Robot-assisted microsurgical forceps with haptic feedback for transoral laser microsurgery.

PubMed

Deshpande, Nikhil; Chauhan, Manish; Pacchierotti, Claudio; Prattichizzo, Domenico; Caldwell, Darwin G; Mattos, Leonardo S

2016-08-01

In this paper, a novel, motorized, multi-degrees-of-freedom (DoF), microsurgical forceps tool is presented, which is based on a master-slave teleoperation architecture. The slave device is a 7-DoF manipulator with: (i) 6-DoF positioning and orientation, (ii) 1 open/close gripper DoF; and (iii) an integrated force/torque sensor for tissue grip-force measurement. The master device is a 7-DoF haptic interface which teleoperates the slave device, and provides haptic feedback in its gripper interface. The combination of the device and the surgeon interface replaces the manual, hand-held device providing easy-to-use and ergonomic tissue control, simplifying the surgical tasks. This makes the system suitable to real surgical scenarios in the operating room (OR). The performance of the system was analysed through the evaluation of teleoperation control and characterization of gripping force. The new system offers an overall positioning error of less than 400 μm demonstrating its safety and accuracy. Improved system precision, usability, and ergonomics point to the potential suitability of the device for the OR and its ability to advance haptic-feedback-enhanced transoral laser microsurgeries.

A coaxially focused multi-mode beam for optical coherence tomography imaging with extended depth of focus (Conference Presentation)

NASA Astrophysics Data System (ADS)

Yin, Biwei; Liang, Chia-Pin; Vuong, Barry; Tearney, Guillermo J.

2017-02-01

Conventional OCT images, obtained using a focused Gaussian beam have a lateral resolution of approximately 30 μm and a depth of focus (DOF) of 2-3 mm, defined as the confocal parameter (twice of Gaussian beam Rayleigh range). Improvement of lateral resolution without sacrificing imaging range requires techniques that can extend the DOF. Previously, we described a self-imaging wavefront division optical system that provided an estimated one order of magnitude DOF extension. In this study, we further investigate the properties of the coaxially focused multi-mode (CAFM) beam created by this self-imaging wavefront division optical system and demonstrate its feasibility for real-time biological tissue imaging. Gaussian beam and CAFM beam fiber optic probes with similar numerical apertures (objective NA≈0.5) were fabricated, providing lateral resolutions of approximately 2 μm. Rigorous lateral resolution characterization over depth was performed for both probes. The CAFM beam probe was found to be able to provide a DOF that was approximately one order of magnitude greater than that of Gaussian beam probe. By incorporating the CAFM beam fiber optic probe into a μOCT system with 1.5 μm axial resolution, we were able to acquire cross-sectional images of swine small intestine ex vivo, enabling the visualization of subcellular structures, providing high quality OCT images over more than a 300 μm depth range.

Structural design and static analysis of a double-ring deployable truss for mesh antennas

NASA Astrophysics Data System (ADS)

Xu, Yan; Guan, Fuling; Chen, Jianjun; Zheng, Yao

2012-12-01

This paper addresses the structural design, the deployment control design, the static analysis and the model testing of a new double-ring deployable truss that is intended for large mesh antennas. This deployable truss is a multi-DOF (degree-of-freedom), over-constrained mechanism. Two kinds of deployable basic elements were introduced, as well as a process to synthesise the structure of the deployable truss. The geometric equations were formulated to determine the length of each strut, including the effects of the joint size. A DOF evaluation showed that the mechanism requires two active cables and requires deployment control. An open-loop control system was designed to control the rotational velocities of two motors. The structural stiffness of the truss was assessed by static analysis that considered the effects of the constraint condition and the pre-stress of the passive cables. A 4.2-metre demonstration model of an antenna was designed and fabricated. The geometry and the deployment behaviour of the double-ring truss were validated by the experiments using this model.

Sensor fusion and computer vision for context-aware control of a multi degree-of-freedom prosthesis

NASA Astrophysics Data System (ADS)

Markovic, Marko; Dosen, Strahinja; Popovic, Dejan; Graimann, Bernhard; Farina, Dario

2015-12-01

Objective. Myoelectric activity volitionally generated by the user is often used for controlling hand prostheses in order to replicate the synergistic actions of muscles in healthy humans during grasping. Muscle synergies in healthy humans are based on the integration of visual perception, heuristics and proprioception. Here, we demonstrate how sensor fusion that combines artificial vision and proprioceptive information with the high-level processing characteristics of biological systems can be effectively used in transradial prosthesis control. Approach. We developed a novel context- and user-aware prosthesis (CASP) controller integrating computer vision and inertial sensing with myoelectric activity in order to achieve semi-autonomous and reactive control of a prosthetic hand. The presented method semi-automatically provides simultaneous and proportional control of multiple degrees-of-freedom (DOFs), thus decreasing overall physical effort while retaining full user control. The system was compared against the major commercial state-of-the art myoelectric control system in ten able-bodied and one amputee subject. All subjects used transradial prosthesis with an active wrist to grasp objects typically associated with activities of daily living. Main results. The CASP significantly outperformed the myoelectric interface when controlling all of the prosthesis DOF. However, when tested with less complex prosthetic system (smaller number of DOF), the CASP was slower but resulted with reaching motions that contained less compensatory movements. Another important finding is that the CASP system required minimal user adaptation and training. Significance. The CASP constitutes a substantial improvement for the control of multi-DOF prostheses. The application of the CASP will have a significant impact when translated to real-life scenarious, particularly with respect to improving the usability and acceptance of highly complex systems (e.g., full prosthetic arms) by amputees.

Sensor fusion and computer vision for context-aware control of a multi degree-of-freedom prosthesis.

PubMed

Markovic, Marko; Dosen, Strahinja; Popovic, Dejan; Graimann, Bernhard; Farina, Dario

2015-12-01

Myoelectric activity volitionally generated by the user is often used for controlling hand prostheses in order to replicate the synergistic actions of muscles in healthy humans during grasping. Muscle synergies in healthy humans are based on the integration of visual perception, heuristics and proprioception. Here, we demonstrate how sensor fusion that combines artificial vision and proprioceptive information with the high-level processing characteristics of biological systems can be effectively used in transradial prosthesis control. We developed a novel context- and user-aware prosthesis (CASP) controller integrating computer vision and inertial sensing with myoelectric activity in order to achieve semi-autonomous and reactive control of a prosthetic hand. The presented method semi-automatically provides simultaneous and proportional control of multiple degrees-of-freedom (DOFs), thus decreasing overall physical effort while retaining full user control. The system was compared against the major commercial state-of-the art myoelectric control system in ten able-bodied and one amputee subject. All subjects used transradial prosthesis with an active wrist to grasp objects typically associated with activities of daily living. The CASP significantly outperformed the myoelectric interface when controlling all of the prosthesis DOF. However, when tested with less complex prosthetic system (smaller number of DOF), the CASP was slower but resulted with reaching motions that contained less compensatory movements. Another important finding is that the CASP system required minimal user adaptation and training. The CASP constitutes a substantial improvement for the control of multi-DOF prostheses. The application of the CASP will have a significant impact when translated to real-life scenarious, particularly with respect to improving the usability and acceptance of highly complex systems (e.g., full prosthetic arms) by amputees.

An 8-DOF dual-arm system for advanced teleoperation performance experiments

NASA Technical Reports Server (NTRS)

Bejczy, Antal K.; Szakaly, Zoltan F.

1992-01-01

This paper describes the electro-mechanical and control features of an 8-DOF manipulator manufactured by AAI Corporation and installed at the Jet Propulsion Lab. (JPL) in a dual-arm setting. The 8-DOF arm incorporates a variety of features not found in other lab or industrial manipulators. Some of the unique features are: 8-DOF revolute configuration with no lateral offsets at joint axes; 1 to 5 payload to weight ratio with 20 kg (44 lb) payload at a 1.75 m (68.5 in.) reach; joint position measurement with dual relative encoders and potentiometer; infinite roll of joint 8 with electrical and fiber optic slip rings; internal fiber optic link of 'smart' end effectors; four-axis wrist; graphite epoxy links; high link and joint stiffness; use of an upgraded JPL Universal Motor Controller (UMC) capable of driving up to 16 joints. The 8-DOF arm is equipped with a 'smart' end effector which incorporates a 6-DOF forcemoment sensor at the end effector base and grasp force sensors at the base of the parallel jaws. The 8-DOF arm is interfaced to a 6 DOF force reflecting hand controller. The same system is duplicated for and installed at NASA-Langley.

The opercular mouth-opening mechanism of largemouth bass functions as a 3D four-bar linkage with three degrees of freedom.

PubMed

Olsen, Aaron M; Camp, Ariel L; Brainerd, Elizabeth L

2017-12-15

The planar, one degree of freedom (1-DoF) four-bar linkage is an important model for understanding the function, performance and evolution of numerous biomechanical systems. One such system is the opercular mechanism in fishes, which is thought to function like a four-bar linkage to depress the lower jaw. While anatomical and behavioral observations suggest some form of mechanical coupling, previous attempts to model the opercular mechanism as a planar four-bar have consistently produced poor model fits relative to observed kinematics. Using newly developed, open source mechanism fitting software, we fitted multiple three-dimensional (3D) four-bar models with varying DoF to in vivo kinematics in largemouth bass to test whether the opercular mechanism functions instead as a 3D four-bar with one or more DoF. We examined link position error, link rotation error and the ratio of output to input link rotation to identify a best-fit model at two different levels of variation: for each feeding strike and across all strikes from the same individual. A 3D, 3-DoF four-bar linkage was the best-fit model for the opercular mechanism, achieving link rotational errors of less than 5%. We also found that the opercular mechanism moves with multiple degrees of freedom at the level of each strike and across multiple strikes. These results suggest that active motor control may be needed to direct the force input to the mechanism by the axial muscles and achieve a particular mouth-opening trajectory. Our results also expand the versatility of four-bar models in simulating biomechanical systems and extend their utility beyond planar or single-DoF systems. © 2017. Published by The Company of Biologists Ltd.

Developing a multi-joint upper limb exoskeleton robot for diagnosis, therapy, and outcome evaluation in neurorehabilitation.

PubMed

Ren, Yupeng; Kang, Sang Hoon; Park, Hyung-Soon; Wu, Yi-Ning; Zhang, Li-Qun

2013-05-01

Arm impairments in patients post stroke involve the shoulder, elbow and wrist simultaneously. It is not very clear how patients develop spasticity and reduced range of motion (ROM) at the multiple joints and the abnormal couplings among the multiple joints and the multiple degrees-of-freedom (DOF) during passive movement. It is also not clear how they lose independent control of individual joints/DOFs and coordination among the joints/DOFs during voluntary movement. An upper limb exoskeleton robot, the IntelliArm, which can control the shoulder, elbow, and wrist, was developed, aiming to support clinicians and patients with the following integrated capabilities: 1) quantitative, objective, and comprehensive multi-joint neuromechanical pre-evaluation capabilities aiding multi-joint/DOF diagnosis for individual patients; 2) strenuous and safe passive stretching of hypertonic/deformed arm for loosening up muscles/joints based on the robot-aided diagnosis; 3) (assistive/resistive) active reaching training after passive stretching for regaining/improving motor control ability; and 4) quantitative, objective, and comprehensive neuromechanical outcome evaluation at the level of individual joints/DOFs, multiple joints, and whole arm. Feasibility of the integrated capabilities was demonstrated through experiments with stroke survivors and healthy subjects.

The JPL Serpentine Robot: A 12 DOF System for Inspection

NASA Technical Reports Server (NTRS)

Paljug, E.; Ohm, T.; Hayati, S.

1995-01-01

The Serpentine Robot is a prototype hyper-redundant (snake-like) manipulator system developed at the Jet Propulsion Laboratory. It is designed to navigate and perform tasks in obstructed and constrained environments in which conventional 6 DOF manipulators cannot function. Described are the robot mechanical design, a joint assembly low level inverse kinematic algorithm, control development, and applications.

Estimation of continuous multi-DOF finger joint kinematics from surface EMG using a multi-output Gaussian Process.

PubMed

Ngeo, Jimson; Tamei, Tomoya; Shibata, Tomohiro

2014-01-01

Surface electromyographic (EMG) signals have often been used in estimating upper and lower limb dynamics and kinematics for the purpose of controlling robotic devices such as robot prosthesis and finger exoskeletons. However, in estimating multiple and a high number of degrees-of-freedom (DOF) kinematics from EMG, output DOFs are usually estimated independently. In this study, we estimate finger joint kinematics from EMG signals using a multi-output convolved Gaussian Process (Multi-output Full GP) that considers dependencies between outputs. We show that estimation of finger joints from muscle activation inputs can be improved by using a regression model that considers inherent coupling or correlation within the hand and finger joints. We also provide a comparison of estimation performance between different regression methods, such as Artificial Neural Networks (ANN) which is used by many of the related studies. We show that using a multi-output GP gives improved estimation compared to multi-output ANN and even dedicated or independent regression models.

Feasibility and concept study to convert the NASA/AMES vertical motion simulator to a helicopter simulator

NASA Technical Reports Server (NTRS)

Belsterling, C. A.; Chou, R. C.; Davies, E. G.; Tsui, K. C.

1978-01-01

The conceptual design for converting the vertical motion simulator (VMS) to a multi-purpose aircraft and helicopter simulator is presented. A unique, high performance four degrees of freedom (DOF) motion system was developed to permanently replace the present six DOF synergistic system. The new four DOF system has the following outstanding features: (1) will integrate with the two large VMS translational modes and their associated subsystems; (2) can be converted from helicopter to fixed-wing aircraft simulation through software changes only; (3) interfaces with an advanced cab/visual display system of large dimensions; (4) makes maximum use of proven techniques, convenient materials and off-the-shelf components; (5) will operate within the existing building envelope without modifications; (6) can be built within the specified weight limit and avoid compromising VMS performance; (7) provides maximum performance with a minimum of power consumption; (8) simple design minimizes coupling between motions and maximizes reliability; and (9) can be built within existing budgetary figures.

Development of a simple system for simultaneously measuring 6DOF geometric motion errors of a linear guide.

PubMed

Qibo, Feng; Bin, Zhang; Cunxing, Cui; Cuifang, Kuang; Yusheng, Zhai; Fenglin, You

2013-11-04

A simple method for simultaneously measuring the 6DOF geometric motion errors of the linear guide was proposed. The mechanisms for measuring straightness and angular errors and for enhancing their resolution are described in detail. A common-path method for measuring the laser beam drift was proposed and it was used to compensate the errors produced by the laser beam drift in the 6DOF geometric error measurements. A compact 6DOF system was built. Calibration experiments with certain standard measurement meters showed that our system has a standard deviation of 0.5 µm in a range of ± 100 µm for the straightness measurements, and standard deviations of 0.5", 0.5", and 1.0" in the range of ± 100" for pitch, yaw, and roll measurements, respectively.

A Generalized Method for Automatic Downhand and Wirefeed Control of a Welding Robot and Positioner

NASA Technical Reports Server (NTRS)

Fernandez, Ken; Cook, George E.

1988-01-01

A generalized method for controlling a six degree-of-freedom (DOF) robot and a two DOF positioner used for arc welding operations is described. The welding path is defined in the part reference frame, and robot/positioner joint angles of the equivalent eight DOF serial linkage are determined via an iterative solution. Three algorithms are presented: the first solution controls motion of the eight DOF mechanism such that proper torch motion is achieved while minimizing the sum-of-squares of joint displacements; the second algorithm adds two constraint equations to achieve torch control while maintaining part orientation so that welding occurs in the downhand position; and the third algorithm adds the ability to control the proper orientation of a wire feed mechanism used in gas tungsten arc (GTA) welding operations. A verification of these algorithms is given using ROBOSIM, a NASA developed computer graphic simulation software package design for robot systems development.

Topology search of 3-DOF translational parallel manipulators with three identical limbs for leg mechanisms

NASA Astrophysics Data System (ADS)

Wang, Mingfeng; Ceccarelli, Marco

2015-07-01

Three-degree of freedom(3-DOF) translational parallel manipulators(TPMs) have been widely studied both in industry and academia in the past decades. However, most architectures of 3-DOF TPMs are created mainly on designers' intuition, empirical knowledge, or associative reasoning and the topology synthesis researches of 3-DOF TPMs are still limited. In order to find out the atlas of designs for 3-DOF TPMs, a topology search is presented for enumeration of 3-DOF TPMs whose limbs can be modeled as 5-DOF serial chains. The proposed topology search of 3-DOF TPMs is aimed to overcome the sensitivities of the design solution of a 3-DOF TPM for a LARM leg mechanism in a biped robot. The topology search, which is based on the concept of generation and specialization in graph theory, is reported as a step-by-step procedure with desired specifications, principle and rules of generalization, design requirements and constraints, and algorithm of number synthesis. In order to obtain new feasible designs for a chosen example and to limit the search domain under general considerations, one topological generalized kinematic chain is chosen to be specialized. An atlas of new feasible designs is obtained and analyzed for a specific solution as leg mechanisms. The proposed methodology provides a topology search for 3-DOF TPMs for leg mechanisms, but it can be also expanded for other applications and tasks.

New Terfenol-D actuator design with applications to multiple DOF active vibration control

NASA Astrophysics Data System (ADS)

Haynes, Leonard S.; Geng, Zheng J.; Teter, Joseph P.

1993-09-01

A linear actuator system for multi-dimensional structure control using the magnetostrictive material Terfenol-D has been designed, built, and tested by the Intelligent Automation, Inc. The actuator assembly incorporates an instrumented Terfenol-D rod, an excitation coil to provide the magnetic field, a permanent magnet assembly to provide a magnetic bias field, and a mechanical preload mechanism. The prototype of the actuator is 2.0 inches in diameter and 8 inches long, and provides a peak-to-peak stroke of 0.01 inches. A linear model was also established to characterize the behavior of the actuator for small motion. Based on the prototype of the actuator, we have performed a study of a six degree-of-freedom active vibration isolation system using a Stewart Platform in a new configuration. IAI's final system is intended for precision control of a wide range of space-based structures as well as earth- base systems.

A new continuous sliding mode control approach with actuator saturation for control of 2-DOF helicopter system.

PubMed

Sadala, S P; Patre, B M

2018-03-01

The 2-degree of freedom (DOF) helicopter system is a typical higher-order, multi-variable, nonlinear and strong coupled control system. The helicopter dynamics also includes parametric uncertainties and is subject to unknown external disturbances. Such complicated system requires designing a sophisticated control algorithm that can handle these difficulties. This paper presents a new robust control algorithm which is a combination of two continuous control techniques, composite nonlinear feedback (CNF) and super-twisting control (STC) methods. In the existing integral sliding mode (ISM) based CNF control law, the discontinuous term exhibits chattering which is not desirable for many practical applications. As the continuity of well known STC reduces chattering in the system, the proposed strategy is beneficial over the current ISM based CNF control law which has a discontinuous term. Two controllers with integral sliding surface are designed to control the position of the pitch and the yaw angles of the 2- DOF helicopter. The adequacy of this specific combination has been exhibited through general analysis, simulation and experimental results of 2-DOF helicopter setup. The acquired results demonstrate the good execution of the proposed controller regarding stabilization, following reference input without overshoot against actuator saturation and robustness concerning to the limited matched disturbances. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

Multi-sensor calibration of low-cost magnetic, angular rate and gravity systems.

PubMed

Lüken, Markus; Misgeld, Berno J E; Rüschen, Daniel; Leonhardt, Steffen

2015-10-13

We present a new calibration procedure for low-cost nine degrees-of-freedom (9DOF) magnetic, angular rate and gravity (MARG) sensor systems, which relies on a calibration cube, a reference table and a body sensor network (BSN). The 9DOF MARG sensor is part of our recently-developed "Integrated Posture and Activity Network by Medit Aachen" (IPANEMA) BSN. The advantage of this new approach is the use of the calibration cube, which allows for easy integration of two sensor nodes of the IPANEMA BSN. One 9DOF MARG sensor node is thereby used for calibration; the second 9DOF MARG sensor node is used for reference measurements. A novel algorithm uses these measurements to further improve the performance of the calibration procedure by processing arbitrarily-executed motions. In addition, the calibration routine can be used in an alignment procedure to minimize errors in the orientation between the 9DOF MARG sensor system and a motion capture inertial reference system. A two-stage experimental study is conducted to underline the performance of our calibration procedure. In both stages of the proposed calibration procedure, the BSN data, as well as reference tracking data are recorded. In the first stage, the mean values of all sensor outputs are determined as the absolute measurement offset to minimize integration errors in the derived movement model of the corresponding body segment. The second stage deals with the dynamic characteristics of the measurement system where the dynamic deviation of the sensor output compared to a reference system is Sensors 2015, 15 25920 corrected. In practical validation experiments, this procedure showed promising results with a maximum RMS error of 3.89°.

Multi-Sensor Calibration of Low-Cost Magnetic, Angular Rate and Gravity Systems

PubMed Central

Lüken, Markus; Misgeld, Berno J.E.; Rüschen, Daniel; Leonhardt, Steffen

2015-01-01

We present a new calibration procedure for low-cost nine degrees-of-freedom (9DOF) magnetic, angular rate and gravity (MARG) sensor systems, which relies on a calibration cube, a reference table and a body sensor network (BSN). The 9DOF MARG sensor is part of our recently-developed “Integrated Posture and Activity Network by Medit Aachen” (IPANEMA) BSN. The advantage of this new approach is the use of the calibration cube, which allows for easy integration of two sensor nodes of the IPANEMA BSN. One 9DOF MARG sensor node is thereby used for calibration; the second 9DOF MARG sensor node is used for reference measurements. A novel algorithm uses these measurements to further improve the performance of the calibration procedure by processing arbitrarily-executed motions. In addition, the calibration routine can be used in an alignment procedure to minimize errors in the orientation between the 9DOF MARG sensor system and a motion capture inertial reference system. A two-stage experimental study is conducted to underline the performance of our calibration procedure. In both stages of the proposed calibration procedure, the BSN data, as well as reference tracking data are recorded. In the first stage, the mean values of all sensor outputs are determined as the absolute measurement offset to minimize integration errors in the derived movement model of the corresponding body segment. The second stage deals with the dynamic characteristics of the measurement system where the dynamic deviation of the sensor output compared to a reference system is corrected. In practical validation experiments, this procedure showed promising results with a maximum RMS error of 3.89°. PMID:26473873

NASA MSFC hardware in the loop simulations of automatic rendezvous and capture systems

NASA Technical Reports Server (NTRS)

Tobbe, Patrick A.; Naumann, Charles B.; Sutton, William; Bryan, Thomas C.

1991-01-01

Two complementary hardware-in-the-loop simulation facilities for automatic rendezvous and capture systems at MSFC are described. One, the Flight Robotics Laboratory, uses an 8 DOF overhead manipulator with a work volume of 160 by 40 by 23 feet to evaluate automatic rendezvous algorithms and range/rate sensing systems. The other, the Space Station/Station Operations Mechanism Test Bed, uses a 6 DOF hydraulic table to perform docking and berthing dynamics simulations.

Sensory-Feedback Exoskeletal Arm Controller

NASA Technical Reports Server (NTRS)

An, Bin; Massie, Thomas H.; Vayner, Vladimir

2004-01-01

An electromechanical exoskeletal arm apparatus has been designed for use in controlling a remote robotic manipulator arm. The apparatus, called a force-feedback exoskeleton arm master (F-EAM) is comfortable to wear and easy to don and doff. It provides control signals from the wearer s arm to a robot arm or a computer simulator (e.g., a virtual-reality system); it also provides force and torque feedback from sensors on the robot arm or from the computer simulator to the wearer s arm. The F-EAM enables the wearer to make the robot arm gently touch objects and finely manipulate them without exerting excessive forces. The F-EAM features a lightweight design in which the motors and gear heads that generate force and torque feedback are made smaller than they ordinarily would be: this is achieved by driving the motors to power levels greater than would ordinarily be used in order to obtain higher torques, and by providing active liquid cooling of the motors to prevent overheating at the high drive levels. The F-EAM (see figure) includes an assembly that resembles a backpack and is worn like a backpack, plus an exoskeletal arm mechanism. The FEAM has five degrees of freedom (DOFs) that correspond to those of the human arm: 1. The first DOF is that of the side-to-side rotation of the upper arm about the shoulder (rotation about axis 1). The reflected torque for this DOF is provided by motor 1 via drum 1 and a planar four-bar linkage. 2. The second DOF is that of the up-and-down rotation of the arm about the shoulder. The reflected torque for this DOF is provided by motor 2 via drum 2. 3. The third DOF is that of twisting of the upper arm about its longitudinal axis. This DOF is implemented in a cable remote-center mechanism (CRCM). The reflected torque for this DOF is provided by motor 3, which drives the upper-arm cuff and the mechanism below it. A bladder inflatable by gas or liquid is placed between the cuff and the wearer s upper arm to compensate for misalignment between the exoskeletal mechanism and the shoulder. 4. The fourth DOF is that of flexion and extension of the elbow. The reflected torque for this DOF is provided by motor 4 and drum 4, which are mounted on a bracket that can slide longitudinally by a pin-and-slot engagement with the upper-arm cuff to compensate for slight variations in the position of the kinematic center of the elbow. Attached to drum 4 is an adapter plate to which is attached a CRCM for the lower arm. 5. The lower-arm CRCM implements the fifth DOF, which is the twist of the forearm about its longitudinal axis. Motor 5 provides the reflected torque for this DOF by driving the lower-arm cuff. A rod transmits twist and torsion between the lower-arm cuff and the hand cuff. With this system, the motion of the wearer s joints and the reflected torques applied to these joints can be measured and controlled in a relatively simple manner. This is because the anthropomorphic design of the mechanism imitates the kinematics of the human arm, eliminating the need for kinematic conversion of joint-torque and joint-angle data.

Vortex-induced vibrations of two cylinders in tandem arrangement in the proximity–wake interference region

PubMed Central

BORAZJANI, IMAN; SOTIROPOULOS, FOTIS

2009-01-01

We investigate numerically vortex-induced vibrations (VIV) of two identical two-dimensional elastically mounted cylinders in tandem in the proximity–wake interference regime at Reynolds number Re = 200 for systems having both one (transverse vibrations) and two (transverse and in-line) degrees of freedom (1-DOF and 2-DOF, respectively). For the 1-DOF system the computed results are in good qualitative agreement with available experiments at higher Reynolds numbers. Similar to these experiments our simulations reveal: (1) larger amplitudes of motion and a wider lock-in region for the tandem arrangement when compared with an isolated cylinder; (2) that at low reduced velocities the vibration amplitude of the front cylinder exceeds that of the rear cylinder; and (3) that above a threshold reduced velocity, large-amplitude VIV are excited for the rear cylinder with amplitudes significantly larger than those of the front cylinder. By analysing the simulated flow patterns we identify the VIV excitation mechanisms that lead to such complex responses and elucidate the near-wake vorticity dynamics and vortex-shedding modes excited in each case. We show that at low reduced velocities vortex shedding provides the initial excitation mechanism, which gives rise to a vertical separation between the two cylinders. When this vertical separation exceeds one cylinder diameter, however, a significant portion of the incoming flow is able to pass through the gap between the two cylinders and the gap-flow mechanism starts to dominate the VIV dynamics. The gap flow is able to periodically force either the top or the bottom shear layer of the front cylinder into the gap region, setting off a series of very complex vortex-to-vortex and vortex-to-cylinder interactions, which induces pressure gradients that result in a large oscillatory force in phase with the vortex shedding and lead to the experimentally observed larger vibration amplitudes. When the vortex shedding is the dominant mechanism the front cylinder vibration amplitude is larger than that of the rear cylinder. The reversing of this trend above a threshold reduced velocity is associated with the onset of the gap flow. The important role of the gap flow is further illustrated via a series of simulations for the 2-DOF system. We show that when the gap-flow mechanism is triggered, the 2-DOF system can develop and sustain large VIV amplitudes comparable to those observed in the corresponding (same reduced velocity) 1-DOF system. For sufficiently high reduced velocities, however, the two cylinders in the 2-DOF system approach each other, thus significantly reducing the size of the gap region. In such cases the gap flow is entirely eliminated, and the two cylinders vibrate together as a single body with vibration amplitudes up to 50% lower than the amplitudes of the corresponding 1-DOF in which the gap flow is active. Three-dimensional simulations are also carried out to examine the adequacy of two-dimensional simulations for describing the dynamic response of the tandem system at Re = 200. It is shown that even though the wake transitions to a weakly three-dimensional state when the gap flow is active, the three-dimensional modes are too weak to affect the dynamic response of the system, which is found to be identical to that obtained from the two-dimensional computations. PMID:19693281

Optimal combination of minimum degrees of freedom to be actuated in the lower limbs to facilitate arm-free paraplegic standing.

PubMed

Kim, Joon-Young; Mills, James K; Vette, Albert H; Popovic, Milos R

2007-12-01

Arm-free paraplegic standing via functional electrical stimulation (FES) has drawn much attention in the biomechanical field as it might allow a paraplegic to stand and simultaneously use both arms to perform daily activities. However, current FES systems for standing require that the individual actively regulates balance using one or both arms, thus limiting the practical use of these systems. The purpose of the present study was to show that actuating only six out of 12 degrees of freedom (12-DOFs) in the lower limbs to allow paraplegics to stand freely is theoretically feasible with respect to multibody stability and physiological torque limitations of the lower limb DOF. Specifically, the goal was to determine the optimal combination of the minimum DOF that can be realistically actuated using FES while ensuring stability and able-bodied kinematics during perturbed arm-free standing. The human body was represented by a three-dimensional dynamics model with 12-DOFs in the lower limbs. Nakamura's method (Nakamura, Y., and Ghodoussi, U., 1989, "Dynamics Computation of Closed-Link Robot Mechanisms With Nonredundant and Redundant Actuators," IEEE Trans. Rob. Autom., 5(3), pp. 294-302) was applied to estimate the joint torques of the system using experimental motion data from four healthy subjects. The torques were estimated by applying our previous finding that only 6 (6-DOFs) out of 12-DOFs in the lower limbs need to be actuated to facilitate stable standing. Furthermore, it was shown that six cases of 6-DOFs exist, which facilitate stable standing. In order to characterize each of these cases in terms of the torque generation patterns and to identify a potential optimal 6-DOF combination, the joint torques during perturbations in eight different directions were estimated for all six cases of 6-DOFs. The results suggest that the actuation of both ankle flexionextension, both knee flexionextension, one hip flexionextension, and one hip abductionadduction DOF will result in the minimum torque requirements to regulate balance during perturbed standing. To facilitate unsupported FES-assisted standing, it is sufficient to actuate only 6-DOFs. An optimal combination of 6-DOFs exists, for which this system can generate able-bodied kinematics while requiring lower limb joint torques that are producible using contemporary FES technology. These findings suggest that FES-assisted arm-free standing of paraplegics is theoretically feasible, even when limited by the fact that muscles actuating specific DOFs are often denervated or difficult to access.

Mode-based equivalent multi-degree-of-freedom system for one-dimensional viscoelastic response analysis of layered soil deposit

NASA Astrophysics Data System (ADS)

Li, Chong; Yuan, Juyun; Yu, Haitao; Yuan, Yong

2018-01-01

Discrete models such as the lumped parameter model and the finite element model are widely used in the solution of soil amplification of earthquakes. However, neither of the models will accurately estimate the natural frequencies of soil deposit, nor simulate a damping of frequency independence. This research develops a new discrete model for one-dimensional viscoelastic response analysis of layered soil deposit based on the mode equivalence method. The new discrete model is a one-dimensional equivalent multi-degree-of-freedom (MDOF) system characterized by a series of concentrated masses, springs and dashpots with a special configuration. The dynamic response of the equivalent MDOF system is analytically derived and the physical parameters are formulated in terms of modal properties. The equivalent MDOF system is verified through a comparison of amplification functions with the available theoretical solutions. The appropriate number of degrees of freedom (DOFs) in the equivalent MDOF system is estimated. A comparative study of the equivalent MDOF system with the existing discrete models is performed. It is shown that the proposed equivalent MDOF system can exactly present the natural frequencies and the hysteretic damping of soil deposits and provide more accurate results with fewer DOFs.

Intelligent Robotic Systems Study (IRSS), phase 4

NASA Technical Reports Server (NTRS)

1991-01-01

Under the Intelligent Robotics Systems Study (IRSS), a generalized robotic control architecture was developed for use with the ProtoFlight Manipulator Arm (PFMA). Based upon the NASREM system design concept, the controller built for the PFMA provides localized position based force control, teleoperation, and advanced path recording and playback capabilities. The PFMA has six computer controllable degrees of freedom (DOF) plus a 7th manually indexable DOF, making the manipulator a pseudo 7 DOF mechanism. Joints on the PFMA are driven via 7 pulse width modulated amplifiers. Digital control of the PFMA is implemented using a variety of single board computers. There were two major activities under the IRSS phase 4 study: (1) enhancement of the PFMA control system software functionality; and (2) evaluation of operating modes via a teleoperation performance study. These activities are described and results are given.

Finite-time synchronization for second-order nonlinear multi-agent system via pinning exponent sliding mode control.

PubMed

Hou, Huazhou; Zhang, Qingling

2016-11-01

In this paper we investigate the finite-time synchronization for second-order multi-agent system via pinning exponent sliding mode control. Firstly, for the nonlinear multi-agent system, differential mean value theorem is employed to transfer the nonlinear system into linear system, then, by pinning only one node in the system with novel exponent sliding mode control, we can achieve synchronization in finite time. Secondly, considering the 3-DOF helicopter system with nonlinear dynamics and disturbances, the novel exponent sliding mode control protocol is applied to only one node to achieve the synchronization. Finally, the simulation results show the effectiveness and the advantages of the proposed method. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

Type synthesis for 4-DOF parallel press mechanism using GF set theory

NASA Astrophysics Data System (ADS)

He, Jun; Gao, Feng; Meng, Xiangdun; Guo, Weizhong

2015-07-01

Parallel mechanisms is used in the large capacity servo press to avoid the over-constraint of the traditional redundant actuation. Currently, the researches mainly focus on the performance analysis for some specific parallel press mechanisms. However, the type synthesis and evaluation of parallel press mechanisms is seldom studied, especially for the four degrees of freedom(DOF) press mechanisms. The type synthesis of 4-DOF parallel press mechanisms is carried out based on the generalized function(GF) set theory. Five design criteria of 4-DOF parallel press mechanisms are firstly proposed. The general procedure of type synthesis of parallel press mechanisms is obtained, which includes number synthesis, symmetrical synthesis of constraint GF sets, decomposition of motion GF sets and design of limbs. Nine combinations of constraint GF sets of 4-DOF parallel press mechanisms, ten combinations of GF sets of active limbs, and eleven combinations of GF sets of passive limbs are synthesized. Thirty-eight kinds of press mechanisms are presented and then different structures of kinematic limbs are designed. Finally, the geometrical constraint complexity( GCC), kinematic pair complexity( KPC), and type complexity( TC) are proposed to evaluate the press types and the optimal press type is achieved. The general methodologies of type synthesis and evaluation for parallel press mechanism are suggested.

SU-F-T-347: An Absolute Dose-Volume Constraint Based Deterministic Optimization Framework for Multi-Co60 Source Focused Radiotherapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang, B; Liu, B; Li, Y

2016-06-15

Purpose: Treatment plan optimization in multi-Co60 source focused radiotherapy with multiple isocenters is challenging, because dose distribution is normalized to maximum dose during optimization and evaluation. The objective functions are traditionally defined based on relative dosimetric distribution. This study presents an alternative absolute dose-volume constraint (ADC) based deterministic optimization framework (ADC-DOF). Methods: The initial isocenters are placed on the eroded target surface. Collimator size is chosen based on the area of 2D contour on corresponding axial slice. The isocenter spacing is determined by adjacent collimator sizes. The weights are optimized by minimizing the deviation from ADCs using the steepest descentmore » technique. An iterative procedure is developed to reduce the number of isocenters, where the isocenter with lowest weight is removed without affecting plan quality. The ADC-DOF is compared with the genetic algorithm (GA) using the same arbitrary shaped target (254cc), with a 15mm margin ring structure representing normal tissues. Results: For ADC-DOF, the ADCs imposed on target and ring are (D100>10Gy, D50,10, 0<12Gy, 15Gy and 20Gy) and (D40<10Gy). The resulting D100, 50, 10, 0 and D40 are (9.9Gy, 12.0Gy, 14.1Gy and 16.2Gy) and (10.2Gy). The objectives of GA are to maximize 50% isodose target coverage (TC) while minimize the dose delivered to the ring structure, which results in 97% TC and 47.2% average dose in ring structure. For ADC-DOF (GA) techniques, 20 out of 38 (10 out of 12) initial isocenters are used in the final plan, and the computation time is 8.7s (412.2s) on an i5 computer. Conclusion: We have developed a new optimization technique using ADC and deterministic optimization. Compared with GA, ADC-DOF uses more isocenters but is faster and more robust, and achieves a better conformity. For future work, we will focus on developing a more effective mechanism for initial isocenter determination.« less

Quantum Computation Based on Photons with Three Degrees of Freedom

PubMed Central

Luo, Ming-Xing; Li, Hui-Ran; Lai, Hong; Wang, Xiaojun

2016-01-01

Quantum systems are important resources for quantum computer. Different from previous encoding forms using quantum systems with one degree of freedom (DoF) or two DoFs, we investigate the possibility of photon systems encoding with three DoFs consisting of the polarization DoF and two spatial DoFs. By exploring the optical circular birefringence induced by an NV center in a diamond embedded in the photonic crystal cavity, we propose several hybrid controlled-NOT (hybrid CNOT) gates operating on the two-photon or one-photon system. These hybrid CNOT gates show that three DoFs may be encoded as independent qubits without auxiliary DoFs. Our result provides a useful way to reduce quantum simulation resources by exploring complex quantum systems for quantum applications requiring large qubit systems. PMID:27174302

Quantum Computation Based on Photons with Three Degrees of Freedom.

PubMed

Luo, Ming-Xing; Li, Hui-Ran; Lai, Hong; Wang, Xiaojun

2016-05-13

Quantum systems are important resources for quantum computer. Different from previous encoding forms using quantum systems with one degree of freedom (DoF) or two DoFs, we investigate the possibility of photon systems encoding with three DoFs consisting of the polarization DoF and two spatial DoFs. By exploring the optical circular birefringence induced by an NV center in a diamond embedded in the photonic crystal cavity, we propose several hybrid controlled-NOT (hybrid CNOT) gates operating on the two-photon or one-photon system. These hybrid CNOT gates show that three DoFs may be encoded as independent qubits without auxiliary DoFs. Our result provides a useful way to reduce quantum simulation resources by exploring complex quantum systems for quantum applications requiring large qubit systems.

Bistable energy harvesting enhancement with an auxiliary linear oscillator

NASA Astrophysics Data System (ADS)

Harne, R. L.; Thota, M.; Wang, K. W.

2013-12-01

Recent work has indicated that linear vibrational energy harvesters with an appended degree-of-freedom (DOF) may be advantageous for introducing new dynamic forms to extend the operational bandwidth. Given the additional interest in bistable harvester designs, which exhibit a propitious snap through effect from one stable state to the other, it is a logical extension to explore the influence of an added DOF to a bistable system. However, bistable snap through is not a resonant phenomenon, which tempers the presumption that the dynamics induced by an additional DOF on bistable designs would inherently be beneficial as for linear systems. This paper presents two analytical formulations to assess the fundamental and superharmonic steady-state dynamics of an excited bistable energy harvester to which is attached an auxiliary linear oscillator. From an energy harvesting perspective, the model predicts that the additional linear DOF uniformly amplifies the bistable harvester response magnitude and generated power for excitation frequencies less than the attachment’s resonance while improved power density spans a bandwidth below this frequency. Analyses predict bandwidths having co-existent responses composed of a unique proportion of fundamental and superharmonic dynamics. Experiments validate key analytical predictions and observe the ability for the coupled system to develop an advantageous multi-harmonic interwell response when the initial conditions are insufficient for continuous high-energy orbit at the excitation frequency. Overall, the addition of an auxiliary linear oscillator to a bistable harvester is found to be an effective means of enhancing the energy harvesting performance and robustness.

Nonlinear dynamics and health monitoring of 6-DOF breathing cracked Jeffcott rotor

NASA Astrophysics Data System (ADS)

Zhao, Jie; DeSmidt, Hans; Yao, Wei

2015-04-01

Jeffcott rotor is employed to study the nonlinear vibration characteristics of breathing cracked rotor system and explore the possibility of further damage identification. This paper is an extension work of prior study based on 4 degree-of-freedom Jeffcott rotor system. With consideration of disk tilting and gyroscopic effect, 6-dof EOM is derived and the crack model is established using SERR (strain energy release rate) in facture mechanics. Same as the prior work, the damaged stiffness matrix is updated by computing the instant crack closure line through Zero Stress Intensity Factor method. The breathing crack area is taken as a variable to analyze the breathing behavior in terms of eccentricity phase and shaft speed. Furthermore, the coupled vibration among lateral, torsional and longitudinal d.o.f is studied under torsional/axial excitation. The final part demonstrates the possibility of using vibration signal of damaged system for the crack diagnosis and health monitoring.

TH-AB-202-11: Spatial and Rotational Quality Assurance of 6DOF Patient Tracking Systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belcher, AH; Liu, X; Grelewicz, Z

2016-06-15

Purpose: External tracking systems used for patient positioning and motion monitoring during radiotherapy are now capable of detecting both translations and rotations (6DOF). In this work, we develop a novel technique to evaluate the 6DOF performance of external motion tracking systems. We apply this methodology to an infrared (IR) marker tracking system and two 3D optical surface mapping systems in a common tumor 6DOF workspace. Methods: An in-house designed and built 6DOF parallel kinematics robotic motion phantom was used to follow input trajectories with sub-millimeter and sub-degree accuracy. The 6DOF positions of the robotic system were then tracked and recordedmore » independently by three optical camera systems. A calibration methodology which associates the motion phantom and camera coordinate frames was first employed, followed by a comprehensive 6DOF trajectory evaluation, which spanned a full range of positions and orientations in a 20×20×16 mm and 5×5×5 degree workspace. The intended input motions were compared to the calibrated 6DOF measured points. Results: The technique found the accuracy of the IR marker tracking system to have maximal root mean square error (RMSE) values of 0.25 mm translationally and 0.09 degrees rotationally, in any one axis, comparing intended 6DOF positions to positions measured by the IR camera. The 6DOF RSME discrepancy for the first 3D optical surface tracking unit yielded maximal values of 0.60 mm and 0.11 degrees over the same 6DOF volume. An earlier generation 3D optical surface tracker was observed to have worse tracking capabilities than both the IR camera unit and the newer 3D surface tracking system with maximal RMSE of 0.74 mm and 0.28 degrees within the same 6DOF evaluation space. Conclusion: The proposed technique was effective at evaluating the performance of 6DOF patient tracking systems. All systems examined exhibited tracking capabilities at the sub-millimeter and sub-degree level within a 6DOF workspace.« less

Raven-II: an open platform for surgical robotics research.

PubMed

Hannaford, Blake; Rosen, Jacob; Friedman, Diana W; King, Hawkeye; Roan, Phillip; Cheng, Lei; Glozman, Daniel; Ma, Ji; Kosari, Sina Nia; White, Lee

2013-04-01

The Raven-II is a platform for collaborative research on advances in surgical robotics. Seven universities have begun research using this platform. The Raven-II system has two 3-DOF spherical positioning mechanisms capable of attaching interchangeable four DOF instruments. The Raven-II software is based on open standards such as Linux and ROS to maximally facilitate software development. The mechanism is robust enough for repeated experiments and animal surgery experiments, but is not engineered to sufficient safety standards for human use. Mechanisms in place for interaction among the user community and dissemination of results include an electronic forum, an online software SVN repository, and meetings and workshops at major robotics conferences.

Design and control of a multi-DOF micromanipulator dedicated to multiscale micromanipulation

NASA Astrophysics Data System (ADS)

Yang, Yi-Ling; Wei, Yan-Ding; Lou, Jun-Qiang; Fu, Lei; Fang, Sheng

2017-11-01

This paper presents the design, implementation and control of a new piezoelectrically actuated compliant micromanipulator dedicated to multiscale, precision and reliable operations. To begin with, the manipulator is devised to obtain multi degrees of freedom and large workspace ranges. Two-stage amplification mechanisms (consists of the leverage and the rocker mechanisms) and composite parallelogram mechanisms are combined to construct the lower microstage. Meanwhile, the structure design of the upper dual-driven microgripper is based on the bridge-type mechanism and the unilateral parallelogram mechanism. Through finite-element analysis, the structural parameters of the micromanipulator are optimized and the structural interaction performances are examined. Moreover, a cooperative control strategy is proposed to achieve the synchronous control of the motion trajectory, the gripper position and the contact force. Precision motion control in terms of the hysteresis phenomenon and system disturbances is ensured by using an adaptive sliding mode control (SMC). In particular, an improved nonsymmetrical Bouc-Wen model and a fuzzy regulator are proposed in the SMC. Several experimental investigations are conducted to validate the effectiveness of the developed micromanipulator by performing transferring operations of a micro-object. Experimental results demonstrate that the micromanipulator presents good characteristics, and precision and robust operation can be acquired using the cooperative controller.

Two-degrees-of-freedom piezo-driven fast steering mirror with cross-axis decoupling capability

NASA Astrophysics Data System (ADS)

Shao, Shubao; Tian, Zheng; Song, Siyang; Xu, Minglong

2018-05-01

Because mechanical cross coupling between its axes would lead to degradation of the scanning precision of a piezo-driven fast steering mirror (PFSM), a two-degrees-of-freedom (2-DoF) PFSM with a cross-axis decoupling capability, in which 2-DoF flexure hinges are used, is proposed in this work. The overall structure of the proposed PFSM is first introduced and then both static and dynamic models are established analytically; in addition, the decoupling mechanism is described in detail and the low dynamic cross coupling ratios that occur between the two DoFs are shown. Because of the decoupling property of the PFSM, the 2-DoF motion is treated as a combination of two independent one-degree-of-freedom (1-DoF) motions and two independent proportional-integral-derivative controllers are thus used separately in the control of the two DoFs. Based on this control strategy, experiments involving both 1-DoF trajectory tracking and 2-DoF trajectory tracking are implemented. The test results show that the proposed PFSM can achieve the tilt range of ±7 mrad for both axes with the low coupling ratios that are less than 2% (-34 dB), and the bandwidths of both axes are higher than 810 Hz; in addition, the maximal tracking full scale range errors for 1-DoF trajectory tracking and 2-DoF trajectory tracking are less than 0.2% and 1%, respectively, where the larger error of 2-DoF trajectory tracking is mainly caused by the remaining cross coupling between axes.

Novel Door-opening Method for Six-legged Robots Based on Only Force Sensing

NASA Astrophysics Data System (ADS)

Chen, Zhi-Jun; Gao, Feng; Pan, Yang

2017-09-01

Current door-opening methods are mainly developed on tracked, wheeled and biped robots by applying multi-DOF manipulators and vision systems. However, door-opening methods for six-legged robots are seldom studied, especially using 0-DOF tools to operate and only force sensing to detect. A novel door-opening method for six-legged robots is developed and implemented to the six-parallel-legged robot. The kinematic model of the six-parallel-legged robot is established and the model of measuring the positional relationship between the robot and the door is proposed. The measurement model is completely based on only force sensing. The real-time trajectory planning method and the control strategy are designed. The trajectory planning method allows the maximum angle between the sagittal axis of the robot body and the normal line of the door plane to be 45º. A 0-DOF tool mounted to the robot body is applied to operate. By integrating with the body, the tool has 6 DOFs and enough workspace to operate. The loose grasp achieved by the tool helps release the inner force in the tool. Experiments are carried out to validate the method. The results show that the method is effective and robust in opening doors wider than 1 m. This paper proposes a novel door-opening method for six-legged robots, which notably uses a 0-DOF tool and only force sensing to detect and open the door.

Mixed semiclassical-classical propagators for the Wigner phase space representation

NASA Astrophysics Data System (ADS)

Koda, Shin-ichi

2016-04-01

We formulate mixed semiclassical-classical (SC-Cl) propagators by adding a further approximation to the phase-space SC propagators, which have been formulated in our previous paper [S. Koda, J. Chem. Phys. 143, 244110 (2015)]. We first show that the stationary phase approximation over the operation of the phase-space van Vleck propagator on initial distribution functions results in the classical mechanical time propagation. Then, after dividing the degrees of freedom (DOFs) of the total system into the semiclassical DOFs and the classical DOFs, the SC-Cl van Vleck propagator and the SC-Cl Herman-Kluk (HK) propagator are derived by performing the stationary phase approximation only with respect to the classical DOFs. These SC-Cl propagators are naturally decomposed to products of the phase-space SC propagators and the classical mechanical propagators when the system does not have any interaction between the semiclassical and the classical DOFs. In addition, we also numerically compare the original phase-space HK (full HK) propagator and the SC-Cl HK propagator in terms of accuracy and efficiency to find that the accuracy of the SC-Cl HK propagator can be comparable to that of the full HK propagator although the latter is more accurate than the former in general. On the other hand, we confirm that the convergence speed of the SC-Cl HK propagator is faster than that of the full HK propagator. The present numerical tests indicate that the SC-Cl HK propagator can be more accurate than the full HK propagator when they use a same and finite number of classical trajectories due to the balance of the accuracy and the efficiency.

Mixed semiclassical-classical propagators for the Wigner phase space representation.

PubMed

Koda, Shin-Ichi

2016-04-21

We formulate mixed semiclassical-classical (SC-Cl) propagators by adding a further approximation to the phase-space SC propagators, which have been formulated in our previous paper [S. Koda, J. Chem. Phys. 143, 244110 (2015)]. We first show that the stationary phase approximation over the operation of the phase-space van Vleck propagator on initial distribution functions results in the classical mechanical time propagation. Then, after dividing the degrees of freedom (DOFs) of the total system into the semiclassical DOFs and the classical DOFs, the SC-Cl van Vleck propagator and the SC-Cl Herman-Kluk (HK) propagator are derived by performing the stationary phase approximation only with respect to the classical DOFs. These SC-Cl propagators are naturally decomposed to products of the phase-space SC propagators and the classical mechanical propagators when the system does not have any interaction between the semiclassical and the classical DOFs. In addition, we also numerically compare the original phase-space HK (full HK) propagator and the SC-Cl HK propagator in terms of accuracy and efficiency to find that the accuracy of the SC-Cl HK propagator can be comparable to that of the full HK propagator although the latter is more accurate than the former in general. On the other hand, we confirm that the convergence speed of the SC-Cl HK propagator is faster than that of the full HK propagator. The present numerical tests indicate that the SC-Cl HK propagator can be more accurate than the full HK propagator when they use a same and finite number of classical trajectories due to the balance of the accuracy and the efficiency.

Vibration isolation using six degree-of-freedom quasi-zero stiffness magnetic levitation

NASA Astrophysics Data System (ADS)

Zhu, Tao; Cazzolato, Benjamin; Robertson, William S. P.; Zander, Anthony

2015-12-01

In laboratories and high-tech manufacturing applications, passive vibration isolators are often used to isolate vibration sensitive equipment from ground-borne vibrations. However, in traditional passive isolation devices, where the payload weight is supported by elastic structures with finite stiffness, a design trade-off between the load capacity and the vibration isolation performance is unavoidable. Low stiffness springs are often required to achieve vibration isolation, whilst high stiffness is desired for supporting payload weight. In this paper, a novel design of a six degree of freedom (six-dof) vibration isolator is presented, as well as the control algorithms necessary for stabilising the passively unstable maglev system. The system applies magnetic levitation as the payload support mechanism, which realises inherent quasi-zero stiffness levitation in the vertical direction, and zero stiffness in the other five dofs. While providing near zero stiffness in multiple dofs, the design is also able to generate static magnetic forces to support the payload weight. This negates the trade-off between load capacity and vibration isolation that often exists in traditional isolator designs. The paper firstly presents the novel design concept of the isolator and associated theories, followed by the mechanical and control system designs. Experimental results are then presented to demonstrate the vibration isolation performance of the proposed system in all six directions.

Spherically Actuated Motor

NASA Technical Reports Server (NTRS)

Peeples, Steven

2015-01-01

A three degree of freedom (DOF) spherical actuator is proposed that will replace functions requiring three single DOF actuators in robotic manipulators providing space and weight savings while reducing the overall failure rate. Exploration satellites, Space Station payload manipulators, and rovers requiring pan, tilt, and rotate movements need an actuator for each function. Not only does each actuator introduce additional failure modes and require bulky mechanical gimbals, each contains many moving parts, decreasing mean time to failure. A conventional robotic manipulator is shown in figure 1. Spherical motors perform all three actuation functions, i.e., three DOF, with only one moving part. Given a standard three actuator system whose actuators have a given failure rate compared to a spherical motor with an equal failure rate, the three actuator system is three times as likely to fail over the latter. The Jet Propulsion Laboratory reliability studies of NASA robotic spacecraft have shown that mechanical hardware/mechanism failures are more frequent and more likely to significantly affect mission success than are electronic failures. Unfortunately, previously designed spherical motors have been unable to provide the performance needed by space missions. This inadequacy is also why they are unavailable commercially. An improved patentable spherically actuated motor (SAM) is proposed to provide the performance and versatility required by NASA missions.

Dynamic simulation of knee-joint loading during gait using force-feedback control and surrogate contact modelling.

PubMed

Walter, Jonathan P; Pandy, Marcus G

2017-10-01

The aim of this study was to perform multi-body, muscle-driven, forward-dynamics simulations of human gait using a 6-degree-of-freedom (6-DOF) model of the knee in tandem with a surrogate model of articular contact and force control. A forward-dynamics simulation incorporating position, velocity and contact force-feedback control (FFC) was used to track full-body motion capture data recorded for multiple trials of level walking and stair descent performed by two individuals with instrumented knee implants. Tibiofemoral contact force errors for FFC were compared against those obtained from a standard computed muscle control algorithm (CMC) with a 6-DOF knee contact model (CMC6); CMC with a 1-DOF translating hinge-knee model (CMC1); and static optimization with a 1-DOF translating hinge-knee model (SO). Tibiofemoral joint loads predicted by FFC and CMC6 were comparable for level walking, however FFC produced more accurate results for stair descent. SO yielded reasonable predictions of joint contact loading for level walking but significant differences between model and experiment were observed for stair descent. CMC1 produced the least accurate predictions of tibiofemoral contact loads for both tasks. Our findings suggest that reliable estimates of knee-joint loading may be obtained by incorporating position, velocity and force-feedback control with a multi-DOF model of joint contact in a forward-dynamics simulation of gait. Copyright © 2017 IPEM. Published by Elsevier Ltd. All rights reserved.

Model-free learning on robot kinematic chains using a nested multi-agent topology

NASA Astrophysics Data System (ADS)

Karigiannis, John N.; Tzafestas, Costas S.

2016-11-01

This paper proposes a model-free learning scheme for the developmental acquisition of robot kinematic control and dexterous manipulation skills. The approach is based on a nested-hierarchical multi-agent architecture that intuitively encapsulates the topology of robot kinematic chains, where the activity of each independent degree-of-freedom (DOF) is finally mapped onto a distinct agent. Each one of those agents progressively evolves a local kinematic control strategy in a game-theoretic sense, that is, based on a partial (local) view of the whole system topology, which is incrementally updated through a recursive communication process according to the nested-hierarchical topology. Learning is thus approached not through demonstration and training but through an autonomous self-exploration process. A fuzzy reinforcement learning scheme is employed within each agent to enable efficient exploration in a continuous state-action domain. This paper constitutes in fact a proof of concept, demonstrating that global dexterous manipulation skills can indeed evolve through such a distributed iterative learning of local agent sensorimotor mappings. The main motivation behind the development of such an incremental multi-agent topology is to enhance system modularity, to facilitate extensibility to more complex problem domains and to improve robustness with respect to structural variations including unpredictable internal failures. These attributes of the proposed system are assessed in this paper through numerical experiments in different robot manipulation task scenarios, involving both single and multi-robot kinematic chains. The generalisation capacity of the learning scheme is experimentally assessed and robustness properties of the multi-agent system are also evaluated with respect to unpredictable variations in the kinematic topology. Furthermore, these numerical experiments demonstrate the scalability properties of the proposed nested-hierarchical architecture, where new agents can be recursively added in the hierarchy to encapsulate individual active DOFs. The results presented in this paper demonstrate the feasibility of such a distributed multi-agent control framework, showing that the solutions which emerge are plausible and near-optimal. Numerical efficiency and computational cost issues are also discussed.

Contact dynamics math model

NASA Technical Reports Server (NTRS)

Glaese, John R.; Tobbe, Patrick A.

1986-01-01

The Space Station Mechanism Test Bed consists of a hydraulically driven, computer controlled six degree of freedom (DOF) motion system with which docking, berthing, and other mechanisms can be evaluated. Measured contact forces and moments are provided to the simulation host computer to enable representation of orbital contact dynamics. This report describes the development of a generalized math model which represents the relative motion between two rigid orbiting vehicles. The model allows motion in six DOF for each body, with no vehicle size limitation. The rotational and translational equations of motion are derived. The method used to transform the forces and moments from the sensor location to the vehicles' centers of mass is also explained. Two math models of docking mechanisms, a simple translational spring and the Remote Manipulator System end effector, are presented along with simulation results. The translational spring model is used in an attempt to verify the simulation with compensated hardware in the loop results.

A 6DOF passive vibration isolator using X-shape supporting structures

NASA Astrophysics Data System (ADS)

Wu, Zhijing; Jing, Xingjian; Sun, Bo; Li, Fengming

2016-10-01

A novel 6 degree of freedom (6-DOF) passive vibration isolator is studied theoretically and validated with experiments. Based on the Stewart platform configuration, the 6-DOF isolator is constructed by 6 X-shape structures as legs, which can realize very good and tunable vibration isolation performance in all 6 directions with a passive manner. The mechanic model is established for static analysis of the working range, static stiffness and loading capacity. Thereafter, the equation of motion of the isolator is derived with the Hamilton principle. The equivalent stiffness and the displacement transmissibility in the six decoupled DOFs direction are then discussed with experimental results for validation. The results reveal that (a) by designing the structure parameters, the system can possess flexible stiffness such as negative, quasi-zero and positive stiffness, (b) due to the combination of the Stewart platform and the X-shape structure, the system can have very good vibration isolation performance in all the 6 directions and in a passive manner, and (c) compared with the simplified linear-stiffness legs, the nonlinearity of the X-shape structures enhance the passive isolator to have much better vibration isolation performance.

Multi-innovation auto-constructed least squares identification for 4 DOF ship manoeuvring modelling with full-scale trial data.

PubMed

Zhang, Guoqing; Zhang, Xianku; Pang, Hongshuai

2015-09-01

This research is concerned with the problem of 4 degrees of freedom (DOF) ship manoeuvring identification modelling with the full-scale trial data. To avoid the multi-innovation matrix inversion in the conventional multi-innovation least squares (MILS) algorithm, a new transformed multi-innovation least squares (TMILS) algorithm is first developed by virtue of the coupling identification concept. And much effort is made to guarantee the uniformly ultimate convergence. Furthermore, the auto-constructed TMILS scheme is derived for the ship manoeuvring motion identification by combination with a statistic index. Comparing with the existing results, the proposed scheme has the significant computational advantage and is able to estimate the model structure. The illustrative examples demonstrate the effectiveness of the proposed algorithm, especially including the identification application with full-scale trial data. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

Spatial and rotational quality assurance of 6DOF patient tracking systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belcher, Andrew H.; Liu, Xinmin; Grelewicz, Zachary

Purpose: External tracking systems used for patient positioning and motion monitoring during radiotherapy are now capable of detecting both translations and rotations. In this work, the authors develop a novel technique to evaluate the 6 degree of freedom 6(DOF) (translations and rotations) performance of external motion tracking systems. The authors apply this methodology to an infrared marker tracking system and two 3D optical surface mapping systems in a common tumor 6DOF workspace. Methods: An in-house designed and built 6DOF parallel kinematics robotic motion phantom was used to perform motions with sub-millimeter and subdegree accuracy in a 6DOF workspace. An infraredmore » marker tracking system was first used to validate a calibration algorithm which associates the motion phantom coordinate frame to the camera frame. The 6DOF positions of the mobile robotic system in this space were then tracked and recorded independently by an optical surface tracking system after a cranial phantom was rigidly fixed to the moveable platform of the robotic stage. The calibration methodology was first employed, followed by a comprehensive 6DOF trajectory evaluation, which spanned a full range of positions and orientations in a 20 × 20 × 16 mm and 5° × 5° × 5° workspace. The intended input motions were compared to the calibrated 6DOF measured points. Results: The technique found the accuracy of the infrared (IR) marker tracking system to have maximal root-mean square error (RMSE) values of 0.18, 0.25, 0.07 mm, 0.05°, 0.05°, and 0.09° in left–right (LR), superior–inferior (SI), anterior–posterior (AP), pitch, roll, and yaw, respectively, comparing the intended 6DOF position and the measured position by the IR camera. Similarly, the 6DOF RSME discrepancy for the HD optical surface tracker yielded maximal values of 0.46, 0.60, 0.54 mm, 0.06°, 0.11°, and 0.08° in LR, SI, AP, pitch, roll, and yaw, respectively, over the same 6DOF evaluative workspace. An earlier generation 3D optical surface tracking unit was observed to have worse tracking capabilities than both the IR camera unit and the newer 3D surface tracking system with maximal RMSE of 0.69, 0.74, 0.47 mm, 0.28°, 0.19°, and 0.18°, in LR, SI, AP, pitch, roll, and yaw, respectively, in the same 6DOF evaluation space. Conclusions: The proposed technique was found to be effective at evaluating the performance of 6DOF patient tracking systems. All observed optical tracking systems were found to exhibit tracking capabilities at the sub-millimeter and subdegree level within a 6DOF workspace.« less

Synchronized motion control and precision positioning compensation of a 3-DOFs macro-micro parallel manipulator fully actuated by piezoelectric actuators

NASA Astrophysics Data System (ADS)

Zhang, Quan; Li, Chaodong; Zhang, Jiantao; Zhang, Xu

2017-11-01

The macro-micro combined approach, as an effective way to realize trans-scale nano-precision positioning with multi-dimensions and high velocity, plays a significant role in integrated circuit manufacturing field. A 3-degree-of-freedoms (3-DOFs) macro-micro manipulator is designed and analyzed to compromise the conflictions among the large stroke, high precision and multi-DOFs. The macro manipulator is a 3-Prismatic-Revolute-Revolute (3-PRR) structure parallel manipulator which is driven by three linear ultrasonic motors. The dynamic model and the cross-coupling error based synchronized motion controller of the 3-PRR parallel manipulator are theoretical analyzed and experimental tested. To further improve the positioning accuracy, a 3-DOFs monolithic compliant manipulator actuated by three piezoelectric stack actuators is designed. Then a multilayer BP neural network based inverse kinematic model identifier is developed to perform the positioning control. Finally, by forming the macro-micro structure, the dual stage manipulator successfully achieved the positioning task from the point (2 mm, 2 mm, 0 rad) back to the original point (0 mm, 0 mm, 0 rad) with the translation errors in X and Y directions less than ±50 nm and the rotation error around Z axis less than ±1 μrad, respectively.

Operation analysis of a Chebyshev-Pantograph leg mechanism for a single DOF biped robot

NASA Astrophysics Data System (ADS)

Liang, Conghui; Ceccarelli, Marco; Takeda, Yukio

2012-12-01

In this paper, operation analysis of a Chebyshev-Pantograph leg mechanism is presented for a single degree of freedom (DOF) biped robot. The proposed leg mechanism is composed of a Chebyshev four-bar linkage and a pantograph mechanism. In contrast to general fully actuated anthropomorphic leg mechanisms, the proposed leg mechanism has peculiar features like compactness, low-cost, and easy-operation. Kinematic equations of the proposed leg mechanism are formulated for a computer oriented simulation. Simulation results show the operation performance of the proposed leg mechanism with suitable characteristics. A parametric study has been carried out to evaluate the operation performance as function of design parameters. A prototype of a single DOF biped robot equipped with two proposed leg mechanisms has been built at LARM (Laboratory of Robotics and Mechatronics). Experimental test shows practical feasible walking ability of the prototype, as well as drawbacks are discussed for the mechanical design.

Comparative study of 2-DOF micromirrors for precision light manipulation

NASA Astrophysics Data System (ADS)

Young, Johanna I.; Shkel, Andrei M.

2001-08-01

Many industry experts predict that the future of fiber optic telecommunications depends on the development of all-optical components for switching of photonic signals from fiber to fiber throughout the networks. MEMS is a promising technology for providing all-optical switching at high speeds with significant cost reductions. This paper reports on the the analysis of two designs for 2-DOF electrostatically actuated MEMS micromirrors for precision controllable large optical switching arrays. The behavior of the micromirror designs is predicted by coupled-field electrostatic and modal analysis using a finite element analysis (FEA) multi-physics modeling software. The analysis indicates that the commonly used gimbal type mirror design experiences electrostatic interference and would therefore be difficult to precisely control for 2-DOF motion. We propose a new design approach which preserves 2-DOF actuation while minimizing electrostatic interference between the drive electrodes and the mirror. Instead of using two torsional axes, we use one actuator which combines torsional and flexural DOFs. A comparative analysis of the conventional gimbal design and the one proposed in this paper is performed.

TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belcher, AH; Liu, X; Wiersma, R

Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics roboticsmore » stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning patients to isocenter with high 6DOF accuracy.« less

Development of biomimetic quadruped walking robot with 2-DOF waist joint

NASA Astrophysics Data System (ADS)

Kim, Kyoung-Ho; Park, Se-Hoon; Lee, Yun-Jung

2005-12-01

This paper presented a novel bio-mimetic quadruped walking robot with 2-DOF (Degree Of Freedom) waist joint, which connects the front and the rear parts of the body. The waist-jointed walking robot can guarantee more stable and more animal-like gait than that of a conventional single-rigid-body walking robot. The developed robot, called ELIRO-II (Eating LIzard RObot version 2), can bend its body from side to side by using 1-DOF passive waist joint while the legs is transferred, thereby increasing the stride and speed of the robot. In addition, ELIRO-II has one more active DOF to bend its body up and down, which increases the mobility in irregular terrain such as slope and stairs. We design the mechanical structure of the robot, which is small and light to have high mobility. This research described characteristics of the 2-DOF waists joint and leg mechanism as well as a hardware and software of the controller of ELIRO-II.

Parametric optimization in virtual prototyping environment of the control device for a robotic system used in thin layers deposition

NASA Astrophysics Data System (ADS)

Enescu (Balaş, M. L.; Alexandru, C.

2016-08-01

The paper deals with the optimal design of the control system for a 6-DOF robot used in thin layers deposition. The optimization is based on parametric technique, by modelling the design objective as a numerical function, and then establishing the optimal values of the design variables so that to minimize the objective function. The robotic system is a mechatronic product, which integrates the mechanical device and the controlled operating device.The mechanical device of the robot was designed in the CAD (Computer Aided Design) software CATIA, the 3D-model being then transferred to the MBS (Multi-Body Systems) environment ADAMS/View. The control system was developed in the concurrent engineering concept, through the integration with the MBS mechanical model, by using the DFC (Design for Control) software solution EASY5. The necessary angular motions in the six joints of the robot, in order to obtain the imposed trajectory of the end-effector, have been established by performing the inverse kinematic analysis. The positioning error in each joint of the robot is used as design objective, the optimization goal being to minimize the root mean square during simulation, which is a measure of the magnitude of the positioning error varying quantity.

Quantum computation based on photonic systems with two degrees of freedom assisted by the weak cross-Kerr nonlinearity

PubMed Central

Luo, Ming-Xing; Li, Hui-Ran; Lai, Hong

2016-01-01

Most of previous quantum computations only take use of one degree of freedom (DoF) of photons. An experimental system may possess various DoFs simultaneously. In this paper, with the weak cross-Kerr nonlinearity, we investigate the parallel quantum computation dependent on photonic systems with two DoFs. We construct nearly deterministic controlled-not (CNOT) gates operating on the polarization spatial DoFs of the two-photon or one-photon system. These CNOT gates show that two photonic DoFs can be encoded as independent qubits without auxiliary DoF in theory. Only the coherent states are required. Thus one half of quantum simulation resources may be saved in quantum applications if more complicated circuits are involved. Hence, one may trade off the implementation complexity and simulation resources by using different photonic systems. These CNOT gates are also used to complete various applications including the quantum teleportation and quantum superdense coding. PMID:27424767

Quantum computation based on photonic systems with two degrees of freedom assisted by the weak cross-Kerr nonlinearity.

PubMed

Luo, Ming-Xing; Li, Hui-Ran; Lai, Hong

2016-07-18

Most of previous quantum computations only take use of one degree of freedom (DoF) of photons. An experimental system may possess various DoFs simultaneously. In this paper, with the weak cross-Kerr nonlinearity, we investigate the parallel quantum computation dependent on photonic systems with two DoFs. We construct nearly deterministic controlled-not (CNOT) gates operating on the polarization spatial DoFs of the two-photon or one-photon system. These CNOT gates show that two photonic DoFs can be encoded as independent qubits without auxiliary DoF in theory. Only the coherent states are required. Thus one half of quantum simulation resources may be saved in quantum applications if more complicated circuits are involved. Hence, one may trade off the implementation complexity and simulation resources by using different photonic systems. These CNOT gates are also used to complete various applications including the quantum teleportation and quantum superdense coding.

Design and implementation of a 2-DOF PID compensation for magnetic levitation systems.

PubMed

Ghosh, Arun; Rakesh Krishnan, T; Tejaswy, Pailla; Mandal, Abhisek; Pradhan, Jatin K; Ranasingh, Subhakant

2014-07-01

This paper employs a 2-DOF (degree of freedom) PID controller for compensating a physical magnetic levitation system. It is shown that because of having a feedforward gain in the proposed 2-DOF PID control, the transient performance of the compensated system can be changed in a desired manner unlike the conventional 1-DOF PID control. It is also shown that for a choice of PID parameters, although the theoretical loop robustness is the same for both the compensated systems, in real-time, 2-DOF PID control may provide superior robustness if a suitable choice of the feedforward parameter is made. The results are verified through simulations and experiments. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

Position versus force control: using the 2-DOF robotic ankle trainer to assess ankle's motor control.

PubMed

Farjadian, Amir B; Nabian, Mohsen; Hartman, Amber; Corsino, Johnathan; Mavroidis, Constantinos; Holden, Maureen K

2014-01-01

An estimated of 2,000,000 acute ankle sprains occur annually in the United States. Furthermore, ankle disabilities are caused by neurological impairments such as traumatic brain injury, cerebral palsy and stroke. The virtually interfaced robotic ankle and balance trainer (vi-RABT) was introduced as a cost-effective platform-based rehabilitation robot to improve overall ankle/balance strength, mobility and control. The system is equipped with 2 degrees of freedom (2-DOF) controlled actuation along with complete means of angle and torque measurement mechanisms. Vi-RABT was used to assess ankle strength, flexibility and motor control in healthy human subjects, while playing interactive virtual reality games on the screen. The results suggest that in the task with 2-DOF, subjects have better control over ankle's position vs. force.

Design and Calibration of a New 6 DOF Haptic Device

PubMed Central

Qin, Huanhuan; Song, Aiguo; Liu, Yuqing; Jiang, Guohua; Zhou, Bohe

2015-01-01

For many applications such as tele-operational robots and interactions with virtual environments, it is better to have performance with force feedback than without. Haptic devices are force reflecting interfaces. They can also track human hand positions simultaneously. A new 6 DOF (degree-of-freedom) haptic device was designed and calibrated in this study. It mainly contains a double parallel linkage, a rhombus linkage, a rotating mechanical structure and a grasping interface. Benefited from the unique design, it is a hybrid structure device with a large workspace and high output capability. Therefore, it is capable of multi-finger interactions. Moreover, with an adjustable base, operators can change different postures without interrupting haptic tasks. To investigate the performance regarding position tracking accuracy and static output forces, we conducted experiments on a three-dimensional electric sliding platform and a digital force gauge, respectively. Displacement errors and force errors are calculated and analyzed. To identify the capability and potential of the device, four application examples were programmed. PMID:26690449

Autonomous docking ground demonstration (category 3)

NASA Technical Reports Server (NTRS)

Lamkin, Steve L.; Eick, Richard E.; Baxter, James M.; Boyd, M. G.; Clark, Fred D.; Lee, Thomas Q.; Othon, L. T.; Prather, Joseph L.; Spehar, Peter T.; Teders, Rebecca J.

1991-01-01

The NASA Johnson Space Center (JSC) is involved in the development of an autonomous docking ground demonstration. The demonstration combines the technologies, expertise and facilities of the JSC Tracking and Communications Division (EE), Structures and Mechanics Division (ES), and the Navigation, Guidance and Control Division (EG) and their supporting contractors. The autonomous docking ground demonstration is an evaluation of the capabilities of the laser sensor system to support the docking phase (12ft to contact) when operated in conjunction with the Guidance, Navigation and Control Software. The docking mechanism being used was developed for the Apollo Soyuz Test Program. This demonstration will be conducted using the Six-Degrees of Freedom (6-DOF) Dynamic Test System (DTS). The DTS environment simulates the Space Station Freedom as the stationary or target vehicle and the Orbiter as the active or chase vehicle. For this demonstration the laser sensor will be mounted on the target vehicle and the retroreflectors on the chase vehicle. This arrangement was used to prevent potential damage to the laser. The sensor system. GN&C and 6-DOF DTS will be operated closed-loop. Initial condition to simulate vehicle misalignments, translational and rotational, will be introduced within the constraints of the systems involved. Detailed description of each of the demonstration components (e.g., Sensor System, GN&C, 6-DOF DTS and supporting computer configuration) including their capabilities and limitations will be discussed. A demonstration architecture drawing and photographs of the test configuration will be presented.

Autonomous docking ground demonstration (category 3)

NASA Astrophysics Data System (ADS)

Lamkin, Steve L.; Eick, Richard E.; Baxter, James M.; Boyd, M. G.; Clark, Fred D.; Lee, Thomas Q.; Othon, L. T.; Prather, Joseph L.; Spehar, Peter T.; Teders, Rebecca J.

The NASA Johnson Space Center (JSC) is involved in the development of an autonomous docking ground demonstration. The demonstration combines the technologies, expertise and facilities of the JSC Tracking and Communications Division (EE), Structures and Mechanics Division (ES), and the Navigation, Guidance and Control Division (EG) and their supporting contractors. The autonomous docking ground demonstration is an evaluation of the capabilities of the laser sensor system to support the docking phase (12ft to contact) when operated in conjunction with the Guidance, Navigation and Control Software. The docking mechanism being used was developed for the Apollo Soyuz Test Program. This demonstration will be conducted using the Six-Degrees of Freedom (6-DOF) Dynamic Test System (DTS). The DTS environment simulates the Space Station Freedom as the stationary or target vehicle and the Orbiter as the active or chase vehicle. For this demonstration the laser sensor will be mounted on the target vehicle and the retroreflectors on the chase vehicle. This arrangement was used to prevent potential damage to the laser. The sensor system. GN&C and 6-DOF DTS will be operated closed-loop. Initial condition to simulate vehicle misalignments, translational and rotational, will be introduced within the constraints of the systems involved. Detailed description of each of the demonstration components (e.g., Sensor System, GN&C, 6-DOF DTS and supporting computer configuration) including their capabilities and limitations will be discussed. A demonstration architecture drawing and photographs of the test configuration will be presented.

Bilateral, Misalignment-Compensating, Full-DOF Hip Exoskeleton: Design and Kinematic Validation

PubMed Central

Degelaen, Marc; Lefeber, Nina; Swinnen, Eva; Vanderborght, Bram; Lefeber, Dirk

2017-01-01

A shared design goal for most robotic lower limb exoskeletons is to reduce the metabolic cost of locomotion for the user. Despite this, only a limited amount of devices was able to actually reduce user metabolic consumption. Preservation of the natural motion kinematics was defined as an important requirement for a device to be metabolically beneficial. This requires the inclusion of all human degrees of freedom (DOF) in a design, as well as perfect alignment of the rotation axes. As perfect alignment is impossible, compensation for misalignment effects should be provided. A misalignment compensation mechanism for a 3-DOF system is presented in this paper. It is validated by the implementation in a bilateral hip exoskeleton, resulting in a compact and lightweight device that can be donned fast and autonomously, with a minimum of required adaptations. Extensive testing of the prototype has shown that hip range of motion of the user is maintained while wearing the device and this for all three hip DOFs. This allowed the users to maintain their natural motion patterns when they are walking with the novel hip exoskeleton. PMID:28790799

Improved single- and multi-contact life-time testing of dental restorative materials using key characteristics of the human masticatory system and a force/position-controlled robotic dental wear simulator.

PubMed

Raabe, D; Harrison, A; Ireland, A; Alemzadeh, K; Sandy, J; Dogramadzi, S; Melhuish, C; Burgess, S

2012-03-01

This paper presents a new in vitro wear simulator based on spatial parallel kinematics and a biologically inspired implicit force/position hybrid controller to replicate chewing movements and dental wear formations on dental components, such as crowns, bridges or a full set of teeth. The human mandible, guided by passive structures such as posterior teeth and the two temporomandibular joints, moves with up to 6 degrees of freedom (DOF) in Cartesian space. The currently available wear simulators lack the ability to perform these chewing movements. In many cases, their lack of sufficient DOF enables them only to replicate the sliding motion of a single occlusal contact point by neglecting rotational movements and the motion along one Cartesian axis. The motion and forces of more than one occlusal contact points cannot accurately be replicated by these instruments. Furthermore, the majority of wear simulators are unable to control simultaneously the main wear-affecting parameters, considering abrasive mechanical wear, which are the occlusal sliding motion and bite forces in the constraint contact phase of the human chewing cycle. It has been shown that such discrepancies between the true in vivo and the simulated in vitro condition influence the outcome and the quality of wear studies. This can be improved by implementing biological features of the human masticatory system such as tooth compliance realized through the passive action of the periodontal ligament and active bite force control realized though the central nervous system using feedback from periodontal preceptors. The simulator described in this paper can be used for single- and multi-occlusal contact testing due to its kinematics and ability to exactly replicate human translational and rotational mandibular movements with up to 6 DOF without neglecting movements along or around the three Cartesian axes. Recorded human mandibular motion and occlusal force data are the reference inputs of the simulator. Experimental studies of wear using this simulator demonstrate that integrating the biological feature of combined force/position hybrid control in dental material testing improves the linearity and reduces the variability of results. In addition, it has been shown that present biaxially operated dental wear simulators are likely to provide misleading results in comparative in vitro/in vivo one-contact studies due to neglecting the occlusal sliding motion in one plane which could introduce an error of up to 49% since occlusal sliding motion D and volumetric wear loss V(loss) are proportional.

Parallel Photonic Quantum Computation Assisted by Quantum Dots in One-Side Optical Microcavities

PubMed Central

Luo, Ming-Xing; Wang, Xiaojun

2014-01-01

Universal quantum logic gates are important elements for a quantum computer. In contrast to previous constructions on one degree of freedom (DOF) of quantum systems, we investigate the possibility of parallel quantum computations dependent on two DOFs of photon systems. We construct deterministic hyper-controlled-not (hyper-CNOT) gates operating on the spatial-mode and the polarization DOFs of two-photon or one-photon systems by exploring the giant optical circular birefringence induced by quantum-dot spins in one-sided optical microcavities. These hyper-CNOT gates show that the quantum states of two DOFs can be viewed as independent qubits without requiring auxiliary DOFs in theory. This result can reduce the quantum resources by half for quantum applications with large qubit systems, such as the quantum Shor algorithm. PMID:25030424

Parallel photonic quantum computation assisted by quantum dots in one-side optical microcavities.

PubMed

Luo, Ming-Xing; Wang, Xiaojun

2014-07-17

Universal quantum logic gates are important elements for a quantum computer. In contrast to previous constructions on one degree of freedom (DOF) of quantum systems, we investigate the possibility of parallel quantum computations dependent on two DOFs of photon systems. We construct deterministic hyper-controlled-not (hyper-CNOT) gates operating on the spatial-mode and the polarization DOFs of two-photon or one-photon systems by exploring the giant optical circular birefringence induced by quantum-dot spins in one-sided optical microcavities. These hyper-CNOT gates show that the quantum states of two DOFs can be viewed as independent qubits without requiring auxiliary DOFs in theory. This result can reduce the quantum resources by half for quantum applications with large qubit systems, such as the quantum Shor algorithm.

Fluctuation of Dof1/Dof2 expression ratio under the influence of varying nitrogen and light conditions: involvement in differential regulation of nitrogen metabolism in two genotypes of finger millet (Eleusine coracana L.).

PubMed

Gupta, Supriya; Gupta, Sanjay Mohan; Gupta, Alok Kumar; Gaur, Vikram Singh; Kumar, Anil

2014-08-10

In order to gain insights into the mechanism of high nitrogen use efficiency (NUE) of finger millet (FM) the role of Dof2 transcription factor (TF), which is a repressor of genes involved in C/N metabolism was investigated. The partial cDNA fragment of EcDof2 (912-bp; GenBank acc. no. KF261117) was isolated and characterized from finger millet (FM) that showed 63% and 58% homology with Dof2 of Zea mays at nucleotide and protein level, respectively. Its expression studies were carried out along with the activator EcDof1 in two genotypes (GE3885, high protein genotype (HPG); GE1437, low protein genotype (LPG)) of FM differing in grain protein contents (13.8% and 6.2%) showed that EcDof2 is expressed in both shoot and root tissues with significantly (p≤0.05) higher expression in the roots. The diurnal expression of both EcDof1 and EcDof2 in shoots was differential having different time of peak expression indicating a differential response to diurnal condition. Under continuous dark conditions, expression of EcDof1 and EcDof2 oscillated in both the genotypes whereas on illumination, the fold expression of EcDof1 was higher as compared to EcDof2. Under increasing nitrate concentration, EcDof2 expression increases in roots and shoots of LPG while it remains unchanged in HPG. However, the EcDof1 expression was found to increase in both genotypes. Further, time kinetics studies under single nitrate concentration revealed that EcDof2 was repressed in the roots of both genotypes whereas EcDof1 oscillated with time. The EcDof1/EcDof2 ratio measured showed differential response under different light and nitrogen conditions. It was higher in the roots of HPG indicating higher activation of genes involved in N uptake and assimilation resulting in high grain protein accumulation. The results indicate that both light and nitrogen concentration influence Dof1 and Dof2 expression and suggests a complex pattern of regulation of genes influenced by these plant specific TFs. In nutshell, the Dof1/Dof2 ratio can serve as an index for measuring the N responsiveness and NUE of crops and can be further validated by Dof2 knock down approach. Copyright © 2014 Elsevier B.V. All rights reserved.

Virtual remote center of motion control for needle placement robots.

PubMed

Boctor, Emad M; Webster, Robert J; Mathieu, Herve; Okamura, Allison M; Fichtinger, Gabor

2004-01-01

We present an algorithm that enables percutaneous needle-placement procedures to be performed with unencoded, unregistered, minimally calibrated robots while removing the constraint of placing the needle tip on a mechanically enforced Remote Center of Motion (RCM). The algorithm requires only online tracking of the surgical tool and a five-degree-of-freedom (5-DOF) robot comprising three prismatic DOF and two rotational DOF. An incremental adaptive motion control cycle guides the needle to the insertion point and also orients it to align with the target-entry-point line. The robot executes RCM motion without having a physically constrained fulcrum point. The proof-of-concept prototype system achieved 0.78 mm translation accuracy and 1.4 degrees rotational accuracy (this is within the tracker accuracy) within 17 iterative steps (0.5-1 s). This research enables robotic assistant systems for image-guided percutaneous procedures to be prototyped/constructed more quickly and less expensively than has been previously possible. Since the clinical utility of such systems is clear and has been demonstrated in the literature, our work may help promote widespread clinical adoption of this technology by lowering system cost and complexity.

Towards Optimal Platform-Based Robot Design for Ankle Rehabilitation: The State of the Art and Future Prospects

PubMed Central

Li, Hongsheng

2018-01-01

This review aims to compare existing robot-assisted ankle rehabilitation techniques in terms of robot design. Included studies mainly consist of selected papers in two published reviews involving a variety of robot-assisted ankle rehabilitation techniques. A free search was also made in Google Scholar and Scopus by using keywords “ankle∗,” and “robot∗,” and (“rehabilitat∗” or “treat∗”). The search is limited to English-language articles published between January 1980 and September 2016. Results show that existing robot-assisted ankle rehabilitation techniques can be classified into wearable exoskeleton and platform-based devices. Platform-based devices are mostly developed for the treatment of a variety of ankle musculoskeletal and neurological injuries, while wearable ones focus more on ankle-related gait training. In terms of robot design, comparative analysis indicates that an ideal ankle rehabilitation robot should have aligned rotation center as the ankle joint, appropriate workspace, and actuation torque, no matter how many degrees of freedom (DOFs) it has. Single-DOF ankle robots are mostly developed for specific applications, while multi-DOF devices are more suitable for comprehensive ankle rehabilitation exercises. Other factors including posture adjustability and sensing functions should also be considered to promote related clinical applications. An ankle rehabilitation robot with reconfigurability to maximize its functions will be a new research point towards optimal design, especially on parallel mechanisms. PMID:29736230

Towards Optimal Platform-Based Robot Design for Ankle Rehabilitation: The State of the Art and Future Prospects.

PubMed

Miao, Qing; Zhang, Mingming; Wang, Congzhe; Li, Hongsheng

2018-01-01

This review aims to compare existing robot-assisted ankle rehabilitation techniques in terms of robot design. Included studies mainly consist of selected papers in two published reviews involving a variety of robot-assisted ankle rehabilitation techniques. A free search was also made in Google Scholar and Scopus by using keywords "ankle ∗ ," and "robot ∗ ," and ("rehabilitat ∗ " or "treat ∗ "). The search is limited to English-language articles published between January 1980 and September 2016. Results show that existing robot-assisted ankle rehabilitation techniques can be classified into wearable exoskeleton and platform-based devices. Platform-based devices are mostly developed for the treatment of a variety of ankle musculoskeletal and neurological injuries, while wearable ones focus more on ankle-related gait training. In terms of robot design, comparative analysis indicates that an ideal ankle rehabilitation robot should have aligned rotation center as the ankle joint, appropriate workspace, and actuation torque, no matter how many degrees of freedom (DOFs) it has. Single-DOF ankle robots are mostly developed for specific applications, while multi-DOF devices are more suitable for comprehensive ankle rehabilitation exercises. Other factors including posture adjustability and sensing functions should also be considered to promote related clinical applications. An ankle rehabilitation robot with reconfigurability to maximize its functions will be a new research point towards optimal design, especially on parallel mechanisms.

A numerical and experimental study on optimal design of multi-DOF viscoelastic supports for passive vibration control in rotating machinery

NASA Astrophysics Data System (ADS)

Ribeiro, Eduardo Afonso; Lopes, Eduardo Márcio de Oliveira; Bavastri, Carlos Alberto

2017-12-01

Viscoelastic materials have played an important role in passive vibration control. Nevertheless, the use of such materials in supports of rotating machines, aiming at controlling vibration, is more recent, mainly when these supports present additional complexities like multiple degrees of freedom and require accurate models to predict the dynamic behavior of viscoelastic materials working in a broad band of frequencies and temperatures. Previously, the authors propose a methodology for an optimal design of viscoelastic supports (VES) for vibration suppression in rotordynamics, which improves the dynamic prediction accuracy, the speed calculation, and the modeling of VES as complex structures. However, a comprehensive numerical study of the dynamics of rotor-VES systems, regarding the types and combinations of translational and rotational degrees of freedom (DOFs), accompanied by the corresponding experimental validation, is still lacking. This paper presents such a study considering different types and combinations of DOFs in addition to the simulation of their number of additional masses/inertias, as well as the kind and association of the applied viscoelastic materials (VEMs). The results - regarding unbalance frequency response, transmissibility and displacement due to static loads - lead to: 1) considering VES as complex structures which allow improving the efficacy in passive vibration control; 2) acknowledging the best configuration concerning DOFs and VEM choice and association for a practical application concerning passive vibration control and load resistance. The specific outcomes of the conducted experimental validation attest the accuracy of the proposed methodology.

Architectural study of the design and operation of advanced force feedback manual controllers

NASA Technical Reports Server (NTRS)

Tesar, Delbert; Kim, Whee-Kuk

1990-01-01

A teleoperator system consists of a manual controller, control hardware/software, and a remote manipulator. It was employed in either hazardous or unstructured, and/or remote environments. In teleoperation, the main-in-the-loop is the central concept that brings human intelligence to the teleoperator system. When teleoperation involves contact with an uncertain environment, providing the feeling of telepresence to the human operator is one of desired characteristics of the teleoperator system. Unfortunately, most available manual controllers in bilateral or force-reflecting teleoperator systems can be characterized by their bulky size, high costs, or lack of smoothness and transparency, and elementary architectures. To investigate other alternatives, a force-reflecting, 3 degree of freedom (dof) spherical manual controller is designed, analyzed, and implemented as a test bed demonstration in this research effort. To achieve an improved level of design to meet criteria such as compactness, portability, and a somewhat enhanced force-reflecting capability, the demonstration manual controller employs high gear-ratio reducers. To reduce the effects of the inertia and friction on the system, various force control strategies are applied and their performance investigated. The spherical manual controller uses a parallel geometry to minimize inertial and gravitational effects on its primary task of transparent information transfer. As an alternative to the spherical 3-dof manual controller, a new conceptual (or parallel) spherical 3-dof module is introduced with a full kinematic analysis. Also, the resulting kinematic properties are compared to those of other typical spherical 3-dof systems. The conceptual design of a parallel 6-dof manual controller and its kinematic analysis is presented. This 6-dof manual controller is similar to the Stewart Platform with the actuators located on the base to minimize the dynamic effects. Finally, a combination of the new 3-dof and 6-dof concepts is presented as a feasible test-bed for enhanced performance in a 9-dof system.

Development of a Pneumatic Robot for MRI-guided Transperineal Prostate Biopsy and Brachytherapy: New Approaches

PubMed Central

Song, Sang-Eun; Cho, Nathan B.; Fischer, Gregory; Hata, Nobuhito; Tempany, Clare; Fichtinger, Gabor; Iordachita, Iulian

2011-01-01

Magnetic Resonance Imaging (MRI) guided prostate biopsy and brachytherapy has been introduced in order to enhance the cancer detection and treatment. For the accurate needle positioning, a number of robotic assistants have been developed. However, problems exist due to the strong magnetic field and limited workspace. Pneumatically actuated robots have shown the minimum distraction in the environment but the confined workspace limits optimal robot design and thus controllability is often poor. To overcome the problem, a simple external damping mechanism using timing belts was sought and a 1-DOF mechanism test result indicated sufficient positioning accuracy. Based on the damping mechanism and modular system design approach, a new workspace-optimized 4-DOF parallel robot was developed for the MRI-guided prostate biopsy and brachytherapy. A preliminary evaluation of the robot was conducted using previously developed pneumatic controller and satisfying results were obtained. PMID:21399734

A quantitative measure for degree of automation and its relation to system performance and mental load.

PubMed

Wei, Z G; Macwan, A P; Wieringa, P A

1998-06-01

In this paper we quantitatively model degree of automation (DofA) in supervisory control as a function of the number and nature of tasks to be performed by the operator and automation. This model uses a task weighting scheme in which weighting factors are obtained from task demand load, task mental load, and task effect on system performance. The computation of DofA is demonstrated using an experimental system. Based on controlled experiments using operators, analyses of the task effect on system performance, the prediction and assessment of task demand load, and the prediction of mental load were performed. Each experiment had a different DofA. The effect of a change in DofA on system performance and mental load was investigated. It was found that system performance became less sensitive to changes in DofA at higher levels of DofA. The experimental data showed that when the operator controlled a partly automated system, perceived mental load could be predicted from the task mental load for each task component, as calculated by analyzing a situation in which all tasks were manually controlled. Actual or potential applications of this research include a methodology to balance and optimize the automation of complex industrial systems.

Stability analysis of a time-periodic 2-dof MEMS structure

NASA Astrophysics Data System (ADS)

Kniffka, Till Jochen; Welte, Johannes; Ecker, Horst

2012-11-01

Microelectromechanical systems (MEMS) are becoming important for all kinds of industrial applications. Among them are filters in communication devices, due to the growing demand for efficient and accurate filtering of signals. In recent developments single degree of freedom (1-dof) oscillators, that are operated at a parametric resonances, are employed for such tasks. Typically vibration damping is low in such MEM systems. While parametric excitation (PE) is used so far to take advantage of a parametric resonance, this contribution suggests to also exploit parametric anti-resonances in order to improve the damping behavior of such systems. Modeling aspects of a 2-dof MEM system and first results of the analysis of the non-linear and the linearized system are the focus of this paper. In principle the investigated system is an oscillating mechanical system with two degrees of freedom x = [x1x2]T that can be described by Mx+Cx+K1x+K3(x2)x+Fes(x,V(t)) = 0. The system is inherently non-linear because of the cubic mechanical stiffness K3 of the structure, but also because of electrostatic forces (1+cos(ωt))Fes(x) that act on the system. Electrostatic forces are generated by comb drives and are proportional to the applied time-periodic voltage V(t). These drives also provide the means to introduce time-periodic coefficients, i.e. parametric excitation (1+cos(ωt)) with frequency ω. For a realistic MEM system the coefficients of the non-linear set of differential equations need to be scaled for efficient numerical treatment. The final mathematical model is a set of four non-linear time-periodic homogeneous differential equations of first order. Numerical results are obtained from two different methods. The linearized time-periodic (LTP) system is studied by calculating the Monodromy matrix of the system. The eigenvalues of this matrix decide on the stability of the LTP-system. To study the unabridged non-linear system, the bifurcation software ManLab is employed. Continuation analysis including stability evaluations are executed and show the frequency ranges for which the 2-dof system becomes unstable due to parametric resonances. Moreover, the existence of frequency intervals are shown where enhanced damping for the system is observed for this MEMS. The results from the stability studies are confirmed by simulation results.

Real-time simultaneous and proportional myoelectric control using intramuscular EMG

PubMed Central

Kuiken, Todd A; Hargrove, Levi J

2014-01-01

Objective Myoelectric prostheses use electromyographic (EMG) signals to control movement of prosthetic joints. Clinically available myoelectric control strategies do not allow simultaneous movement of multiple degrees of freedom (DOFs); however, the use of implantable devices that record intramuscular EMG signals could overcome this constraint. The objective of this study was to evaluate the real-time simultaneous control of three DOFs (wrist rotation, wrist flexion/extension, and hand open/close) using intramuscular EMG. Approach We evaluated task performance of five able-bodied subjects in a virtual environment using two control strategies with fine-wire EMG: (i) parallel dual-site differential control, which enabled simultaneous control of three DOFs and (ii) pattern recognition control, which required sequential control of DOFs. Main Results Over the course of the experiment, subjects using parallel dual-site control demonstrated increased use of simultaneous control and improved performance in a Fitts' Law test. By the end of the experiment, performance using parallel dual-site control was significantly better (up to a 25% increase in throughput) than when using sequential pattern recognition control for tasks requiring multiple DOFs. The learning trends with parallel dual-site control suggested that further improvements in performance metrics were possible. Subjects occasionally experienced difficulty in performing isolated single-DOF movements with parallel dual-site control but were able to accomplish related Fitts' Law tasks with high levels of path efficiency. Significance These results suggest that intramuscular EMG, used in a parallel dual-site configuration, can provide simultaneous control of a multi-DOF prosthetic wrist and hand and may outperform current methods that enforce sequential control. PMID:25394366

Real-time simultaneous and proportional myoelectric control using intramuscular EMG

NASA Astrophysics Data System (ADS)

Smith, Lauren H.; Kuiken, Todd A.; Hargrove, Levi J.

2014-12-01

Objective. Myoelectric prostheses use electromyographic (EMG) signals to control movement of prosthetic joints. Clinically available myoelectric control strategies do not allow simultaneous movement of multiple degrees of freedom (DOFs); however, the use of implantable devices that record intramuscular EMG signals could overcome this constraint. The objective of this study was to evaluate the real-time simultaneous control of three DOFs (wrist rotation, wrist flexion/extension, and hand open/close) using intramuscular EMG. Approach. We evaluated task performance of five able-bodied subjects in a virtual environment using two control strategies with fine-wire EMG: (i) parallel dual-site differential control, which enabled simultaneous control of three DOFs and (ii) pattern recognition control, which required sequential control of DOFs. Main results. Over the course of the experiment, subjects using parallel dual-site control demonstrated increased use of simultaneous control and improved performance in a Fitts’ Law test. By the end of the experiment, performance using parallel dual-site control was significantly better (up to a 25% increase in throughput) than when using sequential pattern recognition control for tasks requiring multiple DOFs. The learning trends with parallel dual-site control suggested that further improvements in performance metrics were possible. Subjects occasionally experienced difficulty in performing isolated single-DOF movements with parallel dual-site control but were able to accomplish related Fitts’ Law tasks with high levels of path efficiency. Significance. These results suggest that intramuscular EMG, used in a parallel dual-site configuration, can provide simultaneous control of a multi-DOF prosthetic wrist and hand and may outperform current methods that enforce sequential control.

Multi-dimensional Fokker-Planck equation analysis using the modified finite element method

NASA Astrophysics Data System (ADS)

Náprstek, J.; Král, R.

2016-09-01

The Fokker-Planck equation (FPE) is a frequently used tool for the solution of cross probability density function (PDF) of a dynamic system response excited by a vector of random processes. FEM represents a very effective solution possibility, particularly when transition processes are investigated or a more detailed solution is needed. Actual papers deal with single degree of freedom (SDOF) systems only. So the respective FPE includes two independent space variables only. Stepping over this limit into MDOF systems a number of specific problems related to a true multi-dimensionality must be overcome. Unlike earlier studies, multi-dimensional simplex elements in any arbitrary dimension should be deployed and rectangular (multi-brick) elements abandoned. Simple closed formulae of integration in multi-dimension domain have been derived. Another specific problem represents the generation of multi-dimensional finite element mesh. Assembling of system global matrices should be subjected to newly composed algorithms due to multi-dimensionality. The system matrices are quite full and no advantages following from their sparse character can be profited from, as is commonly used in conventional FEM applications in 2D/3D problems. After verification of partial algorithms, an illustrative example dealing with a 2DOF non-linear aeroelastic system in combination with random and deterministic excitations is discussed.

Design of a Lightweight Soft Robotic Arm Using Pneumatic Artificial Muscles and Inflatable Sleeves.

PubMed

Ohta, Preston; Valle, Luis; King, Jonathan; Low, Kevin; Yi, Jaehyun; Atkeson, Christopher G; Park, Yong-Lae

2018-04-01

As robots begin to interact with humans and operate in human environments, safety becomes a major concern. Conventional robots, although reliable and consistent, can cause injury to anyone within its range of motion. Soft robotics, wherein systems are made to be soft and mechanically compliant, are thus a promising alternative due to their lightweight nature and ability to cushion impacts, but current designs often sacrifice accuracy and usefulness for safety. We, therefore, have developed a bioinspired robotic arm combining elements of rigid and soft robotics such that it exhibits the positive qualities of both, namely compliance and accuracy, while maintaining a low weight. This article describes the design of a robotic arm-wrist-hand system with seven degrees of freedom (DOFs). The shoulder and elbow each has two DOFs for two perpendicular rotational motions on each joint, and the hand has two DOFs for wrist rotations and one DOF for a grasp motion. The arm is pneumatically powered using custom-built McKibben type pneumatic artificial muscles, which are inflated and deflated using binary and proportional valves. The wrist and hand motions are actuated through servomotors. In addition to the actuators, the arm is equipped with a potentiometer in each joint for detecting joint angle changes. Simulation and experimental results for closed-loop position control are also presented in the article.

Controlled Photon Switch Assisted by Coupled Quantum Dots

PubMed Central

Luo, Ming-Xing; Ma, Song-Ya; Chen, Xiu-Bo; Wang, Xiaojun

2015-01-01

Quantum switch is a primitive element in quantum network communication. In contrast to previous switch schemes on one degree of freedom (DOF) of quantum systems, we consider controlled switches of photon system with two DOFs. These controlled photon switches are constructed by exploring the optical selection rules derived from the quantum-dot spins in one-sided optical microcavities. Several double controlled-NOT gate on different joint systems are greatly simplified with an auxiliary DOF of the controlling photon. The photon switches show that two DOFs of photons can be independently transmitted in quantum networks. This result reduces the quantum resources for quantum network communication. PMID:26095049

Kinematic Analysis and Performance Evaluation of Novel PRS Parallel Mechanism

NASA Astrophysics Data System (ADS)

Balaji, K.; Khan, B. Shahul Hamid

2018-02-01

In this paper, a 3 DoF (Degree of Freedom) novel PRS (Prismatic-Revolute- Spherical) type parallel mechanisms has been designed and presented. The combination of striaght and arc type linkages for 3 DOF parallel mechanism is introduced for the first time. The performances of the mechanisms are evaluated based on the indices such as Minimum Singular Value (MSV), Condition Number (CN), Local Conditioning Index (LCI), Kinematic Configuration Index (KCI) and Global Conditioning Index (GCI). The overall reachable workspace of all mechanisms are presented. The kinematic measure, dexterity measure and workspace analysis for all the mechanism have been evaluated and compared.

Deterministic implementations of single-photon multi-qubit Deutsch-Jozsa algorithms with linear optics

NASA Astrophysics Data System (ADS)

Wei, Hai-Rui; Liu, Ji-Zhen

2017-02-01

It is very important to seek an efficient and robust quantum algorithm demanding less quantum resources. We propose one-photon three-qubit original and refined Deutsch-Jozsa algorithms with polarization and two linear momentums degrees of freedom (DOFs). Our schemes are constructed by solely using linear optics. Compared to the traditional ones with one DOF, our schemes are more economic and robust because the necessary photons are reduced from three to one. Our linear-optic schemes are working in a determinate way, and they are feasible with current experimental technology.

Deterministic implementations of single-photon multi-qubit Deutsch–Jozsa algorithms with linear optics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, Hai-Rui, E-mail: hrwei@ustb.edu.cn; Liu, Ji-Zhen

2017-02-15

It is very important to seek an efficient and robust quantum algorithm demanding less quantum resources. We propose one-photon three-qubit original and refined Deutsch–Jozsa algorithms with polarization and two linear momentums degrees of freedom (DOFs). Our schemes are constructed by solely using linear optics. Compared to the traditional ones with one DOF, our schemes are more economic and robust because the necessary photons are reduced from three to one. Our linear-optic schemes are working in a determinate way, and they are feasible with current experimental technology.

Design and Preliminary Evaluation of a Two DOFs Cable-Driven Ankle–Foot Prosthesis with Active Dorsiflexion–Plantarflexion and Inversion–Eversion

PubMed Central

Ficanha, Evandro Maicon; Ribeiro, Guilherme Aramizo; Dallali, Houman; Rastgaar, Mohammad

2016-01-01

This paper describes the design of an ankle–foot robotic prosthesis controllable in the sagittal and frontal planes. The prosthesis was designed to meet the mechanical characteristics of the human ankle including power, range of motion, and weight. To transfer the power from the motors and gearboxes to the ankle–foot mechanism, a Bowden cable system was used. The Bowden cable allows for optimal placement of the motors and gearboxes in order to improve gait biomechanics such as the metabolic energy cost and gait asymmetry during locomotion. Additionally, it allows flexibility in the customization of the device to amputees with different residual limb sizes. To control the prosthesis, impedance controllers in both sagittal and frontal planes were developed. The impedance controllers used torque feedback from strain gages installed on the foot. Preliminary evaluation was performed to verify the capability of the prosthesis to track the kinematics of the human ankle in two degrees of freedom (DOFs), the mechanical efficiency of the Bowden cable transmission, and the ability of the prosthesis to modulate the impedance of the ankle. Moreover, the system was characterized by describing the relationship between the stiffness of the impedance controllers to the actual stiffness of the ankle. Efficiency estimation showed 85.4% efficiency in the Bowden cable transmission. The prosthesis was capable of properly mimicking human ankle kinematics and changing its mechanical impedance in two DOFs in real time with a range of stiffness sufficient for normal human walking. In dorsiflexion–plantarflexion (DP), the stiffness ranged from 0 to 236 Nm/rad and in inversion–eversion (IE), the stiffness ranged from 1 to 33 Nm/rad. PMID:27200342

Autonomous docking ground demonstration

NASA Technical Reports Server (NTRS)

Lamkin, Steve L.; Le, Thomas Quan; Othon, L. T.; Prather, Joseph L.; Eick, Richard E.; Baxter, Jim M.; Boyd, M. G.; Clark, Fred D.; Spehar, Peter T.; Teters, Rebecca T.

1991-01-01

The Autonomous Docking Ground Demonstration is an evaluation of the laser sensor system to support the docking phase (12 ft to contact) when operated in conjunction with the guidance, navigation, and control (GN&C) software. The docking mechanism being used was developed for the Apollo/Soyuz Test Program. This demonstration will be conducted using the 6-DOF Dynamic Test System (DTS). The DTS simulates the Space Station Freedom as the stationary or target vehicle and the Orbiter as the active or chase vehicle. For this demonstration, the laser sensor will be mounted on the target vehicle and the retroflectors will be on the chase vehicle. This arrangement was chosen to prevent potential damage to the laser. The laser sensor system, GN&C, and 6-DOF DTS will be operated closed-loop. Initial conditions to simulate vehicle misalignments, translational and rotational, will be introduced within the constraints of the systems involved.

Aerial cooperative transporting and assembling control using multiple quadrotor-manipulator systems

NASA Astrophysics Data System (ADS)

Qi, Yuhua; Wang, Jianan; Shan, Jiayuan

2018-02-01

In this paper, a fully distributed control scheme for aerial cooperative transporting and assembling is proposed using multiple quadrotor-manipulator systems with each quadrotor equipped with a robotic manipulator. First, the kinematic and dynamic models of a quadrotor with multi-Degree of Freedom (DOF) robotic manipulator are established together using Euler-Lagrange equations. Based on the aggregated dynamic model, the control scheme consisting of position controller, attitude controller and manipulator controller is presented. Regarding cooperative transporting and assembling, multiple quadrotor-manipulator systems should be able to form a desired formation without collision among quadrotors from any initial position. The desired formation is achieved by the distributed position controller and attitude controller, while the collision avoidance is guaranteed by an artificial potential function method. Then, the transporting and assembling tasks request the manipulators to reach the desired angles cooperatively, which is achieved by the distributed manipulator controller. The overall stability of the closed-loop system is proven by a Lyapunov method and Matrosov's theorem. In the end, the proposed control scheme is simplified for the real application and then validated by two formation flying missions of four quadrotors with 2-DOF manipulators.

Design and implementation of a biomimetic turtle hydrofoil for an autonomous underwater vehicle.

PubMed

Font, Davinia; Tresanchez, Marcel; Siegentahler, Cedric; Pallejà, Tomàs; Teixidó, Mercè; Pradalier, Cedric; Palacin, Jordi

2011-01-01

This paper presents the design and implementation of a turtle hydrofoil for an Autonomous Underwater Vehicle (AUV). The final design of the AUV must have navigation performance like a turtle, which has also been the biomimetic inspiration for the design of the hydrofoil and propulsion system. The hydrofoil design is based on a National Advisory Committee for Aeronautics (NACA) 0014 hydrodynamic profile. During the design stage, four different propulsion systems were compared in terms of propulsion path, compactness, sealing and required power. The final implementation is based on a ball-and-socket mechanism because it is very compact and provides three degrees of freedom (DoF) to the hydrofoil with very few restrictions on the propulsion path. The propulsion obtained with the final implementation of the hydrofoil has been empirically evaluated in a water channel comparing different motion strategies. The results obtained have confirmed that the proposed turtle hydrofoil controlled with a mechanism with three DoF generates can be used in the future implementation of the planned AUV.

ZmDof3, a maize endosperm-specific Dof protein gene, regulates starch accumulation and aleurone development in maize endosperm.

PubMed

Qi, Xin; Li, Shixue; Zhu, Yaxi; Zhao, Qian; Zhu, Dengyun; Yu, Jingjuan

2017-01-01

To explore the function of Dof transcription factors during kernel development in maize, we first identified Dof genes in the maize genome. We found that ZmDof3 was exclusively expressed in the endosperm of maize kernel and had the features of a Dof transcription factor. Suppression of ZmDof3 resulted in a defective kernel phenotype with reduced starch content and a partially patchy aleurone layer. The expression levels of starch synthesis-related genes and aleurone differentiation-associated genes were down-regulated in ZmDof3 knockdown kernels, indicating that ZmDof3 plays an important role in maize endosperm development. The maize endosperm, occupying a large proportion of the kernel, plays an important role in seed development and germination. Current knowledge regarding the regulation of endosperm development is limited. Dof proteins, a family of plant-specific transcription factors, play critical roles in diverse biological processes. In this study, an endosperm-specific Dof protein gene, ZmDof3, was identified in maize through genome-wide screening. Suppression of ZmDof3 resulted in a defective kernel phenotype. The endosperm of ZmDof3 knockdown kernels was loosely packed with irregular starch granules observed by electronic microscope. Through genome-wide expression profiling, we found that down-regulated genes were enriched in GO terms related to carbohydrate metabolism. Moreover, ZmDof3 could bind to the Dof core element in the promoter of starch biosynthesis genes Du1 and Su2 in vitro and in vivo. In addition, the aleurone at local position in mature ZmDof3 knockdown kernels varied from one to three layers, which consisted of smaller and irregular cells. Further analyses showed that knockdown of ZmDof3 reduced the expression of Nkd1, which is involved in aleurone cell differentiation, and that ZmDof3 could bind to the Dof core element in the Nkd1 promoter. Our study reveals that ZmDof3 functions in maize endosperm development as a positive regulator in the signaling system controlling starch accumulation and aleurone development.

Integration of computer-assisted fracture reduction system and a hybrid 3-DOF-RPS mechanism for assisting the orthopedic surgery

NASA Astrophysics Data System (ADS)

Irwansyah; Sinh, N. P.; Lai, J. Y.; Essomba, T.; Asbar, R.; Lee, P. Y.

2018-02-01

In this paper, we present study to integrate virtual fracture bone reduction simulation tool with a novel hybrid 3-DOF-RPS external fixator to relocate back bone fragments into their anatomically original position. A 3D model of fractured bone was reconstructed and manipulated using 3D design and modeling software, PhysiGuide. The virtual reduction system was applied to reduce a bilateral femoral shaft fracture type 32-A3. Measurement data from fracture reduction and fixation stages were implemented to manipulate the manipulator pose in patient’s clinical case. The experimental result presents that by merging both of those techniques will give more possibilities to reduce virtual bone reduction time, improve facial and shortest healing treatment.

Surgical bedside master console for neurosurgical robotic system.

PubMed

Arata, Jumpei; Kenmotsu, Hajime; Takagi, Motoki; Hori, Tatsuya; Miyagi, Takahiro; Fujimoto, Hideo; Kajita, Yasukazu; Hayashi, Yuichiro; Chinzei, Kiyoyuki; Hashizume, Makoto

2013-01-01

We are currently developing a neurosurgical robotic system that facilitates access to residual tumors and improves brain tumor removal surgical outcomes. The system combines conventional and robotic surgery allowing for a quick conversion between the procedures. This concept requires a new master console that can be positioned at the surgical bedside and be sterilized. The master console was developed using new technologies, such as a parallel mechanism and pneumatic sensors. The parallel mechanism is a purely passive 5-DOF (degrees of freedom) joystick based on the author's haptic research. The parallel mechanism enables motion input of conventional brain tumor removal surgery with a compact, intuitive interface that can be used in a conventional surgical environment. In addition, the pneumatic sensors implemented on the mechanism provide an intuitive interface and electrically isolate the tool parts from the mechanism so they can be easily sterilized. The 5-DOF parallel mechanism is compact (17 cm width, 19cm depth, and 15cm height), provides a 505,050 mm and 90° workspace and is highly backdrivable (0.27N of resistance force representing the surgical motion). The evaluation tests revealed that the pneumatic sensors can properly measure the suction strength, grasping force, and hand contact. In addition, an installability test showed that the master console can be used in a conventional surgical environment. The proposed master console design was shown to be feasible for operative neurosurgery based on comprehensive testing. This master console is currently being tested for master-slave control with a surgical robotic system.

Design and characterization of an ocean wave powered lifejacket using 2DOF floating boards

NASA Astrophysics Data System (ADS)

Mi, Jia; Xu, Lin; Yang, Yaling; Zuo, Lei

2018-04-01

Lifejacket is an indispensable life-saving equipment for ships and airplanes. Traditional lifejacket is designed to prevent human from drowning. However, the water temperature is usually low, especially in winter, which significantly reduces the human body temperature and leads to death. Meanwhile, power is critical for drowning people to use emergency communication equipment. This paper proposed an ocean wave powered lifejacket using 2DOF floating boards to provide both buoyance and electricity for drowning people. Hence, they can use this continuous electric power to keep key body warm and send distress signal. This lifejacket is featured with two 2DOF floating boards and the mechanical motion rectifier (MMR) can convert the 2-DOF motions to the unidirectional rotation of generator. The design principle is illustrated and the dynamic modelling for the 2-DOF motions has been analyzed. Bench test and lake test have been conducted to validate the design concept.

Robotic Arm Manipulator Using Active Control for Sample Acquisition and Transfer, and Passive Mode for Surface Compliance

NASA Technical Reports Server (NTRS)

Liu, Jun; Underhill, Michael L.; Trease, Brian P.; Lindemann, Randel A.

2010-01-01

A robotic arm that consists of three joints with four degrees of freedom (DOF) has been developed. It can carry an end-effector to acquire and transfer samples by using active control and comply with surface topology in a passive mode during a brief surface contact. The three joints are arranged in such a way that one joint of two DOFs is located at the shoulder, one joint of one DOF is located at the elbow, and one joint of one DOF is located at the wrist. Operationally, three DOFs are moved in the same plane, and the remaining one on the shoulder is moved perpendicular to the other three for better compliance with ground surface and more flexibility of sample handling. Three out of four joints are backdriveable, making the mechanism less complex and more cost effective

Coherent detection in optical fiber systems.

PubMed

Ip, Ezra; Lau, Alan Pak Tao; Barros, Daniel J F; Kahn, Joseph M

2008-01-21

The drive for higher performance in optical fiber systems has renewed interest in coherent detection. We review detection methods, including noncoherent, differentially coherent, and coherent detection, as well as a hybrid method. We compare modulation methods encoding information in various degrees of freedom (DOF). Polarization-multiplexed quadrature-amplitude modulation maximizes spectral efficiency and power efficiency, by utilizing all four available DOF, the two field quadratures in the two polarizations. Dual-polarization homodyne or heterodyne downconversion are linear processes that can fully recover the received signal field in these four DOF. When downconverted signals are sampled at the Nyquist rate, compensation of transmission impairments can be performed using digital signal processing (DSP). Linear impairments, including chromatic dispersion and polarization-mode dispersion, can be compensated quasi-exactly using finite impulse response filters. Some nonlinear impairments, such as intra-channel four-wave mixing and nonlinear phase noise, can be compensated partially. Carrier phase recovery can be performed using feedforward methods, even when phase-locked loops may fail due to delay constraints. DSP-based compensation enables a receiver to adapt to time-varying impairments, and facilitates use of advanced forward-error-correction codes. We discuss both single- and multi-carrier system implementations. For a given modulation format, using coherent detection, they offer fundamentally the same spectral efficiency and power efficiency, but may differ in practice, because of different impairments and implementation details. With anticipated advances in analog-to-digital converters and integrated circuit technology, DSP-based coherent receivers at bit rates up to 100 Gbit/s should become practical within the next few years.

Incremental harmonic balance method for predicting amplitudes of a multi-d.o.f. non-linear wheel shimmy system with combined Coulomb and quadratic damping

NASA Astrophysics Data System (ADS)

Zhou, J. X.; Zhang, L.

2005-01-01

Incremental harmonic balance (IHB) formulations are derived for general multiple degrees of freedom (d.o.f.) non-linear autonomous systems. These formulations are developed for a concerned four-d.o.f. aircraft wheel shimmy system with combined Coulomb and velocity-squared damping. A multi-harmonic analysis is performed and amplitudes of limit cycles are predicted. Within a large range of parametric variations with respect to aircraft taxi velocity, the IHB method can, at a much cheaper cost, give results with high accuracy as compared with numerical results given by a parametric continuation method. In particular, the IHB method avoids the stiff problems emanating from numerical treatment of aircraft wheel shimmy system equations. The development is applicable to other vibration control systems that include commonly used dry friction devices or velocity-squared hydraulic dampers.

Origami structures with a critical transition to bistability arising from hidden degrees of freedom

NASA Astrophysics Data System (ADS)

Silverberg, Jesse L.; Na, Jun-Hee; Evans, Arthur A.; Liu, Bin; Hull, Thomas C.; Santangelo, Christian D.; Lang, Robert J.; Hayward, Ryan C.; Cohen, Itai

2015-04-01

Origami is used beyond purely aesthetic pursuits to design responsive and customizable mechanical metamaterials. However, a generalized physical understanding of origami remains elusive, owing to the challenge of determining whether local kinematic constraints are globally compatible and to an incomplete understanding of how the folded sheet’s material properties contribute to the overall mechanical response. Here, we show that the traditional square twist, whose crease pattern has zero degrees of freedom (DOF) and therefore should not be foldable, can nevertheless be folded by accessing bending deformations that are not explicit in the crease pattern. These hidden bending DOF are separated from the crease DOF by an energy gap that gives rise to a geometrically driven critical bifurcation between mono- and bistability. Noting its potential utility for fabricating mechanical switches, we use a temperature-responsive polymer-gel version of the square twist to demonstrate hysteretic folding dynamics at the sub-millimetre scale.

Ultra-Long-Distance Hybrid BOTDA/Ф-OTDR

PubMed Central

Fu, Yun; Zhu, Richeng; Xue, Naitian; Lu, Chongyu; Zhang, Bin; Yang, Le; Atubga, David; Rao, Yunjiang

2018-01-01

In the distributed optical fiber sensing (DOFS) domain, simultaneous measurement of vibration and temperature/strain based on Rayleigh scattering and Brillouin scattering in fiber could have wide applications. However, there are certain challenges for the case of ultra-long sensing range, including the interplay of different scattering mechanisms, the interaction of two types of sensing signals, and the competition of pump power. In this paper, a hybrid DOFS system, which can simultaneously measure temperature/strain and vibration over 150 km, is elaborately designed via integrating the Brillouin optical time-domain analyzer (BOTDA) and phase-sensitive optical time-domain reflectometry (Ф-OTDR). Distributed Raman and Brillouin amplifications, frequency division multiplexing (FDM), wavelength division multiplexing (WDM), and time division multiplexing (TDM) are delicately fused to accommodate ultra-long-distance BOTDA and Ф-OTDR. Consequently, the sensing range of the hybrid system is 150.62 km, and the spatial resolution of BOTDA and Ф-OTDR are 9 m and 30 m, respectively. The measurement uncertainty of the BOTDA is ± 0.82 MHz. To the best of our knowledge, this is the first time that such hybrid DOFS is realized with a hundred-kilometer length scale. PMID:29587407

Classical molecular dynamics simulation of electronically non-adiabatic processes.

PubMed

Miller, William H; Cotton, Stephen J

2016-12-22

Both classical and quantum mechanics (as well as hybrids thereof, i.e., semiclassical approaches) find widespread use in simulating dynamical processes in molecular systems. For large chemical systems, however, which involve potential energy surfaces (PES) of general/arbitrary form, it is usually the case that only classical molecular dynamics (MD) approaches are feasible, and their use is thus ubiquitous nowadays, at least for chemical processes involving dynamics on a single PES (i.e., within a single Born-Oppenheimer electronic state). This paper reviews recent developments in an approach which extends standard classical MD methods to the treatment of electronically non-adiabatic processes, i.e., those that involve transitions between different electronic states. The approach treats nuclear and electronic degrees of freedom (DOF) equivalently (i.e., by classical mechanics, thereby retaining the simplicity of standard MD), and provides "quantization" of the electronic states through a symmetrical quasi-classical (SQC) windowing model. The approach is seen to be capable of treating extreme regimes of strong and weak coupling between the electronic states, as well as accurately describing coherence effects in the electronic DOF (including the de-coherence of such effects caused by coupling to the nuclear DOF). A survey of recent applications is presented to illustrate the performance of the approach. Also described is a newly developed variation on the original SQC model (found universally superior to the original) and a general extension of the SQC model to obtain the full electronic density matrix (at no additional cost/complexity).

Robust Real-Time Musculoskeletal Modeling Driven by Electromyograms.

PubMed

Durandau, Guillaume; Farina, Dario; Sartori, Massimo

2018-03-01

Current clinical biomechanics involves lengthy data acquisition and time-consuming offline analyses with biomechanical models not operating in real-time for man-machine interfacing. We developed a method that enables online analysis of neuromusculoskeletal function in vivo in the intact human. We used electromyography (EMG)-driven musculoskeletal modeling to simulate all transformations from muscle excitation onset (EMGs) to mechanical moment production around multiple lower-limb degrees of freedom (DOFs). We developed a calibration algorithm that enables adjusting musculoskeletal model parameters specifically to an individual's anthropometry and force-generating capacity. We incorporated the modeling paradigm into a computationally efficient, generic framework that can be interfaced in real-time with any movement data collection system. The framework demonstrated the ability of computing forces in 13 lower-limb muscle-tendon units and resulting moments about three joint DOFs simultaneously in real-time. Remarkably, it was capable of extrapolating beyond calibration conditions, i.e., predicting accurate joint moments during six unseen tasks and one unseen DOF. The proposed framework can dramatically reduce evaluation latency in current clinical biomechanics and open up new avenues for establishing prompt and personalized treatments, as well as for establishing natural interfaces between patients and rehabilitation systems. The integration of EMG with numerical modeling will enable simulating realistic neuromuscular strategies in conditions including muscular/orthopedic deficit, which could not be robustly simulated via pure modeling formulations. This will enable translation to clinical settings and development of healthcare technologies including real-time bio-feedback of internal mechanical forces and direct patient-machine interfacing.

Frequency Response Function Expansion for Unmeasured Translation and Rotation Dofs for Impedance Modelling Applications

NASA Astrophysics Data System (ADS)

Avitabile, P.; O'Callahan, J.

2003-07-01

Inclusion of rotational effects is critical for the accuracy of the predicted system characteristics, in almost all system modelling studies. However, experimentally derived information for the description of one or more of the components for the system will generally not have any rotational effects included in the description of the component. The lack of rotational effects has long affected the results from any system model development whether using a modal-based approach or an impedance-based approach. Several new expansion processes are described herein for the development of FRFs needed for impedance-based system models. These techniques expand experimentally derived mode shapes, residual modes from the modal parameter estimation process and FRFs directly to allow for the inclusion of the necessary rotational dof. The FRFs involving translational to rotational dofs are developed as well as the rotational to rotational dof. Examples are provided to show the use of these techniques.

3D printing antagonistic systems of artificial muscle using projection stereolithography.

PubMed

Peele, Bryan N; Wallin, Thomas J; Zhao, Huichan; Shepherd, Robert F

2015-09-09

The detailed mechanical design of a digital mask projection stereolithgraphy system is described for the 3D printing of soft actuators. A commercially available, photopolymerizable elastomeric material is identified and characterized in its liquid and solid form using rheological and tensile testing. Its capabilities for use in directly printing high degree of freedom (DOF), soft actuators is assessed. An outcome is the ∼40% strain to failure of the printed elastomer structures. Using the resulting material properties, numerical simulations of pleated actuator architectures are analyzed to reduce stress concentration and increase actuation amplitudes. Antagonistic pairs of pleated actuators are then fabricated and tested for four-DOF, tentacle-like motion. These antagonistic pairs are shown to sweep through their full range of motion (∼180°) with a period of less than 70 ms.

Workspace analysis and design improvement of a carotid flow measurement system.

PubMed

Carbone, G; Nakadate, R; Solis, J; Ceccarelli, M; Takanishi, A; Minagawa, E; Sugawara, M; Niki, K

2010-11-01

Heart and cerebrovascular diseases such as arteriosclerosis and myocardial ischemia dysfunction are currently among the main causes of death in developed countries. Recently, wave intensity (WI), which is an index used to obtain the force of cardiac contraction, has been investigated as a method for early-stage diagnosis of the above-mentioned diseases. Nevertheless, experimental tests have proven that the manual measurements of WI by means of commercial ultrasonic diagnostic systems require too much time and can be affected by the operator's skills. For this purpose, the introduction of robotic-assisted technology has advantages in terms of repetitiveness and accuracy of the measurement procedure. Therefore, at Waseda University, the development of a carotid blood flow measurement system has been proposed to support doctors while using ultrasound diagnostic equipment to measure the WI. This robotic system is composed of a serial robot with a wrist having a six-degree-of-freedom (6-DOF) parallel mechanism. The main focus is to obtain a suitable workspace performance of the 6-DOF parallel mechanism wrist. In this paper, a workspace analysis is carried out on a wrist prototype built for the Waseda-Tokyo Women's Medical Aloka Blood Flow Measurement System No.1 Refined (WTA-1R). Then, mechanical design enhancements are proposed and validated to provide a suitable workspace performance both as reachable workspace and dexterity, and a refined prototype WTA-1RII has been built.

Distributed Optical Fiber Sensors Based on Optical Frequency Domain Reflectometry: A review

PubMed Central

Wang, Chenhuan; Liu, Kun; Jiang, Junfeng; Yang, Di; Pan, Guanyi; Pu, Zelin; Liu, Tiegen

2018-01-01

Distributed optical fiber sensors (DOFS) offer unprecedented features, the most unique one of which is the ability of monitoring variations of the physical and chemical parameters with spatial continuity along the fiber. Among all these distributed sensing techniques, optical frequency domain reflectometry (OFDR) has been given tremendous attention because of its high spatial resolution and large dynamic range. In addition, DOFS based on OFDR have been used to sense many parameters. In this review, we will survey the key technologies for improving sensing range, spatial resolution and sensing performance in DOFS based on OFDR. We also introduce the sensing mechanisms and the applications of DOFS based on OFDR including strain, stress, vibration, temperature, 3D shape, flow, refractive index, magnetic field, radiation, gas and so on. PMID:29614024

Distributed Optical Fiber Sensors Based on Optical Frequency Domain Reflectometry: A review.

PubMed

Ding, Zhenyang; Wang, Chenhuan; Liu, Kun; Jiang, Junfeng; Yang, Di; Pan, Guanyi; Pu, Zelin; Liu, Tiegen

2018-04-03

Distributed optical fiber sensors (DOFS) offer unprecedented features, the most unique one of which is the ability of monitoring variations of the physical and chemical parameters with spatial continuity along the fiber. Among all these distributed sensing techniques, optical frequency domain reflectometry (OFDR) has been given tremendous attention because of its high spatial resolution and large dynamic range. In addition, DOFS based on OFDR have been used to sense many parameters. In this review, we will survey the key technologies for improving sensing range, spatial resolution and sensing performance in DOFS based on OFDR. We also introduce the sensing mechanisms and the applications of DOFS based on OFDR including strain, stress, vibration, temperature, 3D shape, flow, refractive index, magnetic field, radiation, gas and so on.

Parallel controller construction for a multi-DOF hand rehabilitation equipment

NASA Astrophysics Data System (ADS)

Ito, Satoshi; Ueki, Satoshi; Ishihara, Koji; Miura, Masayuki; Kawasaki, Haruhisa; Ishigure, Yasuhiko; Nishimoto, Yutakai

2007-12-01

This paper describes the development of a hand rehabilitation system for stroke patients. Our aim is to provide fine motion exercise for a hand and fingers. Thus, a hand rehabilitation device that assists patients' finger movements was developed. Because this device has 18 degrees of freedom of motion, it is diffcult for disabled patients to use it by themselves. Therefore, an appropriate control strategy and control system are required to allow its safe and effective use. In light of this requirement, a control system was constructed which is comprised of four separated controllers. This paper presents the structure of the control system and introduces the control protocols used in our hand rehabilitation system.

Knowledge capture and the retirement of the director of finance: succession planning in the San Mateo County Human Services Agency.

PubMed

Winship, Kathy

2012-01-01

Concern over the impending retirement of several top-level managers led a county agency to engage in efforts aimed at more efficient succession management. Administrators developed plans to prevent the loss of invaluable knowledge and wisdom accompanying retirement of experienced agency leaders. The agency's Director of Finance (DoF) was one of the first key figures projected to retire, and a succession plan was implemented to transfer his knowledge for use after his departure. The knowledge transfer process involved three stages, including: (1) employing the DoF as teacher, having him develop curricula and conduct trainings; (2) engaging the DoF as mentor, allowing an existing staff member and the DoF's successor to shadow and be coached by the DoF; and (3) developing a knowledge management system that could be used after the DoF departed. This case study describes the knowledge transfer process and experiences shared by the DoF and this agency. Copyright © Taylor & Francis Group, LLC

Research and implementation of a new 6-DOF light-weight robot

NASA Astrophysics Data System (ADS)

Tao, Zihang; Zhang, Tao; Qi, Mingzhong; Ji, Junhui

2017-06-01

Traditional industrial robots have some weaknesses such as low payload-weight, high power consumption and high cost. These drawbacks limit their applications in such areas, special application, service and surgical robots. To improve these shortcomings, a new kind 6-DOF light-weight robot was designed based on modular joints and modular construction. This paper discusses the general requirements of the light-weight robots. Based on these requirements the novel robot is designed. The new robot is described from two aspects, mechanical design and control system. A prototype robot had developed and a joint performance test platform had designed. Position and velocity tests had conducted to evaluate the performance of the prototype robot. Test results showed that the prototype worked well.

