M; Mirrlees, D J; Sennitt, C M; Carey, F; Preston, J; Brittain, D R; Tuffin, D P; Howe, R

    1995-04-18

    Aldose reductase (aldehyde reductase 2) catalyses the conversion of glucose to sorbitol, and methylglyoxal to acetol. Treatment with aldose reductase inhibitors (ARIs) is a potential approach to decrease the development of diabetic complications. The sulphonylnitromethanes are a recently discovered class of aldose reductase inhibitors, first exemplified by ICI215918. We now describe enzyme kinetic characterization of a second sulphonylnitromethane, 3',5'-dimethyl-4'-nitromethylsulphonyl-2-(2-tolyl)acetanilide (ZD5522), which is at least 10-fold more potent against bovine lens aldose reductase in vitro and which also has a greater efficacy for reduction of rat nerve sorbitol levels in vivo (ED95 = 2.8 mg kg-1 for ZD5522 and 20 mg kg-1 for ICI 215918). ZD5522 follows pure noncompetitive kinetics against bovine lens aldose reductase when either glucose or methylglyoxal is varied (K(is) = K(ii) = 7.2 and 4.3 nM, respectively). This contrasts with ICI 215918 which is an uncompetitive inhibitor (K(ii) = 100 nM) of bovine lens aldose reductase when glucose is varied. Against human recombinant aldose reductase, ZD5522 displays mixed noncompetitive kinetics with respect to both substrates (K(is) = 41 nM, K(ii) = 8 nM with glucose and K(is) = 52 nM, K(ii) = 3.8 nM with methylglyoxal). This is the first report of the effects of a sulphonylnitromethane on either human aldose reductase or utilization of methylglyoxal. These results are discussed with reference to a Di Iso Ordered Bi Bi mechanism for aldose reductase, where the inhibitors compete with binding of both the aldehyde substrate and alcohol product. This model may explain why aldose reductase inhibitors follow noncompetitive or uncompetitive kinetics with respect to aldehyde substrates, and X-ray crystallography paradoxically locates an ARI within the substrate binding site. Aldehyde reductase (aldehyde reductase 1) is closely related to aldose reductase. Inhibition of bovine kidney aldehyde reductase by ZD5522

  19. Distribution of isoforms of ferredoxin-NADP(+) reductase (FNR) in cyanobacteria in two growth conditions.

    PubMed

    Alcántara-Sánchez, Felipe; Leyva-Castillo, Lourdes Elizabeth; Chagolla-López, Alicia; González de la Vara, Luis; Gómez-Lojero, Carlos

    2017-04-01

    Ferredoxin-NADP(+) reductase (FNR) transfers reducing equivalents between ferredoxin and NADP(H) in the photosynthetic electron transport chains of chloroplasts and cyanobacteria. In most cyanobacteria, FNR is coded by a single petH gene. The structure of FNR in photosynthetic organisms can be constituted by FAD-binding and NADPH-binding domains (FNR-2D), or by these and an additional N-terminal domain (FNR-3D). In this article, biochemical evidence is provided supporting the induction of FNR-2D by iron or combined nitrogen deficiency in the cyanobacteria Synechocystis PCC 6803 and Anabaena variabilis ATCC 29413. In cell extracts of these cyanobacteria, most of FNR was associated to phycobilisomes (PBS) or phycocyanin (PC), and the rest was found as free enzyme. Free FNR activity increased in both cyanobacteria under iron stress and during diazotrophic conditions in A. variabilis. Characterization of FNR from both cyanobacteria showed that the PBS-associated enzyme was FNR-3D and the free enzyme was mostly a FNR-2D isoform. Predominant isoforms in heterocysts of A. variabilis were FNR-2D; where its N-terminal sequence lacked an initial (formyl)methionine. This means that FNR-3D is targeted to thylakoid membrane, and anchored to PBS, and FNR-2D is found as a soluble protein in the cytoplasm, when iron or fixed nitrogen deficiencies prevail in the environment. Moreover, given that Synechocystis and Anabaena variabilis are dissimilar in genotype, phenotype and ecology, the presence of these two-domain proteins in these species suggests that the mechanism of FNR induction is common among cyanobacteria regardless of their habitat and morphotype.

  20. The transient catalytically competent coenzyme allocation into the active site of Anabaena ferredoxin NADP+ -reductase.

    PubMed

    Peregrina, José Ramón; Lans, Isaías; Medina, Milagros

    2012-01-01

    Ferredoxin-NADP(+) reductase (FNR) catalyses the electron transfer from ferredoxin to NADP(+) via its flavin FAD cofactor. A molecular dynamics theoretical approach is applied here to visualise the transient catalytically competent interaction of Anabaena FNR with its coenzyme, NADP(+). The particular role of some of the residues identified as key in binding and accommodating the 2'P-AMP moiety of the coenzyme is confirmed in molecular terms. Simulations also indicate that the architecture of the active site precisely contributes to the orientation of the N5 of the FAD isoalloxazine ring and the C4 of the coenzyme nicotinamide ring in the conformation of the catalytically competent hydride transfer complex and, therefore, contributes to the efficiency of the process. In particular, the side chain of the C-terminal Y303 in Anabaena FNR appears key to providing the optimum geometry by reducing the stacking probability between the isoalloxazine and nicotinamide rings, thus providing the required co-linearity and distance among the N5 of the flavin cofactor, the C4 of the coenzyme nicotinamide and the hydride that has to be transferred between them. All these factors are highly related to the reaction efficiency, mechanism and reversibility of the process.

  1. Surface orientation control of site-specifically immobilized nitro-reductase (NfsB).

    PubMed

    Shen, Lei; Schroeder, McKenna; Ogorzalek, Tadeusz L; Yang, Pei; Wu, Fu-Gen; Marsh, E Neil G; Chen, Zhan

    2014-05-27

    We demonstrate the control of enzyme orientation for enzymes chemically immobilized on surfaces. Nitro-reductase (NfsB) has the ability to reduce a broad range of nitro-containing compounds and has potential applications in a broad range of areas including the detection and decomposition of explosives. The enzyme was tethered through unique surface cysteine residues to a self-assembled monolayer (SAM) terminated with maleimide groups. One cysteine was introduced close to the active site (V424C), and the other, at a remote site (H360C). The surface-tethered NfsB variants were interrogated by a combination of surface-sensitive sum frequency generation (SFG) vibrational spectroscopy and attenuated total reflection-Fourier transform infrared spectroscopy (ATR-FTIR) to determine how the mode of attachment altered the enzyme's orientation. The activities of the two immobilized NfsB variants were measured and can be well correlated to the deduced orientations. The relationships among enzyme engineering, surface immobilization, enzyme orientation, and enzyme activity were revealed.

  2. The bacteriophage T4 gene for the small subunit of ribonucleotide reductase contains an intron.

    PubMed Central

    Sjöberg, B M; Hahne, S; Mathews, C Z; Mathews, C K; Rand, K N; Gait, M J

    1986-01-01

    The bacteriophage T4 gene nrdB codes for the small subunit of the enzyme ribonucleotide reductase. The T4 nrdB gene was localized between 136.1 kb and 137.8 kb in the T4 genetic map according to the deduced structural homology of the protein to the amino acid sequence of its bacterial counterpart, the B2 subunit of Escherichia coli. This positions the C-terminal end of the T4 nrdB gene approximately 2 kb closer to the T4 gene 63 than earlier anticipated from genetic recombinational analyses. The most surprising feature of the T4 nrdB gene is the presence of an approximately 625 bp intron which divides the structural gene into two parts. This is the second example of a prokaryotic structural gene with an intron. The first prokaryotic intron was reported in the nearby td gene, coding for the bacteriophage T4-specific thymidylate synthase enzyme. The nucleotide sequence at the exon-intron junctions of the T4 nrdB gene is similar to that of the junctions of the T4 td gene: the anticipated exon-intron boundary at the donor site ends with a TAA stop codon and there is an ATG start codon at the putative downstream intron-exon boundary of the acceptor site. In the course of this work the denA gene of T4 (endonuclease II) was also located. PMID:3530746

  3. dNTP deficiency induced by HU via inhibiting ribonucleotide reductase affects neural tube development.

    PubMed

    Guan, Zhen; Wang, Xiuwei; Dong, Yanting; Xu, Lin; Zhu, Zhiqiang; Wang, Jianhua; Zhang, Ting; Niu, Bo

    2015-02-03

    Exposure to environmental toxic chemicals in utero during the neural tube development period can cause developmental disorders. To evaluate the disruption of neural tube development programming, the murine neural tube defects (NTDs) model was induced by interrupting folate metabolism using methotrexate in our previous study. The present study aimed to examine the effects of dNTP deficiency induced by hydroxyurea (HU), a specific ribonucleotide reductase (RNR) inhibitor, during murine neural tube development. Pregnant C57BL/6J mice were intraperitoneally injected with various doses of HU on gestation day (GD) 7.5, and the embryos were checked on GD 11.5. RNR activity and deoxynucleoside triphosphate (dNTP) levels were measured in the optimal dose. Additionally, DNA damage was examined by comet analysis and terminal deoxynucleotidyl transferase mediated dUTP nick end-labeling (TUNEL) assay. Cellular behaviors in NTDs embryos were evaluated with phosphorylation of histone H3 (PH-3) and caspase-3 using immunohistochemistry and western blot analysis. The results showed that NTDs were observed mostly with HU treatment at an optimal dose of 225 mg/kg b/w. RNR activity was inhibited and dNTP levels were decreased in HU-treated embryos with NTDs. Additionally, increased DNA damage, decreased proliferation, and increased caspase-3 were significant in NTDs embryos compared to the controls. Results indicated that HU induced murine NTDs model by disturbing dNTP metabolism and further led to the abnormal cell balance between proliferation and apoptosis.

  4. Evolution of plant δ1-pyrroline-5-carboxylate reductases from phylogenetic and structural perspectives

    DOE PAGES

    Forlani, Giuseppe; Makarova, Kira S.; Ruszkowski, Milosz; ...

    2015-08-03

    Proline plays a crucial role in cell growth and stress responses, and its accumulation is essential for the tolerance of adverse environmental conditions in plants. Two routes are used to biosynthesize proline in plants. The main route uses glutamate as a precursor, while in the other route proline is derived from ornithine. The terminal step of both pathways, the conversion of δ1-pyrroline-5-carboxylate (P5C) to L-proline, is catalyzed by P5C reductase (P5CR) using NADH or NADPH as a cofactor. Since P5CRs are important housekeeping enzymes, they are conserved across all domains of life and appear to be relatively unaffected throughout evolution.more » However, global analysis of these enzymes unveiled significant functional diversity in the preference for cofactors (NADPH vs. NADH), variation in metal dependence and the differences in the oligomeric state. In our study we investigated evolutionary patterns through phylogenetic and structural analysis of P5CR representatives from all kingdoms of life, with emphasis on the plant species. We attempted to correlate local sequence/structure variation among the functionally and structurally characterized members of the family.« less

  5. NIa-pro of Papaya ringspot virus interacts with papaya methionine sulfoxide reductase B1.

    PubMed

    Gao, Le; Shen, Wentao; Yan, Pu; Tuo, Decai; Li, Xiaoying; Zhou, Peng

    2012-12-05

    A chloroplast-localized papaya methionine sulfoxide reductase B1 (PaMsrB1) interacting with Papaya ringspot virus (PRSV) NIa-Pro was identified using a Sos recruitment two-hybrid system (SRS). SRS analysis of several deletion mutants of PRSV NIa-Pro and PaMsrB1 demonstrated that the C-terminal (residues 133-239) fragment of PRSV NIa-Pro and residues 112-175 of PaMsrB1 were necessary for this interaction between PRSV NIa-Pro and PaMsrB1. MsrB1 can repair Met-oxidized proteins damaged by reactive oxygen species (ROS). We confirmed that PRSV infection leads to ROS accumulation and a slight upregulation of level PaMsrB1 mRNA in papaya. This interaction between PaMsrB1 with PRSV NIa-Pro may disturb the import of PaMsrB1 into the chloroplasts. These results suggest that this specific interaction could interfere with PaMsrB1 into the chloroplasts to scavenge ROS caused by PRSV infection. This may be a novel mechanism of PRSV towards the host defense.

  6. Identification of Ser-543 as the major regulatory phosphorylation site in spinach leaf nitrate reductase

    NASA Technical Reports Server (NTRS)

    Bachmann, M.; Shiraishi, N.; Campbell, W. H.; Yoo, B. C.; Harmon, A. C.; Huber, S. C.; Davies, E. (Principal Investigator)

    1996-01-01

    Spinach leaf NADH:nitrate reductase (NR) responds to light/dark signals and photosynthetic activity in part as a result of rapid regulation by reversible protein phosphorylation. We have identified the major regulatory phosphorylation site as Ser-543, which is located in the hinge 1 region connecting the cytochrome b domain with the molybdenum-pterin cofactor binding domain of NR, using recombinant NR fragments containing or lacking the phosphorylation site sequence. Studies with NR partial reactions indicated that the block in electron flow caused by phosphorylation also could be localized to the hinge 1 region. A synthetic peptide (NR6) based on the phosphorylation site sequence was phosphorylated readily by NR kinase (NRk) in vitro. NR6 kinase activity tracked the ATP-dependent inactivation of NR during several chromatographic steps and completely inhibited inactivation/phosphorylation of native NR in vitro. Two forms of NRk were resolved by using anion exchange chromatography. Studies with synthetic peptide analogs indicated that both forms of NRk had similar specificity determinants, requiring a basic residue at P-3 (i.e., three amino acids N-terminal to the phosphorylated serine) and a hydrophobic residue at P-5. Both forms are strictly calcium dependent but belong to distinct families of protein kinases because they are distinct immunochemically.

  7. Acetylene terminated matrix resins

    NASA Technical Reports Server (NTRS)

    Goldfarb, I. J.; Lee, Y. C.; Arnold, F. E.; Helminiak, T. E.

    1985-01-01

    The synthesis of resins with terminal acetylene groups has provided a promising technology to yield high performance structural materials. Because these resins cure through an addition reaction, no volatile by-products are produced during the processing. The cured products have high thermal stability and good properties retention after exposure to humidity. Resins with a wide variety of different chemical structures between the terminal acetylene groups are synthesized and their mechanical properties studied. The ability of the acetylene cured polymers to give good mechanical properties is demonstrated by the resins with quinoxaline structures. Processibility of these resins can be manipulated by varying the chain length between the acetylene groups or by blending in different amounts of reactive deluents. Processing conditions similar to the state-of-the-art epoxy can be attained by using backbone structures like ether-sulfone or bis-phenol-A. The wide range of mechanical properties and processing conditions attainable by this class of resins should allow them to be used in a wide variety of applications.

  8. Termination: A Case Study.

    PubMed

    Friedberg, Ahron L

    2015-12-01

    In this article I posit and examine certain criteria and qualities for ending an analysis. The case study describes the end phase of a four-year psychoanalysis in which the patient's decision to move to another area forced the end of his analysis. We continued to explore and work through his core neurotic conflicts that included issues of competitive rivalry, dominance and submission, control, and anxiety about birth and death. A shift in the transference from me as a negative father to me as a supportive but competitive older brother was also examined in the context of ending treatment as well as other aspects of the transference. In addition, we analyzed the meaning of his ending treatment based on an extra-analytic circumstance. In discussing this phase of treatment, the definition and history of the term "termination" and its connotations are reviewed. Various criteria for completing an analysis are examined, and technical observations about this phase of treatment are investigated. It was found that while a significant shift in the transference occurred in this phase of the patient's analysis, conflicts related to the transference were not "resolved" in the classical sense. Terminating treatment was considered as a practical matter in which the patient's autonomy and sense of choice were respected and analyzed.

  9. Compensating for the absence of selenocysteine in high-molecular weight thioredoxin reductases: the electrophilic activation hypothesis.

    PubMed

    Lothrop, Adam P; Snider, Gregg W; Flemer, Stevenson; Ruggles, Erik L; Davidson, Ronald S; Lamb, Audrey L; Hondal, Robert J

    2014-02-04

    Mammalian thioredoxin reductase (TR) is a pyridine disulfide oxidoreductase that uses the rare amino acid selenocysteine (Sec) in place of the more commonly used amino acid cysteine (Cys). Selenium is a Janus-faced element because it is both highly nucleophilic and highly electrophilic. Cys orthologs of Sec-containing enzymes may compensate for the absence of a Sec residue by making the active site Cys residue more (i) nucleophilic, (ii) electrophilic, or (iii) reactive by increasing both S-nucleophilicity and S-electrophilicity. It has already been shown that the Cys ortholog TR from Drosophila melanogaster (DmTR) has increased S-nucleophilicity [Gromer, S., Johansson, L., Bauer, H., Arscott, L. D., Rauch, S., Ballou, D. P., Williams, C. H., Jr., Schrimer, R. H., and Arnér, E. S (2003) Active sites of thioredoxin reductases: Why selenoproteins? Proc. Natl. Acad. Sci. U.S.A. 100, 12618-12623]. Here we present evidence that DmTR also enhances the electrophilicity of Cys490 through the use of an "electrophilic activation" mechanism. This mechanism is proposed to work by polarizing the disulfide bond that occurs between Cys489 and Cys490 in the C-terminal redox center by the placement of a positive charge near Cys489. This polarization renders the sulfur atom of Cys490 electron deficient and enhances the rate of thiol/disulfide exchange that occurs between the N- and C-terminal redox centers. Our hypothesis was developed by using a strategy of homocysteine (hCys) for Cys substitution in the Cys-Cys redox dyad of DmTR to differentiate the function of each Cys residue. The results show that hCys could substitute for Cys490 with little loss of thioredoxin reductase activity, but that substitution of hCys for Cys489 resulted in a 238-fold reduction in activity. We hypothesize that replacement of Cys489 with hCys destroys an interaction between the sulfur atom of Cys489 and His464 crucial for the proposed electrophilic activation mechanism. This electrophilic activation

  10. Compensating for the Absence of Selenocysteine in High-Molecular Weight Thioredoxin Reductases: The Electrophilic Activation Hypothesis

    PubMed Central

    2015-01-01

    Mammalian thioredoxin reductase (TR) is a pyridine disulfide oxidoreductase that uses the rare amino acid selenocysteine (Sec) in place of the more commonly used amino acid cysteine (Cys). Selenium is a Janus-faced element because it is both highly nucleophilic and highly electrophilic. Cys orthologs of Sec-containing enzymes may compensate for the absence of a Sec residue by making the active site Cys residue more (i) nucleophilic, (ii) electrophilic, or (iii) reactive by increasing both S-nucleophilicity and S-electrophilicity. It has already been shown that the Cys ortholog TR from Drosophila melanogaster (DmTR) has increased S-nucleophilicity [Gromer, S., Johansson, L., Bauer, H., Arscott, L. D., Rauch, S., Ballou, D. P., Williams, C. H., Jr., Schrimer, R. H., and Arnér, E. S (2003) Active sites of thioredoxin reductases: Why selenoproteins? Proc. Natl. Acad. Sci. U.S.A. 100, 12618–12623]. Here we present evidence that DmTR also enhances the electrophilicity of Cys490 through the use of an “electrophilic activation” mechanism. This mechanism is proposed to work by polarizing the disulfide bond that occurs between Cys489 and Cys490 in the C-terminal redox center by the placement of a positive charge near Cys489. This polarization renders the sulfur atom of Cys490 electron deficient and enhances the rate of thiol/disulfide exchange that occurs between the N- and C-terminal redox centers. Our hypothesis was developed by using a strategy of homocysteine (hCys) for Cys substitution in the Cys-Cys redox dyad of DmTR to differentiate the function of each Cys residue. The results show that hCys could substitute for Cys490 with little loss of thioredoxin reductase activity, but that substitution of hCys for Cys489 resulted in a 238-fold reduction in activity. We hypothesize that replacement of Cys489 with hCys destroys an interaction between the sulfur atom of Cys489 and His464 crucial for the proposed electrophilic activation mechanism. This electrophilic

  11. Channel and terminal description of the ACTS mobile terminal

    NASA Technical Reports Server (NTRS)

    Abbe, B. S.; Agan, M. J.; Girardey, C. C.; Jedrey, T. C.

    1994-01-01

    The Advanced Communications Technology Satellite (ACTS) Mobile Terminal (AMT) is a proof-of-concept K/Ka-band mobile satellite communications terminal under development by NASA at JPL. Currently the AMT is undergoing systems integration and testing in preparation for a July 1993 ACTS launch and the subsequent commencement of mobile experiments in the fall of 1993. The AMT objectives are presented, followed by a discussion of the AMT communications channel and the mobile terminal's design and performance.

  12. Channel and terminal description of the ACTS mobile terminal

    NASA Technical Reports Server (NTRS)

    Abbe, B. S.; Agan, M. J.; Girardey, C. C.; Jedrey, T. C.

    1993-01-01

    The Advanced Communications Technology Satellite (ACTS) Mobile Terminal (AMT) is a proof-of-concept K/Ka-band mobile satellite communications terminal under development by NASA at JPL. Currently the AMT is undergoing system integration and test in preparation for a July 1993 ACTS launch and the subsequent commencement of mobile experiments in the fall of 1993. The AMT objectives are presented followed by a discussion of the AMT communications channel and mobile terminal design and performance.

  13. Regulation of Nitrate Reductase Activity in Corn (Zea mays L.) Seedlings by Endogenous Metabolites 1

    PubMed Central

    Schrader, L. E.; Hageman, R. H.

    1967-01-01

    Primary and secondary metabolites of inorganic nitrogen metabolism were evaluated as inhibitors of nitrate reductase (EC 1.6.6.1) induction in green leaf tissue of corn seedlings. Nitrite, nitropropionic acid, ammonium ions, and amino acids were not effective as inhibitors of nitrate reductase activity or synthesis. Increasing α-amino nitrogen and protein content of intact corn seedlings by culture techniques significantly enhanced rather than decreased the potential for induction of nitrate reductase activity in excised seedlings. Secondary metabolites, derived from phenylalanine and tyrosine, were tested as inhibitors of induction of nitrate reductase. Of the 9 different phenylpropanoid compounds tested, only coumarin, trans-cinnamic and trans-o-hydroxycinnamic acids inhibited induction of nitrate reductase. While coumarin alone exhibited a relatively greater inhibitory effect on enzyme induction than on general protein synthesis (the latter measured by incorporation of labeled amino acids), this differential effect may have been dependent upon unequal rates of synthesis and accumulation with respect to the initial levels of nitrate reductase and general proteins. Because of the short half-life of nitrate reductase, inhibitors of protein synthesis in general could still achieve differential regulation of nitrogen metabolism. Coumarin did not inhibit nitrate reductase activity when added directly to the assay mixture at 5 mm. Carbamyl phosphate and its chemical derivative, cyanate, were found to be competitive (with nitrate) inhibitors of nitrate reductase. The data suggest that cyanate is the active inhibitor in the carbamyl phosphate preparations. PMID:16656715

  14. A flavone from Manilkara indica as a specific inhibitor against aldose reductase in vitro.

    PubMed

    Haraguchi, Hiroyuki; Hayashi, Ryosuke; Ishizu, Takashi; Yagi, Akira

    2003-09-01

    Isoaffinetin (5,7,3',4',5'-pentahydroxyflavone-6-C-glucoside) was isolated from Manilkara indica as a potent inhibitor of lens aldose reductase by bioassay-directed fractionation. This C-glucosyl flavone showed specific inhibition against aldose reductases (rat lens, porcine lens and recombinant human) with no inhibition against aldehyde reductase and NADH oxidase. Kinetic analysis showed that isoaffinetin exhibited uncompetitive inhibition against both dl-glyceraldehyde and NADPH. A structure-activity relationship study revealed that the increasing number of hydroxy groups in the B-ring contributes to the increase in aldose reductase inhibition by C-glucosyl flavones.

  15. Ammonification in Bacillus subtilis Utilizing Dissimilatory Nitrite Reductase Is Dependent on resDE

    PubMed Central

    Hoffmann, Tamara; Frankenberg, Nicole; Marino, Marco; Jahn, Dieter

    1998-01-01

    During anaerobic nitrate respiration Bacillus subtilis reduces nitrate via nitrite to ammonia. No denitrification products were observed. B. subtilis wild-type cells and a nitrate reductase mutant grew anaerobically with nitrite as an electron acceptor. Oxygen-sensitive dissimilatory nitrite reductase activity was demonstrated in cell extracts prepared from both strains with benzyl viologen as an electron donor and nitrite as an electron acceptor. The anaerobic expression of the discovered nitrite reductase activity was dependent on the regulatory system encoded by resDE. Mutation of the gene encoding the regulatory Fnr had no negative effect on dissimilatory nitrite reductase formation. PMID:9422613

  16. Structure of the Molybdenum Site of EEcherichia Coli Trimethylamine N-Oxide Reductase

    SciTech Connect

    Zhang, L.; Nelson, K.Johnson; Rajagopalan, K.V.; George, G.N.

    2009-05-28

    We report a structural characterization of the molybdenum site of recombinant Escherichia coli trimethylamine N-oxide (TMAO) reductase using X-ray absorption spectroscopy. The enzyme active site shows considerable similarity to that of dimethyl sulfoxide (DMSO) reductase, in that, like DMSO reductase, the TMAO reductase active site can exist in multiple forms. Examination of the published crystal structure of TMAO oxidase from Shewanella massilia indicates that the postulated Mo coordination structure is chemically impossible. The presence of multiple active site structures provides a potential explanation for the anomalous features reported from the crystal structure.

  17. The Effects of Termination on the Menominee

    ERIC Educational Resources Information Center

    Deer, Ada E.

    1973-01-01

    Topics discussed in this article are: (1) a brief pre-termination history of the Menominee Indians; (2) the enactment of termination; (3) the effects of termination on the Menominee; and (4) the need to repudiate termination. (NQ)

  18. Components of glycine reductase from Eubacterium acidaminophilum. Cloning, sequencing and identification of the genes for thioredoxin reductase, thioredoxin and selenoprotein PA.

    PubMed

    Lübbers, M; Andreesen, J R

    1993-10-15

    The genes encoding thioredoxin reductase (trxB), thioredoxin (trxA), protein PA of glycine reductase (grdA) and the first 23 amino acids of the large subunit of protein PC of glycine reductase (grdC) belonging to the reductive deamination systems present in Eubacterium acidaminophilum were cloned and sequenced. The proteins were products of closely linked genes with 314 codons (thioredoxin reductase), 110 codons (thioredoxin), and 158 codons (protein PA). The protein previously called 'atypically small lipoamide dehydrogenase' or 'electron transferring flavoprotein' could now conclusively be identified as a thioredoxin reductase (subunit mass of 34781 Da) by the alignment with the enzyme of Escherichia coli showing the same typical order of the corresponding domains. The thioredoxin (molecular mass of 11742 Da) deviated considerably from the known consensus sequence, even in the most strongly conserved redox-active segment WCGPC that was now GCVPC. The selenocysteine of protein PA (molecular mass of 16609 Da) was encoded by TGA. The protein was highly similar to those of Clostridium purinolyticum and Clostridium sticklandii involved in glycine reductase. Thioredoxin reductase and thioredoxin of E. acidaminophilum could be successfully expressed in E. coli.

  19. [Terminal ballistics. 3].

    PubMed

    Marini, F; Mangiante, G; Dagradi, V; Radin, S; Carolo, F; Giarolli, M; Della Giacoma, G; Tosi, D; Merico, G; Tenci, A

    1993-01-01

    This brief chapter, focusing essentially on a single topic, has been written in homage to Emile Theodor Kocker, a masterful exponent of the art of surgery and founder of the culture of terminal ballistics. For most of the literature we are indebted to Fackler and Dougherty, who, with the particular grasp, and fair of historians, act as guides on a trial which is only apparently retrograde, but which actually bears eloquent witness to the fact that even in the most physically tangible of arts, namely the art of surgery, inspired curiosity may help us to go well beyond the limits of our day and age. This chapter is also dedicated to the memory of another great surgeon, Vittorio Pettinari, who for one of the authors was an incomparable mentor and past-master of such curiosity.

  20. 75 FR 13644 - TORP Terminal LP, Bienville Offshore Energy Terminal Liquefied Natural Gas Deepwater Port License...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-22

    ... Maritime Administration TORP Terminal LP, Bienville Offshore Energy Terminal Liquefied Natural Gas...) for the TORP Terminal LP, Bienville Offshore Energy Terminal (BOET) Liquefied Natural Gas (LNG..., both are identified in FOR FURTHER INFORMATION CONTACT. Summary of the Application TORP Terminal...

  1. Structural and Biochemical Characterization of Cinnamoyl-CoA Reductases.

    PubMed

    Sattler, Steven A; Walker, Alexander M; Vermerris, Wilfred; Sattler, Scott E; Kang, ChulHee

    2017-02-01

    Cinnamoyl-coenzyme A reductase (CCR) catalyzes the reduction of hydroxycinnamoyl-coenzyme A (CoA) esters using NADPH to produce hydroxycinnamyl aldehyde precursors in lignin synthesis. The catalytic mechanism and substrate specificity of cinnamoyl-CoA reductases from sorghum (Sorghum bicolor), a strategic plant for bioenergy production, were deduced from crystal structures, site-directed mutagenesis, and kinetic and thermodynamic analyses. Although SbCCR1 displayed higher affinity for caffeoyl-CoA or p-coumaroyl-CoA than for feruloyl-CoA, the enzyme showed significantly higher activity for the latter substrate. Through molecular docking and comparisons between the crystal structures of the Vitis vinifera dihydroflavonol reductase and SbCCR1, residues threonine-154 and tyrosine-310 were pinpointed as being involved in binding CoA-conjugated phenylpropanoids. Threonine-154 of SbCCR1 and other CCRs likely confers strong substrate specificity for feruloyl-CoA over other cinnamoyl-CoA thioesters, and the T154Y mutation in SbCCR1 led to broader substrate specificity and faster turnover. Through data mining using our structural and biochemical information, four additional putative CCR genes were discovered from sorghum genomic data. One of these, SbCCR2, displayed greater activity toward p-coumaroyl-CoA than did SbCCR1, which could imply a role in the synthesis of defense-related lignin. Taken together, these findings provide knowledge about critical residues and substrate preference among CCRs and provide, to our knowledge, the first three-dimensional structure information for a CCR from a monocot species.

  2. Thioredoxin Glutathione Reductase-Dependent Redox Networks in Platyhelminth Parasites

    PubMed Central

    Bonilla, Mariana; Gladyshev, Vadim N.

    2013-01-01

    Abstract Significance: Platyhelminth parasites cause chronic infections that are a major cause of disability, mortality, and economic losses in developing countries. Maintaining redox homeostasis is a major adaptive problem faced by parasites and its disruption can shift the biochemical balance toward the host. Platyhelminth parasites possess a streamlined thiol-based redox system in which a single enzyme, thioredoxin glutathione reductase (TGR), a fusion of a glutaredoxin (Grx) domain to canonical thioredoxin reductase (TR) domains, supplies electrons to oxidized glutathione (GSSG) and thioredoxin (Trx). TGR has been validated as a drug target for schistosomiasis. Recent Advances: In addition to glutathione (GSH) and Trx reduction, TGR supports GSH-independent deglutathionylation conferring an additional advantage to the TGR redox array. Biochemical and structural studies have shown that the TR activity does not require the Grx domain, while the glutathione reductase and deglutathionylase activities depend on the Grx domain, which receives electrons from the TR domains. The search for TGR inhibitors has identified promising drug leads, notably oxadiazole N-oxides. Critical Issues: A conspicuous feature of platyhelminth TGRs is that their Grx-dependent activities are temporarily inhibited at high GSSG concentrations. The mechanism underlying the phenomenon and its biological relevance are not completely understood. Future Directions: The functional diversity of Trxs and Grxs encoded in platyhelminth genomes remains to be further assessed to thoroughly understand the TGR-dependent redox network. Optimization of TGR inhibitors and identification of compounds targeting other parasite redox enzymes are good options to clinically develop relevant drugs for these neglected, but important diseases. Antioxid. Redox Signal. 19, 735–745. PMID:22909029

  3. Regioselectivity of nitroglycerin denitration by flavoprotein nitroester reductases purified from two Pseudomonas species.

    PubMed Central

    Blehert, D S; Knoke, K L; Fox, B G; Chambliss, G H

    1997-01-01

    Two species of Pseudomonas capable of utilizing nitroglycerin (NG) as a sole nitrogen source were isolated from NG-contaminated soil and identified as Pseudomonas putida II-B and P. fluorescens I-C. While 9 of 13 laboratory bacterial strains that presumably had no previous exposure to NG could degrade low concentrations of NG (0.44 mM), the natural isolates tolerated concentrations of NG that were toxic to the lab strains (1.76 mM and higher). Whole-cell studies revealed that the two natural isolates produced different mixtures of the isomers of dinitroglycerol (DNG) and mononitroglycerol (MNG). A monomeric, flavin mononucleotide-containing NG reductase was purified from each natural isolate. These enzymes catalyzed the NADPH-dependent denitration of NG, yielding nitrite. Apparent kinetic constants were determined for both reductases. The P. putida enzyme had a Km for NG of 52 +/- 4 microM, a Km for NADPH of 28 +/- 2 microM, and a Vmax of 124 +/- 6 microM x min(-1), while the P. fluorescens enzyme had a Km for NG of 110 +/- 10 microM, a Km for NADPH of 5 +/- 1 microM, and a Vmax of 110 +/- 11 microM x min(-1). Anaerobic titration experiments confirmed the stoichiometry of NADPH consumption, changes in flavin oxidation state, and multiple steps of nitrite removal from NG. The products formed during time-dependent denitration reactions were consistent with a single enzyme being responsible for the in vivo product distributions. Simulation of the product formation kinetics by numerical integration showed that the P. putida enzyme produced an approximately 2-fold molar excess of 1,2-DNG relative to 1,3-DNG. This result could be fortuitous or could possibly be consistent with a random removal of the first nitro group from either the terminal (C-1 and C-3) positions or middle (C-2) position. However, during the denitration of 1,2-DNG, a 1.3-fold selectivity for the C-1 nitro group was determined. Comparable simulations of the product distributions from the P. fluorescens

  4. Chlorate reductase is cotranscribed with cytochrome c and other downstream genes in the gene cluster for chlorate respiration of Ideonella dechloratans.

    PubMed

    Hellberg Lindqvist, Miriam; Nilsson, Thomas; Sundin, Pontus; Rova, Maria

    2015-03-01

    The chlorate-respiring bacterium Ideonella dechloratans is a facultative anaerobe that can use both oxygen and chlorate as terminal electron acceptors. The genes for the enzymes chlorate reductase (clrABDC) and chlorite dismutase, necessary for chlorate metabolism and probably acquired by lateral gene transfer, are located in a gene cluster that also includes other genes potentially important for chlorate metabolism. Among those are a gene for cytochrome c (cyc) whose gene product may serve as an electron carrier during chlorate reduction, a cofactor biosynthesis gene (mobB) and a predicted transcriptional regulator (arsR). Only chlorate reductase and chlorite dismutase have been shown to be expressed in vivo. Here, we report the in vivo production of a single polycistronic transcript covering eight open reading frames including clrABDC, cyc, mobB and arsR. Transcription levels of the cyc and clrA genes were compared to each other by the use of qRT-PCR in RNA preparations from cells grown under aerobic or chlorate reducing anaerobic conditions. The two genes showed the same mRNA levels under both growth regimes, indicating that no transcription termination occurs between them. Higher transcription levels were observed at growth without external oxygen supply. Implications for electron pathway integration following lateral gene transfer are discussed.

  5. Methylenetetrahydrofolate Reductase C677T: Hypoplastic Left Heart and Thrombosis.

    PubMed

    Spronk, Kimberly J; Olivero, Anthony D; Haw, Marcus P; Vettukattil, Joseph J

    2015-10-01

    The incidence of congenital heart defects is higher in infants with mutation of methylenetetrahydrofolate reductase (MTHFR) gene. The MTHFR C677T gene decreases the bioavailability of folate and increases plasma homocysteine, a risk factor for thrombosis. There have been no reported cases in the literature on the clinical implications of this procoagulable state in the setting of cyanotic heart disease, which itself has prothrombotic predisposition. Two patients with hypoplastic left heart syndrome developed postoperative thrombotic complications, both were homozygous for MTHFR C677T. We present these cases and highlight the implications of MTHFR mutation in the management of complex congenital heart disease.

  6. Terpenoids from Diplophyllum taxifolium with quinone reductase-inducing activity.

    PubMed

    Wang, Xiao; Zhang, Jiao-Zhen; Zhou, Jin-Chuan; Shen, Tao; Lou, Hong-Xiang

    2016-03-01

    Two new ent-prenylaromadendrane-type diterpenoids, diplotaxifols A (1) and B (2), a new ent-eudesmol, ent-eudesma-4(15),11(13)-dien-6α,12-diol (3), eight new eudesmanolides enantiomers (4-11) of the corresponding compounds from higher plants along with four known ent-eudesmanolides (12-15) were isolated from the 95% EtOH extract of Chinese liverwort Diplophyllum taxifolium. Their structures were elucidated on the basis of MS, NMR and IR spectral data, and confirmed by single-crystal X-ray diffraction analysis. The quinone reductase-inducing activity of the compounds was evaluated.

  7. Applications of Carboxylic Acid Reductases in Oleaginous Microbes

    SciTech Connect

    Resch, Michael G.; Linger, Jeffrey; McGeehan, John; Tyo, Keith; Beckham, Gregg

    2016-04-24

    Carboxylic acid reductases (CARs) are recently emerging reductive enzymes for the direct production of aldehydes from biologically-produced carboxylic acids. Recent work has demonstrated that these powerful enzymes are able to reduce a very broad range of volatile- to long-chain fatty acids as well as aromatic acids. Here, we express four CAR enzymes from different fungal origins to test their activity against fatty acids commonly produced in oleaginous microbes. These in vitro results will inform metabolic engineering strategies to conduct mild biological reduction of carboxylic acids in situ, which is conventionally done via hydrotreating catalysis at high temperatures and hydrogen pressures.

  8. Is Lake Tahoe Terminal?

    NASA Astrophysics Data System (ADS)

    Coats, R. N.; Reuter, J.; Heyvaert, A.; Lewis, J.; Sahoo, G. B.; Schladow, G.; Thorne, J. H.

    2014-12-01

    ) the climatic water deficit will increase, especially at high elevations that will be most affected by the loss of snow, with likely consequences for existing vegetation and fire frequency. Hydrologically, Lake Tahoe is intermittently terminal; in a medical sense it is not yet terminal, but its condition—especially its valued clarity and deep blue color--is serious.

  9. SCATHA mission termination report

    NASA Technical Reports Server (NTRS)

    Stakkestad, Kjell; Fennessey, Richard

    1993-01-01

    nearly complete lack of available telemetry data, large undamped motion of the long booms, inadequacies in attitude determination software, and an error in the fuel level calculation software. This paper discusses the various proposed termination plans and execution of the selected one. Attitude determination methodologies, nutation from maneuvers, and effects of the flexible booms on the termination mission are presented and analyzed from a satellite analyst point of view.

  10. SCATHA mission termination report

    NASA Astrophysics Data System (ADS)

    Stakkestad, Kjell; Fennessey, Richard

    1993-02-01

    nearly complete lack of available telemetry data, large undamped motion of the long booms, inadequacies in attitude determination software, and an error in the fuel level calculation software. This paper discusses the various proposed termination plans and execution of the selected one. Attitude determination methodologies, nutation from maneuvers, and effects of the flexible booms on the termination mission are presented and analyzed from a satellite analyst point of view.

  11. A Novel NADPH-dependent flavoprotein reductase from Bacillus megaterium acts as an efficient cytochrome P450 reductase.

    PubMed

    Milhim, Mohammed; Gerber, Adrian; Neunzig, Jens; Hannemann, Frank; Bernhardt, Rita

    2016-08-10

    Cytochromes P450 (P450s) require electron transfer partners to catalyze substrate conversions. With regard to biotechnological approaches, the elucidation of novel electron transfer proteins is of special interest, as they can influence the enzymatic activity and specificity of the P450s. In the current work we present the identification and characterization of a novel soluble NADPH-dependent diflavin reductase from Bacillus megaterium with activity towards a bacterial (CYP106A1) and a microsomal (CYP21A2) P450 and, therefore, we referred to it as B. megaterium cytochrome P450 reductase (BmCPR). Sequence analysis of the protein revealed besides the conserved FMN-, FAD- and NADPH-binding motifs, the presence of negatively charged cluster, which is thought to represent the interaction domain with P450s and/or cytochrome c. BmCPR was expressed and purified to homogeneity in Escherichia coli. The purified BmCPR exhibited a characteristic diflavin reductase spectrum, and showed a cytochrome c reducing activity. Furthermore, in an in vitro reconstituted system, the BmCPR was able to support the hydroxylation of testosterone and progesterone with CYP106A1 and CYP21A2, respectively. Moreover, in view of the biotechnological application, the BmCPR is very promising, as it could be successfully utilized to establish CYP106A1- and CYP21A2-based whole-cell biotransformation systems, which yielded 0.3g/L hydroxy-testosterone products within 8h and 0.16g/L 21-hydroxyprogesterone within 6h, respectively. In conclusion, the BmCPR reported herein owns a great potential for further applications and studies and should be taken into consideration for bacterial and/or microsomal CYP-dependent bioconversions.