A Course in Simulation and Demonstration of Humanoid Robot Motion

ERIC Educational Resources Information Center

Liu, Hsin-Yu; Wang, Wen-June; Wang, Rong-Jyue

2011-01-01

An introductory course for humanoid robot motion realization for undergraduate and graduate students is presented in this study. The basic operations of AX-12 motors and the mechanics combination of a 16 degrees-of-freedom (DOF) humanoid robot are presented first. The main concepts of multilink systems, zero moment point (ZMP), and feedback…

Design and Implementation of a Biomimetic Turtle Hydrofoil for an Autonomous Underwater Vehicle

PubMed Central

Font, Davinia; Tresanchez, Marcel; Siegentahler, Cedric; Pallejà, Tomàs; Teixidó, Mercè; Pradalier, Cedric; Palacin, Jordi

2011-01-01

This paper presents the design and implementation of a turtle hydrofoil for an Autonomous Underwater Vehicle (AUV). The final design of the AUV must have navigation performance like a turtle, which has also been the biomimetic inspiration for the design of the hydrofoil and propulsion system. The hydrofoil design is based on a National Advisory Committee for Aeronautics (NACA) 0014 hydrodynamic profile. During the design stage, four different propulsion systems were compared in terms of propulsion path, compactness, sealing and required power. The final implementation is based on a ball-and-socket mechanism because it is very compact and provides three degrees of freedom (DoF) to the hydrofoil with very few restrictions on the propulsion path. The propulsion obtained with the final implementation of the hydrofoil has been empirically evaluated in a water channel comparing different motion strategies. The results obtained have confirmed that the proposed turtle hydrofoil controlled with a mechanism with three DoF generates can be used in the future implementation of the planned AUV. PMID:22247660

Dynamic characteristics of the blisk with synchronized switch damping based on negative capacitor

NASA Astrophysics Data System (ADS)

Liu, J.; Li, L.; Huang, X.; Jezequel, L.

2017-10-01

In this paper, we propose a method to suppress the vibration of the integral bladed disk ('blisk' for short) in aero-engines using synchronized switch damping based on negative capacitor (SSDNC). Different from the classical piezoelectric shunt damping, SSDNC is a type of nonlinear piezoelectric damping. A multi-harmonic balance method combined with the alternating frequency/time method (MHBM-AFT) is used to predict and further analyze the dynamic characteristics of the electromechanical system, and an arc-length continuation technique is used to improve the convergence of the method. In order to validate the algorithm as well as to recognize the characteristics of the system with SSDNC, a two degree-of-freedom (2-DOF) system with SSDNC is studied at first. The nonlinear complex modal information is calculated and compared with those of the corresponding system with a linear RL shunt circuit. The results indicate that the natural frequencies and modal damping ratio do not change with the modal amplitude, which means that SSDNC has the same modal damping corresponding to different system energy levels. In addition, SSDNC can improve the damping level of all the modes nearly without affecting the natural frequencies of the system. Then, the forced response of the blisk with SSDNC in the frequency domain is calculated and analyzed, including a tuned blisk, which is excited by the traveling wave excitation with a single harmonic and multi-harmonic, and a mistuned blisk, which is excited by traveling wave excitation with a single harmonic and multi-harmonic. We present two advantages of the SSDNC technique when compared with piezoelectric shunt damping. First, SSDNC can suppress the vibration of the blisk under a multi-harmonic wideband the traveling wave, and second, the vibration suppression performance of SSDNC is insensitive to the mistuning of mechanical parameters of the blisk. The results will be of great significance in overcoming the problem of the amplitude magnification induced by the inevitable mistuning of the blisk in aero-engines.

Human-Derived Disturbance Estimation and Compensation (DEC) Method Lends Itself to a Modular Sensorimotor Control in a Humanoid Robot.

PubMed

Lippi, Vittorio; Mergner, Thomas

2017-01-01

The high complexity of the human posture and movement control system represents challenges for diagnosis, therapy, and rehabilitation of neurological patients. We envisage that engineering-inspired, model-based approaches will help to deal with the high complexity of the human posture control system. Since the methods of system identification and parameter estimation are limited to systems with only a few DoF, our laboratory proposes a heuristic approach that step-by-step increases complexity when creating a hypothetical human-derived control systems in humanoid robots. This system is then compared with the human control in the same test bed, a posture control laboratory. The human-derived control builds upon the identified disturbance estimation and compensation (DEC) mechanism, whose main principle is to support execution of commanded poses or movements by compensating for external or self-produced disturbances such as gravity effects. In previous robotic implementation, up to 3 interconnected DEC control modules were used in modular control architectures separately for the sagittal plane or the frontal body plane and successfully passed balancing and movement tests. In this study we hypothesized that conflict-free movement coordination between the robot's sagittal and frontal body planes emerges simply from the physical embodiment, not necessarily requiring a full body control. Experiments were performed in the 14 DoF robot Lucy Posturob (i) demonstrating that the mechanical coupling from the robot's body suffices to coordinate the controls in the two planes when the robot produces movements and balancing responses in the intermediate plane, (ii) providing quantitative characterization of the interaction dynamics between body planes including frequency response functions (FRFs), as they are used in human postural control analysis, and (iii) witnessing postural and control stability when all DoFs are challenged together with the emergence of inter-segmental coordination in squatting movements. These findings represent an important step toward controlling in the robot in future more complex sensorimotor functions such as walking.

Human-Derived Disturbance Estimation and Compensation (DEC) Method Lends Itself to a Modular Sensorimotor Control in a Humanoid Robot

PubMed Central

Lippi, Vittorio; Mergner, Thomas

2017-01-01

The high complexity of the human posture and movement control system represents challenges for diagnosis, therapy, and rehabilitation of neurological patients. We envisage that engineering-inspired, model-based approaches will help to deal with the high complexity of the human posture control system. Since the methods of system identification and parameter estimation are limited to systems with only a few DoF, our laboratory proposes a heuristic approach that step-by-step increases complexity when creating a hypothetical human-derived control systems in humanoid robots. This system is then compared with the human control in the same test bed, a posture control laboratory. The human-derived control builds upon the identified disturbance estimation and compensation (DEC) mechanism, whose main principle is to support execution of commanded poses or movements by compensating for external or self-produced disturbances such as gravity effects. In previous robotic implementation, up to 3 interconnected DEC control modules were used in modular control architectures separately for the sagittal plane or the frontal body plane and successfully passed balancing and movement tests. In this study we hypothesized that conflict-free movement coordination between the robot's sagittal and frontal body planes emerges simply from the physical embodiment, not necessarily requiring a full body control. Experiments were performed in the 14 DoF robot Lucy Posturob (i) demonstrating that the mechanical coupling from the robot's body suffices to coordinate the controls in the two planes when the robot produces movements and balancing responses in the intermediate plane, (ii) providing quantitative characterization of the interaction dynamics between body planes including frequency response functions (FRFs), as they are used in human postural control analysis, and (iii) witnessing postural and control stability when all DoFs are challenged together with the emergence of inter-segmental coordination in squatting movements. These findings represent an important step toward controlling in the robot in future more complex sensorimotor functions such as walking. PMID:28951719

Control of a Serpentine Robot for Inspection Tasks

NASA Technical Reports Server (NTRS)

Colbaugh, R.; Glass, K.; Seraji, H.

1994-01-01

This paper presents a simple and robust kinematic control scheme for the JPL serpentine robot system. The proposed strategy is developed using the dampened-least-squares/configuration control methodology, and permits the considerable dexterity of the JPL serpentine robot to be effectively utilized for maneuvering in the congested and uncertain workspaces often encountered in inspection tasks. Computer simulation results are given for the 20 degree-of-freedom (DOF) manipulator system obtained by mounting the twelve DOF serpentine robot at the end-effector of an eight DOF Robotics Research arm/lathe-bed system. These simulations demonstrate that the proposed approach provides an effective method of controlling this complex system.

Multi-objective control for cooperative payload transport with rotorcraft UAVs.

PubMed

Gimenez, Javier; Gandolfo, Daniel C; Salinas, Lucio R; Rosales, Claudio; Carelli, Ricardo

2018-06-01

A novel kinematic formation controller based on null-space theory is proposed to transport a cable-suspended payload with two rotorcraft UAVs considering collision avoidance, wind perturbations, and properly distribution of the load weight. An accurate 6-DoF nonlinear dynamic model of a helicopter and models for flexible cables and payload are included to test the proposal in a realistic scenario. System stability is demonstrated using Lyapunov theory and several simulation results show the good performance of the approach. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

Constraints on methane emissions in North America from future geostationary remote-sensing measurements

DOE PAGES

Bousserez, Nicolas; Henze, Daven K.; Rooney, Brigitte; ...

2016-05-20

The success of future geostationary (GEO) satellite observation missions depends on our ability to design instruments that address their key scientific objectives. Here, an Observation System Simulation Experiment (OSSE) is performed to quantify the constraints on methane (CH 4) emissions in North America obtained from shortwave infrared (SWIR), thermal infrared (TIR), and multi-spectral (SWIR+TIR) measurements in geostationary orbit and from future SWIR low-Earth orbit (LEO) measurements. Furthermore, we used an efficient stochastic algorithm to compute the information content of the inverted emissions at high spatial resolution (0.5° × 0.7°) in a variational framework using the GEOS-Chem chemistry-transport model and itsmore » adjoint. Our results show that at sub-weekly timescales, SWIR measurements in GEO orbit can constrain about twice as many independent flux patterns than in LEO orbit, with a degree of freedom for signal (DOF) for the inversion of 266 and 115, respectively. Comparisons between TIR GEO and SWIR LEO configurations reveal that poor boundary layer sensitivities for the TIR measurements cannot be compensated for by the high spatiotemporal sampling of a GEO orbit. The benefit of a multi-spectral instrument compared to current SWIR products in a GEO context is shown for sub-weekly timescale constraints, with an increase in the DOF of about 50 % for a 3-day inversion. Our results further suggest that both the SWIR and multi-spectral measurements on GEO orbits could almost fully resolve CH 4 fluxes at a spatial resolution of at least 100 km × 100 km over source hotspots (emissions > 4 × 10 5 kg day -1). The sensitivity of the optimized emission scaling factors to typical errors in boundary and initial conditions can reach 30 and 50 % for the SWIR GEO or SWIR LEO configurations, respectively, while it is smaller than 5 % in the case of a multi-spectral GEO system. Our results demonstrate that multi-spectral measurements from a geostationary satellite platform would address the need for higher spatiotemporal constraints on CH 4 emissions while greatly mitigating the impact of inherent uncertainties in source inversion methods on the inferred fluxes.« less

Constraints on methane emissions in North America from future geostationary remote-sensing measurements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bousserez, Nicolas; Henze, Daven K.; Rooney, Brigitte

The success of future geostationary (GEO) satellite observation missions depends on our ability to design instruments that address their key scientific objectives. Here, an Observation System Simulation Experiment (OSSE) is performed to quantify the constraints on methane (CH 4) emissions in North America obtained from shortwave infrared (SWIR), thermal infrared (TIR), and multi-spectral (SWIR+TIR) measurements in geostationary orbit and from future SWIR low-Earth orbit (LEO) measurements. Furthermore, we used an efficient stochastic algorithm to compute the information content of the inverted emissions at high spatial resolution (0.5° × 0.7°) in a variational framework using the GEOS-Chem chemistry-transport model and itsmore » adjoint. Our results show that at sub-weekly timescales, SWIR measurements in GEO orbit can constrain about twice as many independent flux patterns than in LEO orbit, with a degree of freedom for signal (DOF) for the inversion of 266 and 115, respectively. Comparisons between TIR GEO and SWIR LEO configurations reveal that poor boundary layer sensitivities for the TIR measurements cannot be compensated for by the high spatiotemporal sampling of a GEO orbit. The benefit of a multi-spectral instrument compared to current SWIR products in a GEO context is shown for sub-weekly timescale constraints, with an increase in the DOF of about 50 % for a 3-day inversion. Our results further suggest that both the SWIR and multi-spectral measurements on GEO orbits could almost fully resolve CH 4 fluxes at a spatial resolution of at least 100 km × 100 km over source hotspots (emissions > 4 × 10 5 kg day -1). The sensitivity of the optimized emission scaling factors to typical errors in boundary and initial conditions can reach 30 and 50 % for the SWIR GEO or SWIR LEO configurations, respectively, while it is smaller than 5 % in the case of a multi-spectral GEO system. Our results demonstrate that multi-spectral measurements from a geostationary satellite platform would address the need for higher spatiotemporal constraints on CH 4 emissions while greatly mitigating the impact of inherent uncertainties in source inversion methods on the inferred fluxes.« less

Mechatronic Development and Vision Feedback Control of a Nanorobotics Manipulation System inside SEM for Nanodevice Assembly

PubMed Central

Yang, Zhan; Wang, Yaqiong; Yang, Bin; Li, Guanghui; Chen, Tao; Nakajima, Masahiro; Sun, Lining; Fukuda, Toshio

2016-01-01

Carbon nanotubes (CNT) have been developed in recent decades for nanodevices such as nanoradios, nanogenerators, carbon nanotube field effect transistors (CNTFETs) and so on, indicating that the application of CNTs for nanoscale electronics may play a key role in the development of nanotechnology. Nanorobotics manipulation systems are a promising method for nanodevice construction and assembly. For the purpose of constructing three-dimensional CNTFETs, a nanorobotics manipulation system with 16 DOFs was developed for nanomanipulation of nanometer-scale objects inside the specimen chamber of a scanning electron microscope (SEM). Nanorobotics manipulators are assembled into four units with four DOFs (X-Y-Z-θ) individually. The rotational one is actuated by a picomotor. That means a manipulator has four DOFs including three linear motions in the X, Y, Z directions and a 360-degree rotational one (X-Y-Z-θ stage, θ is along the direction rotating with X or Y axis). Manipulators are actuated by picomotors with better than 30 nm linear resolution and <1 micro-rad rotary resolution. Four vertically installed AFM cantilevers (the axis of the cantilever tip is vertical to the axis of electronic beam of SEM) served as the end-effectors to facilitate the real-time observation of the operations. A series of kinematic derivations of these four manipulators based on the Denavit-Hartenberg (D-H) notation were established. The common working space of the end-effectors is 2.78 mm by 4.39 mm by 6 mm. The manipulation strategy and vision feedback control for multi-manipulators operating inside the SEM chamber were been discussed. Finally, application of the designed nanorobotics manipulation system by successfully testing of the pickup-and-place manipulation of an individual CNT onto four probes was described. The experimental results have shown that carbon nanotubes can be successfully picked up with this nanorobotics manipulation system. PMID:27649180

Mechatronic Development and Vision Feedback Control of a Nanorobotics Manipulation System inside SEM for Nanodevice Assembly.

PubMed

Yang, Zhan; Wang, Yaqiong; Yang, Bin; Li, Guanghui; Chen, Tao; Nakajima, Masahiro; Sun, Lining; Fukuda, Toshio

2016-09-14

Carbon nanotubes (CNT) have been developed in recent decades for nanodevices such as nanoradios, nanogenerators, carbon nanotube field effect transistors (CNTFETs) and so on, indicating that the application of CNTs for nanoscale electronics may play a key role in the development of nanotechnology. Nanorobotics manipulation systems are a promising method for nanodevice construction and assembly. For the purpose of constructing three-dimensional CNTFETs, a nanorobotics manipulation system with 16 DOFs was developed for nanomanipulation of nanometer-scale objects inside the specimen chamber of a scanning electron microscope (SEM). Nanorobotics manipulators are assembled into four units with four DOFs (X-Y-Z-θ) individually. The rotational one is actuated by a picomotor. That means a manipulator has four DOFs including three linear motions in the X, Y, Z directions and a 360-degree rotational one (X-Y-Z-θ stage, θ is along the direction rotating with X or Y axis). Manipulators are actuated by picomotors with better than 30 nm linear resolution and <1 micro-rad rotary resolution. Four vertically installed AFM cantilevers (the axis of the cantilever tip is vertical to the axis of electronic beam of SEM) served as the end-effectors to facilitate the real-time observation of the operations. A series of kinematic derivations of these four manipulators based on the Denavit-Hartenberg (D-H) notation were established. The common working space of the end-effectors is 2.78 mm by 4.39 mm by 6 mm. The manipulation strategy and vision feedback control for multi-manipulators operating inside the SEM chamber were been discussed. Finally, application of the designed nanorobotics manipulation system by successfully testing of the pickup-and-place manipulation of an individual CNT onto four probes was described. The experimental results have shown that carbon nanotubes can be successfully picked up with this nanorobotics manipulation system.

Malleability and optimization of tetrahedral metamorphic element for deployable truss antenna reflector

NASA Astrophysics Data System (ADS)

Hu, Fei; Song, Yanping; Huang, Zhirong; Liu, Wenlan; Li, Wan

2018-05-01

The tetrahedral elements that make up the large deployable reflector (LDR) are a kind of metamorphic element, which belongs to the multi-loop coupling mechanism. Firstly, the method of combining topology with screw theory is put forward. The parametric model and the constrained matrix are established to analyze the malleability of 3RR-3RRR tetrahedral element. Secondly, the kinematics expression of each motion pair is deduced by the relationship between the velocity and the motion spinor. Finally, the configuration of the metamorphic element is optimized to make the parabolic antenna fully folded, so that the antenna can meet the maximum folding ratio. The results show that the 3RR-3RRR element is a single-degree of freedom (DOF) mechanism. What's more, three new configurations 3RS-3RRR, 3SR-3RRR and 3UU-3RRR are obtained on the basis of optimization. In particular, it proves to be that the LDR which consists of the 3RS-3RRR metamorphic element can achieve the maximum folding ratio. This paper provides a theoretical basis for the computer-aided design of the truss antennas, which has an excellent applicability in the field of aerospace and other multi-loop coupling mechanism.

Design Rules and Analysis of a Capture Mechanism for Rendezvous between a Space Tether and Payload

NASA Technical Reports Server (NTRS)

Sorensen, Kirk F.; Canfield, Stephen L.; Norris, Marshall A.

2006-01-01

Momentum-exchange/electrodynamic reboost (MXER) tether systems have been proposed to serve as an "upper stage in space". A MXER tether station would boost spacecraft from low Earth orbit to a high-energy orbit quickly, like a high-thrust rocket. Then, it would slowly rebuild its orbital momentum through electrodynamic thrust, minimizing the use of propellant. One of the primary challenges in developing a momentum-exchange/electrodynamic reboost tether system as identified by the 2003 MXER Technology Assessment Group is in the development of a mechanism that will enable the processes of capture, carry and release of a payload by the rotating tether as required by the MXER tether approach. This paper will present a concept that will achieve the desired goals of the capture system. This solution is presented as a multi-DOF (degree-of-freedom) capture mechanism with nearly passive operation that features matching of the capture space and expected window of capture error, efficient use of mass and nearly passive actuation during the capture process. This paper will describe the proposed capture mechanism concept and provide an evaluation of the concept through a dynamic model and experimental tests performed on a prototype article of the mechanism in a dynamically similar environment. This paper will also develop a set of rules to guide the design of such a capture mechanism based on analytical and experimental analyses. The primary contributions of this paper will be a description of the proposed capture mechanism concept, a collection of rules to guide its design, and empirical and model information that can be used to evaluate the capability of the concept

Large-area Overhead Manipulator for Access of Fields

USDA-ARS?s Scientific Manuscript database

Multi-axis, cable-driven manipulators have evolved over many years providing large area suspended platform access, programmability, relatively rigid and flexibly-positioned platform control and full six degree of freedom (DOF) manipulation of sensors and tools. We describe innovations for a new six...

Development of 6-DOF painting robot control system

NASA Astrophysics Data System (ADS)

Huang, Junbiao; Liu, Jianqun; Gao, Weiqiang

2017-01-01

With the development of society, the spraying technology of manufacturing industry in China has changed from the manual operation to the 6-DOF (Degree Of Freedom)robot automatic spraying. Spraying painting robot can not only complete the work which does harm to human being, but also improve the production efficiency and save labor costs. Control system is the most critical part of the 6-DOF robots, however, there is still a lack of relevant technology research in China. It is very necessary to study a kind of control system of 6-DOF spraying painting robots which is easy to operation, and has high efficiency and stable performance. With Googol controller platform, this paper develops programs based on Windows CE embedded systems to control the robot to finish the painting work. Software development is the core of the robot control system, including the direct teaching module, playback module, motion control module, setting module, man-machine interface, alarm module, log module, etc. All the development work of the entire software system has been completed, and it has been verified that the entire software works steady and efficient.

Improved olefinic fat suppression in skeletal muscle DTI using a magnitude-based dixon method.

PubMed

Burakiewicz, Jedrzej; Hooijmans, Melissa T; Webb, Andrew G; Verschuuren, Jan J G M; Niks, Erik H; Kan, Hermien E

2018-01-01

To develop a method of suppressing the multi-resonance fat signal in diffusion-weighted imaging of skeletal muscle. This is particularly important when imaging patients with muscular dystrophies, a group of diseases which cause gradual replacement of muscle tissue by fat. The signal from the olefinic fat peak at 5.3 ppm can significantly confound diffusion-tensor imaging measurements. Dixon olefinic fat suppression (DOFS), a magnitude-based chemical-shift-based method of suppressing the olefinic peak, is proposed. It is verified in vivo by performing diffusion tensor imaging (DTI)-based quantification in the lower leg of seven healthy volunteers, and compared to two previously described fat-suppression techniques in regions with and without fat contamination. In the region without fat contamination, DOFS produces similar results to existing techniques, whereas in muscle contaminated by subcutaneous fat signal moved due to the chemical shift artefact, it consistently showed significantly higher (P = 0.018) mean diffusivity (MD). Because fat presence lowers MD, this suggests improved fat suppression. DOFS offers superior fat suppression and enhances quantitative measurements in the muscle in the presence of fat. DOFS is an alternative to spectral olefinic fat suppression. Magn Reson Med 79:152-159, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

HYDRA, a new tool for mechanical testing

NASA Technical Reports Server (NTRS)

Brinkmann, P. W.

1994-01-01

The introduction outlines the verification concept for programs of the European Space Agency (ESA). The role of the Agency in coordinating the activities of major European space test centers is summarized. Major test facilities of the environmental test center at ESTEC, the Space Research and Technology Center of ESA, are shown and their specific characteristics are highlighted with special emphasis on the 6-degree-of-freedom (6-DOF) hydraulic shaker. The specified performance characteristics for sine and transient tests are presented. Results of single-axis hardware tests and 6-DOF computer simulations are included. Efforts employed to protect payloads against accidental damage in case of malfunctions of the facility are listed. Finally the operational advantages of the facility, as well as the possible use of the HYDRA control system design for future applications are indicated.

Multivariable Dynamic Ankle Mechanical Impedance With Active Muscles

PubMed Central

Lee, Hyunglae; Krebs, Hermano Igo; Hogan, Neville

2015-01-01

Multivariable dynamic ankle mechanical impedance in two coupled degrees-of-freedom (DOFs) was quantified when muscles were active. Measurements were performed at five different target activation levels of tibialis anterior and soleus, from 10% to 30% of maximum voluntary contraction (MVC) with increments of 5% MVC. Interestingly, several ankle behaviors characterized in our previous study of the relaxed ankle were observed with muscles active: ankle mechanical impedance in joint coordinates showed responses largely consistent with a second-order system consisting of inertia, viscosity, and stiffness; stiffness was greater in the sagittal plane than in the frontal plane at all activation conditions for all subjects; and the coupling between dorsiflexion–plantarflexion and inversion–eversion was small—the two DOF measurements were well explained by a strictly diagonal impedance matrix. In general, ankle stiffness increased linearly with muscle activation in all directions in the 2-D space formed by the sagittal and frontal planes, but more in the sagittal than in the frontal plane, resulting in an accentuated “peanut shape.” This characterization of young healthy subjects’ ankle mechanical impedance with active muscles will serve as a baseline to investigate pathophysiological ankle behaviors of biomechanically and/or neurologically impaired patients. PMID:25203497

Dynamics of quiet human stance: computer simulations of a triple inverted pendulum model.

PubMed

Günther, Michael; Wagner, Heiko

2016-01-01

For decades, the biomechanical description of quiet human stance has been dominated by the single inverted pendulum (SIP) paradigm. However, in the past few years, the SIP model family has been falsified as an explanatory approach. Double inverted pendulum models have recently proven to be inappropriate. Human topology with three major leg joints suggests in a natural way to examine triple inverted pendulum (TIP) models as an appropriate approach. In this study, we focused on formulating a TIP model that can synthesise stable balancing attractors based on minimalistic sensor information and actuation complexity. The simulated TIP oscillation amplitudes are realistic in vertical direction. Along with the horizontal ankle, knee and hip positions, though, all simulated joint angle amplitudes still exceed the measured ones about threefold. It is likely that they could be eventually brought down to the physiological range by using more sensor information. The TIP systems' eigenfrequency spectra come out as another major result. The eigenfrequencies spread across about 0.1 Hz...20 Hz. Our main result is that joint stiffnesses can be reduced even below statically required values by using an active hip torque balancing strategy. When reducing mono- and bi-articular stiffnesses further down to levels threatening dynamic stability, the spectra indicate a change from torus-like (stable) to strange (chaotic) attractors. Spectra of measured ground reaction forces appear to be strange-attractor-like. We would conclude that TIP models are a suitable starting point to examine more deeply the dynamic character of and the essential structural properties behind quiet human stance. Abbreviations and technical terms Inverted pendulum body exposed to gravity and pivoting in a joint around position of unstable equilibrium (operating point) SIP single inverted pendulum: one rigid body pivoting around fixation to the ground (external joint) DIP double inverted pendulum: two bodies; external and internal joint operate around instability TIP triple inverted pendulum: three bodies; external and both internal joints operate around instability QIP quadruple inverted pendulum: four bodies, foot replaces external joint; all three internal joints operate around instability Eigenfrequency characteristic frequency that a physical system is oscillating at when externally excited at a limited energy level DOF degree of freedom; in mechanics: linear displacement or angle or combination thereof Mono-articular stiffness: coefficient of proportionality between mechanical displacement of a DOF and restoring force/torque component in the respective DOF Bi-articular stiffness coefficient of proportionality between mechanical displacement of a DOF and restoring force/torque component in another DOF GRF ground reaction force HAT segment including head, arms and trunk COM centre of mass COP centre of pressure in the plane of the force platform surface.

Earthquake response analysis of 11-story RC building that suffered damage in 2011 East Japan Earthquake

NASA Astrophysics Data System (ADS)

Shibata, Akenori; Masuno, Hidemasa

2017-10-01

An eleven-story RC apartment building suffered medium damage in the 2011 East Japan earthquake and was retrofitted for re-use. Strong motion records were obtained near the building. This paper discusses the inelastic earthquake response analysis of the building using the equivalent single-degree-of-freedom (1-DOF) system to account for the features of damage. The method of converting the building frame into 1-DOF system with tri-linear reducing-stiffness restoring force characteristics was given. The inelastic response analysis of the building against the earthquake using the inelastic 1-DOF equivalent system could interpret well the level of actual damage.

Berthing simulator for space station and orbiter

NASA Technical Reports Server (NTRS)

Veerasamy, Sam

1991-01-01

The development of a real-time man-in-the-loop berthing simulator is in progress at NASA Lyndon B. Johnson Space Center (JSC) to conduct a parametric study and to measure forces during contact conditions of the actual docking mechanisms for the Space Station Freedom and the orbiter. In berthing, the docking ports of the Space Station and the orbiter are brought together using the orbiter robotic arm to control the relative motion of the vehicles. The berthing simulator consists of a dynamics docking test system (DDTS), computer system, simulator software, and workstations. In the DDTS, the Space Station, and the orbiter docking mechanisms are mounted on a six-degree-of-freedom (6 DOF) table and a fixed platform above the table. Six load cells are used on the fixed platform to measure forces during contact conditions of the docking mechanisms. Two Encore Concept 32/9780 computers are used to simulate the orbiter robotic arm and to operate the berthing simulator. A systematic procedure for a real-time dynamic initialization is being developed to synchronize the Space Station docking port trajectory with the 6 DOF table movement. The berthing test can be conducted manually or automatically and can be extended for any two orbiting vehicles using a simulated robotic arm. The real-time operation of the berthing simulator is briefly described.

Application of the polynomial chaos expansion to approximate the homogenised response of the intervertebral disc.

PubMed

Karajan, N; Otto, D; Oladyshkin, S; Ehlers, W

2014-10-01

A possibility to simulate the mechanical behaviour of the human spine is given by modelling the stiffer structures, i.e. the vertebrae, as a discrete multi-body system (MBS), whereas the softer connecting tissue, i.e. the softer intervertebral discs (IVD), is represented in a continuum-mechanical sense using the finite-element method (FEM). From a modelling point of view, the mechanical behaviour of the IVD can be included into the MBS in two different ways. They can either be computed online in a so-called co-simulation of a MBS and a FEM or offline in a pre-computation step, where a representation of the discrete mechanical response of the IVD needs to be defined in terms of the applied degrees of freedom (DOF) of the MBS. For both methods, an appropriate homogenisation step needs to be applied to obtain the discrete mechanical response of the IVD, i.e. the resulting forces and moments. The goal of this paper was to present an efficient method to approximate the mechanical response of an IVD in an offline computation. In a previous paper (Karajan et al. in Biomech Model Mechanobiol 12(3):453-466, 2012), it was proven that a cubic polynomial for the homogenised forces and moments of the FE model is a suitable choice to approximate the purely elastic response as a coupled function of the DOF of the MBS. In this contribution, the polynomial chaos expansion (PCE) is applied to generate these high-dimensional polynomials. Following this, the main challenge is to determine suitable deformation states of the IVD for pre-computation, such that the polynomials can be constructed with high accuracy and low numerical cost. For the sake of a simple verification, the coupling method and the PCE are applied to the same simplified motion segment of the spine as was used in the previous paper, i.e. two cylindrical vertebrae and a cylindrical IVD in between. In a next step, the loading rates are included as variables in the polynomial response functions to account for a more realistic response of the overall viscoelastic intervertebral disc. Herein, an additive split into elastic and inelastic contributions to the homogenised forces and moments is applied.

Dual-element transducer with phase-inversion for wide depth of field in high-frequency ultrasound imaging.

PubMed

Jeong, Jong Seob

2014-08-05

In high frequency ultrasound imaging (HFUI), the quality of focusing is deeply related to the length of the depth of field (DOF). In this paper, a phase-inversion technique implemented by a dual-element transducer is proposed to enlarge the DOF. The performance of the proposed method was numerically demonstrated by using the ultrasound simulation program called Field-II. A simulated dual-element transducer was composed of a disc- and an annular-type elements, and its aperture was concavely shaped to have a confocal point at 6 mm. The area of each element was identical in order to provide same intensity at the focal point. The outer diameters of the inner and the outer elements were 2.1 mm and 3 mm, respectively. The center frequency of each element was 40 MHz and the f-number (focal depth/aperture size) was two. When two input signals with 0° and 180° phases were applied to inner and outer elements simultaneously, a multi-focal zone was generated in the axial direction. The total -6 dB DOF, i.e., sum of two -6 dB DOFs in the near and far field lobes, was 40% longer than that of the conventional single element transducer. The signal to noise ratio (SNR) was increased by about two times, especially in the far field. The point and cyst phantom simulation were conducted and their results were identical to that of the beam pattern simulation. Thus, the proposed scheme may be a potential method to improve the DOF and SNR in HFUI.

SU-F-J-138: An Extension of PCA-Based Respiratory Deformation Modeling Via Multi-Linear Decomposition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iliopoulos, AS; Sun, X; Pitsianis, N

Purpose: To address and lift the limited degree of freedom (DoF) of globally bilinear motion components such as those based on principal components analysis (PCA), for encoding and modeling volumetric deformation motion. Methods: We provide a systematic approach to obtaining a multi-linear decomposition (MLD) and associated motion model from deformation vector field (DVF) data. We had previously introduced MLD for capturing multi-way relationships between DVF variables, without being restricted by the bilinear component format of PCA-based models. PCA-based modeling is commonly used for encoding patient-specific deformation as per planning 4D-CT images, and aiding on-board motion estimation during radiotherapy. However, themore » bilinear space-time decomposition inherently limits the DoF of such models by the small number of respiratory phases. While this limit is not reached in model studies using analytical or digital phantoms with low-rank motion, it compromises modeling power in the presence of relative motion, asymmetries and hysteresis, etc, which are often observed in patient data. Specifically, a low-DoF model will spuriously couple incoherent motion components, compromising its adaptability to on-board deformation changes. By the multi-linear format of extracted motion components, MLD-based models can encode higher-DoF deformation structure. Results: We conduct mathematical and experimental comparisons between PCA- and MLD-based models. A set of temporally-sampled analytical trajectories provides a synthetic, high-rank DVF; trajectories correspond to respiratory and cardiac motion factors, including different relative frequencies and spatial variations. Additionally, a digital XCAT phantom is used to simulate a lung lesion deforming incoherently with respect to the body, which adheres to a simple respiratory trend. In both cases, coupling of incoherent motion components due to a low model DoF is clearly demonstrated. Conclusion: Multi-linear decomposition can enable decoupling of distinct motion factors in high-rank DVF measurements. This may improve motion model expressiveness and adaptability to on-board deformation, aiding model-based image reconstruction for target verification. NIH Grant No. R01-184173.« less

Continuous and simultaneous estimation of finger kinematics using inputs from an EMG-to-muscle activation model.

PubMed

Ngeo, Jimson G; Tamei, Tomoya; Shibata, Tomohiro

2014-08-14

Surface electromyography (EMG) signals are often used in many robot and rehabilitation applications because these reflect motor intentions of users very well. However, very few studies have focused on the accurate and proportional control of the human hand using EMG signals. Many have focused on discrete gesture classification and some have encountered inherent problems such as electro-mechanical delays (EMD). Here, we present a new method for estimating simultaneous and multiple finger kinematics from multi-channel surface EMG signals. In this study, surface EMG signals from the forearm and finger kinematic data were extracted from ten able-bodied subjects while they were tasked to do individual and simultaneous multiple finger flexion and extension movements in free space. Instead of using traditional time-domain features of EMG, an EMG-to-Muscle Activation model that parameterizes EMD was used and shown to give better estimation performance. A fast feed forward artificial neural network (ANN) and a nonparametric Gaussian Process (GP) regressor were both used and evaluated to estimate complex finger kinematics, with the latter rarely used in the other related literature. The estimation accuracies, in terms of mean correlation coefficient, were 0.85 ± 0.07, 0.78 ± 0.06 and 0.73 ± 0.04 for the metacarpophalangeal (MCP), proximal interphalangeal (PIP) and the distal interphalangeal (DIP) finger joint DOFs, respectively. The mean root-mean-square error in each individual DOF ranged from 5 to 15%. We show that estimation improved using the proposed muscle activation inputs compared to other features, and that using GP regression gave better estimation results when using fewer training samples. The proposed method provides a viable means of capturing the general trend of finger movements and shows a good way of estimating finger joint kinematics using a muscle activation model that parameterizes EMD. The results from this study demonstrates a potential control strategy based on EMG that can be applied for simultaneous and continuous control of multiple DOF(s) devices such as robotic hand/finger prostheses or exoskeletons.

Contributions of different degrees of freedom to thermal transport in the C60 molecular crystal

NASA Astrophysics Data System (ADS)

Kumar, Sushant; Shao, Cheng; Lu, Simon; McGaughey, Alan J. H.

2018-03-01

Three models of the C60 molecular crystal are studied using molecular dynamics simulations to resolve the roles played by intermolecular and intramolecular degrees of freedom (DOF) in its structural, mechanical, and thermal properties at temperatures between 35 and 400 K. In the full DOF model, all DOF are active. In the rigid body model, the intramolecular DOF are frozen, such that only center of mass (COM) translations and molecular rotations/librations are active. In the point mass model, the molecule is replaced by a point mass, such that only COM translations are active. The zero-pressure lattice constants and bulk moduli predicted from the three models fall within ranges of 0.15 and 20%. The thermal conductivity of the point mass model is the largest across the temperature range, showing a crystal-like temperature dependence (i.e., it decreases with increasing temperature) due to the presence of phonon modes associated with the COM translations. The rigid body model thermal conductivity is the smallest and follows two distinct regimes. It is crystal-like at low temperatures and becomes temperature invariant at high temperatures. The latter is typical of the behavior of an amorphous material. By calculating the rotational diffusion coefficient, the transition between the two regimes is found to occur at the temperature where the molecules begin to rotate freely. Above this temperature, phonons related to COM translations are scattered by the rotational DOF. The full DOF model thermal conductivity is larger than that of the rigid body model, indicating that intramolecular DOF contribute to thermal transport.

Mechanism test bed. Flexible body model report

NASA Technical Reports Server (NTRS)

Compton, Jimmy

1991-01-01

The Space Station Mechanism Test Bed is a six degree-of-freedom motion simulation facility used to evaluate docking and berthing hardware mechanisms. A generalized rigid body math model was developed which allowed the computation of vehicle relative motion in six DOF due to forces and moments from mechanism contact, attitude control systems, and gravity. No vehicle size limitations were imposed in the model. The equations of motion were based on Hill's equations for translational motion with respect to a nominal circular earth orbit and Newton-Euler equations for rotational motion. This rigid body model and supporting software were being refined.

Optical Coherency Matrix Tomography

DTIC Science & Technology

2015-10-19

multiple DoFs, such a treatment necessitates introducing the notion of ‘classical entanglement ’10,19–25. In quantum mechanics, states associated with...corresponding concept of classical entanglement indi- cates the non-separability of the beam into uncoupled DoFs. After the initial suggestion by Spreeuw19, a...substantial body of work has accumulated in the past five years in which classical entanglement is exploited in solving long-standing problems in

Design of a biologically inspired lower limb exoskeleton for human gait rehabilitation.

PubMed

Lyu, Mingxing; Chen, Weihai; Ding, Xilun; Wang, Jianhua; Bai, Shaoping; Ren, Huichao

2016-10-01

This paper proposes a novel bionic model of the human leg according to the theory of physiology. Based on this model, we present a biologically inspired 3-degree of freedom (DOF) lower limb exoskeleton for human gait rehabilitation, showing that the lower limb exoskeleton is fully compatible with the human knee joint. The exoskeleton has a hybrid serial-parallel kinematic structure consisting of a 1-DOF hip joint module and a 2-DOF knee joint module in the sagittal plane. A planar 2-DOF parallel mechanism is introduced in the design to fully accommodate the motion of the human knee joint, which features not only rotation but also relative sliding. Therefore, the design is consistent with the requirements of bionics. The forward and inverse kinematic analysis is studied and the workspace of the exoskeleton is analyzed. The structural parameters are optimized to obtain a larger workspace. The results using MATLAB-ADAMS co-simulation are shown in this paper to demonstrate the feasibility of our design. A prototype of the exoskeleton is also developed and an experiment performed to verify the kinematic analysis. Compared with existing lower limb exoskeletons, the designed mechanism has a large workspace, while allowing knee joint rotation and small amount of sliding.

Design of a biologically inspired lower limb exoskeleton for human gait rehabilitation

NASA Astrophysics Data System (ADS)

Lyu, Mingxing; Chen, Weihai; Ding, Xilun; Wang, Jianhua; Bai, Shaoping; Ren, Huichao

2016-10-01

This paper proposes a novel bionic model of the human leg according to the theory of physiology. Based on this model, we present a biologically inspired 3-degree of freedom (DOF) lower limb exoskeleton for human gait rehabilitation, showing that the lower limb exoskeleton is fully compatible with the human knee joint. The exoskeleton has a hybrid serial-parallel kinematic structure consisting of a 1-DOF hip joint module and a 2-DOF knee joint module in the sagittal plane. A planar 2-DOF parallel mechanism is introduced in the design to fully accommodate the motion of the human knee joint, which features not only rotation but also relative sliding. Therefore, the design is consistent with the requirements of bionics. The forward and inverse kinematic analysis is studied and the workspace of the exoskeleton is analyzed. The structural parameters are optimized to obtain a larger workspace. The results using MATLAB-ADAMS co-simulation are shown in this paper to demonstrate the feasibility of our design. A prototype of the exoskeleton is also developed and an experiment performed to verify the kinematic analysis. Compared with existing lower limb exoskeletons, the designed mechanism has a large workspace, while allowing knee joint rotation and small amount of sliding.

Synthetic light-needle photoacoustic microscopy for extended depth of field (Conference Presentation)

NASA Astrophysics Data System (ADS)

Yang, Jiamiao; Gong, Lei; Xu, Xiao; Hai, Pengfei; Suzuki, Yuta; Wang, Lihong V.

2017-03-01

Photoacoustic microscopy (PAM) has been extensively applied in biomedical study because of its ability to visualize tissue morphology and physiology in vivo in three dimensions (3D). However, conventional PAM suffers from a rapidly decreasing resolution away from the focal plane because of the limited depth of focus of an objective lens, which deteriorates the volumetric imaging quality inevitably. Here, we propose a novel method to synthesize an ultra-long light needle to extend a microscope's depth of focus beyond its physical limitations with wavefront engineering method. Furthermore, it enables an improved lateral resolution that exceeds the diffraction limit of the objective lens. The virtual light needle can be flexibly synthesized anywhere throughout the imaging volume without mechanical scanning. Benefiting from these advantages, we developed a synthetic light needle photoacoustic microscopy (SLN-PAM) to achieve an extended depth of field (DOF), sub-diffraction and motionless volumetric imaging. The DOF of our SLN-PAM system is up to 1800 µm, more than 30-fold improvement over that gained by conventional PAM. Our system also achieves the lateral resolution of 1.8 µm (characterized at 532 nm and 0.1 NA objective), about 50% higher than the Rayleigh diffraction limit. Its superior imaging performance was demonstrated by 3D imaging of both non-biological and biological samples. This extended DOF, sub-diffraction and motionless 3D PAM will open up new opportunities for potential biomedical applications.

Automated optimal coordination of multiple-DOF neuromuscular actions in feedforward neuroprostheses.

PubMed

Lujan, J Luis; Crago, Patrick E

2009-01-01

This paper describes a new method for designing feedforward controllers for multiple-muscle, multiple-DOF, motor system neural prostheses. The design process is based on experimental measurement of the forward input/output properties of the neuromechanical system and numerical optimization of stimulation patterns to meet muscle coactivation criteria, thus resolving the muscle redundancy (i.e., overcontrol) and the coupled DOF problems inherent in neuromechanical systems. We designed feedforward controllers to control the isometric forces at the tip of the thumb in two directions during stimulation of three thumb muscles as a model system. We tested the method experimentally in ten able-bodied individuals and one patient with spinal cord injury. Good control of isometric force in both DOFs was observed, with rms errors less than 10% of the force range in seven experiments and statistically significant correlations between the actual and target forces in all ten experiments. Systematic bias and slope errors were observed in a few experiments, likely due to the neuromuscular fatigue. Overall, the tests demonstrated the ability of a general design approach to satisfy both control and coactivation criteria in multiple-muscle, multiple-axis neuromechanical systems, which is applicable to a wide range of neuromechanical systems and stimulation electrodes.

Hamiltonian formalism for f (T ) gravity

NASA Astrophysics Data System (ADS)

Ferraro, Rafael; Guzmán, María José

2018-05-01

We present the Hamiltonian formalism for f (T ) gravity, and prove that the theory has n/(n -3 ) 2 +1 degrees of freedom (d.o.f.) in n dimensions. We start from a scalar-tensor action for the theory, which represents a scalar field minimally coupled with the torsion scalar T that defines the teleparallel equivalent of general relativity (TEGR) Lagrangian. T is written as a quadratic form of the coefficients of anholonomy of the vierbein. We obtain the primary constraints through the analysis of the structure of the eigenvalues of the multi-index matrix involved in the definition of the canonical momenta. The auxiliary scalar field generates one extra primary constraint when compared with the TEGR case. The secondary constraints are the super-Hamiltonian and supermomenta constraints, that are preserved from the Arnowitt-Deser-Misner formulation of GR. There is a set of n/(n -1 ) 2 primary constraints that represent the local Lorentz transformations of the theory, which can be combined to form a set of n/(n -1 ) 2 -1 first-class constraints, while one of them becomes second class. This result is irrespective of the dimension, due to the structure of the matrix of the brackets between the constraints. The first-class canonical Hamiltonian is modified due to this local Lorentz violation, and the only one local Lorentz transformation that becomes second-class pairs up with the second-class constraint π ≈0 to remove one d.o.f. from the n2+1 pairs of canonical variables. The remaining n/(n -1 ) 2 +2 n -1 primary constraints remove the same number of d.o.f., leaving the theory with n/(n -3 ) 2 +1 d.o.f. This means that f (T ) gravity has only one extra d.o.f., which could be interpreted as a scalar d.o.f.

Design of a surgical robot with dynamic vision field control for Single Port Endoscopic Surgery.

PubMed

Kobayashi, Yo; Sekiguchi, Yuta; Tomono, Yu; Watanabe, Hiroki; Toyoda, Kazutaka; Konishi, Kozo; Tomikawa, Morimasa; Ieiri, Satoshi; Tanoue, Kazuo; Hashizume, Makoto; Fujie, Masaktsu G

2010-01-01

Recently, a robotic system was developed to assist Single Port Endoscopic Surgery (SPS). However, the existing system required a manual change of vision field, hindering the surgical task and increasing the degrees of freedom (DOFs) of the manipulator. We proposed a surgical robot for SPS with dynamic vision field control, the endoscope view being manipulated by a master controller. The prototype robot consisted of a positioning and sheath manipulator (6 DOF) for vision field control, and dual tool tissue manipulators (gripping: 5DOF, cautery: 3DOF). Feasibility of the robot was demonstrated in vitro. The "cut and vision field control" (using tool manipulators) is suitable for precise cutting tasks in risky areas while a "cut by vision field control" (using a vision field control manipulator) is effective for rapid macro cutting of tissues. A resection task was accomplished using a combination of both methods.

Passive and active vibration isolation systems using inerter

NASA Astrophysics Data System (ADS)

Alujević, N.; Čakmak, D.; Wolf, H.; Jokić, M.

2018-03-01

This paper presents a theoretical study on passive and active vibration isolation schemes using inerter elements in a two degree of freedom (DOF) mechanical system. The aim of the work is to discuss basic capabilities and limitations of the vibration control systems at hand using simple and physically transparent models. Broad frequency band dynamic excitation of the source DOF is assumed. The purpose of the isolator system is to prevent vibration transmission to the receiving DOF. The frequency averaged kinetic energy of the receiving mass is used as the metric for vibration isolation quality. It is shown that the use of inerter element in the passive vibration isolation scheme can enhance the isolation effect. In the active case, a feedback disturbance rejection scheme is considered. Here, the error signal is the receiving body absolute velocity which is directly fed to a reactive force actuator between the source and the receiving bodies. In such a scheme, the so-called subcritical vibration isolation problems exist. These problems are characterised by the uncoupled natural frequency of the receiving body larger than the uncoupled natural frequency of the source body. In subcritical vibration isolation problems, the performance of the active control is limited by poor stability margins. This is because the stable feedback gain is restricted in a narrow range between a minimum and a maximum. However, with the inclusion of an inerter in the isolator, one of the two stability margins can be opened. This enables large, theoretically unlimited negative feedback gains and large active damping of the receiving body vibration. A simple expression for the required inertance is derived.

Improved Multiple-DOF SAW Piezoelectric Motors

NASA Technical Reports Server (NTRS)

Bar-Cohen, Yoseph; Bao, Xiaoqi; Hull, Anthony; Wright, John

2003-01-01

Surface-acoustic-wave (SAW) piezoelectric motors of a proposed type would be capable of operating in multiple degrees of freedom (DOFs) simultaneously and would be amenable to integration into diverse structures and mechanisms. These motors would be compact and structurally simple and would not contain bearings or lead screws. One example of a particularly useful motor of this type would be a two-dimensional- translation stage. Another such example would be a self-actuated spherical joint that could be made to undergo controlled, simultaneous rotations about two orthogonal axes: Such a motor could serve as a mechanism for aiming an "eyeball" camera or as a compact transducer in, and an integral part of, a joint in a robot arm. The multiple-DOF SAW piezoelectric motors as now proposed would be successors to the ones reported in "Multiple-DOF Surface-Acoustic-Wave Piezoelectric Motors" (NPO-20735), NASA Tech Briefs, Vol. 24, No. 12 (December 2000), page 5b. The basic principle of operation of a multiple-DOF SAW piezoelectric motor is a straightforward extension of that of single-DOF SAW piezoelectric motors, which have been reported in several previous NASA Tech Briefs articles: For example, in the case of a linear SAW piezoelectric motor, piezoelectric transducers at opposite ends of a stator excite surface acoustic waves that travel along the surface of the stator. An object (denoted the slider) is pressed against the stator with sufficient pressure (in practice .300 MPa) that it remains in frictional contact with the stator at all times. The slider rides the crests of the waves and is thereby made to move along the surface of the stator. The direction of motion (forward or backward) is controlled by selecting the relative phase of waves generated by the two piezoelectric transducers. The speed increases with the amplitude of the waves and thus with the magnitude of the voltage applied to the transducers.

Adaptive control of space-based robot manipulators

NASA Technical Reports Server (NTRS)

Walker, Michael W.; Wee, Liang-Boon

1991-01-01

A control method is presented that achieves globally stable trajectory tracking in the presence of uncertainties in the inertial parameters of the system. The 15-DOF system dynamics are divided into two components: a 9-DOF invertible portion and 6-DOF noninvertible portion. A controller is then designed to achieve trajectory tracking of the invertible portion of the system, which consists of the manipulator-joint positions and the orientation of the base. The motion of the noninvertible portion is bounded but otherwise unspecified. This portion of the system consists of the position of the robot's base and the position of the reaction wheels. A simulation is presented to demonstrate the effectiveness of the controller. A quadratic polynomial is used to generate the desired trajectory to illustrate the trajectory-tracking capability of the controller.

[Effect of extracts from Dendrobii ifficinalis flos on hyperthyroidism Yin deficiency mice].

PubMed

Lei, Shan-shan; Lv, Gui-yuan; Jin, Ze-wu; Li, Bo; Yang, Zheng-biao; Chen, Su-hong

2015-05-01

Some unhealthy life habits, such as long-term smoking, heavy drinking, sexual overstrain and frequent stay-up could induce the Yin deficiency symptoms of zygomatic red and dysphoria. Stems of Dendrobii officinalis flos (DOF) showed the efficacy of nourishing Yin. In this study, the hyperthyroidism Yin deficiency model was set up to study the yin nourishing effect and action mechanism of DOF, in order to provide the pharmacological basis for developing DOF resources and decreasing resource wastes. ICR mice were divided into five groups: the normal control group, the model control group, the positive control group and DOF extract groups (6.4 g · kg(-1)). Except for the normal group, the other groups were administrated with thyroxine for 30 d to set up the hyperthyroidism yin deficiency model. At the same time, the other groups were administrated with the corresponding drugs for 30 d. After administration for 4 weeks, the signs (facial temperature, pain domain, heart rate and autonomic activity) in mice were measured, and the facial and ear micro-circulation blood flow were detected by laser Doppler technology. After the last administration, all mice were fasted for 12 hours, blood were collected from their orbits, and serum were separated to detect AST, ALT, TG and TP by the automatic biochemistry analyzer and test T3, T4 and TSH levels by ELISA. (1) Compared with the normal control group, the model control group showed significant increases in facial and ear micro-circulation blood flow, facial temperature and heart rate (P < 0.05, P < 0.01), serum AST, ALT (P < 0.01), T3 level (P < 0.05), TSH level (P < 0.05) and notable deceases in pain domain (P < 0.01), TG level (P < 0.01). (2) Compared with the model control group, extracts from DOF (6 g · kg(-1)) could notably reduce facial and ear micro-circulation blood flow, facial temperature and heart rate (P < 0.05, P < 0.01) and AST (P < 0.05) and enhance pain domain (P < 0.01) and TG (P < 0.01). Extracts from DOF (4 g · kg(-1)) could remarkably reduce AST and ALT levels (P < 0.01, 0.05). Extracts from DOF (6 g · kg(-1) 4 g · kg(-1)) could significantly reduce T3 and increase serum TSH level (P < 0.05). DOF could improve Yin deficiency symptoms of zygomatic red and dysphoria in mice as well as liver function injury caused by overactive thyroid axis. According to its action mechanism, DOF may show yin nourishing and hepatic protective effects by impacting thyroxin substance metabolism, improving micro-circulation and reducing heart rate.

DESIGN AND CONSTRUCTION OF A FORCE-REFLECTING TELEOPERATION SYSTEM

DOE Office of Scientific and Technical Information (OSTI.GOV)

M.A. Ebadian, Ph.D.

1999-01-01

For certain applications, such as space servicing, undersea operations, and hazardous material handling tasks in nuclear reactors, the environments can be uncertain, complex, and hazardous. Lives may be in danger if humans were to work under these conditions. As a result, a man-machine system--a teleoperator system--has been developed to work in these types of environments. In a typical teleoperator system, the actual system operates at a remote site; the operator located away from this system usually receives visual information from a video image and/or graphical animation on the computer screen. Additional feedback, such as aural and force information, can significantlymore » enhance performance of the system. Force reflection is a type of feedback in which forces experienced by the remote manipulator are fed back to the manual controller. Various control methods have been proposed for implementation on a teleoperator system. In order to examine different control schemes, a one Degree-Of-Freedom (DOF) Force-Reflecting Manual Controller (FRMC) is constructed and integrated into a PC. The system parameters are identified and constructed as a mathematical model. The Proportional-Integral-Derivative (PID) and fuzzy logic controllers are developed and tested experimentally. Numerical simulation results obtained from the mathematical model are compared with those of experimental data for both types of controllers. In addition, the concept of a telesensation system is introduced. A telesensation system is an advanced teleoperator system that attempts to provide the operator with sensory feedback. In this context, a telesensation system integrates the use of a Virtual Reality (VR) unit, FRMC, and Graphical User Interface (GUI). The VR unit is used to provide the operator with a 3-D visual effect. Various commercial VR units are reviewed and features compared for use in a telesensation system. As for the FRMC, the conceptual design of a 3-DOF FRMC is developed in an effort to make the system portable, compact, and lightweight. A variety of design alternatives are presented and evaluated. Finally, a GUI software package is developed to interface with several teleoperation unit components. These components include an industrial robot, electric motor, encoder, force/torque sensor, and CCD camera. The software includes features such as position scaling, force scaling, and rereferencing and is intended to provide a sound basis for the development of a multi-DOF FRMC system in the future.« less

Output Error Analysis of Planar 2-DOF Five-bar Mechanism

NASA Astrophysics Data System (ADS)

Niu, Kejia; Wang, Jun; Ting, Kwun-Lon; Tao, Fen; Cheng, Qunchao; Wang, Quan; Zhang, Kaiyang

2018-03-01

Aiming at the mechanism error caused by clearance of planar 2-DOF Five-bar motion pair, the method of equivalent joint clearance of kinematic pair to virtual link is applied. The structural error model of revolute joint clearance is established based on the N-bar rotation laws and the concept of joint rotation space, The influence of the clearance of the moving pair is studied on the output error of the mechanis. and the calculation method and basis of the maximum error are given. The error rotation space of the mechanism under the influence of joint clearance is obtained. The results show that this method can accurately calculate the joint space error rotation space, which provides a new way to analyze the planar parallel mechanism error caused by joint space.

24 DOF EMG controlled hybrid actuated prosthetic hand.

PubMed

Atasoy, A; Kaya, E; Toptas, E; Kuchimov, S; Kaplanoglu, E; Ozkan, M

2016-08-01

A complete mechanical design concept of an electromyogram (EMG) controlled hybrid prosthetic hand, with 24 degree of freedom (DOF) anthropomorphic structure is presented. Brushless DC motors along with Shape Memory Alloy (SMA) actuators are used to achieve dexterous functionality. An 8 channel EMG is used for detecting 7 basic hand gestures for control purposes. The prosthetic hand will be integrated with the Neural Network (NNE) based controller in the next phase of the study.

Suitport Feasibility - Human Pressurized Space Suit Donning Tests with the Marman Clamp and Pneumatic Flipper Suitport Concepts

NASA Technical Reports Server (NTRS)

Boyle, Robert M.; Rodriggs, Liana; Allton, Charles; Jennings, Mallory; Aitchision, Lindsay

2013-01-01

The suitport concept has been recently implemented as part of the small pressurized lunar rover (Currently the Space Exploration vehicle, or SEV) and the Multi-Mission Space Exploration Vehicle (MMSEV) concept demonstrator vehicle. Suitport replaces or augments the traditional airlock function of a spacecraft by providing a bulkhead opening, capture mechanism, and sealing system to allow ingress and egress of a space suit while the space suit remains outside of the pressurized volume of the spacecraft. This presents significant new opportunities to EVA exploration in both microgravity and surface environments. The suitport concept will enable three main improvements in EVA by providing reductions in: pre-EVA time from hours to less than thirty minutes; airlock consumables; contamination returned to the cabin with the EVA crewmember. Two second generation suitports were designed and tested. The previously reported second generation Marman Clamp suitport and a newer concept, the Pneumatic Flipper Suitport. These second generation suitports demonstrated human donning and doffing of the Z1 spacesuit with an 8.3 psi pressure differential across the spacesuit. Testing was performed using the JSC B32 Chamber B, a human rated vacuum chamber. The test included human rated suitports, the suitport compatible prototype suit, and chamber modifications. This test brought these three elements together in the first ever pressurized donning of a rear entry suit through a suitport. This paper presents the results of the testing, including unexpected difficulties with doffing, and engineering solutions implemented to ease the difficulties. A review of suitport functions, including a discussion of the need to doff a pressurized suit in earth gravity, is included. Recommendations for future design and testing are documented.

Suitport Feasibility - Human Pressurized Space Suit Donning Tests with the Marmon Clamp and Pneumatic Flipper Suitport Concepts

NASA Technical Reports Server (NTRS)

Boyle, Robert M.; Rodriggs, Liana; Alton, Charles; Jennings, Mallory; Aitchison, Lindsay

2012-01-01

The suitport concept has been recently implemented as part of the small pressurized lunar rover (Currently the Space Exploration vehicle, or SEV) and the Multi-Mission Space Exploration Vehicle (MMSEV) concept demonstrator vehicle. Suitport replaces or augments the traditional airlock function of a spacecraft by providing a bulkhead opening, capture mechanism, and sealing system to allow ingress and egress of a space suit while the space suit remains outside of the pressurized volume of the spacecraft. This presents significant new opportunities to EVA exploration in both microgravity and surface environments. The suitport concept will enable three main improvements in EVA by providing reductions in: pre-EVA time from hours to less than thirty minutes; airlock consumables; contamination returned to the cabin with the EVA crewmember. Two second generation suitports were designed and tested. The previously reported second generation Marman Clamp suitport and a newer concept, the Pneumatic Flipper Suitport. These second generation suitports demonstrated human donning and doffing of the Z1 spacesuit with an 8.3 psi pressure differential across the spacesuit. Testing was performed using the JSC B32 Chamber B, a human rated vacuum chamber. The test included human rated suitports, the suitport compatible prototype suit, and chamber modifications. This test brought these three elements together in the first ever pressurized donning of a rear entry suit through a suitport. This paper presents the results of the testing, including unexpected difficulties with doffing, and engineering solutions implemented to ease the difficulties. A review of suitport functions, including a discussion of the need to doff a pressurized suit in earth gravity, is included. Recommendations for future design and testing are documented.

Mathematical modeling and design of a novel 2-DOF micro attraction actuator for a micro optical switch

NASA Astrophysics Data System (ADS)

Kamiya, Daiki; Bagheri, Saeed; Horie, Mikio

2004-08-01

Many studies on optical switches have been performed in an attempt to develop optical information networks to speed information technology. In reality, however, mirror manipulators cannot be applied to multiple input and output systems due to both insufficient output displacements by the mirror parts inside the manipulator, and the difficulty of designing structures and mechanisms suitable for multi-dimensional manipulation. The principal reasons for insufficient displacement are the high rigidity of the elastic parts compared to the available driving forces and the pull-in effect. Therefore, in order to develop optical switches capable of multiple input and output switching, we suggest a novel 2-DOF(degree of freedom) electrostatic microactuator. The actuator is composed of one mirror with four beams laid about it in a corkscrew pattern, with four corkscrew electrodes on the substrate below and one mirror support pyramid situated under the mirror. Using electrostatic force, one or more of the beams are attracted from their outer ends toward the substrate. The mirror is then tilted by an angle proportional to the attracted length along the beam. The inclination and direction of the mirror are determined by the combined attracted length of the four beams. In this work we derive the mathematical model for the corkscrew beam microactuator for optical switches and show that this mathematical model accurately simulates the device by comparison with finite element analysis results. We use this mathematical model for design of the microactuator. Further we show that the designed optical switch microactuator is capable of rotating the mirror from +32 to -32 degrees about two axes with a maximum operating voltage of 163 volts. Finally, stress analysis of the actuator shows that the generated stress in the structure is at most 369 MPa.

Passive stiffness of coupled wrist and forearm rotations.

PubMed

Drake, Will B; Charles, Steven K

2014-09-01

Coordinated movement requires that the neuromuscular system account and compensate for movement dynamics. One particularly complex aspect of movement dynamics is the interaction that occurs between degrees of freedom (DOF), which may be caused by inertia, damping, and/or stiffness. During wrist rotations, the two DOF of the wrist (flexion-extension and radial-ulnar deviation, FE and RUD) are coupled through interaction torques arising from passive joint stiffness. One important unanswered question is whether the DOF of the forearm (pronation-supination, PS) is coupled to the two DOF of the wrist. Answering this question, and understanding the dynamics of wrist and forearm rotations in general, requires knowledge of the stiffness encountered during rotations involving all three DOF (PS, FE, and RUD). Here we present the first-ever measurement of the passive stiffness encountered during simultaneous wrist and forearm rotations. Using a wrist and forearm robot, we measured coupled wrist and forearm stiffness in 10 subjects and present it as a 3-by-3 stiffness matrix. This measurement of passive wrist and forearm stiffness will enable future studies investigating the dynamics of wrist and forearm rotations, exposing the dynamics for which the neuromuscular system must plan and compensate during movements involving the wrist and forearm.

TALARIS project update: Overview of flight testing and development of a prototype planetary surface exploration hopper

NASA Astrophysics Data System (ADS)

Rossi, Christopher; Cunio, Phillip M.; Alibay, Farah; Morrow, Joe; Nothnagel, Sarah L.; Steiner, Ted; Han, Christopher J.; Lanford, Ephraim; Hoffman, Jeffrey A.

2012-12-01

The TALARIS (Terrestrial Artificial Lunar And Reduced GravIty Simulator) project is intended to test GNC (Guidance, Navigation, and Control) algorithms on a prototype planetary surface exploration hopper in a dynamic environment with simulated reduced gravity. The vehicle is being developed by the Charles Stark Draper Laboratory and Massachusetts Institute of Technology in support of efforts in the Google Lunar X-Prize contest. This paper presents progress achieved since September 2010 in vehicle development and flight testing. Upgrades to the vehicle are described, including a redesign of the power train for the gravity-offset propulsion system and a redesign of key elements of the spacecraft emulator propulsion system. The integration of flight algorithms into modular flight software is also discussed. Results are reported for restricted degree of freedom (DOF) tests used to tune GNC algorithms on the path to a full 6-DOF hover-hop flight profile. These tests include 3-DOF tests on flat surfaces restricted to horizontal motion, and 2-DOF vertical tests restricted to vertical motion and 1-DOF attitude control. The results of tests leading up to full flight operations are described, as are lessons learned and future test plans.

Development of an Underactuated 2-DOF Wrist Joint using McKibben PAMs

NASA Astrophysics Data System (ADS)

Rajagopal, S. P.; Jain, S.; Ramasubramanian, S. N.; Johnson, B. V.; Dwivedy, S. K.

2014-10-01

In this work, model of an underactuated 2-DOF wrist joint with pneumatically actuated muscles is proposed. For the joint, McKibben-type artificial muscles are used in parallel configuration for the actuation. For each Degree of Freedom (DOF) one agonist-antagonist pair arrangement is usually used with a pulley mechanism. A mathematical model of wrist joint is derived using conventional forward kinematic analysis. The static model relating pressure in the muscle with the orientation of the wrist joint is obtained by combining the experimental data and mathematical model. Regulation of pressure can be achieved by pulse width modulation control of on/off solenoid valves. A set of free vibration experiments are done for the dynamic identification of the muscle characteristics.