  12. Aldose Reductase-catalyzed Reduction of Aldehyde Phospholipids

    PubMed Central

    Srivastava, Sanjay; Spite, Matthew; Trent, John O.; West, Matthew B.; Ahmed, Yonis; Bhatnagar, Aruni

    2012-01-01

    SUMMARY Oxidation of unsaturated phospholipids results in the generation of aldehyde side chains that remain esterified to the phospholipid backbone. Such “core” aldehydes elicit immune responses and promote inflammation. However, the biochemical mechanisms by which phospholipid aldehydes are metabolized or detoxified are not well understood. In the studies reported here, we examined whether aldose reductase (AR), which reduces hydrophobic aldehydes, metabolizes phospholipid aldehydes. Incubation with AR led to the reduction of 5-oxovaleroyl, 7-oxo-5-heptenoyl, 5-hydroxy-6-oxo-caproyl, and 5-hydroxy-8-oxo-6-octenoyl phospholipids generated upon oxidation of 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphocholine (PAPC). The enzyme also catalyzed the reduction of phospholipid aldehydes generated from the oxidation of 1-alkyl, and 1-alkenyl analogs of PAPC, and 1-palmitoyl-2-arachidonoyl phosphatidic acid or phosphoglycerol. Aldose reductase catalyzed the reduction of chemically synthesized 1-palmitoyl-2-(5-oxovaleroyl)-sn-glycero-3-phosphatidylcholine (POVPC) with a Km of 10 μM. Addition of POVPC to the culture medium led to incorporation and reduction of the aldehyde in COS-7 and THP-1 cells. Reduction of POVPC in these cells was prevented by the AR inhibitors sorbinil and tolrestat and was increased in COS-7 cells overexpressing AR. Together, these observations suggest that AR may be a significant participant in the metabolism of several structurally diverse phospholipid aldehydes. This metabolism may be a critical regulator of the pro-inflammatory and immunogenic effects of oxidized phospholipids. PMID:15465833

  13. Two fatty acyl reductases involved in moth pheromone biosynthesis

    PubMed Central

    Antony, Binu; Ding, Bao-Jian; Moto, Ken’Ichi; Aldosari, Saleh A.; Aldawood, Abdulrahman S.

    2016-01-01

    Fatty acyl reductases (FARs) constitute an evolutionarily conserved gene family found in all kingdoms of life. Members of the FAR gene family play diverse roles, including seed oil synthesis, insect pheromone biosynthesis, and mammalian wax biosynthesis. In insects, FAR genes dedicated to sex pheromone biosynthesis (pheromone-gland-specific fatty acyl reductase, pgFAR) form a unique clade that exhibits substantial modifications in gene structure and possesses unique specificity and selectivity for fatty acyl substrates. Highly selective and semi-selective ‘single pgFARs’ produce single and multicomponent pheromone signals in bombycid, pyralid, yponomeutid and noctuid moths. An intriguing question is how a ‘single reductase’ can direct the synthesis of several fatty alcohols of various chain lengths and isomeric forms. Here, we report two active pgFARs in the pheromone gland of Spodoptera, namely a semi-selective, C14:acyl-specific pgFAR and a highly selective, C16:acyl-specific pgFAR, and demonstrate that these pgFARs play a pivotal role in the formation of species-specific signals, a finding that is strongly supported by functional gene expression data. The study envisages a new area of research for disclosing evolutionary changes associated with C14- and C16-specific FARs in moth pheromone biosynthesis. PMID:27427355

  14. Human Neuroglobin Functions as a Redox-regulated Nitrite Reductase*

    PubMed Central

    Tiso, Mauro; Tejero, Jesús; Basu, Swati; Azarov, Ivan; Wang, Xunde; Simplaceanu, Virgil; Frizzell, Sheila; Jayaraman, Thottala; Geary, Lisa; Shapiro, Calli; Ho, Chien; Shiva, Sruti; Kim-Shapiro, Daniel B.; Gladwin, Mark T.

    2011-01-01

    Neuroglobin is a highly conserved hemoprotein of uncertain physiological function that evolved from a common ancestor to hemoglobin and myoglobin. It possesses a six-coordinate heme geometry with proximal and distal histidines directly bound to the heme iron, although coordination of the sixth ligand is reversible. We show that deoxygenated human neuroglobin reacts with nitrite to form nitric oxide (NO). This reaction is regulated by redox-sensitive surface thiols, cysteine 55 and 46, which regulate the fraction of the five-coordinated heme, nitrite binding, and NO formation. Replacement of the distal histidine by leucine or glutamine leads to a stable five-coordinated geometry; these neuroglobin mutants reduce nitrite to NO ∼2000 times faster than the wild type, whereas mutation of either Cys-55 or Cys-46 to alanine stabilizes the six-coordinate structure and slows the reaction. Using lentivirus expression systems, we show that the nitrite reductase activity of neuroglobin inhibits cellular respiration via NO binding to cytochrome c oxidase and confirm that the six-to-five-coordinate status of neuroglobin regulates intracellular hypoxic NO-signaling pathways. These studies suggest that neuroglobin may function as a physiological oxidative stress sensor and a post-translationally redox-regulated nitrite reductase that generates NO under six-to-five-coordinate heme pocket control. We hypothesize that the six-coordinate heme globin superfamily may subserve a function as primordial hypoxic and redox-regulated NO-signaling proteins. PMID:21296891

  15. A mutant of barley lacking NADH-hydroxypyruvate reductase

    SciTech Connect

    Blackwell, R.; Lea, P. )

    1989-04-01

    A mutant of barley, LaPr 88/29, deficient in peroxisomal NADH-hydroxypyruvate reductase (HPR) activity has been identified. Compared to the wild type the activities of NADH-HPR and NADPH-HPR were severely reduced but the mutant was still capable of fixing CO{sub 2} at rates equivalent to 75% of that of the wild type in air. Although lacking an enzyme in the main photorespiratory pathway, there appeared to be little disruption to photorespiratory metabolism as ammonia release, CO{sub 2} efflux and {sup 14}CO{sub 2} release from L-(U-{sup 14}C) serine were similar in both mutant and wild type. LaPr 88/29 has been used to show that NADH-glyoxylate reductase (GR) and NADH-HPR are probably not catalyzed by the same enzyme in barley and that over 80% of the NADPH-HPR activity is due to the NADH-HPR enzyme. Immunological studies, using antibodies raised against spinach HPR, have shown that the NADH-dependent enzyme protein is absent in LaPr 88/29 but there appears to be enhanced synthesis of the NADPH-dependent enzyme protein.

  16. Fluorescent analogues of methotrexate: characterization and interaction with dihydrofolate reductase.

    PubMed

    Kumar, A A; Kempton, R J; Anstead, G M; Freisheim, J H

    1983-01-18

    The dansylated derivatives of lysine and ornithine analogues of methotrexate exhibit fluorescence properties characteristic of the dansyl moiety with an excitation at 328 nm and an emission maximum at 580 nm in aqueous media. As in the case of dansyl amino acids, the fluorescence emission is dependent upon the polarity of the medium. In solvents of low dielectric constant there is an enhancement of the dansyl fluorescence intensity as well as a shift to shorter wavelengths. The dansylated analogues show a reduction in the quantum yields as compared to N epsilon-dansyl-L-lysine and 5-(N,N-dimethylamino)-1-naphthalenesulfonic acid. The absorption spectra of the two dansyl analogues are similar to the spectra of the parent basic amino acid precursors but with reduced molar extinction values. The two fluorescent analogues of methotrexate were found to be potent inhibitors of purified dihydrofolate reductases from Lactobacillus casei and from chicken liver. The binding of these fluorescent analogues to either dihydrofolate reductase resulted in 10-15-nm blue shift of the ligand emission maxima and a 2-5-fold enhancement of the emission. These fluorescent properties of the bound ligands indicate a possible interaction of the dansyl moiety with a region on the enzyme molecule which is more hydrophobic relative to the surrounding solvent.

  17. ADP-ribosylation of dinitrogenase reductase in Rhodobacter capsulatus

    SciTech Connect

    Jouanneau, Y.; Roby, C.; Meyer, C.M.; Vignais, P.M. )

    1989-07-25

    In the photosynthetic bacterium Rhodobacter capsulatus, nitrogenase is regulated by a reversible covalent modification of Fe protein or dinitrogenase reductase (Rc2). The linkage of the modifying group to inactive Rc2 was found to be sensitive to alkali and to neutral hydroxylamine. Complete release of the modifying group was achieved by incubation of inactive Rc2 in 0.4 or 1 M hydroxylamine. After hydroxylamine treatment of the Rc2 preparation, the modifying group could be isolated and purified by affinity chromatography and ion-exchange HPLC. The modifying group comigrated with ADP-ribose on both ion-exchange HPLC and thin-layer chromatography. Analyses by {sup 31}P NMR spectroscopy and mass spectrometry provided further evidence that the modifying group was ADP-ribose. The NMR spectrum of inactive Rc2 exhibited signals characteristic of ADP-ribose; integration of these signals allowed calculation of a molar ration ADP-ribose/Rc2 of 0.63. A hexapeptide carrying the ADP-ribose moiety was purified from a subtilisin digest of inactive Rc2. The structure of this peptide, determined by amino acid analysis and sequencing, is Gly-Arg(ADP-ribose)-Gly-Val-Ile-Thr. This structure allows identification of the binding site for ADP-ribose as Arg 101 of the polypeptide chain of Rc2. It is concluded that nitrogenase activity in R. capsulatus is regulated by reversible ADP-ribosylation of a specific arginyl residue of dinitrogenase reductase.

  18. Hydroxyurea-resistant vaccinia virus: overproduction of ribonucleotide reductase

    SciTech Connect

    Slabaugh, M.B.; Mathews, C.K.

    1986-11-01

    Repeated passage of vaccinia virus in increasing concentrations of hydroxyurea followed by plaque purification resulted in the isolation of variants capable of growth in 5 mM hydroxyurea, a drug concentration which inhibited the reproduction of wild-type vaccinia virus 1000-fold. Analyses of viral protein synthesis by using (/sup 35/S)methionine pulse-labeling at intervals throughout the infection cycle revealed that all isolates overproduced a 34,000-molecular-weight (MW) early polypeptide. Measurement of ribonucleoside-diphosphate reductase activity after infection indicated that 4- to 10-fold more activity was induced by hydroxyurea-resistant viruses than by the wild-type virus. A two-step partial purification resulted in a substantial enrichment for the 34,000-MW protein from extracts of wild-type and hydroxyurea-resistant-virus-infected, but not mock-infected, cells. In the presence of the drug, the isolates incorporated (/sup 3/H)thymidine into DNA earlier and a rate substantially greater than that of the wild type, although the onset of DNA synthesis was delayed in both cases. The drug resistance trait was markedly unstable in all isolates. In the absence of selective pressure, plaque-purified isolated readily segregated progeny that displayed a wide range of resistance phenotypes. The results of this study indicate that vaccinia virus encodes a subunit of ribonucleotide reductase which is 34,000-MW early protein whose overproduction confers hydroxyurea resistance on reproducing viruses.

  19. Increased nitrite reductase activity of fetal versus adult ovine hemoglobin

    PubMed Central

    Blood, Arlin B.; Tiso, Mauro; Verma, Shilpa T.; Lo, Jennifer; Joshi, Mahesh S.; Azarov, Ivan; Longo, Lawrence D.; Gladwin, Mark T.; Kim-Shapiro, Daniel B.; Power, Gordon G.

    2009-01-01

    Growing evidence indicates that nitrite, NO2−, serves as a circulating reservoir of nitric oxide (NO) bioactivity that is activated during physiological and pathological hypoxia. One of the intravascular mechanisms for nitrite conversion to NO is a chemical nitrite reductase activity of deoxyhemoglobin. The rate of NO production from this reaction is increased when hemoglobin is in the R conformation. Because the mammalian fetus exists in a low-oxygen environment compared with the adult and is exposed to episodes of severe ischemia during the normal birthing process, and because fetal hemoglobin assumes the R conformation more readily than adult hemoglobin, we hypothesized that nitrite reduction to NO may be enhanced in the fetal circulation. We found that the reaction was faster for fetal than maternal hemoglobin or blood and that the reactions were fastest at 50–80% oxygen saturation, consistent with an R-state catalysis that is predominant for fetal hemoglobin. Nitrite concentrations were similar in blood taken from chronically instrumented normoxic ewes and their fetuses but were elevated in response to chronic hypoxia. The findings suggest an augmented nitrite reductase activity of fetal hemoglobin and that the production of nitrite may participate in the regulation of vascular NO homeostasis in the fetus. PMID:19028797

  20. Dimethyl Fumarate Induces Glutathione Recycling by Upregulation of Glutathione Reductase

    PubMed Central

    Hoffmann, Christina; Dietrich, Michael; Herrmann, Ann-Kathrin; Schacht, Teresa

    2017-01-01

    Neuronal degeneration in multiple sclerosis has been linked to oxidative stress. Dimethyl fumarate (DMF) is an effective oral therapeutic option shown to reduce disease activity and progression in patients with relapsing-remitting multiple sclerosis. DMF activates the transcription factor nuclear factor erythroid 2-related factor 2 (NRF2) leading to increased synthesis of the major cellular antioxidant glutathione (GSH) and prominent neuroprotection in vitro. We previously demonstrated that DMF is capable of raising GSH levels even when glutathione synthesis is inhibited, suggesting enhanced GSH recycling. Here, we found that DMF indeed induces glutathione reductase (GSR), a homodimeric flavoprotein that catalyzes GSSG reduction to GSH by using NADPH as a reducing cofactor. Knockdown of GSR using a pool of E. coli RNase III-digested siRNAs or pharmacological inhibition of GSR, however, also induced the antioxidant response rendering it impossible to verify the suspected attenuation of DMF-mediated neuroprotection. However, in cystine-free medium, where GSH synthesis is abolished, pharmacological inhibition of GSR drastically reduced the effect of DMF on glutathione recycling. We conclude that DMF increases glutathione recycling through induction of glutathione reductase. PMID:28116039

  1. Nitrate metabolism in tobacco leaves overexpressing Arabidopsis nitrite reductase.

    PubMed

    Davenport, Susie; Le Lay, Pascaline; Sanchez-Tamburrrino, Juan Pablo

    2015-12-01

    Primary nitrogen assimilation in plants includes the reduction of nitrite to ammonium in the chloroplasts by the enzyme nitrite reductase (NiR EC:1.7.7.1) or in the plastids of non-photosynthetic organs. Here we report on a study overexpressing the Arabidopsis thaliana NiR (AtNiR) gene in tobacco plants under the control of a constitutive promoter (CERV - Carnation Etched Ring Virus). The aim was to overexpress AtNiR in an attempt to alter the level of residual nitrite in the leaf which can act as precursor to the formation of nitrosamines. The impact of increasing the activity of AtNiR produced an increase in leaf protein and a stay-green phenotype in the primary transformed AtNiR population. Investigation of the T1 homozygous population demonstrated elevated nitrate reductase (NR) activity, reductions in leaf nitrite and nitrate and the amino acids proline, glutamine and glutamate. Chlorophyl content of the transgenic lines was increased, as evidenced by the stay-green phenotype. This reveals the importance of NiR in primary nitrogen assimilation and how modification of this key enzyme affects both the nitrogen and carbon metabolism of tobacco plants.

  2. Properties of the arsenate reductase of plasmid R773.

    PubMed

    Gladysheva, T B; Oden, K L; Rosen, B P

    1994-06-14

    Resistance to toxic oxyanions in Escherichia coli is conferred by the ars operon carried on plasmid R773. The gene products of this operon catalyze extrusion of antimonials and arsenicals from cells of E. coli, thus providing resistance to those toxic oxyanions. In addition, resistance to arsenate is conferred by the product of the arsC gene. In this report, purified ArsC protein was shown to catalyze reduction of arsenate to arsenite. The enzymatic activity of the ArsC protein required glutaredoxin as a source of reducing equivalents. Other reductants, including glutathione and thioredoxin, were not effective electron donors. A spectrophotometric assay was devised in which arsenate reduction was coupled to NADPH oxidation. The results obtained with the coupled assay corresponded to those found by direct reduction of radioactive arsenate to arsenite. The only substrate of the reaction was arsenate (Km = 8 mM); other oxyanions including phosphate, sulfate, and antimonate were not reduced. Phosphate and sulfate were weak inhibitors, while the product, arsenite, was a stronger inhibitor (Ki = 0.1 mM). Arsenate reductase activity exhibited a pH optimum of 6.3-6.8. These results indicate that the ArsC protein is a novel reductase, and elucidation of its enzymatic mechanism should be of interest.

  3. [Terminal ballistics. 1].

    PubMed

    Mangiante, G; Dagradi, V; Radin, S; Carolo, F; Giarolli, M; Tenci, A; Merico, G; Tosi, D; Acerbi, A; Della Giacoma, G

    1993-01-01

    We have chosen to conceive of terminal ballistics as a violent and extremely rapid confrontation between two forms of resistance before the final state of rest is reached. This definition, which cannot help but don the admittedly loud and outlandish garb of physics, is the most promising for the purposes of biological interpretation. The main characters on this stage are two, but only one of these really plays the lead, namely the human target, which acts out the basic roles inherent in its physical make-up; the other, the bullet, remains a background figure, frozen in its walk-on part, and ready for the next performance. This modus operandi, which is no simplification, but rather an academic necessity, enables us to focus on images which stand out more clearly as a result of an intensive macroscopic spotlight which brings out the features of the individual phenomena, broken down into a succession of close-ups, and subtracts them from the cold physical nature of this or that form of inert matter, which here is merely an occasional, disagreeable witness, or even more, a standing from time to time for but one of the infinite facets of the biological composite being. Here, then, faced with a kind of exploded macrophotograph of a complex kaleidoscope, we see the animal universe, of which we capture so far the plasticity, the subdivisibility, the anisotropy and the cavitation.

  4. Terminal Descent Sensor Simulation

    NASA Technical Reports Server (NTRS)

    Chen, Curtis W.

    2009-01-01

    Sulcata software simulates the operation of the Mars Science Laboratory (MSL) radar terminal descent sensor (TDS). The program models TDS radar antennas, RF hardware, and digital processing, as well as the physics of scattering from a coherent ground surface. This application is specific to this sensor and is flexible enough to handle end-to-end design validation. Sulcata is a high-fidelity simulation and is used for performance evaluation, anomaly resolution, and design validation. Within the trajectory frame, almost all internal vectors are represented in whatever coordinate system is used to represent platform position. The trajectory frame must be planet-fixed. The platform body frame is specified relative to arbitrary reference points relative to the platform (spacecraft or test vehicle). Its rotation is a function of time from the trajectory coordinate system specified via dynamics input (file for open loop, callback for closed loop). Orientation of the frame relative to the body is arbitrary, but constant over time. The TDS frame must have a constant rotation and translation from the platform body frame specified at run time. The DEM frame has an arbitrary, but time-constant, rotation and translation with respect to the simulation frame specified at run time. It has the same orientation as sigma0 frame, but is possibly translated. Surface sigma0 has the same arbitrary rotation and translation as DEM frame.

  5. Anchored terminal conductor

    SciTech Connect

    Milewski, M.A.; Delmolino, W.P.

    1986-08-19

    An electrochemical cell is described comprising a cell container which is closed by a resilient insulative cell top and an electrode conductor inserted through the cell top and into an electrode of the cell, with the electrode conductor being physically and electrically accessible to the exterior of the cell whereby it functions as a terminal for the electrode, and wherein a portion of the electrode conductor is enclosed within the cell top, characterized in that the cell further comprises means for substantially restraining movement of the electrode conductor relative to the cell top. The electrode conductor has a nail configuration comprising a head and a shank with the head of the nail providing the external physical and electrical accessibility, wherein the restraining means is integrated with the shank of the nail. The restraining means is positioned on the shank, interior to the cell container and below the interior surface of the cell top and in close juxtaposition to the interior surface. The restraining means comprises a circumferential barb longitudinally disposed on the shank and having an upper portion which engages the interior surface to provide the substantial restraining of movement.

  6. Sequence and properties of pentaerythritol tetranitrate reductase from Enterobacter cloacae PB2.

    PubMed

    French, C E; Nicklin, S; Bruce, N C

    1996-11-01

    Pentaerythritol tetranitrate reductase, which reductively liberates nitrite from nitrate esters, is related to old yellow enzyme. Pentaerythritol tetranitrate reductase follows a ping-pong mechanism with competitive substrate inhibition by NADPH, is strongly inhibited by steroids, and is capable of reducing the unsaturated bond of 2-cyclohexen-1-one.

  7. Determination of the specific activities of methionine sulfoxide reductase A and B by capillary electrophoresis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A capillary electrophoresis (CE) method for the determination of methionine sulfoxide reductase A and methionine sulfoxide reductase B activities in mouse liver is described. The method is based on detection of the 4-(dimethylamino)azobenzene-4’-sulfonyl derivative of L-methionine (dabsyl Met), the ...

  8. QTL analysis of ferric reductase activity in the model legume lotus japonicus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Physiological and molecular studies have demonstrated that iron accumulation from the soil into Strategy I plants can be limited by ferric reductase activity. An initial study of Lotus japonicus ecotypes Miyakojima MG-20 and Gifu B-129 identified significant leaf chlorosis and ferric reductase activ...

  9. Biliverdin Reductase Mediates Hypoxia-Induced EMT via PI3-Kinase and Akt

    PubMed Central

    Zeng, Rui; Yao, Ying; Han, Min; Zhao, Xiaoqin; Liu, Xiao-Cheng; Wei, Juncheng; Luo, Yun; Zhang, Juan; Zhou, Jianfeng; Wang, Shixuan; Ma, Ding; Xu, Gang

    2008-01-01

    Chronic hypoxia in the renal parenchyma is thought to induce epithelial-to-mesenchymal transition (EMT), leading to fibrogenesis and ultimately end-stage renal failure. Biliverdin reductase, recently identified as a serine/threonine/tyrosine kinase that may activate phosphatidylinositol 3-kinase (PI3K) and Akt, is upregulated in response to reactive oxygen species that may accompany hypoxia. We investigated this potential role of biliverdin reductase in hypoxia-induced renal tubular EMT. Expression of biliverdin reductase was upregulated in a human proximal tubule cell line (HK-2) cultured in hypoxic conditions (1% O2), and this was accompanied by reduced expression of E-cadherin and increased expression of the mesenchymal marker vimentin. Inhibiting PI3K reversed these changes, consistent with EMT. In normoxic conditions, overexpression of biliverdin reductase promoted similar characteristics of EMT, which were also reversed by inhibiting PI3K. Furthermore, using small interfering RNA (siRNA) to knockdown biliverdin reductase, we demonstrated that the enzyme associates with phosphorylated Akt and mediates the hypoxia-induced EMT phenotype. In vivo, expression of biliverdin reductase increased in the tubular epithelia of 5/6-nephrectomized rats, and immunohistochemistry of serial sections demonstrated similar localization of phosphorylated Akt and biliverdin reductase. In conclusion, biliverdin reductase mediates hypoxia-induced EMT through a PI3K/Akt-dependent pathway. PMID:18184861

  10. Nitrate transport is independent of NADH and NAD(P)H nitrate reductases in barley seedlings

    NASA Technical Reports Server (NTRS)

    Warner, R. L.; Huffaker, R. C.

    1989-01-01

    Barley (Hordeum vulgare L.) has NADH-specific and NAD(P)H-bispecific nitrate reductase isozymes. Four isogenic lines with different nitrate reductase isozyme combinations were used to determine the role of NADH and NAD(P)H nitrate reductases on nitrate transport and assimilation in barley seedlings. Both nitrate reductase isozymes were induced by nitrate and were required for maximum nitrate assimilation in barley seedlings. Genotypes lacking the NADH isozyme (Az12) or the NAD(P)H isozyme (Az70) assimilated 65 or 85%, respectively, as much nitrate as the wild type. Nitrate assimilation by genotype (Az12;Az70) which is deficient in both nitrate reductases, was only 13% of the wild type indicating that the NADH and NAD(P)H nitrate reductase isozymes are responsible for most of the nitrate reduction in barley seedlings. For all genotypes, nitrate assimilation rates in the dark were about 55% of the rates in light. Hypotheses that nitrate reductase has direct or indirect roles in nitrate uptake were not supported by this study. Induction of nitrate transporters and the kinetics of net nitrate uptake were the same for all four genotypes indicating that neither nitrate reductase isozyme has a direct role in nitrate uptake in barley seedlings.

  11. War Termination: A Selected Bibliography

    DTIC Science & Technology

    2010-10-01

    Peace Research 33, no. 4 (November 1996): 491-496. JSTOR Phinney, Catherine. "Enhancing Conflict Termination through Problem Solving...96." Journal of Peace Research 34, no. 3 (August 1997): 339-358. JSTOR Bibliographies Bibliography Branch, comp. Conflict Termination

  12. 49 CFR 1242.27 - Coal marine terminals, ore marine terminals, TOFC/COFC terminals, other marine terminals, motor...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    .../COFC terminals, other marine terminals, motor vehicle loading and distribution facilities, and facilities for other specialized service operations (accounts XX-13-29 to XX-13-35, inclusive). 1242.27..., motor vehicle loading and distribution facilities, and facilities for other specialized...

  13. Antitumor Indolequinones Induced Apoptosis in Human Pancreatic Cancer Cells via Inhibition of Thioredoxin Reductase and Activation of Redox Signaling

    PubMed Central

    Yan, Chao; Siegel, David; Newsome, Jeffery; Chilloux, Aurelie; Moody, Christopher J.

    2012-01-01

    Indolequinones (IQs) were developed as potential antitumor agents against human pancreatic cancer. IQs exhibited potent antitumor activity against the human pancreatic cancer cell line MIA PaCa-2 with growth inhibitory IC50 values in the low nanomolar range. IQs were found to induce time- and concentration-dependent apoptosis and to be potent inhibitors of thioredoxin reductase 1 (TR1) in MIA PaCa-2 cells at concentrations equivalent to those inducing growth-inhibitory effects. The mechanism of inhibition of TR1 by the IQs was studied in detail in cell-free systems using purified enzyme. The C-terminal selenocysteine of TR1 was characterized as the primary adduction site of the IQ-derived reactive iminium using liquid chromatography-tandem mass spectrometry analysis. Inhibition of TR1 by IQs in MIA PaCa-2 cells resulted in a shift of thioredoxin-1 redox state to the oxidized form and activation of the p38/c-Jun NH2-terminal kinase (JNK) mitogen-activated protein kinase (MAPK) signaling pathway. Oxidized thioredoxin is known to activate apoptosis signal-regulating kinase 1, an upstream activator of p38/JNK in the MAPK signaling cascade and this was confirmed in our study providing a potential mechanism for IQ-induced apoptosis. These data describe the redox and signaling events involved in the mechanism of growth inhibition induced by novel inhibitors of TR1 in human pancreatic cancer cells. PMID:22147753

  14. Insights into severe 5,10-methylenetetrahydrofolate reductase deficiency: molecular genetic and enzymatic characterization of 76 patients.

    PubMed

    Burda, Patricie; Schäfer, Alexandra; Suormala, Terttu; Rummel, Till; Bürer, Céline; Heuberger, Dorothea; Frapolli, Michele; Giunta, Cecilia; Sokolová, Jitka; Vlášková, Hana; Kožich, Viktor; Koch, Hans Georg; Fowler, Brian; Froese, D Sean; Baumgartner, Matthias R

    2015-06-01

    5,10-Methylenetetrahydrofolate reductase (MTHFR) deficiency is the most common inherited disorder of folate metabolism and causes severe hyperhomocysteinaemia. To better understand the relationship between mutation and function, we performed molecular genetic analysis of 76 MTHFR deficient patients, followed by extensive enzymatic characterization of fibroblasts from 72 of these. A deleterious mutation was detected on each of the 152 patient alleles, with one allele harboring two mutations. Sixty five different mutations (42 novel) were detected, including a common splicing mutation (c.1542G>A) found in 21 alleles. Using an enzyme assay in the physiological direction, we found residual activity (1.7%-42% of control) in 42 cell lines, of which 28 showed reduced affinity for nicotinamide adenine dinucleotide phosphate (NADPH), one reduced affinity for methylenetetrahydrofolate, five flavin adenine dinucleotide-responsiveness, and 24 abnormal kinetics of S-adenosylmethionine inhibition. Missense mutations causing virtually absent activity were found exclusively in the N-terminal catalytic domain, whereas missense mutations in the C-terminal regulatory domain caused decreased NADPH binding and disturbed inhibition by S-adenosylmethionine. Characterization of patients in this way provides a basis for improved diagnosis using expanded enzymatic criteria, increases understanding of the molecular basis of MTHFR dysfunction, and points to the possible role of cofactor or substrate in the treatment of patients with specific mutations.

  15. Male Sterile2 Encodes a Plastid-Localized Fatty Acyl Carrier Protein Reductase Required for Pollen Exine Development in Arabidopsis

    SciTech Connect

    Chen, W.; Shanklin, J.; Yu, X.-H.; Zhang, K.; Shi, J.; De Oliveira, S.; Schreiber, L.; Zhang, D.

    2011-10-01

    Male Sterile2 (MS2) is predicted to encode a fatty acid reductase required for pollen wall development in Arabidopsis (Arabidopsis thaliana). Transient expression of MS2 in tobacco (Nicotiana benthamiana) leaves resulted in the accumulation of significant levels of C16 and C18 fatty alcohols. Expression of MS2 fused with green fluorescent protein revealed that an amino-terminal transit peptide targets the MS2 to plastids. The plastidial localization of MS2 is biologically important because genetic complementation of MS2 in ms2 homozygous plants was dependent on the presence of its amino-terminal transit peptide or that of the Rubisco small subunit protein amino-terminal transit peptide. In addition, two domains, NAD(P)H-binding domain and sterile domain, conserved in MS2 and its homologs were also shown to be essential for MS2 function in pollen exine development by genetic complementation testing. Direct biochemical analysis revealed that purified recombinant MS2 enzyme is able to convert palmitoyl-Acyl Carrier Protein to the corresponding C16:0 alcohol with NAD(P)H as the preferred electron donor. Using optimized reaction conditions (i.e. at pH 6.0 and 30 C), MS2 exhibits a K{sub m} for 16:0-Acyl Carrier Protein of 23.3 {+-} 4.0 {mu}m, a V{sub max} of 38.3 {+-} 4.5 nmol mg{sup -1} min{sup -1}, and a catalytic efficiency/K{sub m} of 1,873 m{sup -1} s{sup -1}. Based on the high homology of MS2 to other characterized fatty acid reductases, it was surprising that MS2 showed no activity against palmitoyl- or other acyl-coenzyme A; however, this is consistent with its plastidial localization. In summary, genetic and biochemical evidence demonstrate an MS2-mediated conserved plastidial pathway for the production of fatty alcohols that are essential for pollen wall biosynthesis in Arabidopsis.

  16. Comparison of finasteride (Proscar), a 5 alpha reductase inhibitor, and various commercial plant extracts in in vitro and in vivo 5 alpha reductase inhibition.

    PubMed

    Rhodes, L; Primka, R L; Berman, C; Vergult, G; Gabriel, M; Pierre-Malice, M; Gibelin, B

    1993-01-01

    Human prostate was used as a source of 5 alpha reductase. Compounds were incubated with an enzyme preparation and [3H]testosterone. [3H]-dihydrotestosterone production was measured to calculate 5 alpha reductase activity. IC50 values (ng/ml) were finasteride = 1; Permixon = 5,600; Talso = 7,000; Strogen Forte = 31,000; Prostagutt = 40,000; and Tadenan = 63,000. Bazoton and Harzol had no activity at concentrations up to 500,000 ng/ml. In castrate rats stimulated with testosterone (T) or dihydrotestosterone (DHT), finasteride, but not Permixon or Bazoton, inhibited T stimulated prostate growth, while none of the three compounds inhibited DHT stimulated growth. These results demonstrate that finasteride inhibits 5 alpha reductase, while Permixon and Bazoton have neither anti-androgen nor 5 alpha reductase inhibitory activity. In addition, in a 7 day human clinical trial, finasteride, but not Permixon or placebo, decreased serum DHT in men, further confirming the lack of 5 alpha reductase inhibition by Permixon. Finasteride and the plant extracts listed above do not inhibit the binding of DHT to the rat prostatic androgen receptor (concentrations to 100 micrograms/ml). Based on these results, it is unlikely that these plant extracts would shrink the prostate by inhibiting androgen action or 5 alpha reductase.

  17. Trypanothione Reductase: A Viable Chemotherapeutic Target for Antitrypanosomal and Antileishmanial Drug Design

    PubMed Central

    Khan, M. Omar F.

    2007-01-01

    Trypanosomiasis and leishmaniasis are two debilitating disease groups caused by parasites of Trypanosoma and Leishmania spp. and affecting millions of people worldwide. A brief outline of the potential targets for rational drug design against these diseases are presented, with an emphasis placed on the enzyme trypanothione reductase. Trypanothione reductase was identified as unique to parasites and proposed to be an effective target against trypanosomiasis and leishmaniasis. The biochemical basis of selecting this enzyme as a target, with reference to the simile and contrast to human analogous enzyme glutathione reductase, and the structural aspects of its active site are presented. The process of designing selective inhibitors for the enzyme trypanothione reductase has been discussed. An overview of the different chemical classes of inhibitors of trypanothione reductase with their inhibitory activities against the parasites and their prospects as future chemotherapeutic agents are briefly revealed. PMID:21901070

  18. Epigallocatechin-3-gallate potently inhibits the in vitro activity of hydroxy-3-methyl-glutaryl-CoA reductase[S

    PubMed Central

    Cuccioloni, Massimiliano; Mozzicafreddo, Matteo; Spina, Michele; Tran, Chi Nhan; Falconi, Maurizio; Eleuteri, Anna Maria; Angeletti, Mauro

    2011-01-01

    Hydroxy-3-methyl-glutaryl-CoA reductase (HMGR) is the rate-controlling enzyme of cholesterol synthesis, and owing to its biological and pharmacological relevance, researchers have investigated several compounds capable of modulating its activity with the hope of developing new hypocholesterolemic drugs. In particular, polyphenol-rich extracts were extensively tested for their cholesterol-lowering effect as alternatives, or adjuvants, to the conventional statin therapies, but a full understanding of the mechanism of their action has yet to be reached. Our work reports on a detailed kinetic and equilibrium study on the modulation of HMGR by the most-abundant catechin in green tea, epigallocatechin-3-gallate (EGCG). Using a concerted approach involving spectrophotometric, optical biosensor, and chromatographic analyses, molecular docking, and site-directed mutagenesis on the cofactor site of HMGR, we have demonstrated that EGCG potently inhibits the in vitro activity of HMGR (Ki in the nanomolar range) by competitively binding to the cofactor site of the reductase. Finally, we evaluated the effect of combined EGCG-statin administration. PMID:21357570

  19. A new cotton SDR family gene encodes a polypeptide possessing aldehyde reductase and 3-ketoacyl-CoA reductase activities.

    PubMed

    Pang, Yu; Song, Wen-Qiang; Chen, Fang-Yuan; Qin, Yong-Mei

    2010-03-01

    To understand regulatory mechanisms of cotton fiber development, microarray analysis has been performed for upland cotton (Gossypium hirsutum). Based on this, a cDNA (GhKCR3) encoding a polypeptide belonging to short-chain alcohol dehydrogenase/reductase family was isolated and cloned. It contains an open reading frame of 987 bp encoding a polypeptide of 328 amino acid residues. Following its overexpression in bacterial cells, the purified recombinant protein specifically uses NADPH to reduce a variety of short-chain aldehydes. A fragment between Gly180 and Gly191 was found to be essential for its catalytic activity. Though the GhKCR3 gene shares low sequence similarities to the ortholog of Saccharomyces cerevisiae YBR159w that encodes 3-ketoacyl-CoA reductase (KCR) catalyzing the second step of fatty acid elongation, it was surprisingly able to complement the yeast ybr159wDelta mutant. Gas chromatography-mass spectrometry analysis showed that very long-chain fatty acids, especially C26:0, were produced in the ybr159wDelta mutant cells expressing GhKCR3. Applying palmitoyl-CoA and malonyl-CoA as substrates, GhKCR3 showed KCR activity in vitro. Quantitative real time-PCR analysis indicated GhKCR3 transcripts accumulated in rapidly elongating fibers, roots, and stems. Our results suggest that GhKCR3 is probably a novel KCR contributing to very long-chain fatty acid biosynthesis in plants.

  20. Polymorphisms of methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTR), methionine synthase reductase (MTRR), and thymidylate synthase (TYMS) in multiple myeloma risk.

    PubMed

    Lima, Carmen S P; Ortega, Manoela M; Ozelo, Margareth C; Araujo, Renato C; De Souza, Cármino A; Lorand-Metze, Irene; Annichino-Bizzacchi, Joyce M; Costa, Fernando F

    2008-03-01

    We tested whether the polymorphisms of the methylenetetrahydrofolate reductase gene, MTHFR C677T and A1298C, the methionine synthase gene, MTR A2756G, the methionine synthase reductase gene, MTRR A66G, and the thymidylate synthase gene, TYMS 2R-->3R, involved in folate and methionine metabolism, altered the risk for multiple myeloma (MM). Genomic DNA from 123MM patients and 188 controls was analysed by polymerase chain reaction and restriction digestion for the polymorphism analyses. The frequency of the MTR 2756 AG plus GG genotype was higher in patients than in controls (39.8% versus 23.4%, P=0.001). Individual carriers of the variant allele G had a 2.31 (95% CI: 1.38-3.87)-fold increased risk for MM compared with others. In contrast, similar frequencies of the MTHFR, the MTRR and the TYMS genotypes were seen in patients and controls. These results suggest, for the first time, a role for the MTR A2756G polymorphism in MM risk in our country, but should be confirmed by large-scale epidemiological studies with patients and controls age matched.

  1. 5,10-Methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) gene polymorphisms and adult meningioma risk.

    PubMed

    Zhang, Jun; Zhou, Yan-Wen; Shi, Hua-Ping; Wang, Yan-Zhong; Li, Gui-Ling; Yu, Hai-Tao; Xie, Xin-You

    2013-11-01

    The causes of meningiomas are not well understood. Folate metabolism gene polymorphisms have been shown to be associated with various human cancers. It is still controversial and ambiguous between the functional polymorphisms of folate metabolism genes 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) and risk of adult meningioma. A population-based case–control study involving 600 meningioma patients (World Health Organization [WHO] Grade I, 391 cases; WHO Grade II, 167 cases; WHO Grade III, 42 cases) and 600 controls was done for the MTHFR C677T and A1298C, MTRR A66G, and MTR A2756G variants in Chinese Han population. The folate metabolism gene polymorphisms were determined by using a polymerase chain reaction–restriction fragment length polymorphism assay. Meningioma cases had a significantly lower frequency of MTHFR 677 TT genotype [odds ratio (OR) = 0.49, 95 % confidence interval (CI) 0.33–0.74; P = 0.001] and T allele (OR = 0.80, 95 % CI 0.67–0.95; P = 0.01) than controls. A significant association between risk of meningioma and MTRR 66 GG (OR = 1.41, 95 % CI 1.02–1.96; P = 0.04) was also observed. When stratifying by the WHO grade of meningioma, no association was found. Our study suggested that MTHFR C677T and MTRR A66G variants may affect the risk of adult meningioma in Chinese Han population.

  2. Curcumin is a tight-binding inhibitor of the most efficient human daunorubicin reductase--Carbonyl reductase 1.

    PubMed

    Hintzpeter, Jan; Hornung, Jan; Ebert, Bettina; Martin, Hans-Jörg; Maser, Edmund

    2015-06-05

    Curcumin is a major component of the plant Curcuma longa L. It is traditionally used as a spice and coloring in foods and is an important ingredient in curry. Curcuminoids have anti-oxidant and anti-inflammatory properties and gained increasing attention as potential neuroprotective and cancer preventive compounds. In the present study, we report that curcumin is a potent tight-binding inhibitor of human carbonyl reductase 1 (CBR1, Ki=223 nM). Curcumin acts as a non-competitive inhibitor with respect to the substrate 2,3-hexandione as revealed by plotting IC50-values against various substrate concentrations and most likely as a competitive inhibitor with respect to NADPH. Molecular modeling supports the finding that curcumin occupies the cofactor binding site of CBR1. Interestingly, CBR1 is one of the most effective human reductases in converting the anthracycline anti-tumor drug daunorubicin to daunorubicinol. The secondary alcohol metabolite daunorubicinol has significantly reduced anti-tumor activity and shows increased cardiotoxicity, thereby limiting the clinical use of daunorubicin. Thus, inhibition of CBR1 may increase the efficacy of daunorubicin in cancer tissue and simultaneously decrease its cardiotoxicity. Western-blots demonstrated basal expression of CBR1 in several cell lines. Significantly less daunorubicin reduction was detected after incubating A549 cell lysates with increasing concentrations of curcumin (up to 60% less with 50 μM curcumin), suggesting a beneficial effect in the co-treatment of anthracycline anti-tumor drugs together with curcumin.

  3. Naegleria fowleri: a free-living highly pathogenic amoeba contains trypanothione/trypanothione reductase and glutathione/glutathione reductase systems.

    PubMed

    Ondarza, Raúl N; Hurtado, Gerardo; Tamayo, Elsa; Iturbe, Angélica; Hernández, Eva

    2006-11-01

    This paper presents definitive data showing that the thiol-bimane compound isolated and purified by HPLC from Naegleria fowleri trophozoites unequivocally corresponds by matrix assisted laser-desorption ionization-time-of-flight MS, to the characteristic monoprotonated ion of trypanothione-(bimane)(2) [M(+)H(+)] of m/z 1104.57 and to the trypanothione-(bimane) of m/z 914.46. The trypanothione disulfide T(S)(2) was also found to have a molecular ion of m/z 723.37. Additionally HPLC demonstrated that thiol-bimane compounds corresponding to cysteine and glutathione were present in Naegleria. The ion patterns of the thiol-bimane compounds prepared from commercial trypanothione standard, Entamoeba histolytica and Crithidia luciliae are identical to the Naegleria thiol-bimane compound. Partially purified extracts from N. fowleri showed the coexistence of glutathione and trypanothione reductases activities. There is not doubt that the thiol compound trypanothione, which was previously thought to occur only in Kinetoplastida, is also present in the human pathogens E. histolytica and N. fowleri, as well as in the non-pathogenic euglenozoan E. gracilis. The presence of the trypanothione/trypanothione reductase system in N. fowleri creates the possibility of using this enzyme as a new "drug target" for rationally designed drugs to eliminate the parasite, without affecting the human host.

  4. Thioredoxin-thioredoxin reductase system of Streptomyces clavuligerus: sequences, expression, and organization of the genes.

    PubMed Central

    Cohen, G; Yanko, M; Mislovati, M; Argaman, A; Schreiber, R; Av-Gay, Y; Aharonowitz, Y

    1993-01-01

    The genes that encode thioredoxin and thioredoxin reductase of Streptomyces clavuligerus were cloned, and their DNA sequences were determined. Previously, we showed that S. clavuligerus possesses a disulfide reductase with broad substrate specificity that biochemically resembles the thioredoxin oxidoreductase system and may play a role in the biosynthesis of beta-lactam antibiotics. It consists consists of two components, a 70-kDa NADPH-dependent flavoprotein disulfide reductase with two identical subunits and a 12-kDa heat-stable protein general disulfide reductant. In this study, we found, by comparative analysis of their predicted amino acid sequences, that the 35-kDa protein is in fact thioredoxin reductase; it shares 48.7% amino acid sequence identity with Escherichia coli thioredoxin reductase, the 12-kDa protein is thioredoxin, and it shares 28 to 56% amino acid sequence identity with other thioredoxins. The streptomycete thioredoxin reductase has the identical cysteine redox-active region--Cys-Ala-Thr-Cys--and essentially the same flavin adenine dinucleotide- and NADPH dinucleotide-binding sites as E. coli thioredoxin reductase and is partially able to accept E. coli thioredoxin as a substrate. The streptomycete thioredoxin has the same cysteine redox-active segment--Trp-Cys-Gly-Pro-Cys--that is present in virtually all eucaryotic and procaryotic thioredoxins. However, in vivo it is unable to donate electrons to E. coli methionine sulfoxide reductase and does not serve as a substrate in vitro for E. coli thioredoxin reductase. The S. clavuligerus thioredoxin (trxA) and thioredoxin reductase (trxB) genes are organized in a cluster. They are transcribed in the same direction and separated by 33 nucleotides. In contrast, the trxA and trxB genes of E. coli, the only other organism in which both genes have been characterized, are physically widely separated. Images PMID:8349555

  5. Flavin reductase: sequence of cDNA from bovine liver and tissue distribution.

    PubMed Central

    Quandt, K S; Hultquist, D E

    1994-01-01

    Flavin reductase catalyzes electron transfer from reduced pyridine nucleotides to methylene blue or riboflavin, and this catalysis is the basis of the therapeutic use of methylene blue or riboflavin in the treatment of methemoglobinemia. A cDNA for a mammalian flavin reductase has been isolated and sequenced. Degenerate oligonucleotides, with sequences based on amino acid sequences of peptides derived from bovine erythrocyte flavin reductase, were used as primers in PCR to selectively amplify a partial cDNA that encodes the bovine reductase. The template used in the PCR was first strand cDNA synthesized from bovine liver total RNA using oligo(dT) primers. A PCR product was used as a specific probe to screen a bovine liver cDNA library. The sequence determined from two overlapping clones contains an open reading frame of 621 nucleotides and encodes 206 amino acids. The amino acid sequence deduced from the bovine liver flavin reductase cDNA matches the amino acid sequences determined for erythrocyte reductase-derived peptides, and the predicted molecular mass of 22,001 Da for the liver reductase agrees well with the molecular mass of 21,994 Da determined for the erythrocyte reductase by electrospray mass spectrometry. The amino acid sequence at the N terminus of the reductase has homology to sequences of pyridine nucleotide-dependent enzymes, and the predicted secondary structure, beta alpha beta, resembles the common nucleotide-binding structural motif. RNA blot analysis indicates a single 1-kilobase reductase transcript in human heart, kidney, liver, lung, pancreas, placenta, and skeletal muscle. Images PMID:7937764

  6. The use of mobile satellite communication terminals

    NASA Astrophysics Data System (ADS)

    Law, P. A.

    The role of small portable terminals in military satellite systems is examined; the discussion embraces terminals with an antenna reflector diameter of seven meters or less. Emphasis is placed on the specification of MARMOSET (Marconi Mobile Satellite Earth Terminal). Also considered are ship-borne satellite terminals, the improved SCOT terminal, interoperability, reduced downlink power, and reliability and availability.

  7. 32 CFR 34.51 - Termination.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ..., in which case the two parties shall agree upon the termination conditions, including the effective date and, in the case of partial termination, the portion to be terminated. (3) By the recipient upon... effective date, and, in the case of partial termination, the portion to be terminated. The recipient...

  8. 32 CFR 32.61 - Termination.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... consent of the recipient, in which case the two parties shall agree upon the termination conditions, including the effective date and, in the case of partial termination, the portion to be terminated; or (3... for such termination, the effective date, and, in the case of partial termination, the portion to...

  9. Laue crystal structure of Shewanella oneidensis cytochrome c nitrite reductase from a high-yield expression system

    SciTech Connect

    Youngblut, Matthew; Judd, Evan T.; Srajer, Vukica; Sayyed, Bilal; Goelzer, Tyler; Elliott, Sean J.; Schmidt, Marius; Pacheco, A. Andrew

    2012-09-11

    The high-yield expression and purification of Shewanella oneidensis cytochrome c nitrite reductase (ccNiR) and its characterization by a variety of methods, notably Laue crystallography, are reported. A key component of the expression system is an artificial ccNiR gene in which the N-terminal signal peptide from the highly expressed S. oneidensis protein 'small tetraheme c' replaces the wild-type signal peptide. This gene, inserted into the plasmid pHSG298 and expressed in S. oneidensis TSP-1 strain, generated approximately 20 mg crude ccNiR per liter of culture, compared with 0.5-1 mg/L for untransformed cells. Purified ccNiR has nitrite and hydroxylamine reductase activities comparable to those previously reported for Escherichia coli ccNiR, and is stable for over 2 weeks in pH 7 solution at 4 C. UV/vis spectropotentiometric titrations and protein film voltammetry identified five independent one-electron reduction processes. Global analysis of the spectropotentiometric data also allowed determination of the extinction coefficient spectra for the five reduced ccNiR species. The characteristics of the individual extinction coefficient spectra suggest that, within each reduced species, the electrons are distributed among the various hemes, rather than being localized on specific heme centers. The purified ccNiR yielded good-quality crystals, with which the 2.59-{angstrom}-resolution structure was solved at room temperature using the Laue diffraction method. The structure is similar to that of E. coli ccNiR, except in the region where the enzyme interacts with its physiological electron donor (CymA in the case of S. oneidensis ccNiR, NrfB in the case of the E. coli protein).

  10. Oxygen reduction in the strict anaerobe Desulfovibrio vulgaris Hildenborough: characterization of two membrane-bound oxygen reductases.

    PubMed

    Lamrabet, O; Pieulle, L; Aubert, C; Mouhamar, F; Stocker, P; Dolla, A; Brasseur, G

    2011-09-01

    Although Desulfovibrio vulgaris Hildenborough (DvH) is a strictly anaerobic bacterium, it is able to consume oxygen in different cellular compartments, including extensive periplasmic O₂ reduction with hydrogen as electron donor. The genome of DvH revealed the presence of cydAB and cox genes, encoding a quinol oxidase bd and a cytochrome c oxidase, respectively. In the membranes of DvH, we detected both quinol oxygen reductase [inhibited by heptyl-hydroxyquinoline-N-oxide (HQNO)] and cytochrome c oxidase activities. Spectral and HPLC data for the membrane fraction revealed the presence of o-, b- and d-type haems, in addition to a majority of c-type haems, but no a-type haem, in agreement with carbon monoxide-binding analysis. The cytochrome c oxidase is thus of the cc(o/b)o₃ type, a type not previously described. The monohaem cytochrome c₅₅₃ is an electron donor to the cytochrome c oxidase; its encoding gene is located upstream of the cox operon and is 50-fold more transcribed than coxI encoding the cytochrome c oxidase subunit I. Even when DvH is grown under anaerobic conditions in lactate/sulfate medium, the two terminal oxidase-encoding genes are expressed. Furthermore, the quinol oxidase bd-encoding genes are more highly expressed than the cox genes. The cox operon exhibits an atypical genomic organization, with the gene coxII located downstream of coxIV. The occurrence of these membrane-bound oxygen reductases in other strictly anaerobic Deltaproteobacteria is discussed.

  11. Role of structural and functional elements of mouse methionine-S-sulfoxide reductase in its subcellular distribution.

    PubMed

    Kim, Hwa-Young; Gladyshev, Vadim N

    2005-06-07

    Oxidized forms of methionine residues in proteins can be repaired by methionine-S-sulfoxide reductase (MsrA) and methionine-R-sulfoxide reductase (MsrB). In mammals, three MsrBs are present, which are targeted to various subcellular compartments. In contrast, only a single mammalian MsrA gene is known whose products have been detected in both cytosol and mitochondria. Factors that determine the location of the protein in these compartments are not known. Here, we found that MsrA was present in cytosol, nucleus, and mitochondria in mouse cells and tissues and that the major enzyme forms detected in various compartments were generated from a single-translation product rather than by alternative translation initiation. Both cytosolic and mitochondrial forms were processed with respect to the N-terminal signal peptide, and the distribution of the protein occurred post-translationally. Deletion of amino acids 69-108, 69-83, 84-108, or 217-233, which contained elements important for MsrA structure and function, led to exclusive mitochondrial location of MsrA, whereas a region that affected substrate binding but was not part of the overall fold had no influence on the subcellular distribution. The data suggested that proper structure-function organization of MsrA played a role in subcellular distribution of this protein in mouse cells. These findings were recapitulated by expressing various forms of mouse MsrA in Saccharomyces cerevisiae, suggesting conservation of the mechanisms responsible for distribution of the mammalian enzyme among different cellular compartments.

  12. Staying green postharvest: how three mutations in the Arabidopsis chlorophyll b reductase gene NYC1 delay degreening by distinct mechanisms.

    PubMed

    Jibran, Rubina; Sullivan, Kerry L; Crowhurst, Ross; Erridge, Zoe A; Chagné, David; McLachlan, Andrew R G; Brummell, David A; Dijkwel, Paul P; Hunter, Donald A

    2015-11-01

    Stresses such as energy deprivation, wounding and water-supply disruption often contribute to rapid deterioration of harvested tissues. To uncover the genetic regulation behind such stresses, a simple assessment system was used to detect senescence mutants in conjunction with two rapid mapping techniques to identify the causal mutations. To demonstrate the power of this approach, immature inflorescences of Arabidopsis plants that contained ethyl methanesulfonate-induced lesions were detached and screened for altered timing of dark-induced senescence. Numerous mutant lines displaying accelerated or delayed timing of senescence relative to wild type were discovered. The underlying mutations in three of these were identified using High Resolution Melting analysis to map to a chromosomal arm followed by a whole-genome sequencing-based mapping method, termed 'Needle in the K-Stack', to identify the causal lesions. All three mutations were single base pair changes and occurred in the same gene, NON-YELLOW COLORING1 (NYC1), a chlorophyll b reductase of the short-chain dehydrogenase/reductase (SDR) superfamily. This was consistent with the mutants preferentially retaining chlorophyll b, although substantial amounts of chlorophyll b were still lost. The single base pair mutations disrupted NYC1 function by three distinct mechanisms, one by producing a termination codon, the second by interfering with correct intron splicing and the third by replacing a highly conserved proline with a non-equivalent serine residue. This non-synonymous amino acid change, which occurred in the NADPH binding domain of NYC1, is the first example of such a mutation in an SDR protein inhibiting a physiological response in plants.

  13. Identification of long chain specific aldehyde reductase and its use in enhanced fatty alcohol production in E. coli.

    PubMed

    Fatma, Zia; Jawed, Kamran; Mattam, Anu Jose; Yazdani, Syed Shams

    2016-09-01

    Long chain fatty alcohols have wide application in chemical industries and transportation sector. There is no direct natural reservoir for long chain fatty alcohol production, thus many groups explored metabolic engineering approaches for its microbial production. Escherichia coli has been the major microbial platform for this effort, however, terminal endogenous enzyme responsible for converting fatty aldehydes of chain length C14-C18 to corresponding fatty alcohols is still been elusive. Through our in silico analysis we selected 35 endogenous enzymes of E. coli having potential of converting long chain fatty aldehydes to fatty alcohols and studied their role under in vivo condition. We found that deletion of ybbO gene, which encodes NADP(+) dependent aldehyde reductase, led to >90% reduction in long chain fatty alcohol production. This feature was found to be strain transcending and reinstalling ybbO gene via plasmid retained the ability of mutant to produce long chain fatty alcohols. Enzyme kinetic study revealed that YbbO has wide substrate specificity ranging from C6 to C18 aldehyde, with maximum affinity and efficiency for C18 and C16 chain length aldehyde, respectively. Along with endogenous production of fatty aldehyde via optimized heterologous expression of cyanobaterial acyl-ACP reductase (AAR), YbbO overexpression resulted in 169mg/L of long chain fatty alcohols. Further engineering involving modulation of fatty acid as well as of phospholipid biosynthesis pathway improved fatty alcohol production by 60%. Finally, the engineered strain produced 1989mg/L of long chain fatty alcohol in bioreactor under fed-batch cultivation condition. Our study shows for the first time a predominant role of a single enzyme in production of long chain fatty alcohols from fatty aldehydes as well as of modulation of phospholipid pathway in increasing the fatty alcohol production.

  14. Laue Crystal Structure of Shewanella oneidensis Cytochrome c Nitrite Reductase from a High-yield Expression System

    PubMed Central

    Youngblut, Matthew; Judd, Evan T.; Srajer, Vukica; Sayyed, Bilal; Goelzer, Tyler; Elliott, Sean J.; Schmidt, Marius; Pacheco, A. Andrew

    2012-01-01

    The high-yield expression and purification of Shewanella oneidensis cytochrome c nitrite reductase (ccNiR), and its characterization by a variety of methods, notably Laue crystallography, is reported. A key component of the expression system is an artificial ccNiR gene in which the N-terminal signal peptide from the highly expressed S. oneidensis protein “Small Tetra-heme c” replaces the wild-type signal peptide. This gene, inserted into the plasmid pHSG298 and expressed in S. oneidensis TSP-1 strain, generated ~20 mg crude ccNiR/L culture, compared with 0.5–1 mg/L for untransformed cells. Purified ccNiR has nitrite and hydroxylamine reductase activities comparable to those previously reported for E. coli ccNiR, and is stable for over two weeks in pH 7 solution at 4° C. UV/Vis spectropotentiometric titrations and protein film voltammetry identified 5 independent 1-electron reduction processes. Global analysis of the spectropotentiometric data also allowed determination of the extinction coefficient spectra for the 5 reduced ccNiR species. The characteristics of the individual extinction coefficient spectra suggest that, within each reduced species, the electrons are distributed amongst the various hemes, rather than being localized on specific heme centers. The purified ccNiR yielded good quality crystals, with which the 2.59 Å resolution structure was solved at room temperature using the Laue diffraction method. The structure is similar to that of E. coli ccNiR, except in the region where the enzyme interacts with its physiological electron donor (CymA in the case of S. oneidensis ccNiR, NrfB in the case of the E. coli protein). PMID:22382353

  15. Low Earth Orbiter: Terminal

    NASA Technical Reports Server (NTRS)

    Kremer, Steven E.; Bundick, Steven N.

    1999-01-01

    In response to the current government budgetary environment that requires the National Aeronautics and Space Administration (NASA) to do more with less, NASA/Goddard Space Flight Center's Wallops Flight Facility has developed and implemented a class of ground stations known as a Low Earth Orbiter-Terminal (LEO-T). This development thus provides a low-cost autonomous ground tracking service for NASA's customers. More importantly, this accomplishment provides a commercial source to spacecraft customers around the world to purchase directly from the company awarded the NASA contract to build these systems. A few years ago, NASA was driven to provide more ground station capacity for spacecraft telemetry, tracking, and command (TT&C) services with a decreasing budget. NASA also made a decision to develop many smaller, cheaper satellites rather than a few large spacecraft as done in the past. In addition, university class missions were being driven to provide their own TT&C services due to the increasing load on the NASA ground-tracking network. NASA's solution for this ever increasing load was to use the existing large aperture systems to support those missions requiring that level of performance and to support the remainder of the missions with the autonomous LEO-T systems. The LEO-T antenna system is a smaller, cheaper, and fully autonomous unstaffed system that can operate without the existing NASA support infrastructure. The LEO-T provides a low-cost, reliable space communications service to the expanding number of low-earth orbiting missions around the world. The system is also fostering developments that improve cost-effectiveness of autonomous-class capabilities for NASA and commercial space use. NASA has installed three LEO-T systems. One station is at the University of Puerto Rico, the second system is installed at the Poker Flat Research Range near Fairbanks, Alaska, and the third system is installed at NASA's Wallops Flight Facility in Virginia. This paper

  16. Smart sensor for terminal homing

    NASA Astrophysics Data System (ADS)

    Panda, D.; Aggarwal, R.; Hummel, R.

    1980-01-01

    The practical scene matching problem is considered to present certain complications which must extend classical image processing capabilities. Certain aspects of the scene matching problem which must be addressed by a smart sensor for terminal homing are discussed. First a philosophy for treating the matching problem for the terminal homing scenario is outlined. Then certain aspects of the feature extraction process and symbolic pattern matching are considered. It is thought that in the future general ideas from artificial intelligence will be more useful for terminal homing requirements of fast scene recognition and pattern matching.

  17. Kinetic and product distribution analysis of NO* reductase activity in Nitrosomonas europaea hydroxylamine oxidoreductase.

    PubMed

    Kostera, Joshua; Youngblut, Matthew D; Slosarczyk, Jeffrey M; Pacheco, A Andrew

    2008-09-01

    Hydroxylamine oxidoreductase (HAO) from the ammonia-oxidizing bacterium Nitrosomonas europaea normally catalyzes the four-electron oxidation of hydroxylamine to nitrite, which is the second step in ammonia-dependent respiration. Here we show that, in the presence of methyl viologen monocation radical (MV(red)), HAO can catalyze the reduction of nitric oxide to ammonia. The process is analogous to that catalyzed by cytochrome c nitrite reductase, an enzyme found in some bacteria that use nitrite as a terminal electron acceptor during anaerobic respiration. The availability of a reduction pathway to ammonia is an important factor to consider when designing in vitro studies of HAO, and may also have some physiological relevance. The reduction of nitric oxide to ammonia proceeds in two kinetically distinct steps: nitric oxide is first reduced to hydroxylamine, and then hydroxylamine is reduced to ammonia at a tenfold slower rate. The second step was investigated independently in solutions initially containing hydroxylamine, MV(red), and HAO. Both steps show first-order dependence on nitric oxide and HAO concentrations, and zero-order dependence on MV(red) concentration. The rate constants governing each reduction step were found to have values of (4.7 +/- 0.3) x 10(5) and (2.06 +/- 0.04) x 10(4) M(-1) s(-1), respectively. A second reduction pathway, with second-order dependence on nitric oxide, may become available as the concentration of nitric oxide is increased. Such a pathway might lead to production of nitrous oxide. We estimate a maximum value of (1.5 +/- 0.05) x 10(10) M(-2) s(-1) for the rate constant of the alternative pathway, which is small and suggests that the pathway is not physiologically important.

  18. The nitrate reductase-encoding gene of Volvox carteri: map location, sequence and induction kinetics.

    PubMed

    Gruber, H; Goetinck, S D; Kirk, D L; Schmitt, R

    1992-10-12

    The nitrate reductase (NR) structural gene (nitA) of Volvox carteri has been cloned and characterized. There is a single copy of this gene in the genome, and RFLP (restriction-fragment length polymorphism) analysis assigns it to the previously defined nitA/chlR locus on linkage group IX, 20-30 cM from the two beta-tubulin-encoding loci. Determination of the 5871-nt sequence of the coding region of genomic clones, and comparisons to a cDNA sequence, revealed ten introns and eleven exons that encode a 864-aa polypeptide. Detailed comparisons with higher-plant and fungal NRs indicate that, whereas the aa sequence is strongly conserved within functional domains for the flavin adenine dinucleotide-, heme- and molybdenum-pterin cofactor-binding sites, substantial differences in the aa sequence occur in the N-terminal end and the two inter-domain regions. Two potential transcription start points 439 and 452 nt upstream from the start codon and a polyadenylation signal 355 nt downstream from the stop codon have been identified by primer-extension analysis and cDNA sequencing, respectively. Accumulation of the nitA transcript is both induced by nitrate and repressed by ammonium and urea: after the organism is transferred from ammonium to nitrate as the nitrogen source, a 3.6-kb NR transcript is readily detectable on Northern blots by 10 min, reaches maximum abundance by 30 min, and then rapidly declines to an intermediate level that is subsequently maintained. Substantial induction by nitrate is observed at the end of the dark portion of the daily light/dark cycle, but the inductive response peaks in the first hour of the light period.(ABSTRACT TRUNCATED AT 250 WORDS)

  19. Structures of trihydroxynaphthalene reductase-fungicide complexes: implications for structure-based design and catalysis

    SciTech Connect

    Liao, D.-I.; Basarab, G.S.; Gatenby, A.A.; Valent, B.; Jordan, D.B.

    2010-03-08

    Trihydroxynaphthalene reductase catalyzes two intermediate steps in the fungal melanin biosynthetic pathway. The enzyme, a typical short-chain dehydrogenase, is the biochemical target of three commercial fungicides. The fungicides bind preferentially to the NADPH form of the enzyme. Three X-ray structures of the Magnaporthe grisea enzyme complexed with NADPH and two commercial and one experimental fungicide were determined at 1.7 {angstrom} (pyroquilon), 2.0 {angstrom} (2,3-dihydro-4-nitro-1H-inden-1-one, 1), and 2.1 {angstrom} (phthalide) resolutions. The chemically distinct inhibitors occupy similar space within the enzyme's active site. The three inhibitors share hydrogen bonds with the side chain hydroxyls of Ser-164 and Tyr-178 via a carbonyl oxygen (pyroquilon and 1) or via a carbonyl oxygen and a ring oxygen (phthalide). Active site residues occupy similar positions among the three structures. A buried water molecule that is hydrogen bonded to the NZ nitrogen of Lys-182 in each of the three structures likely serves to stabilize the cationic form of the residue for participation in catalysis. The pro S hydrogen of NADPH (which is transferred as a hydride to the enzyme's naphthol substrates) is directed toward the carbonyl carbon of the inhibitors that mimic an intermediate along the reaction coordinate. Modeling tetrahydroxynaphthalene and trihydroxynaphthalene in the active site shows steric and electrostatic repulsion between the extra hydroxyl oxygen of the former substrate and the sulfur atom of Met-283 (the C-terminal residue), which accounts, in part, for the 4-fold greater substrate specificity for trihydroxynaphthalene over tetrahydroxynaphthalene.

  20. Subcellular localization of Arabidopsis 3-hydroxy-3-methylglutaryl-coenzyme A reductase.

    PubMed

    Leivar, Pablo; González, Víctor M; Castel, Susanna; Trelease, Richard N; López-Iglesias, Carmen; Arró, Montserrat; Boronat, Albert; Campos, Narciso; Ferrer, Albert; Fernàndez-Busquets, Xavier

    2005-01-01

    Plants produce diverse isoprenoids, which are synthesized in plastids, mitochondria, endoplasmic reticulum (ER), and the nonorganellar cytoplasm. 3-Hydroxy-3-methylglutaryl-coenzyme A reductase (HMGR) catalyzes the synthesis of mevalonate, a rate-limiting step in the cytoplasmic pathway. Several branches of the pathway lead to the synthesis of structurally and functionally varied, yet essential, isoprenoids. Several HMGR isoforms have been identified in all plants examined. Studies based on gene expression and on fractionation of enzyme activity suggested that subcellular compartmentalization of HMGR is an important intracellular channeling mechanism for the production of the specific classes of isoprenoids. Plant HMGR has been shown previously to insert in vitro into the membrane of microsomal vesicles, but the final in vivo subcellular localization(s) remains controversial. To address the latter in Arabidopsis (Arabidopsis thaliana) cells, we conducted a multipronged microscopy and cell fractionation approach that included imaging of chimeric HMGR green fluorescent protein localizations in transiently transformed cell leaves, immunofluorescence confocal microscopy in wild-type and stably transformed seedlings, immunogold electron microscopy examinations of endogenous HMGR in seedling cotyledons, and sucrose density gradient analyses of HMGR-containing organelles. Taken together, the results reveal that endogenous Arabidopsis HMGR is localized at steady state within ER as expected, but surprisingly also predominantly within spherical, vesicular structures that range from 0.2- to 0.6-microm diameter, located in the cytoplasm and within the central vacuole in differentiated cotyledon cells. The N-terminal region, including the transmembrane domain of HMGR, was found to be necessary and sufficient for directing HMGR to ER and the spherical structures. It is believed, although not directly demonstrated, that these vesicle-like structures are derived from segments of

  1. Subcellular Localization of Arabidopsis 3-Hydroxy-3-Methylglutaryl-Coenzyme A Reductase1

    PubMed Central

    Leivar, Pablo; González, Víctor M.; Castel, Susanna; Trelease, Richard N.; López-Iglesias, Carmen; Arró, Montserrat; Boronat, Albert; Campos, Narciso; Ferrer, Albert; Fernàndez-Busquets, Xavier

    2005-01-01

    Plants produce diverse isoprenoids, which are synthesized in plastids, mitochondria, endoplasmic reticulum (ER), and the nonorganellar cytoplasm. 3-Hydroxy-3-methylglutaryl-coenzyme A reductase (HMGR) catalyzes the synthesis of mevalonate, a rate-limiting step in the cytoplasmic pathway. Several branches of the pathway lead to the synthesis of structurally and functionally varied, yet essential, isoprenoids. Several HMGR isoforms have been identified in all plants examined. Studies based on gene expression and on fractionation of enzyme activity suggested that subcellular compartmentalization of HMGR is an important intracellular channeling mechanism for the production of the specific classes of isoprenoids. Plant HMGR has been shown previously to insert in vitro into the membrane of microsomal vesicles, but the final in vivo subcellular localization(s) remains controversial. To address the latter in Arabidopsis (Arabidopsis thaliana) cells, we conducted a multipronged microscopy and cell fractionation approach that included imaging of chimeric HMGR green fluorescent protein localizations in transiently transformed cell leaves, immunofluorescence confocal microscopy in wild-type and stably transformed seedlings, immunogold electron microscopy examinations of endogenous HMGR in seedling cotyledons, and sucrose density gradient analyses of HMGR-containing organelles. Taken together, the results reveal that endogenous Arabidopsis HMGR is localized at steady state within ER as expected, but surprisingly also predominantly within spherical, vesicular structures that range from 0.2- to 0.6-μm diameter, located in the cytoplasm and within the central vacuole in differentiated cotyledon cells. The N-terminal region, including the transmembrane domain of HMGR, was found to be necessary and sufficient for directing HMGR to ER and the spherical structures. It is believed, although not directly demonstrated, that these vesicle-like structures are derived from segments of HMGR

  2. Increasing cholesterol synthesis in 7-dehydrosterol reductase (DHCR7) deficient mouse models through gene transfer

    PubMed Central

    Matabosch, Xavier; Ying, Lee; Serra, Montserrat; Wassif, Christopher A.; Porter, Forbes D.; Shackleton, Cedric; Watson, Gordon

    2010-01-01

    Smith-Lemli-Opitz syndrome (SLOS) is caused by deficiency in the terminal step of cholesterol biosynthesis: the conversion of 7-dehydrocholesterol (7DHC) to cholesterol (C), catalyzed by 7-dehydrocholesterol reductase (DHCR7). This disorder exhibits several phenotypic traits including dysmorphia and mental retardation with a broad range of severity. There are few proven treatment options. That most commonly used is a high cholesterol diet that seems to enhance the quality of life and improve behavioral characteristics of patients, although these positive effects are controversial. The goal of our study was to investigate the possibility of restoring DHCR7 activity by gene transfer. We constructed an adeno-associated virus (AAV) vector containing the DHCR7 gene. After we infused this vector into affected mice, the introduced DHCR7 gene could be identified in liver, mRNA was expressed and a functional enzyme was produced. Evidence of functionality came from the ability to partially normalize the serum ratio of 7DHC/C in treated animals, apparently by increasing cholesterol production with concomitant decrease in 7DHC precursor. By five weeks after treatment the mean ratio (for 7 animals) had fallen to 0.05 while the ratio for untreated littermate controls had risen to 0.14. This provides proof of principle that gene transfer can ameliorate the genetic defect causing SLOS and provides a new experimental tool for studying the pathogenesis of this disease. If effective in humans, it might also offer a possible alternative to exogenous cholesterol therapy. However, it would not offer a complete cure for the disorder as many of the negative implications of defective synthesis are already established during prenatal development. PMID:20800683

  3. The NapF protein of the Escherichia coli periplasmic nitrate reductase system: demonstration of a cytoplasmic location and interaction with the catalytic subunit, NapA.

    PubMed

    Nilavongse, Arjaree; Brondijk, T Harma C; Overton, Tim W; Richardson, David J; Leach, Emily R; Cole, Jeffrey A

    2006-11-01

    The periplasmic nitrate reductase of Escherichia coli is important during anaerobic growth in low-nitrate environments. The nap operon encoding this nitrate reductase comprises seven genes including a gene, napF, that encodes a putative cytoplasmic iron-sulphur protein of uncertain subcellular location and function. In this study, N-terminal sequence analysis, cell fractionation coupled with immunoblotting and construction of LacZ and PhoA fusion proteins were used together to establish that NapF is located in the E. coli cytoplasm. A bacterial two-hybrid protein-protein interaction system was used to demonstrate that NapF interacted in the cytoplasm with the terminal oxidoreductase NapA, but that it did not self-associate or interact with other electron-transport components of the Nap system, NapC, NapG or NapH, or with another cytoplasmic component, NapD. NapF, purified as a His(6)-tagged protein, exhibited spectral properties characteristic of an iron-sulphur protein. This protein was able to pull down NapA from soluble extracts of E. coli. A growth-based assay for NapF function in intact cell cultures was developed and applied to assess the effect of mutation of a number of conserved amino acids. It emerged that neither a highly conserved N-terminal double-arginine motif, nor a conserved proline motif, is essential for NapF-dependent growth. The combined data indicate that NapF plays one or more currently unidentified roles in the post-translational modification of NapA prior to the export of folded NapA via the twin-arginine translocation pathway into the periplasm.

  4. The fnr Gene of Bacillus licheniformis and the Cysteine Ligands of the C-Terminal FeS Cluster

    PubMed Central

    Klinger, Anette; Schirawski, Jan; Glaser, Philippe; Unden, Gottfried

    1998-01-01

    In the facultatively anaerobic bacterium Bacillus licheniformis a gene encoding a protein of the fumarate nitrate reductase family of transcriptional regulators (Fnr) was isolated. Unlike Fnr proteins from gram-negative bacteria, but like Fnr from Bacillus subtilis, the protein contained a C-terminal cluster of cysteine residues. Unlike in Fnr from B. subtilis, this cluster (Cys226-X2-Cys229-X4-Cys234) is composed of only three Cys residues, which are supposed to serve together with an internal residue (Cys71) as the ligands for an FeS center. Transfer of the B. licheniformis gene to an fnr mutant of B. subtilis complemented the ability for synthesis of nitrate reductase during anaerobic growth. PMID:9642208

  5. The fnr gene of Bacillus licheniformis and the cysteine ligands of the C-terminal FeS cluster.

    PubMed

    Klinger, A; Schirawski, J; Glaser, P; Unden, G

    1998-07-01

    In the facultatively anaerobic bacterium Bacillus licheniformis a gene encoding a protein of the fumarate nitrate reductase family of transcriptional regulators (Fnr) was isolated. Unlike Fnr proteins from gram-negative bacteria, but like Fnr from Bacillus subtilis, the protein contained a C-terminal cluster of cysteine residues. Unlike in Fnr from B. subtilis, this cluster (Cys226-X2-Cys229-X4-Cys234) is composed of only three Cys residues, which are supposed to serve together with an internal residue (Cys71) as the ligands for an FeS center. Transfer of the B. licheniformis gene to an fnr mutant of B. subtilis complemented the ability for synthesis of nitrate reductase during anaerobic growth.

  6. B-vitamins, methylenetetrahydrofolate reductase (MTHFR) and hypertension.

    PubMed

    Ward, Mary; Wilson, Carol P; Strain, J J; Horigan, Geraldine; Scott, John M; McNulty, Helene

    2011-07-01

    Hypertension is a leading risk factor for cardiovascular disease (CVD) and stroke. A common polymorphism in the gene encoding the enzyme methylenetetrahydrofolate reductase (MTHFR), previously identified as the main genetic determinant of elevated homocysteine concentration and also recognized as a risk factor for CVD, appears to be independently associated with hypertension. The B-vitamin riboflavin is required as a cofactor by MTHFR and recent evidence suggests it may have a role in modulating blood pressure, specifically in those with the homozygous mutant MTHFR 677 TT genotype. If studies confirm that this genetic predisposition to hypertension is correctable by low-dose riboflavin, the findings could have important implications for the management of hypertension given that the frequency of this polymorphism ranges from 3 to 32 % worldwide.

  7. A ribonucleotide reductase inhibitor with deoxyribonucleoside-reversible cytotoxicity.

    PubMed

    Crona, Mikael; Codó, Paula; Jonna, Venkateswara Rao; Hofer, Anders; Fernandes, Aristi P; Tholander, Fredrik

    2016-11-01

    Ribonucleotide Reductase (RNR) is the sole enzyme that catalyzes the reduction of ribonucleotides into deoxyribonucleotides. Even though RNR is a recognized target for antiproliferative molecules, and the main target of the approved drug hydroxyurea, few new leads targeted to this enzyme have been developed. We have evaluated a recently identified set of RNR inhibitors with respect to inhibition of the human enzyme and cellular toxicity. One compound, NSC73735, is particularly interesting; it is specific for leukemia cells and is the first identified compound that hinders oligomerization of the mammalian large RNR subunit. Similar to hydroxyurea, it caused a disruption of the cell cycle distribution of cultured HL-60 cells. In contrast to hydroxyurea, the disruption was reversible, indicating higher specificity. NSC73735 thus defines a potential lead candidate for RNR-targeted anticancer drugs, as well as a chemical probe with better selectivity for RNR inhibition than hydroxyurea.

  8. Crystal structure of isoflavone reductase from alfalfa (Medicago sativa L.).

    PubMed

    Wang, Xiaoqiang; He, Xianzhi; Lin, Jianqiao; Shao, Hui; Chang, Zhenzhan; Dixon, Richard A

    2006-05-19

    Isoflavonoids play important roles in plant defense and exhibit a range of mammalian health-promoting activities. Isoflavone reductase (IFR) specifically recognizes isoflavones and catalyzes a stereospecific NADPH-dependent reduction to (3R)-isoflavanone. The crystal structure of Medicago sativa IFR with deletion of residues 39-47 has been determined at 1.6A resolution. Structural analysis, molecular modeling and docking, and comparison with the structures of other NADPH-dependent enzymes, defined the putative binding sites for co-factor and substrate and potential key residues for enzyme activity and substrate specificity. Further mutagenesis has confirmed the role of Lys144 as a catalytic residue. This study provides a structural basis for understanding the enzymatic mechanism and substrate specificity of IFRs as well as the functions of IFR-like proteins.

  9. Vitamin K epoxide reductase: homology, active site and catalytic mechanism.

    PubMed

    Goodstadt, Leo; Ponting, Chris P

    2004-06-01

    Vitamin K epoxide reductase (VKOR) recycles reduced vitamin K, which is used subsequently as a co-factor in the gamma-carboxylation of glutamic acid residues in blood coagulation enzymes. VKORC1, a subunit of the VKOR complex, has recently been shown to possess this activity. Here, we show that VKORC1 is a member of a large family of predicted enzymes that are present in vertebrates, Drosophila, plants, bacteria and archaea. Four cysteine residues and one residue, which is either serine or threonine, are identified as likely active-site residues. In some plant and bacterial homologues the VKORC1 homologous domain is fused with domains of the thioredoxin family of oxidoreductases. These might reduce disulfide bonds of VKORC1-like enzymes as a prerequisite for their catalytic activities.

  10. Thioredoxin reductase 1 suppresses adipocyte differentiation and insulin responsiveness

    PubMed Central

    Peng, Xiaoxiao; Giménez-Cassina, Alfredo; Petrus, Paul; Conrad, Marcus; Rydén, Mikael; Arnér, Elias S. J.

    2016-01-01

    Recently thioredoxin reductase 1 (TrxR1), encoded by Txnrd1, was suggested to modulate glucose and lipid metabolism in mice. Here we discovered that TrxR1 suppresses insulin responsiveness, anabolic metabolism and adipocyte differentiation. Immortalized mouse embryonic fibroblasts (MEFs) lacking Txnrd1 (Txnrd1−/−) displayed increased metabolic flux, glycogen storage, lipogenesis and adipogenesis. This phenotype coincided with upregulated PPARγ expression, promotion of mitotic clonal expansion and downregulation of p27 and p53. Enhanced Akt activation also contributed to augmented adipogenesis and insulin sensitivity. Knockdown of TXNRD1 transcripts accelerated adipocyte differentiation also in human primary preadipocytes. Furthermore, TXNRD1 transcript levels in subcutaneous adipose tissue from 56 women were inversely associated with insulin sensitivity in vivo and lipogenesis in their isolated adipocytes. These results suggest that TrxR1 suppresses anabolic metabolism and adipogenesis by inhibition of intracellular signaling pathways downstream of insulin stimulation. PMID:27346647

  11. B-factor Analysis and Conformational Rearrangement of Aldose Reductase.

    PubMed

    Balendiran, Ganesaratnam K; Pandian, J Rajendran; Drake, Evin; Vinayak, Anubhav; Verma, Malkhey; Cascio, Duilio

    2014-01-01

    The NADPH-dependent reduction of glucose reaction that is catalyzed by Aldose Reductase (AR) follows a sequential ordered kinetic mechanism in which the co-factor NADPH binds to the enzyme prior to the aldehyde substrate. The kinetic/structural experiments have found a conformational change involving a hinge-like movement of a surface loop (residues 213-224) which is anticipated to take place upon the binding of the diphosphate moiety of NADPH. The reorientation of this loop, expected to permit the release of NADP(+), represents the rate-limiting step of the catalytic mechanism. This study reveals: 1) The Translation/Libration/Screw (TLS) analysis of absolute B-factors of apo AR crystal structures indicates that the 212-224 loop might move as a rigid group. 2) Residues that make the flexible loop slide in the AR binary and ternary complexes. 3) The normalized B-factors separate this segment into three different clusters with fewer residues.

  12. Mechanism of inhibition of ribonucleotide reductase with motexafin gadolinium (MGd)

    SciTech Connect

    Zahedi Avval, Farnaz; Berndt, Carsten; Pramanik, Aladdin; Holmgren, Arne

    2009-02-13

    Motexafin gadolinium (MGd) is an expanded porphyrin anticancer agent which selectively targets tumor cells and works as a radiation enhancer, with promising results in clinical trials. Its mechanism of action is oxidation of intracellular reducing molecules and acting as a direct inhibitor of mammalian ribonucleotide reductase (RNR). This paper focuses on the mechanism of inhibition of RNR by MGd. Our experimental data present at least two pathways for inhibition of RNR; one precluding subunits oligomerization and the other direct inhibition of the large catalytic subunit of the enzyme. Co-localization of MGd and RNR in the cytoplasm particularly in the S-phase may account for its inhibitory properties. These data can elucidate an important effect of MGd on the cancer cells with overproduction of RNR and its efficacy as an anticancer agent and not only as a general radiosensitizer.