Development of a Rotary Wing Unmanned Aerial Vehicle (UAV) Simulation Model

DTIC Science & Technology

2014-03-01

Features Language URL Autopilot: DIY UAV - 2 DOF proportional controller - Kalman filtering C http://autopilot.sour ceforge.net Paperazzi - 3 DOF...proprtional controller - Basic navigation OCaml http://paparazzi.ena c.fr JSBSim - Basic control system blockset - Sample autopilot

Nonparametric identification of nonlinear dynamic systems using a synchronisation-based method

NASA Astrophysics Data System (ADS)

Kenderi, Gábor; Fidlin, Alexander

2014-12-01

The present study proposes an identification method for highly nonlinear mechanical systems that does not require a priori knowledge of the underlying nonlinearities to reconstruct arbitrary restoring force surfaces between degrees of freedom. This approach is based on the master-slave synchronisation between a dynamic model of the system as the slave and the real system as the master using measurements of the latter. As the model synchronises to the measurements, it becomes an observer of the real system. The optimal observer algorithm in a least-squares sense is given by the Kalman filter. Using the well-known state augmentation technique, the Kalman filter can be turned into a dual state and parameter estimator to identify parameters of a priori characterised nonlinearities. The paper proposes an extension of this technique towards nonparametric identification. A general system model is introduced by describing the restoring forces as bilateral spring-dampers with time-variant coefficients, which are estimated as augmented states. The estimation procedure is followed by an a posteriori statistical analysis to reconstruct noise-free restoring force characteristics using the estimated states and their estimated variances. Observability is provided using only one measured mechanical quantity per degree of freedom, which makes this approach less demanding in the number of necessary measurement signals compared with truly nonparametric solutions, which typically require displacement, velocity and acceleration signals. Additionally, due to the statistical rigour of the procedure, it successfully addresses signals corrupted by significant measurement noise. In the present paper, the method is described in detail, which is followed by numerical examples of one degree of freedom (1DoF) and 2DoF mechanical systems with strong nonlinearities of vibro-impact type to demonstrate the effectiveness of the proposed technique.

Characteristics of energy exchange between inter- and intramolecular degrees of freedom in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB) with implications for coarse-grained simulations of shock waves in polyatomic molecular crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kroonblawd, Matthew P.; Sewell, Thomas D., E-mail: sewellt@missouri.edu; Maillet, Jean-Bernard, E-mail: jean-bernard.maillet@cea.fr

2016-02-14

In this report, we characterize the kinetics and dynamics of energy exchange between intramolecular and intermolecular degrees of freedom (DoF) in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB). All-atom molecular dynamics (MD) simulations are used to obtain predictions for relaxation from certain limiting initial distributions of energy between the intra- and intermolecular DoF. The results are used to parameterize a coarse-grained Dissipative Particle Dynamics at constant Energy (DPDE) model for TATB. Each TATB molecule in the DPDE model is represented as an all-atom, rigid-molecule mesoparticle, with explicit external (molecular translational and rotational) DoF and coarse-grained implicit internal (vibrational) DoF. In addition to conserving linearmore » and angular momentum, the DPDE equations of motion conserve the total system energy provided that particles can exchange energy between their external and internal DoF. The internal temperature of a TATB molecule is calculated using an internal equation of state, which we develop here, and the temperatures of the external and internal DoF are coupled using a fluctuation-dissipation relation. The DPDE force expression requires specification of the input parameter σ that determines the rate at which energy is exchanged between external and internal DoF. We adjusted σ based on the predictions for relaxation processes obtained from MD simulations. The parameterized DPDE model was employed in large-scale simulations of shock compression of TATB. We show that the rate of energy exchange governed by σ can significantly influence the transient behavior of the system behind the shock.« less

A Research on the Primary Mirror Manipulator of Large Segmented-mirror Telescope

NASA Astrophysics Data System (ADS)

Zuo, H.

2012-09-01

Since Galileo firstly used the telescope to observe the sky 400 years ago, the aperture of the telescope has become larger and larger to observe the deeper universe, and the segmented-mirror telescope is becoming more and more popular with increasing aperture. In the early 21st century, a series of segmented-mirror telescopes have been constructed including the Large Sky Area Multi-object Fiber Spectroscopic Telescope (LAMOST) of China. LAMOST is a meridian reflecting Schmidt telescope, and the dimension of the primary mirror is about 6.7 m× 6 m, which is composed of 37 hexagonal sub-mirrors. However, a problem about the mirror installation appears with the increasing aperture. If there are hundreds of sub-mirrors in the telescope, it is a challenging job to mount and dismount them to the truss. This problem is discussed in this paper and a manipulator for the primary mirror of LAMOST is designed to perform the mount and dismount work. In chapter 1, all the segmented-mirror telescopes in the world are introduced and how the sub-mirrors of these telescopes are installed has been investigated. After comparing with the serial and the parallel robot, a serial robot manipulator proposal, which has several redundant degrees of freedom (DOFs), has been chosen from a series of design proposals. In chapter 2, the theoretical analysis has been carried out on the basis of the design proposal, which includes the forward kinematics and the inverse kinematics. Firstly the D-H coordinate is built according to the structure of the manipulator, so it is possible to obtain the end-effector position and orientation from the individual joint motion thanks to the forward kinematics. Because of the redundant DOFs of the manipulator, the inverse kinematics solution can be a very trick task, and the result may not be only, therefore a kind of simulation is carried out to get the numerical solution using ADAMS (Automatic Dynamic Analysis of Mechanical System). In the dynamics analysis the Lagrange formulation is introduced, and the dynamic equations of the manipulator have been obtained by using the Lagrange method. Since the manipulator is a serious coupling system, the dynamic curve of the key joints is plotted by using the ADAMS software. According to the theoretical analysis, the manipulator for the primary mirror of LAMOST is designed and fabricated. The whole manipulator consists of three parts. The first part is the mechanical arm which is used to realize the high speed and the long distance location, and it is rebuilt from a small truck crane; The second part is a serial mechanical hand which is used to realize the low speed and the short distance location. It has six DOFs including the pitch, the rotate about the vertical axis, the elevation along the vertical axis, and two horizontal translations. Subsequently the structure is analyzed in the ANSYS software to confirm that the strength is enough and the displacement is in the tolerance; The third part is a mechanical wrist, in which part a hydraulic rod is used to keep the bottom of the mechanical hand horizontal. In chapter 6, the control characteristics of the whole manipulator are analyzed. Furthermore, the control method and flowchart are proposed. Based on this method the control device was selected. In the end of this paper, the main work and the results of this project are summarized. Further research is prospected and it provides a reference for the future large telescope projects.

Digital compensation techniques for the effects of time lag in closed-loop simulation using the 6 DOF motion system

NASA Technical Reports Server (NTRS)

Brown, R.

1982-01-01

Efforts are continued to develop digital filter compensation schemes for the correction of momentum gains observed in the closed loop simulation of the docking of two satellites using the 6 DOF motion system. Several filters that work well for small delays ( .100ms) and a non-preloaded probe are discussed.

Comparing position and orientation accuracy of different electromagnetic sensors for tracking during interventions.

PubMed

Nijkamp, Jasper; Schermers, Bram; Schmitz, Sander; de Jonge, Sofieke; Kuhlmann, Koert; van der Heijden, Ferdinand; Sonke, Jan-Jakob; Ruers, Theo

2016-08-01

To compare the position and orientation accuracy between using one 6-degree of freedom (DOF) electromagnetic (EM) sensor, or the position information of three 5DOF sensors within the scope of tumor tracking. The position accuracy of Northern Digital Inc Aurora 5DOF and 6DOF sensors was determined for a table-top field generator (TTFG) up to a distance of 52 cm. For each sensor 716 positions were measured for 10 s at 15 Hz. Orientation accuracy was determined for each of the orthogonal axis at the TTFG distances of 17, 27, 37 and 47 cm. For the 6DOF sensors, orientation was determined for sensors in-line with the orientation axis, and perpendicular. 5DOF orientation accuracy was determined for a theoretical 4 cm tumor. An optical tracking system was used as reference. Position RMSE and jitter were comparable between the sensors and increasing with distance. Jitter was within 0.1 cm SD within 45 cm distance to the TTFG. Position RMSE was approximately 0.1 cm up to 32 cm distance, increasing to 0.4 cm at 52 cm distance. Orientation accuracy of the 6DOF sensor was within 1[Formula: see text], except when the sensor was in-line with the rotation axis perpendicular to the TTFG plane (4[Formula: see text] errors at 47 cm). Orientation accuracy using 5DOF positions was within 1[Formula: see text] up to 37 cm and 2[Formula: see text] at 47 cm. The position and orientation accuracy of a 6DOF sensor was comparable with a sensor configuration consisting of three 5DOF sensors. To achieve tracking accuracy within 1 mm and 1[Formula: see text], the distance to the TTFG should be limited to approximately 30 cm.

SPACESUIT DONNING AND DOFFING - ZERO-G TRAINING - DON PETERSON - STS-6

NASA Image and Video Library

1982-07-14

Spacesuit Donning and Doffing in Zero-G Training for Don Peterson of the STS-6 Crew with Astronaut Jerry Ross assisting; and, apparatus for testing the JSC Mechanically-Induced Settling Technology (MIST) Experiment. The training is being held aboard the KC-135 to simulate weightlessness. He is being assisted to don the lower torso of the Extravehicular Mobility Unit (EMU) by an ILC Technician. 1. ASTRONAUT ROSS, JERRY L. - ZERO-G SUITING 2. SHUTTLE - EXPERIMENTS (MIST)

Human-Inspired Eigenmovement Concept Provides Coupling-Free Sensorimotor Control in Humanoid Robot.

PubMed

Alexandrov, Alexei V; Lippi, Vittorio; Mergner, Thomas; Frolov, Alexander A; Hettich, Georg; Husek, Dusan

2017-01-01

Control of a multi-body system in both robots and humans may face the problem of destabilizing dynamic coupling effects arising between linked body segments. The state of the art solutions in robotics are full state feedback controllers. For human hip-ankle coordination, a more parsimonious and theoretically stable alternative to the robotics solution has been suggested in terms of the Eigenmovement (EM) control. Eigenmovements are kinematic synergies designed to describe the multi DoF system, and its control, with a set of independent, and hence coupling-free , scalar equations. This paper investigates whether the EM alternative shows "real-world robustness" against noisy and inaccurate sensors, mechanical non-linearities such as dead zones, and human-like feedback time delays when controlling hip-ankle movements of a balancing humanoid robot. The EM concept and the EM controller are introduced, the robot's dynamics are identified using a biomechanical approach, and robot tests are performed in a human posture control laboratory. The tests show that the EM controller provides stable control of the robot with proactive ("voluntary") movements and reactive balancing of stance during support surface tilts and translations. Although a preliminary robot-human comparison reveals similarities and differences, we conclude (i) the Eigenmovement concept is a valid candidate when different concepts of human sensorimotor control are considered, and (ii) that human-inspired robot experiments may help to decide in future the choice among the candidates and to improve the design of humanoid robots and robotic rehabilitation devices.

Human-Inspired Eigenmovement Concept Provides Coupling-Free Sensorimotor Control in Humanoid Robot

PubMed Central

Alexandrov, Alexei V.; Lippi, Vittorio; Mergner, Thomas; Frolov, Alexander A.; Hettich, Georg; Husek, Dusan

2017-01-01

Control of a multi-body system in both robots and humans may face the problem of destabilizing dynamic coupling effects arising between linked body segments. The state of the art solutions in robotics are full state feedback controllers. For human hip-ankle coordination, a more parsimonious and theoretically stable alternative to the robotics solution has been suggested in terms of the Eigenmovement (EM) control. Eigenmovements are kinematic synergies designed to describe the multi DoF system, and its control, with a set of independent, and hence coupling-free, scalar equations. This paper investigates whether the EM alternative shows “real-world robustness” against noisy and inaccurate sensors, mechanical non-linearities such as dead zones, and human-like feedback time delays when controlling hip-ankle movements of a balancing humanoid robot. The EM concept and the EM controller are introduced, the robot's dynamics are identified using a biomechanical approach, and robot tests are performed in a human posture control laboratory. The tests show that the EM controller provides stable control of the robot with proactive (“voluntary”) movements and reactive balancing of stance during support surface tilts and translations. Although a preliminary robot-human comparison reveals similarities and differences, we conclude (i) the Eigenmovement concept is a valid candidate when different concepts of human sensorimotor control are considered, and (ii) that human-inspired robot experiments may help to decide in future the choice among the candidates and to improve the design of humanoid robots and robotic rehabilitation devices. PMID:28487646

Design and development an insect-inspired humanoid gripper that is structurally sound, yet very flexible

NASA Astrophysics Data System (ADS)

Hajjaj, S.; Pun, N.

2013-06-01

One of the biggest challenges in mechanical robotics design is the balance between structural integrity and flexibility. An industrial robotic gripper could be technically advanced, however it contains only 1 Degree of Freedom (DOF). If one is to add more DOFs the design would become complex. On the other hand, the human wrist and fingers contain 23 DOFs, and is very lightweight and highly flexible. Robotics are becoming more and more part of our social life, they are more and more being incorporated in social, medical, and personal application. Therefore, for such robots to be effective, they need to mimic human performance, both in performance as well as in mechanical design. In this work, a Humanoid Gripper is designed and built to mimic a simplified version of a human wrist and fingers. This is attempted by mimicking insect and human designs of grippes. The main challenge was to insure that the gripper is structurally sound, but at the same time flexible and lightweight. A combination of light weight material and a unique design of finger actuators were applied. The gripper is controlled by a PARALLAX servo controller 28823 (PSCI), which mounted on the assembly itself. At the end, a 6 DOF humanoid gripper made of lightweight material, similar in size to the human arm, and is able to carry a weight of 1 Kg has been designed and built.

Embedded Distributed Optical Fiber Sensors in Reinforced Concrete Structures—A Case Study

PubMed Central

Villalba, Sergi

2018-01-01

When using distributed optical fiber sensors (DOFS) on reinforced concrete structures, a compromise must be achieved between the protection requirements and robustness of the sensor deployment and the accuracy of the measurements both in the uncracked and cracked stages and under loading, unloading and reloading processes. With this in mind the authors have carried out an experiment where polyimide-coated DOFS were installed on two concrete beams, both embedded in the rebar elements and also bonded to the concrete surface. The specimens were subjected to a three-point load test where after cracking, they are unloaded and reloaded again to assess the capability of the sensor when applied to a real loading scenarios in concrete structures. Rayleigh Optical Frequency Domain Reflectometry (OFDR) was used as the most suitable technique for crack detection in reinforced concrete elements. To verify the reliability and accuracy of the DOFS measurements, additional strain gauges were also installed at three locations along the rebar. The results show the feasibility of using a thin coated polyimide DOFS directly bonded on the reinforcing bar without the need of indention or mechanization. A proposal for a Spectral Shift Quality (SSQ) threshold is also obtained and proposed for future works when using polyimide-coated DOFS bonded to rebars with cyanoacrylate adhesive. PMID:29587449

Embedded Distributed Optical Fiber Sensors in Reinforced Concrete Structures-A Case Study.

PubMed

Barrias, António; Casas, Joan R; Villalba, Sergi

2018-03-26

When using distributed optical fiber sensors (DOFS) on reinforced concrete structures, a compromise must be achieved between the protection requirements and robustness of the sensor deployment and the accuracy of the measurements both in the uncracked and cracked stages and under loading, unloading and reloading processes. With this in mind the authors have carried out an experiment where polyimide-coated DOFS were installed on two concrete beams, both embedded in the rebar elements and also bonded to the concrete surface. The specimens were subjected to a three-point load test where after cracking, they are unloaded and reloaded again to assess the capability of the sensor when applied to a real loading scenarios in concrete structures. Rayleigh Optical Frequency Domain Reflectometry (OFDR) was used as the most suitable technique for crack detection in reinforced concrete elements. To verify the reliability and accuracy of the DOFS measurements, additional strain gauges were also installed at three locations along the rebar. The results show the feasibility of using a thin coated polyimide DOFS directly bonded on the reinforcing bar without the need of indention or mechanization. A proposal for a Spectral Shift Quality (SSQ) threshold is also obtained and proposed for future works when using polyimide-coated DOFS bonded to rebars with cyanoacrylate adhesive.

Functional impacts of exoskeleton-based rehabilitation in chronic stroke: multi-joint versus single-joint robotic training

PubMed Central

2013-01-01

Stroke is a major cause of disability in the world. The activities of upper limb segments are often compromised following a stroke, impairing most daily tasks. Robotic training is now considered amongst the rehabilitation methods applied to promote functional recovery. However, the implementation of robotic devices remains a major challenge for the bioengineering and clinical community. Latest exoskeletons with multiple degrees of freedom (DOF) may become particularly attractive, because of their low apparent inertia, the multiple actuators generating large torques, and the fact that patients can move the arm in the normal wide workspace. A recent study published in JNER by Milot and colleagues underlines that training with a 6-DOF exoskeleton impacts positively on motor function in patients being in stable phase of recovery after a stroke. Also, multi-joint robotic training was not found to be superior to single-joint robotic training. Although it is often considered that rehabilitation should start from simple movements to complex functional movements as the recovery evolves, this study challenges this widespread notion whose scientific basis has remained uncertain. PMID:24354518

Singularity and workspace analysis of three isoconstrained parallel manipulators with schoenflies motion

NASA Astrophysics Data System (ADS)

Lee, Po-Chih; Lee, Jyh-Jone

2012-06-01

This paper presents the analysis of three parallel manipulators with Schoenflies-motion. Each parallel manipulator possesses two limbs in structure and the end-effector has three DOFs (degree of freedom) in the translational motion and one DOF in rotational motion about a given direction axis with respect to the world coordinate system. The three isoconstrained parallel manipulators have the structures denoted as C{u/u}UwHw-//-C{v/v}UwHw, CuR{u/u}Uhw-//-CvR{v/v}Uhw and CuPuUhw-//-CvPvUhw. The kinematic equations are first introduced for each manipulator. Then, Jacobian matrix, singularity, workspace, and performance index for each mechanism are subsequently derived and analysed for the first time. The results can be helpful for the engineers to evaluate such kind of parallel robots for possible application in industry where pick-and-place motion is required.

Correction of contaminated yaw rate signal and estimation of sensor bias for an electric vehicle under normal driving conditions

NASA Astrophysics Data System (ADS)

Zhang, Guoguang; Yu, Zitian; Wang, Junmin

2017-03-01

Yaw rate is a crucial signal for the motion control systems of ground vehicles. Yet it may be contaminated by sensor bias. In order to correct the contaminated yaw rate signal and estimate the sensor bias, a robust gain-scheduling observer is proposed in this paper. First of all, a two-degree-of-freedom (2DOF) vehicle lateral and yaw dynamic model is presented, and then a Luenberger-like observer is proposed. To make the observer more applicable to real vehicle driving operations, a 2DOF vehicle model with uncertainties on the coefficients of tire cornering stiffness is employed. Further, a gain-scheduling approach and a robustness enhancement are introduced, leading to a robust gain-scheduling observer. Sensor bias detection mechanism is also designed. Case studies are conducted using an electric ground vehicle to assess the performance of signal correction and sensor bias estimation under difference scenarios.

Bandit: Technologies for Proximity Operations of Teams of Sub-10Kg Spacecraft

DTIC Science & Technology

2007-10-16

and adding a dedicated overhead camera system. As will be explained below, the forced-air system did not work and the existing system has proven too...erratic to justify the expense of the camera system. 6DOF Software Simulator. The existing Java-based graphical 6DOF simulator was to be improved for...proposed camera system for a nonfunctional table. The C-9 final report is enclosed. ["Prf flj ,er Figure 1. Forced-air table schematic Figure 2

A self-aligning knee joint for walking assistance devices.

PubMed

Byungjune Choi; Younbaek Lee; Jeonghun Kim; Minhyung Lee; Jongwon Lee; Se-Gon Roh; Hyundo Choi; Yong-Jae Kim; Jung-Yun Choi

2016-08-01

This paper presents a novel self-aligning knee mechanism for walking assistance devices for the elderly to provide physical gait assistance. Self-aligning knee joints can assist in flexion/extension motions of the knee joint and compensate the knee's transitional movements in the sagittal plane. In order to compensate the center of rotation, which moves with the flexion/extension motion of the human knee joint, a self-aligning knee joint is proposed that adds redundant degrees of freedom (i.e., 2-DoF) to the 1-DoF revolute joint. The key idea of the proposed mechanism is to decouple joint rotations and translations for use in lower-extremity wearable devices. This paper describes the mechanical design of this self-aligning knee mechanism and its implementation on a wearable robot and in preliminary experiments. The performance of the proposed mechanism is verified by simulations and experiments.

A double torsion pendulum with two cascade soft degrees of freedom

NASA Astrophysics Data System (ADS)

Marconi, L.; Stanga, R.; Bassan, M.

2012-06-01

We report on a double torsion pendulum, where motion along two degrees of freedom (DoFs) is almost free. The Test Mass (TM) is enclosed in a replica of the LISA-Pathfinder electrostatic readout and actuation system. This apparatus is designed to perform extensive ground testing of undesired effects such as leakage of the readout noise from one DoF to another, or actuation cross talks with closed feedback loop. Such investigation is relevant to the noise budget of LISA and LISA-Pathfinder missions, as the TM will be sensitive to weak forces along all 6 degrees of freedom (DoFs). The instrument being developed in Firenze is capable of measuring the forces and stiffnesses acting simultaneously along the 2 soft DoFs. We have completed an upgrade of the apparatus to a definitive configuration and we report on both advances in the commissioning tests and on measurements of residual charge, with the first DoF released.

Evaluate depth of field limits of fixed focus lens arrangements in thermal infrared

NASA Astrophysics Data System (ADS)

Schuster, Norbert

2016-05-01

More and more modern thermal imaging systems use uncooled detectors. High volume applications work with detectors that have a reduced pixel count (typically between 200x150 and 640x480). This reduces the usefulness of modern image treatment procedures such as wave front coding. On the other hand, uncooled detectors demand lenses with fast fnumbers, near f/1.0, which reduces the expected Depth of Field (DoF). What are the limits on resolution if the target changes distance to the camera system? The desire to implement lens arrangements without a focusing mechanism demands a deeper quantification of the DoF problem. A new approach avoids the classic "accepted image blur circle" and quantifies the expected DoF by the Through Focus MTF of the lens. This function is defined for a certain spatial frequency that provides a straightforward relation to the pixel pitch of imaging device. A certain minimum MTF-level is necessary so that the complete thermal imaging system can realize its basic functions, such as recognition or detection of specified targets. Very often, this technical tradeoff is approved with a certain lens. But what is the impact of changing the lens for one with a different focal length? Narrow field lenses, which give more details of targets in longer distances, tighten the DoF problem. A first orientation is given by the hyperfocal distance. It depends in a square relation on the focal length and in a linear relation on the through focus MTF of the lens. The analysis of these relations shows the contradicting requirements between higher thermal and spatial resolution, faster f-number and desired DoF. Furthermore, the hyperfocal distance defines the DoF-borders. Their relation between is such as the first order imaging formulas. A calculation methodology will be presented to transfer DoF-results from an approved combination lens and camera to another lens in combination with the initial camera. Necessary input for this prediction is the accepted DoF of the initial combination and the through focus MTFs of both lenses. The accepted DoF of the initial combination defines an application and camera related MTF-level, which must be provided also by the new lens. Examples are provided. The formula of the Diffraction-Limited-Through-Focus-MTF (DLTF) quantifies the physical limit and works without any ray trace. This relation respects the pixel pitch, the waveband and the aperture based f-number, but is independent of detector size. The DLTF has a steeper slope than the ray traced Through-Focus-MTF; its maximum is the diffraction limit. The DLTF predicts the DoF-relations quite precisely. Differences to ray trace results are discussed. Last calculations with modern detectors show that a static chosen MTF-level doesn't reflect the reality for the DoFproblem. The MTF-level to respect depends on application, pixel pitch, IR-camera and image treatment. A value of 0.250 at the detector Nyquist frequency seems to be a reasonable starting point for uncooled FPAs with 17μm pixel pitch.

Design and Evaluation of an Actuated Exoskeleton for Examining Motor Control in Stroke Thumb

PubMed Central

Wang, Furui; Jones, Christopher L.; Shastri, Milind; Qian, Kai; Kamper, Derek G.; Sarkar, Nilanjan

2016-01-01

Chronic hand impairment is common following stroke. This paper presents an actuated thumb exoskeleton (ATX) to facilitate research in examining motor control and hand rehabilitation. The ATX presented in this work aims to provide independent bi-directional actuation in each of the 5 degrees-of-freedom (DOF) of the thumb using a novel flexible shaft based mechanism that has 5 active DOF and 3 passive DOF. A prototype has been built and experiments have been conducted to measure the allowable workspace at the thumb and evaluate the kinematic and kinetic performance of the ATX. The experimental results show that the ATX is able to provide individual actuation at all 5 thumb joints with high joint velocity and torque capacities. Further improvement and future work are discussed. PMID:27672232

Design and Realization of a Three Degrees of Freedom Displacement Measurement System Composed of Hall Sensors Based on Magnetic Field Fitting by an Elliptic Function

PubMed Central

Zhao, Bo; Wang, Lei; Tan, Jiu-Bin

2015-01-01

This paper presents the design and realization of a three degrees of freedom (DOFs) displacement measurement system composed of Hall sensors, which is built for the XYθz displacement measurement of the short stroke stage of the reticle stage of lithography. The measurement system consists of three pairs of permanent magnets mounted on the same plane on the short stroke stage along the Y, Y, X directions, and three single axis Hall sensors correspondingly mounted on the frame of the reticle stage. The emphasis is placed on the decoupling and magnetic field fitting of the three DOFs measurement system. The model of the measurement system is illustrated, and the XY positions and θZ rotation of the short stroke stage can be obtained by decoupling the sensor outputs. A magnetic field fitting by an elliptic function-based compensation method is proposed. The practical field intensity of a permanent magnet at a certain plane height can be substituted for the output voltage of a Hall sensors, which can be expressed by the elliptic function through experimental data as the crucial issue to calculate the three DOFs displacement. Experimental results of the Hall sensor displacement measurement system are presented to validate the proposed three DOFs measurement system. PMID:26370993

Nonlinear damping model for flexible structures. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Zang, Weijian

1990-01-01

The study of nonlinear damping problem of flexible structures is addressed. Both passive and active damping, both finite dimensional and infinite dimensional models are studied. In the first part, the spectral density and the correlation function of a single DOF nonlinear damping model is investigated. A formula for the spectral density is established with O(Gamma(sub 2)) accuracy based upon Fokker-Planck technique and perturbation. The spectral density depends upon certain first order statistics which could be obtained if the stationary density is known. A method is proposed to find the approximate stationary density explicitly. In the second part, the spectral density of a multi-DOF nonlinear damping model is investigated. In the third part, energy type nonlinear damping model in an infinite dimensional setting is studied.

A control system for a powered prosthesis using positional and myoelectric inputs from the shoulder complex.

PubMed

Losier, Y; Englehart, K; Hudgins, B

2007-01-01

The integration of multiple input sources within a control strategy for powered upper limb prostheses could provide smoother, more intuitive multi-joint reaching movements based on the user's intended motion. The work presented in this paper presents the results of using myoelectric signals (MES) of the shoulder area in combination with the position of the shoulder as input sources to multiple linear discriminant analysis classifiers. Such an approach may provide users with control signals capable of controlling three degrees of freedom (DOF). This work is another important step in the development of hybrid systems that will enable simultaneous control of multiple degrees of freedom used for reaching tasks in a prosthetic limb.

Adaptive control based on an on-line parameter estimation of an upper limb exoskeleton.

PubMed

Riani, Akram; Madani, Tarek; Hadri, Abdelhafid El; Benallegue, Abdelaziz

2017-07-01

This paper presents an adaptive control strategy for an upper-limb exoskeleton based on an on-line dynamic parameter estimator. The objective is to improve the control performance of this system that plays a critical role in assisting patients for shoulder, elbow and wrist joint movements. In general, the dynamic parameters of the human limb are unknown and differ from a person to another, which degrade the performances of the exoskeleton-human control system. For this reason, the proposed control scheme contains a supplementary loop based on a new efficient on-line estimator of the dynamic parameters. Indeed, the latter is acting upon the parameter adaptation of the controller to ensure the performances of the system in the presence of parameter uncertainties and perturbations. The exoskeleton used in this work is presented and a physical model of the exoskeleton interacting with a 7 Degree of Freedom (DoF) upper limb model is generated using the SimMechanics library of MatLab/Simulink. To illustrate the effectiveness of the proposed approach, an example of passive rehabilitation movements is performed using multi-body dynamic simulation. The aims is to maneuver the exoskeleton that drive the upper limb to track desired trajectories in the case of the passive arm movements.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Multi-Mission Earth Vehicle Subsonic Dynamic Stability Testing and Analyses

NASA Technical Reports Server (NTRS)

Glaab, Louis J.; Fremaux, C. Michael

2013-01-01

Multi-Mission Earth Entry Vehicles (MMEEVs) are blunt-body vehicles designed with the purpose of transporting payloads from outer space to the surface of the Earth. To achieve high-reliability and minimum weight, MMEEVs avoid use of limited-reliability systems, such as parachutes, retro-rockets, and reaction control systems and rely on the natural aerodynamic stability of the vehicle throughout the Entry, Descent, and Landing (EDL) phase of flight. The Multi-Mission Systems Analysis for Planetary Entry (M-SAPE) parametric design tool is used to facilitate the design of MMEEVs for an array of missions and develop and visualize the trade space. Testing in NASA Langley?s Vertical Spin Tunnel (VST) was conducted to significantly improve M-SAPE?s subsonic aerodynamic models. Vehicle size and shape can be driven by entry flight path angle and speed, thermal protection system performance, terminal velocity limitations, payload mass and density, among other design parameters. The objectives of the VST testing were to define usable subsonic center of gravity limits, and aerodynamic parameters for 6-degree-of-freedom (6-DOF) simulations, for a range of MMEEV designs. The range of MMEEVs tested was from 1.8m down to 1.2m diameter. A backshell extender provided the ability to test a design with a much larger payload for the 1.2m MMEEV.

On-Board Imaging Validation of Optically Guided Stereotactic Radiosurgery Positioning System for Conventionally Fractionated Radiotherapy for Paranasal Sinus and Skull Base Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxim, Peter G.; Loo, Billy W.; Murphy, James D.

2011-11-15

Purpose: To evaluate the positioning accuracy of an optical positioning system for stereotactic radiosurgery in a pilot experience of optically guided, conventionally fractionated, radiotherapy for paranasal sinus and skull base tumors. Methods and Materials: Before each daily radiotherapy session, the positioning of 28 patients was set up using an optical positioning system. After this initial setup, the patients underwent standard on-board imaging that included daily orthogonal kilovoltage images and weekly cone beam computed tomography scans. Daily translational shifts were made after comparing the on-board images with the treatment planning computed tomography scans. These daily translational shifts represented the daily positionalmore » error in the optical tracking system and were recorded during the treatment course. For 13 patients treated with smaller fields, a three-degree of freedom (3DOF) head positioner was used for more accurate setup. Results: The mean positional error for the optically guided system in patients with and without the 3DOF head positioner was 1.4 {+-} 1.1 mm and 3.9 {+-} 1.6 mm, respectively (p <.0001). The mean positional error drifted 0.11 mm/wk upward during the treatment course for patients using the 3DOF head positioner (p = .057). No positional drift was observed in the patients without the 3DOF head positioner. Conclusion: Our initial clinical experience with optically guided head-and-neck fractionated radiotherapy was promising and demonstrated clinical feasibility. The optically guided setup was especially useful when used in conjunction with the 3DOF head positioner and when it was recalibrated to the shifts using the weekly portal images.« less

Thermal Actuation Based 3-DoF Non-Resonant Microgyroscope Using MetalMUMPs

PubMed Central

Shakoor, Rana Iqtidar; Bazaz, Shafaat Ahmed; Kraft, Michael; Lai, Yongjun; Masood ul Hassan, Muhammad

2009-01-01

High force, large displacement and low voltage consumption are a primary concern for microgyroscopes. The chevron-shaped thermal actuators are unique in terms of high force generation combined with the large displacements at a low operating voltage in comparison with traditional electrostatic actuators. A Nickel based 3-DoF micromachined gyroscope comprising 2-DoF drive mode and 1-DoF sense mode oscillator utilizing the chevron-shaped thermal actuators is presented here. Analytical derivations and finite element simulations are carried out to predict the performance of the proposed device using the thermo-physical properties of electroplated nickel. The device sensitivity is improved by utilizing the dynamical amplification of the oscillation in 2-DoF drive mode using an active-passive mass configuration. A comprehensive theoretical description, dynamics and mechanical design considerations of the proposed gyroscopes model are discussed in detail. Parametric optimization of gyroscope, its prototype modeling and fabrication using MetalMUMPs has also been investigated. Dynamic transient simulation results predicted that the sense mass of the proposed device achieved a drive displacement of 4.1μm when a sinusoidal voltage of 0.5V is applied at 1.77 kHz exhibiting a mechanical sensitivity of 1.7μm /°/s in vacuum. The wide bandwidth frequency response of the 2-DoF drive mode oscillator consists of two resonant peaks and a flat region of 2.11 kHz between the peaks defining the operational frequency region. The sense mode resonant frequency can lie anywhere within this region and therefore the amplitude of the response is insensitive to structural parameter variations, enhancing device robustness against such variations. The proposed device has a size of 2.2 × 2.6 mm2, almost one third in comparison with existing M-DoF vibratory gyroscope with an estimated power consumption of 0.26 Watts. These predicted results illustrate that the chevron-shaped thermal actuator has a large voltage-stroke ratio shifting the paradigm in MEMS gyroscope design from the traditional interdigitated comb drive electrostatic actuator. These actuators have low damping compared to electrostatic comb drive actuators which may result in high quality factor microgyroscopes operating at atmospheric pressure. PMID:22574020

Piezoelectrically Actuated Robotic System for MRI-Guided Prostate Percutaneous Therapy

PubMed Central

Su, Hao; Shang, Weijian; Cole, Gregory; Li, Gang; Harrington, Kevin; Camilo, Alexander; Tokuda, Junichi; Tempany, Clare M.; Hata, Nobuhiko; Fischer, Gregory S.

2014-01-01

This paper presents a fully-actuated robotic system for percutaneous prostate therapy under continuously acquired live magnetic resonance imaging (MRI) guidance. The system is composed of modular hardware and software to support the surgical workflow of intra-operative MRI-guided surgical procedures. We present the development of a 6-degree-of-freedom (DOF) needle placement robot for transperineal prostate interventions. The robot consists of a 3-DOF needle driver module and a 3-DOF Cartesian motion module. The needle driver provides needle cannula translation and rotation (2-DOF) and stylet translation (1-DOF). A custom robot controller consisting of multiple piezoelectric motor drivers provides precision closed-loop control of piezoelectric motors and enables simultaneous robot motion and MR imaging. The developed modular robot control interface software performs image-based registration, kinematics calculation, and exchanges robot commands and coordinates between the navigation software and the robot controller with a new implementation of the open network communication protocol OpenIGTLink. Comprehensive compatibility of the robot is evaluated inside a 3-Tesla MRI scanner using standard imaging sequences and the signal-to-noise ratio (SNR) loss is limited to 15%. The image deterioration due to the present and motion of robot demonstrates unobservable image interference. Twenty-five targeted needle placements inside gelatin phantoms utilizing an 18-gauge ceramic needle demonstrated 0.87 mm root mean square (RMS) error in 3D Euclidean distance based on MRI volume segmentation of the image-guided robotic needle placement procedure. PMID:26412962

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fasiello, Matteo; Vlah, Zvonimir

A specific value for the cosmological constant Λ can account for late-time cosmic acceleration. However, motivated by the so-called cosmological constant problem(s), several alternative mechanisms have been explored. To date, a host of well-studied dynamical dark energy and modified gravity models exists. Going beyond ΛCDM often comes with additional degrees of freedom (dofs). For these to pass existing observational tests, an efficient screening mechanism must be in place. Furthermore, the linear and quasi-linear regimes of structure formation are ideal probes of such dofs and can capture the onset of screening. We propose here a semi-phenomenological “filter” to account for screeningmore » dynamics on LSS observables, with special emphasis on Vainshtein-type screening.« less

Communication: importance sampling including path correlation in semiclassical initial value representation calculations for time correlation functions.

PubMed

Pan, Feng; Tao, Guohua

2013-03-07

Full semiclassical (SC) initial value representation (IVR) for time correlation functions involves a double phase space average over a set of two phase points, each of which evolves along a classical path. Conventionally, the two initial phase points are sampled independently for all degrees of freedom (DOF) in the Monte Carlo procedure. Here, we present an efficient importance sampling scheme by including the path correlation between the two initial phase points for the bath DOF, which greatly improves the performance of the SC-IVR calculations for large molecular systems. Satisfactory convergence in the study of quantum coherence in vibrational relaxation has been achieved for a benchmark system-bath model with up to 21 DOF.

A kinematic analysis of the modified flight telerobotic servicer manipulator system

NASA Technical Reports Server (NTRS)

Crane, Carl; Carnahan, Tim; Duffy, Joseph

1992-01-01

A reverse kinematic analysis is presented of a six-DOF subchain of a modified seven-DOF flight telerobotic servicer manipulator system. The six-DOF subchain is designated as a TR-RT chain, which describes the sequence of manipulator joints beginning with the first grounded hook joint (universal joint) T, where the sequence R-R designates a pair of revolute joints with parallel axes. At the outset, it had been thought that the reverse kinematic analysis would be similar to a TTT manipulator previously analyzed, in which the third and fourth joints intersected at a finite point. However, this is shown not the case, and a 16th-degree tan-half-angle polynomial is derived for the TR-RT manipulator.

Genome-wide characterization of the SiDof gene family in foxtail millet (Setaria italica).

PubMed

Zhang, Li; Liu, Baoling; Zheng, Gewen; Zhang, Aiying; Li, Runzhi

2017-01-01

Dof (DNA binding with one finger) proteins, which constitute a class of transcription factors found exclusively in plants, are involved in numerous physiological and biochemical reactions affecting growth and development. A genome-wide analysis of SiDof genes was performed in this study. Thirty five SiDof genes were identified and those genes were unevenly distributed across nine chromosomes in the Seteria italica genome. Protein lengths, molecular weights, and theoretical isoelectric points of SiDofs all vary greatly. Gene structure analysis demonstrated that most SiDof genes lack introns. Phylogenetic analysis of SiDof proteins and Dof proteins from Arabidopsis thaliana, rice, sorghum, and Setaria viridis revealed six major groups. Analysis of RNA-Seq data indicated that SiDof gene expression levels varied across roots, stems, leaves, and spike. In addition, expression profiling of SiDof genes in response to stress suggested that SiDof 7 and SiDof 15 are involved in drought stress signalling. Overall, this study could provide novel information on SiDofs for further investigation in foxtail millet. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

A manipulative instrument with simultaneous gesture and end-effector trajectory planning and controlling

NASA Astrophysics Data System (ADS)

Lin, Hsien-I.; Nguyen, Xuan-Anh

2017-05-01

To operate a redundant manipulator to accomplish the end-effector trajectory planning and simultaneously control its gesture in online programming, incorporating the human motion is a useful and flexible option. This paper focuses on a manipulative instrument that can simultaneously control its arm gesture and end-effector trajectory via human teleoperation. The instrument can be classified by two parts; first, for the human motion capture and data processing, marker systems are proposed to capture human gesture. Second, the manipulator kinematics control is implemented by an augmented multi-tasking method, and forward and backward reaching inverse kinematics, respectively. Especially, the local-solution and divergence problems of a multi-tasking method are resolved by the proposed augmented multi-tasking method. Computer simulations and experiments with a 7-DOF (degree of freedom) redundant manipulator were used to validate the proposed method. Comparison among the single-tasking, original multi-tasking, and augmented multi-tasking algorithms were performed and the result showed that the proposed augmented method had a good end-effector position accuracy and the most similar gesture to the human gesture. Additionally, the experimental results showed that the proposed instrument was realized online.

Robust extraction of basis functions for simultaneous and proportional myoelectric control via sparse non-negative matrix factorization

NASA Astrophysics Data System (ADS)

Lin, Chuang; Wang, Binghui; Jiang, Ning; Farina, Dario

2018-04-01

Objective. This paper proposes a novel simultaneous and proportional multiple degree of freedom (DOF) myoelectric control method for active prostheses. Approach. The approach is based on non-negative matrix factorization (NMF) of surface EMG signals with the inclusion of sparseness constraints. By applying a sparseness constraint to the control signal matrix, it is possible to extract the basis information from arbitrary movements (quasi-unsupervised approach) for multiple DOFs concurrently. Main Results. In online testing based on target hitting, able-bodied subjects reached a greater throughput (TP) when using sparse NMF (SNMF) than with classic NMF or with linear regression (LR). Accordingly, the completion time (CT) was shorter for SNMF than NMF or LR. The same observations were made in two patients with unilateral limb deficiencies. Significance. The addition of sparseness constraints to NMF allows for a quasi-unsupervised approach to myoelectric control with superior results with respect to previous methods for the simultaneous and proportional control of multi-DOF. The proposed factorization algorithm allows robust simultaneous and proportional control, is superior to previous supervised algorithms, and, because of minimal supervision, paves the way to online adaptation in myoelectric control.

6DOF Testing of the SLS Inertial Navigation Unit

NASA Technical Reports Server (NTRS)

Geohagan, Kevin W.; Bernard, William P.; Oliver, T. Emerson; Strickland, Dennis J.; Leggett, Jared O.

2018-01-01

The Navigation System on the NASA Space Launch System (SLS) Block 1 vehicle performs initial alignment of the Inertial Navigation System (INS) navigation frame through gyrocompass alignment (GCA). In lieu of direct testing of GCA accuracy in support of requirement verification, the SLS Navigation Team proposed and conducted an engineering test to, among other things, validate the GCA performance and overall behavior of the SLS INS model through comparison with test data. This paper will detail dynamic hardware testing of the SLS INS, conducted by the SLS Navigation Team at Marshall Space Flight Center's 6DOF Table Facility, in support of GCA performance characterization and INS model validation. A 6-DOF motion platform was used to produce 6DOF pad twist and sway dynamics while a simulated SLS flight computer communicated with the INS. Tests conducted include an evaluation of GCA algorithm robustness to increasingly dynamic pad environments, an examination of GCA algorithm stability and accuracy over long durations, and a long-duration static test to gather enough data for Allan Variance analysis. Test setup, execution, and data analysis will be discussed, including analysis performed in support of SLS INS model validation.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

MEMS 3-DoF gyroscope design, modeling and simulation through equivalent circuit lumped parameter model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mian, Muhammad Umer, E-mail: umermian@gmail.com; Khir, M. H. Md.; Tang, T. B.

Pre-fabrication, behavioural and performance analysis with computer aided design (CAD) tools is a common and fabrication cost effective practice. In light of this we present a simulation methodology for a dual-mass oscillator based 3 Degree of Freedom (3-DoF) MEMS gyroscope. 3-DoF Gyroscope is modeled through lumped parameter models using equivalent circuit elements. These equivalent circuits consist of elementary components which are counterpart of their respective mechanical components, used to design and fabricate 3-DoF MEMS gyroscope. Complete designing of equivalent circuit model, mathematical modeling and simulation are being presented in this paper. Behaviors of the equivalent lumped models derived for themore » proposed device design are simulated in MEMSPRO T-SPICE software. Simulations are carried out with the design specifications following design rules of the MetalMUMPS fabrication process. Drive mass resonant frequencies simulated by this technique are 1.59 kHz and 2.05 kHz respectively, which are close to the resonant frequencies found by the analytical formulation of the gyroscope. The lumped equivalent circuit modeling technique proved to be a time efficient modeling technique for the analysis of complex MEMS devices like 3-DoF gyroscopes. The technique proves to be an alternative approach to the complex and time consuming couple field analysis Finite Element Analysis (FEA) previously used.« less

Principal components analysis based control of a multi-DoF underactuated prosthetic hand.

PubMed

Matrone, Giulia C; Cipriani, Christian; Secco, Emanuele L; Magenes, Giovanni; Carrozza, Maria Chiara

2010-04-23

Functionality, controllability and cosmetics are the key issues to be addressed in order to accomplish a successful functional substitution of the human hand by means of a prosthesis. Not only the prosthesis should duplicate the human hand in shape, functionality, sensorization, perception and sense of body-belonging, but it should also be controlled as the natural one, in the most intuitive and undemanding way. At present, prosthetic hands are controlled by means of non-invasive interfaces based on electromyography (EMG). Driving a multi degrees of freedom (DoF) hand for achieving hand dexterity implies to selectively modulate many different EMG signals in order to make each joint move independently, and this could require significant cognitive effort to the user. A Principal Components Analysis (PCA) based algorithm is used to drive a 16 DoFs underactuated prosthetic hand prototype (called CyberHand) with a two dimensional control input, in order to perform the three prehensile forms mostly used in Activities of Daily Living (ADLs). Such Principal Components set has been derived directly from the artificial hand by collecting its sensory data while performing 50 different grasps, and subsequently used for control. Trials have shown that two independent input signals can be successfully used to control the posture of a real robotic hand and that correct grasps (in terms of involved fingers, stability and posture) may be achieved. This work demonstrates the effectiveness of a bio-inspired system successfully conjugating the advantages of an underactuated, anthropomorphic hand with a PCA-based control strategy, and opens up promising possibilities for the development of an intuitively controllable hand prosthesis.

Design and control of a 3-DOF rehabilitation robot for forearm and wrist.

PubMed

Lincong Luo; Liang Peng; Zengguang Hou; Weiqun Wang

2017-07-01

This paper presents a 3-DOF compact rehabilitation robot, involving mechanical structure design, control system design and gravity compensation analysis. The robot can simultaneously provide assistance for pronation/supination(P/S), flexion/extension(F/E) and adduction/abduction(A/A) joints rehabilitation training. The P/S and F/E joints are designed to be driven by cable transmission to gain a high backdrivability, and an adjustment plate is adopted to decrease the distance between the rotation axis of F/E joint of the human wrist and the robot. In addition, gravity compensation is considered to offset the impact of self-gravity on the performance of the controller. A "moving window" control strategy based on impedance control is proposed and implemented on the robot. A comparison between the "moving window" control and classical impedance control indicates that the former has more potential to stimulate the voluntary efforts of the participant, and has a less limitation moving in a fixed reference trajectory. Meanwhile, the results also validate the feasibility and safety of the wrist robot system.

Modeling and simulation of a 2-DOF bidirectional electrothermal microactuator

NASA Astrophysics Data System (ADS)

Topaloglu, N.; Elbuken, C.; Nieva, P. M.; Yavuz, M.; Huissoon, J. P.

2008-03-01

In this paper we present the modeling and simulation of a 2 degree-of-freedom (DOF) bidirectional electrothermal actuator. The four arm microactuator was designed to move in both the horizontal and vertical axes. By tailoring the geometrical parameters of the design, the in-plane and out-of-plane motions were decoupled, resulting in enhanced mobility in both directions. The motion of the actuator was modeled analytically using an electro-thermo-mechanical analysis. To validate the analytical model, finite element simulations were performed using ANSYS. The microactuators were fabricated using PolyMUMPS process and experimental results show good agreement with both the analytical model and the simulations. We demonstrated that the 2-DOF bidirectional electrothermal actuator can achieve 3.7 μm in-plane and 13.3 μm out-of-plane deflections with an input voltage of 10 V.

Portable haptic interface with omni-directional movement and force capability.

PubMed

Avizzano, Carlo Alberto; Satler, Massimo; Ruffaldi, Emanuele

2014-01-01

We describe the design of a new mobile haptic interface that employs wheels for force rendering. The interface, consisting of an omni-directional Killough type platform, provides 2DOF force feedback with different control modalities. The system autonomously performs sensor fusion for localization and force rendering. This paper explains the relevant choices concerning the functional aspects, the control design, the mechanical and electronic solution. Experimental results for force feedback characterization are reported.

Generalized topology for resonators having N commensurate harmonics

NASA Astrophysics Data System (ADS)

Danzi, Francesco; Gibert, James M.; Frulla, Giacomo; Cestino, Enrico

2018-04-01

Despite the ubiquity of both linear and nonlinear multimember resonators in MEMS and kinetic energy harvesting devices very few research efforts examine the orientation of members in the resonator on its dynamic behavior. Previous efforts to design this type of resonator constrains the members to have relative orientations that are 0○ or 90○ to each other, i.e., the elements are connected inline with adjoining members or are perpendicular to adjoining members. The work expands upon the existing body of research by considering the effect of the relative orientation between members on the dynamic behavior of the system. In this manuscript, we derive a generalized reduced-order model for the design of a multi-member planar resonator that has integer multiple modal frequencies. The model is based on a Rayleigh Ritz approximation where the number of degrees of freedom equals the number of structural members in the resonator. The analysis allows the generation of design curves, representing all the possible solutions for modal frequencies that are commensurate. The generalized model, valid for an N-DOF structure, is then restricted for a 2- and 3-DOF system/member resonator, where the linear dynamic behavior of the resonator is investigated in depth. Furthermore, this analysis demonstrates a rule of thumb; relaxing restrictions on the relative orientation of members in a planar structure, allows the structure to exhibit exactly N commensurable frequencies if it contains N members.

Modeling of the 6DOF Missile Dynamics using the NED Axes System

DTIC Science & Technology

1997-08-01

representer le corps du missile, l’autodirecteur ainsi que Ia ligne missile-but. Le systeme d’axes le plus couramment utilise dans le domaine de la ...simulation de missiles tactiques ainsi que dans la librairie de composantes de modele de simulation du CRDV est le systeme d’axes NED, qui utilise l’axe x...RESEARCH ESTABLISHMENT CENTRE DE RECHERCHES POUR LA DEFENSE VALCARTIER,QuEBEC DREV- N-9703 MODELING OF THE 6DOF MISSILE DYNAMICS USING THE NED AXES

Towards frameless maskless SRS through real-time 6DoF robotic motion compensation.

PubMed

Belcher, Andrew H; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D

2017-11-13

Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient's skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system's effectiveness in maintaining the target's 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system's effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system's success with volunteers has demonstrated its capability for implementation with frameless and maskless SRS treatments, potentially able to achieve the same or better treatment accuracies compared to traditional frame-based approaches.

Programmable diffractive optical elements for extending the depth of focus in ophthalmic optics

NASA Astrophysics Data System (ADS)

Romero, Lenny A.; Millán, María. S.; Jaroszewicz, Zbigniew; Kołodziejczyk, Andrzej

2015-01-01

The depth of focus (DOF) defines the axial range of high lateral resolution in the image space for object position. Optical devices with a traditional lens system typically have a limited DOF. However, there are applications such as in ophthalmology, which require a large DOF in comparison to a traditional optical system, this is commonly known as extended DOF (EDOF). In this paper we explore Programmable Diffractive Optical Elements (PDOEs), with EDOF, as an alternative solution to visual impairments, especially presbyopia. These DOEs were written onto a reflective liquid cystal on silicon (LCoS) spatial light modulator (SLM). Several designs of the elements are analyzed: the Forward Logarithmic Axicon (FLAX), the Axilens (AXL), the Light sword Optical Element (LSOE), the Peacock Eye Optical Element (PE) and Double Peacock Eye Optical Element (DPE). These elements focus an incident plane wave into a segment of the optical axis. The performances of the PDOEs are compared with those of multifocal lenses. In all cases, we obtained the point spread function and the image of an extended object. The results are presented and discussed.

Integrated Chassis Control of Active Front Steering and Yaw Stability Control Based on Improved Inverse Nyquist Array Method

PubMed Central

2014-01-01

An integrated chassis control (ICC) system with active front steering (AFS) and yaw stability control (YSC) is introduced in this paper. The proposed ICC algorithm uses the improved Inverse Nyquist Array (INA) method based on a 2-degree-of-freedom (DOF) planar vehicle reference model to decouple the plant dynamics under different frequency bands, and the change of velocity and cornering stiffness were considered to calculate the analytical solution in the precompensator design so that the INA based algorithm runs well and fast on the nonlinear vehicle system. The stability of the system is guaranteed by dynamic compensator together with a proposed PI feedback controller. After the response analysis of the system on frequency domain and time domain, simulations under step steering maneuver were carried out using a 2-DOF vehicle model and a 14-DOF vehicle model by Matlab/Simulink. The results show that the system is decoupled and the vehicle handling and stability performance are significantly improved by the proposed method. PMID:24782676

Integrated chassis control of active front steering and yaw stability control based on improved inverse nyquist array method.

PubMed

Zhu, Bing; Chen, Yizhou; Zhao, Jian

2014-01-01

An integrated chassis control (ICC) system with active front steering (AFS) and yaw stability control (YSC) is introduced in this paper. The proposed ICC algorithm uses the improved Inverse Nyquist Array (INA) method based on a 2-degree-of-freedom (DOF) planar vehicle reference model to decouple the plant dynamics under different frequency bands, and the change of velocity and cornering stiffness were considered to calculate the analytical solution in the precompensator design so that the INA based algorithm runs well and fast on the nonlinear vehicle system. The stability of the system is guaranteed by dynamic compensator together with a proposed PI feedback controller. After the response analysis of the system on frequency domain and time domain, simulations under step steering maneuver were carried out using a 2-DOF vehicle model and a 14-DOF vehicle model by Matlab/Simulink. The results show that the system is decoupled and the vehicle handling and stability performance are significantly improved by the proposed method.

Reduced-Dimensionality Semiclassical Transition State Theory: Application to Hydrogen Atom Abstraction and Exchange Reactions of Hydrocarbons.

PubMed

Greene, Samuel M; Shan, Xiao; Clary, David C

2015-12-17

Quantum mechanical methods for calculating rate constants are often intractable for reactions involving many atoms. Semiclassical transition state theory (SCTST) offers computational advantages over these methods but nonetheless scales exponentially with the number of degrees of freedom (DOFs) of the system. Here we present a method with more favorable scaling, reduced-dimensionality SCTST (RD SCTST), that treats only a subset of DOFs of the system explicitly. We apply it to three H abstraction and exchange reactions for which two-dimensional potential energy surfaces (PESs) have previously been constructed and evaluated using RD quantum scattering calculations. We differentiated these PESs to calculate harmonic frequencies and anharmonic constants, which were then used to calculate cumulative reaction probabilities and rate constants by RD SCTST. This method yielded rate constants in good agreement with quantum scattering results. Notably, it performed well for a heavy-light-heavy reaction, even though it does not explicitly account for corner-cutting effects. Recent extensions to SCTST that improve its treatment of deep tunneling were also evaluated within the reduced-dimensionality framework. The success of RD SCTST in this study suggests its potential applicability to larger systems.

Statistical Sensor Fusion of a 9-DOF Mems Imu for Indoor Navigation

NASA Astrophysics Data System (ADS)

Chow, J. C. K.

2017-09-01

Sensor fusion of a MEMS IMU with a magnetometer is a popular system design, because such 9-DoF (degrees of freedom) systems are capable of achieving drift-free 3D orientation tracking. However, these systems are often vulnerable to ambient magnetic distortions and lack useful position information; in the absence of external position aiding (e.g. satellite/ultra-wideband positioning systems) the dead-reckoned position accuracy from a 9-DoF MEMS IMU deteriorates rapidly due to unmodelled errors. Positioning information is valuable in many satellite-denied geomatics applications (e.g. indoor navigation, location-based services, etc.). This paper proposes an improved 9-DoF IMU indoor pose tracking method using batch optimization. By adopting a robust in-situ user self-calibration approach to model the systematic errors of the accelerometer, gyroscope, and magnetometer simultaneously in a tightly-coupled post-processed least-squares framework, the accuracy of the estimated trajectory from a 9-DoF MEMS IMU can be improved. Through a combination of relative magnetic measurement updates and a robust weight function, the method is able to tolerate a high level of magnetic distortions. The proposed auto-calibration method was tested in-use under various heterogeneous magnetic field conditions to mimic a person walking with the sensor in their pocket, a person checking their phone, and a person walking with a smartwatch. In these experiments, the presented algorithm improved the in-situ dead-reckoning orientation accuracy by 79.8-89.5 % and the dead-reckoned positioning accuracy by 72.9-92.8 %, thus reducing the relative positioning error from metre-level to decimetre-level after ten seconds of integration, without making assumptions about the user's dynamics.

Robust design of a 2-DOF GMV controller: a direct self-tuning and fuzzy scheduling approach.

PubMed

Silveira, Antonio S; Rodríguez, Jaime E N; Coelho, Antonio A R

2012-01-01

This paper presents a study on self-tuning control strategies with generalized minimum variance control in a fixed two degree of freedom structure-or simply GMV2DOF-within two adaptive perspectives. One, from the process model point of view, using a recursive least squares estimator algorithm for direct self-tuning design, and another, using a Mamdani fuzzy GMV2DOF parameters scheduling technique based on analytical and physical interpretations from robustness analysis of the system. Both strategies are assessed by simulation and real plants experimentation environments composed of a damped pendulum and an under development wind tunnel from the Department of Automation and Systems of the Federal University of Santa Catarina. Copyright © 2011 ISA. Published by Elsevier Ltd. All rights reserved.

Optimal design of an alignment-free two-DOF rehabilitation robot for the shoulder complex.

PubMed

Galinski, Daniel; Sapin, Julien; Dehez, Bruno

2013-06-01

This paper presents the optimal design of an alignment-free exoskeleton for the rehabilitation of the shoulder complex. This robot structure is constituted of two actuated joints and is linked to the arm through passive degrees of freedom (DOFs) to drive the flexion-extension and abduction-adduction movements of the upper arm. The optimal design of this structure is performed through two steps. The first step is a multi-objective optimization process aiming to find the best parameters characterizing the robot and its position relative to the patient. The second step is a comparison process aiming to select the best solution from the optimization results on the basis of several criteria related to practical considerations. The optimal design process leads to a solution outperforming an existing solution on aspects as kinematics or ergonomics while being more simple.

Screening in perturbative approaches to LSS

DOE PAGES

Fasiello, Matteo; Vlah, Zvonimir

2017-08-24

A specific value for the cosmological constant Λ can account for late-time cosmic acceleration. However, motivated by the so-called cosmological constant problem(s), several alternative mechanisms have been explored. To date, a host of well-studied dynamical dark energy and modified gravity models exists. Going beyond ΛCDM often comes with additional degrees of freedom (dofs). For these to pass existing observational tests, an efficient screening mechanism must be in place. Furthermore, the linear and quasi-linear regimes of structure formation are ideal probes of such dofs and can capture the onset of screening. We propose here a semi-phenomenological “filter” to account for screeningmore » dynamics on LSS observables, with special emphasis on Vainshtein-type screening.« less

Design of a knee joint mechanism that adapts to individual physiology.

PubMed

Jiun-Yih Kuan; Pasch, Kenneth A; Herr, Hugh M

2014-01-01

This paper describes the design of a new knee joint mechanism, called the Adaptive Coupling Joint (ACJ). The new mechanism has an adaptive trajectory of the center of rotations (COR) that automatically matches those of the attached biological joint. The detailed design is presented as well as characterization results of the ACJ. Conventional exoskeleton and assistive devices usually consider limb joints as a one to three degrees of freedom (DOFs) joint synthesized by multiple one-DOF hinge joints in a single plane. However, the biological joints are complex and usually rotate with respect to a changing COR. As a result, the mismatch between limb joint motion and mechanical interface motion can lead to forces that cause undesired ligament and muscle length changes and internal mechanical changes. These undesired changes contribute to discomfort, as well as to the slippage and sluggish interaction between humans and devices. It is shown that the ACJ can transmit planetary torques from either active or passive devices to the limbs without altering the normal biological joint motion.

Use of probabilistic weights to enhance linear regression myoelectric control

NASA Astrophysics Data System (ADS)

Smith, Lauren H.; Kuiken, Todd A.; Hargrove, Levi J.

2015-12-01

Objective. Clinically available prostheses for transradial amputees do not allow simultaneous myoelectric control of degrees of freedom (DOFs). Linear regression methods can provide simultaneous myoelectric control, but frequently also result in difficulty with isolating individual DOFs when desired. This study evaluated the potential of using probabilistic estimates of categories of gross prosthesis movement, which are commonly used in classification-based myoelectric control, to enhance linear regression myoelectric control. Approach. Gaussian models were fit to electromyogram (EMG) feature distributions for three movement classes at each DOF (no movement, or movement in either direction) and used to weight the output of linear regression models by the probability that the user intended the movement. Eight able-bodied and two transradial amputee subjects worked in a virtual Fitts’ law task to evaluate differences in controllability between linear regression and probability-weighted regression for an intramuscular EMG-based three-DOF wrist and hand system. Main results. Real-time and offline analyses in able-bodied subjects demonstrated that probability weighting improved performance during single-DOF tasks (p < 0.05) by preventing extraneous movement at additional DOFs. Similar results were seen in experiments with two transradial amputees. Though goodness-of-fit evaluations suggested that the EMG feature distributions showed some deviations from the Gaussian, equal-covariance assumptions used in this experiment, the assumptions were sufficiently met to provide improved performance compared to linear regression control. Significance. Use of probability weights can improve the ability to isolate individual during linear regression myoelectric control, while maintaining the ability to simultaneously control multiple DOFs.

Model-independent position domain sliding mode control for contour tracking of robotic manipulator

NASA Astrophysics Data System (ADS)

Yue, W. H.; Pano, V.; Ouyang, P. R.; Hu, Y. Q.

2017-01-01

In this paper, a new position domain feedback type sliding mode control (PDC-SMC) law is proposed for contour tracking control of multi-DOF (degree of freedom) nonlinear robotic manipulators focusing on the improvement of contour tracking performances. One feature of the proposed control law is its model-independent control scheme that can avoid calculation of the feedforward part in a standard SMC. The new control law takes the advantages of the high contour tracking performance of PD type feedback position domain control (PDC) and the robustness of SMC. Stability analysis is performed using the Lyapunov stability theory, and simulation studies are conducted to verify the effectiveness of the developed PDC-SMC control system. In addition, the effects of control parameters of the SMC on system performances are studied.

Exploring the Free Energy Landscape of Solutes Embedded in Lipid Bilayers.

PubMed

Jämbeck, Joakim P M; Lyubartsev, Alexander P

2013-06-06

Free energy calculations are vital for our understanding of biological processes on an atomistic scale and can offer insight to various mechanisms. However, in some cases, degrees of freedom (DOFs) orthogonal to the reaction coordinate have high energy barriers and/or long equilibration times, which prohibit proper sampling. Here we identify these orthogonal DOFs when studying the transfer of a solute from water to a model membrane. Important DOFs are identified in bulk liquids of different dielectric nature with metadynamics simulations and are used as reaction coordinates for the translocation process, resulting in two- and three-dimensional space of reaction coordinates. The results are in good agreement with experiments and elucidate the pitfalls of using one-dimensional reaction coordinates. The calculations performed here offer the most detailed free energy landscape of solutes embedded in lipid bilayers to date and show that free energy calculations can be used to study complex membrane translocation phenomena.

Evolution analysis of Dof transcription factor family and their expression in response to multiple abiotic stresses in Malus domestica.

PubMed

Zhang, Zhengrong; Yuan, Li; Liu, Xin; Chen, Xuesen; Wang, Xiaoyun

2018-01-10

As a family of transcription factors, DNA binding with one figure (Dof) proteins play important roles in various biological processes in plants. Here, a total of 60 putative apple (Malus domestica) Dof genes (MdDof) were identified and mapped to different chromosomes. Chromosomal distribution and synteny analysis indicated that the expansion of the MdDof genes came primarily from segmental and duplication events, and from whole genome duplication, which lead to more Dof members in apples than in other plants. All 60 MdDof genes were classified into thirteen groups, according to multiple sequence alignment and the phylogenetic tree constructed of Dof genes from apple, peach (Prunus persica), Arabidopsis and rice. Within each group, the members shared a similar exon/intron and motif compositions, although the sizes of the MdDof genes and encoding proteins were quite different. Several Dof genes from the apple and peach were identified to be homologues based on their close synteny relationship, which suggested that these genes bear similar functions. Half of the MdDof genes were randomly selected to determine their responses to different stresses. The majority of MdDof genes were quite sensitive to PEG, NaCl, cold and exogenous ABA treatment. Our results suggested that MdDof family members may play important roles in plant tolerance to abiotic stress. Copyright © 2017 Elsevier B.V. All rights reserved.

Through the big bang: Continuing Einstein's equations beyond a cosmological singularity

NASA Astrophysics Data System (ADS)

Koslowski, Tim A.; Mercati, Flavio; Sloan, David

2018-03-01

All measurements are comparisons. The only physically accessible degrees of freedom (DOFs) are dimensionless ratios. The objective description of the universe as a whole thus predicts only how these ratios change collectively as one of them is changed. Here we develop a description for classical Bianchi IX cosmology implementing these relational principles. The objective evolution decouples from the volume and its expansion degree of freedom. We use the relational description to investigate both vacuum dominated and quiescent Bianchi IX cosmologies. In the vacuum dominated case the relational dynamical system predicts an infinite amount of change of the relational DOFs, in accordance with the well known chaotic behaviour of Bianchi IX. In the quiescent case the relational dynamical system evolves uniquely though the point where the decoupled scale DOFs predict the big bang/crunch. This is a non-trivial prediction of the relational description; the big bang/crunch is not the end of physics - it is instead a regular point of the relational evolution. Describing our solutions as spacetimes that satisfy Einstein's equations, we find that the relational dynamical system predicts two singular solutions of GR that are connected at the hypersurface of the singularity such that relational DOFs are continuous and the orientation of the spatial frame is inverted.

Genome-wide analysis of the DNA-binding with one zinc finger (Dof) transcription factor family in bananas.

PubMed

Dong, Chen; Hu, Huigang; Xie, Jianghui

2016-12-01

DNA-binding with one finger (Dof) domain proteins are a multigene family of plant-specific transcription factors involved in numerous aspects of plant growth and development. In this study, we report a genome-wide search for Musa acuminata Dof (MaDof) genes and their expression profiles at different developmental stages and in response to various abiotic stresses. In addition, a complete overview of the Dof gene family in bananas is presented, including the gene structures, chromosomal locations, cis-regulatory elements, conserved protein domains, and phylogenetic inferences. Based on the genome-wide analysis, we identified 74 full-length protein-coding MaDof genes unevenly distributed on 11 chromosomes. Phylogenetic analysis with Dof members from diverse plant species showed that MaDof genes can be classified into four subgroups (StDof I, II, III, and IV). The detailed genomic information of the MaDof gene homologs in the present study provides opportunities for functional analyses to unravel the exact role of the genes in plant growth and development.

Six Degree-of-Freedom Measurements of Human Mild Traumatic Brain Injury.

PubMed

Hernandez, Fidel; Wu, Lyndia C; Yip, Michael C; Laksari, Kaveh; Hoffman, Andrew R; Lopez, Jaime R; Grant, Gerald A; Kleiven, Svein; Camarillo, David B

2015-08-01

This preliminary study investigated whether direct measurement of head rotation improves prediction of mild traumatic brain injury (mTBI). Although many studies have implicated rotation as a primary cause of mTBI, regulatory safety standards use 3 degree-of-freedom (3DOF) translation-only kinematic criteria to predict injury. Direct 6DOF measurements of human head rotation (3DOF) and translation (3DOF) have not been previously available to examine whether additional DOFs improve injury prediction. We measured head impacts in American football, boxing, and mixed martial arts using 6DOF instrumented mouthguards, and predicted clinician-diagnosed injury using 12 existing kinematic criteria and 6 existing brain finite element (FE) criteria. Among 513 measured impacts were the first two 6DOF measurements of clinically diagnosed mTBI. For this dataset, 6DOF criteria were the most predictive of injury, more than 3DOF translation-only and 3DOF rotation-only criteria. Peak principal strain in the corpus callosum, a 6DOF FE criteria, was the strongest predictor, followed by two criteria that included rotation measurements, peak rotational acceleration magnitude and Head Impact Power (HIP). These results suggest head rotation measurements may improve injury prediction. However, more 6DOF data is needed to confirm this evaluation of existing injury criteria, and to develop new criteria that considers directional sensitivity to injury.

A fast high-precision six-degree-of-freedom relative position sensor

NASA Astrophysics Data System (ADS)

Hughes, Gary B.; Macasaet, Van P.; Griswold, Janelle; Sison, Claudia A.; Lubin, Philip; Meinhold, Peter; Suen, Jonathan; Brashears, Travis; Zhang, Qicheng; Madajian, Jonathan

2016-03-01

Lasers are commonly used in high-precision measurement and profiling systems. Some laser measurement systems are based on interferometry principles, and others are based on active triangulation, depending on requirements of the application. This paper describes an active triangulation laser measurement system for a specific application wherein the relative position of two fixed, rigid mechanical components is to be measured dynamically with high precision in six degrees of freedom (DOF). Potential applications include optical systems with feedback to control for mechanical vibration, such as target acquisition devices with multiple focal planes. The method uses an array of several laser emitters mounted on one component. The lasers are directed at a reflective surface on the second component. The reflective surface consists of a piecewise-planar pattern such as a pyramid, or more generally a curved reflective surface such as a hyperbolic paraboloid. The reflected spots are sensed at 2-dimensional photodiode arrays on the emitter component. Changes in the relative position of the emitter component and reflective surface will shift the location of the reflected spots within photodiode arrays. Relative motion in any degree of freedom produces independent shifts in the reflected spot locations, allowing full six-DOF relative position determination between the two component positions. Response time of the sensor is limited by the read-out rate of the photodiode arrays. Algorithms are given for position determination with limits on uncertainty and sensitivity, based on laser and spot-sensor characteristics, and assuming regular surfaces. Additional uncertainty analysis is achievable for surface irregularities based on calibration data.

Equivalence principle for quantum systems: dephasing and phase shift of free-falling particles

NASA Astrophysics Data System (ADS)

Anastopoulos, C.; Hu, B. L.

2018-02-01

We ask the question of how the (weak) equivalence principle established in classical gravitational physics should be reformulated and interpreted for massive quantum objects that may also have internal degrees of freedom (dof). This inquiry is necessary because even elementary concepts like a classical trajectory are not well defined in quantum physics—trajectories originating from quantum histories become viable entities only under stringent decoherence conditions. From this investigation we posit two logically and operationally distinct statements of the equivalence principle for quantum systems. Version A: the probability distribution of position for a free-falling particle is the same as the probability distribution of a free particle, modulo a mass-independent shift of its mean. Version B: any two particles with the same velocity wave-function behave identically in free fall, irrespective of their masses. Both statements apply to all quantum states, including those without a classical correspondence, and also for composite particles with quantum internal dof. We also investigate the consequences of the interaction between internal and external dof induced by free fall. For a class of initial states, we find dephasing occurs for the translational dof, namely, the suppression of the off-diagonal terms of the density matrix, in the position basis. We also find a gravitational phase shift in the reduced density matrix of the internal dof that does not depend on the particle’s mass. For classical states, the phase shift has a natural classical interpretation in terms of gravitational red-shift and special relativistic time-dilation.

Is it Finger or Wrist Dexterity That is Missing in Current Hand Prostheses?

PubMed

Montagnani, Federico; Controzzi, Marco; Cipriani, Christian

2015-07-01

Building prostheses with dexterous motor function equivalent to that of the human hand is one of the ambitious goals of bioengineers. State of art prostheses lack several degrees of freedom (DoF) and force the individuals to compensate for them by changing the motions of their arms and body. However, such compensatory movements often result in residual limb pain and overuse syndromes. Significant efforts were spent in designing artificial hands with multiple allowed grasps but little work has been done with regards to wrist design, regardless the fact that the wrist contributes significantly to the execution of upper limb motor tasks. We hypothesized that a single DoF hand with wrist flexion/extension allowed function comparable to a highly performant multi DoF hand without wrist flexion/extension. To assess this we compared four emulated architectures of hand-wrist prostheses using the Southampton Hand Assessment Procedure and evaluating the extent of compensatory movements with unimpaired subjects wearing ortheses. Our findings show indeed that shifting the dexterity from the hand to the wrist could preserve the ability of transradial amputees in performing common tasks with limited effect on the compensatory movements. Hence, this study invites rehabilitation engineers to focus on novel artificial wrist architectures.

Assessment of Healthcare Worker Protocol Deviations and Self-Contamination During Personal Protective Equipment Donning and Doffing.

PubMed

Kwon, Jennie H; Burnham, Carey-Ann D; Reske, Kimberly A; Liang, Stephen Y; Hink, Tiffany; Wallace, Meghan A; Shupe, Angela; Seiler, Sondra; Cass, Candice; Fraser, Victoria J; Dubberke, Erik R

2017-09-01

OBJECTIVE To evaluate healthcare worker (HCW) risk of self-contamination when donning and doffing personal protective equipment (PPE) using fluorescence and MS2 bacteriophage. DESIGN Prospective pilot study. SETTING Tertiary-care hospital. PARTICIPANTS A total of 36 HCWs were included in this study: 18 donned/doffed contact precaution (CP) PPE and 18 donned/doffed Ebola virus disease (EVD) PPE. INTERVENTIONS HCWs donned PPE according to standard protocols. Fluorescent liquid and MS2 bacteriophage were applied to HCWs. HCWs then doffed their PPE. After doffing, HCWs were scanned for fluorescence and swabbed for MS2. MS2 detection was performed using reverse transcriptase PCR. The donning and doffing processes were videotaped, and protocol deviations were recorded. RESULTS Overall, 27% of EVD PPE HCWs and 50% of CP PPE HCWs made ≥1 protocol deviation while donning, and 100% of EVD PPE HCWs and 67% of CP PPE HCWs made ≥1 protocol deviation while doffing (P=.02). The median number of doffing protocol deviations among EVD PPE HCWs was 4, versus 1 among CP PPE HCWs. Also, 15 EVD PPE protocol deviations were committed by doffing assistants and/or trained observers. Fluorescence was detected on 8 EVD PPE HCWs (44%) and 5 CP PPE HCWs (28%), most commonly on hands. MS2 was recovered from 2 EVD PPE HCWs (11%) and 3 CP PPE HCWs (17%). CONCLUSIONS Protocol deviations were common during both EVD and CP PPE doffing, and some deviations during EVD PPE doffing were committed by the HCW doffing assistant and/or the trained observer. Self-contamination was common. PPE donning/doffing are complex and deserve additional study. Infect Control Hosp Epidemiol 2017;38:1077-1083.

Characterization of Dof Transcription Factors and Their Responses to Osmotic Stress in Poplar (Populus trichocarpa)

PubMed Central

Wang, Han; Zhao, Shicheng; Gao, Yuchi; Yang, Jingli

2017-01-01

The DNA-binding One Zinc Finger (Dof) genes are ubiquitous in many plant species and are especial transcription regulators that participate in plant growth, development and various procedures, including biotic and abiotic stress reactions. In this study, we identified 41 PtrDof members from Populus trichocarpa genomes and classified them into four groups. The conserved motifs and gene structures of some PtrDof genes belonging to the same subgroup were almost the same. The 41 PtrDof genes were dispersed on 18 of the 19 Populus chromosomes. Many key stress- or phytohormone-related cis-elements were discovered in the PtrDof gene promoter regions. Consequently, we undertook expression profiling of the PtrDof genes in leaves and roots in response to osmotic stress and abscisic acid. A total of seven genes (PtrDof14, 16, 25, 27, 28, 37 and 39) in the Populus Dof gene family were consistently upregulated at point in all time in the leaves and roots under osmotic and abscisic acid (ABA) stress. We observed that 12 PtrDof genes could be targeted by 15 miRNAs. Moreover, we mapped the cleavage site in PtrDof30 using the 5’RLM-RACE. The results showed that PtrDofs may have a role in resistance to abiotic stress in Populus trichocarpa. PMID:28095469

Comparison and Analysis of ISO/IEEE 11073, IHE PCD-01, and HL7 FHIR Messages for Personal Health Devices

PubMed Central

Do, Hyoungho

2018-01-01

Objectives Increasing use of medical devices outside of healthcare facilities inevitably requires connectivity and interoperability between medical devices and healthcare information systems. To this end, standards have been developed and used to provide interoperability between personal health devices (PHDs) and external systems. ISO/IEEE 11073 standards and IHE PCD-01 standard messages have been used the most in the exchange of observation data of health devices. Recently, transmitting observation data using the HL7 FHIR standard has been devised in the name of DoF (Devices on FHIR) and adopted very fast. We compare and analyze these standards and suggest that which standard will work best at the different environments of device usage. Methods We generated each message/resource of the three standards for observed vital signs from blood pressure monitor and thermometer. Then, the size, the contents, and the exchange processes of these messages are compared and analyzed. Results ISO/IEEE 11073 standard message has the smallest data size, but it has no ability to contain the key information, patient information. On the other hand, PCD-01 messages and FHIR standards have the fields for patient information. HL7 DoF standards provide reusing of information unit known as resource, and it is relatively easy to parse DoF messages since it uses widely known XML and JSON. Conclusions ISO/IEEE 11073 standards are suitable for devices having very small computing power. IHE PCD-01 and HL7 DoF messages can be used for the devices that need to be connected to hospital information systems that require patient information. When information reuse is frequent, DoF is advantageous over PCD-01. PMID:29503752

Comparison and Analysis of ISO/IEEE 11073, IHE PCD-01, and HL7 FHIR Messages for Personal Health Devices.

PubMed

Lee, Sungkee; Do, Hyoungho

2018-01-01

Increasing use of medical devices outside of healthcare facilities inevitably requires connectivity and interoperability between medical devices and healthcare information systems. To this end, standards have been developed and used to provide interoperability between personal health devices (PHDs) and external systems. ISO/IEEE 11073 standards and IHE PCD-01 standard messages have been used the most in the exchange of observation data of health devices. Recently, transmitting observation data using the HL7 FHIR standard has been devised in the name of DoF (Devices on FHIR) and adopted very fast. We compare and analyze these standards and suggest that which standard will work best at the different environments of device usage. We generated each message/resource of the three standards for observed vital signs from blood pressure monitor and thermometer. Then, the size, the contents, and the exchange processes of these messages are compared and analyzed. ISO/IEEE 11073 standard message has the smallest data size, but it has no ability to contain the key information, patient information. On the other hand, PCD-01 messages and FHIR standards have the fields for patient information. HL7 DoF standards provide reusing of information unit known as resource, and it is relatively easy to parse DoF messages since it uses widely known XML and JSON. ISO/IEEE 11073 standards are suitable for devices having very small computing power. IHE PCD-01 and HL7 DoF messages can be used for the devices that need to be connected to hospital information systems that require patient information. When information reuse is frequent, DoF is advantageous over PCD-01.

Multi-Target Single Cycle Instrument Placement

NASA Technical Reports Server (NTRS)

Pedersen, Liam; Smith, David E.; Deans, Matthew; Sargent, Randy; Kunz, Clay; Lees, David; Rajagopalan, Srikanth; Bualat, Maria

2005-01-01

This presentation is about the robotic exploration of Mars using multiple targets command cycle, safe instrument placements, safe operation, and K9 Rover which has a 6 wheel steer rocket-bogey chassis (FIDO, MER), 70% MER size, 1.2 GHz Pentium M laptop running Linux OS, Odometry and compass/inclinometer, CLARAty architecture, 5 DOF manipulator w/CHAMP microscopic camera, SciCams, NavCams and HazCams.

Sensor module design and forward and inverse kinematics analysis of 6-DOF sorting transferring robot

NASA Astrophysics Data System (ADS)

Zhou, Huiying; Lin, Jiajian; Liu, Lei; Tao, Meng

2017-09-01

To meet the demand of high strength express sorting, it is significant to design a robot with multiple degrees of freedom that can sort and transfer. This paper uses infrared sensor, color sensor and pressure sensor to receive external information, combine the plan of motion path in advance and the feedback information from the sensors, then write relevant program. In accordance with these, we can design a 6-DOF robot that can realize multi-angle seizing. In order to obtain characteristics of forward and inverse kinematics, this paper describes the coordinate directions and pose estimation by the D-H parameter method and closed solution. On the basis of the solution of forward and inverse kinematics, geometric parameters of links and link parameters are optimized in terms of application requirements. In this way, this robot can identify route, sort and transfer.

Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation.

PubMed

Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping

2009-11-01

DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

PubMed

Guo, Yong; Qiu, Li-Juan

2013-01-01

The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max). In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs) were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

Input Shaping enhanced Active Disturbance Rejection Control for a twin rotor multi-input multi-output system (TRMS).

PubMed

Yang, Xiaoyan; Cui, Jianwei; Lao, Dazhong; Li, Donghai; Chen, Junhui

2016-05-01

In this paper, a composite control based on Active Disturbance Rejection Control (ADRC) and Input Shaping is presented for TRMS with two degrees of freedom (DOF). The control tasks consist of accurately tracking desired trajectories and obtaining disturbance rejection in both horizontal and vertical planes. Due to un-measurable states as well as uncertainties stemming from modeling uncertainty and unknown disturbance torques, ADRC is employed, and feed-forward Input Shaping is used to improve the dynamical response. In the proposed approach, because the coupling effects are maintained in controller derivation, there is no requirement to decouple the TRMS into horizontal and vertical subsystems, which is usually performed in the literature. Finally, the proposed method is implemented on the TRMS platform, and the results are compared with those of PID and ADRC in a similar structure. The experimental results demonstrate the effectiveness of the proposed method. The operation of the controller allows for an excellent set-point tracking behavior and disturbance rejection with system nonlinearity and complex coupling conditions. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

Genome-Wide Screening and Characterization of the Dof Gene Family in Physic Nut (Jatropha curcas L.).

PubMed

Wang, Peipei; Li, Jing; Gao, Xiaoyang; Zhang, Di; Li, Anlin; Liu, Changning

2018-05-29

Physic nut ( Jatropha curcas L.) is a species of flowering plant with great potential for biofuel production and as an emerging model organism for functional genomic analysis, particularly in the Euphorbiaceae family. DNA binding with one finger (Dof) transcription factors play critical roles in numerous biological processes in plants. Nevertheless, the knowledge about members, and the evolutionary and functional characteristics of the Dof gene family in physic nut is insufficient. Therefore, we performed a genome-wide screening and characterization of the Dof gene family within the physic nut draft genome. In total, 24 JcDof genes (encoding 33 JcDof proteins) were identified. All the JcDof genes were divided into three major groups based on phylogenetic inference, which was further validated by the subsequent gene structure and motif analysis. Genome comparison revealed that segmental duplication may have played crucial roles in the expansion of the JcDof gene family, and gene expansion was mainly subjected to positive selection. The expression profile demonstrated the broad involvement of JcDof genes in response to various abiotic stresses, hormonal treatments and functional divergence. This study provides valuable information for better understanding the evolution of JcDof genes, and lays a foundation for future functional exploration of JcDof genes.

A novel sensor for two-degree-of-freedom motion measurement of linear nanopositioning stage using knife edge displacement sensing technique

NASA Astrophysics Data System (ADS)

Zolfaghari, Abolfazl; Jeon, Seongkyul; Stepanick, Christopher K.; Lee, ChaBum

2017-06-01

This paper presents a novel method for measuring two-degree-of-freedom (DOF) motion of flexure-based nanopositioning systems based on optical knife-edge sensing (OKES) technology, which utilizes the interference of two superimposed waves: a geometrical wave from the primary source of light and a boundary diffraction wave from the secondary source. This technique allows for two-DOF motion measurement of the linear and pitch motions of nanopositioning systems. Two capacitive sensors (CSs) are used for a baseline comparison with the proposed sensor by simultaneously measuring the motions of the nanopositioning system. The experimental results show that the proposed sensor closely agrees with the fundamental linear motion of the CS. However, the two-DOF OKES technology was shown to be approximately three times more sensitive to the pitch motion than the CS. The discrepancy in the two sensor outputs is discussed in terms of measuring principle, linearity, bandwidth, control effectiveness, and resolution.

Experimental verification of a novel MEMS multi-modal vibration energy harvester for ultra-low power remote sensing nodes

NASA Astrophysics Data System (ADS)

Iannacci, J.; Sordo, G.; Serra, E.; Kucera, M.; Schmid, U.

2015-05-01

In this work, we discuss the verification and preliminary experimental characterization of a MEMS-based vibration Energy Harvester (EH) design. The device, named Four-Leaf Clover (FLC), is based on a circular-shaped mechanical resonator with four petal-like mass-spring cascaded systems. This solution introduces several mechanical Degrees of Freedom (DOFs), and therefore enables multiple resonant modes and deformation shapes in the vibrations frequency range of interest. The target is to realize a wideband multi-modal EH-MEMS device, that overcomes the typical narrowband working characteristics of standard cantilevered EHs, by ensuring flexible and adaptable power source to ultra-low power electronics for integrated remote sensing nodes (e.g. Wireless Sensor Networks - WSNs) in the Internet of Things (IoT) scenario, aiming to self-powered and energy autonomous smart systems. Finite Element Method simulations of the FLC EH-MEMS show the presence of several resonant modes for vibrations up to 4-5 kHz, and level of converted power up to a few μW at resonance and in closed-loop conditions (i.e. with resistive load). On the other hand, the first experimental tests of FLC fabricated samples, conducted with a Laser Doppler Vibrometer (LDV), proved the presence of several resonant modes, and allowed to validate the accuracy of the FEM modeling method. Such a good accordance holds validity for what concerns the coupled field behavior of the FLC EH-MEMS, as well. Both measurements and simulations performed at 190 Hz (i.e. out of resonance) showed the generation of power in the range of nW (Root Mean Square - RMS values). Further steps of this work will include the experimental characterization in a full range of vibrations, aiming to prove the whole functionality of the FLC EH-MEMS proposed design concept.

Development of an Implantable Myoelectric Sensor for Advanced Prosthesis Control

PubMed Central

Merrill, Daniel R.; Lockhart, Joseph; Troyk, Phil R.; Weir, Richard F.; Hankin, David L.

2013-01-01

Modern hand and wrist prostheses afford a high level of mechanical sophistication, but the ability to control them in an intuitive and repeatable manner lags. Commercially available systems using surface electromyographic (EMG) or myoelectric control can supply at best two degrees of freedom (DOF), most often sequentially controlled. This limitation is partially due to the nature of surface-recorded EMG, for which the signal contains components from multiple muscle sources. We report here on the development of an implantable myoelectric sensor using EMG sensors that can be chronically implanted into an amputee’s residual muscles. Because sensing occurs at the source of muscle contraction, a single principal component of EMG is detected by each sensor, corresponding to intent to move a particular effector. This system can potentially provide independent signal sources for control of individual effectors within a limb prosthesis. The use of implanted devices supports inter-day signal repeatability. We report on efforts in preparation for human clinical trials, including animal testing, and a first-in-human proof of principle demonstration where the subject was able to intuitively and simultaneously control two DOF in a hand and wrist prosthesis. PMID:21371058

The servicing aid tool: A teleoperated robotics system for space applications

NASA Technical Reports Server (NTRS)

Dorman, Keith W.; Pullen, John L.; Keksz, William O.; Eismann, Paul H.; Kowalski, Keith A.; Karlen, James P.

1994-01-01

The Servicing Aid Tool (SAT) is a teleoperated, force-reflecting manipulation system designed for use on the Space Shuttle. The system will assist Extravehicular Activity (EVA) servicing of spacecraft such as the Hubble Space Telescope. The SAT stands out from other robotics development programs in that special attention was given to provide a low-cost, space-qualified design which can easily and inexpensively be reconfigured and/or enhanced through the addition of existing NASA funded technology as that technology matures. SAT components are spaceflight adaptations of existing ground-based designs from Robotics Research Corporation (RRC), the leading supplier of robotics systems to the NASA and university research community in the United States. Fairchild Space is the prime contractor and provides the control electronics, safety system, system integration, and qualification testing. The manipulator consists of a 6-DOF Slave Arm mounted on a 1-DOF Positioning Link in the shuttle payload bay. The Slave Arm is controlled via a highly similar, 6-DOF, force-reflecting Master Arm from Schilling Development, Inc. This work is being performed under contract to the Goddard Space Flight Center Code, Code 442, Hubble Space Telescope Flight Systems and Servicing Project.

Implementation of Kane's Method for a Spacecraft Composed of Multiple Rigid Bodies

NASA Technical Reports Server (NTRS)

Stoneking, Eric T.

2013-01-01

Equations of motion are derived for a general spacecraft composed of rigid bodies connected via rotary (spherical or gimballed) joints in a tree topology. Several supporting concepts are developed in depth. Basis dyads aid in the transition from basis-free vector equations to component-wise equations. Joint partials allow abstraction of 1-DOF, 2-DOF, 3-DOF gimballed and spherical rotational joints to a common notation. The basic building block consisting of an "inner" body and an "outer" body connected by a joint enables efficient organization of arbitrary tree structures. Kane's equation is recast in a form which facilitates systematic assembly of large systems of equations, and exposes a relationship of Kane's equation to Newton and Euler's equations which is obscured by the usual presentation. The resulting system of dynamic equations is of minimum dimension, and is suitable for numerical solution by computer. Implementation is ·discussed, and illustrative simulation results are presented.

Composite Material Testing Data Reduction to Adjust for the Systematic 6-DOF Testing Machine Aberrations

Treesearch

Athanasios lliopoulos; John G. Michopoulos; John G. C. Hermanson

2012-01-01

This paper describes a data reduction methodology for eliminating the systematic aberrations introduced by the unwanted behavior of a multiaxial testing machine, into the massive amounts of experimental data collected from testing of composite material coupons. The machine in reference is a custom made 6-DoF system called NRL66.3 and developed at the NAval...

Super Strypi HWIL 6DOF (Hardware-In-Loop six-degree-of-freedom) Rev. 2175

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilkey, Jeff C.; Harl, Nathan R.; Kowalchuk, Scott A.

2016-02-23

The Super Strypi HWIL is a six degree-of-freedom (6DOF) simulation for the Super Strypi Launch Vehicle. The simulation is used to test the NGC flight software including the navigation software. Aerodynamic and propulsive forces, mass properties, ACS (attitude control system) parameters are defined in input files. Output parameters are saved to a Matlab mat file.

Six-Degree-of-Freedom Trajectory Optimization Utilizing a Two-Timescale Collocation Architecture

NASA Technical Reports Server (NTRS)

Desai, Prasun N.; Conway, Bruce A.

2005-01-01

Six-degree-of-freedom (6DOF) trajectory optimization of a reentry vehicle is solved using a two-timescale collocation methodology. This class of 6DOF trajectory problems are characterized by two distinct timescales in their governing equations, where a subset of the states have high-frequency dynamics (the rotational equations of motion) while the remaining states (the translational equations of motion) vary comparatively slowly. With conventional collocation methods, the 6DOF problem size becomes extraordinarily large and difficult to solve. Utilizing the two-timescale collocation architecture, the problem size is reduced significantly. The converged solution shows a realistic landing profile and captures the appropriate high-frequency rotational dynamics. A large reduction in the overall problem size (by 55%) is attained with the two-timescale architecture as compared to the conventional single-timescale collocation method. Consequently, optimum 6DOF trajectory problems can now be solved efficiently using collocation, which was not previously possible for a system with two distinct timescales in the governing states.

Non-Parametric Blur Map Regression for Depth of Field Extension.

PubMed

D'Andres, Laurent; Salvador, Jordi; Kochale, Axel; Susstrunk, Sabine

2016-04-01

Real camera systems have a limited depth of field (DOF) which may cause an image to be degraded due to visible misfocus or too shallow DOF. In this paper, we present a blind deblurring pipeline able to restore such images by slightly extending their DOF and recovering sharpness in regions slightly out of focus. To address this severely ill-posed problem, our algorithm relies first on the estimation of the spatially varying defocus blur. Drawing on local frequency image features, a machine learning approach based on the recently introduced regression tree fields is used to train a model able to regress a coherent defocus blur map of the image, labeling each pixel by the scale of a defocus point spread function. A non-blind spatially varying deblurring algorithm is then used to properly extend the DOF of the image. The good performance of our algorithm is assessed both quantitatively, using realistic ground truth data obtained with a novel approach based on a plenoptic camera, and qualitatively with real images.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Unseren, M.A.

This report proposes a method for resolving the kinematic redundancy of a serial link manipulator moving in a three-dimensional workspace. The underspecified problem of solving for the joint velocities based on the classical kinematic velocity model is transformed into a well-specified problem. This is accomplished by augmenting the original model with additional equations which relate a new vector variable quantifying the redundant degrees of freedom (DOF) to the joint velocities. The resulting augmented system yields a well specified solution for the joint velocities. Methods for selecting the redundant DOF quantifying variable and the transformation matrix relating it to the jointmore » velocities are presented so as to obtain a minimum Euclidean norm solution for the joint velocities. The approach is also applied to the problem of resolving the kinematic redundancy at the acceleration level. Upon resolving the kinematic redundancy, a rigid body dynamical model governing the gross motion of the manipulator is derived. A control architecture is suggested which according to the model, decouples the Cartesian space DOF and the redundant DOF.« less

State-space control of prosthetic hand shape.

PubMed

Velliste, M; McMorland, A J C; Diril, E; Clanton, S T; Schwartz, A B

2012-01-01

In the field of neuroprosthetic control, there is an emerging need for simplified control of high-dimensional devices. Advances in robotic technology have led to the development of prosthetic arms that now approach the look and number of degrees of freedom (DoF) of a natural arm. These arms, and especially hands, now have more controllable DoFs than the number of control DoFs available in many applications. In natural movements, high correlations exist between multiple joints, such as finger flexions. Therefore, discrepancy between the number of control and effector DoFs can be overcome by a control scheme that maps low-DoF control space to high-DoF joint space. Imperfect effectors, sensor noise and interactions with external objects require the use of feedback controllers. The incorporation of feedback in a system where the command is in a different space, however, is challenging, requiring a potentially difficult inverse high-DoF to low-DoF transformation. Here we present a solution to this problem based on the Extended Kalman Filter.

Towards frameless maskless SRS through real-time 6DoF robotic motion compensation

NASA Astrophysics Data System (ADS)

Belcher, Andrew H.; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D.

2017-12-01

Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient’s skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system’s effectiveness in maintaining the target’s 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system’s effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system’s success with volunteers has demonstrated its capability for implementation with frameless and maskless SRS treatments, potentially able to achieve the same or better treatment accuracies compared to traditional frame-based approaches.

Design of a nonlinear torsional vibration absorber

NASA Astrophysics Data System (ADS)

Tahir, Ammaar Bin

Tuned mass dampers (TMD) utilizing linear spring mechanisms to mitigate destructive vibrations are commonly used in practice. A TMD is usually tuned for a specific resonant frequency or an operating frequency of a system. Recently, nonlinear vibration absorbers attracted attention of researchers due to some potential advantages they possess over the TMDs. The nonlinear vibration absorber, or the nonlinear energy sink (NES), has an advantage of being effective over a broad range of excitation frequencies, which makes it more suitable for systems with several resonant frequencies, or for a system with varying excitation frequency. Vibration dissipation mechanism in an NES is passive and ensures that there is no energy backflow to the primary system. In this study, an experimental setup of a rotational system has been designed for validation of the concept of nonlinear torsional vibration absorber with geometrically induced cubic stiffness nonlinearity. Dimensions of the primary system have been optimized so as to get the first natural frequency of the system to be fairly low. This was done in order to excite the dynamic system for torsional vibration response by the available motor. Experiments have been performed to obtain the modal parameters of the system. Based on the obtained modal parameters, the design optimization of the nonlinear torsional vibration absorber was carried out using an equivalent 2-DOF modal model. The optimality criterion was chosen to be maximization of energy dissipation in the nonlinear absorber attached to the equivalent 2-DOF system. The optimized design parameters of the nonlinear absorber were tested on the original 5-DOF system numerically. A comparison was made between the performance of linear and nonlinear absorbers using the numerical models. The comparison showed the superiority of the nonlinear absorber over its linear counterpart for the given set of primary system parameters as the vibration energy dissipation in the former is larger than that in the latter. A nonlinear absorber design has been proposed comprising of thin beams as elastic elements. The geometric configuration of the proposed design has been shown to provide cubic stiffness nonlinearity in torsion. The values of design variables, namely the strength of nonlinearity alpha and torsional stiffness kalpha, were obtained by optimizing dimensions and material properties of the beams for a maximum vibration energy dissipation in the nonlinear absorber. A parametric study has also been conducted to analyze the effect of the magnitude of excitation provided to the system on the performance of a nonlinear absorber. It has been shown that the nonlinear absorber turns out to be more effective in terms of energy dissipation as compared to a linear absorber with an increase in the excitation level applied to the system.

A shuttle and space station manipulator system for assembly, docking, maintenance cargo handling and spacecraft retrieval (preliminary design). Volume 1: Management summary

NASA Technical Reports Server (NTRS)

1972-01-01

A preliminary design is established for a general purpose manipulator system which can be used interchangeably on the shuttle and station and can be transferred back and forth between them. Control of the manipulator is accomplished by hard wiring from internal control stations in the shuttle or station. A variety of shuttle and station manipulator operations are considered including servicing the Large Space Telescope; however, emphasis is placed on unloading modules from the shuttle and assembling the space station. Simulation studies on foveal stereoscopic viewing and manipulator supervisory computer control have been accomplished to investigate the feasibility of their use in the manipulator system. The basic manipulator system consists of a single 18.3 m long, 7 degree of freedom (DOF), electrically acutated main boom with an auxiliary 3 DOF electrically actuated, extendible 18.3 m maximum length, lighting, and viewing boom. A 3 DOF orientor assembly is located at the tip of the viewing boom to provide camera pan, tilt, and roll.

A novel robotic platform for single-port abdominal surgery

NASA Astrophysics Data System (ADS)

Singh, Satwinder; Cheung, Jo L. K.; Sreedhar, Biji; Hoa, Xuyen Dai; Ng, Hoi Pang; Yeung, Chung Kwong

2018-03-01

In this paper, a novel robot-assisted platform for single-port minimally invasive surgery is presented. A miniaturized seven degrees of freedom (dof) fully internalized in-vivo actuated robotic arm is designed. Due to in-vivo actuation, the system has a smaller footprint and can generate 20 N of gripping force. The complete work envelop of the robotic arms is 252 mm × 192 mm × 322 m. With the assistance of the cannula-swivel system, the robotic arms can also be re-positioned and have multi-quadrant reachability without any additional incision. Surgical tasks, such as lifting, gripping suturing and knot tying that are commonly used in a standard surgical procedure, were performed to verify the dexterity of the robotic arms. A single-port trans-abdominal cholecystectomy in a porcine model was successfully performed to further validate its functionality.

A Multi-Sensor Fusion MAV State Estimation from Long-Range Stereo, IMU, GPS and Barometric Sensors.

PubMed

Song, Yu; Nuske, Stephen; Scherer, Sebastian

2016-12-22

State estimation is the most critical capability for MAV (Micro-Aerial Vehicle) localization, autonomous obstacle avoidance, robust flight control and 3D environmental mapping. There are three main challenges for MAV state estimation: (1) it can deal with aggressive 6 DOF (Degree Of Freedom) motion; (2) it should be robust to intermittent GPS (Global Positioning System) (even GPS-denied) situations; (3) it should work well both for low- and high-altitude flight. In this paper, we present a state estimation technique by fusing long-range stereo visual odometry, GPS, barometric and IMU (Inertial Measurement Unit) measurements. The new estimation system has two main parts, a stochastic cloning EKF (Extended Kalman Filter) estimator that loosely fuses both absolute state measurements (GPS, barometer) and the relative state measurements (IMU, visual odometry), and is derived and discussed in detail. A long-range stereo visual odometry is proposed for high-altitude MAV odometry calculation by using both multi-view stereo triangulation and a multi-view stereo inverse depth filter. The odometry takes the EKF information (IMU integral) for robust camera pose tracking and image feature matching, and the stereo odometry output serves as the relative measurements for the update of the state estimation. Experimental results on a benchmark dataset and our real flight dataset show the effectiveness of the proposed state estimation system, especially for the aggressive, intermittent GPS and high-altitude MAV flight.

Simultaneous and Continuous Estimation of Shoulder and Elbow Kinematics from Surface EMG Signals

PubMed Central

Zhang, Qin; Liu, Runfeng; Chen, Wenbin; Xiong, Caihua

2017-01-01

In this paper, we present a simultaneous and continuous kinematics estimation method for multiple DoFs across shoulder and elbow joint. Although simultaneous and continuous kinematics estimation from surface electromyography (EMG) is a feasible way to achieve natural and intuitive human-machine interaction, few works investigated multi-DoF estimation across the significant joints of upper limb, shoulder and elbow joints. This paper evaluates the feasibility to estimate 4-DoF kinematics at shoulder and elbow during coordinated arm movements. Considering the potential applications of this method in exoskeleton, prosthetics and other arm rehabilitation techniques, the estimation performance is presented with different muscle activity decomposition and learning strategies. Principle component analysis (PCA) and independent component analysis (ICA) are respectively employed for EMG mode decomposition with artificial neural network (ANN) for learning the electromechanical association. Four joint angles across shoulder and elbow are simultaneously and continuously estimated from EMG in four coordinated arm movements. By using ICA (PCA) and single ANN, the average estimation accuracy 91.12% (90.23%) is obtained in 70-s intra-cross validation and 87.00% (86.30%) is obtained in 2-min inter-cross validation. This result suggests it is feasible and effective to use ICA (PCA) with single ANN for multi-joint kinematics estimation in variant application conditions. PMID:28611573

Compliant-linkage kinematic design for multi-degree-of-freedom mobile robots

NASA Astrophysics Data System (ADS)

Borenstein, Johann

1993-05-01

Multi-degree-of-freedom (MDOF) vehicles have many potential advantages over conventional (i.e., 2-DOF) vehicles. For example, MDOF vehicles can travel sideways and they can negotiate tight turns more easily. In addition, some MDOF designs provide better payload capability, better traction, and improved static and dynamic stability. However, MDOF vehicles with more than three degrees-of-freedom are difficult to control because of their overconstrained nature. These difficulties translate into severe wheel slippage or jerky motion under certain driving conditions. In the past, these problems limited the use of MDOF vehicles to applications where the vehicle would follow a guide-wire, which would correct wheel slippage and control errors. By contrast, autonomous or semi-autonomous mobile robots usually rely on dead-reckoning between periodic absolute position updates and their performance is diminished by excessive wheel slippage. This paper introduces a new concept in the kinematic design of MDOF vehicles. This concept is based on the provision of a compliant linkage between drive wheels or drive axles. Simulation results indicate that compliant linkage allows to overcome the control problems found in conventional MDOF vehicles and reduces the amount of wheel slippage to the same level (or less) than the amount of slippage found on a comparable 2-DOF vehicle.

A ring-type multi-DOF ultrasonic motor with four feet driving consistently.

PubMed

Shi, Shengjun; Xiong, Huaiyin; Liu, Yingxiang; Chen, Weishan; Liu, Junkao

2017-04-01

A new type of multiple-degree-of-freedom (multi-DOF) ultrasonic motor was developed aiming at high output torque and compact structure. To reach this purpose, a ring type composite stator was proposed with four driving feet uniformly arranged in the inner circumference of the ring stator. The stator employs two orthogonal axial bending modes and a radial bending mode, by exciting two of them simultaneously, to generate elliptic trajectories on driving feet tips and to push sphere rotor around x, y and z axis respectively. Based on the deduced criteria, a specific combination of the A(0,5) axial bending modes and R(0,2) radial bending mode were chosen to realize that the rotating directions of the elliptical driving trajectories on four feet tips can push the sphere rotor to spin in the same direction consistently, thus the efficiency and output performance will be improved by decreasing the slip between feet and rotor. FEM was used to design the motor including selecting key parameters to tune the resonant frequencies by sensitivity analysis, and a prototype was fabricated and tested. The experiment results showed that the maximum output torque of the motor is 0.118Nm and the maximum speed is 55r/min. Copyright © 2017 Elsevier B.V. All rights reserved.

A eutectic-alloy-infused soft actuator with sensing, tunable degrees of freedom, and stiffness properties

NASA Astrophysics Data System (ADS)

Hao, Yufei; Wang, Tianmiao; Xie, Zhexin; Sun, Wenguang; Liu, Zemin; Fang, Xi; Yang, Minxuan; Wen, Li

2018-02-01

This paper presents a soft actuator embedded with two types of eutectic alloys which enable sensing, tunable mechanical degrees of freedom (DOF), and variable stiffness properties. To modulate the stiffness of the actuator, we embedded a low melting point alloy (LMPA) in the bottom portion of the soft actuator. Different sections of the LMPA could be selectively melted by the Ni-Cr wires twined underneath. To acquire the curvature information, EGaIn (eutectic gallium indium) was infused into a microchannel surrounding the chambers of the soft actuator. Systematic experiments were performed to characterize the stiffness, tunable DOF, and sensing the bending curvature. We found that the average bending force and elasticity modulus could be increased about 35 and 4000 times, respectively, with the LMPA in a solid state. The entire LMPA could be melted from a solid to a liquid state within 12 s. In particular, up to six different motion patterns could be achieved under each pneumatic pressure of the soft actuator. Furthermore, the kinematics of the actuator under different motion patterns could be obtained by a mathematical model whose input was provided by the EGaIn sensor. For demonstration purposes, a two-fingered gripper was fabricated to grasp various objects by adjusting the DOF and mechanical stiffness.

X-33 Ascent Flight Controller Design by Trajectory Linearization: A Singular Perturbational Approach

NASA Technical Reports Server (NTRS)

Zhu, J. Jim; Banker, Brad D.; Hall, Charles E.

2000-01-01

The flight control of X-33 poses a challenge to conventional gain-scheduled flight controllers due to its large attitude maneuvers from liftoff to orbit and reentry. In addition, a wide range of uncertainties in vehicle handling qualities and disturbances must be accommodated by the attitude control system. Nonlinear tracking and decoupling control by trajectory linearization can be viewed as the ideal gain-scheduling controller designed at every point on the flight trajectory. Therefore it provides robust stability and performance at all stages of flight without interpolation of controller gains and eliminates costly controller redesigns due to minor airframe alteration or mission reconfiguration. In this paper, a prototype trajectory linearization design for an X-33 ascent flight controller is presented along with 3-DOF and 6-DOF simulation results. It is noted that the 6-DOF results were obtained from the 3-DOF design with only a few hours of tuning, which demonstrates the inherent robustness of the design technique. It is this "plug-and-play" feature that is much needed by NASA for the development, test and routine operations of the RLV'S. Plans for further research are also presented, and refined 6-DOF simulation results will be presented in the final version of the paper.

Functional insights into the late embryogenesis abundant (LEA) protein family from Dendrobium officinale (Orchidaceae) using an Escherichia coli system

PubMed Central

Ling, Hong; Zeng, Xu; Guo, Shunxing

2016-01-01

Late embryogenesis abundant (LEA) proteins, a diverse family, accumulate during seed desiccation in the later stages of embryogenesis. LEA proteins are associated with tolerance to abiotic stresses, such as drought, salinity and high or cold temperature. Here, we report the first comprehensive survey of the LEA gene family in Dendrobium officinale, an important and widely grown medicinal orchid in China. Based on phylogenetic relationships with the complete set of Arabidopsis and Oryza LEA proteins, 17 genes encoding D. officinale LEAs (DofLEAs) were identified and their deduced proteins were classified into seven groups. The motif composition of these deduced proteins was correlated with the gene structure found in each LEA group. Our results reveal the DofLEA genes are widely distributed and expressed in tissues. Additionally, 11 genes from different groups were introduced into Escherichia coli to assess the functions of DofLEAs. Expression of 6 and 7 DofLEAs in E. coli improved growth performance compared with the control under salt and heat stress, respectively. Based on qPCR data, all of these genes were up-regulated in various tissues following exposure to salt and heat stresses. Our results suggest that DofLEAs play an important role in responses to abiotic stress. PMID:28004781

Hand rehabilitation after stroke using a wearable, high DOF, spring powered exoskeleton.

PubMed

Tianyao Chen; Lum, Peter S

2016-08-01

Stroke patients often have inappropriate finger flexor activation and finger extensor weakness, which makes it difficult to open their affected hand for functional grasp. The goal was to develop a passive, lightweight, wearable device to enable improved hand function during performance of activities of daily living. The device, HandSOME II, assists with opening the patient's hand using 11 elastic actuators that apply extension torques to finger and thumb joints. Device design and initial testing are described. A novel mechanical design applies forces orthogonal to the finger segments despite the fact that all of the device DOFs are not aligned with human joint DOF. In initial testing with seven stroke subjects with impaired hand function, use of HandSOME II significantly increased maximum extension angles and range of motion in all of the index finger joints (P<;0.05). HandSOME II allows performance of all the grip patterns used in daily activities and can be used as part of home-based therapy programs.

Looped back fiber mode for reduction of false alarm in leak detection using distributed optical fiber sensor.

PubMed

Chelliah, Pandian; Murgesan, Kasinathan; Samvel, Sosamma; Chelamchala, Babu Rao; Tammana, Jayakumar; Nagarajan, Murali; Raj, Baldev

2010-07-10

Optical-fiber-based sensors have inherent advantages, such as immunity to electromagnetic interference, compared to the conventional sensors. Distributed optical fiber sensor (DOFS) systems, such as Raman and Brillouin distributed temperature sensors are used for leak detection. The inherent noise of fiber-based systems leads to occasional false alarms. In this paper, a methodology is proposed to overcome this. This uses a looped back fiber mode in DOFS and voting logic is employed to considerably reduce the false alarm rate.

Genome wide in silico characterization of Dof gene families of pigeonpea (Cajanus cajan (L) Millsp.).

PubMed

Malviya, N; Gupta, S; Singh, V K; Yadav, M K; Bisht, N C; Sarangi, B K; Yadav, D

2015-02-01

The DNA binding with One Finger (Dof) protein is a plant specific transcription factor involved in the regulation of wide range of processes. The analysis of whole genome sequence of pigeonpea has identified 38 putative Dof genes (CcDof) distributed on 8 chromosomes. A total of 17 out of 38 CcDof genes were found to be intronless. A comprehensive in silico characterization of CcDof gene family including the gene structure, chromosome location, protein motif, phylogeny, gene duplication and functional divergence has been attempted. The phylogenetic analysis resulted in 3 major clusters with closely related members in phylogenetic tree revealed common motif distribution. The in silico cis-regulatory element analysis revealed functional diversity with predominance of light responsive and stress responsive elements indicating the possibility of these CcDof genes to be associated with photoperiodic control and biotic and abiotic stress. The duplication pattern showed that tandem duplication is predominant over segmental duplication events. The comparative phylogenetic analysis of these Dof proteins along with 78 soybean, 36 Arabidopsis and 30 rice Dof proteins revealed 7 major clusters. Several groups of orthologs and paralogs were identified based on phylogenetic tree constructed. Our study provides useful information for functional characterization of CcDof genes.

Designs for optimizing depth of focus and spot size for UV laser ablation

NASA Astrophysics Data System (ADS)

Wei, An-Chi; Sze, Jyh-Rou; Chern, Jyh-Long

2010-11-01

The proposed optical systems are designed for extending the depths of foci (DOF) of UV lasers, which can be exploited in the laser-ablation technologies, such as laser machining and lithography. The designed systems are commonly constructed by an optical module that has at least one aspherical surface. Two configurations of optical module, lens-only and lens-reflector, are presented with the designs of 2-lens and 1-lens-1-reflector demonstrated by commercially optical software. Compared with conventional DOF-enhanced systems, which required the chromatic aberration lenses and the light sources with multiple wavelengths, the proposed designs are adapted to the single-wavelength systems, leading to more economical and efficient systems.

A structurally decoupled mechanism for measuring wrist torque in three degrees of freedom

NASA Astrophysics Data System (ADS)

Pan, Lizhi; Yang, Zhen; Zhang, Dingguo

2015-10-01

The wrist joint is a critical part of the human body for movement. Measuring the torque of the wrist with three degrees of freedom (DOFs) is important in some fields, including rehabilitation, biomechanics, ergonomics, and human-machine interfacing. However, the particular structure of the wrist joint makes it difficult to measure the torque in all three directions simultaneously. This work develops a structurally decoupled instrument for measuring and improving the measurement accuracy of 3-DOF wrist torque during isometric contraction. Three single-axis torque sensors were embedded in a customized mechanical structure. The dimensions and components of the instrument were designed based on requirement of manufacturability. A prototype of the instrument was machined, assembled, integrated, and tested. The results show that the structurally decoupled mechanism is feasible for acquiring wrist torque data in three directions either independently or simultaneously. As a case study, we use the device to measure wrist torques concurrently with electromyography signal acquisition in preparation for simultaneous and proportional myoelectric control of prostheses.

A structurally decoupled mechanism for measuring wrist torque in three degrees of freedom.

PubMed

Pan, Lizhi; Yang, Zhen; Zhang, Dingguo

2015-10-01

The wrist joint is a critical part of the human body for movement. Measuring the torque of the wrist with three degrees of freedom (DOFs) is important in some fields, including rehabilitation, biomechanics, ergonomics, and human-machine interfacing. However, the particular structure of the wrist joint makes it difficult to measure the torque in all three directions simultaneously. This work develops a structurally decoupled instrument for measuring and improving the measurement accuracy of 3-DOF wrist torque during isometric contraction. Three single-axis torque sensors were embedded in a customized mechanical structure. The dimensions and components of the instrument were designed based on requirement of manufacturability. A prototype of the instrument was machined, assembled, integrated, and tested. The results show that the structurally decoupled mechanism is feasible for acquiring wrist torque data in three directions either independently or simultaneously. As a case study, we use the device to measure wrist torques concurrently with electromyography signal acquisition in preparation for simultaneous and proportional myoelectric control of prostheses.

The banana fruit Dof transcription factor MaDof23 acts as a repressor and interacts with MaERF9 in regulating ripening-related genes

PubMed Central

Feng, Bi-hong; Han, Yan-chao; Xiao, Yun-yi; Kuang, Jian-fei; Fan, Zhong-qi; Chen, Jian-ye; Lu, Wang-jin

2016-01-01

The DNA binding with one finger (Dof) proteins, a family of plant-specific transcription factors, are involved in a variety of plant biological processes. However, little information is available on their involvement in fruit ripening. We have characterized 25 MaDof genes from banana fruit (Musa acuminata), designated as MaDof1–MaDof25. Gene expression analysis in fruit subjected to different ripening conditions revealed that MaDofs were differentially expressed during different stages of ripening. MaDof10, 23, 24, and 25 were ethylene-inducible and nuclear-localized, and their transcript levels increased during fruit ripening. Moreover, yeast two-hybrid and bimolecular fluorescence complementation analyses demonstrated a physical interaction between MaDof23 and MaERF9, a potential regulator of fruit ripening reported in a previous study. We determined that MaDof23 is a transcriptional repressor, whereas MaERF9 is a transcriptional activator. We suggest that they might act antagonistically in regulating 10 ripening-related genes, including MaEXP1/2/3/5, MaXET7, MaPG1, MaPME3, MaPL2, MaCAT, and MaPDC, which are associated with cell wall degradation and aroma formation. Taken together, our findings provide new insight into the transcriptional regulation network controlling banana fruit ripening. PMID:26889012

Exoskeletal meal assistance system (EMAS II) for progressive muscle dystrophy patient.

PubMed

Hasegawa, Yasuhisa; Oura, Saori

2011-01-01

This paper introduces a 4-DOFs exoskeletal meal assistance system (EMAS II) for progressive muscle dystrophy patient. It is generally better for the patient to use his/her hands by himself in daily life because active works maintain level of residual functions, health and initiative of him/her. The EMAS II that has a new joystick-type user interface device and three-DOFs on a shoulder part is enhanced for an easier operation and more comfortable support on eating, as the succeeding model of the previous system that has two-DOFs on a shoulder. In order to control the 4-DOFs system by the simple user interface device, the EMAS II simulates upper limb motion patterns of a healthy person. The motion patterns are modeled by extracting correlations between the height of a user's wrist joint and that of the user's elbow joint at the table. Moreover, the EMAS II automatically brings user's hand up to his/her mouth or back to a table when he/she pushes a preset switch on the interface device. Therefore a user has only to control a position of his/her wrist to pick or scoop foods and then flip the switch to start automatic mode, while a height of the elbow joint is automatically controlled by the EMAS II itself. The results of experiments, where a healthy subject regarded as a muscle dystrophy patient eats a meal with EMAS II, show that the subject finished her meal in a natural way in 18 minutes 40 seconds which was within a recommended time of 30 minutes. © 2011 IEEE

Self-recognition mechanism between skin and suckers prevents octopus arms from interfering with each other.

PubMed

Nesher, Nir; Levy, Guy; Grasso, Frank W; Hochner, Binyamin

2014-06-02

Controlling movements of flexible arms is a challenging task for the octopus because of the virtually infinite number of degrees of freedom (DOFs) [1, 2]. Octopuses simplify this control by using stereotypical motion patterns that reduce the DOFs, in the control space, to a workable few [2]. These movements are triggered by the brain and are generated by motor programs embedded in the peripheral neuromuscular system of the arm [3-5]. The hundreds of suckers along each arm have a tendency to stick to almost any object they contact [6-9]. The existence of this reflex could pose significant problems with unplanned interactions between the arms if not appropriately managed. This problem is likely to be accentuated because it is accepted that octopuses are "not aware of their arms" [10-14]. Here we report of a self-recognition mechanism that has a novel role in motor control, restraining the arms from interfering with each other. We show that the suckers of amputated arms never attach to octopus skin because a chemical in the skin inhibits the attachment reflex of the suckers. The peripheral mechanism appears to be overridden by central control because, in contrast to amputated arms, behaving octopuses sometime grab amputated arms. Surprisingly, octopuses seem to identify their own amputated arms, as they treat arms of other octopuses like food more often than their own. This self-recognition mechanism is a novel peripheral component in the embodied organization of the adaptive interactions between the octopus's brain, body, and environment [15, 16]. Copyright © 2014 Elsevier Ltd. All rights reserved.

Design of a 7-DOF slave robot integrated with a magneto-rheological haptic master

NASA Astrophysics Data System (ADS)

Hwang, Yong-Hoon; Cha, Seung-Woo; Kang, Seok-Rae; Choi, Seung-Bok

2017-04-01

In this study, a 7-DOF slave robot integrated with the haptic master is designed and its dynamic motion is controlled. The haptic master is made using a controllable magneto-rheological (MR) clutch and brake and it provides the surgeon with a sense of touch by using both kinetic and kinesthetic information. Due to the size constraint of the slave robot, a wire actuating is adopted to make the desired motion of the end-effector which has 3-DOF instead of a conventional direct-driven motor. Another motions of the link parts that have 4-DOF use direct-driven motor. In total system, for working as a haptic device, the haptic master need to receive the information of repulsive forces applied on the slave robot. Therefore, repulsive forces on the end-effector are sensed by using three uniaxial torque transducer inserted in the wire actuating system and another repulsive forces applied on link part are sensed by using 6-axis transducer that is able to sense forces and torques. Using another 6-axis transducer, verify the reliability of force information on final end of slave robot. Lastly, integrated with a MR haptic master, psycho-physical test is conducted by different operators who can feel the different repulsive force or torque generated from the haptic master which is equivalent to the force or torque occurred on the end-effector to demonstrate the effectiveness of the proposed system.

[A gearing mechanism with 4 degrees of freedom for robotic applications in medicine].

PubMed

Pott, P; Weiser, P; Scharf, H P; Schwarz, M

2004-06-01

Applications in robot-aided surgery are currently based on modifications of manipulators used in industrial manufacturing processes. In this paper we describe novel rotatory kinematics for a manipulator, specially developed for deployment in robot-aided surgery. The construction of the gearing mechanism used for the positioning and orientation of a linkage point is described. Forward and inverse kinematics were calculated, and a constructive solution proposed. The gearing mechanism is based on two disk systems, each of which consists of two opposing rotatable discs. The construction was designed in such a way that the linkage point can be positioned freely anywhere within the mechanism's range of motion. The kinematics thus permits an x-y-positioning via rotating movements only. The spatial arrangement of two of such disc systems permits movements in four degrees of freedom (DOF). The construction is compact, but can be further miniaturized, is flexible and manufacturing costs are low. On the basis of this mechanical concept a new, small automated manipulator for surgical application will be developed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Hailong; Vibration Control Lab, School of Electrical and Automation Engineering, Nanjing Normal University, Nanjing 210042; Zhang, Ning

Magneto-rheological (MR) damper possesses inherent hysteretic characteristics. We investigate the resulting nonlinear behaviors of a two degree-of-freedom (2-DoF) MR vibration isolation system under harmonic external excitation. A MR damper is identified by employing the modified Bouc-wen hysteresis model. By numerical simulation, we characterize the nonlinear dynamic evolution of period-doubling, saddle node bifurcating and inverse period-doubling using bifurcation diagrams of variations in frequency with a fixed amplitude of the harmonic excitation. The strength of chaos is determined by the Lyapunov exponent (LE) spectrum. Semi-physical experiment on the 2-DoF MR vibration isolation system is proposed. We trace the time history and phasemore » trajectory under certain values of frequency of the harmonic excitation to verify the nonlinear dynamical evolution of period-doubling bifurcations to chaos. The largest LEs computed with the experimental data are also presented, confirming the chaotic motion in the experiment. We validate the chaotic motion caused by the hysteresis of the MR damper, and show the transitions between distinct regimes of stable motion and chaotic motion of the 2-DoF MR vibration isolation system for variations in frequency of external excitation.« less

Input relegation control for gross motion of a kinematically redundant manipulator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Unseren, M.A.

1992-10-01

This report proposes a method for resolving the kinematic redundancy of a serial link manipulator moving in a three-dimensional workspace. The underspecified problem of solving for the joint velocities based on the classical kinematic velocity model is transformed into a well-specified problem. This is accomplished by augmenting the original model with additional equations which relate a new vector variable quantifying the redundant degrees of freedom (DOF) to the joint velocities. The resulting augmented system yields a well specified solution for the joint velocities. Methods for selecting the redundant DOF quantifying variable and the transformation matrix relating it to the jointmore » velocities are presented so as to obtain a minimum Euclidean norm solution for the joint velocities. The approach is also applied to the problem of resolving the kinematic redundancy at the acceleration level. Upon resolving the kinematic redundancy, a rigid body dynamical model governing the gross motion of the manipulator is derived. A control architecture is suggested which according to the model, decouples the Cartesian space DOF and the redundant DOF.« less

Fuzzy logic control of telerobot manipulators

NASA Technical Reports Server (NTRS)

Franke, Ernest A.; Nedungadi, Ashok

1992-01-01

Telerobot systems for advanced applications will require manipulators with redundant 'degrees of freedom' (DOF) that are capable of adapting manipulator configurations to avoid obstacles while achieving the user specified goal. Conventional methods for control of manipulators (based on solution of the inverse kinematics) cannot be easily extended to these situations. Fuzzy logic control offers a possible solution to these needs. A current research program at SRI developed a fuzzy logic controller for a redundant, 4 DOF, planar manipulator. The manipulator end point trajectory can be specified by either a computer program (robot mode) or by manual input (teleoperator). The approach used expresses end-point error and the location of manipulator joints as fuzzy variables. Joint motions are determined by a fuzzy rule set without requiring solution of the inverse kinematics. Additional rules for sensor data, obstacle avoidance and preferred manipulator configuration, e.g., 'righty' or 'lefty', are easily accommodated. The procedure used to generate the fuzzy rules can be extended to higher DOF systems.

Degree-of-Freedom Strengthened Cascade Array for DOD-DOA Estimation in MIMO Array Systems.

PubMed

Yao, Bobin; Dong, Zhi; Zhang, Weile; Wang, Wei; Wu, Qisheng

2018-05-14

In spatial spectrum estimation, difference co-array can provide extra degrees-of-freedom (DOFs) for promoting parameter identifiability and parameter estimation accuracy. For the sake of acquiring as more DOFs as possible with a given number of physical sensors, we herein design a novel sensor array geometry named cascade array. This structure is generated by systematically connecting a uniform linear array (ULA) and a non-uniform linear array, and can provide more DOFs than some exist array structures but less than the upper-bound indicated by minimum redundant array (MRA). We further apply this cascade array into multiple input multiple output (MIMO) array systems, and propose a novel joint direction of departure (DOD) and direction of arrival (DOA) estimation algorithm, which is based on a reduced-dimensional weighted subspace fitting technique. The algorithm is angle auto-paired and computationally efficient. Theoretical analysis and numerical simulations prove the advantages and effectiveness of the proposed array structure and the related algorithm.

[Mechatronic in functional endoscopic sinus surgery. First experiences with the daVinci Telemanipulatory System].

PubMed

Strauss, G; Winkler, D; Jacobs, S; Trantakis, C; Dietz, A; Bootz, F; Meixensberger, J; Falk, V

2005-07-01

This study examines the advantages and disadvantages of a commercial telemanipulator system (daVinci, Intuitive Surgical, USA) with computer-guided instruments in functional endoscopic sinus surgery (FESS). We performed five different surgical FESS steps on 14 anatomical preparation and compared them with conventional FESS. A total of 140 procedures were examined taking into account the following parameters: degrees of freedom (DOF), duration , learning curve, force feedback, human-machine-interface. Telemanipulatory instruments have more DOF available then conventional instrumentation in FESS. The average time consumed by configuration of the telemanipulator is around 9+/-2 min. Missing force feedback is evaluated mainly as a disadvantage of the telemanipulator. Scaling was evaluated as helpful. The ergonomic concept seems to be better than the conventional solution. Computer guided instruments showed better results for the available DOF of the instruments. The human-machine-interface is more adaptable and variable then in conventional instrumentation. Motion scaling and indexing are characteristics of the telemanipulator concept which are helpful for FESS in our study.

Comparative study of lossy and lossless data compression in distributed optical fiber sensing systems

NASA Astrophysics Data System (ADS)

Atubga, David; Wu, Huijuan; Lu, Lidong; Sun, Xiaoyan

2017-02-01

Typical fully distributed optical fiber sensors (DOFS) with dozens of kilometers are equivalent to tens of thousands of point sensors along the whole monitoring line, which means tens of thousands of data will be generated for one pulse launching period. Therefore, in an all-day nonstop monitoring, large volumes of data are created thereby triggering the demand for large storage space and high speed for data transmission. In addition, when the monitoring length and channel numbers increase, the data also increase extensively. The task of mitigating large volumes of data accumulation, large storage capacity, and high-speed data transmission is, therefore, the aim of this paper. To demonstrate our idea, we carried out a comparative study of two lossless methods, Huffman and Lempel Ziv Welch (LZW), with a lossy data compression algorithm, fast wavelet transform (FWT) based on three distinctive DOFS sensing data, such as Φ-OTDR, P-OTDR, and B-OTDA. Our results demonstrated that FWT yielded the best compression ratio with good consumption time, irrespective of errors in signal construction of the three DOFS data. Our outcomes indicate the promising potentials of FWT which makes it more suitable, reliable, and convenient for real-time compression of the DOFS data. Finally, it was observed that differences in the DOFS data structure have some influence on both the compression ratio and computational cost.

Model identification and vision-based H∞ position control of 6-DoF cable-driven parallel robots

NASA Astrophysics Data System (ADS)

Chellal, R.; Cuvillon, L.; Laroche, E.

2017-04-01

This paper presents methodologies for the identification and control of 6-degrees of freedom (6-DoF) cable-driven parallel robots (CDPRs). First a two-step identification methodology is proposed to accurately estimate the kinematic parameters independently and prior to the dynamic parameters of a physics-based model of CDPRs. Second, an original control scheme is developed, including a vision-based position controller tuned with the H∞ methodology and a cable tension distribution algorithm. The position is controlled in the operational space, making use of the end-effector pose measured by a motion-tracking system. A four-block H∞ design scheme with adjusted weighting filters ensures good trajectory tracking and disturbance rejection properties for the CDPR system, which is a nonlinear-coupled MIMO system with constrained states. The tension management algorithm generates control signals that maintain the cables under feasible tensions. The paper makes an extensive review of the available methods and presents an extension of one of them. The presented methodologies are evaluated by simulations and experimentally on a redundant 6-DoF INCA 6D CDPR with eight cables, equipped with a motion-tracking system.

Dynamic Model of Aircraft Passenger Seats for Vibration Comfort Evaluation and Control

NASA Astrophysics Data System (ADS)

Šika, Z.; Valášek, Michael; Vampola, T.; Füllekrug, U.; Klimmek, T.

The paper deals with the development of the seat dynamical model for vibration comfort evaluation and control. The aircraft seats have been tested extensively by vibrations on the 6 DOF vibrating platform. The importance of the careful comfort control together with the flight mechanics control is namely stressed for the blended wing body (BWB) aircrafts. They have a very large fuselage, where the mechanical properties (accelerations, angular accelerations) vary considerably for different seat places. The model have been improved by adding of dynamical models of the aircraft passenger seats identified by the measurements on the 6 DOF vibrating platform. The experiments, their results and the identification of the dynamical seat model are described. The model is further modified by adding of the comfort evaluation norms represented by dynamical filters. The structure and identification of the seat model is briefly described and discussed.

Enhancing depth of focus in tilted microfluidics channels by digital holography.

PubMed

Matrecano, Marcella; Paturzo, Melania; Finizio, Andrea; Ferraro, Pietro

2013-03-15

In this Letter we propose a method to enhance the limited depth of field (DOF) in optical imaging systems, through digital holography. The proposed approach is based on the introduction of a cubic phase plate into the diffraction integral, analogous to what occurs in white-light imaging systems. By this approach we show that it is possible to improve the DOF and to recover the extended focus image of a tilted object in a single reconstruction step. Moreover, we demonstrate the possibility of obtaining well-focused biological cells flowing into a tilted microfluidic channel.

Mars, Phobos, and Deimos Sample Return Enabled by ARRM Alternative Trade Study Spacecraft

NASA Technical Reports Server (NTRS)

Englander, Jacob A.; Vavrina, Matthew; Merrill, Raymond G.; Qu, Min; Naasz, Bo J.