  13. Structure of a bacterial homologue of vitamin K epoxide reductase

    SciTech Connect

    Li, Weikai; Schulman, Sol; Dutton, Rachel J.; Boyd, Dana; Beckwith, Jon; Rapoport, Tom A.

    2010-03-19

    Vitamin K epoxide reductase (VKOR) generates vitamin K hydroquinone to sustain {gamma}-carboxylation of many blood coagulation factors. Here, we report the 3.6 {angstrom} crystal structure of a bacterial homologue of VKOR from Synechococcus sp. The structure shows VKOR in complex with its naturally fused redox partner, a thioredoxin-like domain, and corresponds to an arrested state of electron transfer. The catalytic core of VKOR is a four transmembrane helix bundle that surrounds a quinone, connected through an additional transmembrane segment with the periplasmic thioredoxin-like domain. We propose a pathway for how VKOR uses electrons from cysteines of newly synthesized proteins to reduce a quinone, a mechanism confirmed by in vitro reconstitution of vitamin K-dependent disulphide bridge formation. Our results have implications for the mechanism of the mammalian VKOR and explain how mutations can cause resistance to the VKOR inhibitor warfarin, the most commonly used oral anticoagulant.

  14. Go green: the anti-inflammatory effects of biliverdin reductase.

    PubMed

    Wegiel, Barbara; Otterbein, Leo E

    2012-01-01

    Biliverdin (BV) has emerged as a cytoprotective and important anti-inflammatory molecule. Conversion of BV to bilirubin (BR) is catalyzed by biliverdin reductase (BVR) and is required for the downstream signaling and nuclear localization of BVR. Recent data by others and us make clear that BVR is a critical regulator of innate immune responses resulting from acute insult and injury and moreover, that a lack of BVR results in an enhanced proinflammatory phenotype. In macrophages, BVR is regulated by its substrate BV which leads to activation of the PI3K-Akt-IL-10 axis and inhibition of TLR4 expression via direct binding of BVR to the TLR4 promoter. In this review, we will summarize recent findings on the role of BVR and the bile pigments in inflammation in context with its activity as an enzyme, receptor, and transcriptional regulator.

  15. Identification of imine reductase-specific sequence motifs.

    PubMed

    Fademrecht, Silvia; Scheller, Philipp N; Nestl, Bettina M; Hauer, Bernhard; Pleiss, Jürgen

    2016-05-01

    Chiral amines are valuable building blocks for the production of a variety of pharmaceuticals, agrochemicals and other specialty chemicals. Only recently, imine reductases (IREDs) were discovered which catalyze the stereoselective reduction of imines to chiral amines. Although several IREDs were biochemically characterized in the last few years, knowledge of the reaction mechanism and the molecular basis of substrate specificity and stereoselectivity is limited. To gain further insights into the sequence-function relationships, the Imine Reductase Engineering Database (www.IRED.BioCatNet.de) was established and a systematic analysis of 530 putative IREDs was performed. A standard numbering scheme based on R-IRED-Sk was introduced to facilitate the identification and communication of structurally equivalent positions in different proteins. A conservation analysis revealed a highly conserved cofactor binding region and a predominantly hydrophobic substrate binding cleft. Two IRED-specific motifs were identified, the cofactor binding motif GLGxMGx(5 )[ATS]x(4) Gx(4) [VIL]WNR[TS]x(2) [KR] and the active site motif Gx[DE]x[GDA]x[APS]x(3){K}x[ASL]x[LMVIAG]. Our results indicate a preference toward NADPH for all IREDs and explain why, despite their sequence similarity to β-hydroxyacid dehydrogenases (β-HADs), no conversion of β-hydroxyacids has been observed. Superfamily-specific conservations were investigated to explore the molecular basis of their stereopreference. Based on our analysis and previous experimental results on IRED mutants, an exclusive role of standard position 187 for stereoselectivity is excluded. Alternatively, two standard positions 139 and 194 were identified which are superfamily-specifically conserved and differ in R- and S-selective enzymes.

  16. Evidence for a Hexaheteromeric Methylenetetrahydrofolate Reductase in Moorella thermoacetica

    PubMed Central

    Mock, Johanna; Wang, Shuning; Huang, Haiyan; Kahnt, Jörg

    2014-01-01

    Moorella thermoacetica can grow with H2 and CO2, forming acetic acid from 2 CO2 via the Wood-Ljungdahl pathway. All enzymes involved in this pathway have been characterized to date, except for methylenetetrahydrofolate reductase (MetF). We report here that the M. thermoacetica gene that putatively encodes this enzyme, metF, is part of a transcription unit also containing the genes hdrCBA, mvhD, and metV. MetF copurified with the other five proteins encoded in the unit in a hexaheteromeric complex with an apparent molecular mass in the 320-kDa range. The 40-fold-enriched preparation contained per mg protein 3.1 nmol flavin adenine dinucleotide (FAD), 3.4 nmol flavin mononucleotide (FMN), and 110 nmol iron, almost as predicted from the primary structure of the six subunits. It catalyzed the reduction of methylenetetrahydrofolate with reduced benzyl viologen but not with NAD(P)H in either the absence or presence of oxidized ferredoxin. It also catalyzed the reversible reduction of benzyl viologen with NADH (diaphorase activity). Heterologous expression of the metF gene in Escherichia coli revealed that the subunit MetF contains one FMN rather than FAD. MetF exhibited 70-fold-higher methylenetetrahydrofolate reductase activity with benzyl viologen when produced together with MetV, which in part shows sequence similarity to MetF. Heterologously produced HdrA contained 2 FADs and had NAD-specific diaphorase activity. Our results suggested that the physiological electron donor for methylenetetrahydrofolate reduction in M. thermoacetica is NADH and that the exergonic reduction of methylenetetrahydrofolate with NADH is coupled via flavin-based electron bifurcation with the endergonic reduction of an electron acceptor, whose identity remains unknown. PMID:25002540

  17. The modulation of carbonyl reductase 1 by polyphenols.

    PubMed

    Boušová, Iva; Skálová, Lenka; Souček, Pavel; Matoušková, Petra

    2015-01-01

    Carbonyl reductase 1 (CBR1), an enzyme belonging to the short-chain dehydrogenases/reductases family, has been detected in all human tissues. CBR1 catalyzes the reduction of many xenobiotics, including important drugs (e.g. anthracyclines, nabumetone, bupropion, dolasetron) and harmful carbonyls and quinones. Moreover, it participates in the metabolism of a number of endogenous compounds and it may play a role in certain pathologies. Plant polyphenols are not only present in many human food sources, but are also a component of many popular dietary supplements and herbal medicines. Many studies reviewed herein have demonstrated the potency of certain flavonoids, stilbenes and curcuminoids in the inhibition of the activity of CBR1. Interactions of these polyphenols with transcriptional factors, which regulate CBR1 expression, have also been reported in several studies. As CBR1 plays an important role in drug metabolism as well as in the protection of the organism against potentially harmful carbonyls, the modulation of its expression/activity may have significant pharmacological and/or toxicological consequences. Some polyphenols (e.g. luteolin, apigenin and curcumin) have been shown to be very potent CBR1 inhibitors. The inhibition of CBR1 seems useful regarding the increased efficacy of anthracycline therapy, but it may cause the worse detoxification of reactive carbonyls. Nevertheless, all known information about the interactions of polyphenols with CBR1 have only been based on the results of in vitro studies. With respect to the high importance of CBR1 and the frequent consumption of polyphenols, in vivo studies would be very helpful for the evaluation of risks/benefits of polyphenol interactions with CBR1.

  18. d-Apiose Reductase from Aerobacter aerogenes1

    PubMed Central

    Neal, Donna L.; Kindel, Paul K.

    1970-01-01

    A strain of Aerobacter aerogenes PRL-R3 has been isolated which utilizes d-apiose as its sole source of carbon. A new enzyme, d-apiose reductase, was discovered in this strain. The enzyme was not present when the strain was grown on d-glucose. d-Apiose reductase catalyzes the nicotinamide adenine dinucleotide-dependent interconversion of d-apiose and d-apiitol. The enzyme is specific for d-apiose and d-apiitol, with a few possible exceptions. The Km for d-apiose is 0.02 m. The Km for d-apiitol is 0.01 m. The enzyme is almost completely specific for the reduced and oxidized forms of nicotinamide adenine dinucleotide. When cell-free extracts were centrifuged at 100,000 × g for 1 hr, the enzyme remained in solution. Optimal activity for the reduction of d-apiose was obtained at pH 7.5 in glycylglycine buffer, whereas for the oxidation of d-apiitol it was obtained at pH 10.5 in glycine buffer. Enzymatic reduction of d-apiose was not appreciably affected by the presence of 0.02 m ethylenediaminetetraacetate. Paper chromatography and specific spray reagents were used to identify d-apiitol and d-apiose as the products of this reversible reaction. d-Apiose and d-apiitol did not serve as substrates for ribitol dehydrogenase and d-arabitol dehydrogenase from A. aerogenes PRL-R3. PMID:4314545

  19. Changes in glutathione redox cycle during diapause determination and termination in the bivoltine silkworm, Bombyx mori.

    PubMed

    Zhao, Lin-Chuan; Hou, Yi-Sheng; Sima, Yang-Hu

    2014-02-01

    To explore whether glutathione regulates diapause determination and termination in the bivoltine silkworm Bombyx mori, we monitored the changes in glutathione redox cycle in the ovary of both diapause- and nondiapause-egg producers, as well as those in diapause eggs incubated at different temperatures. The activity of thioredoxin reductase (TrxR) was detected in ovaries but not in eggs, while neither ovaries nor eggs showed activity of glutathione peroxidase. A lower reduced glutathione/oxidized glutathione (GSH/GSSG) ratio was observed in the ovary of diapause-egg producers, due to weaker reduction of oxidized glutathione (GSSG) to the reduced glutathione (GSH) catalyzed by glutathione reductase (GR) and TrxR. This indicates an oxidative shift in the glutathione redox cycle during diapause determination. Compared with the 25°C-treated diapause eggs, the 5°C-treated diapause eggs showed lower GSH/GSSG ratio, a result of stronger oxidation of GSH catalyzed by thioredoxin peroxidase and weaker reduction of GSSG catalyzed by GR. Our study demonstrated the important regulatory role of glutathione in diapause determination and termination of the bivoltine silkworm.

  20. 77 FR 38128 - Withdrawal of TORP Terminal LP, Bienville Offshore Energy Terminal Liquefied Natural Gas (LNG...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-26

    ... Maritime Administration Withdrawal of TORP Terminal LP, Bienville Offshore Energy Terminal Liquefied... Terminal LP's (TORP) withdrawal of the deepwater port license application for the proposed Bienville Offshore Energy Terminal (BOET). All actions related to the processing and agency coordination...

  1. Balanced Branching in Transcription Termination

    NASA Technical Reports Server (NTRS)

    Harrington, K. J.; Laughlin, R. B.; Liang, S.

    2001-01-01

    The theory of stochastic transcription termination based on free-energy competition requires two or more reaction rates to be delicately balanced over a wide range of physical conditions. A large body of work on glasses and large molecules suggests that this should be impossible in such a large system in the absence of a new organizing principle of matter. We review the experimental literature of termination and find no evidence for such a principle but many troubling inconsistencies, most notably anomalous memory effects. These suggest that termination has a deterministic component and may conceivably be not stochastic at all. We find that a key experiment by Wilson and von Hippel allegedly refuting deterministic termination was an incorrectly analyzed regulatory effect of Mg(2+) binding.

  2. Terminal attractors in neural networks

    NASA Technical Reports Server (NTRS)

    Zak, Michail

    1989-01-01

    A new type of attractor (terminal attractors) for content-addressable memory, associative memory, and pattern recognition in artificial neural networks operating in continuous time is introduced. The idea of a terminal attractor is based upon a violation of the Lipschitz condition at a fixed point. As a result, the fixed point becomes a singular solution which envelopes the family of regular solutions, while each regular solution approaches such an attractor in finite time. It will be shown that terminal attractors can be incorporated into neural networks such that any desired set of these attractors with prescribed basins is provided by an appropriate selection of the synaptic weights. The applications of terminal attractors for content-addressable and associative memories, pattern recognition, self-organization, and for dynamical training are illustrated.

  3. Discovery Performs Terminal Initiation Burn

    NASA Video Gallery

    The terminal initiation burn, a left Orbital Maneuvering System engine firing that gave Discovery one last big push toward the space station, took place Feb. 26, 2011 at 10:33 a.m. The burn lasted ...

  4. Steroid 5β-Reductase from Leaves of Vitis vinifera: Molecular Cloning, Expression, and Modeling.

    PubMed

    Ernst, Mona; Munkert, Jennifer; Campa, Manuela; Malnoy, Mickael; Martens, Stefan; Müller-Uri, Frieder

    2015-11-25

    A steroid 5β-reductase gene corresponding to the hypothetical protein LOC100247199 from leaves of Vitis vinifera (var. 'Chardonnay') was cloned and overexpressed in Escherichia coli. The recombinant protein showed 5β-reductase activity when progesterone was used as a substrate. The reaction was stereoselective, producing only 5β-products such as 5β-pregnane-3,20-dione. Other small substrates (terpenoids and enones) were also accepted as substrates, indicating the highly promiscuous character of the enzyme class. Our results show that the steroid 5β-reductase gene, encoding an orthologous enzyme described as a key enzyme in cardenolide biosynthesis, is also expressed in leaves of the cardenolide-free plant V. vinifera. We emphasize the fact that, on some occasions, different reductases (e.g., progesterone 5β-reductase and monoterpenoid reductase) can also use molecules that are similar to the final products as a substrate. Therefore, in planta, the different reductases may contribute to the immense number of diverse small natural products finally leading to the flavor of wine.

  5. Purification, properties, and sequence of glycerol trinitrate reductase from Agrobacterium radiobacter.

    PubMed Central

    Snape, J R; Walkley, N A; Morby, A P; Nicklin, S; White, G F

    1997-01-01

    Glycerol trinitrate (GTN) reductase, which enables Agrobacterium radiobacter to utilize GTN and related explosives as sources of nitrogen for growth, was purified and characterized, and its gene was cloned and sequenced. The enzyme was a 39-kDa monomeric protein which catalyzed the NADH-dependent reductive scission of GTN (Km = 23 microM) to glycerol dinitrates (mainly the 1,3-isomer) with a pH optimum of 6.5, a temperature optimum of 35 degrees C, and no dependence on metal ions for activity. It was also active on pentaerythritol tetranitrate (PETN), on isosorbide dinitrate, and, very weakly, on ethyleneglycol dinitrate, but it was inactive on isopropyl nitrate, hexahydro-1,3,5-trinitro-1,3,5-triazine, 2,4,6-trinitrotoluene, ammonium ions, nitrate, or nitrite. The amino acid sequence deduced from the DNA sequence was homologous (42 to 51% identity and 61 to 69% similarity) to those of PETN reductase from Enterobacter cloacae, N-ethylmaleimide reductase from Escherichia coli, morphinone reductase from Pseudomonas putida, and old yellow enzyme from Saccharomyces cerevisiae, placing the GTN reductase in the alpha/beta barrel flavoprotein group of proteins. GTN reductase and PETN reductase were very similar in many respects except in their distinct preferences for NADH and NADPH cofactors, respectively. PMID:9401040

  6. Crystal structure of nitrous oxide reductase from Paracoccus denitrificans at 1.6 A resolution.

    PubMed Central

    Haltia, Tuomas; Brown, Kieron; Tegoni, Mariella; Cambillau, Christian; Saraste, Matti; Mattila, Kimmo; Djinovic-Carugo, Kristina

    2003-01-01

    N2O is generated by denitrifying bacteria as a product of NO reduction. In denitrification, N2O is metabolized further by the enzyme N2O reductase (N2OR), a multicopper protein which converts N2O into dinitrogen and water. The structure of N2OR remained unknown until the recent elucidation of the structure of the enzyme isolated from Pseudomonas nautica. In the present paper, we report the crystal structure of a blue form of the enzyme that was purified under aerobic conditions from Paracoccus denitrificans. N2OR is a head-to-tail homodimer stabilized by a multitude of interactions including two calcium sites located at the intermonomeric surface. Each monomer is composed of two domains: a C-terminal cupredoxin domain that carries the dinuclear electron entry site known as Cu(A), and an N-terminal seven-bladed beta-propeller domain which hosts the active-site centre Cu(Z). The electrons are transferred from Cu(A) to Cu(Z) across the subunit interface. Cu(Z) is a tetranuclear copper cluster in which the four copper ions (Cu1 to Cu4) are ligated by seven histidine imidazoles, a hydroxyl or water oxygen and a bridging inorganic sulphide. A bound chloride ion near the Cu(Z) active site shares one of the ligand imidazoles of Cu1. This arrangement probably influences the redox potential of Cu1 so that this copper is stabilized in the cupric state. The treatment of N2OR with H2O2 or cyanide causes the disappearance of the optical band at 640 nm, attributed to the Cu(Z) centre. The crystal structure of the enzyme soaked with H2O2 or cyanide suggests that an average of one copper of the Cu(Z) cluster has been lost. The lowest occupancy is observed for Cu3 and Cu4. A docking experiment suggests that N(2)O binds between Cu1 and Cu4 so that the oxygen of N2O replaces the oxygen ligand of Cu4. Certain ligand imidazoles of Cu1 and Cu2, as well as of Cu4, are located at the dimer interface. Particularly those of Cu2 and Cu4 are parts of a bonding network which couples these

  7. Propagation Terminal Design and Measurements

    NASA Technical Reports Server (NTRS)

    Nessel, James

    2015-01-01

    The NASA propagation terminal has been designed and developed by the Glenn Research Center and is presently deployed at over 5 NASA and partner ground stations worldwide collecting information on the effects of the atmosphere on Ka-band and millimeter wave communications links. This lecture provides an overview of the fundamentals and requirements of the measurement of atmospheric propagation effects and, specifically, the types of hardware and digital signal processing techniques employed by current state-of-the-art propagation terminal systems.

  8. 15 CFR 286.12 - Terminations.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... STANDARDS AND TECHNOLOGY, DEPARTMENT OF COMMERCE ACCREDITATION AND ASSESSMENT PROGRAMS NATIONAL VOLUNTARY CONFORMITY ASSESSMENT SYSTEM EVALUATION (NVCASE) PROGRAM § 286.12 Terminations. (a) Voluntary termination. Any participant may voluntarily terminate participation at any time by written notification to...

  9. Pyrroline-5-Carboxylate Reductase in Chlorella autotrophica and Chlorella saccharophila in Relation to Osmoregulation.

    PubMed

    Laliberté, G; Hellebust, J A

    1989-11-01

    Pyrroline-5-carboxylate (P5C) reductase (EC 1.5.1.2), which catalyzes the reduction of P5C to proline, was partially purified from two Chlorella species; Chlorella autotrophica, a euryhaline marine alga that responds to increases in salinity by accumulating proline and ions, and Chlorella saccharophila, which does not accumulate proline for osmoregulation. From the elution profile of this enzyme from an anion exchange column in Tris-HCl buffer (pH 7.6), containing sorbitol and glycine betaine, it was shown that P5C reductase from C. autotrophica was a neutral protein whereas the enzyme from C. saccharophila was negatively charged. The kinetic mechanisms of the reductase was characteristic of a ping-pong mechanism with double competitive substrate inhibition. Both enzymes showed high specificity for NADH as cofactor. The affinities of the reductases for their substrates did not change when the cells were grown at different salinities. In both algae, the apparent K(m) values of the reductase for P5C and NADH were 0.17 and 0.10 millimolar, respectively. A fourfold increase in maximal velocity of the reductase was observed when C. autotrophica was transferred from 50 to 150% artificial sea water. Even though the reductase was inhibited by NaCl, KCl, and proline, it still showed appreciable activity in the presence of these compounds at molar concentrations. A possible role for the regulation of proline synthesis at the step catalyzed by P5C reductase is discussed in relation to the specificity of P5C reductase for NADH and its responses to salt treatments.

  10. Steroidal pyrazolines evaluated as aromatase and quinone reductase-2 inhibitors for chemoprevention of cancer.

    PubMed

    Abdalla, Mohamed M; Al-Omar, Mohamed A; Bhat, Mashooq A; Amr, Abdel-Galil E; Al-Mohizea, Abdullah M

    2012-05-01

    The aromatase and quinone reductase-2 inhibition of synthesized heterocyclic pyrazole derivatives fused with steroidal structure for chemoprevention of cancer is reported herein. All compounds were interestingly less toxic than the reference drug (Cyproterone(®)). The aromatase inhibitory activities of these compounds were much more potent than the lead compound resveratrol, which has an IC(50) of 80 μM. In addition, all the compounds displayed potent quinone reductase-2 inhibition. Initially the acute toxicity of the compounds was assayed via the determination of their LD(50). The aromatase and quinone reductase-2 inhibitors resulting from this study have potential value in the treatment and prevention of cancer.

  11. Comparison of the Stereospecificity and Immunoreactivity of NADH-Ferricyanide Reductases in Plant Membranes.

    PubMed Central

    Fredlund, K. M.; Struglics, A.; Widell, S.; Askerlund, P.; Kader, J. C.; Moller, I. M.

    1994-01-01

    The substrate stereospecificity of NADH-ferricyanide reductase activities in the inner mitochondrial membrane and peroxisomal membrane of potato (Solanum tuberosum L.) tubers, spinach (Spinacea oleracea L.) leaf plasma membrane, and red beetroot (Beta vulgaris L.) tonoplast were all specific for the [beta]-hydrogen of NADH, whereas the reductases in wheat root (Triticum aestivum L.) endoplasmic reticulum and potato tuber outer mitochondrial membrane were both [alpha]-hydrogen specific. In all isolated membrane fractions one or several polypeptides with an apparent size of 45 to 55 kD cross-reacted with antibodies raised against a microsomal NADH-ferricyanide reductase on western blots. PMID:12232391

  12. Cloning and characterization of the methyl coenzyme M reductase genes from Methanobacterium thermoautotrophicum.

    PubMed Central

    Bokranz, M; Bäumner, G; Allmansberger, R; Ankel-Fuchs, D; Klein, A

    1988-01-01

    The genes coding for methyl coenzyme M reductase were cloned from a genomic library of Methanobacterium thermoautotrophicum Marburg into Escherichia coli by using plasmid expression vectors. When introduced into E. coli, the reductase genes were expressed, yielding polypeptides identical in size to the three known subunits of the isolated enzyme, alpha, beta, and gamma. The polypeptides also reacted with the antibodies raised against the respective enzyme subunits. In M. thermoautotrophicum, the subunits are encoded by a gene cluster whose transcript boundaries were mapped. Sequence analysis revealed two more open reading frames of unknown function located between two of the methyl coenzyme M reductase genes. Images PMID:2448287

  13. Proanthocyanidin synthesis and expression of genes encoding leucoanthocyanidin reductase and anthocyanidin reductase in developing grape berries and grapevine leaves.

    PubMed

    Bogs, Jochen; Downey, Mark O; Harvey, John S; Ashton, Anthony R; Tanner, Gregory J; Robinson, Simon P

    2005-10-01

    Proanthocyanidins (PAs), also called condensed tannins, can protect plants against herbivores and are important quality components of many fruits. Two enzymes, leucoanthocyanidin reductase (LAR) and anthocyanidin reductase (ANR), can produce the flavan-3-ol monomers required for formation of PA polymers. We isolated and functionally characterized genes encoding both enzymes from grapevine (Vitis vinifera L. cv Shiraz). ANR was encoded by a single gene, but we found two highly related genes encoding LAR. We measured PA content and expression of genes encoding ANR, LAR, and leucoanthocyanidin dioxygenase in grape berries during development and in grapevine leaves, which accumulated PA throughout leaf expansion. Grape flowers had high levels of PA, and accumulation continued in skin and seeds from fruit set until the onset of ripening. VvANR was expressed throughout early flower and berry development, with expression increasing after fertilization. It was expressed in berry skin and seeds until the onset of ripening, and in expanding leaves. The genes encoding LAR were expressed in developing fruit, particularly in seeds, but had low expression in leaves. The two LAR genes had different patterns of expression in skin and seeds. During grape ripening, PA levels decreased in both skin and seeds, and expression of genes encoding ANR and LAR were no longer detected. The results indicate that PA accumulation occurs early in grape development and is completed when ripening starts. Both ANR and LAR contribute to PA synthesis in fruit, and the tissue and temporal-specific regulation of the genes encoding ANR and LAR determines PA accumulation and composition during grape berry development.

  14. 7 CFR 1206.22 - Terminate.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.22 Terminate. Terminate...

  15. 7 CFR 1206.22 - Terminate.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.22 Terminate. Terminate...

  16. 7 CFR 1206.22 - Terminate.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.22 Terminate. Terminate...

  17. 7 CFR 1206.22 - Terminate.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.22 Terminate. Terminate...

  18. 7 CFR 1206.22 - Terminate.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.22 Terminate. Terminate...

  19. Membrane-bound oxygen reductases of the anaerobic sulfate-reducing Desulfovibrio vulgaris Hildenborough: roles in oxygen defence and electron link with periplasmic hydrogen oxidation.

    PubMed

    Ramel, F; Amrani, A; Pieulle, L; Lamrabet, O; Voordouw, G; Seddiki, N; Brèthes, D; Company, M; Dolla, A; Brasseur, G

    2013-12-01

    Cytoplasmic membranes of the strictly anaerobic sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough contain two terminal oxygen reductases, a bd quinol oxidase and a cc(b/o)o3 cytochrome oxidase (Cox). Viability assays pointed out that single Δbd, Δcox and double ΔbdΔcox deletion mutant strains were more sensitive to oxygen exposure than the WT strain, showing the involvement of these oxygen reductases in the detoxification of oxygen. The Δcox strain was slightly more sensitive than the Δbd strain, pointing to the importance of the cc(b/o)o3 cytochrome oxidase in oxygen protection. Decreased O2 reduction rates were measured in mutant cells and membranes using lactate, NADH, ubiquinol and menadiol as substrates. The affinity for oxygen measured with the bd quinol oxidase (Km, 300 nM) was higher than that of the cc(b/o)o3 cytochrome oxidase (Km, 620 nM). The total membrane activity of the bd quinol oxidase was higher than that of the cytochrome oxidase activity in line with the higher expression of the bd oxidase genes. In addition, analysis of the ΔbdΔcox mutant strain indicated the presence of at least one O2-scavenging membrane-bound system able to reduce O2 with menaquinol as electron donor with an O2 affinity that was two orders of magnitude lower than that of the bd quinol oxidase. The lower O2 reductase activity in mutant cells with hydrogen as electron donor and the use of specific inhibitors indicated an electron transfer link between periplasmic H2 oxidation and membrane-bound oxygen reduction via the menaquinol pool. This linkage is crucial in defence of the strictly anaerobic bacterium Desulfovibrio against oxygen stress.

  20. Molecular Cloning, Heterologous Expression, and Functional Characterization of an NADPH-Cytochrome P450 Reductase Gene from Camptotheca acuminata, a Camptothecin-Producing Plant

    PubMed Central

    Chen, Fei; Yang, Yun; Yang, Lixia; Zhang, Guolin; Luo, Yinggang

    2015-01-01

    Camptothecin (CAM), a complex pentacyclic pyrroloqinoline alkaloid, is the starting material for CAM-type drugs that are well-known antitumor plant drugs. Although many chemical and biological research efforts have been performed to produce CAM, a few attempts have been made to uncover the enzymatic mechanism involved in the biosynthesis of CAM. Enzyme-catalyzed oxidoreduction reactions are ubiquitously presented in living organisms, especially in the biosynthetic pathway of most secondary metabolites such as CAM. Due to a lack of its reduction partner, most catalytic oxidation steps involved in the biosynthesis of CAM have not been established. In the present study, an NADPH-cytochrome P450 reductase (CPR) encoding gene CamCPR was cloned from Camptotheca acuminata, a CAM-producing plant. The full length of CamCPR cDNA contained an open reading frame of 2127-bp nucleotides, corresponding to 708-amino acid residues. CamCPR showed 70 ~ 85% identities to other characterized plant CPRs and it was categorized to the group II of CPRs on the basis of the results of multiple sequence alignment of the N-terminal hydrophobic regions. The intact and truncate CamCPRs with N- or C-terminal His6-tag were heterologously overexpressed in Escherichia coli. The recombinant enzymes showed NADPH-dependent reductase activity toward a chemical substrate ferricyanide and a protein substrate cytochrome c. The N-terminal His6-tagged CamCPR showed 18- ~ 30-fold reduction activity higher than the C-terminal His6-tagged CamCPR, which supported a reported conclusion, i.e., the last C-terminal tryptophan of CPRs plays an important role in the discrimination between NADPH and NADH. Co-expression of CamCPR and a P450 monooxygenase, CYP73A25, a cinnamate 4-hydroxylase from cotton, and the following catalytic formation of p-coumaric acid suggested that CamCPR transforms electrons from NADPH to the heme center of P450 to support its oxidation reaction. Quantitative real-time PCR analysis showed that

  1. Conformal mapping for multiple terminals

    NASA Astrophysics Data System (ADS)

    Wang, Weimin; Ma, Wenying; Wang, Qiang; Ren, Hao

    2016-11-01

    Conformal mapping is an important mathematical tool that can be used to solve various physical and engineering problems in many fields, including electrostatics, fluid mechanics, classical mechanics, and transformation optics. It is an accurate and convenient way to solve problems involving two terminals. However, when faced with problems involving three or more terminals, which are more common in practical applications, existing conformal mapping methods apply assumptions or approximations. A general exact method does not exist for a structure with an arbitrary number of terminals. This study presents a conformal mapping method for multiple terminals. Through an accurate analysis of boundary conditions, additional terminals or boundaries are folded into the inner part of a mapped region. The method is applied to several typical situations, and the calculation process is described for two examples of an electrostatic actuator with three electrodes and of a light beam splitter with three ports. Compared with previously reported results, the solutions for the two examples based on our method are more precise and general. The proposed method is helpful in promoting the application of conformal mapping in analysis of practical problems.

  2. Conformal mapping for multiple terminals.

    PubMed

    Wang, Weimin; Ma, Wenying; Wang, Qiang; Ren, Hao

    2016-11-10

    Conformal mapping is an important mathematical tool that can be used to solve various physical and engineering problems in many fields, including electrostatics, fluid mechanics, classical mechanics, and transformation optics. It is an accurate and convenient way to solve problems involving two terminals. However, when faced with problems involving three or more terminals, which are more common in practical applications, existing conformal mapping methods apply assumptions or approximations. A general exact method does not exist for a structure with an arbitrary number of terminals. This study presents a conformal mapping method for multiple terminals. Through an accurate analysis of boundary conditions, additional terminals or boundaries are folded into the inner part of a mapped region. The method is applied to several typical situations, and the calculation process is described for two examples of an electrostatic actuator with three electrodes and of a light beam splitter with three ports. Compared with previously reported results, the solutions for the two examples based on our method are more precise and general. The proposed method is helpful in promoting the application of conformal mapping in analysis of practical problems.

  3. Conformal mapping for multiple terminals

    PubMed Central

    Wang, Weimin; Ma, Wenying; Wang, Qiang; Ren, Hao

    2016-01-01

    Conformal mapping is an important mathematical tool that can be used to solve various physical and engineering problems in many fields, including electrostatics, fluid mechanics, classical mechanics, and transformation optics. It is an accurate and convenient way to solve problems involving two terminals. However, when faced with problems involving three or more terminals, which are more common in practical applications, existing conformal mapping methods apply assumptions or approximations. A general exact method does not exist for a structure with an arbitrary number of terminals. This study presents a conformal mapping method for multiple terminals. Through an accurate analysis of boundary conditions, additional terminals or boundaries are folded into the inner part of a mapped region. The method is applied to several typical situations, and the calculation process is described for two examples of an electrostatic actuator with three electrodes and of a light beam splitter with three ports. Compared with previously reported results, the solutions for the two examples based on our method are more precise and general. The proposed method is helpful in promoting the application of conformal mapping in analysis of practical problems. PMID:27830746

  4. Inhibition of carbonyl reductase activity in pig heart by alkyl phenyl ketones.

    PubMed

    Imamura, Yorishige; Narumi, Rika; Shimada, Hideaki

    2007-02-01

    The inhibitory effects of alkyl phenyl ketones on carbonyl reductase activity were examined in pig heart. In this study, carbonyl reductase activity was estimated as the ability to reduce 4-benzoylpyridine to S(-)-alpha-phenyl-4-pyridylmethanol in the cytosolic fraction from pig heart (pig heart cytosol). The order of their inhibitory potencies was hexanophenone > valerophenone > heptanophenone > butyrophenone > propiophenone. The inhibitory potencies of acetophenone and nonanophenone were much lower. A significant relationship was observed between Vmax/Km values for the reduction of alkyl phenyl ketones and their inhibitory potencies for carbonyl reductase activity in pig heart cytosol. Furthermore, hexanophenone was a competitive inhibitor for the enzyme activity. These results indicate that several alkyl phenyl ketones including hexanophenone inhibit carbonyl reductase activity in pig heart cytosol, by acting as substrate inhibitors.

  5. Amplification and loss of dihydrofolate reductase genes in a Chinese hamster ovary cell line

    SciTech Connect

    Kaufman, R.J.; Schimke, R.T.

    1981-12-01

    During stepwise increases in the methotrexate concentration in culture medium, the authors selected Chinese hamster ovary cells that contained elevated dihydrofolate reductase levels which were proportional to the number of dihydrofolate reductase gene copies (i.e., gene amplification). The authors studied the dihydrofolate reductase levels in individual cells that underwent the initial steps of methotrexate resistance by using the fluorescence-activated cell sorter technique. Such cells constituted a heterogeneous population with differing dihydrofolate reductase levels, and they characteristically lost the elevated enzyme levels when they were grown in the absence of methotrexate. The progeny of individual cells with high enzyme levels behaved differently and could lose all or variable numbers of the amplified genes.

  6. An electron transport system in maize roots for reactions of glutamate synthase and nitrite reductase : physiological and immunochemical properties of the electron carrier and pyridine nucleotide reductase.

    PubMed

    Suzuki, A; Oaks, A; Jacquot, J P; Vidal, J; Gadal, P

    1985-06-01

    A non-heme iron containing protein which bears an antigenic similarity to ferredoxin from spinach leaves (Spinacia oleracea L.) has been identified in extracts prepared from young roots of maize (Zea mays L., hybrid W64A x W182E). The ferredoxin-like root electron carrier could substitute for ferredoxin in a cytochrome c reduction system in which pyridine nucleotide (NADPH) reduces the root electron carrier in a reaction catalyzed by ferredoxin-NADP(+) reductase (EC 1.6.7.1) from spinach leaves. However, the root electron carrier did not mediate the photoreduction of NADP(+) in an illuminated reconstituted chloroplast system.A pyridine nucleotide reductase which shares identical immunological determinants with the ferredoxin-NADP(+) reductase from spinach leaves has also been characterized from maize roots. Root pyridine nucleotide reductase mediated the transfer of electrons from either NADPH or NADH to cytochrome c via ferredoxin or the root electron carrier. Under chemical reducing conditions with sodium dithionite and bicarbonate, the ferredoxin-like root electron carrier served as an electron carrier for the ferredoxin-requiring glutamate synthase (EC 1.4.7.1) and nitrite reductase (EC 1.7.7.1) obtained from maize roots or leaves. In the presence of root pyridine nucleotide reductase and root electron carrier, either NADPH or NADH served as the primary electron donor for glutamate synthesis in extracts from maize roots or leaves. The electron transport system originating with NADH or NADPH, was, however, not able to mediate the reduction of NO(2) (-) to NH(3).

  7. Glycine reductase of Clostridium litorale. Cloning, sequencing, and molecular analysis of the grdAB operon that contains two in-frame TGA codons for selenium incorporation.

    PubMed

    Kreimer, S; Andreesen, J R

    1995-11-15

    A 2.8-kb HindIII fragment, containing three open reading frames, has been cloned and sequenced from Clostridium litorale. The first gene grdA encoded the selenocysteine-containing protein PA of the glycine reductase complex, a protein of 159 amino acids with a deduced molecular mass of 16.7 kDa. The second gene (grdB) encoded the 47-kDa subunit of the substrate-specific selenoprotein PB glycine that is composed of 437 amino acids. The third gene contained the 5'-region of the gene for thioredoxin reductase, trxB. All gene products shared high similarity with the corresponding proteins from Eubacterium acidaminophilum. In both genes grdA and grdB, the opal termination codon (TGA) was found inframe, indicating the presence of selenocysteine in both polypeptides. Northern-blot analysis showed that grdA and grdB are organized as one operon. Unlike Escherichia coli, no stable secondary structures of the corresponding mRNA were found immediately downstream of the UGA codons to direct an insertion of selenocysteine into the grdA and grdB transcripts of C. litorale. Instead, a secondary structure was identified in the 3'-untranslated region of grdB.

  8. In vitro inhibition of human erythrocyte glutathione reductase by some new organic nitrates.

    PubMed

    Sentürk, Murat; Talaz, Oktay; Ekinci, Deniz; Cavdar, Hüseyin; Küfrevioğlu, Omer Irfan

    2009-07-01

    Glutathione reductase (GR), is responsible for the existence of GSH molecule, a crucial antioxidant against oxidative stress reagents. The antimalarial activities of some redox active compounds are attributed to their inhibition of antioxidant flavoenzyme glutathione reductase, and inhibitors are therefore expected to be useful for the treatment of malaria. Twelve organic nitrate derivatives were synthesized and treated with human erythrocyte GR. The molecules were identified as strong GR inhibitors and novel antimalaria candidates.

  9. Balanced Branching in Transcription Termination

    NASA Technical Reports Server (NTRS)

    Harrington, K. J.; Laughlin, R. B.; Liang, S.

    2000-01-01

    The theory of stochastic transcription termination based on free-energy competition requires two or more reaction rates to be delicately balanced over a wide range of physical conditions. A large body of work on glasses and large molecules suggests that this should be impossible in such a large system in the absence of a new organizing principle of matter. We review the experimental literature of termination and find no evidence for such a principle but many troubling inconsistencies, most notably anomalous memory effects. These suggest that term ination has a deterministic component and may conceivably be not stochastic at all. We find that a key experiment by Wilson and von Hippel allegedly refuting deterministic termination was an incorrectly analyzed regulatory effect of Mg(2+) binding.

  10. Digital autonomous terminal access communications

    NASA Technical Reports Server (NTRS)

    Novacki, S.

    1987-01-01

    A significant problem for the Bus Monitor Unit is to identify the source of a given transmission. This problem arises from the fact that the label which identifies the source of the transmission as it is put into the bus is intercepted by the Digital Autonomous Terminal Access Communications (DATAC) terminal and removed from the transmission. Thus, a given subsystem will see only data associated with a label and never the identifying label itself. The Bus Monitor must identify the source of the transmission so as to be able to provide some type of error identification/location in the event that some problem with the data transmission occurs. Steps taken to alleviate this problem by modifications to the DATAC terminal are discussed.

  11. Chromatin condensation during terminal erythropoiesis.

    PubMed

    Zhao, Baobing; Yang, Jing; Ji, Peng

    2016-09-02

    Mammalian terminal erythropoiesis involves gradual but dramatic chromatin condensation steps that are essential for cell differentiation. Chromatin and nuclear condensation is followed by a unique enucleation process, which is believed to liberate more spaces for hemoglobin enrichment and enable the generation of a physically flexible mature red blood cell. Although these processes have been known for decades, the mechanisms are still unclear. Our recent study reveals an unexpected nuclear opening formation during mouse terminal erythropoiesis that requires caspase-3 activity. Major histones, except H2AZ, are partially released from the opening, which is important for chromatin condensation. Block of the nuclear opening through caspase inhibitor or knockdown of caspase-3 inhibits chromatin condensation and enucleation. We also demonstrate that nuclear opening and histone release are cell cycle regulated. These studies reveal a novel mechanism for chromatin condensation in mammalia terminal erythropoiesis.

  12. Airborne Satcom Terminal Research at NASA Glenn

    NASA Technical Reports Server (NTRS)

    Hoder, Doug; Zakrajsek, Robert

    2002-01-01

    NASA Glenn has constructed an airborne Ku-band satellite terminal, which provides wideband full-duplex ground-aircraft communications. The terminal makes use of novel electronically-steered phased array antennas and provides IP connectivity to and from the ground. The satcom terminal communications equipment may be easily changed whenever a new configuration is required, enhancing the terminal's versatility.

  13. 40 CFR 30.61 - Termination.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    .... (2) By EPA with the consent of the recipient, in which case the two parties shall agree upon the termination conditions, including the effective date and, in the case of partial termination, the portion to... reasons for such termination, the effective date, and, in the case of partial termination, the portion...

  14. 15 CFR 14.61 - Termination.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... with the consent of the recipient, in which case the two parties shall agree upon the termination conditions, including the effective date and, in the case of partial termination, the portion to be... reasons for such termination, the effective date, and, in the case of partial termination, the portion...

  15. 38 CFR 49.61 - Termination.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... conditions of an award. (2) By the Federal awarding agency with the consent of the recipient, in which case... case of partial termination, the portion to be terminated. (3) By the recipient upon sending to the... date, and, in the case of partial termination, the portion to be terminated. However, if the...

  16. X-ray structure of trypanothione reductase from Crithidia fasciculata at 2. 4- angstrom resolution

    SciTech Connect

    Kuriyan, J.; Xiangpeng Kong; Krishna, T.S.R.; Murgolo, N.J.; Field, H.; Cerami, A.; Henderson, G.B. ); Sweet, R.M. )

    1991-10-01

    Trypanosomes and related protozoan parasites lack glutathione reductase and possess instead a closely related enzyme that serves as the reductant of a bis(glutathione)-spermidien conjugate, trypanothione. The human and parasite enzymes have mutually exclusive substrate specificities, providing a route for the design of therapeutic agents by specific inhibition of the parasite enzyme. The authors report here the three-dimensional structure of trypanothione reductase from Crithidia fasciculata and show that it closely resembles the structure of human glutathione reductase. In particular, the core structure surrounding the catalytic machinery is almost identical in the two enzymes. However, significant differences are found at the substrate binding sites. A cluster of basic residues in glutathione reductase is replaced by neutral, hydrophobic, or acidic residues in trypanothione reductase, consistent with the nature of the spermidine linkage and the change in overall charge of the substrate from {minus}2 to +1, respectively. The binding site is more open in trypanothione reductase due to rotations of about 4{degree} in the domains that form in site, with relative shifts of as much as 2-3 {angstrom} in residues that can interact with potential inhibitors and complement previous modeling and mutagenesis studies on the two enzymes.

  17. Genetic and Physiologic Characterization of Ferric/Cupric Reductase Constitutive Mutants of Cryptococcus neoformans

    PubMed Central

    Nyhus, Karin J.; Jacobson, Eric S.

    1999-01-01

    Cryptococcus neoformans is a pathogenic yeast that causes meningitis in immunocompromised patients. Because iron acquisition is critical for growth of a pathogen in a host, we studied the regulation of the ferric reductase and ferrous uptake system of this organism. We isolated 18 mutants, representing four independent loci, with dysregulated ferric reductase. The mutant strains had >10-fold higher than wild-type WT reductase activity in the presence of iron. Two of the strains also had >7-fold higher than WT iron uptake in the presence of iron but were not markedly iron sensitive. Both were sensitive to the oxidative stresses associated with superoxide and hydrogen peroxide. One strain exhibited only 23% of the WT level of iron uptake in the absence of iron and grew poorly without iron supplementation of the medium, phenotypes consistent with an iron transport deficiency; it was sensitive to superoxide but not to hydrogen peroxide. The fourth strain had high reductase activity but normal iron uptake; it was not very sensitive to oxidative stress. We also demonstrated that the ferric reductase was regulated by copper and could act as a cupric reductase. Sensitivity to oxidants may be related to iron acquisition by a variety of mechanisms and may model the interaction of the yeast with the immune system. PMID:10225895

  18. Ascorbate free radical reductases and diaphorases in soluble fractions of the human lens.

    PubMed

    Bando, M; Obazawa, H

    1995-12-01

    Major and minor ascorbate free radical (AFR) reductases, with diaphorase activity, and three other diaphorases were separated from the human lens soluble fraction by DEAE-cellulose ion-exchange column chromatography. They were characterized for adsorptivity to ion-exchange and 5'AMP-Sepharose 4B affinity columns, kinetic properties, and substrate specificity. The latter diaphorases were closely correlated with NADH-cytochrome beta 5 reductase. The major and minor AFR reductases were regarded as a major diaphorase group different from two ubiquitous diaphorases, i.e., NADH-cytochrome beta 5 reductase and DT-diaphorase. A major AFR reductase was partially purified approximately 50 fold over the lens soluble fraction by ion-exchange, affinity, and gel filtration (Sephacryl S-200 HR) column chromatography. From the partially purified enzyme, 2 bands, one sharp and one diffuse, were obtained by native polyacrylamide gel electrophoresis. Two proteins, of 20 and 24 kDa, were identified in the active enzyme bands by SDS-polyacrylamide gel electrophoresis. This suggests that the 20 and/or 24 kDa proteins may be components of the major AFR reductase.

  19. The role of glutathione reductase and related enzymes on cellular redox homoeostasis network.

    PubMed

    Couto, Narciso; Wood, Jennifer; Barber, Jill

    2016-06-01

    In this review article we examine the role of glutathione reductase in the regulation, modulation and maintenance of cellular redox homoeostasis. Glutathione reductase is responsible for maintaining the supply of reduced glutathione; one of the most abundant reducing thiols in the majority of cells. In its reduced form, glutathione plays key roles in the cellular control of reactive oxygen species. Reactive oxygen species act as intracellular and extracellular signalling molecules and complex cross talk between levels of reactive oxygen species, levels of oxidised and reduced glutathione and other thiols, and antioxidant enzymes such as glutathione reductase determine the most suitable conditions for redox control within a cell or for activation of programmed cell death. Additionally, we discuss the translation and expression of glutathione reductase in a number of organisms including yeast and humans. In yeast and human cells, a single gene expresses more than one form of glutathione reductase, destined for residence in the cytoplasm or for translocation to different organelles; in plants, however, two genes encoding this protein have been described. In general, insects and kinetoplastids (a group of protozoa, including Plasmodia and Trypanosoma) do not express glutathione reductase or glutathione biosynthetic enzymes. Instead, they express either the thioredoxin system or the trypanothione system. The thioredoxin system is also present in organisms that have the glutathione system and there may be overlapping functions with cross-talk between the two systems. Finally we evaluate therapeutic targets to overcome oxidative stress associated cellular disorders.

  20. Androgen Regulation of 5α-Reductase Isoenzymes in Prostate Cancer: Implications for Prostate Cancer Prevention

    PubMed Central

    Li, Jin; Ding, Zhiyong; Wang, Zhengxin; Lu, Jing-Fang; Maity, Sankar N.; Navone, Nora M.; Logothetis, Christopher J.; Mills, Gordon B.; Kim, Jeri

    2011-01-01

    The enzyme 5α-reductase, which converts testosterone to dihydrotestosterone (DHT), performs key functions in the androgen receptor (AR) signaling pathway. The three isoenzymes of 5α-reductase identified to date are encoded by different genes: SRD5A1, SRD5A2, and SRD5A3. In this study, we investigated mechanisms underlying androgen regulation of 5α-reductase isoenzyme expression in human prostate cells. We found that androgen regulates the mRNA level of 5α-reductase isoenzymes in a cell type–specific manner, that such regulation occurs at the transcriptional level, and that AR is necessary for this regulation. In addition, our results suggest that AR is recruited to a negative androgen response element (nARE) on the promoter of SRD5A3 in vivo and directly binds to the nARE in vitro. The different expression levels of 5α-reductase isoenzymes may confer response or resistance to 5α-reductase inhibitors and thus may have importance in prostate cancer prevention. PMID:22194926

  1. Cyclohexanol and methylcyclohexanols. A family of inhibitors of hepatic HMGCoA reductase in vivo.

    PubMed

    Miciak, A; White, D A; Middleton, B

    1986-10-15

    Oral dosing of rats with cyclohexanol and methylcyclohexanols resulted in the inhibition of hepatic HMGCoA reductase. Neither cyclohexane or cyclohexane diols exerted any effects. Inhibition was not due to alcohol dehydrogenase mediated changes in redox state since 3,3',5-trimethylcyclohexanol (TMC), a non substrate for alcohol dehydrogenase, was a potent inhibitor of HMGCoA reductase. Following a single dose of TMC there was no alteration in total hepatic HMGCoA reductase activity for more than 6 hr after which the enzyme activity was depressed in a dose-dependent manner. The normal diurnal rhythm of HMGCoA reductase was reduced in amplitude following TMC administration but the phase was unaltered and the t 1/2 for activity decay following the peak of activity was unaffected. Prior to the inhibitory effect of a TMC dose becoming apparent in total HMGCoA reductase activity we found that the expressed activity of the enzyme (after isolation in F- medium to suppress endogenous protein phosphatase) was depressed by 43%. The inhibitory effect of TMC on total HMGCoA reductase activity seen 8 hr or more after dosing was reflected by inhibition of sterol synthesis in liver measured in vivo after [3H]-H2O administration.

  2. A novel L-xylulose reductase essential for L-arabinose catabolism in Trichoderma reesei.

    PubMed

    Metz, Benjamin; Mojzita, Dominik; Herold, Silvia; Kubicek, Christian P; Richard, Peter; Seiboth, Bernhard

    2013-04-09

    L-Xylulose reductases belong to the superfamily of short chain dehydrogenases and reductases (SDRs) and catalyze the NAD(P)H-dependent reduction of L-xylulose to xylitol in L-arabinose and glucuronic acid catabolism. Here we report the identification of a novel L-xylulose reductase LXR3 in the fungus Trichoderma reesei by a bioinformatic approach in combination with a functional analysis. LXR3, a 31 kDa protein, catalyzes the reduction of L-xylulose to xylitol via NADPH and is also able to convert D-xylulose, D-ribulose, L-sorbose, and D-fructose to their corresponding polyols. Transcription of lxr3 is specifically induced by L-arabinose and L-arabitol. Deletion of lxr3 affects growth on L-arabinose and L-arabitol and reduces total NADPH-dependent LXR activity in cell free extracts. A phylogenetic analysis of known L-xylulose reductases shows that LXR3 is phylogenetically different from the Aspergillus niger L-xylulose reductase LxrA and, moreover, that all identified true L-xylulose reductases belong to different clades within the superfamily of SDRs. This indicates that the enzymes responsible for the reduction of L-xylulose in L-arabinose and glucuronic acid catabolic pathways have evolved independently and that even the fungal LXRs of the L-arabinose catabolic pathway have evolved in different clades of the superfamily of SDRs.

  3. A Novel l-Xylulose Reductase Essential for l-Arabinose Catabolism in Trichoderma reesei

    PubMed Central

    2013-01-01

    l-Xylulose reductases belong to the superfamily of short chain dehydrogenases and reductases (SDRs) and catalyze the NAD(P)H-dependent reduction of l-xylulose to xylitol in l-arabinose and glucuronic acid catabolism. Here we report the identification of a novel l-xylulose reductase LXR3 in the fungus Trichoderma reesei by a bioinformatic approach in combination with a functional analysis. LXR3, a 31 kDa protein, catalyzes the reduction of l-xylulose to xylitol via NADPH and is also able to convert d-xylulose, d-ribulose, l-sorbose, and d-fructose to their corresponding polyols. Transcription of lxr3 is specifically induced by l-arabinose and l-arabitol. Deletion of lxr3 affects growth on l-arabinose and l-arabitol and reduces total NADPH-dependent LXR activity in cell free extracts. A phylogenetic analysis of known l-xylulose reductases shows that LXR3 is phylogenetically different from the Aspergillus nigerl-xylulose reductase LxrA and, moreover, that all identified true l-xylulose reductases belong to different clades within the superfamily of SDRs. This indicates that the enzymes responsible for the reduction of l-xylulose in l-arabinose and glucuronic acid catabolic pathways have evolved independently and that even the fungal LXRs of the l-arabinose catabolic pathway have evolved in different clades of the superfamily of SDRs. PMID:23506391

  4. Characterization of anaerobic sulfite reduction by Salmonella typhimurium and purification of the anaerobically induced sulfite reductase

    SciTech Connect

    Hallenbeck, P.C. ); Clark, M.A.; Barrett, E.L. )

    1989-06-01

    Mutants of Salmonella typhimurium that lack the biosynthetic sulfite reductase (cysI and cysJ mutants) retain the ability to reduce sulfite for growth under anaerobic conditions. Here we report studies of sulfite reduction by a cysI mutant of S. typhimurium and purification of the associated anaerobic sulfite reductase. Sulfite reduction for anaerobic growth did not require a reducing atmosphere but was prevented by an argon atmosphere contaminated with air (<0.33%). It was also prevented by the presence of 0.1 mM nitrate. Anaerobic growth in liquid minimal medium, but not on agar, was found to require additions of trace amounts (10{sup {minus}7} M) of cysteine. Spontaneous mutants that grew under the argon contaminated with air also lost the requirement for 10{sup {minus}7}M cysteine for anaerobic growth in liquid. A role for sulfite reduction in anaerobic energy generation was contraindicated by the findings that sulfite reduction did not improve cell yields, and anaerobic sulfite reductase activity was greatest during the stationary phase of growth. Sulfite reductase was purified from the cytoplasmic fraction of the anaerobically grown cysI mutant and was purified 190-fold. The most effective donor in crude extracts was NADH. NADHP and methyl viologen were, respectively, 40 and 30% as effective as NADH. Oxygen reversibly inhibited the enzyme. The anaerobic sulfite reductase showed some resemblance to the biosynthetic sulfite reductase, but apparently it has a unique, as yet unidentified function.

  5. Catalytic cycle of human glutathione reductase near 1 Å resolution

    PubMed Central

    Berkholz, Donald S.; Faber, H. Richard; Savvides, Savvas N.; Karplus, P. Andrew

    2008-01-01

    Summary Efficient enzyme catalysis depends on exquisite details of structure beyond those resolvable in typical medium- and high-resolution crystallographic analyses. Here we report synchrotron-based cryocrystallographic studies of natural substrate complexes of the flavoenzyme human glutathione reductase (GR) at nominal resolutions between 1.1 and 0.95 Å that reveal new aspects of its mechanism. Compression in the active site causes overlapping van der Waals radii and distortion in the nicotinamide ring of the NADPH substrate, which enhances catalysis via stereoelectronic effects. The bound NADPH and redox-active disulfide are positioned optimally on opposite sides of the flavin for a 1,2-addition across a flavin double bond. The new structures extend earlier observations to reveal that the redox-active disulfide loop in GR is an extreme case of sequential peptide bonds systematically deviating from planarity, a net deviation of 53° across 5 residues. But this apparent strain is not a factor in catalysis as it is present in both oxidized and reduced structures. Intriguingly, the flavin bond lengths in oxidized GR are intermediate between those expected for oxidized and reduced flavin, but we present evidence that this may not be due to the protein environment but instead to partial synchrotron reduction of the flavin by the synchrotron beam. Finally, of more general relevance, we present evidence that the structures of synchrotron-reduced disulfide bonds cannot generally be used as reliable models for naturally reduced disulfide bonds. PMID:18638483

  6. Methylenetetrahydrofolate reductase (MTHFR) deficiency enhances resistance against cytomegalovirus infection.

    PubMed

    Fodil-Cornu, N; Kozij, N; Wu, Q; Rozen, R; Vidal, S M

    2009-10-01

    Folates provide one-carbon units for nucleotide synthesis and methylation reactions. A common polymorphism in the MTHFR gene (677C --> T) results in reduced enzymatic activity, and is associated with an increased risk for neural tube defects and cardiovascular disease. The high prevalence of this polymorphism suggests that it may have experienced a selective advantage under environmental pressure, possibly an infectious agent. To test the hypothesis that methylenetetrahydrofolate reductase (MTHFR) genotype influences the outcome of infectious disease, we examined the response of Mthfr-deficient mice against mouse cytomegalovirus (MCMV) infection. Acute MCMV infection of Mthfr(-/-) mice resulted in early control of cytokine secretion, decreased viral titer and preservation of spleen immune cells, in contrast to Mthfr wild-type littermates. The phenotype was abolished in MTHFR transgenic mice carrying an extra copy of the gene. Infection of primary fibroblasts with MCMV showed a decrease in viral replication and in the number of productively infected cells in Mthfr(+/-) fibroblasts compared with wild-type cells. These results indicate that Mthfr deficiency protects against MCMV infection in vivo and in vitro, suggesting that human genetic variants may provide an advantage in the host response against certain pathogens.

  7. Erythrocyte aldose reductase activity and sorbitol levels in diabetic retinopathy

    PubMed Central

    Satyanarayana, A.; Balakrishna, N.; Ayyagari, Radha; Padma, M.; Viswanath, K.; Petrash, J. Mark

    2008-01-01

    Purpose Activation of polyol pathway due to increased aldose reductase (ALR2) activity has been implicated in the development of diabetic complications including diabetic retinopathy (DR), a leading cause of blindness. However, the relationship between hyperglycemia-induced activation of polyol pathway in retina and DR is still uncertain. We investigated the relationship between ALR2 levels and human DR by measuring ALR2 activity and its product, sorbitol, in erythrocytes. Methods We enrolled 362 type 2 diabetic subjects (T2D) with and without DR and 66 normal subjects in this clinical case-control study. Clinical evaluation of DR in T2D patients was done by fundus examination. ALR2 activity and sorbitol levels along with glucose and glycosylated hemoglobin (HbA1C) levels in erythrocytes were determined. Results T2D patients with DR showed significantly higher specific activity of ALR2 as compared to T2D patients without DR. Elevated levels of sorbitol in T2D patients with DR, as compared to T2D patients without DR, corroborated the increased ALR2 activity in erythrocytes of DR patients. However, the increased ALR2 activity was not significantly associated with diabetes duration, age, and HbA1C in both the DR group and total T2D subjects. Conclusions Levels of ALR2 activity as well as sorbitol in erythrocytes may have value as a quantitative trait to be included among other markers to establish a risk profile for development of DR. PMID:18385795

  8. [Molecular characterizations of two dehydroascorbate reductases from Selaginella moellendorffii].

    PubMed

    Cheng, Zishuo; Lan, Ting; Li, Di; Yang, Hailing; Zeng, Qingyin

    2011-01-01

    Plant dehydroascorbate reductase (DHAR) is a physiologically important reducing enzyme in the ascorbate-glutathione recycling reaction. In this study, two DHARs genes (SmDHAR1 and SmDHAR2) were isolated from Selaginella moellendorffii. The SmDHAR1 and SmDHAR2 genes encode two proteins of 218 and 241 amino acid residues, with a calculated molecular mass of 23.97 kDa and 27.33 kDa, respectively. The genomic sequence analysis showed SmDHAR1 and SmDHAR2 contained five and six introns, respectively. Reverse transcription PCR revealed that the SmDHAR1 and SmDHAR2 were constitutive expression genes in S. moellendorffii. The recombinant SmDHAR1 and SmDHAR2 proteins were overexpressed in E. coli, and were purified by Ni-affinity chromatography. The recombinant SmDHAR1 showed 116-fold higher enzymatic activity towards the substrate dehydroascorbate than recombinant SmDHAR2. The recombinant SmDHAR1 showed higher thermal stability than recombinant SmDHAR2. These results indicated obvious functional divergence between the duplicate genes SmDHAR1 and SmDHAR2.

  9. The superoxide reductase from the early diverging eukaryote Giardia intestinalis.

    PubMed

    Testa, Fabrizio; Mastronicola, Daniela; Cabelli, Diane E; Bordi, Eugenio; Pucillo, Leopoldo P; Sarti, Paolo; Saraiva, Lígia M; Giuffrè, Alessandro; Teixeira, Miguel

    2011-10-15

    Unlike superoxide dismutases (SODs), superoxide reductases (SORs) eliminate superoxide anion (O(2)(•-)) not through its dismutation, but via reduction to hydrogen peroxide (H(2)O(2)) in the presence of an electron donor. The microaerobic protist Giardia intestinalis, responsible for a common intestinal disease in humans, though lacking SOD and other canonical reactive oxygen species-detoxifying systems, is among the very few eukaryotes encoding a SOR yet identified. In this study, the recombinant SOR from Giardia (SOR(Gi)) was purified and characterized by pulse radiolysis and stopped-flow spectrophotometry. The protein, isolated in the reduced state, after oxidation by superoxide or hexachloroiridate(IV), yields a resting species (T(final)) with Fe(3+) ligated to glutamate or hydroxide depending on pH (apparent pK(a)=8.7). Although showing negligible SOD activity, reduced SOR(Gi) reacts with O(2)(•-) with a pH-independent second-order rate constant k(1)=1.0×10(9) M(-1) s(-1) and yields the ferric-(hydro)peroxo intermediate T(1); this in turn rapidly decays to the T(final) state with pH-dependent rates, without populating other detectable intermediates. Immunoblotting assays show that SOR(Gi) is expressed in the disease-causing trophozoite of Giardia. We propose that the superoxide-scavenging activity of SOR in Giardia may promote the survival of this air-sensitive parasite in the fairly aerobic proximal human small intestine during infection.

  10. Correlated Protein Motion Measurements of Dihydrofolate Reductase Crystals

    NASA Astrophysics Data System (ADS)

    Xu, Mengyang; Niessen, Katherine; Pace, James; Cody, Vivian; Markelz, Andrea

    2014-03-01

    We report the first direct measurements of the long range structural vibrational modes in dihydrofolate reductase (DHFR). DHFR is a universal housekeeping enzyme that catalyzes the reduction of 7,8-dihydrofolate to 5,6,7,8-tetra-hydrofolate, with the aid of coenzyme nicotinamide adenine dinucleotide phosphate (NADPH). This crucial enzymatic role as the target for anti-cancer [methotrexate (MTX)], and other clinically useful drugs, has made DHFR a long-standing target of enzymological studies. The terahertz (THz) frequency range (5-100 cm-1), corresponds to global correlated protein motions. In our lab we have developed Crystal Anisotropy Terahertz Microscopy (CATM), which directly measures these large scale intra-molecular protein vibrations, by removing the relaxational background of the solvent and residue side chain librational motions. We demonstrate narrowband features in the anisotropic absorbance for mouse DHFR with the ligand binding of NADPH and MTX single crystals as well as Escherichia coli DHFR with the ligand binding of NADPH and MTX single crystals. This work is supported by NSF grant MRI2 grant DBI2959989.

  11. A second target of benzamide riboside: dihydrofolate reductase.

    PubMed

    Roussel, Breton; Johnson-Farley, Nadine; Kerrigan, John E; Scotto, Kathleen W; Banerjee, Debabrata; Felczak, Krzysztof; Pankiewicz, Krzysztof W; Gounder, Murugesan; Lin, HongXia; Abali, Emine Ercikan; Bertino, Joseph R

    2012-11-01

    Dihydrofolate reductase (DHFR) is an essential enzyme involved in de novo purine and thymidine biosynthesis. For several decades, selective inhibition of DHFR has proven to be a potent therapeutic approach in the treatment of various cancers including acute lymphoblastic leukemia, non-Hodgkin's lymphoma, osteogenic sarcoma, carcinoma of the breast, and head and neck cancer. Therapeutic success with DHFR inhibitor methotrexate (MTX) has been compromised in the clinic, which limits the success of MTX treatment by both acquired and intrinsic resistance mechanisms. We report that benzamide riboside (BR), via anabolism to benzamide adenine dinucleotide (BAD) known to potently inhibit inosine monophosphate dehydrogenase (IMPDH), also inhibits cell growth through a mechanism involving downregulation of DHFR protein. Evidence to support this second site of action of BR includes the finding that CCRF-CEM/R human T-cell lymphoblasic leukemia cells, resistant to MTX as a consequence of gene amplification and overexpression of DHFR, are more resistant to BR than are parental cells. Studies of the mechanism by which BR lowers DHFR showed that BR, through its metabolite BAD, reduced NADP and NADPH cellular levels by inhibiting nicotinamide adenine dinucleotide kinase (NADK). As consequence of the lack of NADPH, DHFR was shown to be destabilized. We suggest that, inhibition of NADK is a new approach to downregulate DHFR and to inhibit cell growth.

  12. Chromate reductase activity in Streptomyces sp. MC1.

    PubMed

    Polti, Marta A; Amoroso, María J; Abate, Carlos M

    2010-02-01

    Biological transformation of Cr(VI) to Cr(III) by enzymatic reduction may provide a less costly and more environmentally friendly approach to remediation. In a previous report a Cr(VI) resistant actinomycete strain, Streptomyces sp. MC1, was able to reduce Cr(VI) present in a synthetic medium, soil extract and soil samples. This is the first time optimal conditions such as pH, temperature, growth phase and electron donor have been elucidated in vitro for Cr(VI) reduction by a streptomycete. Chromate reductase of Streptomyces sp. MC1 is a constitutive enzyme which was mainly associated with biomass and required NAD(P)H as an electron donor. It was active over a broad temperature (19-39 degrees C) and pH (5-8) range, and optimum conditions were 30 degrees C and pH 7. The enzyme was present in supernatant, pellet and cell free extract. Bioremediation with the enzyme was observed in non-compatible cell reproduction systems, conditions frequently found in contaminated environments.

  13. Identification of activators of methionine sulfoxide reductases A and B

    PubMed Central

    Cudic, Predrag; Joshi, Neelambari; Sagher, Daphna; Williams, Brandon T.; Stawikowski, Maciej J.; Weissbach, Herbert

    2016-01-01

    The methionine sulfoxide reductase (Msr) family of enzymes has been shown to protect cells against oxidative damage. The two major Msr enzymes, MsrA and MsrB, can repair oxidative damage to proteins due to reactive oxygen species, by reducing the methionine sulfoxide in proteins back to methionine. A role of MsrA in animal aging was first demonstrated in D. melanogaster where transgenic flies over-expressing recombinant bovine MsrA had a markedly extended life span. Subsequently, MsrA was also shown to be involved in the life span extension in C. elegans. These results supported other studies that indicated up-regulation, or activation, of the normal cellular protective mechanisms that cells use to defend against oxidative damage could be an approach to treat age related diseases and slow the aging process. In this study we have identified, for the first time, compounds structurally related to the natural products fusaricidins that markedly activate recombinant bovine and human MsrA and human MsrB. PMID:26718410

  14. Structural Basis for Activation of Class Ib Ribonucleotide Reductase

    SciTech Connect

    Boal, Amie K.; Cotruvo, Jr., Joseph A.; Stubbe, JoAnne; Rosenzweig, Amy C.

    2010-12-03

    The class Ib ribonucleotide reductase of Escherichia coli can initiate reduction of nucleotides to deoxynucleotides with either a Mn{sub 2}{sup III}-tyrosyl radical (Y{sm_bullet}) or a Fe{sub 2}{sup III}-Y{sm_bullet} cofactor in the NrdF subunit. Whereas Fe{sub 2}{sup III}-Y{sm_bullet} can self-assemble from Fe{sub 2}{sup II}-NrdF and O{sub 2}, activation of Mn{sub 2}{sup II}-NrdF requires a reduced flavoprotein, NrdI, proposed to form the oxidant for cofactor assembly by reduction of O{sub 2}. The crystal structures reported here of E. coli Mn{sub 2}{sup II}-NrdF and Fe{sub 2}{sup II}-NrdF reveal different coordination environments, suggesting distinct initial binding sites for the oxidants during cofactor activation. In the structures of Mn{sub 2}{sup II}-NrdF in complex with reduced and oxidized NrdI, a continuous channel connects the NrdI flavin cofactor to the NrdF Mn{sub 2}{sup II} active site. Crystallographic detection of a putative peroxide in this channel supports the proposed mechanism of Mn{sub 2}{sup III}-Y{sm_bullet} cofactor assembly.

  15. Structure and kinetics assays of recombinant Schistosoma mansoni dihydrofolate reductase.

    PubMed

    Serrão, Vitor Hugo Balasco; Romanello, Larissa; Cassago, Alexandre; de Souza, Juliana Roberta Torini; Cheleski, Juliana; DeMarco, Ricardo; Brandão-Neto, José; Pereira, Humberto D'Muniz

    2017-03-11

    The parasite Schistosoma mansoni possesses all pathways for pyrimidine biosynthesis, in which dihydrofolate reductase (DHFR), thymidylate cycle participants, is essential for nucleotide metabolism to obtain energy and structural nucleic acids. Thus, DHFRs have been widely suggested as therapeutic targets for the treatment of infectious diseases. In this study, we expressed recombinant SmDHFR in a heterologous manner to obtain structural, biochemical and kinetic information. X-ray diffraction of recombinant SmDHFR at 1.95Å resolution showed that the structure exhibited the canonical DHFR fold. Isothermal titration calorimetry was used to determine the kinetic constants for NADP(+) and dihydrofolate. Moreover, inhibition assays were performed using the commercial folate analogs methotrexate and aminopterin; these analogs are recognized as folate competitors and are used as chemotherapeutic agents in cancer and autoimmune diseases. This study provides information that may prove useful for the future discovery of novel drugs and for understanding these metabolic steps from this pathway of S. mansoni, thus aiding in our understanding of the function of these essential pathways for parasite metabolism.

  16. Fasciola gigantica thioredoxin glutathione reductase: Biochemical properties and structural modeling.

    PubMed

    Gupta, Ankita; Kesherwani, Manish; Velmurugan, Devadasan; Tripathi, Timir

    2016-08-01

    Platyhelminth thioredoxin glutathione reductase (TGR) is a multifunctional enzyme that crosstalk between the conventional thioredoxin (Trx) and glutathione (GSH) system. It has been validated as a potential drug target in blood flukes. In the present study, we have performed a biochemical study on Fasciola gigantica TGR with substrates DTNB and GSSG. The Michaelis constant (Km) with DTNB was found to be 4.34±0.12μM while it was 61.15±1.50μM with GSSG. The kinetic results were compared with the TGR activities of other helminths. FgTGR showed typical hysteretic behavior with GSSG as other TGRs. We also described a homology-based structure of FgTGR. The cofactors (NADPH and FAD) and substrates (GSSG and DTNB) were docked, and two possible binding sites for substrates were identified in a single chain. The substrates were found to bind more favorably in the second site of TrxR domains. We also presented the first report on binding interaction of DTNB with a TGR. DTNB forms H-bond with His204 and Arg450 of chain A, Sec597, and Gly598 from chain B, salt-bridge with Lys124, and numerous other hydrophobic interactions. Helminth TGR represents an important enzyme in the redox and antioxidant system; hence, its inhibition can be used as an effective strategy against liver flukes.

  17. Arabidopsis thaliana dehydroascorbate reductase 2: Conformational flexibility during catalysis

    NASA Astrophysics Data System (ADS)

    Bodra, Nandita; Young, David; Astolfi Rosado, Leonardo; Pallo, Anna; Wahni, Khadija; de Proft, Frank; Huang, Jingjing; van Breusegem, Frank; Messens, Joris

    2017-02-01

    Dehydroascorbate reductase (DHAR) catalyzes the glutathione (GSH)-dependent reduction of dehydroascorbate and plays a direct role in regenerating ascorbic acid, an essential plant antioxidant vital for defense against oxidative stress. DHAR enzymes bear close structural homology to the glutathione transferase (GST) superfamily of enzymes and contain the same active site motif, but most GSTs do not exhibit DHAR activity. The presence of a cysteine at the active site is essential for the catalytic functioning of DHAR, as mutation of this cysteine abolishes the activity. Here we present the crystal structure of DHAR2 from Arabidopsis thaliana with GSH bound to the catalytic cysteine. This structure reveals localized conformational differences around the active site which distinguishes the GSH-bound DHAR2 structure from that of DHAR1. We also unraveled the enzymatic step in which DHAR releases oxidized glutathione (GSSG). To consolidate our structural and kinetic findings, we investigated potential conformational flexibility in DHAR2 by normal mode analysis and found that subdomain mobility could be linked to GSH binding or GSSG release.

  18. Hydrogenases in sulfate-reducing bacteria function as chromium reductase.

    PubMed

    Chardin, B; Giudici-Orticoni, M-T; De Luca, G; Guigliarelli, B; Bruschi, M

    2003-12-01

    The ability of sulfate-reducing bacteria (SRB) to reduce chromate VI has been studied for possible application to the decontamination of polluted environments. Metal reduction can be achieved both chemically, by H(2)S produced by the bacteria, and enzymatically, by polyhemic cytochromes c(3). We demonstrate that, in addition to low potential polyheme c-type cytochromes, the ability to reduce chromate is widespread among [Fe], [NiFe], and [NiFeSe] hydrogenases isolated from SRB of the genera Desulfovibrio and Desulfomicrobium. Among them, the [Fe] hydrogenase from Desulfovibrio vulgaris strain Hildenborough reduces Cr(VI) with the highest rate. Both [Fe] and [NiFeSe] enzymes exhibit the same K(m) towards Cr(VI), suggesting that Cr(VI) reduction rates are directly correlated with hydrogen consumption rates. Electron paramagnetic resonance spectroscopy enabled us to probe the oxidation by Cr(VI) of the various metal centers in both [NiFe] and [Fe] hydrogenases. These experiments showed that Cr(VI) is reduced to paramagnetic Cr(III), and revealed inhibition of the enzyme at high Cr(VI) concentrations. The significant decrease of both hydrogenase and Cr(VI)-reductase activities in a mutant lacking [Fe] hydrogenase demonstrated the involvement of this enzyme in Cr(VI) reduction in vivo. Experiments with [3Fe-4S] ferredoxin from Desulfovibrio gigas demonstrated that the low redox [Fe-S] (non-heme iron) clusters are involved in the mechanism of metal reduction by hydrogenases.

  19. Transgenic overexpression of ribonucleotide reductase improves cardiac performance

    PubMed Central

    Nowakowski, Sarah G.; Kolwicz, Stephen C.; Korte, Frederick Steven; Luo, Zhaoxiong; Robinson-Hamm, Jacqueline N.; Page, Jennifer L.; Brozovich, Frank; Weiss, Robert S.; Tian, Rong; Murry, Charles E.; Regnier, Michael

    2013-01-01

    We previously demonstrated that cardiac myosin can use 2-deoxy-ATP (dATP) as an energy substrate, that it enhances contraction and relaxation with minimal effect on calcium-handling properties in vitro, and that contractile enhancement occurs with only minor elevation of cellular [dATP]. Here, we report the effect of chronically enhanced dATP concentration on cardiac function using a transgenic mouse that overexpresses the enzyme ribonucleotide reductase (TgRR), which catalyzes the rate-limiting step in de novo deoxyribonucleotide biosynthesis. Hearts from TgRR mice had elevated left ventricular systolic function compared with wild-type (WT) mice, both in vivo and in vitro, without signs of hypertrophy or altered diastolic function. Isolated cardiomyocytes from TgRR mice had enhanced contraction and relaxation, with no change in Ca2+ transients, suggesting targeted improvement of myofilament function. TgRR hearts had normal ATP and only slightly decreased phosphocreatine levels by 31P NMR spectroscopy, and they maintained rate responsiveness to dobutamine challenge. These data demonstrate long-term (at least 5-mo) elevation of cardiac [dATP] results in sustained elevation of basal left ventricular performance, with maintained β-adrenergic responsiveness and energetic reserves. Combined with results from previous studies, we conclude that this occurs primarily via enhanced myofilament activation and contraction, with similar or faster ability to relax. The data are sufficiently compelling to consider elevated cardiac [dATP] as a therapeutic option to treat systolic dysfunction. PMID:23530224

  20. Effects of galactose feeding on aldose reductase gene expression.

    PubMed Central

    Wu, R R; Lyons, P A; Wang, A; Sainsbury, A J; Chung, S; Palmer, T N

    1993-01-01

    Aldose reductase (AR) is implicated in the pathogenesis of the diabetic complications and osmotic cataract. AR has been identified as an osmoregulatory protein, at least in the renal medulla. An outstanding question relates to the response of AR gene expression to diet-induced galactosemia in extrarenal tissues. This paper shows that AR gene expression in different tissues is regulated by a complex multifactorial mechanism. Galactose feeding in the rat is associated with a complex and, on occasions, multiphasic pattern of changes in AR mRNA levels in kidney, testis, skeletal muscle, and brain. These changes are not in synchrony with the temporal sequence of changes in tissue galactitol, galactose, and myoinositol concentrations. Moreover, galactose feeding results in changes in tissue AR activities that are not related, temporally or quantitatively, to the alterations in tissue AR mRNA or galactitol levels. It is concluded that AR gene expression and tissue AR activities are regulated by mechanisms that are not purely dependent on nonspecific alterations in intracellular metabolite concentrations. This conclusion is supported by the finding that chronic xylose feeding, despite being associated with intracellular xylitol accumulation, does not result in alterations in AR mRNA levels, at least in the kidney. PMID:8325980

  1. Nitrate Reductase of Primary Roots of Red Spruce Seedlings 1

    PubMed Central

    Yandow, Tim S.; Klein, Richard M.

    1986-01-01

    Nitrate reductase activity (NRA) was found in primary roots, but not in foliage of red spruce (Picea rubens Sarg.) seedlings. Nitrate induced NRA:NH4+ did not induce and slightly depressed NRA in older seedlings. Induction required 8 hours and, once induced, NRA decreased slowly in the absence of exogenous NO3−. Seedlings were grown in perlite with a complete nutrient solution containing NH4+ to limit NR induction. Established seedlings were stressed with nutrient solutions at pH 3, 4, or 5 supplemented with Cl− salts of Al, Cd, Pb, or Zn each at two concentrations. NRA in primary root tips was measured at 2, 14, 28, and 42 days. NRA induction was greatest at pH 3, and remained high during the period of study. NRA induction at pH 4 was lower. Metal ions suppressed NRA at pH 3 and 5, but enhanced NRA at pH 4. It is concluded that acidity and soluble metals in the root environment of red spruce are unlikely to be important factors in nitrogen transformations in red spruce roots. PMID:16664891

  2. Structure of Escherichia coli Flavodiiron Nitric Oxide Reductase.

    PubMed

    Romão, Célia V; Vicente, João B; Borges, Patrícia T; Victor, Bruno L; Lamosa, Pedro; Silva, Elísio; Pereira, Luís; Bandeiras, Tiago M; Soares, Cláudio M; Carrondo, Maria A; Turner, David; Teixeira, Miguel; Frazão, Carlos

    2016-11-20

    Flavodiiron proteins (FDPs) are present in organisms from all domains of life and have been described so far to be involved in the detoxification of oxygen or nitric oxide (NO), acting as O2 and/or NO reductases. The Escherichia coli FDP, named flavorubredoxin (FlRd), is the most extensively studied FDP. Biochemical and in vivo studies revealed that FlRd is involved in NO detoxification as part of the bacterial defense mechanisms against reactive nitrogen species. E. coli FlRd has a clear preference for NO as a substrate in vitro, exhibiting a very low reactivity toward O2. To contribute to the understanding of the structural features defining this substrate selectivity, we determined the crystallographic structure of E. coli FlRd, both in the isolated and reduced states. The overall tetrameric structure revealed a highly conserved flavodiiron core domain, with a metallo-β-lactamase-like domain containing a diiron center, and a flavodoxin domain with a flavin mononucleotide cofactor. The metal center in the oxidized state has a μ-hydroxo bridge coordinating the two irons, while in the reduced state, this moiety is not detected. Since only the flavodiiron domain was observed in these crystal structures, the structure of the rubredoxin domain was determined by NMR. Tunnels for the substrates were identified, and through molecular dynamics simulations, no differences for O2 or NO permeation were found. The present data represent the first structure for a NO-selective FDP.

  3. Prognostic Relevance of Methylenetetrahydrofolate Reductase Polymorphisms for Prostate Cancer

    PubMed Central

    Lin, Victor C.; Lu, Te-Ling; Yin, Hsin-Ling; Yang, Sheau-Fang; Lee, Yung-Chin; Liu, Chia-Chu; Huang, Chao-Yuan; Yu, Chia-Cheng; Chang, Ta-Yuan; Huang, Shu-Pin; Bao, Bo-Ying

    2016-01-01

    Folate metabolism has been associated with cancers via alterations in nucleotide synthesis, DNA methylation, and DNA repair. We hypothesized that genetic variants in methylenetetrahydrofolate reductase (MTHFR), a key enzyme of folate metabolism, would affect the prognosis of prostate cancer. Three haplotype-tagging single-nucleotide polymorphisms (SNPs) across the MTHFR gene region were genotyped in a cohort of 458 patients with clinically localized prostate cancer treated with radical prostatectomy. One SNP, rs9651118, was associated with disease recurrence, and the association persisted after multivariate analyses adjusting for known risk factors. Public dataset analyses suggested that rs9651118 affects MTHFR expression. Quantitative real-time polymerase chain reaction analysis revealed that MTHFR expression is significantly upregulated in prostate tumor tissues when compared with adjacent normal tissues. Furthermore, overexpression of MTHFR correlates with cancer recurrence and death in two independent publicly available prostate cancer datasets. In conclusion, our data provide rationale to further validate the clinical utility of MTHFR rs9651118 as a biomarker for prognosis in prostate cancer. PMID:27916838

  4. CHARACTERIZATION OF THE METHIONINE SULFOXIDE REDUCTASES OF SCHISTOSOMA MANSONI

    PubMed Central

    Oke, Tolulope T.; Moskovitz, Jackob; Williams, David L.