2014-01-01

The Asteroid Robotic Redirect Mission (ARRM) has been the topic of many mission design studies since 2011. The reference ARRM spacecraft uses a powerful solar electric propulsion (SEP) system and a bag device to capture a small asteroid from an Earth-like orbit and redirect it to a distant retrograde orbit (DRO) around the moon. The ARRM Option B spacecraft uses the same propulsion system and multi-Degree of Freedom (DoF) manipulators device to retrieve a very large sample (thousands of kilograms) from a 100+ meter diameter farther-away Near Earth Asteroid (NEA). This study will demonstrate that the ARRM Option B spacecraft design can also be used to return samples from Mars and its moons - either by acquiring a large rock from the surface of Phobos or Deimos, and or by rendezvousing with a sample-return spacecraft launched from the surface of Mars.

Mars, Phobos, and Deimos Sample Return Enabled by ARRM Alternative Trade Study Spacecraft

NASA Technical Reports Server (NTRS)

Englander, Jacob A.; Vavrina, Matthew; Naasz, Bo; Merill, Raymond G.; Qu, Min

2014-01-01

The Asteroid Robotic Redirect Mission (ARRM) has been the topic of many mission design studies since 2011. The reference ARRM spacecraft uses a powerful solar electric propulsion (SEP) system and a bag device to capture a small asteroid from an Earth-like orbit and redirect it to a distant retrograde orbit (DRO) around the moon. The ARRM Option B spacecraft uses the same propulsion system and multi-Degree of Freedom (DoF) manipulators device to retrieve a very large sample (thousands of kilograms) from a 100+ meter diameter farther-away Near Earth Asteroid (NEA). This study will demonstrate that the ARRM Option B spacecraft design can also be used to return samples from Mars and its moons - either by acquiring a large rock from the surface of Phobos or Deimos, and/or by rendezvousing with a sample-return spacecraft launched from the surface of Mars.

Control of the seven-degree-of-freedom upper limb exoskeleton for an improved human-robot interface

NASA Astrophysics Data System (ADS)

Kim, Hyunchul; Kim, Jungsuk

2017-04-01

This study analyzes a practical scheme for controlling an exoskeleton robot with seven degrees of freedom (DOFs) that supports natural movements of the human arm. A redundant upper limb exoskeleton robot with seven DOFs is mechanically coupled to the human body such that it becomes a natural extension of the body. If the exoskeleton robot follows the movement of the human body synchronously, the energy exchange between the human and the robot will be reduced significantly. In order to achieve this, the redundancy of the human arm, which is represented by the swivel angle, should be resolved using appropriate constraints and applied to the robot. In a redundant 7-DOF upper limb exoskeleton, the pseudoinverse of the Jacobian with secondary objective functions is widely used to resolve the redundancy that defines the desired joint angles. A secondary objective function requires the desired joint angles for the movement of the human arm, and the angles are estimated by maximizing the projection of the longest principle axis of the manipulability ellipsoid for the human arm onto the virtual destination toward the head region. Then, they are fed into the muscle model with a relative damping to achieve more realistic robot-arm movements. Various natural arm movements are recorded using a motion capture system, and the actual swivel-angle is compared to that estimated using the proposed swivel angle estimation algorithm. The results indicate that the proposed algorithm provides a precise reference for estimating the desired joint angle with an error less than 5°.

Workflow Optimization for Tuning Prostheses with High Input Channel

DTIC Science & Technology

2017-10-01

of Specific Aim 1 by driving a commercially available two DoF wrist and single DoF hand. The high -level control system will provide analog signals...AWARD NUMBER: W81XWH-16-1-0767 TITLE: Workflow Optimization for Tuning Prostheses with High Input Channel PRINCIPAL INVESTIGATOR: Daniel Merrill...Unlimited The views, opinions and/or findings contained in this report are those of the author(s) and should not be construed as an official Department

Note: Reliable and non-contact 6D motion tracking system based on 2D laser scanners for cargo transportation.

PubMed

Kim, Young-Keun; Kim, Kyung-Soo

2014-10-01

Maritime transportation demands an accurate measurement system to track the motion of oscillating container boxes in real time. However, it is a challenge to design a sensor system that can provide both reliable and non-contact methods of 6-DOF motion measurements of a remote object for outdoor applications. In the paper, a sensor system based on two 2D laser scanners is proposed for detecting the relative 6-DOF motion of a crane load in real time. Even without implementing a camera, the proposed system can detect the motion of a remote object using four laser beam points. Because it is a laser-based sensor, the system is expected to be highly robust to sea weather conditions.

Note: Reliable and non-contact 6D motion tracking system based on 2D laser scanners for cargo transportation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Young-Keun, E-mail: ykkim@handong.edu; Kim, Kyung-Soo

Maritime transportation demands an accurate measurement system to track the motion of oscillating container boxes in real time. However, it is a challenge to design a sensor system that can provide both reliable and non-contact methods of 6-DOF motion measurements of a remote object for outdoor applications. In the paper, a sensor system based on two 2D laser scanners is proposed for detecting the relative 6-DOF motion of a crane load in real time. Even without implementing a camera, the proposed system can detect the motion of a remote object using four laser beam points. Because it is a laser-basedmore » sensor, the system is expected to be highly robust to sea weather conditions.« less

Note: Reliable and non-contact 6D motion tracking system based on 2D laser scanners for cargo transportation

NASA Astrophysics Data System (ADS)

Kim, Young-Keun; Kim, Kyung-Soo

2014-10-01

Maritime transportation demands an accurate measurement system to track the motion of oscillating container boxes in real time. However, it is a challenge to design a sensor system that can provide both reliable and non-contact methods of 6-DOF motion measurements of a remote object for outdoor applications. In the paper, a sensor system based on two 2D laser scanners is proposed for detecting the relative 6-DOF motion of a crane load in real time. Even without implementing a camera, the proposed system can detect the motion of a remote object using four laser beam points. Because it is a laser-based sensor, the system is expected to be highly robust to sea weather conditions.

Design of a 6-DOF upper limb rehabilitation exoskeleton with parallel actuated joints.

PubMed

Chen, Yanyan; Li, Ge; Zhu, Yanhe; Zhao, Jie; Cai, Hegao

2014-01-01

In this paper, a 6-DOF wearable upper limb exoskeleton with parallel actuated joints which perfectly mimics human motions is proposed. The upper limb exoskeleton assists the movement of physically weak people. Compared with the existing upper limb exoskeletons which are mostly designed using a serial structure with large movement space but small stiffness and poor wearable ability, a prototype for motion assistance based on human anatomy structure has been developed in our design. Moreover, the design adopts balls instead of bearings to save space, which simplifies the structure and reduces the cost of the mechanism. The proposed design also employs deceleration processes to ensure that the transmission ratio of each joint is coincident.

Hybrid Imaging for Extended Depth of Field Microscopy

NASA Astrophysics Data System (ADS)

Zahreddine, Ramzi Nicholas

An inverse relationship exists in optical systems between the depth of field (DOF) and the minimum resolvable feature size. This trade-off is especially detrimental in high numerical aperture microscopy systems where resolution is pushed to the diffraction limit resulting in a DOF on the order of 500 nm. Many biological structures and processes of interest span over micron scales resulting in significant blurring during imaging. This thesis explores a two-step computational imaging technique known as hybrid imaging to create extended DOF (EDF) microscopy systems with minimal sacrifice in resolution. In the first step a mask is inserted at the pupil plane of the microscope to create a focus invariant system over 10 times the traditional DOF, albeit with reduced contrast. In the second step the contrast is restored via deconvolution. Several EDF pupil masks from the literature are quantitatively compared in the context of biological microscopy. From this analysis a new mask is proposed, the incoherently partitioned pupil with binary phase modulation (IPP-BPM), that combines the most advantageous properties from the literature. Total variation regularized deconvolution models are derived for the various noise conditions and detectors commonly used in biological microscopy. State of the art algorithms for efficiently solving the deconvolution problem are analyzed for speed, accuracy, and ease of use. The IPP-BPM mask is compared with the literature and shown to have the highest signal-to-noise ratio and lowest mean square error post-processing. A prototype of the IPP-BPM mask is fabricated using a combination of 3D femtosecond glass etching and standard lithography techniques. The mask is compared against theory and demonstrated in biological imaging applications.

Coil-free active stabilisation of extended payloads with optical inertial sensors

NASA Astrophysics Data System (ADS)

Watchi, J.; Ding, B.; Tshilumba, D.; Artoos, K.; Collette, C.

2018-05-01

This paper presents a new active isolation strategy and system which is dedicated to extended payloads, and compatible with the particle accelerator environment. In comparison to the current isolation systems used in this environment, the system proposed does not contain any coil or elastomer, and the supporting frame is dedicated to isolating long payloads from seismic motion. The concept proposed has been tested numerically on 3 and 6 degrees of freedom (DOF) models, and validated experimentally on a 1-DOF scaled test set-up. An attenuation of 40 dB at 1 Hz has been reached with the stage built. The complete description of performance and a noise budgeting are included in this paper.

Torque Measurement of 3-DOF Haptic Master Operated by Controllable Electrorheological Fluid

NASA Astrophysics Data System (ADS)

Oh, Jong-Seok; Choi, Seung-Bok; Lee, Yang-Sub

2015-02-01

This work presents a torque measurement method of 3-degree-of-freedom (3-DOF) haptic master featuring controllable electrorheological (ER) fluid. In order to reflect the sense of an organ for a surgeon, the ER haptic master which can generate the repulsive torque of an organ is utilized as a remote controller for a surgery robot. Since accurate representation of organ feeling is essential for the success of the robot-assisted surgery, it is indispensable to develop a proper torque measurement method of 3-DOF ER haptic master. After describing the structural configuration of the haptic master, the torque models of ER spherical joint are mathematically derived based on the Bingham model of ER fluid. A new type of haptic device which has pitching, rolling, and yawing motions is then designed and manufactured using a spherical joint mechanism. Subsequently, the field-dependent parameters of the Bingham model are identified and generating repulsive torque according to applied electric field is measured. In addition, in order to verify the effectiveness of the proposed torque model, a comparative work between simulated and measured torques is undertaken.

Hand Motion Classification Using a Multi-Channel Surface Electromyography Sensor

PubMed Central

Tang, Xueyan; Liu, Yunhui; Lv, Congyi; Sun, Dong

2012-01-01

The human hand has multiple degrees of freedom (DOF) for achieving high-dexterity motions. Identifying and replicating human hand motions are necessary to perform precise and delicate operations in many applications, such as haptic applications. Surface electromyography (sEMG) sensors are a low-cost method for identifying hand motions, in addition to the conventional methods that use data gloves and vision detection. The identification of multiple hand motions is challenging because the error rate typically increases significantly with the addition of more hand motions. Thus, the current study proposes two new methods for feature extraction to solve the problem above. The first method is the extraction of the energy ratio features in the time-domain, which are robust and invariant to motion forces and speeds for the same gesture. The second method is the extraction of the concordance correlation features that describe the relationship between every two channels of the multi-channel sEMG sensor system. The concordance correlation features of a multi-channel sEMG sensor system were shown to provide a vast amount of useful information for identification. Furthermore, a new cascaded-structure classifier is also proposed, in which 11 types of hand gestures can be identified accurately using the newly defined features. Experimental results show that the success rate for the identification of the 11 gestures is significantly high. PMID:22438703

Hand motion classification using a multi-channel surface electromyography sensor.

PubMed

Tang, Xueyan; Liu, Yunhui; Lv, Congyi; Sun, Dong

2012-01-01

The human hand has multiple degrees of freedom (DOF) for achieving high-dexterity motions. Identifying and replicating human hand motions are necessary to perform precise and delicate operations in many applications, such as haptic applications. Surface electromyography (sEMG) sensors are a low-cost method for identifying hand motions, in addition to the conventional methods that use data gloves and vision detection. The identification of multiple hand motions is challenging because the error rate typically increases significantly with the addition of more hand motions. Thus, the current study proposes two new methods for feature extraction to solve the problem above. The first method is the extraction of the energy ratio features in the time-domain, which are robust and invariant to motion forces and speeds for the same gesture. The second method is the extraction of the concordance correlation features that describe the relationship between every two channels of the multi-channel sEMG sensor system. The concordance correlation features of a multi-channel sEMG sensor system were shown to provide a vast amount of useful information for identification. Furthermore, a new cascaded-structure classifier is also proposed, in which 11 types of hand gestures can be identified accurately using the newly defined features. Experimental results show that the success rate for the identification of the 11 gestures is significantly high.

A Multi-Sensor Fusion MAV State Estimation from Long-Range Stereo, IMU, GPS and Barometric Sensors

PubMed Central

Song, Yu; Nuske, Stephen; Scherer, Sebastian

2016-01-01

State estimation is the most critical capability for MAV (Micro-Aerial Vehicle) localization, autonomous obstacle avoidance, robust flight control and 3D environmental mapping. There are three main challenges for MAV state estimation: (1) it can deal with aggressive 6 DOF (Degree Of Freedom) motion; (2) it should be robust to intermittent GPS (Global Positioning System) (even GPS-denied) situations; (3) it should work well both for low- and high-altitude flight. In this paper, we present a state estimation technique by fusing long-range stereo visual odometry, GPS, barometric and IMU (Inertial Measurement Unit) measurements. The new estimation system has two main parts, a stochastic cloning EKF (Extended Kalman Filter) estimator that loosely fuses both absolute state measurements (GPS, barometer) and the relative state measurements (IMU, visual odometry), and is derived and discussed in detail. A long-range stereo visual odometry is proposed for high-altitude MAV odometry calculation by using both multi-view stereo triangulation and a multi-view stereo inverse depth filter. The odometry takes the EKF information (IMU integral) for robust camera pose tracking and image feature matching, and the stereo odometry output serves as the relative measurements for the update of the state estimation. Experimental results on a benchmark dataset and our real flight dataset show the effectiveness of the proposed state estimation system, especially for the aggressive, intermittent GPS and high-altitude MAV flight. PMID:28025524

An Inertial and Optical Sensor Fusion Approach for Six Degree-of-Freedom Pose Estimation

PubMed Central

He, Changyu; Kazanzides, Peter; Sen, Hasan Tutkun; Kim, Sungmin; Liu, Yue

2015-01-01

Optical tracking provides relatively high accuracy over a large workspace but requires line-of-sight between the camera and the markers, which may be difficult to maintain in actual applications. In contrast, inertial sensing does not require line-of-sight but is subject to drift, which may cause large cumulative errors, especially during the measurement of position. To handle cases where some or all of the markers are occluded, this paper proposes an inertial and optical sensor fusion approach in which the bias of the inertial sensors is estimated when the optical tracker provides full six degree-of-freedom (6-DOF) pose information. As long as the position of at least one marker can be tracked by the optical system, the 3-DOF position can be combined with the orientation estimated from the inertial measurements to recover the full 6-DOF pose information. When all the markers are occluded, the position tracking relies on the inertial sensors that are bias-corrected by the optical tracking system. Experiments are performed with an augmented reality head-mounted display (ARHMD) that integrates an optical tracking system (OTS) and inertial measurement unit (IMU). Experimental results show that under partial occlusion conditions, the root mean square errors (RMSE) of orientation and position are 0.04° and 0.134 mm, and under total occlusion conditions for 1 s, the orientation and position RMSE are 0.022° and 0.22 mm, respectively. Thus, the proposed sensor fusion approach can provide reliable 6-DOF pose under long-term partial occlusion and short-term total occlusion conditions. PMID:26184191

An Inertial and Optical Sensor Fusion Approach for Six Degree-of-Freedom Pose Estimation.

PubMed

He, Changyu; Kazanzides, Peter; Sen, Hasan Tutkun; Kim, Sungmin; Liu, Yue

2015-07-08

Optical tracking provides relatively high accuracy over a large workspace but requires line-of-sight between the camera and the markers, which may be difficult to maintain in actual applications. In contrast, inertial sensing does not require line-of-sight but is subject to drift, which may cause large cumulative errors, especially during the measurement of position. To handle cases where some or all of the markers are occluded, this paper proposes an inertial and optical sensor fusion approach in which the bias of the inertial sensors is estimated when the optical tracker provides full six degree-of-freedom (6-DOF) pose information. As long as the position of at least one marker can be tracked by the optical system, the 3-DOF position can be combined with the orientation estimated from the inertial measurements to recover the full 6-DOF pose information. When all the markers are occluded, the position tracking relies on the inertial sensors that are bias-corrected by the optical tracking system. Experiments are performed with an augmented reality head-mounted display (ARHMD) that integrates an optical tracking system (OTS) and inertial measurement unit (IMU). Experimental results show that under partial occlusion conditions, the root mean square errors (RMSE) of orientation and position are 0.04° and 0.134 mm, and under total occlusion conditions for 1 s, the orientation and position RMSE are 0.022° and 0.22 mm, respectively. Thus, the proposed sensor fusion approach can provide reliable 6-DOF pose under long-term partial occlusion and short-term total occlusion conditions.

Precision Closed-Loop Orbital Maneuvering System Design and Performance for the Magnetospheric Multi-Scale Mission (MMS) Formation

NASA Technical Reports Server (NTRS)

Chai, Dean; Queen, Steve; Placanica, Sam

2015-01-01

NASA's Magnetospheric Multi-Scale (MMS) mission successfully launched on March 13, 2015 (UTC) consists of four identically instrumented spin-stabilized observatories that function as a constellation to study magnetic reconnection in space. The need to maintain sufficiently accurate spatial and temporal formation resolution of the observatories must be balanced against the logistical constraints of executing overly-frequent maneuvers on a small fleet of spacecraft. These two considerations make for an extremely challenging maneuver design problem. This paper focuses on the design elements of a 6-DOF spacecraft attitude control and maneuvering system capable of delivering the high-precision adjustments required by the constellation designers---specifically, the design, implementation, and on-orbit performance of the closed-loop formation-class maneuvers that include initialization, maintenance, and re-sizing. The maneuvering control system flown on MMS utilizes a micro-gravity resolution accelerometer sampled at a high rate in order to achieve closed-loop velocity tracking of an inertial target with arc-minute directional and millimeter-per-second magnitude accuracy. This paper summarizes the techniques used for correcting bias drift, sensor-head offsets, and centripetal aliasing in the acceleration measurements. It also discusses the on-board pre-maneuver calibration and compensation algorithms as well as the implementation of the post-maneuver attitude adjustments.

Inertial-space disturbance rejection for robotic manipulators

NASA Technical Reports Server (NTRS)

Holt, Kevin

1992-01-01

The disturbance rejection control problem for a 6-DOF (degree of freedom) PUMA manipulator mounted on a 3-DOF platform is investigated. A control algorithm is designed to track the desired position and attitude of the end-effector in inertial space, subject to unknown disturbances in the platform axes. Conditions for the stability of the closed-loop system are derived. The performance of the controller is compared for step, sinusoidal, and random disturbances in the platform rotational axis and in the neighborhood of kinematic singularities.

On DSS Implementation in the Dynamic Model of the Digital Oil field

NASA Astrophysics Data System (ADS)

Korovin, Iakov S.; Khisamutdinov, Maksim V.; Kalyaev, Anatoly I.

2018-02-01

Decision support systems (DSS), especially based on the artificial intelligence (AI) techniques are been widely applied in different domains nowadays. In the paper we depict an approach of implementing DSS in to Digital Oil Field (DOF) dynamic model structure in order to reduce the human factor influence, considering the automation of all production processes to be the DOF model clue element. As the basic tool of data handling we propose the hybrid application on artificial neural networks and evolutional algorithms.

A comparison of the real-time controllability of pattern recognition to conventional myoelectric control for discrete and simultaneous movements

PubMed Central

2014-01-01

Myoelectric control has been used for decades to control powered upper limb prostheses. Conventional, amplitude-based control has been employed to control a single prosthesis degree of freedom (DOF) such as closing and opening of the hand. Within the last decade, new and advanced arm and hand prostheses have been constructed that are capable of actuating numerous DOFs. Pattern recognition control has been proposed to control a greater number of DOFs than conventional control, but has traditionally been limited to sequentially controlling DOFs one at a time. However, able-bodied individuals use multiple DOFs simultaneously, and it may be beneficial to provide amputees the ability to perform simultaneous movements. In this study, four amputees who had undergone targeted motor reinnervation (TMR) surgery with previous training using myoelectric prostheses were configured to use three control strategies: 1) conventional amplitude-based myoelectric control, 2) sequential (one-DOF) pattern recognition control, 3) simultaneous pattern recognition control. Simultaneous pattern recognition was enabled by having amputees train each simultaneous movement as a separate motion class. For tasks that required control over just one DOF, sequential pattern recognition based control performed the best with the lowest average completion times, completion rates and length error. For tasks that required control over 2 DOFs, the simultaneous pattern recognition controller performed the best with the lowest average completion times, completion rates and length error compared to the other control strategies. In the two strategies in which users could employ simultaneous movements (conventional and simultaneous pattern recognition), amputees chose to use simultaneous movements 78% of the time with simultaneous pattern recognition and 64% of the time with conventional control for tasks that required two DOF motions to reach the target. These results suggest that when amputees are given the ability to control multiple DOFs simultaneously, they choose to perform tasks that utilize multiple DOFs with simultaneous movements. Additionally, they were able to perform these tasks with higher performance (faster speed, lower length error and higher completion rates) without losing substantial performance in 1 DOF tasks. PMID:24410948

National Fire News- Current Wildfires

MedlinePlus

... of Denali Bella Creek Southwest Area Forestry, DOF ST 2,631 0 Bismark Galena Zone BLM 876 ... of Hughes Devil's Elbow Southwest Area Forestry, DOF ST 180 0 Door Mountains Southwest Area Forestry, DOF ...

Towards Kilo-Hertz 6-DoF Visual Tracking Using an Egocentric Cluster of Rolling Shutter Cameras.

PubMed

Bapat, Akash; Dunn, Enrique; Frahm, Jan-Michael

2016-11-01

To maintain a reliable registration of the virtual world with the real world, augmented reality (AR) applications require highly accurate, low-latency tracking of the device. In this paper, we propose a novel method for performing this fast 6-DOF head pose tracking using a cluster of rolling shutter cameras. The key idea is that a rolling shutter camera works by capturing the rows of an image in rapid succession, essentially acting as a high-frequency 1D image sensor. By integrating multiple rolling shutter cameras on the AR device, our tracker is able to perform 6-DOF markerless tracking in a static indoor environment with minimal latency. Compared to state-of-the-art tracking systems, this tracking approach performs at significantly higher frequency, and it works in generalized environments. To demonstrate the feasibility of our system, we present thorough evaluations on synthetically generated data with tracking frequencies reaching 56.7 kHz. We further validate the method's accuracy on real-world images collected from a prototype of our tracking system against ground truth data using standard commodity GoPro cameras capturing at 120 Hz frame rate.

6DOF Testing of the SLS Inertial Navigation Unit

NASA Technical Reports Server (NTRS)

Geohagan, Kevin; Bernard, Bill; Oliver, T. Emerson; Leggett, Jared; Strickland, Dennis

2018-01-01

The Navigation System on the NASA Space Launch System (SLS) Block 1 vehicle performs initial alignment of the Inertial Navigation System (INS) navigation frame through gyrocompass alignment (GCA). Because the navigation architecture for the SLS Block 1 vehicle is a purely inertial system, the accuracy of the achieved orbit relative to mission requirements is very sensitive to initial alignment accuracy. The assessment of this sensitivity and many others via simulation is a part of the SLS Model-Based Design and Model-Based Requirements approach. As a part of the aforementioned, 6DOF Monte Carlo simulation is used in large part to develop and demonstrate verification of program requirements. To facilitate this and the GN&C flight software design process, an SLS-Program-controlled Design Math Model (DMM) of the SLS INS was developed by the SLS Navigation Team. The SLS INS model implements all of the key functions of the hardware-namely, GCA, inertial navigation, and FDIR (Fault Detection, Isolation, and Recovery)-in support of SLS GN&C design requirements verification. Despite the strong sensitivity to initial alignment, GCA accuracy requirements were not verified by test due to program cost and schedule constraints. Instead, the system relies upon assessments performed using the SLS INS model. In order to verify SLS program requirements by analysis, the SLS INS model is verified and validated against flight hardware. In lieu of direct testing of GCA accuracy in support of requirement verification, the SLS Navigation Team proposed and conducted an engineering test to, among other things, validate the GCA performance and overall behavior of the SLS INS model through comparison with test data. This paper will detail dynamic hardware testing of the SLS INS, conducted by the SLS Navigation Team at Marshall Space Flight Center's 6DOF Table Facility, in support of GCA performance characterization and INS model validation. A 6-DOF motion platform was used to produce 6DOF pad twist and sway dynamics while a simulated SLS flight computer communicated with the INS. Tests conducted include an evaluation of GCA algorithm robustness to increasingly dynamic pad environments, an examination of GCA algorithm stability and accuracy over long durations, and a long-duration static test to gather enough data for Allan Variance analysis. Test setup, execution, and data analysis will be discussed, including analysis performed in support of SLS INS model validation.

Theoretical performance analysis of doped optical fibers based on pseudo parameters

NASA Astrophysics Data System (ADS)

Karimi, Maryam; Seraji, Faramarz E.

2010-09-01

Characterization of doped optical fibers (DOFs) is an essential primary stage for design of DOF-based devices. This paper presents design of novel measurement techniques to determine DOFs parameters using mono-beam propagation in a low-loss medium by generating pseudo parameters for the DOFs. The designed techniques are able to characterize simultaneously the absorption, emission cross-sections (ACS and ECS), and dopant concentration of DOFs. In both the proposed techniques, we assume pseudo parameters for the DOFs instead of their actual values and show that the choice of these pseudo parameters values for design of DOF-based devices, such as erbium-doped fiber amplifier (EDFA), are appropriate and the resulting error is quite negligible when compared with the actual parameters values.Utilization of pseudo ACS and ECS values in design procedure of EDFAs does not require the measurement of background loss coefficient (BLC) and makes the rate equation of the DOFs simple. It is shown that by using the pseudo parameters values obtained by the proposed techniques, the error in the gain of a designed EDFA with a BLC of about 1 dB/km, are about 0.08 dB. It is further indicated that the same scenario holds good for BLC lower than 5 dB/m and higher than 12 dB/m. The proposed characterization techniques have simple procedures and are low cost that can have an advantageous use in manufacturing of the DOFs.

Analyzing Aeroelastic Stability of a Tilt-Rotor Aircraft

NASA Technical Reports Server (NTRS)

Kvaternil, Raymond G.

2006-01-01

Proprotor Aeroelastic Stability Analysis, now at version 4.5 (PASTA 4.5), is a FORTRAN computer program for analyzing the aeroelastic stability of a tiltrotor aircraft in the airplane mode of flight. The program employs a 10-degree- of-freedom (DOF), discrete-coordinate, linear mathematical model of a rotor with three or more blades and its drive system coupled to a 10-DOF modal model of an airframe. The user can select which DOFs are included in the analysis. Quasi-steady strip-theory aerodynamics is employed for the aerodynamic loads on the blades, a quasi-steady representation is employed for the aerodynamic loads acting on the vibrational modes of the airframe, and a stability-derivative approach is used for the aerodynamics associated with the rigid-body DOFs of the airframe. Blade parameters that vary with the blade collective pitch can be obtained by interpolation from a user-defined table. Stability is determined by examining the eigenvalues that are obtained by solving the coupled equations of motions as a matrix eigenvalue problem. Notwithstanding the relative simplicity of its mathematical foundation, PASTA 4.5 and its predecessors have played key roles in a number of engineering investigations over the years.

Robotic-assisted real-time MRI-guided TAVR: from system deployment to in vivo experiment in swine model.

PubMed

Chan, Joshua L; Mazilu, Dumitru; Miller, Justin G; Hunt, Timothy; Horvath, Keith A; Li, Ming

2016-10-01

Real-time magnetic resonance imaging (rtMRI) guidance provides significant advantages during transcatheter aortic valve replacement (TAVR) as it provides superior real-time visualization and accurate device delivery tracking. However, performing a TAVR within an MRI scanner remains difficult due to a constrained procedural environment. To address these concerns, a magnetic resonance (MR)-compatible robotic system to assist in TAVR deployments was developed. This study evaluates the technical design and interface considerations of an MR-compatible robotic-assisted TAVR system with the purpose of demonstrating that such a system can be developed and executed safely and precisely in a preclinical model. An MR-compatible robotic surgical assistant system was built for TAVR deployment. This system integrates a 5-degrees of freedom (DoF) robotic arm with a 3-DoF robotic valve delivery module. A user interface system was designed for procedural planning and real-time intraoperative manipulation of the robot. The robotic device was constructed of plastic materials, pneumatic actuators, and fiber-optical encoders. The mechanical profile and MR compatibility of the robotic system were evaluated. The system-level error based on a phantom model was 1.14 ± 0.33 mm. A self-expanding prosthesis was successfully deployed in eight Yorkshire swine under rtMRI guidance. Post-deployment imaging and necropsy confirmed placement of the stent within 3 mm of the aortic valve annulus. These phantom and in vivo studies demonstrate the feasibility and advantages of robotic-assisted TAVR under rtMRI guidance. This robotic system increases the precision of valve deployments, diminishes environmental constraints, and improves the overall success of TAVR.

Adding Liquid Payloads Effects to the 6-DOF Trajectory of Spinning Projectiles

DTIC Science & Technology

2010-03-01

Adding Liquid Payloads Effects to the 6-DOF Trajectory of Spinning Projectiles by Gene R. Cooper ARL-TR-5118 March 2010...Liquid Payloads Effects to the 6-DOF Trajectory of Spinning Projectiles Gene R. Cooper Weapons and Materials Research Directorate, ARL...September 2007 4. TITLE AND SUBTITLE Adding Liquid Payloads Effects to the 6-DOF Trajectory of Spinning Projectiles 5a. CONTRACT NUMBER 5b. GRANT

Critical transition to bistability arising from hidden degrees of freedom in origami structures

NASA Astrophysics Data System (ADS)

Cohen, Itai; Silverberg, Jesse; Na, Jun-Hee; Evans, Arthur; Liu, Bin; Hull, Thomas; Santangelo, Christian; Lang, Robert; Hayward, Ryan

2015-03-01

Origami, the traditional art of paper folding, is now being used to design responsive, dynamic, and customizable mechanical metamaterials. The remarkable abilities of these origami-inspired devices emerge from a predefined crease pattern, which couples kinematic folding constraints to the geometric placement of creases. In spite of this progress, a generalized physical understanding of origami remains elusive due to the challenge in determining whether local kinematic constraints are globally compatible, and an incomplete understanding of how bending and crease plasticity found in real materials contribute to the overall mechanical response. Here, we show experimentally and theoretically that the traditional square twist, whose crease pattern has zero degrees of freedom (DOF) and therefore should not be foldable, is nevertheless able to be folded by accessing higher energy scale deformations associated with bending. Due to the separation of bending and crease energy scales, these hidden DOF lead to a geometrically-driven critical bifurcation between mono- and bistability. The scale-free geometric underpinnings of this physical phenomenon suggest a generalized design principle that can be useful for fabricating micro- and nanoscale mechanical switches.

Inverse dynamic substructuring using the direct hybrid assembly in the frequency domain

NASA Astrophysics Data System (ADS)

D'Ambrogio, Walter; Fregolent, Annalisa

2014-04-01

The paper deals with the identification of the dynamic behaviour of a structural subsystem, starting from the known dynamic behaviour of both the coupled system and the remaining part of the structural system (residual subsystem). This topic is also known as decoupling problem, subsystem subtraction or inverse dynamic substructuring. Whenever it is necessary to combine numerical models (e.g. FEM) and test models (e.g. FRFs), one speaks of experimental dynamic substructuring. Substructure decoupling techniques can be classified as inverse coupling or direct decoupling techniques. In inverse coupling, the equations describing the coupling problem are rearranged to isolate the unknown substructure instead of the coupled structure. On the contrary, direct decoupling consists in adding to the coupled system a fictitious subsystem that is the negative of the residual subsystem. Starting from a reduced version of the 3-field formulation (dynamic equilibrium using FRFs, compatibility and equilibrium of interface forces), a direct hybrid assembly is developed by requiring that both compatibility and equilibrium conditions are satisfied exactly, either at coupling DoFs only, or at additional internal DoFs of the residual subsystem. Equilibrium and compatibility DoFs might not be the same: this generates the so-called non-collocated approach. The technique is applied using experimental data from an assembled system made by a plate and a rigid mass.

The influence of mass configurations on velocity amplified vibrational energy harvesters

NASA Astrophysics Data System (ADS)

O'Donoghue, D.; Frizzell, R.; Kelly, G.; Nolan, K.; Punch, J.

2016-05-01

Vibrational energy harvesters scavenge ambient vibrational energy, offering an alternative to batteries for the autonomous operation of low power electronics. Velocity amplified electromagnetic generators (VAEGs) utilize the velocity amplification effect to increase power output and operational bandwidth, compared to linear resonators. A detailed experimental analysis of the influence of mass ratio and number of degrees-of-freedom (dofs) on the dynamic behaviour and power output of a macro-scale VAEG is presented. Various mass configurations are tested under drop-test and sinusoidal forced excitation, and the system performances are compared. For the drop-test, increasing mass ratio and number of dofs increases velocity amplification. Under forced excitation, the impacts between the masses are more complex, inducing greater energy losses. This results in the 2-dof systems achieving the highest velocities and, hence, highest output voltages. With fixed transducer size, higher mass ratios achieve higher voltage output due to the superior velocity amplification. Changing the magnet size to a fixed percentage of the final mass showed the increase in velocity of the systems with higher mass ratios is not significant enough to overcome the reduction in transducer size. Consequently, the 3:1 mass ratio systems achieved the highest output voltage. These findings are significant for the design of future reduced-scale VAEGs.

Development of haptic system for surgical robot

NASA Astrophysics Data System (ADS)

Gang, Han Gyeol; Park, Jiong Min; Choi, Seung-Bok; Sohn, Jung Woo

2017-04-01

In this paper, a new type of haptic system for surgical robot application is proposed and its performances are evaluated experimentally. The proposed haptic system consists of an effective master device and a precision slave robot. The master device has 3-DOF rotational motion as same as human wrist motion. It has lightweight structure with a gyro sensor and three small-sized MR brakes for position measurement and repulsive torque generation, respectively. The slave robot has 3-DOF rotational motion using servomotors, five bar linkage and a torque sensor is used to measure resistive torque. It has been experimentally demonstrated that the proposed haptic system has good performances on tracking control of desired position and repulsive torque. It can be concluded that the proposed haptic system can be effectively applied to the surgical robot system in real field.

Development of Quasi-3DOF upper limb rehabilitation system using ER brake: PLEMO-P1

NASA Astrophysics Data System (ADS)

Kikuchi, T.; Fukushima, K.; Furusho, J.; Ozawa, T.

2009-02-01

In recent years, many researchers have studied the potential of using robotics technology to assist and quantify the motor functions for neuron-rehabilitation. Some kinds of haptic devices have been developed and evaluated its efficiency with clinical tests, for example, upper limb training for patients with spasticity after stroke. However, almost all the devices are active-type (motor-driven) haptic devices and they basically require high-cost safety system compared to passive-type (brake-based) devices. In this study, we developed a new practical haptic device 'PLEMO-P1'; this system adopted ER brakes as its force generators. In this paper, the mechanism of PLEMO-P1 and its software for a reaching rehabilitation are described.

Robonaut: A Robotic Astronaut Assistant

NASA Technical Reports Server (NTRS)

Ambrose, Robert O.; Diftler, Myron A.

2001-01-01

NASA's latest anthropomorphic robot, Robonaut, has reached a milestone in its capability. This highly dexterous robot, designed to assist astronauts in space, is now performing complex tasks at the Johnson Space Center that could previously only be carried out by humans. With 43 degrees of freedom, Robonaut is the first humanoid built for space and incorporates technology advances in dexterous hands, modular manipulators, lightweight materials, and telepresence control systems. Robonaut is human size, has a three degree of freedom (DOF) articulated waist, and two, seven DOF arms, giving it an impressive work space for interacting with its environment. Its two, five fingered hands allow manipulation of a wide range of tools. A pan/tilt head with multiple stereo camera systems provides data for both teleoperators and computer vision systems.

Measurement system and model for simultaneously measuring 6DOF geometric errors.

PubMed

Zhao, Yuqiong; Zhang, Bin; Feng, Qibo

2017-09-04

A measurement system to simultaneously measure six degree-of-freedom (6DOF) geometric errors is proposed. The measurement method is based on a combination of mono-frequency laser interferometry and laser fiber collimation. A simpler and more integrated optical configuration is designed. To compensate for the measurement errors introduced by error crosstalk, element fabrication error, laser beam drift, and nonparallelism of two measurement beam, a unified measurement model, which can improve the measurement accuracy, is deduced and established using the ray-tracing method. A numerical simulation using the optical design software Zemax is conducted, and the results verify the correctness of the model. Several experiments are performed to demonstrate the feasibility and effectiveness of the proposed system and measurement model.

iLIDS Simulations and Videos for Docking TIM

NASA Technical Reports Server (NTRS)

Lewis, James L.

2010-01-01

The video shows various aspects of the International Low Impact Docking System, including team members, some production, configuration, mated androgynous iLIDS, SCS Lockdown system, thermal analysis, electrical engineering aspects, the iLIDS control box and emulator, radiation testing at BNL, component environmental testing, component vibration testing, 3G processor board delivery system, GTA vibe test, EMA testbed, hook and hook disassembly, flex shaftdrive assembly, GSE cradle MISSE-6 Columbus, MISSE 6 and 7 seal experiments, actuated full scale seal test rig, LIDS on Hubble, dynamics test prep, EDU 54 mass emulation and SCS, load ring characterization, 6DOF proof test, SCS at 6DOF, machining EEMS and inner ring assembly, APAS assembly, inner ring fitting, rotation stand assembly, EEMS mating, and EEMS proof of concept demonstration.

Joint-space adaptive control of a 6 DOF end-effector with closed-kinematic chain mechanism

NASA Technical Reports Server (NTRS)

Nguyen, Charles C.; Zhou, Zhen-Lei

1989-01-01

The development is presented for a joint-space adaptive scheme that controls the joint position of a six-degree-of-freedom (DOF) robot end-effector performing fine and precise motion within a very limited workspace. The end-effector was built to study autonomous assembly of NASA hardware in space. The design of the adaptive controller is based on the concept of model reference adaptive control (MRAC) and Lyapunov direct method. In the development, it is assumed that the end-effector performs slowly varying motion. Computer simulation is performed to investigate the performance of the developed control scheme on position control of the end-effector. Simulation results manifest that the adaptive control scheme provides excellent tracking of several test paths.

Dynamic test/analysis correlation using reduced analytical models

NASA Technical Reports Server (NTRS)

Mcgowan, Paul E.; Angelucci, A. Filippo; Javeed, Mehzad

1992-01-01

Test/analysis correlation is an important aspect of the verification of analysis models which are used to predict on-orbit response characteristics of large space structures. This paper presents results of a study using reduced analysis models for performing dynamic test/analysis correlation. The reduced test-analysis model (TAM) has the same number and orientation of DOF as the test measurements. Two reduction methods, static (Guyan) reduction and the Improved Reduced System (IRS) reduction, are applied to the test/analysis correlation of a laboratory truss structure. Simulated test results and modal test data are used to examine the performance of each method. It is shown that selection of DOF to be retained in the TAM is critical when large structural masses are involved. In addition, the use of modal test results may provide difficulties in TAM accuracy even if a large number of DOF are retained in the TAM.

Surgical scissors extension adds the 7th axis of force feedback to the Freedom 6S.

PubMed

Powers, Marilyn J; Sinclair, Ian P W; Brouwer, Iman; Laroche, Denis

2007-01-01

A virtual reality surgical simulator ideally allows seamless transition between the real and virtual world. In that respect, all of a surgeon's motions and tools must be simulated. Until now researchers have been limited to using a pen-like tool in six degrees-of-freedom. This paper presents the addition of haptically enabled scissors to the end effector of a 6-DOF haptic device, the Freedom 6S. The scissors are capable of pinching a maximum torque of 460 mN.m with low inertia and low back-drive friction. The device is a balanced design so that the user feels like they are holding no more than actual scissors, although with some added inertia on the load end. The system is interchangeable between the 6-DOF and 7-DOF configurations to allow switching tools quickly.

Hyperentanglement concentration for polarization-spatial-time-bin hyperentangled photon systems with linear optics

NASA Astrophysics Data System (ADS)

Wang, Hong; Ren, Bao-Cang; Alzahrani, Faris; Hobiny, Aatef; Deng, Fu-Guo

2017-10-01

Hyperentanglement has significant applications in quantum information processing. Here we present an efficient hyperentanglement concentration protocol (hyper-ECP) for partially hyperentangled Bell states simultaneously entangled in polarization, spatial-mode and time-bin degrees of freedom (DOFs) with the parameter-splitting method, where the parameters of the partially hyperentangled Bell states are known to the remote parties. In this hyper-ECP, only one remote party is required to perform some local operations on the three DOFs of a photon, only the linear optical elements are considered, and the success probability can achieve the maximal value. Our hyper-ECP can be easily generalized to concentrate the N-photon partially hyperentangled Greenberger-Horne-Zeilinger states with known parameters, where the multiple DOFs have largely improved the channel capacity of long-distance quantum communication. All of these make our hyper-ECP more practical and useful in high-capacity long-distance quantum communication.

Lower Limb Rehabilitation Using Patient Data

PubMed Central

Saadat, Mozafar

2016-01-01

The aim of this study is to investigate the performance of a 6-DoF parallel robot in tracking the movement of the foot trajectory of a paretic leg during a single stride. The foot trajectories of nine patients with a paretic leg including both males and females have been measured and analysed by a Vicon system in a gait laboratory. Based on kinematic and dynamic analysis of a 6-DoF UPS parallel robot, an algorithm was developed in MATLAB to calculate the length of the actuators and their required forces during all trajectories. The workspace and singularity points of the robot were then investigated in nine different cases. A 6-DoF UPS parallel robot prototype with high repeatability was designed and built in order to simulate a single stride. Results showed that the robot was capable of tracking all of the trajectories with the maximum position error of 1.2 mm. PMID:27721648

Overexpression of Grain Amaranth (Amaranthus hypochondriacus) AhERF or AhDOF Transcription Factors in Arabidopsis thaliana Increases Water Deficit- and Salt-Stress Tolerance, Respectively, via Contrasting Stress-Amelioration Mechanisms

PubMed Central

Massange-Sánchez, Julio A.; Palmeros-Suárez, Paola A.; Espitia-Rangel, Eduardo; Rodríguez-Arévalo, Isaac; Sánchez-Segura, Lino; Martínez-Gallardo, Norma A.; Alatorre-Cobos, Fulgencio; Tiessen, Axel; Délano-Frier, John P.

2016-01-01

Two grain amaranth transcription factor (TF) genes were overexpressed in Arabidopsis plants. The first, coding for a group VII ethylene response factor TF (i.e., AhERF-VII) conferred tolerance to water-deficit stress (WS) in transgenic Arabidopsis without affecting vegetative or reproductive growth. A significantly lower water-loss rate in detached leaves coupled to a reduced stomatal opening in leaves of plants subjected to WS was associated with this trait. WS tolerance was also associated with an increased antioxidant enzyme activity and the accumulation of putative stress-related secondary metabolites. However, microarray and GO data did not indicate an obvious correlation between WS tolerance, stomatal closure, and abscisic acid (ABA)-related signaling. This scenario suggested that stomatal closure during WS in these plants involved ABA-independent mechanisms, possibly involving reactive oxygen species (ROS). WS tolerance may have also involved other protective processes, such as those employed for methyl glyoxal detoxification. The second, coding for a class A and cluster I DNA binding with one finger TF (i.e., AhDof-AI) provided salt-stress (SS) tolerance with no evident fitness penalties. The lack of an obvious development-related phenotype contrasted with microarray and GO data showing an enrichment of categories and genes related to developmental processes, particularly flowering. SS tolerance also correlated with increased superoxide dismutase activity but not with augmented stomatal closure. Additionally, microarray and GO data indicated that, contrary to AhERF-VII, SS tolerance conferred by AhDof-AI in Arabidopsis involved ABA-dependent and ABA-independent stress amelioration mechanisms. PMID:27749893

Non-symmetric forms of non-linear vibrations of flexible cylindrical panels and plates under longitudinal load and additive white noise

NASA Astrophysics Data System (ADS)

Krysko, V. A.; Awrejcewicz, J.; Krylova, E. Yu; Papkova, I. V.; Krysko, A. V.

2018-06-01

Parametric non-linear vibrations of flexible cylindrical panels subjected to additive white noise are studied. The governing Marguerre equations are investigated using the finite difference method (FDM) of the second-order accuracy and the Runge-Kutta method. The considered mechanical structural member is treated as a system of many/infinite number of degrees of freedom (DoF). The dependence of chaotic vibrations on the number of DoFs is investigated. Reliability of results is guaranteed by comparing the results obtained using two qualitatively different methods to reduce the problem of PDEs (partial differential equations) to ODEs (ordinary differential equations), i.e. the Faedo-Galerkin method in higher approximations and the 4th and 6th order FDM. The Cauchy problem obtained by the FDM is eventually solved using the 4th-order Runge-Kutta methods. The numerical experiment yielded, for a certain set of parameters, the non-symmetric vibration modes/forms with and without white noise. In particular, it has been illustrated and discussed that action of white noise on chaotic vibrations implies quasi-periodicity, whereas the previously non-symmetric vibration modes are closer to symmetric ones.

Modification of a Limbed Robot to Favor Climbing

NASA Technical Reports Server (NTRS)

Okon, Avi; Kennedy, Brett; Garrett, Michael; Magnone, Lee

2006-01-01

The figure shows the LEMUR IIb, which is a modified version of the LEMUR II the second generation of the Limbed Excursion Mechanical Utility Robot (LEMUR). Except as described below, the LEMUR IIb hardware is mostly the same as that of the LEMUR II. The IIb and II versions differ in their kinematic configurations and characteristics associated with their kinematic configurations. The differences are such that relative to the LEMUR II, the LEMUR IIb is simpler and is better suited to climbing on inclined surfaces. The first-generation LEMUR, now denoted the LEMUR I, was described in Six-Legged Experimental Robot (NPO-20897), NASA Tech Briefs, Vol. 25, No. 12 (December 2001), page 58. The LEMUR II was described in Second-Generation Six-Limbed Experimental Robot (NPO-35140) NASA Tech Briefs, Vol. 28, No. 11 (November 2004), page 55. To recapitulate: the LEMUR I and LEMUR II were six-legged or sixlimbed robots for demonstrating robotic capabilities for assembly, maintenance, and inspection. They were designed to be capable of walking autonomously along a truss structure toward a mechanical assembly at a prescribed location. They were equipped with stereoscopic video cameras and image-data-processing circuitry for navigation and mechanical operations. They were also equipped with wireless modems, through which they could be commanded remotely. Upon arrival at a mechanical assembly, the LEMUR I would perform simple mechanical operations by use of one or both of its front legs (or in the case of the LEMUR II, any of its limbs could be used to perform mechanical operations). Either LEMUR could also transmit images to a host computer. The differences between the LEMUR IIb and the LEMUR II are the following: Whereas the LEMUR II had six limbs, the LEMUR IIb has four limbs. This change has reduced both the complexity and mass of the legs and of the overall robot. Whereas each limb of the LEMUR II had four degrees of freedom (DOFs), each limb of the LEMUR IIb has three DOFs. This change has also reduced both complexity and mass. Notwithstanding the decrease in the number of DOFs, the three remaining DOFs are configured to provide greater dexterity for motion along a surface. To extend reach, the limbs of the LEMUR IIb are 25 percent longer than those of the LEMUR II. Additional benefits stemming from the modifications are that the robot body supported by the limbs is now less massive and its center of gravity is now closer to the surface along which the robot is to move. These benefits have been obtained without sacrificing load-carrying capacity. Hence, overall, the LEMUR IIb is a more adept climber.

Compact, Automated Centrifugal Slide-Staining System

NASA Technical Reports Server (NTRS)

Feeback, Daniel L.; Clarke, Mark S. F.

2004-01-01

The Directional Acceleration Vector-Driven Displacement of Fluids (DAVD-DOF) system, under development at the time of reporting the information for this article, would be a relatively compact, automated, centrifugally actuated system for staining blood smears and other microbiological samples on glass microscope slides in either a microgravitational or a normal Earth gravitational environment. The DAVD-DOF concept is a successor to the centrifuge-operated slide stainer (COSS) concept, which was reported in Slide-Staining System for Microgravity or Gravity (MSC-22949), NASA Tech Briefs, Vol. 25, No. 1 (January, 2001), page 64. The COSS includes reservoirs and a staining chamber that contains a microscope slide to which a biological sample is affixed. The staining chamber is sequentially filled with and drained of staining and related liquids from the reservoirs by use of a weighted plunger to force liquid from one reservoir to another at a constant level of hypergravity maintained in a standard swing-bucket centrifuge. In the DAVD-DOF system, a staining chamber containing a sample would also be sequentially filled and emptied, but with important differences. Instead of a simple microscope slide, one would use a special microscope slide on which would be fabricated a network of very small reservoirs and narrow channels connected to a staining chamber (see figure). Unlike in the COSS, displacement of liquid would be effected by use of the weight of the liquid itself, rather than the weight of a plunger.

Modeling and design of a two-axis elliptical notch flexure hinge

NASA Astrophysics Data System (ADS)

Wu, Jianwei; Zhang, Yin; Lu, Yunfeng; Wen, Zhongpu; Bin, Deer; Tan, Jiubin

2018-04-01

As an important part of the joule balance system, the two-axis elliptical notch flexure hinge (TENFH) which typically consists of two single-axis elliptical notch flexure hinges was studied. First, a 6 degrees of freedom (6-DOF) compliance model was established based on the coordinate transformation method. In addition, the maximum stress of the TENFH was derived. The compliance and maximum stress model was verified using finite element analysis simulation. To decouple the attitude of the suspended coil system and reduce the offset between the centroid of the suspended coil mechanism and the mass comparator in the joule balance system, a new mechanical structure of TENFH was designed based on the compliance model and stress model proposed in this paper. The maximum rotation range is up to 10°, and the axial load is more than 5 kg, which meets the requirements of the system. The compliance model was also verified by deformation experimentation with the designed TENFH.

Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

PubMed

da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

2016-01-01

The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development

PubMed Central

da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

2016-01-01

The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir. PMID:27610237

Transfer of bacteriophage MS2 and fluorescein from N95 filtering facepiece respirators to hands: Measuring fomite potential

PubMed Central

Brady, Tyler M.; Strauch, Amanda L.; Almaguer, Claudia M.; Niezgoda, George; Shafer, Ronald E.; Yorio, Patrick L.; Fisher, Edward M.

2017-01-01

Contact transmission of pathogens from personal protective equipment is a concern within the healthcare industry. During public health emergency outbreaks, resources become constrained and the reuse of personal protective equipment, such as N95 filtering facepiece respirators, may be needed. This study was designed to characterize the transfer of bacteriophage MS2 and fluorescein between filtering facepiece respirators and the wearer’s hands during three simulated use scenarios. Filtering facepiece respirators were contaminated with MS2 and fluorescein in droplets or droplet nuclei. Thirteen test subjects performed filtering facepiece respirator use scenarios including improper doffing, proper doffing and reuse, and improper doffing and reuse. Fluorescein and MS2 contamination transfer were quantified. The average MS2 transfer from filtering facepiece respirators to the subjects’ hands ranged from 7.6–15.4% and 2.2–2.7% for droplet and droplet nuclei derived contamination, respectively. Handling filtering facepiece respirators contaminated with droplets resulted in higher levels of MS2 transfer compared to droplet nuclei for all use scenarios (p = 0.007). MS2 transfer from droplet contaminated filtering facepiece respirators during improper doffing and reuse was greater than transfer during improper doffing (p = 0.008) and proper doffing and reuse (p = 0.042). Droplet contamination resulted in higher levels of fluorescein transfer compared to droplet nuclei contaminated filtering facepiece respirators for all use scenarios (p = 0.009). Fluorescein transfer was greater for improper doffing and reuse (p = 0.007) from droplet contaminated masks compared to droplet nuclei contaminated filtering facepiece respirators and for improper doffing and reuse when compared improper doffing (p = 0.017) and proper doffing and reuse (p = 0.018) for droplet contaminated filtering facepiece respirators. For droplet nuclei contaminated filtering facepiece respirators, the difference in MS2 and fluorescein transfer did not reach statistical significance when comparing any of the use scenarios. The findings suggest that the results of fluorescein and MS2 transfer were consistent and highly correlated across the conditions of study. The data supports CDC recommendations for using proper doffing techniques and discarding filtering facepiece respirators that are directly contaminated with secretions from a cough or sneeze. PMID:28650715

A novel Morse code-inspired method for multiclass motor imagery brain-computer interface (BCI) design.

PubMed

Jiang, Jun; Zhou, Zongtan; Yin, Erwei; Yu, Yang; Liu, Yadong; Hu, Dewen

2015-11-01

Motor imagery (MI)-based brain-computer interfaces (BCIs) allow disabled individuals to control external devices voluntarily, helping us to restore lost motor functions. However, the number of control commands available in MI-based BCIs remains limited, limiting the usability of BCI systems in control applications involving multiple degrees of freedom (DOF), such as control of a robot arm. To address this problem, we developed a novel Morse code-inspired method for MI-based BCI design to increase the number of output commands. Using this method, brain activities are modulated by sequences of MI (sMI) tasks, which are constructed by alternately imagining movements of the left or right hand or no motion. The codes of the sMI task was detected from EEG signals and mapped to special commands. According to permutation theory, an sMI task with N-length allows 2 × (2(N)-1) possible commands with the left and right MI tasks under self-paced conditions. To verify its feasibility, the new method was used to construct a six-class BCI system to control the arm of a humanoid robot. Four subjects participated in our experiment and the averaged accuracy of the six-class sMI tasks was 89.4%. The Cohen's kappa coefficient and the throughput of our BCI paradigm are 0.88 ± 0.060 and 23.5bits per minute (bpm), respectively. Furthermore, all of the subjects could operate an actual three-joint robot arm to grasp an object in around 49.1s using our approach. These promising results suggest that the Morse code-inspired method could be used in the design of BCIs for multi-DOF control. Copyright © 2015 Elsevier Ltd. All rights reserved.

Optical design and evaluation of a 4 mm cost-effective ultra-high-definition arthroscope.

PubMed

Cheng, Dewen; Wang, Yongtian; Yu, Lu; Liu, Xiaohua

2014-08-01

High definition and magnification rigid endoscope plays an important role in modern minimally invasive medical surgery and diagnosis. In this paper, we present the design and evaluation methods of a high definition rigid endoscope, specifically an arthroscope, with a large depth of field (DOF). The incident heights and exit angles of the sampled rays on the relay lens are controlled during the optimization process to ensure an effective field view (70°) and a normal ray path within the limited lens diameter of 2.7 mm. The lens is set up as a multi-configuration system with two extreme and one middle object distances to cover a large DOF. As a result, an entrance pupil of 0.3 mm is achieved for the first time, to bring the theoretical resolution to 23.1 lps/mm in the object space at a working distance of 20 mm, with the wavelength of 0.532 um. The modulation transfer function (MTF) curves approach diffraction limit, and the values are all higher than 0.3 at 160 line pairs/mm (lps/mm) in the image space. Meanwhile, stray light caused by total internal reflection on the inner wall of the rod lenses and the objective lens is eliminated. The measured resolution in the object space at a 20 mm working distance is 22.3 lps/mm, and test results show that other performance characteristics also fulfill design requirements. The relay lenses are designed with only one type of the spacer and two types of lenses to greatly reduce the fabrication and assembly cost. The design method has important research and application values for lens systems used in modern minimally invasive medical surgery and industrial non-destructive testing area.

Achievable degrees of freedom of MIMO two-way relay interference channel with delayed CSIT

NASA Astrophysics Data System (ADS)

Li, Qingyun; Wu, Gang; Li, Shaoqian

2016-10-01

In this paper, assuming each node has delayed channel state information at the transmitter (CSIT), we investigate the achievable degrees of freedom (DOF) of MIMO two-way relay interference channel in frequency division duplex (FDD) systems, where there are K user pairs (i.e., 2K users) and each user in a user pair exchanges messages with the other user in the same user pair simultaneously via an intermediate relay. We propose a two-stage transmission scheme and derive the closed-form expressions for its achievable DOF.

Automated Re-Entry System using FNPEG

NASA Technical Reports Server (NTRS)

Johnson, Wyatt R.; Lu, Ping; Stachowiak, Susan J.

2017-01-01

This paper discusses the implementation and simulated performance of the FNPEG (Fully Numerical Predictor-corrector Entry Guidance) algorithm into GNC FSW (Guidance, Navigation, and Control Flight Software) for use in an autonomous re-entry vehicle. A few modifications to FNPEG are discussed that result in computational savings -- a change to the state propagator, and a modification to cross-range lateral logic. Finally, some Monte Carlo results are presented using a representative vehicle in both a high-fidelity 6-DOF (degree-of-freedom) sim as well as in a 3-DOF sim for independent validation.

Stereo-hologram in discrete depth of field (Conference Presentation)

NASA Astrophysics Data System (ADS)

Lee, Kwanghoon; Park, Min-Chul

2017-05-01

In holographic space, continuous object space can be divided as several discrete spaces satisfied each of same depth of field (DoF). In the environment of wearable device using holography, specially, this concept can be applied to macroscopy filed in contrast of the field of microscopy. Since the former has not need to high depth resolution because perceiving power of eye in human visual system, it can distinguish clearly among the objects in depth space, has lower than optical power of microscopic field. Therefore continuous but discrete depth of field (DDoF) for whole object space can present the number of planes included sampled space considered its DoF. Each DoF plane has to consider the occlusion among the object's areas in its region to show the occluded phenomenon inducing by the visual axis around the eye field of view. It makes natural scene in recognition process even though the combined discontinuous DoF regions are altered to the continuous object space. Thus DDoF pull out the advantages such as saving consuming time of the calculation process making the hologram and the reconstruction. This approach deals mainly the properties of several factors required in stereo hologram HMD such as stereoscopic DoF according to the convergence, least number of DDoFs planes in normal visual circumstance (within to 10,000mm), the efficiency of saving time for taking whole holographic process under the our method compared to the existing. Consequently this approach would be applied directly to the stereo-hologram HMD field to embody a real-time holographic imaging.

Change of a motor synergy for dampening hand vibration depending on a task difficulty.

PubMed

Togo, Shunta; Kagawa, Takahiro; Uno, Yoji

2014-10-01

The present study investigated the relationship between the number of usable degrees of freedom (DOFs) and joint coordination during a human-dampening hand vibration task. Participants stood on a platform generating an anterior-posterior directional oscillation and held a water-filled cup. Their usable DOFs were changed under the following conditions of limb constraint: (1) no constraint; (2) ankle constrained; and (3) ankle-knee constrained. Kinematic whole-body data were recorded using a three-dimensional position measurement system. The jerk of each body part was evaluated as an index of oscillation intensity. To quantify joint coordination, an uncontrolled manifold (UCM) analysis was applied and the variance of joints related to hand jerk divided into two components: a UCM component that did not affect hand jerk and an orthogonal (ORT) component that directly affected hand jerk. The results showed that hand jerk when the task used a cup filled with water was significantly smaller than when a cup containing stones was used, regardless of limb constraint condition. Thus, participants dampened their hand vibration utilizing usable joint DOFs. According to UCM analysis, increasing the oscillation velocity and the decrease in usable DOFs by the limb constraints led to an increase of total variance of the joints and the UCM component, indicating that a synergy-dampening hand vibration was enhanced. These results show that the variance of usable joint DOFs is more fitted to the UCM subspace when the joints are varied by increasing the velocity and limb constraints and suggest that humans adopt enhanced synergies to achieve more difficult tasks.

Implementation and performance of the metrology system for the multi-object optical and near-infrared spectrograph MOONS

NASA Astrophysics Data System (ADS)

Drass, Holger; Vanzi, Leonardo; Torres-Torriti, Miguel; Dünner, Rolando; Shen, Tzu-Chiang; Belmar, Francisco; Dauvin, Lousie; Staig, Tomás.; Antognini, Jonathan; Flores, Mauricio; Luco, Yerko; Béchet, Clémentine; Boettger, David; Beard, Steven; Montgomery, David; Watson, Stephen; Cabral, Alexandre; Hayati, Mahmoud; Abreu, Manuel; Rees, Phil; Cirasuolo, Michele; Taylor, William; Fairley, Alasdair

2016-08-01

The Multi-Object Optical and Near-infrared Spectrograph (MOONS) will cover the Very Large Telescope's (VLT) field of view with 1000 fibres. The fibres will be mounted on fibre positioning units (FPU) implemented as two-DOF robot arms to ensure a homogeneous coverage of the 500 square arcmin field of view. To accurately and fast determine the position of the 1000 fibres a metrology system has been designed. This paper presents the hardware and software design and performance of the metrology system. The metrology system is based on the analysis of images taken by a circular array of 12 cameras located close to the VLTs derotator ring around the Nasmyth focus. The system includes 24 individually adjustable lamps. The fibre positions are measured through dedicated metrology targets mounted on top of the FPUs and fiducial markers connected to the FPU support plate which are imaged at the same time. A flexible pipeline based on VLT standards is used to process the images. The position accuracy was determined to 5 μm in the central region of the images. Including the outer regions the overall positioning accuracy is 25 μm. The MOONS metrology system is fully set up with a working prototype. The results in parts of the images are already excellent. By using upcoming hardware and improving the calibration it is expected to fulfil the accuracy requirement over the complete field of view for all metrology cameras.

Two degree of freedom internal model control-PID design for LFC of power systems via logarithmic approximations.

PubMed

Singh, Jay; Chattterjee, Kalyan; Vishwakarma, C B

2018-01-01

Load frequency controller has been designed for reduced order model of single area and two-area reheat hydro-thermal power system through internal model control - proportional integral derivative (IMC-PID) control techniques. The controller design method is based on two degree of freedom (2DOF) internal model control which combines with model order reduction technique. Here, in spite of taking full order system model a reduced order model has been considered for 2DOF-IMC-PID design and the designed controller is directly applied to full order system model. The Logarithmic based model order reduction technique is proposed to reduce the single and two-area high order power systems for the application of controller design.The proposed IMC-PID design of reduced order model achieves good dynamic response and robustness against load disturbance with the original high order system. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

A novel 4-DOF surgical instrument with modular joints and 6-Axis Force sensing capability.

PubMed

Li, Kun; Pan, Bo; Zhang, Fuhai; Gao, Wenpeng; Fu, Yili; Wang, Shuguo

2017-03-01

It is difficult for surgeons to exert appropriate forces during delicate operations due to lack of force feedback in robot-assisted minimally invasive surgery (RMIS). A 4-DOF surgical grasper with a modular wrist and 6-axis force sensing capability is developed. A grasper integrated with a miniature force and torque sensor based on the Stewart platform is designed, and a cable tension decomposition mechanism is designed to alleviate influence of the cable tension to the sensor. A modularized wrist consisting of four joint units is designed to facilitate integration of the sensor and eliminate coupled motion of the wrist. Sensing ranges of this instrument are ±10 N and ±160 N mm, and resolutions are 1.2% in radial directions, 5% in axial direction, and 4.2% in rotational directions. An ex vivo experiment shows that this instrument prototype successfully measures the interaction forces. A 4-DOF surgical instrument with modular joints and 6-axis force sensing capability is developed. This instrument can be used for force feedback in RMIS. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Dynamic modeling and hierarchical compound control of a novel 2-DOF flexible parallel manipulator with multiple actuation modes

NASA Astrophysics Data System (ADS)

Liang, Dong; Song, Yimin; Sun, Tao; Jin, Xueying

2018-03-01

This paper addresses the problem of rigid-flexible coupling dynamic modeling and active control of a novel flexible parallel manipulator (PM) with multiple actuation modes. Firstly, based on the flexible multi-body dynamics theory, the rigid-flexible coupling dynamic model (RFDM) of system is developed by virtue of the augmented Lagrangian multipliers approach. For completeness, the mathematical models of permanent magnet synchronous motor (PMSM) and piezoelectric transducer (PZT) are further established and integrated with the RFDM of mechanical system to formulate the electromechanical coupling dynamic model (ECDM). To achieve the trajectory tracking and vibration suppression, a hierarchical compound control strategy is presented. Within this control strategy, the proportional-differential (PD) feedback controller is employed to realize the trajectory tracking of end-effector, while the strain and strain rate feedback (SSRF) controller is developed to restrain the vibration of the flexible links using PZT. Furthermore, the stability of the control algorithm is demonstrated based on the Lyapunov stability theory. Finally, two simulation case studies are performed to illustrate the effectiveness of the proposed approach. The results indicate that, under the redundant actuation mode, the hierarchical compound control strategy can guarantee the flexible PM achieves singularity-free motion and vibration attenuation within task workspace simultaneously. The systematic methodology proposed in this study can be conveniently extended for the dynamic modeling and efficient controller design of other flexible PMs, especially the emerging ones with multiple actuation modes.