    2013-01-01

    Schistosomiasis, also known as Bilharzia, is an infectious disease caused by several species of Schistosoma. Twenty million individuals suffer severe symptoms and 200,000 people die annually from the disease. The host responds to the presence of S. mansoni by producing reactive oxygen species that cause oxidative stress. We hypothesized that schistosomes produce antioxidants in response to oxidative stress. A known antioxidant protein is methionine sulfoxide reductase (Msr). Methionine residues can be oxidized to methionine sulfoxide in the presence of oxidizing agents, which is readily reversed by the action of the Msr system. Two S. mansoni MsrB genes (MsrB1 and MsrB2) were cloned and the recombinant proteins expressed in bacteria and purified. The S. mansoni MsrB proteins contained the common conserved catalytic and zinc coordinating cysteines. Analysis of the proteins showed that both proteins promote the reduction of both free methionine sulfoxide (Met[O]) and dabsyl-Met(O) to free methionine (Met) and dabsyl-Met, respectively, while exhibiting differences in their specific activities towards these substrates. Using real-time PCR, both proteins were found to be expressed in all stages of the parasite’s life cycle with the highest level of expression of both proteins in the egg stage. This is the first description of MsrB proteins from a parasite. PMID:19604033

  5. Lausannevirus Encodes a Functional Dihydrofolate Reductase Susceptible to Proguanil

    PubMed Central

    Mueller, L.; Hauser, P. M.; Gauye, F.

    2017-01-01

    ABSTRACT Lausannevirus belongs to the family Marseilleviridae within the group of nucleocytoplasmic large DNA viruses (NCLDVs). These giant viruses exhibit unique features, including a large genome, ranging from 100 kb to 2.5 Mb and including from 150 to more than 2,500 genes, as well as the presence of genes coding for proteins involved in transcription and translation. The large majority of Lausannevirus open reading frames have unknown functions. Interestingly, a bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) is encoded in the Lausannevirus genome. The enzyme plays central roles in DNA precursor biosynthesis. DHFR is the pharmacological target of antifolates, such as trimethoprim, pyrimethamine, and proguanil. First, the functionality of Lausannevirus DHFR-TS was demonstrated by the successful complementation of a DHFR-deficient Saccharomyces cerevisiae strain with a plasmid expressing the heterologous gene. Additionally, using this heterologous expression system, we demonstrated the in vitro susceptibility of Lausannevirus DHFR-TS to proguanil and its resistance to pyrimethamine and trimethoprim. Proguanil may provide a unique and useful treatment if Lausannevirus proves to be a human pathogen. To our knowledge, this is the first time that a DHFR-TS has been described and characterized in an NCLDV. PMID:28137801

  6. Short-chain dehydrogenases/reductases (SDR): the 2002 update.

    PubMed

    Oppermann, Udo; Filling, Charlotta; Hult, Malin; Shafqat, Naeem; Wu, Xiaoqiu; Lindh, Monica; Shafqat, Jawed; Nordling, Erik; Kallberg, Yvonne; Persson, Bengt; Jörnvall, Hans

    2003-02-01

    Short-chain dehydrogenases/reductases (SDR) form a large, functionally heterogeneous protein family presently with about 3000 primary and about 30 3D structures deposited in databases. Despite low sequence identities between different forms (about 15-30%), the 3D structures display highly similar alpha/beta folding patterns with a central beta-sheet, typical of the Rossmann-fold. Based on distinct sequence motifs functional assignments and classifications are possible, making it possible to build a general nomenclature system. Recent mutagenetic and structural studies considerably extend the knowledge on the general reaction mechanism, thereby establishing a catalytic tetrad of Asn-Ser-Tyr-Lys residues, which presumably form the framework for a proton relay system including the 2'-OH of the nicotinamide ribose, similar to the mechanism found in horse liver ADH. Based on their cellular functions, several SDR enzymes appear as possible and promising pharmacological targets with application areas spanning hormone-dependent cancer forms or metabolic diseases such as obesity and diabetes, and infectious diseases.

  7. Solvent effects on catalysis by Escherichia coli dihydrofolate reductase.

    PubMed

    Loveridge, E Joel; Tey, Lai-Hock; Allemann, Rudolf K

    2010-01-27

    Hydride transfer catalyzed by dihydrofolate reductase (DHFR) has been described previously within an environmentally coupled model of hydrogen tunneling, where protein motions control binding of substrate and cofactor to generate a tunneling ready conformation and modulate the width of the activation barrier and hence the reaction rate. Changes to the composition of the reaction medium are known to perturb protein motions. We have measured kinetic parameters of the reaction catalyzed by DHFR from Escherichia coli in the presence of various cosolvents and cosolutes and show that the dielectric constant, but not the viscosity, of the reaction medium affects the rate of reaction. Neither the primary kinetic isotope effect on the reaction nor its temperature dependence were affected by changes to the bulk solvent properties. These results are in agreement with our previous report on the effect of solvent composition on catalysis by DHFR from the hyperthermophile Thermotoga maritima. However, the effect of solvent on the temperature dependence of the kinetic isotope effect on hydride transfer catalyzed by E. coli DHFR is difficult to explain within a model, in which long-range motions couple to the chemical step of the reaction, but may indicate the existence of a short-range promoting vibration or the presence of multiple nearly isoenergetic conformational substates of enzymes with similar but distinct catalytic properties.

  8. Constitutive nitrate reductase expression and inhibition in winged bean

    SciTech Connect

    Wu, Shenchuan; Harper, J.E. )

    1990-05-01

    It was found that NO{sub 3}{sup {minus}} had no effect on winged bean nitrate reductase activity (NRA). Similar NRA was expressed in plants grown on NO{sub 3}{sup {minus}}, urea, NH{sub 4}{sup +}, and nil N. This indicated that the primary NR expressed in winged bean was constitutive, rather than substrate-inducible. Maximum NRA in winged bean was obtained in the light. KClO{sub 3} was capable of inhibiting NRA of leaves if added to the root growth medium or to the NR assay medium, indicating possible competition with NO{sub 3}{sup {minus}} at the reduction site. While it has previously been shown that either cycloheximide alone, or both cycloheximide and chloramphenicol impair the synthesis of NR protein, our data unexpectedly demonstrated that cycloheximide had little effect on NRA, whereas chloramphenicol greatly inhibited the expression of NRA in winged bean. One interpretation is that chloroplasts may influence the activity and/or synthesis of constitutive NR proteins.

  9. Optical observation of correlated motions in dihydrofolate reductase

    NASA Astrophysics Data System (ADS)

    Xu, Mengyang; Niessen, Katherine; Pace, James; Cody, Vivian; Markelz, Andrea

    2015-03-01

    Enzyme function relies on its structural flexibility to make conformational changes for substrate binding and product release. An example of a metabolic enzyme where such structural changes are vital is dihydrofolate reductase (DHFR). DHFR is essential in both prokaryotes and eukaryotes for the nucleotide biosynthesis by catalyzing the reduction of dihydrofolate to tetrahydrofolate. NMR dynamical measurements found large amplitude fast dynamics that could indicate rigid-body, twisting-hinge motion for ecDHFR that may mediate flux. The role of such long-range correlated motions in function was suggested by the observed sharp decrease in enzyme activity for the single point mutation G121V, which is remote from active sites. This decrease in activity may be caused by the mutation interfering with the long-range intramolecular vibrations necessary for rapid access to functional configurations. We use our new technique of crystal anisotropy terahertz microscopy (CATM), to observe correlated motions in ecDHFR crystals with the bonding of NADPH and methotrexate. We compare the measured intramolecular vibrational spectrum with calculations using normal mode analysis.

  10. Loss of quinone reductase 2 function selectively facilitates learning behaviors.

    PubMed

    Benoit, Charles-Etienne; Bastianetto, Stephane; Brouillette, Jonathan; Tse, YiuChung; Boutin, Jean A; Delagrange, Philippe; Wong, TakPan; Sarret, Philippe; Quirion, Rémi

    2010-09-22

    High levels of reactive oxygen species (ROS) are associated with deficits in learning and memory with age as well as in Alzheimer's disease. Using DNA microarray, we demonstrated the overexpression of quinone reductase 2 (QR2) in the hippocampus in two models of learning deficits, namely the aged memory impaired rats and the scopolamine-induced amnesia model. QR2 is a cytosolic flavoprotein that catalyzes the reduction of its substrate and enhances the production of damaging activated quinone and ROS. QR2-like immunostaining is enriched in cerebral structures associated with learning behaviors, such as the hippocampal formation and the temporofrontal cortex of rat, mouse, and human brains. In cultured rat embryonic hippocampal neurons, selective inhibitors of QR2, namely S26695 and S29434, protected against menadione-induced cell death by reversing its proapoptotic action. S26695 (8 mg/kg) also significantly inhibited scopolamine-induced amnesia. Interestingly, adult QR2 knock-out mice demonstrated enhanced learning abilities in various tasks, including Morris water maze, object recognition, and rotarod performance test. Other behaviors related to anxiety (elevated plus maze), depression (forced swim), and schizophrenia (prepulse inhibition) were not affected in QR2-deficient mice. Together, these data suggest a role for QR2 in cognitive behaviors with QR2 inhibitors possibly representing a novel therapeutic strategy toward the treatment of learning deficits especially observed in the aged brain.

  11. Severe scoliosis in a patient with severe methylenetetrahydrofolate reductase deficiency.

    PubMed

    Munoz, Tatiana; Patel, Jinesh; Badilla-Porras, Ramses; Kronick, Jonathan; Mercimek-Mahmutoglu, Saadet

    2015-01-01

    Severe methylenetetrahydrofolate reductase (MTHFR) deficiency is a rare autosomal recessively inherited inborn error of folate metabolism. We report a new patient with severe MTHFR deficiency who presented at age 4 months with early onset severe scoliosis associated with severe hypotonia. Markedly decreased MTHFR enzyme activity (0.3 nmoles CHO/mg protein/h; reference range>9) and compound heterozygous mutations (c. 1304T>C; p.Phe435Ser and c.1539dup; p.Glu514Argfs∗24) in the MTHFR gene confirmed the diagnosis. She was treated with vitamin B12, folic acid and betaine supplementation and showed improvements in her developmental milestones and hypotonia. To the best of our knowledge, this is the first patient with MTHFR deficiency reported with severe early onset scoliosis. Despite the late diagnosis and treatment initiation, she showed favorable short-term neurodevelopmental outcome. This case suggests that homocysteine measurement should be included in the investigations of patients with developmental delay, hypotonia and scoliosis within first year of life prior to organizing genetic investigations.

  12. Mutation Update and Review of Severe Methylenetetrahydrofolate Reductase Deficiency.

    PubMed

    Froese, D Sean; Huemer, Martina; Suormala, Terttu; Burda, Patricie; Coelho, David; Guéant, Jean-Louis; Landolt, Markus A; Kožich, Viktor; Fowler, Brian; Baumgartner, Matthias R

    2016-05-01

    Severe 5,10-methylenetetrahydrofolate reductase (MTHFR) deficiency is caused by mutations in the MTHFR gene and results in hyperhomocysteinemia and varying severity of disease, ranging from neonatal lethal to adult onset. Including those described here, 109 MTHFR mutations have been reported in 171 families, consisting of 70 missense mutations, 17 that primarily affect splicing, 11 nonsense mutations, seven small deletions, two no-stop mutations, one small duplication, and one large duplication. Only 36% of mutations recur in unrelated families, indicating that most are "private." The most common mutation is c.1530A>G (numbered from NM_005957.4, p.Lys510 = ) causing a splicing defect, found in 13 families; the most common missense mutation is c.1129C>T (p.Arg377Cys) identified in 10 families. To increase disease understanding, we report enzymatic activity, detected mutations, and clinical onset information (early, <1 year; or late, >1 year) for all published patients available, demonstrating that patients with early onset have less residual enzyme activity than those presenting later. We also review animal models, diagnostic approaches, clinical presentations, and treatment options. This is the first large review of mutations in MTHFR, highlighting the wide spectrum of disease-causing mutations.

  13. Composition and structure of assimilatory nitrate reductase from Ankistrodesmus braunii.

    PubMed

    De la Rosa, M A; Vega, J M; Zumft, W G

    1981-06-10

    Assimilatory NAD(P)H-nitrate reductase (EC 1.6.6.2) from Ankistrodesmus braunii has been purified to homogeneity by affinity chromatography on blue Sepharose. The specific activity of the purified enzyme is in the range of 72 to 80 units/mg of protein. The electronic spectrum of the native enzyme shows absorption maxima at 278, 414 (Soret), 532 (beta), 562 (alpha), and 669 nm and shoulders at 455 and 484 nm, with an A278/A414 ratio of 2.56. The reduced enzyme shows absorption maxima at 424 (Soret), 528 (beta), 557 (alpha),and 669 n. The enzyme complex (Mr = 467,400) is composed of eight similar subunits (Mr = 58,750) and contains 4 molecules of FAD, 4 heme groups, and 2 atoms of molybdenum. Labile sulfide and nonheme iron were not detected. Electron micrographs show the eight subunits arranged alternately in two planes, and an 8-fold rotational symmetry was deduced from highly magnified images processed by optical superposition.

  14. Converting a Sulfenic Acid Reductase into a Disulfide Bond Isomerase

    PubMed Central

    Chatelle, Claire; Kraemer, Stéphanie; Ren, Guoping; Chmura, Hannah; Marechal, Nils; Boyd, Dana; Roggemans, Caroline; Ke, Na; Riggs, Paul; Bardwell, James

    2015-01-01

    Abstract Aims: Posttranslational formation of disulfide bonds is essential for the folding of many secreted proteins. Formation of disulfide bonds in a protein with more than two cysteines is inherently fraught with error and can result in incorrect disulfide bond pairing and, consequently, misfolded protein. Protein disulfide bond isomerases, such as DsbC of Escherichia coli, can recognize mis-oxidized proteins and shuffle the disulfide bonds of the substrate protein into their native folded state. Results: We have developed a simple blue/white screen that can detect disulfide bond isomerization in vivo, using a mutant alkaline phosphatase (PhoA*) in E. coli. We utilized this screen to isolate mutants of the sulfenic acid reductase (DsbG) that allowed this protein to act as a disulfide bond isomerase. Characterization of the isolated mutants in vivo and in vitro allowed us to identify key amino acid residues responsible for oxidoreductase properties of thioredoxin-like proteins such as DsbC or DsbG. Innovation and Conclusions: Using these key residues, we also identified and characterized interesting environmental homologs of DsbG with novel properties, thus demonstrating the capacity of this screen to discover and elucidate mechanistic details of in vivo disulfide bond isomerization. Antioxid. Redox Signal. 23, 945–957. PMID:26191605

  15. Role of Helicobacter pylori methionine sulfoxide reductase in urease maturation

    PubMed Central

    Kuhns, Lisa G.; Mahawar, Manish; Sharp, Joshua S.; Benoit, Stéphane; Maier, Robert J.

    2014-01-01

    The persistence of the gastric pathogen Helicobacter pylori is due in part to urease and Msr (methionine sulfoxide reductase). Upon exposure to relatively mild (21% partial pressure of O2) oxidative stress, a Δmsr mutant showed both decreased urease specific activity in cell-free extracts and decreased nickel associated with the partially purified urease fraction as compared with the parent strain, yet urease apoprotein levels were the same for the Δmsr and wild-type extracts. Urease activity of the Δmsr mutant was not significantly different from the wild-type upon non-stress microaerobic incubation of strains. Urease maturation occurs through nickel mobilization via a suite of known accessory proteins, one being the GTPase UreG. Treatment of UreG with H2O2 resulted in oxidation of MS-identified methionine residues and loss of up to 70% of its GTPase activity. Incubation of pure H2O2-treated UreG with Msr led to reductive repair of nine methionine residues and recovery of up to full enzyme activity. Binding of Msr to both oxidized and non-oxidized UreG was observed by cross-linking. Therefore we conclude Msr aids the survival of H. pylori in part by ensuring continual UreG-mediated urease maturation under stress conditions. PMID:23181726

  16. Light regulates alternative splicing of hydroxypyruvate reductase in pumpkin.

    PubMed

    Mano, S; Hayashi, M; Nishimura, M

    1999-02-01

    Hydroxypyruvate reductase (HPR) is a leaf peroxisomal enzyme that functions in the glycolate pathway of photorespiration in plants. We have obtained two highly similar cDNAs for pumpkin HPR (HPR1 and HPR2). It has been revealed that two HPR mRNAs might be produced by alternative splicing from a single type of pre-mRNA. The HPR1 protein, but not the HPR2 protein, was found to have a targeting sequence into leaf peroxisomes at the C-terminus, suggesting that alternative splicing controls the subcellular localization of the two HPR proteins. Immunoblot analysis and subcellular fractionation experiments showed that HPR1 and HPR2 proteins are localized in leaf peroxisomes and the cytosol, respectively. Moreover, indirect fluorescence microscopy and analyses of transgenic tobacco cultured cells and Arabidopsis thaliana expressing fusion proteins with green fluorescent protein (GFP) revealed the different subcellular localizations of the two HPR proteins. Both mRNAs were induced developmentally and by light, but with quantitative differences. Almost equal amounts of the mRNAs were detected in pumpkin cotyledons grown in darkness, but treatment with light greatly enhanced the production of HPR2 mRNA. These findings indicate that light regulates alternative splicing of HPR mRNA, suggesting the presence of a novel mechanism of mRNA maturation, namely light-regulated alternative splicing, in higher plants.

  17. Arabidopsis thaliana dehydroascorbate reductase 2: Conformational flexibility during catalysis

    PubMed Central

    Bodra, Nandita; Young, David; Astolfi Rosado, Leonardo; Pallo, Anna; Wahni, Khadija; De Proft, Frank; Huang, Jingjing; Van Breusegem, Frank; Messens, Joris

    2017-01-01

    Dehydroascorbate reductase (DHAR) catalyzes the glutathione (GSH)-dependent reduction of dehydroascorbate and plays a direct role in regenerating ascorbic acid, an essential plant antioxidant vital for defense against oxidative stress. DHAR enzymes bear close structural homology to the glutathione transferase (GST) superfamily of enzymes and contain the same active site motif, but most GSTs do not exhibit DHAR activity. The presence of a cysteine at the active site is essential for the catalytic functioning of DHAR, as mutation of this cysteine abolishes the activity. Here we present the crystal structure of DHAR2 from Arabidopsis thaliana with GSH bound to the catalytic cysteine. This structure reveals localized conformational differences around the active site which distinguishes the GSH-bound DHAR2 structure from that of DHAR1. We also unraveled the enzymatic step in which DHAR releases oxidized glutathione (GSSG). To consolidate our structural and kinetic findings, we investigated potential conformational flexibility in DHAR2 by normal mode analysis and found that subdomain mobility could be linked to GSH binding or GSSG release. PMID:28195196

  18. Atypical features of Thermus thermophilus succinate:quinone reductase.

    PubMed

    Kolaj-Robin, Olga; Noor, Mohamed R; O'Kane, Sarah R; Baymann, Frauke; Soulimane, Tewfik

    2013-01-01

    The Thermus thermophilus succinate:quinone reductase (SQR), serving as the respiratory complex II, has been homologously produced under the control of a constitutive promoter and subsequently purified. The detailed biochemical characterization of the resulting wild type (wt-rcII) and His-tagged (rcII-His(8)-SdhB and rcII-SdhB-His(6)) complex II variants showed the same properties as the native enzyme with respect to the subunit composition, redox cofactor content and sensitivity to the inhibitors malonate, oxaloacetate, 3-nitropropionic acid and nonyl-4-hydroxyquinoline-N-oxide (NQNO). The position of the His-tag determined whether the enzyme retained its native trimeric conformation or whether it was present in a monomeric form. Only the trimer exhibited positive cooperativity at high temperatures. The EPR signal of the [2Fe-2S] cluster was sensitive to the presence of substrate and showed an increased rhombicity in the presence of succinate in the native and in all recombinant forms of the enzyme. The detailed analysis of the shape of this signal as a function of pH, substrate concentration and in the presence of various inhibitors and quinones is presented, leading to a model for the molecular mechanism that underlies the influence of succinate on the rhombicity of the EPR signal of the proximal iron-sulfur cluster.

  19. Phosphorylation and proteolysis of HMGCoA reductase

    SciTech Connect

    Parker, R.A.; Lanier, T.L.; Miller, S.J.; Gibson, D.M.

    1987-05-01

    The phosphorylation of rat liver microsomal 97 kDa HMGCoA reductase (HMGR) was examined by immunoprecipitation and SDS-PAGE using antibodies to 53 kDa HMGR. MgATP preincubation decreased expressed HMGR activity from 10.1 +/- 2.4 to 0.81 +/- 0.2 U/mg. Concomitant incorporation of TSP from el-TSP-ATP into 97 kDa HMGR protein was observed. Competitive antibody binding by affinity-purified 53 kDa HMGR showed that the 97 kDa TSP band was authentic HMGR. HMGR was reactivated and the TSP label was removed by protein phosphatase in a concentration-dependent manner: the increase in expressed/total activity ratio (E/T) correlated linearly with a decrease in 97 kDa TSP. Therefore, the E/T ratio provides a valid index of the phosphorylation state of microsomal 97 kDa HMGR. Protease cleavage patterns of HMGR mass and TSP were compared using calpain: a 52-56 kDa doublet of HMGR mass was observed in immunoblots under conditions in which only the 56 kDa band contained TSP. Further proteolysis decreased the TSP label as the 52 kDa mass product increased. The data suggest that the major phosphorylation site in 97 kDa HMGR lies between two main calpain cleavage sites in the linker region joining the cytoplasmic domain to the membrane-spanning domain of the native enzyme.

  20. Molecular Cloning of Complementary DNA Encoding Maize Nitrite Reductase

    PubMed Central

    Lahners, Kristine; Kramer, Vance; Back, Eduard; Privalle, Laura; Rothstein, Steven

    1988-01-01

    Complementary DNA has been isolated that codes for maize nitrite reductase (NiR) by using the corresponding spinach gene (E Back et al. 1988 Mol Gen Genet 212:20-26) as a heterologous probe. The sequences of the complementary DNAs from the two species are 66% homologous while the deduced amino acid sequences are 86% similar when analogous amino acids are included. A high percentage of the differences in the DNA sequences is due to the extremely strong bias in the corn gene to have a G/C base in the third codon position with 559/569 codons ending in a G or C. Using a hydroponic system, maize seedlings grown in the absence of an exogenous nitrogen source were induced with nitrate or nitrite. Nitrate stimulated a rapid induction of the NiR mRNA in both roots and leaves. There is also a considerable induction of this gene in roots upon the addition of nitrite, although under the conditions used the final mRNA level was not as high as when nitrate was the inducer. There is a small but detectable level of NiR mRNA in leaves prior to induction, but no constitutive NiR mRNA can be seen in the roots. Analysis of genomic DNA supports the notion that there are at least two NiR genes in maize. Images Fig. 3 Fig. 4 Fig. 5 PMID:16666376

  1. Drug susceptibility testing of Mycobacterium tuberculosis with nitrate reductase assay.

    PubMed

    Coban, Ahmet Yilmaz; Birinci, Asuman; Ekinci, Bora; Durupinar, Belma

    2004-09-01

    The nitrate reductase assay (NRA) was evaluated for susceptibility testing of Mycobacterium tuberculosis using 80 clinical isolates of M. tuberculosis and H37Rv as a control strain. All isolates were tested by the proportion method and the NRA for isoniazid (INH), rifampicin (RIF), streptomycin (STR) and ethambutol (ETM). The proportion method was carried out according to NCCLS on Löwenstein-Jensen (LJ) medium and the NRA on LJ medium containing 1000 microg/ml potassium nitrate (KNO(3)). After incubation for 7, 10, 14 and 21 days, Griess reagent was added to each LJ medium and nitrate reduction was determined by a colour change. Comparing the NRA with the proportion method, sensitivities were 100, 100, 82.1 and 92.2% for INH, RIF, STR and ETM, respectively. Specificities were 100, 100, 92.3 and 100% for INH, RIF, STR and ETM, respectively. The results of 2, 22 and 56 isolates were obtained after 7, 10 and 14 days, respectively. The proportion method result were read at 21-28 days. The NRA is rapid, inexpensive and easy to perform. Our results indicated that the NRA is suitable for the early determination of INH and RIF resistance in countries where sophisticated procedures are not always available.

  2. Cloning of a nitrate reductase inactivator (NRI) cDNA from Spinacia oleracea L. and expression of mRNA and protein of NRI in cultured spinach cells.

    PubMed

    Sonoda, Masatoshi; Ide, Hiroaki; Nakayama, Shinya; Sasaki, Asako; Kitazaki, Shinei; Sato, Takahide; Nakagawa, Hiroki

    2003-04-01

    The spinach ( Spinacia oleracea L. (cv. Hoyo) nitrate reductase inactivator (NRI) is a novel protein that irreversibly inactivates NR. Using degenerate primers based on an N-terminal amino acid sequence of NRI purified from spinach leaves and a cDNA library, we isolated a full-length NRI cDNA from spinach that contains an open reading frame encoding 479 amino acid residues. This protein shares 67.4% and 51.1-68.3% amino acid sequence similarities with a nucleotide pyrophosphatase (EC 3.6.1.9) from rice and three types of the nucleotide pyrophosphatase-like protein from Arabidopsis thaliana, respectively. Immunoblot analysis revealed that NRI was constitutively expressed in suspension-cultured spinach cells; however, its expression level is quite low in 1-day-subcultured cells. Moreover, northern blot analysis indicated that this expression was regulated at the mRNA level. These results suggest that NRI functions in mature cells.

  3. Novel terminal strips for transformers

    NASA Technical Reports Server (NTRS)

    Wiler, E. M.

    1969-01-01

    Spacing tinned terminal leads between two tapes of woven glass fiber that are sandwich-bonded with pliable epoxy adhesive alleviates problems of taped leads pulling away from the transformer and shorting due to crossover of wires. Individual leads may or may not be enclosed in glass-fiber sleeves.

  4. Balanced Branching in Transcription Termination

    NASA Technical Reports Server (NTRS)

    Harrington, K. J.; Laughlin, R. B.; Liang, S.

    2000-01-01

    The theory of stochastic transcription termination based on free-energy competition [von Hippel, P. H. & Yager, T. D. (1992) Science 255,809-812 and van Hippel, P. H. & Yager, T. D. (1991) Proc. Natl. Acad. Sci. USA 88, 2307-2311] requires two or more reaction rates to be delicately balanced over a wide range of physical conditions. A large body of work on glasses and large molecules suggests that this balancing should be impossible in such a large system in the absence of a new organizing principle of matter. We review the experimental literature of termination and find no evidence for such a principle, but do find many troubling Inconsistencies, most notably, anomalous memory effects. These effects suggest that termination has a deterministic component and may conceivably not be stochastic at all. We find that a key experiment by Wilson and von Hippel [Wilson, K. S. & von Hippel, P. H. (1994) J. Mol. Biol. 244,36-51] thought to demonstrate stochastic termination was an incorrectly analyzed regulatory effect of Mg(2+) binding.

  5. Do Twelfths Terminate or Repeat?

    ERIC Educational Resources Information Center

    Ambrose, Rebecca; Burnison, Erica

    2015-01-01

    When finding the decimal equivalent of a fraction with 12 in the denominator, will it terminate or repeat? This question came from a seventh grader in author Erica Burnison's class as the student was pondering a poster generated by one of her classmates. Not only was the question intriguing, but it also affirmed the belief in the power of…

  6. Teaching the Terminally Ill Child.

    ERIC Educational Resources Information Center

    Ainsa, Trisha

    1981-01-01

    Classroom teachers of terminally ill children face potentially difficult, challenging, rewarding and professionally expanding experiences which require an understanding of the basic needs of the dying. Strategies for teaching such children include literature, writing, role playing, magic circle discussions, play therapy, art therapy, counseling,…

  7. Video Display Terminals: Radiation Issues.

    ERIC Educational Resources Information Center

    Murray, William E.

    1985-01-01

    Discusses information gathered in past few years related to health effects of video display terminals (VDTs) with particular emphasis given to issues raised by VDT users. Topics covered include radiation emissions, health concerns, radiation surveys, occupational radiation exposure standards, and long-term risks. (17 references) (EJS)

  8. Resistance of herpes simplex virus type 1 to peptidomimetic ribonucleotide reductase inhibitors: selection and characterization of mutant isolates.

    PubMed Central

    Bonneau, A M; Kibler, P; White, P; Bousquet, C; Dansereau, N; Cordingley, M G

    1996-01-01

    Herpes simplex virus (HSV) encodes its own ribonucleotide reductase (RR), which provides the high levels of deoxynucleoside triphosphates required for viral DNA replication in infected cells. HSV RR is composed of two distinct subunits, R1 and R2, whose association is required for enzymatic activity. Peptidomimetic inhibitors that mimic the C-terminal amino acids of R2 inhibit HSV RR by preventing the association of R1 and R2. These compounds are candidate antiviral therapeutic agents. Here we describe the in vitro selection of HSV type 1 KOS variants with three- to ninefold-decreased sensitivity to the RR inhibitor BILD 733. The resistant isolates have growth properties in vitro similar to those of wild-type KOS but are more sensitive to acyclovir, possibly as a consequence of functional impairment of their RRs. A single amino acid substitution in R1 (Ala-1091 to Ser) was associated with threefold resistance to BILD 733, whereas an additional substitution (Pro-1090 to Leu) was required for higher levels of resistance. These mutations were reintroduced into HSV type 1 KOS and shown to be sufficient to confer the resistance phenotype. Studies in vitro with RRs isolated from cells infected with these mutant viruses demonstrated that these RRs bind BILD 733 more weakly than the wild-type enzyme and are also functionally impaired, exhibiting an elevated dissociation constant (Kd) for R1-R2 subunit association and/or reduced activity (kcat). This work provides evidence that the C-terminal end of HSV R1 (residues 1090 and 1091) is involved in R2 binding interactions and demonstrates that resistance to subunit association inhibitors may be associated with compromised activity of the target enzyme. PMID:8551616

  9. Cloning, Functional Expression, and Subcellular Localization of Multiple NADPH-Cytochrome P450 Reductases from Hybrid Poplar1

    PubMed Central

    Ro, Dae-Kyun; Ehlting, Jürgen; Douglas, Carl J.

    2002-01-01

    NADPH:cytochrome P450 reductase (CPR) provides reducing equivalents to diverse cytochrome P450 monooxygenases. We isolated cDNAs for three CPR genes (CPR1, CPR2, and CPR3) from hybrid poplar (Populus trichocarpa × Populus deltoides). Deduced CPR2 and CPR3 amino acid sequences were 91% identical, but encoded isoforms divergent from CPR1 (72% identity). CPR1 and CPR2 were co-expressed together with the P450 enzyme cinnamate-4-hydroxylase (C4H) in yeast (Saccharomyces cerevisiae). Microsomes isolated from strains expressing CPR1/C4H or CPR2/C4H enhanced C4H activities approximately 10-fold relative to the C4H-only control strain, and catalyzed NADPH-dependent cytochrome c reduction. The divergent CPR isoforms (CPR1 and CPR2/3) contained entirely different N-terminal sequences, which are conserved in other plant CPRs and are diagnostic for two distinct classes of CPRs within the angiosperms. C-terminal green fluorescent protein fusions to CPR1 and CPR2 were constructed and expressed in both yeast and Arabidopsis. The fusion proteins expressed in yeast retained the ability to support C4H activity and, thus, were catalytically active. Both CPR::green fluorescent protein fusion proteins were strictly localized to the endoplasmic reticulum in transgenic Arabidopsis. The lack of localization of either isoform to chloroplasts, where P450s are known to be present, suggests that an alternative P450 reduction system may be operative in this organelle. Transcripts for the three poplar CPR genes were present ubiquitously in all tissues examined, but CPR2 showed highest expression in young leaf tissue. PMID:12481067

  10. Mapping and characterization of mutations induced by benzo[a]pyrene diol epoxide at dihydrofolate reductase locus in CHO cells.

    PubMed

    Carothers, A M; Urlaub, G; Grunberger, D; Chasin, L A

    1988-03-01

    Chinese hamster ovary cells were mutagenized with benzo[a]pyrene diol epoxide (BPDE), an aromatic hydrocarbon carcinogen, and mutants at the dihydrofolate reductase (dhfr) locus were isolated. Of 15 mutants analyzed by Southern blotting, one contained a large deletion that spanned all six exons of the 25-kb dhfr gene; the remaining mutants exhibited no detectable changes. Three of these putative point mutations were localized by the loss of a restriction site: a SacI site in exon III, an MspI site in exon III, and a KpnI site in exon VI. The affected regions in two of these mutants were cloned and sequenced. The SacI- mutant was caused by a G:C----T:A transversion resulting in an amber termination codon. In the MspI- mutant, the deletion of a single C:G resulted in a frameshift and a downstream ochre termination codon. On the basis of overlapping restriction site sequences, the KpnI- mutant was deduced to be a splicing mutant involving the most 3' G in intron V. The location of these and the remaining 11 putative point mutations was sought using RNA heteroduplex mapping. Mismatched bases between riboprobes complementary to wild-type dhfr mRNA and mutant mRNA molecules were detected in 10 of the 14 mutants analyzed. These mutations mapped to four of the six exons or exon splice sites. Surprisingly, over half of these mutants exhibited greatly reduced (approximately 10-fold) steady-state levels of dhfr mRNA.

  11. Purification, Characterization, and Genetic Analysis of Cu-Containing Dissimilatory Nitrite Reductase from a Denitrifying Halophilic Archaeon, Haloarcula marismortui

    PubMed Central

    Ichiki, Hirotaka; Tanaka, Yoko; Mochizuki, Kiyotaka; Yoshimatsu, Katsuhiko; Sakurai, Takeshi; Fujiwara, Taketomo

    2001-01-01

    Cu-containing dissimilatory nitrite reductase (CuNiR) was purified from denitrifying cells of a halophilic archaeon, Haloarcula marismortui. The purified CuNiR appeared blue in the oxidized state, possessing absorption peaks at 600 and 465 nm in the visible region. Electron paramagnetic resonance spectroscopy suggested the presence of type 1 Cu (gII = 2.232; AII = 4.4 mT) and type 2 Cu centers (gII = 2.304; AII = 13.3 mT) in the enzyme. The enzyme contained two subunits, whose apparent molecular masses were 46 and 42 kDa, according to sodium dodecyl sulfate-polyacrylamide gel electrophoresis. N-terminal amino acid sequence analysis indicated that the two subunits were identical, except that the 46-kDa subunit was 16 amino acid residues longer than the 42-kDa subunit in the N-terminal region. A nirK gene encoding the CuNiR was cloned and sequenced, and the deduced amino acid sequence with a residual length of 361 amino acids was homologous (30 to 41%) with bacterial counterparts. Cu-liganding residues His-133, Cys-174, His-182, and Met-187 (for type 1 Cu) and His-138, His-173, and His-332 (for type 2 Cu) were conserved in the enzyme. As generally observed in the halobacterial enzymes, the enzymatic activity of the purified CuNiR was enhanced during increasing salt concentration and reached its maximum in the presence of 2 M NaCl with the value of 960 μM NO2− · min−1 · mg−1. PMID:11418554

  12. Community analysis of a mercury hot spring supports occurrence of domain-specific forms of mercuric reductase.

    PubMed

    Simbahan, Jessica; Kurth, Elizabeth; Schelert, James; Dillman, Amanda; Moriyama, Etsuko; Jovanovich, Stevan; Blum, Paul

    2005-12-01

    Mercury is a redox-active heavy metal that reacts with active thiols and depletes cellular antioxidants. Active resistance to the mercuric ion is a widely distributed trait among bacteria and results from the action of mercuric reductase (MerA). Protein phylogenetic analysis of MerA in bacteria indicated the occurrence of a second distinctive form of MerA among the archaea, which lacked an N-terminal metal recruitment domain and a C-terminal active tyrosine. To assess the distribution of the forms of MerA in an interacting community comprising members of both prokaryotic domains, studies were conducted at a naturally occurring mercury-rich geothermal environment. Geochemical analyses of Coso Hot Springs indicated that mercury ore (cinnabar) was present at concentrations of parts per thousand. Under high-temperature and acid conditions, cinnabar may be oxidized to the toxic form Hg2+, necessitating mercury resistance in resident prokaryotes. Culture-independent analysis combined with culture-based methods indicated the presence of thermophilic crenarchaeal and gram-positive bacterial taxa. Fluorescence in situ hybridization analysis provided quantitative data for community composition. DNA sequence analysis of archaeal and bacterial merA sequences derived from cultured pool isolates and from community DNA supported the hypothesis that both forms of MerA were present. Competition experiments were performed to assess the role of archaeal merA in biological fitness. An essential role for this protein was evident during growth in a mercury-contaminated environment. Despite environmental selection for mercury resistance and the proximity of community members, MerA retains the two distinct prokaryotic forms and avoids genetic homogenization.

  13. Defective Pollen Wall is Required for Anther and Microspore Development in Rice and Encodes a Fatty Acyl Carrier Protein Reductase

    SciTech Connect

    Shi, J.; Shanklin, J.; Tan, H.; Yu, X.-H.; Liu, Y.; Liang, W.; Ranathunge, K.; Franke, R. B.; Schreiber, L.; Wang, Y.; Kai, G.; Ma, H.; Zhang, D.

    2011-06-01

    Aliphatic alcohols naturally exist in many organisms as important cellular components; however, their roles in extracellular polymer biosynthesis are poorly defined. We report here the isolation and characterization of a rice (Oryza sativa) male-sterile mutant, defective pollen wall (dpw), which displays defective anther development and degenerated pollen grains with an irregular exine. Chemical analysis revealed that dpw anthers had a dramatic reduction in cutin monomers and an altered composition of cuticular wax, as well as soluble fatty acids and alcohols. Using map-based cloning, we identified the DPW gene, which is expressed in both tapetal cells and microspores during anther development. Biochemical analysis of the recombinant DPW enzyme shows that it is a novel fatty acid reductase that produces 1-hexadecanol and exhibits >270-fold higher specificity for palmiltoyl-acyl carrier protein than for C16:0 CoA substrates. DPW was predominantly targeted to plastids mediated by its N-terminal transit peptide. Moreover, we demonstrate that the monocot DPW from rice complements the dicot Arabidopsis thaliana male sterile2 (ms2) mutant and is the probable ortholog of MS2. These data suggest that DPWs participate in a conserved step in primary fatty alcohol synthesis for anther cuticle and pollen sporopollenin biosynthesis in monocots and dicots.

  14. Defective pollen wall is required for anther and microspore development in rice and encodes a fatty acyl carrier protein reductase.

    PubMed

    Shi, Jing; Tan, Hexin; Yu, Xiao-Hong; Liu, Yuanyun; Liang, Wanqi; Ranathunge, Kosala; Franke, Rochus Benni; Schreiber, Lukas; Wang, Yujiong; Kai, Guoying; Shanklin, John; Ma, Hong; Zhang, Dabing

    2011-06-01

    Aliphatic alcohols naturally exist in many organisms as important cellular components; however, their roles in extracellular polymer biosynthesis are poorly defined. We report here the isolation and characterization of a rice (Oryza sativa) male-sterile mutant, defective pollen wall (dpw), which displays defective anther development and degenerated pollen grains with an irregular exine. Chemical analysis revealed that dpw anthers had a dramatic reduction in cutin monomers and an altered composition of cuticular wax, as well as soluble fatty acids and alcohols. Using map-based cloning, we identified the DPW gene, which is expressed in both tapetal cells and microspores during anther development. Biochemical analysis of the recombinant DPW enzyme shows that it is a novel fatty acid reductase that produces 1-hexadecanol and exhibits >270-fold higher specificity for palmiltoyl-acyl carrier protein than for C16:0 CoA substrates. DPW was predominantly targeted to plastids mediated by its N-terminal transit peptide. Moreover, we demonstrate that the monocot DPW from rice complements the dicot Arabidopsis thaliana male sterile2 (ms2) mutant and is the probable ortholog of MS2. These data suggest that DPWs participate in a conserved step in primary fatty alcohol synthesis for anther cuticle and pollen sporopollenin biosynthesis in monocots and dicots.

  15. Expression of a deregulated tobacco nitrate reductase gene in potato increases biomass production and decreases nitrate concentration in all organs.

    PubMed

    Djennane, Samia; Quilleré, Isabelle; Leydecker, Marie-Thérèse; Meyer, Christian; Chauvin, Jean-Eric

    2004-09-01

    We investigated the physiological consequences for nitrogen metabolism and growth of the deregulated expression of an N-terminal-deleted tobacco nitrate reductase in two lines of potato (Solanum tuberosum L. cv Safrane). The transgenic plants showed a higher biomass accumulation, especially in tubers, but a constant nitrogen content per plant. This implies that the transformed lines had a reduced nitrogen concentration per unit of dry weight. A severe reduction in nitrate concentrations was also observed in all organs, but was more apparent in tubers where nitrate was almost undetectable in the transgenic lines. In leaves and roots, but not tubers, this nitrate decrease was accompanied by a statistically significant increase in the level of malate, which acts as a counter-anion for nitrate reduction. Apart from glutamine in tubers, no major changes in amino acid concentration were seen in leaves, roots or tubers. We conclude that enhancement of nitrate reduction rate leads to higher biomass production, probably by allowing a better allocation of N-resources to photosynthesis and C-metabolism.