The Development of Rigorously Correct, Dynamical Pseudopotentials for Use in Mixed Quantum/Classical Molecular Dynamics Simulations in the Condensed Phase

NASA Astrophysics Data System (ADS)

Kahros, Argyris

Incorporating quantum mechanics into an atomistic simulation necessarily involves solving the Schrodinger equation. Unfortunately, the computational expense associated with solving this equation scales miserably with the number of included quantum degrees of freedom (DOF). The situation is so dire, in fact, that a molecular dynamics (MD) simulation cannot include more than a small number of quantum DOFs before it becomes computationally intractable. Thus, if one were to simulate a relatively large system, such as one containing several hundred atoms or molecules, it would be unreasonable to attempt to include the effects of all of the electrons associated with all of the components of the system. The mixed quantum/classical (MQC) approach provides a way to circumvent this issue. It involves treating the vast majority of the system classically, which incurs minimal computational expense, and reserves the consideration of quantum mechanical effects for only the few degrees of freedom more directly involved in the chemical phenomenon being studied. For example, if one were to study the bonding of a single diatomic molecule in the gas phase, one could employ a MQC approach by treating the nuclei of the molecule's two atoms classically---including the deeply bound, low-energy electrons that change relatively little---and solving the Schrodinger equation only for the high energy electron(s) directly involved in the bonding of the classical cores. In such a way, one could study the bonding of this molecule in a rigorous fashion while treating only the directly related degrees of freedom quantum mechanically. Pseudopotentials are then responsible for dictating the interactions between the quantum and classical degrees of freedom. As these potentials are the sole link between the quantum and classical DOFs, their proper development is of the utmost importance. This Thesis is concerned primarily with my work on the development of novel, rigorous and dynamical pseudopotentials for use in mixed quantum/ classical simulations in the condensed phase. The pseudopotentials discussed within are constructed in an ab initio fashion, without the introduction of any empiricism, and are able to exactly reproduce the results of higher level, fully quantum mechanical Hartree-Fock calculations. A recurring theme in the following pages is overcoming the so-called frozen core approximation (FCA). This essentially comes down to creating pseudopotentials that are able to respond in some way to the local molecular environment in a rigorous fashion. The various methods and discussions that are part of this document are presented in the context of two particular systems. The first is the sodium dimer cation molecule, which serves as a proof of concept for the development of coordinate-dependent pseudopotentials and is the subject of Chapters 2 and 3. Next, the hydrated electron---the excess electron in liquid water---is tackled in an effort to address the recent controversy concerning its true structure and is the subject of Chapters 4 and 5. In essence, the work in this Dissertation is concerned with finding new ways to overcome the problem of a lack of infinite computer processing power.

Design and fabrication of a 1-DOF drive mode and 2-DOF sense mode micro-gyroscope using SU-8 based UV-LIGA process

NASA Astrophysics Data System (ADS)

Verma, Payal; Juneja, Sucheta; Savelyev, Dmitry A.; Khonina, Svetlana N.; Gopal, Ram

2016-04-01

This paper presents design and fabrication of a 1-DOF (degree-of-freedom) drive mode and 2-DOF sense mode micro-gyroscope. It is an inherently robust structure and offers a high sense frequency bandwidth. The proposed design utilizes resonance of the1-DOF drive mode oscillator and employs dynamic amplification concept in sense modes to increase the sensitivity while maintaining robustness. The 2-DOF in the sense direction renders the device immune to process imperfections and environmental effects. The design is simulated using FEA software (CoventorWare®). The device is designed considering process compatibility with SU-8 based UV-LIGA process, which is an economical fabrication technique. The complete fabrication process is presented along with SEM images of the fabricated device. The device has 9 µm thick Nickel as the key structural layer with an overall reduced key structure size of 2.2 mm by 2.1 mm.

Computational Fluid Dynamics Demonstration of Rigid Bodies in Motion

NASA Technical Reports Server (NTRS)

Camarena, Ernesto; Vu, Bruce T.

2011-01-01

The Design Analysis Branch (NE-Ml) at the Kennedy Space Center has not had the ability to accurately couple Rigid Body Dynamics (RBD) and Computational Fluid Dynamics (CFD). OVERFLOW-D is a flow solver that has been developed by NASA to have the capability to analyze and simulate dynamic motions with up to six Degrees of Freedom (6-DOF). Two simulations were prepared over the course of the internship to demonstrate 6DOF motion of rigid bodies under aerodynamic loading. The geometries in the simulations were based on a conceptual Space Launch System (SLS). The first simulation that was prepared and computed was the motion of a Solid Rocket Booster (SRB) as it separates from its core stage. To reduce computational time during the development of the simulation, only half of the physical domain with respect to the symmetry plane was simulated. Then a full solution was prepared and computed. The second simulation was a model of the SLS as it departs from a launch pad under a 20 knot crosswind. This simulation was reduced to Two Dimensions (2D) to reduce both preparation and computation time. By allowing 2-DOF for translations and 1-DOF for rotation, the simulation predicted unrealistic rotation. The simulation was then constrained to only allow translations.

Gender dimorphic ACL strain in response to combined dynamic 3D knee joint loading: implications for ACL injury risk.

PubMed

Mizuno, Kiyonori; Andrish, Jack T; van den Bogert, Antonie J; McLean, Scott G

2009-12-01

While gender-based differences in knee joint anatomies/laxities are well documented, the potential for them to precipitate gender-dimorphic ACL loading and resultant injury risk has not been considered. To this end, we generated gender-specific models of ACL strain as a function of any six degrees of freedom (6DOF) knee joint load state via a combined cadaveric and analytical approach. Continuously varying joint forces and torques were applied to five male and five female cadaveric specimens and recorded along with synchronous knee flexion and ACL strain data. All data (approximately 10,000 samples) were submitted to specimen-specific regression analyses, affording ACL strain predictions as a function of the combined 6 DOF knee loads. Following individual model verifications, generalized gender-specific models were generated and subjected to 6 DOF external load scenarios consistent with both a clinical examination and a dynamic sports maneuver. The ensuing model-based strain predictions were subsequently examined for gender-based discrepancies. Male and female specimen-specific models predicted ACL strain within 0.51%+/-0.10% and 0.52%+/-0.07% of the measured data respectively, and explained more than 75% of the associated variance in each case. Predicted female ACL strains were also significantly larger than respective male values for both simulated 6 DOF load scenarios. Outcomes suggest that the female ACL will rupture in response to comparatively smaller external load applications. Future work must address the underlying anatomical/laxity contributions to knee joint mechanical and resultant ACL loading, ultimately affording prevention strategies that may cater to individual joint vulnerabilities.

Optimised robot-based system for the exploration of elastic joint properties.

PubMed

Frey, M; Burgkart, R; Regenfelder, F; Riener, R

2004-09-01

Numerous publications provide measured biomechanical data relating to synovial joints. However, in general, they do not reflect the non-linear elastic joint properties in detail or do not consider all degrees of freedom (DOF), or the quantity of data is sparse. To perform more comprehensive, extended measurements of elastic joint properties, an optimised robot-based approach was developed. The basis was an industrial, high-precision robot that was capable of applying loads to the joint and measuring the joint displacement in 6 DOF. The system was equipped with novel, custom-made control hardware. In contrast to the commonly used sampling rates that are below 100 Hz, a rate of 4 kHz was realised for each DOF. This made it possible to implement advanced, highly dynamic, quasi-continuous closed-loop controllers. Thus oscillations of the robot were avoided, and measurements were speeded up. The stiffness of the entire system was greater than 44 kNm(-1) and 22 Nm deg(-1), and the maximum difference between two successive measurements was less than 0.5 deg. A sophisticated CT-based referencing routine facilitated the matching of kinematic data with the individual anatomy of the tested joint. The detailed detection of the elastic varus-valgus properties of a human knee joint is described, and the need for high spatial resolution is demonstrated.

Compensator-based 6-DOF control for probe asteroid-orbital-frame hovering with actuator limitations

NASA Astrophysics Data System (ADS)

Liu, Xiaosong; Zhang, Peng; Liu, Keping; Li, Yuanchun

2016-05-01

This paper is concerned with 6-DOF control of a probe hovering in the orbital frame of an asteroid. Considering the requirements of the scientific instruments pointing direction and orbital position in practical missions, the coordinate control of relative attitude and orbit between the probe and target asteroid is imperative. A 6-DOF dynamic equation describing the relative translational and rotational motion of a probe in the asteroid's orbital frame is derived, taking the irregular gravitation, model and parameter uncertainties and external disturbances into account. An adaptive sliding mode controller is employed to guarantee the convergence of the state error, where the adaptation law is used to estimate the unknown upper bound of system uncertainty. Then the controller is improved to deal with the practical problem of actuator limitations by introducing a RBF neural network compensator, which is used to approximate the difference between the actual control with magnitude constraint and the designed nominal control law. The closed-loop system is proved to be asymptotically stable through the Lyapunov stability analysis. Numerical simulations are performed to compare the performances of the preceding designed control laws. Simulation results demonstrate the validity of the control scheme using the compensator-based adaptive sliding mode control law in the presence of actuator limitations, system uncertainty and external disturbance.

From reaching to reach-to-grasp: the arm posture difference and its implications on human motion control strategy.

PubMed

Li, Zhi; Milutinović, Dejan; Rosen, Jacob

2017-05-01

Reach-to-grasp arm postures differ from those in pure reaching because they are affected by grasp position/orientation, rather than simple transport to a position during a reaching motion. This paper investigates this difference via an analysis of experimental  data collected on reaching and reach-to-grasp motions. A seven-degree-of-freedom (DOFs) kinematic arm model with the swivel angle is used for the motion analysis. Compared to a widely used anatomical arm model, this model distinguishes clearly the four grasping-relevant DOFs (GR-DOFs) that are affected by positions and orientations of the objects to be grasped. These four GR-DOFs include the swivel angle that measures the elbow rotation about the shoulder-wrist axis, and three wrist joint angles. For each GR-DOF, we quantify position vs orientation task-relevance bias that measures how much the DOF is affected by the grasping position vs orientation. The swivel angle and forearm supination have similar bias, and the analysis of their motion suggests two hypotheses regarding the synergistic coordination of the macro- and micro-structures of the human arm (1) DOFs with similar task-relevance are synergistically coordinated; and (2) such synergy breaks when a task-relevant DOF is close to its joint limit without necessarily reaching the limit. This study provides a motion analysis method to reduce the control complexity for reach-to-grasp tasks, and suggests using dynamic coupling to coordinate the hand and arm of upper-limb exoskeletons.

Refined hyperentanglement purification of two-photon systems for high-capacity quantum communication with cavity-assisted interaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Du, Fang-Fang; Li, Tao; Long, Gui-Lu, E-mail: gllong@tsinghua.edu.cn

Hyperentanglement, defined as the entanglement in multiple degrees of freedom (DOFs) of a photonic quantum system, has attracted much attention recently as it can improve the channel capacity of quantum communication largely. Here we present a refined hyperentanglement purification protocol (hyper-EPP) for two-photon systems in mixed hyperentangled states in both the spatial-mode and polarization DOFs, assisted by cavity quantum electrodynamics. By means of the spatial (polarization) quantum state transfer process, the quantum states that are discarded in the previous hyper-EPPs can be preserved. That is, the spatial (polarization) state of a four-photon system with high fidelity can be transformed intomore » another four-photon system with low fidelity, not disturbing its polarization (spatial) state, which makes this hyper-EPP take the advantage of possessing a higher efficiency.« less

Mode localization in a class of multidegree-of-freedom nonlinear systems with cyclic symmetry

NASA Astrophysics Data System (ADS)

Vakakis, Alexander F.; Cetinkaya, Cetin

1993-02-01

The free oscillations of n-degree-of-freedom (DOF) nonlinear systems with cyclic symmetry and weak coupling between substructures are examined. An asymptotic methodology is used to detect localized nonsimilar normal modes, i.e., free periodic motions spatially confined to only a limited number of substructures of the cyclic system. It is shown that nonlinear mode localization occurs in the perfectly symmetric, weakly coupled structure, in contrast to linear mode localization, which exists only in the presence of substructure 'mistuning'. In addition to the localized modes, nonlocalized modes are also found in the weakly coupled system. The stability of the identified modes is investigated by means of an approximate two-timing averaging mothodology, and the general theory is applied to the case of a cyclic system with three-DOF. The theoretical results are then verified by direct numerical integrations of the equations of motion.

Learning-based position control of a closed-kinematic chain robot end-effector

NASA Technical Reports Server (NTRS)

Nguyen, Charles C.; Zhou, Zhen-Lei

1990-01-01

A trajectory control scheme whose design is based on learning theory, for a six-degree-of-freedom (DOF) robot end-effector built to study robotic assembly of NASA hardwares in space is presented. The control scheme consists of two control systems: the feedback control system and the learning control system. The feedback control system is designed using the concept of linearization about a selected operating point, and the method of pole placement so that the closed-loop linearized system is stabilized. The learning control scheme consisting of PD-type learning controllers, provides additional inputs to improve the end-effector performance after each trial. Experimental studies performed on a 2 DOF end-effector built at CUA, for three tracking cases show that actual trajectories approach desired trajectories as the number of trials increases. The tracking errors are substantially reduced after only five trials.

A Flexure-Based Mechanism for Precision Adjustment of National Ignition Facility Target Shrouds in Three Rotational Degrees of Freedom

DOE PAGES

Boehm, K. -J.; Gibson, C. R.; Hollaway, J. R.; ...

2016-09-01

This study presents the design of a flexure-based mount allowing adjustment in three rotational degrees of freedom (DOFs) through high-precision set-screw actuators. The requirements of the application called for small but controlled angular adjustments for mounting a cantilevered beam. The proposed design is based on an array of parallel beams to provide sufficiently high stiffness in the translational directions while allowing angular adjustment through the actuators. A simplified physical model in combination with standard beam theory was applied to estimate the deflection profile and maximum stresses in the beams. A finite element model was built to calculate the stresses andmore » beam profiles for scenarios in which the flexure is simultaneously actuated in more than one DOF.« less

Communication: Methane dissociation on Ni(111) surface: Importance of azimuth and surface impact site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, Xiangjian; State Key Laboratory of Molecular Reaction Dynamics and Center for Theoretical Computational Chemistry, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023; Zhang, Zhaojun, E-mail: zhangzhj@dicp.ac.cn, E-mail: zhangdh@dicp.ac.cn

2016-03-14

Understanding the role of reactant ro-vibrational degrees of freedom (DOFs) in reaction dynamics of polyatomic molecular dissociation on metal surfaces is of great importance to explore the complex chemical reaction mechanism. Here, we present an expensive quantum dynamics study of the dissociative chemisorption of CH{sub 4} on a rigid Ni(111) surface by developing an accurate nine-dimensional quantum dynamical model including the DOF of azimuth. Based on a highly accurate fifteen-dimensional potential energy surface built from first principles, our simulations elucidate that the dissociation probability of CH{sub 4} has the strong dependence on azimuth and surface impact site. Some improvements aremore » suggested to obtain the accurate dissociation probability from quantum dynamics simulations.« less

A small biomimetic quadruped robot driven by multistacked dielectric elastomer actuators

NASA Astrophysics Data System (ADS)

Nguyen, Canh Toan; Phung, Hoa; Dat Nguyen, Tien; Lee, Choonghan; Kim, Uikyum; Lee, Donghyouk; Moon, Hyungpil; Koo, Jachoon; Nam, Jae-do; Ryeol Choi, Hyouk

2014-06-01

A kind of dielectric elastomer (DE) material, called ‘synthetic elastomer’, has been developed based on acrylonitrile butadiene rubber (NBR) to be used as a dielectric elastomer actuator (DEA). By stacking single layers of synthetic elastomer, a linear actuator, called a multistacked actuator, is produced, and used by mechatronic and robotic systems to generate linear motion. In this paper, we demonstrate the application of the multistacked dielectric elastomer actuator in a biomimetic legged robot. A miniature robot driven by a biomimetic actuation system with four 2-DOF (two-degree-of-freedom) legged mechanisms is realized. Based on the experimental results, we evaluate the performance of the proposed robot and validate the feasibility of the multistacked actuator in a locomotion system as a replacement for conventional actuators.

A novel method for simultaneous measurement of doped optical fiber parameters

NASA Astrophysics Data System (ADS)

Karimi, M.; Seraji, F. E.

2010-05-01

Simultaneous measurement technique of evaluating the doped optical fibers (DOF) parameters is a suitable scheme for DOF production industries. In this paper, we introduce a novel technique to characterize simultaneously the main parameters of DOF such as absorption and emission cross-sections (ACS, ECS), background loss coefficient (BLC), and low dopant concentration using the gain equation of DOFs. We used this new method to determine the ACS, ECS, BLC in a standard sample of Al-P-Erbium doped optical fiber. The results have been analyzed and compared with other reports.

Expression of the Maize Dof1 Transcription Factor in Wheat and Sorghum

PubMed Central

Peña, Pamela A.; Quach, Truyen; Sato, Shirley; Ge, Zhengxiang; Nersesian, Natalya; Changa, Taity; Dweikat, Ismail; Soundararajan, Madhavan; Clemente, Tom E.

2017-01-01

Nitrogen is essential for plant growth and development. Improving the ability of plants to acquire and assimilate nitrogen more efficiently is a key agronomic parameter that will augment sustainability in agriculture. A transcription factor approach was pursued to address improvement of nitrogen use efficiency in two major commodity crops. To this end, the Zea mays Dof1 (ZmDof1) transcription factor was expressed in both wheat (Triticum aestivum) and sorghum (Sorghum bicolor) either constitutively, UBI4 promoter from sugarcane, or in a tissue specific fashion via the maize rbcS1 promoter. The primary transcription activation target of ZmDof1, phosphoenolpyruvate carboxylase (PEPC), is observed in transgenic wheat events. Expression ZmDof1 under control of the rbcs1 promoter translates to increase in biomass and yield components in wheat. However, constitutive expression of ZmDof1 led to the down-regulation of genes involved in photosynthesis and the functional apparatus of chloroplasts, and an outcome that negatively impacts photosynthesis, height, and biomass in wheat. Similar patterns were also observed in sorghum transgenic events harboring the constitutive expression cassette of ZmDof1. These results indicate that transcription factor strategies to boost agronomic phenotypic outcomes in crops need to consider expression patterns of the genetic elements to be introduced. PMID:28424717

High-capacity quantum secure direct communication using hyper-entanglement of photonic qubits

NASA Astrophysics Data System (ADS)

Cai, Jiarui; Pan, Ziwen; Wang, Tie-Jun; Wang, Sihai; Wang, Chuan

2016-11-01

Hyper-entanglement is a system constituted by photons entangled in multiple degrees of freedom (DOF), being considered as a promising way of increasing channel capacity and guaranteeing powerful eavesdropping safeguard. In this work, we propose a coding scheme based on a 3-particle hyper-entanglement of polarization and orbital angular momentum (OAM) system and its application as a quantum secure direct communication (QSDC) protocol. The OAM values are specially encoded by Fibonacci sequence and the polarization carries information by defined unitary operations. The internal relations of the secret message enhances security due to principle of quantum mechanics and Fibonacci sequence. We also discuss the coding capacity and security property along with some simulation results to show its superiority and extensibility.

Ankle mechanics during sidestep cutting implicates need for 2-degrees of freedom powered ankle-foot prostheses.

PubMed

Ficanha, Evandro M; Rastgaar, Mohammad; Kaufman, Kenton R

2015-01-01

The ankle joint of currently available powered prostheses is capable of controlling one degree of freedom (DOF), focusing on improved mobility in the sagittal plane. To increase agility, the requirements of turning in prosthesis design need to be considered. Ankle kinematics and kinetics were studied during sidestep cutting and straight walking. There were no significant differences between the ankle sagittal plane mechanics when comparing sidestep cutting and straight walking; however, significant differences were observed in ankle frontal plane mechanics. During straight walking, the inversion-eversion (IE) angles were smaller than with sidestep cutting. The ankle that initiated the sidestep cutting showed progressively increasing inversion from 2 to 13 degrees while the following contralateral step showed progressively decreasing inversion from 8 to -4 degrees during normal walking speed. The changes in IE kinematics were the most significant during sidestep cutting compared with straight walking. The IE moments of the step that initiated the sidestep cutting were always in eversion, acting as a braking moment opposing the inverting motion. This suggests that an ankle-foot prosthesis with active DOFs in the sagittal and frontal planes will increase the agility of gait for patients with limb loss.

Transient and chaotic low-energy transfers in a system with bistable nonlinearity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Romeo, F., E-mail: francesco.romeo@uniroma1.it; Manevitch, L. I.; Bergman, L. A.

2015-05-15

The low-energy dynamics of a two-dof system composed of a grounded linear oscillator coupled to a lightweight mass by means of a spring with both cubic nonlinear and negative linear components is investigated. The mechanisms leading to intense energy exchanges between the linear oscillator, excited by a low-energy impulse, and the nonlinear attachment are addressed. For lightly damped systems, it is shown that two main mechanisms arise: Aperiodic alternating in-well and cross-well oscillations of the nonlinear attachment, and secondary nonlinear beats occurring once the dynamics evolves solely in-well. The description of the former dissipative phenomenon is provided in a two-dimensionalmore » projection of the phase space, where transitions between in-well and cross-well oscillations are associated with sequences of crossings across a pseudo-separatrix. Whereas the second mechanism is described in terms of secondary limiting phase trajectories of the nonlinear attachment under certain resonance conditions. The analytical treatment of the two aformentioned low-energy transfer mechanisms relies on the reduction of the nonlinear dynamics and consequent analysis of the reduced dynamics by asymptotic techniques. Direct numerical simulations fully validate our analytical predictions.« less

Six degree of freedom simulation system for evaluating automated rendezvous and docking spacecraft

NASA Technical Reports Server (NTRS)

Rourke, Kenneth H.; Tsugawa, Roy K.

1991-01-01

Future logistics supply and servicing vehicles such as cargo transfer vehicles (CTV) must have full 6 degree of freedom (6DOF) capability in order to perform requisite rendezvous, proximity operations, and capture operations. The design and performance issues encountered when developing a 6DOF maneuvering spacecraft are very complex with subtle interactions which are not immediately obvious or easily anticipated. In order to deal with these complexities and develop robust maneuvering spacecraft designs, a simulation system and associated family of tools are used at TRW for generating and validating spacecraft performance requirements and guidance algorithms. An overview of the simulator and tools is provided. These are used by TRW for autonomous rendezvous and docking research projects including CTV studies.

Exoskeleton for gait rehabilitation of children: Conceptual design.

PubMed

Cornejo, Jorge L; Santana, Jesus F; Salinas, Sergio A

2017-07-01

This paper presents the conceptual design of an exoskeleton for gait rehabilitation of children. This system has electronics, mechanicals and software sections, which are implemented and tested using a mannequin of a child. The prototype uses servomotors to move robotic joints that are attached to simulated patient's legs. The design has 4 DOF (degrees of freedom) two for hip joints and other two for knee joints, in the sagittal plane. A microcontroller measures sensor signals, controls motors and exchanges data with a computer. The user interacts with a graphical interface to configure, control and monitor the exoskeleton activities. The laboratory tests show soften movements in joint angle tracking.

Hand controller commonality evaluation process

NASA Technical Reports Server (NTRS)

Stuart, Mark A.; Bierschwale, John M.; Wilmington, Robert P.; Adam, Susan C.; Diaz, Manuel F.; Jensen, Dean G.

1990-01-01

A hand controller evaluation process has been developed to determine the appropriate hand controller configurations for supporting remotely controlled devices. These devices include remote manipulator systems (RMS), dexterous robots, and remotely-piloted free flyers. Standard interfaces were developed to evaluate six different hand controllers in three test facilities including dynamic computer simulations, kinematic computer simulations, and physical simulations. The hand controllers under consideration were six degree-of-freedom (DOF) position and rate minimaster and joystick controllers, and three-DOF rate controllers. Task performance data, subjective comments, and anthropometric data obtained during tests were used for controller configuration recommendations to the SSF Program.

A simple 5-DoF MR-compatible motion signal measurement system.

PubMed

Chung, Soon-Cheol; Kim, Hyung-Sik; Yang, Jae-Woong; Lee, Su-Jeong; Choi, Mi-Hyun; Kim, Ji-Hye; Yeon, Hong-Won; Park, Jang-Yeon; Yi, Jeong-Han; Tack, Gye-Rae

2011-09-01

The purpose of this study was to develop a simple motion measurement system with magnetic resonance (MR) compatibility and safety. The motion measurement system proposed here can measure 5-DoF motion signals without deteriorating the MR images, and it has no effect on the intense and homogeneous main magnetic field, the temporal-gradient magnetic field (which varies rapidly with time), the transceiver radio frequency (RF) coil, and the RF pulse during MR data acquisition. A three-axis accelerometer and a two-axis gyroscope were used to measure 5-DoF motion signals, and Velcro was used to attach a sensor module to a finger or wrist. To minimize the interference between the MR imaging system and the motion measurement system, nonmagnetic materials were used for all electric circuit components in an MR shield room. To remove the effect of RF pulse, an amplifier, modulation circuit, and power supply were located in a shielded case, which was made of copper and aluminum. The motion signal was modulated to an optic signal using pulse width modulation, and the modulated optic signal was transmitted outside the MR shield room using a high-intensity light-emitting diode and an optic cable. The motion signal was recorded on a PC by demodulating the transmitted optic signal into an electric signal. Various kinematic variables, such as angle, acceleration, velocity, and jerk, can be measured or calculated by using the motion measurement system developed here. This system also enables motion tracking by extracting the position information from the motion signals. It was verified that MR images and motion signals could reliably be measured simultaneously.

Spectral Upscaling for Graph Laplacian Problems with Application to Reservoir Simulation

DOE PAGES

Barker, Andrew T.; Lee, Chak S.; Vassilevski, Panayot S.

2017-10-26

Here, we consider coarsening procedures for graph Laplacian problems written in a mixed saddle-point form. In that form, in addition to the original (vertex) degrees of freedom (dofs), we also have edge degrees of freedom. We extend previously developed aggregation-based coarsening procedures applied to both sets of dofs to now allow more than one coarse vertex dof per aggregate. Those dofs are selected as certain eigenvectors of local graph Laplacians associated with each aggregate. Additionally, we coarsen the edge dofs by using traces of the discrete gradients of the already constructed coarse vertex dofs. These traces are defined on themore » interface edges that connect any two adjacent aggregates. The overall procedure is a modification of the spectral upscaling procedure developed in for the mixed finite element discretization of diffusion type PDEs which has the important property of maintaining inf-sup stability on coarse levels and having provable approximation properties. We consider applications to partitioning a general graph and to a finite volume discretization interpreted as a graph Laplacian, developing consistent and accurate coarse-scale models of a fine-scale problem.« less

Endocavity Ultrasound Probe Manipulators

PubMed Central

Stoianovici, Dan; Kim, Chunwoo; Schäfer, Felix; Huang, Chien-Ming; Zuo, Yihe; Petrisor, Doru; Han, Misop

2014-01-01

We developed two similar structure manipulators for medical endocavity ultrasound probes with 3 and 4 degrees of freedom (DoF). These robots allow scanning with ultrasound for 3-D imaging and enable robot-assisted image-guided procedures. Both robots use remote center of motion kinematics, characteristic of medical robots. The 4-DoF robot provides unrestricted manipulation of the endocavity probe. With the 3-DoF robot the insertion motion of the probe must be adjusted manually, but the device is simpler and may also be used to manipulate external-body probes. The robots enabled a novel surgical approach of using intraoperative image-based navigation during robot-assisted laparoscopic prostatectomy (RALP), performed with concurrent use of two robotic systems (Tandem, T-RALP). Thus far, a clinical trial for evaluation of safety and feasibility has been performed successfully on 46 patients. This paper describes the architecture and design of the robots, the two prototypes, control features related to safety, preclinical experiments, and the T-RALP procedure. PMID:24795525

Active fault tolerant control based on interval type-2 fuzzy sliding mode controller and non linear adaptive observer for 3-DOF laboratory helicopter.

PubMed

Zeghlache, Samir; Benslimane, Tarak; Bouguerra, Abderrahmen

2017-11-01

In this paper, a robust controller for a three degree of freedom (3 DOF) helicopter control is proposed in presence of actuator and sensor faults. For this purpose, Interval type-2 fuzzy logic control approach (IT2FLC) and sliding mode control (SMC) technique are used to design a controller, named active fault tolerant interval type-2 Fuzzy Sliding mode controller (AFTIT2FSMC) based on non-linear adaptive observer to estimate and detect the system faults for each subsystem of the 3-DOF helicopter. The proposed control scheme allows avoiding difficult modeling, attenuating the chattering effect of the SMC, reducing the rules number of the fuzzy controller. Exponential stability of the closed loop is guaranteed by using the Lyapunov method. The simulation results show that the AFTIT2FSMC can greatly alleviate the chattering effect, providing good tracking performance, even in presence of actuator and sensor faults. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

UDOF direct improvement by modulating mask absorber thickness

NASA Astrophysics Data System (ADS)

Yu, Tuan-Yen; Lio, En Chuan; Chen, Po Tsang; Wei, Chih I.; Chen, Yi Ting; Peng, Ming Chun; Chou, William; Yu, Chun Chi

2016-10-01

As the process generation migrate to advanced and smaller dimension or pitch, the mask and resist 3D effects will impact the lithography focus common window severely because of both individual depth-of-focus (iDOF) range decrease and center mismatch. Furthermore, some chemical or thermal factors, such as PEB (Post Exposure Bake) also worsen the usable depth-of-focus (uDOF) performance. So the mismatch of thru-pitch iDOF center should be considered as a lithography process integration issue, and more complicated to partition the 3D effects induced by optical or chemical factors. In order to reduce the impact of 3D effects induced by both optical and chemical issues, and improve iDOF center mismatch, we would like to propose a mask absorber thickness offset approach, which is directly to compensate the iDOF center bias by adjusting mask absorber thickness, for iso, semi-iso or dense characteristics in line, space or via patterns to enlarge common process window, i.e uDOF, which intends to provide similar application as Flexwave[1] (ASML trademark). By the way, since mask absorber thickness offset approach is similar to focus tuning or change on wafer lithography process, it could be acted as the process tuning method of photoresist (PR) profile optimization locally, PR scum improvement in specific patterns or to modulate etching bias to meet process integration request. For mass production consideration, and available material, current att-PSM blank, quartz, MoSi with chrome layer as hard-mask in reticle process, will be implemented in this experiment, i.e. chrome will be kept remaining above partial thru-pitch patterns, and act as the absorber thickness bias in different patterns. And then, from the best focus offset of thru-pitch patterns, the iDOF center shifts could be directly corrected and to enlarge uDOF by increasing the overlap of iDOF. Finally, some negative tone development (NTD) result in line patterns will be demonstrated as well.

Exact analytical approach for six-degree-of-freedom measurement using image-orientation-change method.

PubMed

Tsai, Chung-Yu

2012-04-01

An exact analytical approach is proposed for measuring the six-degree-of-freedom (6-DOF) motion of an object using the image-orientation-change (IOC) method. The proposed measurement system comprises two reflector systems, where each system consists of two reflectors and one position sensing detector (PSD). The IOCs of the object in the two reflector systems are described using merit functions determined from the respective PSD readings before and after motion occurs, respectively. The three rotation variables are then determined analytically from the eigenvectors of the corresponding merit functions. After determining the three rotation variables, the order of the translation equations is downgraded to a linear form. Consequently, the solution for the three translation variables can also be analytically determined. As a result, the motion transformation matrix describing the 6-DOF motion of the object is fully determined. The validity of the proposed approach is demonstrated by means of an illustrative example.

Understanding of and applications for robot vision guidance at KSC

NASA Technical Reports Server (NTRS)

Shawaga, Lawrence M.

1988-01-01

The primary thrust of robotics at KSC is for the servicing of Space Shuttle remote umbilical docking functions. In order for this to occur, robots performing servicing operations must be capable of tracking a swaying Orbiter in Six Degrees of Freedom (6-DOF). Currently, in NASA KSC's Robotic Applications Development Laboratory (RADL), an ASEA IRB-90 industrial robot is being equipped with a real-time computer vision (hardware and software) system to allow it to track a simulated Orbiter interface (target) in 6-DOF. The real-time computer vision system effectively becomes the eyes for the lab robot, guiding it through a closed loop visual feedback system to move with the simulated Orbiter interface. This paper will address an understanding of this vision guidance system and how it will be applied to remote umbilical servicing at KSC. In addition, other current and future applications will be addressed.

18-Degree-of-Freedom Controller Design for the ST7 Disturbance Reduction System

NASA Technical Reports Server (NTRS)

Markley, F. L.; Maghami, P. G.; Houghton, M. B.; Hsu, O. C.

2003-01-01

This paper presents the overall design and analysis process of the spacecraft controller being developed at NASA's Goddard Space Flight Center to close the loop between the GRS and the micro-newton colloidal thrusters. The essential dynamics of the ST7-DRS are captured in a simulation including eighteen rigid-body dynamic degrees of freedom: three translations and three rotations for the spacecraft and for each test mass. The ST7 DRS comprises three control systems: the attitude control system (ACS) to maintain a sun-pointing attitude; the drag free control (DFC) to center the spacecraft about the test masses; and the test mass suspension control. This paper summarizes the control design and analysis of the ST7-DRS 18-DOF model, and is an extension of previous analyses employing a 7-DOF planar model of ST-7.

Development of new vibration energy flow analysis software and its applications to vehicle systems

NASA Astrophysics Data System (ADS)

Kim, D.-J.; Hong, S.-Y.; Park, Y.-H.

2005-09-01

The Energy flow analysis (EFA) offers very promising results in predicting the noise and vibration responses of system structures in medium-to-high frequency ranges. We have developed the Energy flow finite element method (EFFEM) based software, EFADSC++ R4, for the vibration analysis. The software can analyze the system structures composed of beam, plate, spring-damper, rigid body elements and many other components developed, and has many useful functions in analysis. For convenient use of the software, the main functions of the whole software are modularized into translator, model-converter, and solver. The translator module makes it possible to use finite element (FE) model for the vibration analysis. The model-converter module changes FE model into energy flow finite element (EFFE) model, and generates joint elements to cover the vibrational attenuation in the complex structures composed of various elements and can solve the joint element equations by using the wave tra! nsmission approach very quickly. The solver module supports the various direct and iterative solvers for multi-DOF structures. The predictions of vibration for real vehicles by using the developed software were performed successfully.

Gender Dimorphic ACL Strain In Response to Combined Dynamic 3D Knee Joint Loading: Implications for ACL Injury Risk

PubMed Central

Mizuno, Kiyonori; Andrish, Jack T.; van den Bogert, Antonie J.; McLean, Scott G.

2009-01-01

While gender-based differences in knee joint anatomies/laxities are well documented, the potential for them to precipitate gender-dimorphic ACL loading and resultant injury risk has not been considered. To this end, we generated gender-specific models of ACL strain as a function of any six degrees of freedom (6DOF) knee joint load state via a combined cadaveric and analytical approach. Continuously varying joint forces and torques were applied to five male and five female cadaveric specimens and recorded along with synchronous knee flexion and ACL strain data. All data (~10,000 samples) were submitted to specimen-specific regression analyses, affording ACL strain predictions as a function of the combined 6 DOF knee loads. Following individual model verifications, generalized gender-specific models were generated and subjected to 6 DOF external load scenarios consistent with both a clinical examination and a dynamic sports maneuver. The ensuing model-based strain predictions were subsequently examined for gender-based discrepancies. Male and female specimen specific models predicted ACL strain within 0.51% ± 0.10% and 0.52% ± 0.07% of the measured data respectively, and explained more than 75% of the associated variance in each case. Predicted female ACL strains were also significantly larger than respective male values for both of simulated 6 DOF load scenarios. Outcomes suggest that the female ACL will rupture in response to comparatively smaller external load applications. Future work must address the underlying anatomical/laxity contributions to knee joint mechanical and resultant ACL loading, ultimately affording prevention strategies that may cater to individual joint vulnerabilities. PMID:19464897

Six degree-of-freedom analysis of hip, knee, ankle and foot provides updated understanding of biomechanical work during human walking.

PubMed

Zelik, Karl E; Takahashi, Kota Z; Sawicki, Gregory S

2015-03-01

Measuring biomechanical work performed by humans and other animals is critical for understanding muscle-tendon function, joint-specific contributions and energy-saving mechanisms during locomotion. Inverse dynamics is often employed to estimate joint-level contributions, and deformable body estimates can be used to study work performed by the foot. We recently discovered that these commonly used experimental estimates fail to explain whole-body energy changes observed during human walking. By re-analyzing previously published data, we found that about 25% (8 J) of total positive energy changes of/about the body's center-of-mass and >30% of the energy changes during the Push-off phase of walking were not explained by conventional joint- and segment-level work estimates, exposing a gap in our fundamental understanding of work production during gait. Here, we present a novel Energy-Accounting analysis that integrates various empirical measures of work and energy to elucidate the source of unexplained biomechanical work. We discovered that by extending conventional 3 degree-of-freedom (DOF) inverse dynamics (estimating rotational work about joints) to 6DOF (rotational and translational) analysis of the hip, knee, ankle and foot, we could fully explain the missing positive work. This revealed that Push-off work performed about the hip may be >50% greater than conventionally estimated (9.3 versus 6.0 J, P=0.0002, at 1.4 m s(-1)). Our findings demonstrate that 6DOF analysis (of hip-knee-ankle-foot) better captures energy changes of the body than more conventional 3DOF estimates. These findings refine our fundamental understanding of how work is distributed within the body, which has implications for assistive technology, biomechanical simulations and potentially clinical treatment. © 2015. Published by The Company of Biologists Ltd.

An algebraic multigrid method for Q2-Q1 mixed discretizations of the Navier-Stokes equations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prokopenko, Andrey; Tuminaro, Raymond S.

Algebraic multigrid (AMG) preconditioners are considered for discretized systems of partial differential equations (PDEs) where unknowns associated with different physical quantities are not necessarily co-located at mesh points. Speci cally, we investigate a Q 2-Q 1 mixed finite element discretization of the incompressible Navier-Stokes equations where the number of velocity nodes is much greater than the number of pressure nodes. Consequently, some velocity degrees-of-freedom (dofs) are defined at spatial locations where there are no corresponding pressure dofs. Thus, AMG approaches lever- aging this co-located structure are not applicable. This paper instead proposes an automatic AMG coarsening that mimics certain pressure/velocitymore » dof relationships of the Q 2-Q 1 discretization. The main idea is to first automatically define coarse pressures in a somewhat standard AMG fashion and then to carefully (but automatically) choose coarse velocity unknowns so that the spatial location relationship between pressure and velocity dofs resembles that on the nest grid. To define coefficients within the inter-grid transfers, an energy minimization AMG (EMIN-AMG) is utilized. EMIN-AMG is not tied to specific coarsening schemes and grid transfer sparsity patterns, and so it is applicable to the proposed coarsening. Numerical results highlighting solver performance are given on Stokes and incompressible Navier-Stokes problems.« less

An algebraic multigrid method for Q2-Q1 mixed discretizations of the Navier-Stokes equations

DOE PAGES

Prokopenko, Andrey; Tuminaro, Raymond S.

2016-07-01

Algebraic multigrid (AMG) preconditioners are considered for discretized systems of partial differential equations (PDEs) where unknowns associated with different physical quantities are not necessarily co-located at mesh points. Speci cally, we investigate a Q 2-Q 1 mixed finite element discretization of the incompressible Navier-Stokes equations where the number of velocity nodes is much greater than the number of pressure nodes. Consequently, some velocity degrees-of-freedom (dofs) are defined at spatial locations where there are no corresponding pressure dofs. Thus, AMG approaches lever- aging this co-located structure are not applicable. This paper instead proposes an automatic AMG coarsening that mimics certain pressure/velocitymore » dof relationships of the Q 2-Q 1 discretization. The main idea is to first automatically define coarse pressures in a somewhat standard AMG fashion and then to carefully (but automatically) choose coarse velocity unknowns so that the spatial location relationship between pressure and velocity dofs resembles that on the nest grid. To define coefficients within the inter-grid transfers, an energy minimization AMG (EMIN-AMG) is utilized. EMIN-AMG is not tied to specific coarsening schemes and grid transfer sparsity patterns, and so it is applicable to the proposed coarsening. Numerical results highlighting solver performance are given on Stokes and incompressible Navier-Stokes problems.« less

Selecting seats for steel industry mobile machines based on seat effective amplitude transmissibility and comfort.

PubMed

Conrad, Leanne F; Oliver, Michele L; Jack, Robert J; Dickey, James P; Eger, Tammy R

2014-01-01

The purpose of this work was to help a steel industry partner select the most appropriate of three high end heavy equipment seats to retrofit a number of their heavy mobile machines used in the steel making process. The participants included 8 males (22.3 ± 2.0 yrs.) and 8 females (23.5 ± 1.8 yrs.) with no experience operating heavy mobile equipment. Previously recorded 6-DOF chassis acceleration data from a Pot Hauler (a machine which picks up and transports pots of slag) were used to extract six, 20 second representative profiles for implementation on a lab-based heavy machine simulator (6-DOF Parallel Robotics System Corporation robot). Subjects sat on three heavy equipment seats (BeGe7150, Grammar MSG 95G1721, and a 6801 Isringhausen with the seat pan cushion retrofitted with a Skydex cushion) mounted on the simulator. Each subject completed three trials for each combination of seat (n=3) and vibration profile (n=6). Chassis and operator/seat interface vibration were measured by 2, 6-DOF vibration transducers. Variables included Seat Effective Amplitude Transmissibility (SEAT) (X,Y,Z,Roll,Pitch,Yaw,6DOF Vector Sum) to determine if the seat was attenuating or amplifying the vibration, 6-degree of freedom (DOF) vibration total value weighted predicted comfort (Avc) (according to ISO 2631-1) and operator reported comfort (ORC). Factorial ANOVAs revealed significant differences (p < or = 0.05) between seats for all SEAT variables but different seats performed better than others depending on the axis. Significant differences between males and females were observed for SEAT in X,Y, and Pitch as well as for Avs. As expected there were significant differences between vibration profiles for all assessed variables. A number of interaction effects were observed, the most frequently occurring of which was between seat and vibration profile. Based upon the number of seat and vibration profile interactions, results suggest that a single seat is not suited for all tested conditions. However, SEAT values for all of the seats tested were extremely low (e.g., 6-DOF SEAT < 30%) indicating that all of the seats were capable of providing good vibration attenuation.

High-frequency ultrasonic imaging of the anterior segment using an annular array transducer.

PubMed

Silverman, Ronald H; Ketterling, Jeffrey A; Coleman, D Jackson

2007-04-01

Very high-frequency ultrasound (VHFU; >35 megahertz [MHz]) allows imaging of anterior segment structures of the eye with a resolution of less than 40 microm. The low focal ratio of VHFU transducers, however, results in a depth of field (DOF) of less than 1 mm. The aim was to develop a high-frequency annular array transducer for ocular imaging with improved DOF, sensitivity, and resolution compared with conventional transducers. Experimental study. Cadaver eyes, ex vivo cow eyes, in vivo rabbit eyes. A spherically curved annular array ultrasound transducer was fabricated. The array consisted of 5 concentric rings of equal area, had an overall aperture of 6 mm, and a geometric focus of 12 mm. The nominal center frequency of all array elements was 40 MHz. An experimental system was designed in which a single array element was pulsed and echo data were recorded from all elements. By sequentially pulsing each element, echo data were acquired for all 25 transmit-and-receive annuli combinations. The echo data then were focused synthetically and composite images were produced. Transducer operation was tested by scanning a test object consisting of a series of 25-microm diameter wires spaced at increasing range from the transducer. Imaging capabilities of the annular array were demonstrated in ex vivo bovine, in vivo rabbit, and human cadaver eyes. Depth of field, resolution, and sensitivity. The wire scans verified the operation of the array and demonstrated a 6.0-mm DOF, compared with the 1.0-mm DOF of a conventional single-element transducer of comparable frequency, aperture, and focal length. B-mode images of ex vivo bovine, in vivo rabbit, and cadaver eyes showed that although the single-element transducer had high sensitivity and resolution within 1 to 2 mm of its focus, the array with synthetic focusing maintained this quality over a 6-mm DOF. An annular array for high-resolution ocular imaging has been demonstrated. This technology offers improved DOF, sensitivity, and lateral resolution compared with single-element fixed focus transducers currently used for VHFU imaging of the eye.

Human Factors Risk Analyses of a Doffing Protocol for Ebola-Level Personal Protective Equipment: Mapping Errors to Contamination.

PubMed

Mumma, Joel M; Durso, Francis T; Ferguson, Ashley N; Gipson, Christina L; Casanova, Lisa; Erukunuakpor, Kimberly; Kraft, Colleen S; Walsh, Victoria L; Zimring, Craig; DuBose, Jennifer; Jacob, Jesse T

2018-03-05

Doffing protocols for personal protective equipment (PPE) are critical for keeping healthcare workers (HCWs) safe during care of patients with Ebola virus disease. We assessed the relationship between errors and self-contamination during doffing. Eleven HCWs experienced with doffing Ebola-level PPE participated in simulations in which HCWs donned PPE marked with surrogate viruses (ɸ6 and MS2), completed a clinical task, and were assessed for contamination after doffing. Simulations were video recorded, and a failure modes and effects analysis and fault tree analyses were performed to identify errors during doffing, quantify their risk (risk index), and predict contamination data. Fifty-one types of errors were identified, many having the potential to spread contamination. Hand hygiene and removing the powered air purifying respirator (PAPR) hood had the highest total risk indexes (111 and 70, respectively) and number of types of errors (9 and 13, respectively). ɸ6 was detected on 10% of scrubs and the fault tree predicted a 10.4% contamination rate, likely occurring when the PAPR hood inadvertently contacted scrubs during removal. MS2 was detected on 10% of hands, 20% of scrubs, and 70% of inner gloves and the predicted rates were 7.3%, 19.4%, 73.4%, respectively. Fault trees for MS2 and ɸ6 contamination suggested similar pathways. Ebola-level PPE can both protect and put HCWs at risk for self-contamination throughout the doffing process, even among experienced HCWs doffing with a trained observer. Human factors methodologies can identify error-prone steps, delineate the relationship between errors and self-contamination, and suggest remediation strategies.

Acquiring neural signals for developing a perception and cognition model

NASA Astrophysics Data System (ADS)

Li, Wei; Li, Yunyi; Chen, Genshe; Shen, Dan; Blasch, Erik; Pham, Khanh; Lynch, Robert

2012-06-01

The understanding of how humans process information, determine salience, and combine seemingly unrelated information is essential to automated processing of large amounts of information that is partially relevant, or of unknown relevance. Recent neurological science research in human perception, and in information science regarding contextbased modeling, provides us with a theoretical basis for using a bottom-up approach for automating the management of large amounts of information in ways directly useful for human operators. However, integration of human intelligence into a game theoretic framework for dynamic and adaptive decision support needs a perception and cognition model. For the purpose of cognitive modeling, we present a brain-computer-interface (BCI) based humanoid robot system to acquire brainwaves during human mental activities of imagining a humanoid robot-walking behavior. We use the neural signals to investigate relationships between complex humanoid robot behaviors and human mental activities for developing the perception and cognition model. The BCI system consists of a data acquisition unit with an electroencephalograph (EEG), a humanoid robot, and a charge couple CCD camera. An EEG electrode cup acquires brainwaves from the skin surface on scalp. The humanoid robot has 20 degrees of freedom (DOFs); 12 DOFs located on hips, knees, and ankles for humanoid robot walking, 6 DOFs on shoulders and arms for arms motion, and 2 DOFs for head yaw and pitch motion. The CCD camera takes video clips of the human subject's hand postures to identify mental activities that are correlated to the robot-walking behaviors. We use the neural signals to investigate relationships between complex humanoid robot behaviors and human mental activities for developing the perception and cognition model.

Design a software real-time operation platform for wave piercing catamarans motion control using linear quadratic regulator based genetic algorithm.

PubMed

Liang, Lihua; Yuan, Jia; Zhang, Songtao; Zhao, Peng

2018-01-01

This work presents optimal linear quadratic regulator (LQR) based on genetic algorithm (GA) to solve the two degrees of freedom (2 DoF) motion control problem in head seas for wave piercing catamarans (WPC). The proposed LQR based GA control strategy is to select optimal weighting matrices (Q and R). The seakeeping performance of WPC based on proposed algorithm is challenged because of multi-input multi-output (MIMO) system of uncertain coefficient problems. Besides the kinematical constraint problems of WPC, the external conditions must be considered, like the sea disturbance and the actuators (a T-foil and two flaps) control. Moreover, this paper describes the MATLAB and LabVIEW software plats to simulate the reduction effects of WPC. Finally, the real-time (RT) NI CompactRIO embedded controller is selected to test the effectiveness of the actuators based on proposed techniques. In conclusion, simulation and experimental results prove the correctness of the proposed algorithm. The percentage of heave and pitch reductions are more than 18% in different high speeds and bad sea conditions. And the results also verify the feasibility of NI CompactRIO embedded controller.

Design a software real-time operation platform for wave piercing catamarans motion control using linear quadratic regulator based genetic algorithm

PubMed Central

Liang, Lihua; Zhang, Songtao; Zhao, Peng

2018-01-01

This work presents optimal linear quadratic regulator (LQR) based on genetic algorithm (GA) to solve the two degrees of freedom (2 DoF) motion control problem in head seas for wave piercing catamarans (WPC). The proposed LQR based GA control strategy is to select optimal weighting matrices (Q and R). The seakeeping performance of WPC based on proposed algorithm is challenged because of multi-input multi-output (MIMO) system of uncertain coefficient problems. Besides the kinematical constraint problems of WPC, the external conditions must be considered, like the sea disturbance and the actuators (a T-foil and two flaps) control. Moreover, this paper describes the MATLAB and LabVIEW software plats to simulate the reduction effects of WPC. Finally, the real-time (RT) NI CompactRIO embedded controller is selected to test the effectiveness of the actuators based on proposed techniques. In conclusion, simulation and experimental results prove the correctness of the proposed algorithm. The percentage of heave and pitch reductions are more than 18% in different high speeds and bad sea conditions. And the results also verify the feasibility of NI CompactRIO embedded controller. PMID:29709008

Designing, Fabrication and Controlling Of Multipurpose3-DOF Robotic Arm

NASA Astrophysics Data System (ADS)

Nabeel, Hafiz Muhammad; Azher, Anum; Usman Ali, Syed M.; Wahab Mughal, Abdul

2013-12-01

In the present work, we have successfully designed and developed a 3-DOF articulated Robotic Arm capable of performing typical industrial tasks such as painting or spraying, assembling and handling automobiles parts and etc., in resemblance to a human arm. The mechanical assembly is designed on SOLIDWORKS and aluminum grade 6061 -T6 is used for its fabrication in order to reduce the structure weight. We have applied inverse kinematics to determine the joint angles, equations are fed into an efficient microcontroller ATMEGA16 which performs all the calculations to determine the joint angles on the basis of given coordinates to actuate the joints through motorized control. Good accuracy was obtained with quadrature optical encoders installed in each joint to achieve the desired position and a LabVIEW based GUI is designed to provide human machine interface.

Design, Modelling and Teleoperation of a 2 mm Diameter Compliant Instrument for the da Vinci Platform.

PubMed

Francis, P; Eastwood, K W; Bodani, V; Looi, T; Drake, J M

2018-05-07

This work explores the feasibility of creating and accurately controlling an instrument for robotic surgery with a 2 mm diameter and a three degree-of-freedom (DoF) wrist which is compatible with the da Vinci platform. The instrument's wrist is composed of a two DoF bending notched-nitinol tube pattern, for which a kinematic model has been developed. A base mechanism for controlling the wrist is designed for integration with the da Vinci Research Kit. A basic teleoperation task is successfully performed using two of the miniature instruments. The performance and accuracy of the instrument suggest that creating and accurately controlling a 2 mm diameter instrument is feasible and the design and modelling proposed in this work provide a basis for future miniature instrument development.

Cable-driven elastic parallel humanoid head with face tracking for Autism Spectrum Disorder interventions.

PubMed

Su, Hao; Dickstein-Fischer, Laurie; Harrington, Kevin; Fu, Qiushi; Lu, Weina; Huang, Haibo; Cole, Gregory; Fischer, Gregory S

2010-01-01

This paper presents the development of new prismatic actuation approach and its application in human-safe humanoid head design. To reduce actuator output impedance and mitigate unexpected external shock, the prismatic actuation method uses cables to drive a piston with preloaded spring. By leveraging the advantages of parallel manipulator and cable-driven mechanism, the developed neck has a parallel manipulator embodiment with two cable-driven limbs embedded with preloaded springs and one passive limb. The eye mechanism is adapted for low-cost webcam with succinct "ball-in-socket" structure. Based on human head anatomy and biomimetics, the neck has 3 degree of freedom (DOF) motion: pan, tilt and one decoupled roll while each eye has independent pan and synchronous tilt motion (3 DOF eyes). A Kalman filter based face tracking algorithm is implemented to interact with the human. This neck and eye structure is translatable to other human-safe humanoid robots. The robot's appearance reflects a non-threatening image of a penguin, which can be translated into a possible therapeutic intervention for children with Autism Spectrum Disorders.

Imaging and image restoration of an on-axis three-mirror Cassegrain system with wavefront coding technology.

PubMed

Guo, Xiaohu; Dong, Liquan; Zhao, Yuejin; Jia, Wei; Kong, Lingqin; Wu, Yijian; Li, Bing

2015-04-01

Wavefront coding (WFC) technology is adopted in the space optical system to resolve the problem of defocus caused by temperature difference or vibration of satellite motion. According to the theory of WFC, we calculate and optimize the phase mask parameter of the cubic phase mask plate, which is used in an on-axis three-mirror Cassegrain (TMC) telescope system. The simulation analysis and the experimental results indicate that the defocused modulation transfer function curves and the corresponding blurred images have a perfect consistency in the range of 10 times the depth of focus (DOF) of the original TMC system. After digital image processing by a Wiener filter, the spatial resolution of the restored images is up to 57.14 line pairs/mm. The results demonstrate that the WFC technology in the TMC system has superior performance in extending the DOF and less sensitivity to defocus, which has great value in resolving the problem of defocus in the space optical system.

A Novel Telemanipulated Robotic Assistant for Surgical Endoscopy: Preclinical Application to ESD.

PubMed

Zorn, Lucile; Nageotte, Florent; Zanne, Philippe; Legner, Andras; Dallemagne, Bernard; Marescaux, Jacques; de Mathelin, Michel

2018-04-01

Minimally invasive surgical interventions in the gastrointestinal tract, such as endoscopic submucosal dissection (ESD), are very difficult for surgeons when performed with standard flexible endoscopes. Robotic flexible systems have been identified as a solution to improve manipulation. However, only a few such systems have been brought to preclinical trials as of now. As a result, novel robotic tools are required. We developed a telemanipulated robotic device, called STRAS, which aims to assist surgeons during intraluminal surgical endoscopy. This is a modular system, based on a flexible endoscope and flexible instruments, which provides 10 degrees of freedom (DoFs). The modularity allows the user to easily set up the robot and to navigate toward the operating area. The robot can then be teleoperated using master interfaces specifically designed to intuitively control all available DoFs. STRAS capabilities have been tested in laboratory conditions and during preclinical experiments. We report 12 colorectal ESDs performed in pigs, in which large lesions were successfully removed. Dissection speeds are compared with those obtained in similar conditions with the manual Anubiscope platform from Karl Storz. We show significant improvements ( ). These experiments show that STRAS (v2) provides sufficient DoFs, workspace, and force to perform ESD, that it allows a single surgeon to perform all the surgical tasks and those performances are improved with respect to manual systems. The concepts developed for STRAS are validated and could bring new tools for surgeons to improve comfort, ease, and performances for intraluminal surgical endoscopy.

A 6-DOF parallel bone-grinding robot for cervical disc replacement surgery.

PubMed

Tian, Heqiang; Wang, Chenchen; Dang, Xiaoqing; Sun, Lining

2017-12-01

Artificial cervical disc replacement surgery has become an effective and main treatment method for cervical disease, which has become a more common and serious problem for people with sedentary work. To improve cervical disc replacement surgery significantly, a 6-DOF parallel bone-grinding robot is developed for cervical bone-grinding by image navigation and surgical plan. The bone-grinding robot including mechanical design and low level control is designed. The bone-grinding robot navigation is realized by optical positioning with spatial registration coordinate system defined. And a parametric robot bone-grinding plan and high level control have been developed for plane grinding for cervical top endplate and tail endplate grinding by a cylindrical grinding drill and spherical grinding for two articular surfaces of bones by a ball grinding drill. Finally, the surgical flow for a robot-assisted cervical disc replacement surgery procedure is present. The final experiments results verified the key technologies and performance of the robot-assisted surgery system concept excellently, which points out a promising clinical application with higher operability. Finally, study innovations, study limitations, and future works of this present study are discussed, and conclusions of this paper are also summarized further. This bone-grinding robot is still in the initial stage, and there are many problems to be solved from a clinical point of view. Moreover, the technique is promising and can give a good support for surgeons in future clinical work.

Swarm Counter-Asymmetric-Threat (CAT) 6-DOF Dynamics Simulation

DTIC Science & Technology

2005-07-01

NAWCWD TP 8593 Swarm Counter-Asymmetric-Threat ( CAT ) 6-DOF Dynamics Simulation by James Bobinchak Weapons and Energetics...mathematical models used in the swarm counter- asymmetric-threat ( CAT ) simulation and the results of extensive Monte Carlo simulations. The swarm CAT ...Asymmetric-Threat ( CAT ) 6-DOF Dynamics Simulation (U) 6. AUTHOR(S) James Bobinchak and Gary Hewer 7. PERFORMING ORGANIZATION NAME(S) AND

Depth of focus enhancement of a modified imaging quasi-fractal zone plate.

PubMed

Zhang, Qinqin; Wang, Jingang; Wang, Mingwei; Bu, Jing; Zhu, Siwei; Gao, Bruce Z; Yuan, Xiaocong

2012-10-01

We propose a new parameter w for optimization of foci distribution of conventional fractal zone plates (FZPs) with a greater depth of focus (DOF) in imaging. Numerical simulations of DOF distribution on axis directions indicate that the values of DOF can be extended by a factor of 1.5 or more by a modified quasi-FZP. In experiments, we employ a simple object-lens-image-plane arrangement to pick up images at various positions within the DOF of a conventional FZP and a quasi-FZP, respectively. Experimental results show that the parameter w improves foci distribution of FZPs in good agreement with theoretical predictions.

Depth of focus enhancement of a modified imaging quasi-fractal zone plate

PubMed Central

Zhang, Qinqin; Wang, Jingang; Wang, Mingwei; Bu, Jing; Zhu, Siwei; Gao, Bruce Z.; Yuan, Xiaocong

2013-01-01

We propose a new parameter w for optimization of foci distribution of conventional fractal zone plates (FZPs) with a greater depth of focus (DOF) in imaging. Numerical simulations of DOF distribution on axis directions indicate that the values of DOF can be extended by a factor of 1.5 or more by a modified quasi-FZP. In experiments, we employ a simple object–lens–image-plane arrangement to pick up images at various positions within the DOF of a conventional FZP and a quasi-FZP, respectively. Experimental results show that the parameter w improves foci distribution of FZPs in good agreement with theoretical predictions. PMID:24285908

The NUHM2 after LHC Run 1

DOE PAGES

Buchmueller, O.; Cavanaugh, R.; Citron, M.; ...

2014-12-17

We make a frequentist analysis of the parameter space of the NUHM2, in which the soft supersymmetry (SUSY)-breaking contributions to the masses of the two Higgs multiplets, m 2 Hu,d, vary independently from the universal soft SUSY-breaking contributions m 2 0 to the masses of squarks and sleptons. Our analysis uses the MultiNest sampling algorithm with over 4 × 10⁸ points to sample the NUHM2 parameter space. It includes the ATLAS and CMS Higgs mass measurements as well as the ATLAS search for supersymmetric jets + /E T signals using the full LHC Run 1 data, the measurements of BR(Bmore » s→μ⁺μ⁻) by LHCb and CMS together with other B-physics observables, electroweak precision observables and the XENON100 and LUX searches for spin-independent dark-matter scattering. We find that the preferred regions of the NUHM2 parameter space have negative SUSY-breaking scalar masses squared at the GUT scale for squarks and sleptons, m 2 0 < 0, as well as m 2 Hu < m 2 Hd < 0. The tension present in the CMSSM and NUHM1 between the supersymmetric interpretation of (g – 2)μ and the absence to date of SUSY at the LHC is not significantly alleviated in the NUHM2. We find that the minimum χ 2 = 32.5 with 21 degrees of freedom (dof) in the NUHM2, to be compared with χ 2/dof = 35.0/23 in the CMSSM, and χ 2/dof = 32.7/22 in the NUHM1. We find that the one-dimensional likelihood functions for sparticle masses and other observables are similar to those found previously in the CMSSM and NUHM1.« less

Downstream-of-FGFR Is a Fibroblast Growth Factor-Specific Scaffolding Protein and Recruits Corkscrew upon Receptor Activation

PubMed Central

Petit, Valérie; Nussbaumer, Ute; Dossenbach, Caroline; Affolter, Markus

2004-01-01

Fibroblast growth factor (FGF) receptor (FGFR) signaling controls the migration of glial, mesodermal, and tracheal cells in Drosophila melanogaster. Little is known about the molecular events linking receptor activation to cytoskeletal rearrangements during cell migration. We have performed a functional characterization of Downstream-of-FGFR (Dof), a putative adapter protein that acts specifically in FGFR signal transduction in Drosophila. By combining reverse genetic, cell culture, and biochemical approaches, we demonstrate that Dof is a specific substrate for the two Drosophila FGFRs. After defining a minimal Dof rescue protein, we identify two regions important for Dof function in mesodermal and tracheal cell migration. The N-terminal 484 amino acids are strictly required for the interaction of Dof with the FGFRs. Upon receptor activation, tyrosine residue 515 becomes phosphorylated and recruits the phosphatase Corkscrew (Csw). Csw recruitment represents an essential step in FGF-induced cell migration and in the activation of the Ras/MAPK pathway. However, our results also indicate that the activation of Ras is not sufficient to activate the migration machinery in tracheal and mesodermal cells. Additional proteins binding either to the FGFRs, to Dof, or to Csw appear to be crucial for a chemotactic response. PMID:15082772

Downstream-of-FGFR is a fibroblast growth factor-specific scaffolding protein and recruits Corkscrew upon receptor activation.

PubMed

Petit, Valérie; Nussbaumer, Ute; Dossenbach, Caroline; Affolter, Markus

2004-05-01

Fibroblast growth factor (FGF) receptor (FGFR) signaling controls the migration of glial, mesodermal, and tracheal cells in Drosophila melanogaster. Little is known about the molecular events linking receptor activation to cytoskeletal rearrangements during cell migration. We have performed a functional characterization of Downstream-of-FGFR (Dof), a putative adapter protein that acts specifically in FGFR signal transduction in Drosophila. By combining reverse genetic, cell culture, and biochemical approaches, we demonstrate that Dof is a specific substrate for the two Drosophila FGFRs. After defining a minimal Dof rescue protein, we identify two regions important for Dof function in mesodermal and tracheal cell migration. The N-terminal 484 amino acids are strictly required for the interaction of Dof with the FGFRs. Upon receptor activation, tyrosine residue 515 becomes phosphorylated and recruits the phosphatase Corkscrew (Csw). Csw recruitment represents an essential step in FGF-induced cell migration and in the activation of the Ras/MAPK pathway. However, our results also indicate that the activation of Ras is not sufficient to activate the migration machinery in tracheal and mesodermal cells. Additional proteins binding either to the FGFRs, to Dof, or to Csw appear to be crucial for a chemotactic response.

Low-impact mating system

NASA Technical Reports Server (NTRS)

Lewis, James L. (Inventor); Carroll, Monty B. (Inventor); Le, Thang D. (Inventor); Morales, Ray H. (Inventor); Robertson, Brandan R. (Inventor)

2009-01-01

An androgynous mating system for mating two exoatmospheric space modules comprising a first mating assembly capable of mating with a second mating assembly; a second mating assembly structurally identical to said first mating assembly, said first mating assembly comprising; a load ring; a plurality of load cell subassemblies; a plurality of actuators; a base ring; a tunnel; a closed loop control system; one or more electromagnets; and one or more striker plates, wherein said one or more electomagnets on said second mating assembly are capable of mating with said one or more striker plates on said first mating assembly, and wherein said one or more striker plates is comprised of a plate of predetermined shape and a 5-DOF mechanism capable of maintaining predetermined contact requirements during said mating of said one or more electromagnets and said one or more striker plates.

Laser interferometer space antenna dynamics and controls model

NASA Astrophysics Data System (ADS)

Maghami, Peiman G.; Tupper Hyde, T.