  16. Characterization of developmental- and stress-mediated expression of cinnamoyl-CoA reductase in kenaf (Hibiscus cannabinus L.).

    PubMed

    Ghosh, Ritesh; Choi, Bosung; Cho, Byoung-Kwan; Lim, Hyoun-Sub; Park, Sang-Un; Bae, Hyeun-Jong; Natarajan, Savithiry; Bae, Hanhong

    2014-01-01

    Cinnamoyl-CoA reductase (CCR) is an important enzyme for lignin biosynthesis as it catalyzes the first specific committed step in monolignol biosynthesis. We have cloned a full length coding sequence of CCR from kenaf (Hibiscus cannabinus L.), which contains a 1,020-bp open reading frame (ORF), encoding 339 amino acids of 37.37 kDa, with an isoelectric point (pI) of 6.27 (JX524276, HcCCR2). BLAST result found that it has high homology with other plant CCR orthologs. Multiple alignment with other plant CCR sequences showed that it contains two highly conserved motifs: NAD(P) binding domain (VTGAGGFIASWMVKLLLEKGY) at N-terminal and probable catalytic domain (NWYCYGK). According to phylogenetic analysis, it was closely related to CCR sequences of Gossypium hirsutum (ACQ59094) and Populus trichocarpa (CAC07424). HcCCR2 showed ubiquitous expression in various kenaf tissues and the highest expression was detected in mature flower. HcCCR2 was expressed differentially in response to various stresses, and the highest expression was observed by drought and NaCl treatments.

  17. Induction of Thioredoxin Reductase 1 by Korean Red Ginseng Water Extract Regulates Cytoprotective Effects on Human Endothelial Cells

    PubMed Central

    Park, Hye Rim; Lee, Seung Eun; Yang, Hana; Son, Gun Woo; Jin, Young-Ho; Park, Yong Seek

    2015-01-01

    Korean Red Ginseng is a popular herbal medicine and is widely used in many food products. KRG has biological benefits related to vascular diseases including diabetes, hypertension, atherosclerosis, and other cardiac diseases and KRG has antioxidant and anti-hyperlipidemic actions. KRG decreases the level of oxidative stress and suppresses proinflammatory cytokines and cell adhesion molecules, thus protecting endothelial dysfunction. Mammalian Thioredoxin reductase 1 is an NADPH-dependent selenoprotein, essential for antioxidant defense and DNA synthesis and repair, that regulates the redox system by modulating redox-sensitive transcription factors and thiol-containing proteins. Here, we show that KRG water extract increases the expression of TrxR1 in human umbilical vein endothelial cells via the p38 and PKC-δ signaling pathways. The induction of TrxR1 expression by KRG was confirmed by Western blot analysis and reverse transcription polymerase chain reaction. However, the increase in TrxR1 expression was abolished by specific silencing of the p38 and PKC-δ genes. In addition, we demonstrated that auranofin, a TrxR1 inhibitor, weakens the protective effect of KRG against H2O2-induced cell death as measured by the terminal transferase dUTP nick end labeling assay. These results suggest that KRG may have protective effects in vascular diseases by upregulating TrxR1 in endothelial cells, thereby inhibiting the generation of reactive oxygen species and cell death. PMID:26236385

  18. Evolution of plant δ1-pyrroline-5-carboxylate reductases from phylogenetic and structural perspectives

    SciTech Connect

    Forlani, Giuseppe; Makarova, Kira S.; Ruszkowski, Milosz; Bertazzini, Michele; Nocek, Boguslaw

    2015-08-03

    Proline plays a crucial role in cell growth and stress responses, and its accumulation is essential for the tolerance of adverse environmental conditions in plants. Two routes are used to biosynthesize proline in plants. The main route uses glutamate as a precursor, while in the other route proline is derived from ornithine. The terminal step of both pathways, the conversion of δ1-pyrroline-5-carboxylate (P5C) to L-proline, is catalyzed by P5C reductase (P5CR) using NADH or NADPH as a cofactor. Since P5CRs are important housekeeping enzymes, they are conserved across all domains of life and appear to be relatively unaffected throughout evolution. However, global analysis of these enzymes unveiled significant functional diversity in the preference for cofactors (NADPH vs. NADH), variation in metal dependence and the differences in the oligomeric state. In our study we investigated evolutionary patterns through phylogenetic and structural analysis of P5CR representatives from all kingdoms of life, with emphasis on the plant species. We attempted to correlate local sequence/structure variation among the functionally and structurally characterized members of the family.

  19. Molecular characterization of the sor gene, which encodes the sulfur oxygenase/reductase of the thermoacidophilic Archaeum Desulfurolobus ambivalens.

    PubMed Central

    Kletzin, A

    1992-01-01

    A 5.8-kbp HindIII fragment containing the sor gene which encodes the aerobically induced sulfur oxygenase/reductase of the thermoacidophilic, chemolithoautotrophic, and facultatively anaerobic archaeum Desulfurolobus ambivalens, was cloned in pUC18 by using an oligonucleotide derived from the N-terminal amino acid sequence for identification (pSOR-1/17). The native enzyme is a 550,000-molecular-weight oligomer composed of single 40,000-molecular-weight subunits; this oligomer is capable of the simultaneous oxidation and reduction of sulfur (A. Kletzin, J. Bacteriol. 171:1638-1643, 1989). From the fragment, 3,025 bp that contained the entire sor gene were sequenced. The sor gene encoded a protein with 309 amino acid residues (molecular weight, 35,317). The transcript length was determined by Northern RNA hybridization to be 960 to 1,020 nucleotides, and the transcriptional start site was mapped by primer extension analysis. The transcript of the sor gene in aerobically grown cells was amplified 38- to 42-fold relative to that in anaerobically grown cells. An initial transcriptional characterization of three neighboring genes of unknown function is also reported. Images PMID:1522063

  20. Sequence of a cDNA encoding nitrite reductase from the tree Betula pendula and identification of conserved protein regions.

    PubMed

    Friemann, A; Brinkmann, K; Hachtel, W

    1992-02-01

    The sequence of an mRNA encoding nitrite reductase (NiR, EC 1.7.7.1.) from the tree Betula pendula was determined. A cDNA library constructed from leaf poly(A)+ mRNA was screened with an oligonucleotide probe deduced from NiR sequences from spinach and maize. A 2.5 kb cDNA was isolated that hybridized to an mRNA, the steady-state level of which increased markedly upon induction with nitrate. The nucleotide sequence of the cDNA contains a reading frame encoding a protein of 583 amino acids that reveals 79% identity with NiR from spinach. The transit peptide of the NiR precursor from birch was determined to be 22 amino acids in size by sequence comparison with NiR from spinach and maize and is the shortest transit peptide reported so far. A graphical evaluation of identities found in the NiR sequence alignment revealed nine well conserved sections each exceeding ten amino acids in size. Sequence comparisons with related redox proteins identified essential residues involved in cofactor binding. A putative binding site for ferredoxin was found in the N-terminal half of the protein.

  1. Characterization of Developmental- and Stress-Mediated Expression of Cinnamoyl-CoA Reductase in Kenaf (Hibiscus cannabinus L.)

    PubMed Central

    Lim, Hyoun-Sub; Park, Sang-Un; Bae, Hyeun-Jong; Natarajan, Savithiry

    2014-01-01

    Cinnamoyl-CoA reductase (CCR) is an important enzyme for lignin biosynthesis as it catalyzes the first specific committed step in monolignol biosynthesis. We have cloned a full length coding sequence of CCR from kenaf (Hibiscus cannabinus L.), which contains a 1,020-bp open reading frame (ORF), encoding 339 amino acids of 37.37 kDa, with an isoelectric point (pI) of 6.27 (JX524276, HcCCR2). BLAST result found that it has high homology with other plant CCR orthologs. Multiple alignment with other plant CCR sequences showed that it contains two highly conserved motifs: NAD(P) binding domain (VTGAGGFIASWMVKLLLEKGY) at N-terminal and probable catalytic domain (NWYCYGK). According to phylogenetic analysis, it was closely related to CCR sequences of Gossypium hirsutum (ACQ59094) and Populus trichocarpa (CAC07424). HcCCR2 showed ubiquitous expression in various kenaf tissues and the highest expression was detected in mature flower. HcCCR2 was expressed differentially in response to various stresses, and the highest expression was observed by drought and NaCl treatments. PMID:24723816

  2. Recombinant bovine dihydrofolate reductase produced by mutagenesis and nested PCR of murine dihydrofolate reductase cDNA.

    PubMed

    Cody, Vivian; Mao, Qilong; Queener, Sherry F

    2008-11-01

    Recent reports of the slow-tight binding inhibition of bovine liver dihydrofolate reductase (bDHFR) in the presence of polyphenols isolated from green tea leaves has spurred renewed interest in the biochemical properties of bDHFR. Earlier studies were done with native bDHFR but in order to validate models of polyphenol binding to bDHFR, larger quantities of bDHFR are necessary to support structural studies. Bovine DHFR differs from its closest sequence homologue, murine DHFR, by 19 amino acids. To obtain the bDHFR cDNA, murineDHFR cDNA was transformed by a series of nested PCRs to reproduce the amino acid coding sequence for bovine DHFR. The bovine liver DHFR cDNA has an open reading frame of 561 base pairs encoding a protein of 187 amino acids that has a high level of conservation at the primary sequence level with other DHFR enzymes, and more so for the amino acid residues in the active site of the mammalian DHFR enzymes. Expression of the bovine DHFR cDNA in bacterial cells produced a stable recombinant protein with high enzymatic activity and kinetic properties similar to those previously reported for the native protein.

  3. Seven novel mutations in the methylenetetrahydrofolate reductase gene and genotype/phenotype correlations in severe methylenetetrahydrofolate reductase deficiency

    SciTech Connect

    Goyette, P.; Frosst, P.; Rosenblatt, D.S.; Rozen. R.

    1995-05-01

    5-Methyltetrahydrofolate, the major form of folate in plasma, is a carbon donor for the remethylation of homocysteine to methionine. This form of folate is generated from 5,10-methylenetetrahydrofolate through the action of 5,10-methylenetetrahydrofolate reductase (MTHFR), a cytosolic flavoprotein. Patients with an autosomal recessive severe deficiency of MTHFR have homocystinuria and a wide range of neurological and vascular disturbances. We have recently described the isolation of a cDNA for MTHFR and the identification of two mutations in patients with severe MTHFR deficiency. We report here the characterization of seven novel mutations in this gene: six missense mutations and a 5{prime} splice-site defect that activates a cryptic splice in the coding sequence. We also present a preliminary analysis of the relationship between genotype and phenotype for all nine mutations identified thus far in this gene. A nonsense mutation and two missense mutations (proline to leucine and threonine to methionine) in the homozygous state are associated with extremely low activity (0%-3%) and onset of symptoms within the 1st year of age. Other missense mutations (arginine to cysteine and arginine to glutamine) are associated with higher enzyme activity and later onset of symptoms. 19 refs., 4 figs., 2 tabs.

  4. Molecular basis for thermoprotection in Bemisia: structural differences between whitefly ketose reductase and other medium-chain dehydrogenases/reductases.

    PubMed

    Wolfe, G R; Smith, C A; Hendrix, D L; Salvucci, M E

    1999-02-01

    The silverleaf whitefly (Bemisia argentifolii, Bellows and Perring) accumulates sorbitol as a thermoprotectant in response to elevated temperature. Sorbitol synthesis in this insect is catalyzed by an unconventional ketose reductase (KR) that uses NADPH to reduce fructose. A cDNA encoding the NADPH-KR from adult B. argentifolii was cloned and sequenced to determine the primary structure of this enzyme. The cDNA encoded a protein of 352 amino acids with a calculated molecular mass of 38.2 kDa. The deduced amino acid sequence of the cDNA shared 60% identity with sheep NAD(+)-dependent sorbitol dehydrogenase (SDH). Residues in SDH involved in substrate binding were conserved in the whitefly NADPH-KR. An important structural difference between the whitefly NADPH-KR and NAD(+)-SDHs occurred in the nucleotide-binding site. The Asp residue that coordinates the adenosyl ribose hydroxyls in NAD(+)-dependent dehydrogenases (including NAD(+)-SDH), was replaced by an Ala in the whitefly NADPH-KR. The whitefly NADPH-KR also contained two neutral to Arg substitutions within four residues of the Asp to Ala substitution. Molecular modeling indicated that addition of the Arg residues and loss of the Asp decreased the electric potential of the adenosine ribose-binding pocket, creating an environment favorable for NADPH-binding. Because of the ability to use NADPH, the whitefly NADPH-KR synthesizes sorbitol under physiological conditions, unlike NAD(+)-SDHs, which function in sorbitol catabolism.

  5. Aerobic Degradation of 2,4,6-Trinitrotoluene by Enterobacter cloacae PB2 and by Pentaerythritol Tetranitrate Reductase

    PubMed Central

    French, Christopher E.; Nicklin, Stephen; Bruce, Neil C.

    1998-01-01

    Enterobacter cloacae PB2 was originally isolated on the basis of its ability to utilize nitrate esters, such as pentaerythritol tetranitrate (PETN) and glycerol trinitrate, as the sole nitrogen source for growth. The enzyme responsible is an NADPH-dependent reductase designated PETN reductase. E. cloacae PB2 was found to be capable of slow aerobic growth with 2,4,6-trinitrotoluene (TNT) as the sole nitrogen source. Dinitrotoluenes were not produced and could not be used as nitrogen sources. Purified PETN reductase was found to reduce TNT to its hydride-Meisenheimer complex, which was further reduced to the dihydride-Meisenheimer complex. Purified PETN reductase and recombinant Escherichia coli expressing PETN reductase were able to liberate nitrogen as nitrite from TNT. The ability to remove nitrogen from TNT suggests that PB2 or recombinant organisms expressing PETN reductase may be useful for bioremediation of TNT-contaminated soil and water. PMID:9687442

  6. Aerobic degradation of 2,4,6-trinitrotoluene by Enterobacter cloacae PB2 and by pentaerythritol tetranitrate reductase

    SciTech Connect

    French, C.E.; Bruce, N.C.; Nicklin, S.

    1998-08-01

    Enterobacter cloacae PB2 was originally isolated on the basis of its ability to utilize nitrate esters, such as pentaerythritol tetranitrate (PETN) and glycerol trinitrate, as the sole nitrogen source for growth. The enzyme responsible is an NADPH-dependent reductase designated PETN reductase. E. cloacae PB2 was found to be capable of slow aerobic growth with 2,4,6-trinitrotoluene (TNT) as the sole nitrogen source. Dinitrotoluenes were not produced and could not be used as nitrogen sources. Purified PETN reductase was found to reduce TNT to its hydride-Meisenheimer complex, which was further reduced to the dihydride-Meisenheimer complex. Purified PETN reductase and recombinant Escherichia coli expressing PETN reductase were able to liberate nitrogen as nitrite from TNT. The ability to remove nitrogen from TNT suggests that PB2 or recombinant organisms expressing PETN reductase may be useful for bioremediation of TNT-contaminated soil and water.

  7. Genetic Diversity of Benzoyl Coenzyme A Reductase Genes Detected in Denitrifying Isolates and Estuarine Sediment Communities

    PubMed Central

    Song, Bongkeun; Ward, Bess B.

    2005-01-01

    Benzoyl coenzyme A (benzoyl-CoA) reductase is a central enzyme in the anaerobic degradation of organic carbon, which utilizes a common intermediate (benzoyl-CoA) in the metabolism of many aromatic compounds. The diversity of benzoyl-CoA reductase genes in denitrifying bacterial isolates capable of degrading aromatic compounds and in river and estuarine sediment samples from the Arthur Kill in New Jersey and the Chesapeake Bay in Maryland was investigated. Degenerate primers were developed from the known benzoyl-CoA reductase genes from Thauera aromatica, Rhodopseudomonas palustris, and Azoarcus evansii. PCR amplification detected benzoyl-CoA reductase genes in the denitrifying isolates belonging to α-, β-, or γ-Proteobacteria as well as in the sediment samples. Phylogenetic analysis, sequence similarity comparison, and conserved indel determination grouped the new sequences into either the bcr type (found in T. aromatica and R. palustris) or the bzd type (found in A. evansii). All the Thauera strains and the isolates from the genera Acidovorax, Bradyrhizobium, Paracoccus, Ensifer, and Pseudomonas had bcr-type benzoyl-CoA reductases with amino acid sequence similarities of more than 97%. The genes detected from Azarocus strains were assigned to the bzd type. A total of 50 environmental clones were detected from denitrifying consortium and sediment samples, and 28 clones were assigned to either the bcr or the bzd type of benzoyl-CoA reductase genes. Thus, we could determine the genetic capabilities for anaerobic degradation of aromatic compounds in sediment communities of the Chesapeake Bay and the Arthur Kill on the basis of the detection of two types of benzoyl-CoA reductase genes. The detected genes have future applications as genetic markers to monitor aromatic compound degradation in natural and engineered ecosystems. PMID:15812036

  8. The Effects of Hexavalent Chromium on Thioredoxin Reductase and Peroxiredoxins in Human Bronchial Epithelial Cells

    PubMed Central

    Myers, Judith M.; Myers, Charles R.

    2009-01-01

    Inhalational exposure to hexavalent chromium [Cr(VI)] compounds (e.g. chromates) is of concern in many Cr-related industries and their surrounding environments. The bronchial epithelium is directly exposed to inhaled Cr(VI). Cr(VI) species gain easy access inside cells where they are reduced to reactive Cr species which may also contribute to the generation of reactive oxygen species (ROS). The thioredoxin (Trx) system promotes cell survival and has a major role in maintaining intracellular thiol redox balance. Previous studies with normal human bronchial epithelial cells (BEAS-2B) demonstrated that chromates cause dose- and time-dependent oxidation of Trx1 and Trx2. The Trxs keep many intracellular proteins reduced including the peroxiredoxins (Prx). Prx1 (cytosolic) and Prx3 (mitochondrial) were oxidized by Cr(VI) treatments that oxidized all, or nearly all, of the respective Trxs. Prx oxidation is therefore likely the result of a lack of reducing equivalents from Trx. Trx reductases (TrxR) maintain the Trxs largely in the reduced state. Cr(VI) caused pronounced inhibition of TrxR, but the levels of TrxR protein remained unchanged. The inhibition of TrxR was not reversed by removal of residual Cr(VI) or by NADPH, the endogenous electron donor for TrxR. In contrast, the oxidation of Trx1, Trx2, and Prx3 were reversible by disulfide reductants. Prolonged inhibition of TrxR in Cr(VI)-treated cells might contribute to the sustained oxidation of Trxs and Prxs. Reduced Trx binds to an N-terminal domain of apoptosis signaling kinase (ASK1), keeping ASK1 inactive. Cr(VI) treatments that significantly oxidized Trx1 resulted in pronounced dissociation of Trx1 from ASK1. Overall, the effects of Cr(VI) on the redox state and function of the Trxs, Prxs, and TrxR in the bronchial epithelium could have important implications for redox-sensitive cell signaling and tolerance to oxidant insults. PMID:19703554

  9. Rapid Identification of Aldose Reductase Inhibitory Compounds from Perilla frutescens

    PubMed Central

    Paek, Ji Hun; Shin, Kuk Hyun; Kang, Young-Hee; Lee, Jae-Yong; Lim, Soon Sung

    2013-01-01

    The ethyl acetate (EtOAc) soluble fraction of methanol extracts of Perilla frutescens (P. frutescens) inhibits aldose reductase (AR), the key enzyme in the polyol pathway. Our investigation of inhibitory compounds from the EtOAc soluble fraction of P. frutescens was followed by identification of the inhibitory compounds by a combination of HPLC microfractionation and a 96-well enzyme assay. This allowed the biological activities to be efficiently matched with selected HPLC peaks. Structural analyses of the active compounds were performed by LC-MSn. The main AR inhibiting compounds were tentatively identified as chlorogenic acid and rosmarinic acid by LC-MSn. A two-step high speed counter current chromatography (HSCCC) isolation method was developed with a solvent system of n-hexane-ethyl acetate-methanol-water at 1.5 : 5 : 1 : 5, v/v and 3 : 7 : 5 : 5, v/v. The chemical structures of the isolated compounds were determined by 1H- and 13C-nuclear magnetic resonance spectrometry (NMR). The main compounds inhibiting AR in the EtOAc fraction of methanol extracts of P. frutescens were identified as chlorogenic acid (2) (IC50 = 3.16 μM), rosmarinic acid (4) (IC50 = 2.77 μM), luteolin (5) (IC50 = 6.34 μM), and methyl rosmarinic acid (6) (IC50 = 4.03 μM). PMID:24308003

  10. Increased 5. cap alpha. -reductase activity in idiopathic hirsutism

    SciTech Connect

    Serafini, P.; Lobo, R.A.

    1985-01-01

    In vitro, genital skin 5..cap alpha..-reductase activity (5..cap alpha..-RA) was measured in ten hirsute women with normal androgen levels (idiopathic hirsutism (IH)) and in ten hirsute women with elevated androgen levels (polycystic ovary syndrome (PCO)) in order to determine the influence of secreted androgens on 5..cap alpha..-RA. In vitro 5..cap alpha..-RA was assessed by incubations of skin with /sup 14/C-testosterone (T) for 2 hours, after which steroids were separated and the radioactivity of dihydrotestosterone (DHT) and 5..cap alpha..-androstane 3..cap alpha..-17..beta..-estradiol (3..cap alpha..-diol) in specific eluates were determined. All androgens were normal in IH with the exception of higher levels of 3..cap alpha..-diol glucuronide which were similar to the levels of PCO. The conversion ratio (CR) of T to DHT in IH and PCO were similar, yet significantly greater than the CR of control subjects. The CR of T to 3..cap alpha..-diol in IH and PCO were similar, yet higher than in control subjects. Serum androgens showed no correlation with 5..cap alpha..-RA, while the CR of T to DHT showed a significant positive correlation with the Ferriman and Gallwey score. The increased 5..cap alpha..-RA in IH appears to be independent of serum androgen levels and is, therefore, an inherent abnormality. The term idiopathic is a misnomer, because hirsutism in these patients may be explained on the basis of increased skin 5..cap alpha..-RA.

  11. Metabolism of bupropion by carbonyl reductases in liver and intestine.

    PubMed

    Connarn, Jamie N; Zhang, Xinyuan; Babiskin, Andrew; Sun, Duxin

    2015-07-01

    Bupropion's metabolism and the formation of hydroxybupropion in the liver by cytochrome P450 2B6 (CYP2B6) has been extensively studied; however, the metabolism and formation of erythro/threohydrobupropion in the liver and intestine by carbonyl reductases (CR) has not been well characterized. The purpose of this investigation was to compare the relative contribution of the two metabolism pathways of bupropion (by CYP2B6 and CR) in the subcellular fractions of liver and intestine and to identify the CRs responsible for erythro/threohydrobupropion formation in the liver and the intestine. The results showed that the liver microsome generated the highest amount of hydroxybupropion (Vmax = 131 pmol/min per milligram, Km = 87 μM). In addition, liver microsome and S9 fractions formed similar levels of threohydrobupropion by CR (Vmax = 98-99 pmol/min per milligram and Km = 186-265 μM). Interestingly, the liver has similar capability to form hydroxybupropion (by CYP2B6) and threohydrobupropion (by CR). In contrast, none of the intestinal fractions generate hydroxybupropion, suggesting that the intestine does not have CYP2B6 available for metabolism of bupropion. However, intestinal S9 fraction formed threohydrobupropion to the extent of 25% of the amount of threohydrobupropion formed by liver S9 fraction. Enzyme inhibition and Western blots identified that 11β-dehydrogenase isozyme 1 in the liver microsome fraction is mainly responsible for the formation of threohydrobupropion, and in the intestine AKR7 may be responsible for the same metabolite formation. These quantitative comparisons of bupropion metabolism by CR in the liver and intestine may provide new insight into its efficacy and side effects with respect to these metabolites.

  12. Human endothelial dihydrofolate reductase low activity limits vascular tetrahydrobiopterin recycling.

    PubMed

    Whitsett, Jennifer; Rangel Filho, Artur; Sethumadhavan, Savitha; Celinska, Joanna; Widlansky, Michael; Vasquez-Vivar, Jeannette

    2013-10-01

    Tetrahydrobiopterin (BH₄) is required for NO synthesis and inhibition of superoxide release from endothelial NO synthase. Clinical trials using BH₄ to treat endothelial dysfunction have produced mixed results. Poor outcomes may be explained by the rapid systemic and cellular oxidation of BH₄. One of the oxidation products of BH₄, 7,8-dihydrobiopterin (7,8-BH₂), is recycled back to BH₄ by dihydrofolate reductase (DHFR). This enzyme is ubiquitously distributed and shows a wide range of activity depending on species-specific factors and cell type. Information about the kinetics and efficiency of BH4 recycling in human endothelial cells receiving BH₄ treatment is lacking. To characterize this reaction, we applied a novel multielectrode coulometric HPLC method that enabled the direct quantification of 7,8-BH₂ and BH₄, which is not possible with fluorescence-based methodologies. We found that basal untreated BH₄ and 7,8-BH₂ concentrations in human endothelial cells (ECs) are lower than in bovine and murine endothelioma cells. Treatment of human ECs with BH₄ transiently increased intracellular BH₄ while accumulating the more stable 7,8-BH₂. This was different from bovine or murine ECs, which resulted in preferential BH₄ increase. Using BH₄ diastereomers, 6S-BH₄ and 6R-BH₄, the narrow contribution of enzymatic DHFR recycling to total intracellular BH₄ was demonstrated. Reduction of 7,8-BH₂ to BH₄ occurs at very slow rates in cells and needs supraphysiological levels of 7,8-BH₂, indicating this reaction is kinetically limited. Activity assays verified that human DHFR has very low affinity for 7,8-BH₂ (DHF7,8-BH₂) and folic acid inhibits 7,8-BH₂ recycling. We conclude that low activity of endothelial DHFR is an important factor limiting the benefits of BH4 therapies, which may be further aggravated by folate supplements.

  13. The Reaction Mechanism of Methyl-Coenzyme M Reductase

    PubMed Central

    Wongnate, Thanyaporn; Ragsdale, Stephen W.

    2015-01-01

    Methyl-coenzyme M reductase (MCR) is a nickel tetrahydrocorphinoid (coenzyme F430) containing enzyme involved in the biological synthesis and anaerobic oxidation of methane. MCR catalyzes the conversion of methyl-2-mercaptoethanesulfonate (methyl-SCoM) and N-7-mercaptoheptanoylthreonine phosphate (CoB7SH) to CH4 and the mixed disulfide CoBS-SCoM. In this study, the reaction of MCR from Methanothermobacter marburgensis, with its native substrates was investigated using static binding, chemical quench, and stopped-flow techniques. Rate constants were measured for each step in this strictly ordered ternary complex catalytic mechanism. Surprisingly, in the absence of the other substrate, MCR can bind either substrate; however, only one binary complex (MCR·methyl-SCoM) is productive whereas the other (MCR·CoB7SH) is inhibitory. Moreover, the kinetic data demonstrate that binding of methyl-SCoM to the inhibitory MCR·CoB7SH complex is highly disfavored (Kd = 56 mm). However, binding of CoB7SH to the productive MCR·methyl-SCoM complex to form the active ternary complex (CoB7SH·MCR(NiI)·CH3SCoM) is highly favored (Kd = 79 μm). Only then can the chemical reaction occur (kobs = 20 s−1 at 25 °C), leading to rapid formation and dissociation of CH4 leaving the binary product complex (MCR(NiII)·CoB7S−·SCoM), which undergoes electron transfer to regenerate Ni(I) and the final product CoBS-SCoM. This first rapid kinetics study of MCR with its natural substrates describes how an enzyme can enforce a strictly ordered ternary complex mechanism and serves as a template for identification of the reaction intermediates. PMID:25691570

  14. The Effect of Protein Mass Modulation on Human Dihydrofolate Reductase

    PubMed Central

    Francis, Kevin; Sapienza, Paul J.; Lee, Andrew L.; Kohen, Amnon

    2016-01-01

    Dihydrofolate reductase (DHFR) from Escherichia coli has long served as a model enzyme with which to elucidate possible links between protein dynamics and the catalyzed reaction. Such physical properties of its human counterpart have not been rigorously studied so far, but recent computer-based simulations suggest that these two DHFRs differ significantly in how closely coupled the protein dynamics and the catalyzed C-H→C hydride transfer step are. To test this prediction, two contemporary probes for studying the effect of protein dynamics on catalysis were combined here: temperature dependence of intrinsic kinetic isotope effects (KIEs) that are sensitive to the physical nature of the chemical step, and protein mass-modulation that slows down fast dynamics (femto- to picosecond timescale) throughout the protein. The intrinsic H/T KIEs of human DHFR, like those of E. coli DHFR, are shown to be temperature-independent in the range from 5–45 °C, indicating fast sampling of donor and acceptor distances (DADs) at the reaction’s transition state (or tunneling ready state – TRS). Mass modulation of these enzymes through isotopic labeling with 13C, 15N, and 2H at nonexchangeable hydrogens yield an 11% heavier enzyme. The additional mass has no effect on the intrinsic KIEs of the human enzyme. This finding indicates that the mass-modulation of the human DHFR affects neither DAD distribution nor the DAD’s conformational sampling dynamics. Furthermore, reduction in the enzymatic turnover number and the dissociation rate constant for the product indicate that the isotopic substitution affects kinetic steps that are not the catalyzed C-H→C hydride transfer. The findings are discussed in terms of fast dynamics and their role in catalysis, the comparison of calculations and experiments, and the interpretation of isotopically-modulated heavy enzymes in general. PMID:26813442

  15. Environmental Adaptation of Dihydrofolate Reductase from Deep-Sea Bacteria.

    PubMed

    Ohmae, Eiji; Gekko, Kunihiko; Kato, Chiaki

    2015-01-01

    In order to elucidate the molecular adaptation mechanisms of enzymes to the high hydrostatic pressure of the deep sea, we cloned, purified, and characterized more than ten dihydrofolate reductases (DHFRs) from bacteria living in deep-sea and ambient atmospheric pressure environments. The nucleotide and amino acid sequences of these DHFRs indicate the deep-sea bacteria are adapted to their environments after the differentiation of their genus from ancestors inhabiting atmospheric pressure environments. In particular, the backbone structure of the deep-sea DHFR from Moritella profunda (mpDHFR) almost overlapped with the normal homolog from Escherichia coli (ecDHFR). Thus, those of other DHFRs would also overlap on the basis of their sequence similarities. However, the structural stability of both DHFRs was quite different: compared to ecDHFR, mpDHFR was more thermally stable but less stable against urea and pressure unfolding. The smaller volume changes due to unfolding suggest that the native structure of mpDHFR has a smaller cavity and/or enhanced hydration compared to ecDHFR. High hydrostatic pressure reduced the enzymatic activity of many DHFRs, but three deep-sea DHFRs and the D27E mutant of ecDHFR exhibited pressure-dependent activation. The inverted activation volumes from positive to negative values indicate the modification of their structural dynamics, conversion of the rate-determining step of the enzymatic reaction, and different contributions of the cavity and hydration to the transition-state structure. Since the cavity and hydration depend on amino acid side chains, DHFRs would adapt to the deep-sea environment by regulating the cavity and hydration by substituting their amino acid side chains without altering their backbone structure. The results of this study clearly indicate that the cavity and hydration play important roles in the adaptation of enzymes to the deep-sea environment.

  16. Pyranopterin Coordination Controls Molybdenum Electrochemistry in Escherichia coli Nitrate Reductase.

    PubMed

    Wu, Sheng-Yi; Rothery, Richard A; Weiner, Joel H

    2015-10-09

    We test the hypothesis that pyranopterin (PPT) coordination plays a critical role in defining molybdenum active site redox chemistry and reactivity in the mononuclear molybdoenzymes. The molybdenum atom of Escherichia coli nitrate reductase A (NarGHI) is coordinated by two PPT-dithiolene chelates that are defined as proximal and distal based on their proximity to a [4Fe-4S] cluster known as FS0. We examined variants of two sets of residues involved in PPT coordination: (i) those interacting directly or indirectly with the pyran oxygen of the bicyclic distal PPT (NarG-Ser(719), NarG-His(1163), and NarG-His(1184)); and (ii) those involved in bridging the two PPTs and stabilizing the oxidation state of the proximal PPT (NarG-His(1092) and NarG-His(1098)). A S719A variant has essentially no effect on the overall Mo(VI/IV) reduction potential, whereas the H1163A and H1184A variants elicit large effects (ΔEm values of -88 and -36 mV, respectively). Ala variants of His(1092) and His(1098) also elicit large ΔEm values of -143 and -101 mV, respectively. An Arg variant of His(1092) elicits a small ΔEm of +18 mV on the Mo(VI/IV) reduction potential. There is a linear correlation between the molybdenum Em value and both enzyme activity and the ability to support anaerobic respiratory growth on nitrate. These data support a non-innocent role for the PPT moieties in controlling active site metal redox chemistry and catalysis.

  17. Short-chain dehydrogenases/reductases in cyanobacteria.

    PubMed

    Kramm, Anneke; Kisiela, Michael; Schulz, Rüdiger; Maser, Edmund

    2012-03-01

    The short-chain dehydrogenases/reductases (SDRs) represent a large superfamily of enzymes, most of which are NAD(H)-dependent or NADP(H)-dependent oxidoreductases. They display a wide substrate spectrum, including steroids, alcohols, sugars, aromatic compounds, and xenobiotics. On the basis of characteristic sequence motifs, the SDRs are subdivided into two main (classical and extended) and three smaller (divergent, intermediate, and complex) families. Despite low residue identities in pairwise comparisons, the three-dimensional structure among the SDRs is conserved and shows a typical Rossmann fold. Here, we used a bioinformatics approach to determine whether and which SDRs are present in cyanobacteria, microorganisms that played an important role in our ecosystem as the first oxygen producers. Cyanobacterial SDRs could indeed be identified, and were clustered according to the SDR classification system. Furthermore, because of the early availability of its genome sequence and the easy application of transformation methods, Synechocystis sp. PCC 6803, one of the most important cyanobacterial strains, was chosen as the model organism for this phylum. Synechocystis sp. SDRs were further analysed with bioinformatics tools, such as hidden Markov models (HMMs). It became evident that several cyanobacterial SDRs show remarkable sequence identities with SDRs in other organisms. These so-called 'homologous' proteins exist in plants, model organisms such as Drosophila melanogaster and Caenorhabditis  elegans, and even in humans. As sequence identities of up to 60% were found between Synechocystis and humans, it was concluded that SDRs seemed to have been well conserved during evolution, even after dramatic terrestrial changes such as the conversion of the early reducing atmosphere to an oxidizing one by cyanobacteria.

  18. Prokaryotic arsenate reductase enhances arsenate resistance in Mammalian cells.

    PubMed

    Wu, Dan; Tao, Xuanyu; Wu, Gaofeng; Li, Xiangkai; Liu, Pu

    2014-01-01

    Arsenic is a well-known heavy metal toxicant in the environment. Bioremediation of heavy metals has been proposed as a low-cost and eco-friendly method. This article described some of recent patents on transgenic plants with enhanced heavy metal resistance. Further, to test whether genetic modification of mammalian cells could render higher arsenic resistance, a prokaryotic arsenic reductase gene arsC was transfected into human liver cancer cell HepG2. In the stably transfected cells, the expression level of arsC gene was determined by quantitative real-time PCR. Results showed that arsC was expressed in HepG2 cells and the expression was upregulated by 3 folds upon arsenate induction. To further test whether arsC has function in HepG2 cells, the viability of HepG2-pCI-ArsC cells exposed to arsenite or arsenate was compared to that of HepG2-pCI cells without arsC gene. The results indicated that arsC increased the viability of HepG2 cells by 25% in arsenate, but not in arsenite. And the test of reducing ability of stably transfected cells revealed that the concentration of accumulated trivalent arsenic increased by 25% in HepG2-pCI-ArsC cells. To determine the intracellular localization of ArsC, a fusion vector with fluorescent marker pEGFP-N1-ArsC was constructed and transfected into.HepG2. Laser confocal microscopy showed that EGFP-ArsC fusion protein was distributed throughout the cells. Taken together, these results demonstrated that prokaryotic arsenic resistant gene arsC integrated successfully into HepG2 genome and enhanced arsenate resistance of HepG2, which brought new insights of arsenic detoxification in mammalian cells.

  19. Characterization of thioredoxin glutathione reductase in Schiotosoma japonicum.

    PubMed

    Han, Yanhui; Zhang, Min; Hong, Yang; Zhu, Zhu; Li, Dong; Li, Xiangrui; Fu, Zhiqiang; Lin, Jiaojiao

    2012-09-01

    Schistosomiasis is one of the most prevalent and serious parasitic diseases in the world and remains an important public health problem in China. Screening and discovery of an effective vaccine candidate or new drug target is crucial for the control of this disease. In this study, we cloned a cDNA encoding Schistosoma japonicum (S. japonicum) thioredoxin glutathione reductase (SjTGR) from the cDNA of 42-day-old adult worms. The open reading frame (ORF) of the gene was 1791 base pairs (bp) encoding a protein of 596 amino acids. SjTGR was subcloned into pET-32a (+) and expressed in Escherichia coli (E. coli) BL21 (DE3). The recombinant protein rSjTGR exhibited enzymatic activity of 5.13U/mg with DTNB as the substrate, and showed strong immunogenecity. Real-time PCR results indicated that SjTGR was expressed at a higher level in 35-day-old schistosome worms in transcript. We vaccinated BALB/c mice with rSjTGR in combination with MONTANIDE™ ISA 206 VG (ISA 206) and observed a 33.50% to 36.51% (P<0.01) decrease in the adult worm burden and a 33.73%to 43.44% (P<0.01) decrease in the number of eggs counted compared to the ISA 206 or blank control groups in two independent vaccination tests. ELISA analysis demonstrated that rSjTGR induced a high level of SjTGR-specific IgG, IgG1, and IgG 2a antibodies and induced elevated production of IFN-γ. This study provides the basis for further investigations into the biological function of SjTGR and further evaluation of the potential use of this molecule as a vaccine candidate or new drug target is warranted.

  20. Human carbonyl reductase catalyzes reduction of 4-oxonon-2-enal.

    PubMed

    Doorn, Jonathan A; Maser, Edmund; Blum, Andreas; Claffey, David J; Petersen, Dennis R

    2004-10-19

    4-Oxonon-2-enal (4ONE) was demonstrated to be a product of lipid peroxidation, and previous studies found that it was highly reactive toward DNA and protein. The present study sought to determine whether carbonyl reductase (CR) catalyzes reduction of 4ONE, representing a potential pathway for metabolism of the lipid peroxidation product. Recombinant CR was cloned from a human liver cDNA library, expressed in Escherichia coli, and purified by metal chelate chromatography. Both 4ONE and its glutathione conjugate were found to be substrates for CR, and kinetic parameters were calculated. TLC analysis of reaction products revealed the presence of three compounds, two of which were identified as 4-hydroxynon-2-enal (4HNE) and 1-hydroxynon-2-en-4-one (1HNO). GC/MS analysis confirmed 4HNE and 1HNO and identified the unknown reaction product as 4-oxononanal (4ONA). Analysis of oxime derivatives of the reaction products via LC/MS confirmed the unknown as 4ONA. The time course for CR-mediated, NADPH-dependent 4ONE reduction and appearance of 4HNE and 1HNO was determined using HPLC, demonstrating 4HNE to be a major product and 1HNO and 4ONA to be minor products. Simulated structures of 4ONE in the active site of CR/NADPH calculated via docking experiments predict the ketone positioned as primary hydride acceptor. Results of the present study demonstrate that 4ONE is a substrate for CR/NADPH and the enzyme may represent a pathway for biotransformation of the lipid. Furthermore, these findings reveal that CR catalyzes hydride transfer selectively to the ketone but also to the aldehyde and C=C of 4ONE, resulting in 4HNE, 1HNO, and 4ONA, respectively.

  1. Tales of Dihydrofolate Binding to R67 Dihydrofolate Reductase

    PubMed Central

    2015-01-01

    Homotetrameric R67 dihydrofolate reductase possesses 222 symmetry and a single active site pore. This situation results in a promiscuous binding site that accommodates either the substrate, dihydrofolate (DHF), or the cofactor, NADPH. NADPH interacts more directly with the protein as it is larger than the substrate. In contrast, the p-aminobenzoyl-glutamate tail of DHF, as monitored by nuclear magnetic resonance and crystallography, is disordered when bound. To explore whether smaller active site volumes (which should decrease the level of tail disorder by confinement effects) alter steady state rates, asymmetric mutations that decreased the half-pore volume by ∼35% were constructed. Only minor effects on kcat were observed. To continue exploring the role of tail disorder in catalysis, 1-ethyl-3-[3-(dimethylamino)propyl]carbodiimide-mediated cross-linking between R67 DHFR and folate was performed. A two-folate, one-tetramer complex results in the loss of enzyme activity where two symmetry-related K32 residues in the protein are cross-linked to the carboxylates of two bound folates. The tethered folate could be reduced, although with a ≤30-fold decreased rate, suggesting decreased dynamics and/or suboptimal positioning of the cross-linked folate for catalysis. Computer simulations that restrain the dihydrofolate tail near K32 indicate that cross-linking still allows movement of the p-aminobenzoyl ring, which allows the reaction to occur. Finally, a bis-ethylene-diamine-α,γ-amide folate adduct was synthesized; both negatively charged carboxylates in the glutamate tail were replaced with positively charged amines. The Ki for this adduct was ∼9-fold higher than for folate. These various results indicate a balance between folate tail disorder, which helps the enzyme bind substrate while dynamics facilitates catalysis. PMID:26637016

  2. Hydride transfer during catalysis by dihydrofolate reductase from Thermotoga maritima.

    PubMed Central

    Maglia, Giovanni; Javed, Masood H; Allemann, Rudolf K

    2003-01-01

    DHFR (dihydrofolate reductase) catalyses the metabolically important reduction of 7,8-dihydrofolate by NADPH. DHFR from the hyperthermophilic bacterium Thermotoga maritima (TmDHFR), which shares similarity with DHFR from Escherichia coli, has previously been characterized structurally. Its tertiary structure is similar to that of DHFR from E. coli but it is the only DHFR characterized so far that relies on dimerization for stability. The midpoint of the thermal unfolding of TmDHFR was at approx. 83 degrees C, which was 30 degrees C higher than the melting temperature of DHFR from E. coli. The turnover and the hydride-transfer rates in the kinetic scheme of TmDHFR were derived from measurements of the steady-state and pre-steady-state kinetics using absorbance and stopped-flow fluorescence spectroscopy. The rate constant for hydride transfer was found to depend strongly on the temperature and the pH of the solution. Hydride transfer was slow (0.14 s(-1) at 25 degrees C) and at least partially rate limiting at low temperatures but increased dramatically with temperature. At 80 degrees C the hydride-transfer rate of TmDHFR was 20 times lower than that observed for the E. coli enzyme at its physiological temperature. Hydride transfer depended on ionization of a single group in the active site with a p K(a) of 6.0. While at 30 degrees C, turnover of substrate by TmDHFR was almost two orders of magnitude slower than by DHFR from E. coli; the steady-state rates of the two enzymes differed only 8-fold at their respective working temperatures. PMID:12765545

  3. Clothes Dryer Automatic Termination Evaluation

    SciTech Connect

    TeGrotenhuis, Ward E.

    2014-10-01

    Volume 2: Improved Sensor and Control Designs Many residential clothes dryers on the market today provide automatic cycles that are intended to stop when the clothes are dry, as determined by the final remaining moisture content (RMC). However, testing of automatic termination cycles has shown that many dryers are susceptible to over-drying of loads, leading to excess energy consumption. In particular, tests performed using the DOE Test Procedure in Appendix D2 of 10 CFR 430 subpart B have shown that as much as 62% of the energy used in a cycle may be from over-drying. Volume 1 of this report shows an average of 20% excess energy from over-drying when running automatic cycles with various load compositions and dryer settings. Consequently, improving automatic termination sensors and algorithms has the potential for substantial energy savings in the U.S.

  4. VSATs - Very small aperture terminals

    NASA Astrophysics Data System (ADS)

    Everett, John L.

    The present volume on very small aperture terminals (VSATs) discusses antennas, semiconductor devices, and traveling wave tubes and amplifiers for VSAT systems, VSAT low noise downconverters, and modems and codecs for VSAT systems. Attention is given to multiaccess protocols for VSAT networks, protocol software in Ku-band VSAT network systems, system design of VSAT data networks, and the policing of VSAT networks. Topics addressed include the PANDATA and PolyCom systems, APOLLO - a satellite-based information distribution system, data broadcasting within a satellite television channel, and the NEC NEXTAR VSAT system. Also discussed are small aperture military ground terminals, link budgets for VSAT systems, capabilities and experience of a VSAT service provider, and developments in VSAT regulation.

  5. MEANS FOR TERMINATING NUCLEAR REACTIONS

    DOEpatents

    Cooper, C.M.

    1959-02-17

    An apparatus is presented for use in a reactor of the heterogeneous, fluid cooled type for the purpose of quickly terminating the reaction, the coolant being circulated through coolant tubes extending through the reactor core. Several of the tubes in the critical region are connected through valves to a tank containing a poisoning fluid having a high neutron capture crosssection and to a reservoir. When it is desired to quickly terminate the reaction, the valves are operated to permit the flow of the poisoning fluid through these particular tubes and into the reservoir while normal coolant is being circulated through the remaining tubes. The apparatus is designed to prevent contamination of the primary coolant by the poisoning fluid.

  6. Design of superlattice termination layers

    NASA Technical Reports Server (NTRS)

    Coon, D. D.; Sorar, E.

    1990-01-01

    Problems associated with quantum mechanical reflection of miniband carriers at the ends of superlattices are examined. Moebius transformations which map miniband Bloch wave reflectivity into plane wave reflectivity and vice versa are derived. These transformations facilitate the design of blocking and antiblocking layers which are analogous to reflective and antireflective coatings on optical elements. An example of termination layer design which is easy to implement is given. Applications include superlattice infrared detector design.

  7. Military Governance and War Termination

    DTIC Science & Technology

    2011-05-19

    existing data sources, gathering and maintaining the data needed, and completing and reviewing this collection of information. Send comments...amount of census data was collected, which served civil administration purposes and provided intelligence for military operations.123 Additionally, in...York: Henry Holt and Company, 2005. Bade , Bruce C. War Termination: Why Don’t We Plan It? Fort McNair: National War College, 1994. Barthlomees, J

  8. Structural and biochemical properties of cloned and expressed human and rat steroid 5. alpha. -reductases

    SciTech Connect

    Andersson, S.; Russell, D.W. )

    1990-05-01

    The microsomal enzyme steroid 5{alpha}-reductase is responsible for the conversion of testosterone into the more potent androgen dihydrotestosterone. In man, this steroid acts on a variety of androgen-responsive target tissues to mediate such diverse endocrine processes as male sexual differentiation in the fetus and prostatic growth in men. Here we describe the isolation, structure, and expression of a cDNA encoding the human steroid 5{alpha}-reductase. A rat cDNA was used as a hybridization probe to screen a human prostate cDNA library. A 2.1-kilobase cDNA was identified and DNA sequence analysis indicated that the human steroid 5{alpha}-reductase was a hydrophobic protein of 259 amino acids with a predicted molecular weight of 29,462. A comparison of the human and rat protein sequences revealed a 60% identity. Transfection of expression vectors containing the human and rat cDNAs into simian COS cells resulted in the synthesis of high levels of steroid 5{alpha}-reductase enzyme activity. Both enzymes expressed in COS cells showed similar substrate specificities for naturally occurring steroid hormones. However, synthetic 4-azasteroids demonstrated marked differences in their abilities to inhibit the human and rat steroid 5{alpha}-reductases.

  9. Characterization and regulation of Leishmania major 3-hydroxy-3-methylglutaryl-CoA reductase.

    PubMed

    Montalvetti, A; Peña-Díaz, J; Hurtado, R; Ruiz-Pérez, L M; González-Pacanowska, D

    2000-07-01

    In eukaryotes the enzyme 3-hydroxy-3-methylglutaryl CoA (HMG-CoA) reductase catalyses the synthesis of mevalonic acid, a common precursor to all isoprenoid compounds. Here we report the isolation and overexpression of the gene coding for HMG-CoA reductase from Leishmania major. The protein from Leishmania lacks the membrane domain characteristic of eukaryotic cells but exhibits sequence similarity with eukaryotic reductases. Highly purified protein was achieved by ammonium sulphate precipitation followed by chromatography on hydroxyapatite. Kinetic parameters were determined for the protozoan reductase, obtaining K(m) values for the overall reaction of 40.3+/-5.8 microM for (R,S)-HMG-CoA and 81.4+/-5.3 microM for NADPH; V(max) was 33.55+/-1.8 units x mg(-1). Gel-filtration experiments suggested an apparent molecular mass of 184 kDa with subunits of 46 kDa. Finally, in order to achieve a better understanding of the role of this enzyme in trypanosomatids, the effect of possible regulators of isoprenoid biosynthesis in cultured promastigote cells was studied. Neither mevalonic acid nor serum sterols appear to modulate enzyme activity whereas incubation with lovastatin results in significant increases in the amount of reductase protein. Western- and Northern-blot analyses indicate that this activation is apparently performed via post-transcriptional control.

  10. Daio-Orengedokuto inhibits HMG-CoA reductase and pancreatic lipase.

    PubMed

    Kim, Young-Suk; Jung, Eun-Ah; Shin, Ji-Eun; Chang, Jong-Chul; Yang, Hyung-Kil; Kim, Nam-Jae; Cho, Ki-Ho; Bae, Hyung-Sup; Moon, Sang-Kwan; Kim, Dong-Hyun

    2002-11-01

    To evaluate the antihyperlipidemic activities of Orengedokuto (OT) and Daio-Orengedokuto (DOT), the inhibitory effects of these polyprescriptions on HMG-CoA reductase and pancreatic lipase and on the rat hyperlipidemic model induced by Triton WR-1339 were measured. OT potently inhibited HMG-CoA reductase but did not inhibit lipase. Among their ingredients, Coptidis Rhizoma was the most potent inhibitor, followed by Rhei Rhizoma. The HMG-CoA reductase-inhibitory activity of 80% EtOH extract was superior to that of water extract. However, DOT potently inhibited HMG CoA-reductase as well as pancreatic lipase. In the rat hyperlipidemic model induced by Triton WR-1339, OT and DOT decreased serum total cholesterol and low-density lipoprotein cholesterol levels. DOT also decreased serum triglyceride levels, but OT did not decrease it. These results suggest that the antihyperlipidemic activity of DOT may originate from the inhibition of pancreatic lipase as well as HMG-CoA reductase.

  11. Organization of dimethyl sulfoxide reductase in the plasma membrane of Escherichia coli.

    PubMed Central

    Sambasivarao, D; Scraba, D G; Trieber, C; Weiner, J H

    1990-01-01

    Dimethyl sulfoxide reductase is a trimeric, membrane-bound, iron-sulfur molybdoenzyme induced in Escherichia coli under anaerobic growth conditions. The enzyme catalyzes the reduction of dimethyl sulfoxide, trimethylamine N-oxide, and a variety of S- and N-oxide compounds. The topology of dimethyl sulfoxide reductase subunits was probed by a combination of techniques. Immunoblot analysis of the periplasmic proteins from the osmotic shock and chloroform wash fluids indicated that the subunits were not free in the periplasm. The reductase was susceptible to proteases in everted membrane vesicles, but the enzyme in outer membrane-permeabilized cells became protease sensitive only after detergent solubilization of the E. coli plasma membrane. Lactoperoxidase catalyzed the iodination of each of the three subunits in an everted membrane vesicle preparation. Antibodies to dimethyl sulfoxide reductase and fumarate reductase specifically agglutinated the everted membrane vesicles. No TnphoA fusions could be found in the dmsA or -B genes, indicating that these subunits were not translocated to the periplasm. Immunogold electron microscopy of everted membrane vesicles and thin sections by using antibodies to the DmsABC, DmsA, DmsB subunits resulted in specific labeling of the cytoplasmic surface of the inner membrane. These results show that the DmsA (catalytic subunit) and DmsB (electron transfer subunit) are membrane-extrinsic subunits facing the cytoplasmic side of the plasma membrane. Images PMID:2170332

  12. α-Glucosidase and aldose reductase inhibitory activities from the fruiting body of Phellinus merrillii.

    PubMed

    Huang, Guan-Jhong; Hsieh, Wen-Tsong; Chang, Heng-Yuan; Huang, Shyh-Shyun; Lin, Ying-Chih; Kuo, Yueh-Hsiung

    2011-05-25

    The inhibitory activity from the isolated component of the fruiting body Phellinus merrillii (PM) was evaluated against α-glucosidase and lens aldose reductase from Sprague-Dawley male rats and compared to the quercetin as an aldose reductase inhibitor and acarbose as an α-glucosidase inhibitor. The ethanol extracts of PM (EPM) showed the strong α-glucosidase and aldose reductase activities. α-Glucosidase and aldose reductase inhibitors were identified as hispidin (A), hispolon (B), and inotilone (C), which were isolated from EtOAc-soluble fractions of EPM. The above structures were elucidated by their spectra and comparison with the literatures. Among them, hispidin, hispolon, and inotilone exhibited potent against α-glucosidase inhibitor activity with IC(50) values of 297.06 ± 2.06, 12.38 ± 0.13, and 18.62 ± 0.23 μg/mL, respectively, and aldose reductase inhibitor activity with IC(50) values of 48.26 ± 2.48, 9.47 ± 0.52, and 15.37 ± 0.32 μg/mL, respectively. These findings demonstrated that PM may be a good source for lead compounds as alternatives for antidiabetic agents currently used. The importance of finding effective antidiabetic therapeutics led us to further investigate natural compounds.

  13. Structural basis for cyclopropanation by a unique enoyl-acyl carrier protein reductase

    PubMed Central

    Khare, Dheeraj; Hale, Wendi A.; Tripathi, Ashootosh; Gu, Liangcai; Sherman, David H.; Gerwick, William H.; Håkansson, Kristina; Smith, Janet L.

    2015-01-01

    The natural product curacin A, a potent anticancer agent, contains a rare cyclopropane group. The five enzymes for cyclopropane biosynthesis are highly similar to enzymes that generate a vinyl chloride moiety in the jamaicamide natural product. The structural biology of this remarkable catalytic adaptability is probed with high-resolution crystal structures of the curacin cyclopropanase (CurF ER), an in vitro enoyl reductase (JamJ ER), and a canonical curacin enoyl reductase (CurK ER). The JamJ and CurK ERs catalyze NADPH-dependent double bond reductions typical of enoyl reductases (ERs) of the medium chain dehydrogenase reductase (MDR) superfamily. Cyclopropane formation by CurF ER is specified by a short loop which, when transplanted to JamJ ER, confers cyclopropanase activity on the chimeric enzyme. Detection of an adduct of NADPH with the model substrate crotonyl-CoA provides indirect support for a recent proposal of a C2-ene intermediate on the reaction pathway of MDR enoyl-thioester reductases. PMID:26526850

  14. Characterization and regulation of Leishmania major 3-hydroxy-3-methylglutaryl-CoA reductase.

    PubMed Central

    Montalvetti, A; Peña-Díaz, J; Hurtado, R; Ruiz-Pérez, L M; González-Pacanowska, D

    2000-01-01

    In eukaryotes the enzyme 3-hydroxy-3-methylglutaryl CoA (HMG-CoA) reductase catalyses the synthesis of mevalonic acid, a common precursor to all isoprenoid compounds. Here we report the isolation and overexpression of the gene coding for HMG-CoA reductase from Leishmania major. The protein from Leishmania lacks the membrane domain characteristic of eukaryotic cells but exhibits sequence similarity with eukaryotic reductases. Highly purified protein was achieved by ammonium sulphate precipitation followed by chromatography on hydroxyapatite. Kinetic parameters were determined for the protozoan reductase, obtaining K(m) values for the overall reaction of 40.3+/-5.8 microM for (R,S)-HMG-CoA and 81.4+/-5.3 microM for NADPH; V(max) was 33.55+/-1.8 units x mg(-1). Gel-filtration experiments suggested an apparent molecular mass of 184 kDa with subunits of 46 kDa. Finally, in order to achieve a better understanding of the role of this enzyme in trypanosomatids, the effect of possible regulators of isoprenoid biosynthesis in cultured promastigote cells was studied. Neither mevalonic acid nor serum sterols appear to modulate enzyme activity whereas incubation with lovastatin results in significant increases in the amount of reductase protein. Western- and Northern-blot analyses indicate that this activation is apparently performed via post-transcriptional control. PMID:10861207

  15. Enzymatic removal of diacetyl from beer. II. Further studies on the use of diacetyl reductase.

    PubMed

    Tolls, T N; Shovers, J; Sandine, W E; Elliker, P R

    1970-04-01

    Diacetyl removal from beer was studied with whole cells and crude enzyme extracts of yeasts and bacteria. Cells of Streptococcus diacetilactis 18-16 destroyed diacetyl in solutions at a rate almost equal to that achieved by the addition of whole yeast cells. Yeast cells impregnated in a diatomaceous earth filter bed removed all diacetyl from solutions percolated through the bed. Undialyzed crude enzyme extracts from yeast cells removed diacetyl very slowly from beer at its normal pH (4.1); at a pH of 5.0 or higher, rapid diacetyl removal was achieved. Dialyzed crude enzyme extracts from yeast cells were found to destroy diacetyl in a manner quite similar to that of diacetyl reductase from Aerobacter aerogenes, and both the bacterial and the yeast extracts were stimulated significantly by the addition of reduced nicotinamide adenine dinucleotide (NADH). Diacetyl reductase activity of four strains of A. aerogenes was compared; three of the strains produced enzyme with approximately twice the specific activity of the other strain (8724). Gel electrophoresis results indicated that at least three different NADH-oxidizing enzymes were present in crude extracts of diacetyl reductase. Sephadex-gel chromotography separated NADH oxidase from diacetyl reductase. It was also noted that ethyl alcohol concentrations approximately equivalent to those found in beer were quite inhibitory to diacetyl reductase.

  16. Regulation of 5alpha-reductase isoforms by oxytocin in the rat ventral prostate.

    PubMed

    Assinder, S J; Johnson, C; King, K; Nicholson, H D

    2004-12-01

    Oxytocin (OT) is present in the male reproductive tract, where it is known to modulate contractility, cell growth, and steroidogenesis. Little is known about how OT regulates these processes. This study describes the localization of OT receptor in the rat ventral prostate and investigates if OT regulates gene expression and/or activity of 5alpha-reductase isoforms I and II. The ventral prostates of adult male Wistar rats were collected following daily sc administration of saline (control), OT, a specific OT antagonist or both OT plus antagonist for 3 d. Expression of the OT receptor was identified in the ventral prostate by RT-PCR and Western blot, and confirmed to be a single active binding site by radioreceptor assay. Immunohistochemistry localized the receptor to the epithelium of prostatic acini and to the stromal tissue. Real-time RT-PCR determined that OT treatment significantly reduced expression of 5alpha-reductase I but significantly increased 5alpha-reductase II expression in the ventral prostate. Activity of both isoforms of 5alpha-reductase was significantly increased by OT, resulting in increased concentration of prostatic dihydrotestosterone. In conclusion, OT is involved in regulating conversion of testosterone to the biologically active dihydrotestosterone in the rat ventral prostate. It does so by differential regulation of 5alpha-reductase isoforms I and II.

  17. High Octane Fuel: Terminal Backgrounder

    SciTech Connect

    Moriarty, Kristi

    2016-02-11

    The Bioenergy Technologies Office of the U.S. Department of Energy Office of Energy Efficiency and Renewable Energy sponsored a scoping study to assess the potential of ethanol-based high octane fuel (HOF) to reduce energy consumption and greenhouse gas emissions. When the HOF blend is made with 25%-40% ethanol by volume, this energy efficiency improvement is potentially sufficient to offset the reduced vehicle range often associated with the decreased volumetric energy density of ethanol. The purpose of this study is to assess the ability of the fuel supply chain to accommodate more ethanol at fuel terminals. Fuel terminals are midstream in the transportation fuel supply chain and serve to store and distribute fuels to end users. While there are no technical issues to storing more ethanol at fuel terminals, there are several factors that could impact the ability to deploy more ethanol. The most significant of these issues include the availability of land to add more infrastructure and accommodate more truck traffic for ethanol deliveries as well as a lengthy permitting process to erect more tanks.

  18. Hydrogen at the Lunar Terminator

    NASA Astrophysics Data System (ADS)

    Livengood, T. A.; Chin, G.; Sagdeev, R. Z.; Mitrofanov, I. G.; Boynton, W. V.; Evans, L. G.; Litvak, M. L.; McClanahan, T. P.; Sanin, A. B.; Starr, R. D.; Su, J. J.

    2015-10-01

    Suppression of the Moon's naturally occurring epithermal neutron leakage flux near the equatorial dawn terminator is consistent with the presence of diurnally varying quantities of hydrogen in the regolith with maximum concentration on the day side of the dawn terminator. This flux suppression has been observed using the Lunar Exploration Neutron Detector (LEND) on the polar-orbiting Lunar Reconnaissance Orbiter (LRO). The chemical form of hydrogen is not determined, but other remote sensing methods and elemental availability suggest water. The observed variability is interpreted as frost collecting in or on the cold nightside surface, thermally desorbing in sunlight during the lunar morning,and migrating away from the warm subsolar region across the nearby terminator to return to the lunar surface. The maximum concentration, averaged over the upper ~1m of regolith to which neutron detection is sensitive,is estimated to be 0.0125±0.0022 weight-percent water-equivalent hydrogen (wt% WEH), yielding an accumulation of 190±30 ml recoverable water per square meter of regolith at each dawn. The source of hydrogen (water) must be in equilibrium with losses due to solar photolysis and escape. A chemical recycling process or self-shielding from solar UV must be assumed in order to bring the loss rate down to compatibility with possible sources, including solar wind or micrometeoroid delivery of hydrogen, which require near-complete retention of hydrogen,or outgassing of primordial volatiles, for which a plausible supply rate requires significantly less retention efficiency.

  19. The GRO remote terminal system

    NASA Technical Reports Server (NTRS)

    Zillig, David J.; Valvano, Joe

    1994-01-01

    In March 1992, NASA HQ challenged GSFC/Code 531 to propose a fast, low-cost approach to close the Tracking Data Relay Satellite System (TDRSS) Zone-of-Exclusion (ZOE) over the Indian Ocean in order to provide global communications coverage for the Compton Gamma Ray Observatory (GRO) spacecraft. GRO had lost its tape recording capability which limited its valuable science data return to real-time contacts with the TDRS-E and TDRS-W synchronous data relay satellites, yielding only approximately 62 percent of the possible data obtainable. To achieve global coverage, a TDRS spacecraft would have to be moved over the Indian Ocean out of line-of-sight control of White Sands Ground Terminal (WSGT). To minimize operations life cycle costs, Headquarters also set a goal for remote control, from the WSGT, of the overseas ground station which was required for direct communications with TDRS-1. On August 27, 1992, Code 531 was given the go ahead to implement the proposed GRO Relay Terminal System (GRTS). This paper describes the Remote Ground Relay Terminal (RGRT) which went operational at the Canberra Deep Space Communications Complex (CDSCC) in Canberra, Australia in December 1993 and is currently augmenting the TDRSS constellation in returning between 80-100 percent of GRO science data under the control of a single operator at WSGT.

  20. Kinetics of Dissimilatory Iron Reduction in Shewanella oneidensis MR-1: Scaling From Purified Proteins to Whole Cell Cultures

    NASA Astrophysics Data System (ADS)

    Brantley, S.; Ross, D.; Tien, M.

    2006-12-01

    To predict biogeochemical reactions in the field, it will be necessary to predict rates and processes from fundamental biochemical observations. Shewanella oneidensis MR-1 is a gram-negative facultative anaerobe that has a versatile respiration system capable of utilizing a large number of terminal electron acceptors. Genetic studies have identified most if not all of the proteins involved in iron reduction; however, the mechanism of iron reduction is yet to be determined. Our research is focused on how this bacterium is able to utilize solid iron forms as its terminal electron acceptor; we are also investigating the reduction of chelated iron forms such as EDTA, NTA and ferric citrate for kinetic comparison. Solid iron oxides are the predominant form which iron is found in the earth's crust under aerobic and circumneutral pH conditions. In order to fully understand how this process works, we have taken a biochemical/kinetics approach. We have measured kinetic constants at three different scales: transient-state kinetic studies using a stop flow, steady-state kinetic from isolated membrane fractions and, whole cell kinetic. With the stop flow, we have measured rate constants between hemeproteins OmcA, MtrA and CctA with EDTA-Fe3+, NTA-Fe3+ and citrate-Fe3+. For steady state kinetics with membrane fractions, we have obtained kinetic constants with EDTA-Fe3+, NTA- Fe3+, citrate-Fe3+ and goethite. The rates are expressed as per mole of MtrC. The hemeprotein MtrC, thought to be the terminal iron reductase, was quantified through Western-blot analysis using polyclonal antibodies. Second order rate constants from stop flow studies are then compared to kcat/Km values obtained from steady state kinetic studies. Similar studies were also performed with whole cells and again normalized to MtrC content. The kinetic constants scale up well for the soluble iron forms but not for the insoluble iron form (goethite). Mechanistic implications from these scale up studies will be

  1. Aldo-keto reductase (AKR) 1C3: role in prostate disease and the development of specific inhibitors.

    PubMed

    Penning, Trevor M; Steckelbroeck, Stephan; Bauman, David R; Miller, Meredith W; Jin, Yi; Peehl, Donna M; Fung, Kar-Ming; Lin, Hseuh-Kung

    2006-03-27

    Human aldo-keto reductases (AKR) of the 1A, 1B, 1C and 1D subfamilies are involved in the pre-receptor regulation of nuclear (steroid hormone and orphan) receptors by regulating the local concentrations of their lipophilic ligands. AKR1C3 is one of the most interesting isoforms. It was cloned from human prostate and the recombinant protein was found to function as a 3-, 17- and 20-ketosteroid reductase with a preference for the conversion of Delta4-androstene-3,17-dione to testosterone implicating this enzyme in the local production of active androgens within the prostate. Using a validated isoform specific real-time RT-PCR procedure the AKR1C3 transcript was shown to be more abundant in primary cultures of epithelial cells than stromal cells, and its expression in stromal cells increased with benign and malignant disease. Using a validated isoform specific monoclonal Ab, AKR1C3 protein expression was also detected in prostate epithelial cells by immunoblot analysis. Immunohistochemical staining of prostate tissue showed that AKR1C3 was expressed in adenocarcinoma and surprisingly high expression was observed in the endothelial cells. These cells are a rich source of prostaglandin G/H synthase 2 (COX-2) and vasoactive prostaglandins (PG) and thus the ability of recombinant AKR1C enzymes to act as PGF synthases was compared. AKR1C3 had the highest catalytic efficiency (kcat/Km) for the 11-ketoreduction of PGD2 to yield 9alpha,11beta-PGF2 raising the prospect that AKR1C3 may govern ligand access to peroxisome proliferator activated receptor (PPARgamma). Activation of PPARgamma is often a pro-apoptotic signal and/or leads to terminal differentiation, while 9alpha,11beta-PGF2 is a pro-proliferative signal. AKR1C3 is potently inhibited by non-steroidal anti-inflammatory drugs suggesting that the cancer chemopreventive properties of these agents may be mediated either by inhibition of AKR1C3 or COX. To discriminate between these effects we developed potent AKR1C

  2. Structural-functional characterization and physiological significance of ferredoxin-NADP reductase from Xanthomonas axonopodis pv. citri.

    PubMed

    Tondo, María Laura; Musumeci, Matías A; Delprato, María Laura; Ceccarelli, Eduardo A; Orellano, Elena G

    2011-01-01

    Xanthomonas axonopodis pv. citri is a phytopathogen bacterium that causes severe citrus canker disease. Similar to other phytopathogens, after infection by this bacterium, plants trigger a defense mechanism that produces reactive oxygen species. Ferredoxin-NADP(+) reductases (FNRs) are redox flavoenzymes that participate in several metabolic functions, including the response to reactive oxygen species. Xanthomonas axonopodis pv. citri has a gene (fpr) that encodes for a FNR (Xac-FNR) that belongs to the subclass I bacterial FNRs. The aim of this work was to search for the physiological role of this enzyme and to characterize its structural and functional properties. The functionality of Xac-FNR was tested by cross-complementation of a FNR knockout Escherichia coli strain, which exhibit high susceptibility to agents that produce an abnormal accumulation of (•)O(2)(-). Xac-FNR was able to substitute for the FNR in E. coli in its antioxidant role. The expression of fpr in X. axonopodis pv. citri was assessed using semiquantitative RT-PCR and Western blot analysis. A 2.2-fold induction was observed in the presence of the superoxide-generating agents methyl viologen and 2,3-dimethoxy-1,4-naphthoquinone. Structural and functional studies showed that Xac-FNR displayed different functional features from other subclass I bacterial FNRs. Our analyses suggest that these differences may be due to the unusual carboxy-terminal region. We propose a further classification of subclass I bacterial FNRs, which is useful to determine the nature of their ferredoxin redox partners. Using sequence analysis, we identified a ferredoxin (XAC1762) as a potential substrate of Xac-FNR. The purified ferredoxin protein displayed the typical broad UV-visible spectrum of [4Fe-4S] clusters and was able to function as substrate of Xac-FNR in the cytochrome c reductase activity. Our results suggest that Xac-FNR is involved in the oxidative stress response of Xanthomonas axonopodis pv. citri and

  3. Differential Feedback Regulation of Δ4-3-Oxosteroid 5β-Reductase Expression by Bile Acids

    PubMed Central

    Valanejad, Leila; Nadolny, Christina; Shiffka, Stephanie; Chen, Yuan; You, Sangmin; Deng, Ruitang

    2017-01-01

    Δ4-3-oxosteroid 5β-reductase is member D1 of the aldo-keto reductase family 1 (AKR1D1), which catalyzes 5β-reduction of molecules with a 3-oxo-4-ene structure. Bile acid intermediates and most of the steroid hormones carry the 3-oxo-4-ene structure. Therefore, AKR1D1 plays critical roles in both bile acid synthesis and steroid hormone metabolism. Currently our understanding on transcriptional regulation of AKR1D1 under physiological and pathological conditions is very limited. In this study, we investigated the regulatory effects of primary bile acids, chenodeoxycholic acid (CDCA) and cholic acid (CA), on AKR1D1 expression. The expression levels of AKR1D1 mRNA and protein in vitro and in vivo following bile acid treatments were determined by real-time PCR and Western blotting. We found that CDCA markedly repressed AKR1D1 expression in vitro in human hepatoma HepG2 cells and in vivo in mice. On the contrary, CA significantly upregulated AKR1D1 expression in HepG2 cells and in mice. Further mechanistic investigations revealed that the farnesoid x receptor (FXR) signaling pathway was not involved in regulating AKR1D1 by bile acids. Instead, CDCA and CA regulated AKR1D1 through the mitogen-activated protein kinases/c-Jun N-terminal kinases (MAPK/JNK) signaling pathway. Inhibition of the MAPK/JNK pathway effectively abolished CDCA and CA-mediated regulation of AKR1D1. It was thus determined that AKR1D1 expression was regulated by CDCA and CA through modulating the MAPK/JNK signaling pathway. In conclusion, AKR1D1 expression was differentially regulated by primary bile acids through negative and positive feedback mechanisms. The findings indicated that both bile acid concentrations and compositions play important roles in regulating AKR1D1 expression, and consequently bile acid synthesis and steroid hormone metabolism. PMID:28125709

  4. The Nitric Oxide Reductase Mechanism of a Flavo-Diiron Protein: Identification of Active-Site Intermediates and Products

    PubMed Central

    2015-01-01

    The unique active site of flavo-diiron proteins (FDPs) consists of a nonheme diiron-carboxylate site proximal to a flavin mononucleotide (FMN) cofactor. FDPs serve as the terminal components for reductive scavenging of dioxygen or nitric oxide to combat oxidative or nitrosative stress in bacteria, archaea, and some protozoan parasites. Nitric oxide is reduced to nitrous oxide by the four-electron reduced (FMNH2–FeIIFeII) active site. In order to clarify the nitric oxide reductase mechanism, we undertook a multispectroscopic presteady-state investigation, including the first Mössbauer spectroscopic characterization of diiron redox intermediates in FDPs. A new transient intermediate was detected and determined to be an antiferromagnetically coupled diferrous-dinitrosyl (S = 0, [{FeNO}7]2) species. This species has an exchange energy, J ≥ 40 cm–1 (JS1 ° S2), which is consistent with a hydroxo or oxo bridge between the two irons. The results show that the nitric oxide reductase reaction proceeds through successive formation of diferrous-mononitrosyl (S = 1/2, FeII{FeNO}7) and the S = 0 diferrous-dinitrosyl species. In the rate-determining process, the diferrous-dinitrosyl converts to diferric (FeIIIFeIII) and by inference N2O. The proximal FMNH2 then rapidly rereduces the diferric site to diferrous (FeIIFeII), which can undergo a second 2NO → N2O turnover. This pathway is consistent with previous results on the same deflavinated and flavinated FDP, which detected N2O as a product (HayashiBiochemistry2010, 49, 704020669924). Our results do not support other proposed mechanisms, which proceed either via “super-reduction” of [{FeNO}7]2 by FMNH2 or through FeII{FeNO}7 directly to a diferric-hyponitrite intermediate. The results indicate that an S = 0 [{FeNO}7}]2 complex is a proximal precursor to N–N bond formation and N–O bond cleavage to give N2O and that this conversion can occur without redox participation of the FMN cofactor. PMID:24828196

  5. 42 CFR 460.54 - Termination procedures.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... (CONTINUED) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) Sanctions, Enforcement Actions, and Termination § 460.54 Termination procedures. (a)...

  6. 42 CFR 460.54 - Termination procedures.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... (CONTINUED) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) Sanctions, Enforcement Actions, and Termination § 460.54 Termination procedures. (a)...

  7. 42 CFR 460.54 - Termination procedures.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... (CONTINUED) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) Sanctions, Enforcement Actions, and Termination § 460.54 Termination procedures. (a)...

  8. 42 CFR 460.54 - Termination procedures.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... (CONTINUED) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) Sanctions, Enforcement Actions, and Termination § 460.54 Termination procedures. (a)...

  9. 42 CFR 460.54 - Termination procedures.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... (CONTINUED) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) Sanctions, Enforcement Actions, and Termination § 460.54 Termination procedures. (a)...

  10. 48 CFR 12.403 - Termination.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... entitled “Termination for the Government's Convenience” and “Termination for Cause” contain concepts which... required to comply with the cost accounting standards or the contract cost principles in part 31....

  11. Ethynyl terminated imidothioethers and resins therefrom

    NASA Technical Reports Server (NTRS)

    Hergenrother, Paul M. (Inventor); Connell, John W. (Inventor); Bass, R. Gerald (Inventor)

    1989-01-01

    Ethynyl terminated imidothioethers (ETIs) are prepared by the reaction of a dimercaptan, such as 4,4'-dimercaptodiphenyl ether, and an ethynyl containing maleimide, such as N-(3-ethynylphenyl)maleimide. Blends of thse ETIs and ethynyl terminated polymeric materials, such as ethynyl terminated sulfones and ethynyl terminated arylene ethers, are also prepared. These resin blends exhibit excellent processability, and the cured blends show excellent fracture toughness and solvent resistance, as well as excellent adhesive and composite properties.

  12. Ethynyl terminated imidothioethers and resins therefrom

    NASA Technical Reports Server (NTRS)

    Hergenrother, Paul M. (Inventor); Connell, John W. (Inventor); Bass, R. Gerald (Inventor)

    1991-01-01

    Ethynyl terminated imidothioethers (ETIs) are prepared by the reaction of a dimercaptan, such as 4,4'-dimercaptodiphenyl ether, and an ethynyl containing maleimide, such as N-(3-ethynylphenyl)maleimide. Blends of these ETIs and ethynyl terminated polymeric materials, such as ethynyl terminated sulfones and ethynyl terminated arylene ethers, are also prepared. These resin blends exhibit excellent processability, and the cured blends show excellent fracture toughness and solvent resistance, as well as excellent adhesive and composite properties.

  13. Endothelial human dihydrofolate reductase low activity limits vascular tetrahydrobiopterin recycling

    PubMed Central

    Whitsett, Jennifer; Filho, Artur Rangel; Sethumadhavan, Savitha; Celinska, Joanna; Widlansky, Michael; Vásquez-Vivar, Jeannette

    2013-01-01

    Tetrahydrobiopterin (BH4) is required for NO synthesis and inhibition of superoxide release from eNOS. Clinical trials using BH4 to treat endothelial dysfunction have produced mixed results. Poor outcomes may be explained by the rapid systemic and cellular oxidation of BH4. One of the oxidation products of BH4, 7,8-dihydrobiopterin (7,8-BH2), is recycled back to BH4 by dihydrofolate reductase (DHFR). This enzyme is ubiquitously distributed and shows a wide range of activity depending on species-specific factors and cell type. Information about the kinetics and efficiency of BH4 recycling in human endothelial cells receiving BH4 treatment is lacking. To characterize this reaction, we applied a novel multi-electrode coulometric HPLC method that enabled the direct quantification of 7,8-BH2 and BH4 which is not possible with fluorescent-based methodologies. We found that basal untreated BH4 and 7,8-BH2 concentrations in human ECs is lower than bovine and murine endothelioma cells. Treatment of human ECs with BH4 transiently increased intracellular BH4 while accumulating the more stable 7,8-BH2. This was different from bovine or murine ECs that resulted in preferential BH4 increase. Using BH4 diastereomers, 6S-BH4 and 6R-BH4, the narrow contribution of enzymatic DHFR recycling to total intracellular BH4 was demonstrated. Reduction of 7,8-BH2 to BH4 occurs at very slow rates in cells and needs supra-physiological levels of 7,8-BH2, indicating this reaction is kinetically limited. Activity assays verified that hDHFR has very low affinity for 7,8-BH2 (DHF7,8-BH2) and folic acid inhibits 7,8-BH2 recycling. We conclude that low activity of endothelial DHFR is an important factor limiting the benefits of BH4 therapies which may be further aggravated by folate supplements. PMID:23707606

  14. Expression and purification of spinach nitrite reductase in E. coli

    SciTech Connect

    Bellissimo, D.; Privalle, L. )

    1991-03-11

    The study of structure-function relationships in nitrite reductase (NiR) by site-directed mutagenesis requires an expression system from which suitable quantities of active enzyme can be purified. Spinach NiR cDNA was cloned into pUC18 and expressed in E.coli JM109 as a beta-galactosidase fusion protein. The IPTG-induced fusion protein contains five additional amino acids at the N-terminus. The expressed NiR in aerobic cultures was mostly insoluble and inactive indicating the presence of inclusion bodies. By altering growth conditions, active NiR could represent 0.5-1.0% of the total E.coli protein, Effects of the addition of delta-aminolevulinic acid, a heme precursor, and anaerobic growth were also examined. Spinach NiR was purified approximately 200 fold to homogeneity. When subjected to electrophoresis on SDS polyacrylamide gels, the NiR migrated as a single band with similar mobility to pure spinach enzyme. The expressed enzyme also reacted with rabbit anti-spinach NiR antibody as visualized by Western blot analysis. The absorption spectrum of the E.coli-expressed enzyme was identical to spinach enzyme with a Soret and alpha band a 386 and 573 nm, respectively, and an A{sub 278}/A{sub 386} = 1.9. The addition of nitrite produced the characteristic shifts in the spectrum. The E. coli-expressed NiR catalyzed the methylviologen-dependent reduction of nitrite. The specific activity was 100 U/mg. The K{sub m} determined for nitrite was 0.3 mM which is in agreement with values reported for the enzyme. These results indicate that the E.coli-expressed NiR is fully comparable to spinach NiR in purity, catalytic activity and physical state. Site-directed mutants have been made using PCR to examine structure-function relationships in this enzyme.

  15. 49 CFR 374.309 - Terminal facilities.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 5 2010-10-01 2010-10-01 false Terminal facilities. 374.309 Section 374.309... REGULATIONS Adequacy of Intercity Motor Common Carrier Passenger Service § 374.309 Terminal facilities. (a... attendants and be regularly patrolled. (b) Outside facilities. At terminals and stations that are closed...

  16. 30 CFR 745.15 - Termination.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... PROGRAM STATE-FEDERAL COOPERATIVE AGREEMENTS § 745.15 Termination. (a) A cooperative agreement may be terminated by the State upon written notice to the Secretary, specifying the date upon which the cooperative... notice. (b) A cooperative agreement may be terminated by the Secretary after giving notice to the...

  17. 33 CFR 159.79 - Terminals.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 33 Navigation and Navigable Waters 2 2013-07-01 2013-07-01 false Terminals. 159.79 Section 159.79 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) POLLUTION MARINE SANITATION DEVICES Design, Construction, and Testing § 159.79 Terminals. Terminals must be solderless...

  18. 33 CFR 159.79 - Terminals.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 33 Navigation and Navigable Waters 2 2012-07-01 2012-07-01 false Terminals. 159.79 Section 159.79 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) POLLUTION MARINE SANITATION DEVICES Design, Construction, and Testing § 159.79 Terminals. Terminals must be solderless...

  19. 33 CFR 159.79 - Terminals.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Terminals. 159.79 Section 159.79 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) POLLUTION MARINE SANITATION DEVICES Design, Construction, and Testing § 159.79 Terminals. Terminals must be solderless...

  20. 12 CFR 1102.7 - Waiver termination.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 9 2012-01-01 2012-01-01 false Waiver termination. 1102.7 Section 1102.7 Banks and Banking FEDERAL FINANCIAL INSTITUTIONS EXAMINATION COUNCIL APPRAISER REGULATION Temporary Waiver Requests § 1102.7 Waiver termination. The ASC at any time may terminate a waiver order on the finding...