2003-05-01

A 19 degree-of-freedom (DOF) dynamics and controls model of a laser interferometer space antenna (LISA) spacecraft has been developed. This model is used to evaluate the feasibility of the dynamic pointing and positioning requirements of a typical LISA spacecraft. These requirements must be met for LISA to be able to successfully detect gravitational waves in the frequency band of interest (0.1-100 mHz). The 19-DOF model includes all rigid-body degrees of freedom. A number of disturbance sources, both internal and external, are included. Preliminary designs for the four control systems that comprise the LISA disturbance reduction system (DRS) have been completed and are included in the model. Simulation studies are performed to demonstrate that the LISA pointing and positioning requirements are feasible and can be met.

3D in vivo imaging with extended-focus optical coherence microscopy.

PubMed

Chen, Yu; Trinh, Le A; Fingler, Jeff; Fraser, Scott E

2017-11-01

Optical coherence microscopy (OCM) has unique advantages of non-invasive 3D imaging without the need of exogenous labels for studying biological samples. However, the imaging depth of this technique is limited by the tradeoff between the depth of focus (DOF) and high lateral resolution in Gaussian optics. To overcome this limitation, we have developed an extended-focus OCM (xf-OCM) imaging system using quasi-Bessel beam illumination to extend the DOF to ∼100 μm, about 3-fold greater than standard OCM. High lateral resolution of 1.6 μm ensured detailed identification of structures within live animal samples. The insensitivity to spherical aberrations strengthened the capability of our xf-OCM system in 3D biological imaging. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Impact of Environmental Design on Doffing Personal Protective Equipment in a Healthcare Environment: A Formative Human Factors Trial.

PubMed

Herlihey, Tracey A; Gelmi, Stefano; Cafazzo, Joseph A; Hall, Trevor N T

2017-06-01

OBJECTIVE To explore the impact of environmental design on doffing personal protective equipment in a simulated healthcare environment. METHODS A mixed-methods approach was used that included human-factors usability testing and qualitative questionnaire responses. A patient room and connecting anteroom were constructed for testing purposes. This experimental doffing area was designed to overcome the environmental failures identified in a previous study and was not constructed based on any generalizable hospital standard. RESULTS In total, 72 healthcare workers from Ontario, Canada, took part in the study and tested the simulated doffing area. The following environmental design changes were tested and were deemed effective: increasing prominence of color-coded zones; securing disinfectant wipes and hand sanitizer; outlining disposal bins locations; providing mirrors to detect possible contamination; providing hand rails to assist with doffing; and restricting the space to doff. Further experimentation and iterative design are required with regard to several important features: positioning the disposal bins for safety, decreasing the risk of contamination and user accessibility; optimal positioning of mirrors for safety; communication within the team; and positioning the secondary team member for optimal awareness. Additional design suggestions also emerged during this study, and they require future investigation. CONCLUSIONS This study highlights the importance of the environment on doffing personal protective equipment in a healthcare setting. Iterative testing and modification of the design of the environment (doffing area) are important to enhancing healthcare worker safety. Infect Control Hosp Epidemiol 2017;38:712-717.

Scalable Methods for Uncertainty Quantification, Data Assimilation and Target Accuracy Assessment for Multi-Physics Advanced Simulation of Light Water Reactors

NASA Astrophysics Data System (ADS)

Khuwaileh, Bassam

High fidelity simulation of nuclear reactors entails large scale applications characterized with high dimensionality and tremendous complexity where various physics models are integrated in the form of coupled models (e.g. neutronic with thermal-hydraulic feedback). Each of the coupled modules represents a high fidelity formulation of the first principles governing the physics of interest. Therefore, new developments in high fidelity multi-physics simulation and the corresponding sensitivity/uncertainty quantification analysis are paramount to the development and competitiveness of reactors achieved through enhanced understanding of the design and safety margins. Accordingly, this dissertation introduces efficient and scalable algorithms for performing efficient Uncertainty Quantification (UQ), Data Assimilation (DA) and Target Accuracy Assessment (TAA) for large scale, multi-physics reactor design and safety problems. This dissertation builds upon previous efforts for adaptive core simulation and reduced order modeling algorithms and extends these efforts towards coupled multi-physics models with feedback. The core idea is to recast the reactor physics analysis in terms of reduced order models. This can be achieved via identifying the important/influential degrees of freedom (DoF) via the subspace analysis, such that the required analysis can be recast by considering the important DoF only. In this dissertation, efficient algorithms for lower dimensional subspace construction have been developed for single physics and multi-physics applications with feedback. Then the reduced subspace is used to solve realistic, large scale forward (UQ) and inverse problems (DA and TAA). Once the elite set of DoF is determined, the uncertainty/sensitivity/target accuracy assessment and data assimilation analysis can be performed accurately and efficiently for large scale, high dimensional multi-physics nuclear engineering applications. Hence, in this work a Karhunen-Loeve (KL) based algorithm previously developed to quantify the uncertainty for single physics models is extended for large scale multi-physics coupled problems with feedback effect. Moreover, a non-linear surrogate based UQ approach is developed, used and compared to performance of the KL approach and brute force Monte Carlo (MC) approach. On the other hand, an efficient Data Assimilation (DA) algorithm is developed to assess information about model's parameters: nuclear data cross-sections and thermal-hydraulics parameters. Two improvements are introduced in order to perform DA on the high dimensional problems. First, a goal-oriented surrogate model can be used to replace the original models in the depletion sequence (MPACT -- COBRA-TF - ORIGEN). Second, approximating the complex and high dimensional solution space with a lower dimensional subspace makes the sampling process necessary for DA possible for high dimensional problems. Moreover, safety analysis and design optimization depend on the accurate prediction of various reactor attributes. Predictions can be enhanced by reducing the uncertainty associated with the attributes of interest. Accordingly, an inverse problem can be defined and solved to assess the contributions from sources of uncertainty; and experimental effort can be subsequently directed to further improve the uncertainty associated with these sources. In this dissertation a subspace-based gradient-free and nonlinear algorithm for inverse uncertainty quantification namely the Target Accuracy Assessment (TAA) has been developed and tested. The ideas proposed in this dissertation were first validated using lattice physics applications simulated using SCALE6.1 package (Pressurized Water Reactor (PWR) and Boiling Water Reactor (BWR) lattice models). Ultimately, the algorithms proposed her were applied to perform UQ and DA for assembly level (CASL progression problem number 6) and core wide problems representing Watts Bar Nuclear 1 (WBN1) for cycle 1 of depletion (CASL Progression Problem Number 9) modeled via simulated using VERA-CS which consists of several multi-physics coupled models. The analysis and algorithms developed in this dissertation were encoded and implemented in a newly developed tool kit algorithms for Reduced Order Modeling based Uncertainty/Sensitivity Estimator (ROMUSE).

A restrained-torque-based motion instructor: forearm flexion/extension-driving exoskeleton

NASA Astrophysics Data System (ADS)

Nishimura, Takuya; Nomura, Yoshihiko; Sakamoto, Ryota

2013-01-01

When learning complicated movements by ourselves, we encounter such problems as a self-rightness. The self-rightness results in a lack of detail and objectivity, and it may cause to miss essences and even twist the essences. Thus, we sometimes fall into the habits of doing inappropriate motions. To solve these problems or to alleviate the problems as could as possible, we have been developed mechanical man-machine human interfaces to support us learning such motions as cultural gestures and sports form. One of the promising interfaces is a wearable exoskeleton mechanical system. As of the first try, we have made a prototype of a 2-link 1-DOF rotational elbow joint interface that is applied for teaching extension-flexion operations with forearms and have found its potential abilities for teaching the initiating and continuing flection motion of the elbow.

Development of a 3-D Rehabilitation System for Upper Limbs Using ER Actuators in a Nedo Project

NASA Astrophysics Data System (ADS)

Furusho, Junji; Koyanagi, Ken'ichi; Nakanishi, Kazuhiko; Ryu, Ushio; Takenaka, Shigekazu; Inoue, Akio; Domen, Kazuhisa; Miyakoshi, Koichi

New training methods and exercises for upper limbs rehabilitation are made possible by application of robotics and virtual reality technology. The technologies can also make quantitative evaluations and enhance the qualitative effect of training. We have joined a project managed by NEDO (New Energy and Industrial Technology Development Organization as a semi-governmental organization under the Ministry of Economy, Trade and Industry of Japan) 5-year Project, "Rehabilitation System for the Upper Limbs and Lower Limbs", and developed a 3-DOF exercise machine for upper limbs (EMUL) using ER actuators. In this paper, we also present the development of software for motion exercise trainings and some results of clinical evaluation. Moreover, it is discussed how ER actuators ensure the mechanical safety.

Motion and dynamic responses of a semisubmersible in freak waves

NASA Astrophysics Data System (ADS)

Li, Xin; Deng, Yan-fei; Li, Lei; Tian, Xin-liang; Li, Jun

2017-12-01

The present research aims at clarifying the effects of freak wave on the motion and dynamic responses of a semisubmersible. To reveal the effects of mooring stiffness, two mooring systems were employed in the model tests and time-domain simulations. The 6-DOF motion responses and mooring tensions have been measured and the 3-DOF motions of fairleads were calculated as well. From the time series, trajectories and statistics information, the interactions between the freak wave and the semisubmersible have been demonstrated and the effects of mooring stiffness have been identified. The shortage of numerical simulations based on 3D potential flow theory is presented. Results show that the freak wave is likely to cause large horizontal motions for soft mooring system and to result in extremely large mooring tensions for tight mooring system. Therefore, the freak wave is a real threat for the marine structure, which needs to be carefully considered at design stage.

Design of a recovery system for a reentry vehicle

NASA Technical Reports Server (NTRS)

Von Eckroth, Wulf; Garrard, William L.; Miller, Norman

1993-01-01

Engineers are often required to design decelerator systems which are deployed in cross-wind orientations. If the system is not designed to minimize 'line sail', damage to the parachutes could result. A Reentry Vehicle Analysis Code (RVAC) and an accompanying graphics animation software program (DISPLAY) are presented in this paper. These computer codes allow the user to quickly apply the Purvis line sail modeling technique to any vehicle and then observe the relative motion of the vehicle, nose cap, suspension lines, pilot and drogue bags and canopies on a computer screen. Data files are created which allow plots of velocities, spacial positions, and dynamic pressures versus time to be generated. The code is an important tool for the design engineer because it integrates two degrees of freedom (DOF) line sail equations with a three DOF model of the reentry body and jettisoned nose cap to provide an animated output.

Intraoperative optical coherence tomography of the cerebral cortex using a 7 degree-of freedom robotic arm

NASA Astrophysics Data System (ADS)

Reyes Perez, Robnier; Jivraj, Jamil; Yang, Victor X. D.

2017-02-01

Optical Coherence Tomography (OCT) provides a high-resolution imaging technique with limited depth penetration. The current use of OCT is limited to relatively small areas of tissue for anatomical structure diagnosis or minimally invasive guided surgery. In this study, we propose to image a large area of the surface of the cerebral cortex. This experiment aims to evaluate the potential difficulties encountered when applying OCT imaging to large and irregular surface areas. The current state-of-the-art OCT imaging technology uses scanning systems with at most 3 degrees-of-freedom (DOF) to obtain a 3D image representation of the sample tissue. We propose the use of a 7 DOF industrial robotic arm to increase the scanning capabilities of our OCT. Such system will be capable of acquiring data from large samples of tissue that are too irregular for conventional methods. Advantages and disadvantages of our system are discussed.

Conceptual design of a novel multi-DoF manual instrument for laparoscopic surgery.

PubMed

Wang, Xiaofei; Wang, Shuxin; Li, Jianmin; Zhang, Guokai; Wu, Zhiliang

2013-03-01

Laparoscopic surgery is becoming increasingly popular throughout the world. But the conventional instruments used in many surgeries are not flexible enough to be operated. Challenging tasks, such as suturing and knot-tying tasks are difficult to complete using conventional instruments with limited degrees of freedom (DoFs). In the paper, a novel cable-driven multi-DoF manual instrument is presented with a simple structure but strong functionality. The proposed instrument has been developed with a wristlike operation end (OE), a wristlike end effector (EE), and the transmission system. It can be operated intuitively. The orientation and the position of the EE are directly controlled by surgeons due to the one-to-one motion mapping structure. The clamp structure and tension device are reasonably designed. The pitch, yaw, and the open and close motion are actuated by cables. Based on the optimization index Global Condition Index (GCI), four cables are used to actuate the pitch and yaw motions, while other two are used for the open and close motion. The layout of the cables is also determined by the GCI. Experiments carried out with a prototype show that tasks such as suturing and knot-tying can be completed comfortably. Due to the intuitive control and multi-DoFs, surgeons can use the prototype to finish the tasks with ease. The instrument developed herein with intuitive control and dexterity can be used alone or together with a robotic system to accomplish some challenging tasks that are difficult for conventional instruments. Copyright © 2012 John Wiley & Sons, Ltd.

3D-2D registration in mobile radiographs: algorithm development and preliminary clinical evaluation

NASA Astrophysics Data System (ADS)

Otake, Yoshito; Wang, Adam S.; Uneri, Ali; Kleinszig, Gerhard; Vogt, Sebastian; Aygun, Nafi; Lo, Sheng-fu L.; Wolinsky, Jean-Paul; Gokaslan, Ziya L.; Siewerdsen, Jeffrey H.

2015-03-01

An image-based 3D-2D registration method is presented using radiographs acquired in the uncalibrated, unconstrained geometry of mobile radiography. The approach extends a previous method for six degree-of-freedom (DOF) registration in C-arm fluoroscopy (namely ‘LevelCheck’) to solve the 9-DOF estimate of geometry in which the position of the source and detector are unconstrained. The method was implemented using a gradient correlation similarity metric and stochastic derivative-free optimization on a GPU. Development and evaluation were conducted in three steps. First, simulation studies were performed that involved a CT scan of an anthropomorphic body phantom and 1000 randomly generated digitally reconstructed radiographs in posterior-anterior and lateral views. A median projection distance error (PDE) of 0.007 mm was achieved with 9-DOF registration compared to 0.767 mm for 6-DOF. Second, cadaver studies were conducted using mobile radiographs acquired in three anatomical regions (thorax, abdomen and pelvis) and three levels of source-detector distance (~800, ~1000 and ~1200 mm). The 9-DOF method achieved a median PDE of 0.49 mm (compared to 2.53 mm for the 6-DOF method) and demonstrated robustness in the unconstrained imaging geometry. Finally, a retrospective clinical study was conducted with intraoperative radiographs of the spine exhibiting real anatomical deformation and image content mismatch (e.g. interventional devices in the radiograph that were not in the CT), demonstrating a PDE = 1.1 mm for the 9-DOF approach. Average computation time was 48.5 s, involving 687 701 function evaluations on average, compared to 18.2 s for the 6-DOF method. Despite the greater computational load, the 9-DOF method may offer a valuable tool for target localization (e.g. decision support in level counting) as well as safety and quality assurance checks at the conclusion of a procedure (e.g. overlay of planning data on the radiograph for verification of the surgical product) in a manner consistent with natural surgical workflow.

Dimensional synthesis of a 3-DOF parallel manipulator with full circle rotation

NASA Astrophysics Data System (ADS)

Ni, Yanbing; Wu, Nan; Zhong, Xueyong; Zhang, Biao

2015-07-01

Parallel robots are widely used in the academic and industrial fields. In spite of the numerous achievements in the design and dimensional synthesis of the low-mobility parallel robots, few research efforts are directed towards the asymmetric 3-DOF parallel robots whose end-effector can realize 2 translational and 1 rotational(2T1R) motion. In order to develop a manipulator with the capability of full circle rotation to enlarge the workspace, a new 2T1R parallel mechanism is proposed. The modeling approach and kinematic analysis of this proposed mechanism are investigated. Using the method of vector analysis, the inverse kinematic equations are established. This is followed by a vigorous proof that this mechanism attains an annular workspace through its circular rotation and 2 dimensional translations. Taking the first order perturbation of the kinematic equations, the error Jacobian matrix which represents the mapping relationship between the error sources of geometric parameters and the end-effector position errors is derived. With consideration of the constraint conditions of pressure angles and feasible workspace, the dimensional synthesis is conducted with a goal to minimize the global comprehensive performance index. The dimension parameters making the mechanism to have optimal error mapping and kinematic performance are obtained through the optimization algorithm. All these research achievements lay the foundation for the prototype building of such kind of parallel robots.

Mechanical Validation of an MRI Compatible Stereotactic Neurosurgery Robot in Preparation for Pre-Clinical Trials.

PubMed

Nycz, Christopher J; Gondokaryono, Radian; Carvalho, Paulo; Patel, Nirav; Wartenberg, Marek; Pilitsis, Julie G; Fischer, Gregory S

2017-09-01

The use of magnetic resonance imaging (MRI) for guiding robotic surgical devices has shown great potential for performing precisely targeted and controlled interventions. To fully realize these benefits, devices must work safely within the tight confines of the MRI bore without negatively impacting image quality. Here we expand on previous work exploring MRI guided robots for neural interventions by presenting the mechanical design and assessment of a device for positioning, orienting, and inserting an interstitial ultrasound-based ablation probe. From our previous work we have added a 2 degree of freedom (DOF) needle driver for use with the aforementioned probe, revised the mechanical design to improve strength and function, and performed an evaluation of the mechanism's accuracy and effect on MR image quality. The result of this work is a 7-DOF MRI robot capable of positioning a needle tip and orienting it's axis with accuracy of 1.37 ± 0.06 mm and 0.79° ± 0.41°, inserting it along it's axis with an accuracy of 0.06 ± 0.07 mm , and rotating it about it's axis to an accuracy of 0.77° ± 1.31°. This was accomplished with no significant reduction in SNR caused by the robot's presence in the MRI bore, ≤ 10.3% reduction in SNR from running the robot's motors during a scan, and no visible paramagnetic artifacts.

The contact condition influence on stability and energy efficiency of quadruped robot

NASA Astrophysics Data System (ADS)

Lei, Jingtao; Wang, Tianmiao; Gao, Feng

2008-10-01

Quadruped robot has attribute of serial and parallel manipulator with multi-loop mechanism, with more DOF of each leg and intermittent contact with ground during walking, the trot gait of quadruped robot belongs to dynamic waking, compared to the crawl gait, the walking speed is higher, but the robot becomes unstable, it is difficult to keep dynamically stable walking. In this paper, we mainly analyze the condition for the quadruped robot to realize dynamically stable walking, establish centroid orbit equation based on ZMP (Zero Moment Point) stability theory, on the other hand , we study contact impact and friction influence on stability and energy efficiency. Because of the periodic contact between foots and ground, the contact impact and friction are considered to establish spring-damp nonlinear dynamics model. Robot need to be controlled to meet ZMP stability condition and contact constraint condition. Based on the virtual prototyping model, we study control algorithm considering contact condition, the contact compensator and friction compensator are adopted. The contact force and the influence of different contact conditions on the energy efficiency during whole gait cycle are obtained.

Monte-Carlo Simulation for Accuracy Assessment of a Single Camera Navigation System

NASA Astrophysics Data System (ADS)

Bethmann, F.; Luhmann, T.

2012-07-01

The paper describes a simulation-based optimization of an optical tracking system that is used as a 6DOF navigation system for neurosurgery. Compared to classical system used in clinical navigation, the presented system has two unique properties: firstly, the system will be miniaturized and integrated into an operating microscope for neurosurgery; secondly, due to miniaturization a single camera approach has been designed. Single camera techniques for 6DOF measurements show a special sensitivity against weak geometric configurations between camera and object. In addition, the achievable accuracy potential depends significantly on the geometric properties of the tracked objects (locators). Besides quality and stability of the targets used on the locator, their geometric configuration is of major importance. In the following the development and investigation of a simulation program is presented which allows for the assessment and optimization of the system with respect to accuracy. Different system parameters can be altered as well as different scenarios indicating the operational use of the system. Measurement deviations are estimated based on the Monte-Carlo method. Practical measurements validate the correctness of the numerical simulation results.

A Multi-Finger Interface with MR Actuators for Haptic Applications.

PubMed

Qin, Huanhuan; Song, Aiguo; Gao, Zhan; Liu, Yuqing; Jiang, Guohua

2018-01-01

Haptic devices with multi-finger input are highly desirable in providing realistic and natural feelings when interacting with the remote or virtual environment. Compared with the conventional actuators, MR (Magneto-rheological) actuators are preferable options in haptics because of larger passive torque and torque-volume ratios. Among the existing haptic MR actuators, most of them are still bulky and heavy. If they were smaller and lighter, they would become more suitable for haptics. In this paper, a small-scale yet powerful MR actuator was designed to build a multi-finger interface for the 6 DOF haptic device. The compact structure was achieved by adopting the multi-disc configuration. Based on this configuration, the MR actuator can generate the maximum torque of 480 N.mm with dimensions of only 36 mm diameter and 18 mm height. Performance evaluation showed that it can exhibit a relatively high dynamic range and good response characteristics when compared with some other haptic MR actuators. The multi-finger interface is equipped with three MR actuators and can provide up to 8 N passive force to the thumb, index and middle fingers, respectively. An application example was used to demonstrate the effectiveness and potential of this new MR actuator based interface.

An Evolutionarily Conserved DOF-CONSTANS Module Controls Plant Photoperiodic Signaling1[OPEN

PubMed Central

2015-01-01

The response to daylength is a crucial process that evolved very early in plant evolution, entitling the early green eukaryote to predict seasonal variability and attune its physiological responses to the environment. The photoperiod responses evolved into the complex signaling pathways that govern the angiosperm floral transition today. The Chlamydomonas reinhardtii DNA-Binding with One Finger (CrDOF) gene controls transcription in a photoperiod-dependent manner, and its misexpression influences algal growth and viability. In short days, CrDOF enhances CrCO expression, a homolog of plant CONSTANS (CO), by direct binding to its promoter, while it reduces the expression of cell division genes in long days independently of CrCO. In Arabidopsis (Arabidopsis thaliana), transgenic plants overexpressing CrDOF show floral delay and reduced expression of the photoperiodic genes CO and FLOWERING LOCUS T. The conservation of the DOF-CO module during plant evolution could be an important clue to understanding diversification by the inheritance of conserved gene toolkits in key developmental programs. PMID:25897001

Position calibration of a 3-DOF hand-controller with hybrid structure

NASA Astrophysics Data System (ADS)

Zhu, Chengcheng; Song, Aiguo

2017-09-01

A hand-controller is a human-robot interactive device, which measures the 3-DOF (Degree of Freedom) position of the human hand and sends it as a command to control robot movement. The device also receives 3-DOF force feedback from the robot and applies it to the human hand. Thus, the precision of 3-DOF position measurements is a key performance factor for hand-controllers. However, when using a hybrid type 3-DOF hand controller, various errors occur and are considered originating from machining and assembly variations within the device. This paper presents a calibration method to improve the position tracking accuracy of hybrid type hand-controllers by determining the actual size of the hand-controller parts. By re-measuring and re-calibrating this kind of hand-controller, the actual size of the key parts that cause errors is determined. Modifying the formula parameters with the actual sizes, which are obtained in the calibrating process, improves the end position tracking accuracy of the device.

Efficient Kinematic Computations For 7-DOF Manipulators

NASA Technical Reports Server (NTRS)

Seraji, Homayoun; Long, Mark K.; Kreutz-Delgado, Kenneth

1994-01-01

Efficient algorithms for forward kinematic mappings of seven-degree-of-freedom (7-DOF) robotic manipulator having revolute joints developed on basis of representation of redundant DOF in terms of parameter called "arm angle." Continuing effort to exploit redundancy in manipulator according to concept of basic and additional tasks. Concept also discussed in "Configuration-Control Scheme Copes With Singularities" (NPO-18556) and "Increasing the Dexterity of Redundant Robots" (NPO-17801).

Transversely polarized sub-diffraction optical needle with ultra-long depth of focus

NASA Astrophysics Data System (ADS)

Guan, Jian; Lin, Jie; Chen, Chen; Ma, Yuan; Tan, Jiubin; Jin, Peng

2017-12-01

We generated purely transversely polarized sub-diffraction optical needles with ultra-long depth of focus (DOF) by focusing azimuthally polarized (AP) beams that were modulated by a vortex 0-2 π phase plate and binary phase diffraction optical elements (DOEs). The concentric belts' radii of the DOEs were optimized by a hybrid genetic particle swarm optimization (HGPSO) algorithm. For the focusing system with the numerical aperture (NA) of 0.95, an optical needle with the full width at half maximum (FWHM) of 0.40 λ and the DOF of 6.23 λ was generated. Similar optical needles were also generated by binary phase DOEs with different belts. The results demonstrated that the binary phase DOEs could achieve smaller FWHMs and longer DOFs simultaneously. The generated needles were circularly polarized on the z-axis and there were no longitudinally polarized components in the focal fields. The radius fabrication errors of a DOE have little effect on the optical needle produced by itself. The generated optical needles can be applied to the fields of photolithography, high-density optical data storage, microscope imaging and particle trapping.

Mechanical design and analysis of focal plate for gravity deformation

NASA Astrophysics Data System (ADS)

Wang, Jianping; Chu, Jiaru; Hu, Hongzhuan; Li, Kexuan; Zhou, Zengxiang

2014-07-01

The surface accuracy of astronomical telescope focal plate is a key indicator to precision stellar observation. To conduct accurate deformation measurement for focal plate in different status, a 6-DOF hexapod platform was used for attitude adjustment. For the small adjustment range of a classic 6-DOF hexapod platform, an improved structural arrangement method was proposed in the paper to achieve ultimate adjustment of the focal plate in horizontal and vertical direction. To validate the feasibility of this method, an angle change model which used ball hinge was set up for the movement and base plate. Simulation results in MATLAB suggested that the ball hinge angle change of movement and base plate is within the range of the limiting angle in the process of the platform plate adjusting to ultimate attitude. The proposed method has some guiding significance for accurate surface measurement of focal plate.

Real-time robustness evaluation of regression based myoelectric control against arm position change and donning/doffing.

PubMed

Hwang, Han-Jeong; Hahne, Janne Mathias; Müller, Klaus-Robert

2017-01-01

There are some practical factors, such as arm position change and donning/doffing, which prevent robust myoelectric control. The objective of this study is to precisely characterize the impacts of the two representative factors on myoelectric controllability in practical control situations, thereby providing useful references that can be potentially used to find better solutions for clinically reliable myoelectric control. To this end, a real-time target acquisition task was performed by fourteen subjects including one individual with congenital upper-limb deficiency, where the impacts of arm position change, donning/doffing and a combination of both factors on control performance was systematically evaluated. The changes in online performance were examined with seven different performance metrics to comprehensively evaluate various aspects of myoelectric controllability. As a result, arm position change significantly affects offline prediction accuracy, but not online control performance due to real-time feedback, thereby showing no significant correlation between offline and online performance. Donning/doffing was still problematic in online control conditions. It was further observed that no benefit was attained when using a control model trained with multiple position data in terms of arm position change, and the degree of electrode shift caused by donning/doffing was not severely associated with the degree of performance loss under practical conditions (around 1 cm electrode shift). Since this study is the first to concurrently investigate the impacts of arm position change and donning/doffing in practical myoelectric control situations, all findings of this study provide new insights into robust myoelectric control with respect to arm position change and donning/doffing.

Real-time robustness evaluation of regression based myoelectric control against arm position change and donning/doffing

PubMed Central

Hahne, Janne Mathias; Müller, Klaus-Robert

2017-01-01

There are some practical factors, such as arm position change and donning/doffing, which prevent robust myoelectric control. The objective of this study is to precisely characterize the impacts of the two representative factors on myoelectric controllability in practical control situations, thereby providing useful references that can be potentially used to find better solutions for clinically reliable myoelectric control. To this end, a real-time target acquisition task was performed by fourteen subjects including one individual with congenital upper-limb deficiency, where the impacts of arm position change, donning/doffing and a combination of both factors on control performance was systematically evaluated. The changes in online performance were examined with seven different performance metrics to comprehensively evaluate various aspects of myoelectric controllability. As a result, arm position change significantly affects offline prediction accuracy, but not online control performance due to real-time feedback, thereby showing no significant correlation between offline and online performance. Donning/doffing was still problematic in online control conditions. It was further observed that no benefit was attained when using a control model trained with multiple position data in terms of arm position change, and the degree of electrode shift caused by donning/doffing was not severely associated with the degree of performance loss under practical conditions (around 1 cm electrode shift). Since this study is the first to concurrently investigate the impacts of arm position change and donning/doffing in practical myoelectric control situations, all findings of this study provide new insights into robust myoelectric control with respect to arm position change and donning/doffing. PMID:29095846

PETER: A Hardware Simulator for the Test Mass-GRS System of LISA Pathfinder

NASA Astrophysics Data System (ADS)

Marconi, L.; Stanga, R.; Bassan, M.; De Marchi, F.; Pucacco, G.; Visco, M.; Di Fiore, L.; De Rosa, R.; Garufi, F.

2013-01-01

Each LISA PathFinder test mass (TM) will be sensitive to forces along all its 6 Degrees of Freedom (DoFs). Extensive ground testing is required in order to evaluate the influence of cross-talks from the read-out and actuator channels. In the INFN laboratory of Firenze we have developed a facility for a good representation of the free fall conditions of the TM on flight. A hollow replica of a TM hanging from a double torsion pendulum can move inside a Gravitational Reference Sensor (GRS) with quasi free fall condition on two Dofs, in the frequency band (0.1 ÷ 100)mHz. On both DoFs, the target residual accelerations (yet to be achieved) at the low end frequency range are ≤ 3 × 10-13ms-2, limited by the thermal noise of the fibres. At higher frequencies, the sensitivity is limited by the readout noise of the readout, a replica of the flight electronics. After a long commissioning, we are now in operating conditions, and can carry out a series of experiments to better qualify the interaction between TM and GRS. In this paper we will show some significant qualification measurements and a first scientific measurements, i.e. the measurement and compensation of the DC bias in the GRS using two independent channels, as well as a measurement of the residual acceleration of the translational DoF, with the feedback loop closed on the rotational one, and viceversa.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, J; Nguyen, D; O’Brien, R

Purpose: Kilovoltage intrafraction monitoring (KIM) scheme has been successfully used to simultaneously monitor 3D tumor motion during radiotherapy. Recently, an iterative closest point (ICP) algorithm was implemented in KIM to also measure rotations about three axes, enabling real-time tracking of tumor motion in six degrees-of-freedom (DoF). This study aims to evaluate the accuracy of the six DoF motion estimates of KIM by comparing it with the corresponding motion (i) measured by the Calypso; and (ii) derived from kV/MV triangulation. Methods: (i) Various motions (static and dynamic) were applied to a CIRS phantom with three embedded electromagnetic transponders (Calypso Medical) usingmore » a 5D motion platform (HexaMotion) and a rotating treatment couch while both KIM and Calypso were used to concurrently track the phantom motion in six DoF. (ii) KIM was also used to retrospectively estimate six DoF motion from continuous sets of kV projections of a prostate, implanted with three gold fiducial markers (2 patients with 80 fractions in total), acquired during the treatment. Corresponding motion was obtained from kV/MV triangulation using a closed form least squares method based on three markers’ positions. Only the frames where all three markers were present were used in the analysis. The mean differences between the corresponding motion estimates were calculated for each DoF. Results: Experimental results showed that the mean of absolute differences in six DoF phantom motion measured by Calypso and KIM were within 1.1° and 0.7 mm. kV/MV triangulation derived six DoF prostate tumor better agreed with KIM estimated motion with the mean (s.d.) difference of up to 0.2° (1.36°) and 0.2 (0.25) mm for rotation and translation, respectively. Conclusion: These results suggest that KIM can provide an accurate six DoF intrafraction tumor during radiotherapy.« less

A driver-adaptive stability control strategy for sport utility vehicles

NASA Astrophysics Data System (ADS)

Zhu, Shenjin; He, Yuping

2017-08-01

Conventional vehicle stability control (VSC) systems are designed for average drivers. For a driver with a good driving skill, the VSC systems may be redundant; for a driver with a poor driving skill, the VSC intervention may be inadequate. To increase safety of sport utility vehicles (SUVs), this paper proposes a novel driver-adaptive VSC (DAVSC) strategy based on scaling the target yaw rate commanded by the driver. The DAVSC system is adaptive to drivers' driving skills. More control effort would be exerted for drivers with poor driving skills, and vice versa. A sliding mode control (SMC)-based differential braking (DB) controller is designed using a three degrees of freedom (DOF) yaw-plane model. An eight DOF nonlinear yaw-roll model is used to simulate the SUV dynamics. Two driver models, namely longitudinal and lateral, are used to 'drive' the virtual SUV. By integrating the virtual SUV, the DB controller, and the driver models, the performance of the DAVSC system is investigated. The simulations demonstrate the effectiveness of the DAVSC strategy.

Simulation of cooperating robot manipulators on a mobile platform

NASA Technical Reports Server (NTRS)

Murphy, Stephen H.; Wen, John Ting-Yung; Saridis, George N.

1991-01-01

The dynamic equations of motion are presented for two or more cooperating manipulators on a freely moving mobile platform. The system of cooperating robot manipulators forms a closed kinematic chain where the force of interaction must be included in the formulation of robot and platform dynamics. The formulation includes the full dynamic interactions from arms to platform and arm tip to arm tip, and the possible translation and rotation of the platform. The equations of motion are shown to be identical in structure to the fixed-platform cooperative manipulator dynamics. The number of DOFs of the system is sufficiently large to make recursive dynamic calculation methods potentially more efficient than closed-form solutions. A complete simulation with two 6-DOF manipulators of a free-floating platform is presented along a with a multiple-arm controller to position the common load.

Scaling and characterisation of a 2-DoF velocity amplified electromagnetic vibration energy harvester

NASA Astrophysics Data System (ADS)

O’Donoghue, D.; Frizzell, R.; Punch, J.

2018-07-01

Vibration energy harvesters (VEHs) offer an alternative to batteries for the autonomous operation of low-power electronics. Understanding the influence of scaling on VEHs is of great importance in the design of reduced scale harvesters. The nonlinear harvesters investigated here employ velocity amplification, a technique used to increase velocity through impacts, to improve the power output of multiple-degree-of-freedom VEHs, compared to linear resonators. Such harvesters, employing electromagnetic induction, are referred to as velocity amplified electromagnetic generators (VAEGs), with gains in power achieved by increasing the relative velocity between the magnet and coil in the transducer. The influence of scaling on a nonlinear 2-DoF VAEG is presented. Due to the increased complexity of VAEGs, compared to linear systems, linear scaling theory cannot be directly applied to VAEGs. Therefore, a detailed nonlinear scaling method is utilised. Experimental and numerical methods are employed. This nonlinear scaling method can be used for analysing the scaling behaviour of all nonlinear electromagnetic VEHs. It is demonstrated that the electromagnetic coupling coefficient degrades more rapidly with scale for systems with larger displacement amplitudes, meaning that systems operating at low frequencies will scale poorly compared to those operating at higher frequencies. The load power of the 2-DoF VAEG is predicted to scale as {P}L\\propto {s}5.51 (s = volume1/3), suggesting that achieving high power densities in a VAEG with low device volume is extremely challenging.

Free-flying dynamics and control of an astronaut assistant robot based on fuzzy sliding mode algorithm

NASA Astrophysics Data System (ADS)

Gao, Qing; Liu, Jinguo; Tian, Tongtong; Li, Yangmin

2017-09-01

Space robots can perform some tasks in harsh environment as assistants of astronauts or substitutions of astronauts. Taking the limited working time and the arduous task of the astronauts in the space station into account, an astronaut assistant robot (AAR-2) applied in the space station is proposed and designed in this paper. The AAR-2 is achieved with some improvements on the basis of AAR-1 which was designed before. It can exploit its position and attitude sensors and control system to free flight or hover in the space cabin. And it also has a definite environmental awareness and artificial intelligence to complete some specified tasks under the control of astronauts or autonomously. In this paper, it mainly analyzes and controls the 6-DOF motion of the AAR-2. Firstly, the system configuration of AAR-2 is specifically described, and the movement principles are analyzed. Secondly, according to the physical model of the AAR-2, the Newton - Euler equation is applied in the preparation of space dynamics model of 6-DOF motion. Then, according to the mathematical model's characteristics which are nonlinear and strong coupling, a dual closed loop position and attitude controller based on fuzzy sliding mode control is proposed and designed. Finally, simulation experiments are appropriate to provide for AAR-2 control system by using Matlab/Simulink. From the simulation results it can be observed that the designed fuzzy sliding mode controller can control the 6-DOF motion of AAR-2 quickly and precisely.

Learning by Demonstration for Motion Planning of Upper-Limb Exoskeletons

PubMed Central

Lauretti, Clemente; Cordella, Francesca; Ciancio, Anna Lisa; Trigili, Emilio; Catalan, Jose Maria; Badesa, Francisco Javier; Crea, Simona; Pagliara, Silvio Marcello; Sterzi, Silvia; Vitiello, Nicola; Garcia Aracil, Nicolas; Zollo, Loredana

2018-01-01

The reference joint position of upper-limb exoskeletons is typically obtained by means of Cartesian motion planners and inverse kinematics algorithms with the inverse Jacobian; this approach allows exploiting the available Degrees of Freedom (i.e. DoFs) of the robot kinematic chain to achieve the desired end-effector pose; however, if used to operate non-redundant exoskeletons, it does not ensure that anthropomorphic criteria are satisfied in the whole human-robot workspace. This paper proposes a motion planning system, based on Learning by Demonstration, for upper-limb exoskeletons that allow successfully assisting patients during Activities of Daily Living (ADLs) in unstructured environment, while ensuring that anthropomorphic criteria are satisfied in the whole human-robot workspace. The motion planning system combines Learning by Demonstration with the computation of Dynamic Motion Primitives and machine learning techniques to construct task- and patient-specific joint trajectories based on the learnt trajectories. System validation was carried out in simulation and in a real setting with a 4-DoF upper-limb exoskeleton, a 5-DoF wrist-hand exoskeleton and four patients with Limb Girdle Muscular Dystrophy. Validation was addressed to (i) compare the performance of the proposed motion planning with traditional methods; (ii) assess the generalization capabilities of the proposed method with respect to the environment variability. Three ADLs were chosen to validate the system: drinking, pouring and lifting a light sphere. The achieved results showed a 100% success rate in the task fulfillment, with a high level of generalization with respect to the environment variability. Moreover, an anthropomorphic configuration of the exoskeleton is always ensured. PMID:29527161

Learning by Demonstration for Motion Planning of Upper-Limb Exoskeletons.

PubMed

Lauretti, Clemente; Cordella, Francesca; Ciancio, Anna Lisa; Trigili, Emilio; Catalan, Jose Maria; Badesa, Francisco Javier; Crea, Simona; Pagliara, Silvio Marcello; Sterzi, Silvia; Vitiello, Nicola; Garcia Aracil, Nicolas; Zollo, Loredana

2018-01-01

The reference joint position of upper-limb exoskeletons is typically obtained by means of Cartesian motion planners and inverse kinematics algorithms with the inverse Jacobian; this approach allows exploiting the available Degrees of Freedom (i.e. DoFs) of the robot kinematic chain to achieve the desired end-effector pose; however, if used to operate non-redundant exoskeletons, it does not ensure that anthropomorphic criteria are satisfied in the whole human-robot workspace. This paper proposes a motion planning system, based on Learning by Demonstration, for upper-limb exoskeletons that allow successfully assisting patients during Activities of Daily Living (ADLs) in unstructured environment, while ensuring that anthropomorphic criteria are satisfied in the whole human-robot workspace. The motion planning system combines Learning by Demonstration with the computation of Dynamic Motion Primitives and machine learning techniques to construct task- and patient-specific joint trajectories based on the learnt trajectories. System validation was carried out in simulation and in a real setting with a 4-DoF upper-limb exoskeleton, a 5-DoF wrist-hand exoskeleton and four patients with Limb Girdle Muscular Dystrophy. Validation was addressed to (i) compare the performance of the proposed motion planning with traditional methods; (ii) assess the generalization capabilities of the proposed method with respect to the environment variability. Three ADLs were chosen to validate the system: drinking, pouring and lifting a light sphere. The achieved results showed a 100% success rate in the task fulfillment, with a high level of generalization with respect to the environment variability. Moreover, an anthropomorphic configuration of the exoskeleton is always ensured.

Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

PubMed

Ueki, Toshiyuki; Inouye, Sumiko

2005-12-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

Motion control of 7-DOF arms - The configuration control approach

NASA Technical Reports Server (NTRS)

Seraji, Homayoun; Long, Mark K.; Lee, Thomas S.

1993-01-01

Graphics simulation and real-time implementation of configuration control schemes for a redundant 7-DOF Robotics Research arm are described. The arm kinematics and motion control schemes are described briefly. This is followed by a description of a graphics simulation environment for 7-DOF arm control on the Silicon Graphics IRIS Workstation. Computer simulation results are presented to demonstrate elbow control, collision avoidance, and optimal joint movement as redundancy resolution goals. The laboratory setup for experimental validation of motion control of the 7-DOF Robotics Research arm is then described. The configuration control approach is implemented on a Motorola-68020/VME-bus-based real-time controller, with elbow positioning for redundancy resolution. Experimental results demonstrate the efficacy of configuration control for real-time control.

Girsanov's transformation based variance reduced Monte Carlo simulation schemes for reliability estimation in nonlinear stochastic dynamics

NASA Astrophysics Data System (ADS)

Kanjilal, Oindrila; Manohar, C. S.

2017-07-01

The study considers the problem of simulation based time variant reliability analysis of nonlinear randomly excited dynamical systems. Attention is focused on importance sampling strategies based on the application of Girsanov's transformation method. Controls which minimize the distance function, as in the first order reliability method (FORM), are shown to minimize a bound on the sampling variance of the estimator for the probability of failure. Two schemes based on the application of calculus of variations for selecting control signals are proposed: the first obtains the control force as the solution of a two-point nonlinear boundary value problem, and, the second explores the application of the Volterra series in characterizing the controls. The relative merits of these schemes, vis-à-vis the method based on ideas from the FORM, are discussed. Illustrative examples, involving archetypal single degree of freedom (dof) nonlinear oscillators, and a multi-degree of freedom nonlinear dynamical system, are presented. The credentials of the proposed procedures are established by comparing the solutions with pertinent results from direct Monte Carlo simulations.

A novel remote center of motion mechanism for the force-reflective master robot of haptic tele-surgery systems.

PubMed

Hadavand, Mostafa; Mirbagheri, Alireza; Behzadipour, Saeed; Farahmand, Farzam

2014-06-01

An effective master robot for haptic tele-surgery applications needs to provide a solution for the inversed movements of the surgical tool, in addition to sufficient workspace and manipulability, with minimal moving inertia. A novel 4 + 1-DOF mechanism was proposed, based on a triple parallelogram linkage, which provided a Remote Center of Motion (RCM) at the back of the user's hand. The kinematics of the robot was analyzed and a prototype was fabricated and evaluated by experimental tests. With a RCM at the back of the user's hand the actuators far from the end effector, the robot could produce the sensation of hand-inside surgery with minimal moving inertia. The target workspace was achieved with an acceptable manipulability. The trajectory tracking experiments revealed small errors, due to backlash at the joints. The proposed mechanism meets the basic requirements of an effective master robot for haptic tele-surgery applications. Copyright © 2013 John Wiley & Sons, Ltd.

Robot-aided therapy on the upper limb of subacute and chronic stroke patients: a biomechanical approach.

PubMed

Mazzoleni, S; Filippi, M; Carrozza, M C; Posteraro, F; Puzzolante, L; Falchi, E

2011-01-01

The goal of this study is to propose a methodology for evaluating recovery mechanisms in subacute and chronic post-stroke patients after a robot-aided upper-limb therapy, using a set of biomechanical parameters. Fifty-six post-stroke subjects, thirteen subacute and forty-three chronic patients participated in the study. A 2 dof robotic system, implementing an "assist-as-needed" control strategy, was used. Biomechanical parameters related (i) to the speed measured at the robot's end-effector and (ii) to the movement's smoothness were computed. Outcome clinical measures show a decrease in motor impairment after the treatment both in chronic and subacute patients. All the biomechanical parameters show an improvement between admission and discharge. Our results show that the robot-aided training can contribute to reduce the motor impairment in both subacute and chronic patients and identify neurophysiological mechanisms underlying the different stages of motor recovery. © 2011 IEEE

Depth-of-Focus and its Association with the Spherical Aberration Sign. A Ray-Tracing Analysis

PubMed Central

Bakaraju, Ravi C.; Ehrmann, Klaus; Papas, Eric B.; Ho, Arthur

2010-01-01

Purpose To investigate the relationship between the sign of spherical aberration (SA) and the corresponding depth-of-focus (DoF) values around best focus, at three different spatial frequencies (SF). Additionally, to study the influence of the Stiles-Crawford effect (SCE) on DoF. Methods We modeled schematic eyes having a range of SA values, C (4, 0), from -0.20 to 0.20 μm, at 6 mm pupil, in a ray-tracing software (Zemax). The through-focus optical performance was obtained via Modulation Transfer Function (MTF) calculations using thin paraxial lenses in-front of the model eye, from -2.00 to+2.00 D in 0.05D steps. Through-focus full-width (defocus) occurring at the half maximum of MTF value was considered as DoF, in diopters. Results For the low-SF configuration, +SA and –SA results were close to being mirror symmetries of one another. However, for midand high- SF targets, in the SA range spanning from -0.15 to 0.15 μm, models of equal SA magnitude but opposite sign produced similar DoF measures, but those with SA more negative than -0.15 μm showed marginally higher DoF than their positive counterparts. The SCE improved DoF for low SF (10 cycles/mm), while for mid and higher SF (>30 cycles/mm) mixed results were observed. Conclusions As regards presbyopic-correction strategies that use deliberately induced aberrations to increase the depth of focus, the current study suggests that both positive and negative SA have equal potential. However, practical considerations will probably limit the useful DoF achievable through the utilization of SCE in presbyopes. for reference to a contemporary record detailing refractive history.

Predicting tibiotalar and subtalar joint angles from skin-marker data with dual-fluoroscopy as a reference standard.

PubMed

Nichols, Jennifer A; Roach, Koren E; Fiorentino, Niccolo M; Anderson, Andrew E

2016-09-01

Evidence suggests that the tibiotalar and subtalar joints provide near six degree-of-freedom (DOF) motion. Yet, kinematic models frequently assume one DOF at each of these joints. In this study, we quantified the accuracy of kinematic models to predict joint angles at the tibiotalar and subtalar joints from skin-marker data. Models included 1 or 3 DOF at each joint. Ten asymptomatic subjects, screened for deformities, performed 1.0m/s treadmill walking and a balanced, single-leg heel-rise. Tibiotalar and subtalar joint angles calculated by inverse kinematics for the 1 and 3 DOF models were compared to those measured directly in vivo using dual-fluoroscopy. Results demonstrated that, for each activity, the average error in tibiotalar joint angles predicted by the 1 DOF model were significantly smaller than those predicted by the 3 DOF model for inversion/eversion and internal/external rotation. In contrast, neither model consistently demonstrated smaller errors when predicting subtalar joint angles. Additionally, neither model could accurately predict discrete angles for the tibiotalar and subtalar joints on a per-subject basis. Differences between model predictions and dual-fluoroscopy measurements were highly variable across subjects, with joint angle errors in at least one rotation direction surpassing 10° for 9 out of 10 subjects. Our results suggest that both the 1 and 3 DOF models can predict trends in tibiotalar joint angles on a limited basis. However, as currently implemented, neither model can predict discrete tibiotalar or subtalar joint angles for individual subjects. Inclusion of subject-specific attributes may improve the accuracy of these models. Copyright © 2016 Elsevier B.V. All rights reserved.

Assessment of Self-Contamination During Removal of Personal Protective Equipment for Ebola Patient Care.

PubMed

Casanova, Lisa M; Teal, Lisa J; Sickbert-Bennett, Emily E; Anderson, Deverick J; Sexton, Daniel J; Rutala, William A; Weber, David J

2016-10-01

OBJECTIVE Ebola virus disease (EVD) places healthcare personnel (HCP) at high risk for infection during patient care, and personal protective equipment (PPE) is critical. Protocols for EVD PPE doffing have not been validated for prevention of viral self-contamination. Using surrogate viruses (non-enveloped MS2 and enveloped Φ6), we assessed self-contamination of skin and clothes when trained HCP doffed EVD PPE using a standardized protocol. METHODS A total of 15 HCP donned EVD PPE for this study. Virus was applied to PPE, and a trained monitor guided them through the doffing protocol. Of the 15 participants, 10 used alcohol-based hand rub (ABHR) for glove and hand hygiene and 5 used hypochlorite for glove hygiene and ABHR for hand hygiene. Inner gloves, hands, face, and scrubs were sampled after doffing. RESULTS After doffing, MS2 virus was detected on the inner glove worn on the dominant hand for 8 of 15 participants, on the non-dominant inner glove for 6 of 15 participants, and on scrubs for 2 of 15 participants. All MS2 on inner gloves was observed when ABHR was used for glove hygiene; none was observed when hypochlorite was used. When using hypochlorite for glove hygiene, 1 participant had MS2 on hands, and 1 had MS2 on scrubs. CONCLUSIONS A structured doffing protocol using a trained monitor and ABHR protects against enveloped virus self-contamination. Non-enveloped virus (MS2) contamination was detected on inner gloves, possibly due to higher resistance to ABHR. Doffing protocols protective against all viruses need to incorporate highly effective glove and hand hygiene agents. Infect Control Hosp Epidemiol 2016;1-6.

Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

PubMed Central

Ueki, Toshiyuki; Inouye, Sumiko

2005-01-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

Effect of suspension kinematic on 14 DOF vehicle model

NASA Astrophysics Data System (ADS)

Wongpattananukul, T.; Chantharasenawong, C.

2017-12-01

Computer simulations play a major role in shaping modern science and engineering. They reduce time and resource consumption in new studies and designs. Vehicle simulations have been studied extensively to achieve a vehicle model used in minimum lap time solution. Simulation result accuracy depends on the abilities of these models to represent real phenomenon. Vehicles models with 7 degrees of freedom (DOF), 10 DOF and 14 DOF are normally used in optimal control to solve for minimum lap time. However, suspension kinematics are always neglected on these models. Suspension kinematics are defined as wheel movements with respect to the vehicle body. Tire forces are expressed as a function of wheel slip and wheel position. Therefore, the suspension kinematic relation is appended to the 14 DOF vehicle model to investigate its effects on the accuracy of simulate trajectory. Classical 14 DOF vehicle model is chosen as baseline model. Experiment data is collected from formula student style car test runs as baseline data for simulation and comparison between baseline model and model with suspension kinematic. Results show that in a single long turn there is an accumulated trajectory error in baseline model compared to model with suspension kinematic. While in short alternate turns, the trajectory error is much smaller. These results show that suspension kinematic had an effect on the trajectory simulation of vehicle. Which optimal control that use baseline model will result in inaccuracy control scheme.

Standardized Observational Assessment of Attention Deficit Hyperactivity Disorder Combined and Predominantly Inattentive Subtypes. II. Classroom Observations.

PubMed

McConaughy, Stephanie H; Ivanova, Masha Y; Antshel, Kevin; Eiraldi, Ricardo B; Dumenci, Levent

2009-07-01

Trained classroom observers used the Direct Observation Form (DOF; McConaughy & Achenbach, 2009) to rate observations of 163 6- to 11-year-old children in their school classrooms. Participants were assigned to four groups based on a parent diagnostic interview and parent and teacher rating scales: Attention Deficit Hyperactivity Disorder (ADHD)-Combined type (n = 64); ADHD-Inattentive type (n = 22); clinically referred without ADHD (n = 51); and nonreferred control children (n = 26). The ADHD-Combined group scored significantly higher than the referred without ADHD group and controls on the DOF Intrusive and Oppositional syndromes, Attention Deficit Hyperactivity Problems scale, Hyperactivity-Impulsivity subscale, and Total Problems; and significantly lower on the DOF On-Task score. The ADHD-Inattentive group scored significantly higher than controls on the DOF Sluggish Cognitive Tempo and Attention Problems syndromes, Inattention subscale, and Total Problems; and significantly lower on the DOF On-Task score. Implications are discussed regarding the discriminative validity of standardized classroom observations for identifying children with ADHD and differentiating between the two ADHD subtypes.

An Evolutionarily Conserved DOF-CONSTANS Module Controls Plant Photoperiodic Signaling.

PubMed

Lucas-Reina, Eva; Romero-Campero, Francisco J; Romero, José M; Valverde, Federico

2015-06-01

The response to daylength is a crucial process that evolved very early in plant evolution, entitling the early green eukaryote to predict seasonal variability and attune its physiological responses to the environment. The photoperiod responses evolved into the complex signaling pathways that govern the angiosperm floral transition today. The Chlamydomonas reinhardtii DNA-Binding with One Finger (CrDOF) gene controls transcription in a photoperiod-dependent manner, and its misexpression influences algal growth and viability. In short days, CrDOF enhances CrCO expression, a homolog of plant CONSTANS (CO), by direct binding to its promoter, while it reduces the expression of cell division genes in long days independently of CrCO. In Arabidopsis (Arabidopsis thaliana), transgenic plants overexpressing CrDOF show floral delay and reduced expression of the photoperiodic genes CO and FLOWERING LOCUS T. The conservation of the DOF-CO module during plant evolution could be an important clue to understanding diversification by the inheritance of conserved gene toolkits in key developmental programs. © 2015 American Society of Plant Biologists. All Rights Reserved.

Standardized Observational Assessment of Attention Deficit Hyperactivity Disorder Combined and Predominantly Inattentive Subtypes. II. Classroom Observations

PubMed Central

McConaughy, Stephanie H.; Ivanova, Masha Y.; Antshel, Kevin; Eiraldi, Ricardo B.; Dumenci, Levent

2010-01-01

Trained classroom observers used the Direct Observation Form (DOF; McConaughy & Achenbach, 2009) to rate observations of 163 6- to 11-year-old children in their school classrooms. Participants were assigned to four groups based on a parent diagnostic interview and parent and teacher rating scales: Attention Deficit Hyperactivity Disorder (ADHD)—Combined type (n = 64); ADHD—Inattentive type (n = 22); clinically referred without ADHD (n = 51); and nonreferred control children (n = 26). The ADHD—Combined group scored significantly higher than the referred without ADHD group and controls on the DOF Intrusive and Oppositional syndromes, Attention Deficit Hyperactivity Problems scale, Hyperactivity-Impulsivity subscale, and Total Problems; and significantly lower on the DOF On-Task score. The ADHD—Inattentive group scored significantly higher than controls on the DOF Sluggish Cognitive Tempo and Attention Problems syndromes, Inattention subscale, and Total Problems; and significantly lower on the DOF On-Task score. Implications are discussed regarding the discriminative validity of standardized classroom observations for identifying children with ADHD and differentiating between the two ADHD subtypes. PMID:20802813

Kinematic Analysis of a Six-Degrees-of-Freedom Model Based on ISB Recommendation: A Repeatability Analysis and Comparison with Conventional Gait Model.

PubMed

Żuk, Magdalena; Pezowicz, Celina

2015-01-01

Objective. The purpose of the present work was to assess the validity of a six-degrees-of-freedom gait analysis model based on the ISB recommendation on definitions of joint coordinate systems (ISB 6DOF) through a quantitative comparison with the Helen Hays model (HH) and repeatability assessment. Methods. Four healthy subjects were analysed with both marker sets: an HH marker set and four marker clusters in ISB 6DOF. A navigated pointer was used to indicate the anatomical landmark position in the cluster reference system according to the ISB recommendation. Three gait cycles were selected from the data collected simultaneously for the two marker sets. Results. Two protocols showed good intertrial repeatability, which apart from pelvic rotation did not exceed 2°. The greatest differences between protocols were observed in the transverse plane as well as for knee angles. Knee internal/external rotation revealed the lowest subject-to-subject and interprotocol repeatability and inconsistent patterns for both protocols. Knee range of movement in transverse plane was overestimated for the HH set (the mean is 34°), which could indicate the cross-talk effect. Conclusions. The ISB 6DOF anatomically based protocol enabled full 3D kinematic description of joints according to the current standard with clinically acceptable intertrial repeatability and minimal equipment requirements.

Kinematics and control of redundant robotic arm based on dielectric elastomer actuators

NASA Astrophysics Data System (ADS)

Branz, Francesco; Antonello, Andrea; Carron, Andrea; Carli, Ruggero; Francesconi, Alessandro

2015-04-01

Soft robotics is a promising field and its application to space mechanisms could represent a breakthrough in space technologies by enabling new operative scenarios (e.g. soft manipulators, capture systems). Dielectric Elastomers Actuators have been under deep study for a number of years and have shown several advantages that could be of key importance for space applications. Among such advantages the most notable are high conversion efficiency, distributed actuation, self-sensing capability, multi-degree-of-freedom design, light weight and low cost. The big potentialities of double cone actuators have been proven in terms of good performances (i.e. stroke and force/torque), ease of manufacturing and durability. In this work the kinematic, dynamic and control design of a two-joint redundant robotic arm is presented. Two double cone actuators are assembled in series to form a two-link design. Each joint has two degrees of freedom (one rotational and one translational) for a total of four. The arm is designed to move in a 2-D environment (i.e. the horizontal plane) with 4 DoF, consequently having two degrees of redundancy. The redundancy is exploited in order to minimize the joint loads. The kinematic design with redundant Jacobian inversion is presented. The selected control algorithm is described along with the results of a number of dynamic simulations that have been executed for performance verification. Finally, an experimental setup is presented based on a flexible structure that counteracts gravity during testing in order to better emulate future zero-gravity applications.

Periodic Forced Response of Structures Having Three-Dimensional Frictional Constraints

NASA Astrophysics Data System (ADS)

CHEN, J. J.; YANG, B. D.; MENQ, C. H.

2000-01-01

Many mechanical systems have moving components that are mutually constrained through frictional contacts. When subjected to cyclic excitations, a contact interface may undergo constant changes among sticks, slips and separations, which leads to very complex contact kinematics. In this paper, a 3-D friction contact model is employed to predict the periodic forced response of structures having 3-D frictional constraints. Analytical criteria based on this friction contact model are used to determine the transitions among sticks, slips and separations of the friction contact, and subsequently the constrained force which consists of the induced stick-slip friction force on the contact plane and the contact normal load. The resulting constrained force is often a periodic function and can be considered as a feedback force that influences the response of the constrained structures. By using the Multi-Harmonic Balance Method along with Fast Fourier Transform, the constrained force can be integrated with the receptance of the structures so as to calculate the forced response of the constrained structures. It results in a set of non-linear algebraic equations that can be solved iteratively to yield the relative motion as well as the constrained force at the friction contact. This method is used to predict the periodic response of a frictionally constrained 3-d.o.f. oscillator. The predicted results are compared with those of the direct time integration method so as to validate the proposed method. In addition, the effect of super-harmonic components on the resonant response and jump phenomenon is examined.

Through-focus optical characteristics of monofocal and bifocal soft contact lenses across the peripheral visual field.

PubMed

Ji, Qiuzhi; Yoo, Young-Sik; Alam, Hira; Yoon, Geunyoung

2018-05-01

To characterise the impact of monofocal soft contact lens (SCL) and bifocal SCLs on refractive error, depth of focus (DoF) and orientation of blur in the peripheral visual field. Monofocal and two bifocal SCLs, Acuvue Bifocal (AVB, Johnson & Johnson) and Misight Dual Focus (DF, CooperVision) with +2.0 D add power were modelled using a ray tracing program (ZEMAX) based on their power maps. These SCLs were placed onto the anterior corneal surface of the simulated Atchison myopic eye model to correct for -3.0 D spherical refractive error at the fovea. To quantify through-focus retinal image quality, defocus from -3.5 D to 1.5 D in 0.5 D steps was induced at each horizontal eccentricity from 0 to 40° in 10° steps. Wavefront aberrations were computed for each visual eccentricity and defocus. The retinal images were simulated using a custom software program developed in Matlab (The MathWorks) by convolving the point spread function calculated from the aberration with a reference image. The convolved images were spatially filtered to match the spatial resolution limit of each peripheral eccentricity. Retinal image quality was then quantified by the 2-D cross-correlation between the filtered convolved retinal images and the reference image. Peripheral defocus, DoF and orientation of blur were also estimated. In comparison with the monofocal SCL, the bifocal SCLs degraded retinal image quality while DoF was increased at fovea. From 10 to 20°, a relatively small amount of myopic shift (less than 0.3 D) was induced by bifocal SCLs compared with monofocal. DoF was also increased with bifocal SCLs at peripheral vision of 10 and 20°. The trend of myopic shift became less consistent at larger eccentricity, where at 30° DF showed a 0.75 D myopic shift while AVB showed a 0.2 D hyperopic shift and both AVB and DF exhibited large relative hyperopic defocus at 40°. The anisotropy in orientation of blur was found to increase and change its direction through focus beyond central vision. This trend was found to be less dominant with bifocal SCLs compared to monofocal SCL. Bifocal SCLs have a relatively small impact on myopic shift in peripheral refractive error while DoF is increased significantly. We hypothetically suggest that a mechanism underlying myopia control with these bifocal or multifocal contact lenses is an increase in DoF and a decrease in anisotropy of peripheral optical blur. © 2018 The Authors Ophthalmic & Physiological Optics © 2018 The College of Optometrists.

Flexibility of movement organization in piano performance.

PubMed

Furuya, Shinichi; Altenmüller, Eckart

2013-01-01

Piano performance involves a large repertoire of highly skilled movements. The acquisition of these exceptional skills despite innate neural and biomechanical constraints requires a sophisticated interaction between plasticity of the neural system and organization of a redundant number of degrees of freedom (DOF) in the motor system. Neuroplasticity subserving virtuosity of pianists has been documented in neuroimaging studies investigating effects of long-term piano training on structure and function of the cortical and subcortical regions. By contrast, recent behavioral studies have advanced the understanding of neuromuscular strategies and biomechanical principles behind the movement organization that enables skilled piano performance. Here we review the motor control and biomechanics literature, introducing the importance of describing motor behaviors not only for understanding mechanisms responsible for skillful motor actions in piano playing, but also for advancing diagnosis and rehabilitation of movement disorders caused by extensive piano practice.

Biphasic responses in multi-site phosphorylation systems.

PubMed

Suwanmajo, Thapanar; Krishnan, J

2013-12-06

Multi-site phosphorylation systems are repeatedly encountered in cellular biology and multi-site modification is a basic building block of post-translational modification. In this paper, we demonstrate how distributive multi-site modification mechanisms by a single kinase/phosphatase pair can lead to biphasic/partial biphasic dose-response characteristics for the maximally phosphorylated substrate at steady state. We use simulations and analysis to uncover a hidden competing effect which is responsible for this and analyse how it may be accentuated. We build on this to analyse different variants of multi-site phosphorylation mechanisms showing that some mechanisms are intrinsically not capable of displaying this behaviour. This provides both a consolidated understanding of how and under what conditions biphasic responses are obtained in multi-site phosphorylation and a basis for discriminating between different mechanisms based on this. We also demonstrate how this behaviour may be combined with other behaviour such as threshold and bistable responses, demonstrating the capacity of multi-site phosphorylation systems to act as complex molecular signal processors.

The first clinical implementation of a real-time six degree of freedom target tracking system during radiation therapy based on Kilovoltage Intrafraction Monitoring (KIM).

PubMed

Nguyen, Doan Trang; O'Brien, Ricky; Kim, Jung-Ha; Huang, Chen-Yu; Wilton, Lee; Greer, Peter; Legge, Kimberley; Booth, Jeremy T; Poulsen, Per Rugaard; Martin, Jarad; Keall, Paul J

2017-04-01

We present the first clinical implementation of a real-time six-degree of freedom (6DoF) Kilovoltage Intrafraction Monitoring (KIM) system which tracks the cancer target translational and rotational motions during treatment. The method was applied to measure and correct for target motion during stereotactic body radiotherapy (SBRT) for prostate cancer. Patient: A patient with prostate adenocarcinoma undergoing SBRT with 36.25Gy, delivered in 5 fractions was enrolled in the study. 6DoF KIM technology: 2D positions of three implanted gold markers in each of the kV images (125kV, 10mA at 11Hz) were acquired continuously during treatment. The 2D→3D target position estimation was based on a probability distribution function. The 3D→6DoF target rotation was calculated using an iterative closest point algorithm. The accuracy and precision of the KIM method was measured by comparing the real-time results with kV-MV triangulation. Of the five treatment fractions, KIM was utilised successfully in four fractions. The intrafraction prostate motion resulted in three couch shifts in two fractions when the prostate motion exceeded the pre-set action threshold of 2mm for more than 5s. KIM translational accuracy and precision were 0.3±0.6mm, -0.2±0.3mm and 0.2±0.7mm in the Left-Right (LR), Superior-Inferior (SI) and Anterior-Posterior (AP) directions, respectively. The KIM rotational accuracy and precision were 0.8°±2.0°, -0.5°±3.3° and 0.3°±1.6° in the roll, pitch and yaw directions, respectively. This treatment represents, to the best of our knowledge, the first time a cancer patient's tumour position and rotation have been monitored in real-time during treatment. The 6 DoF KIM system has sub-millimetre accuracy and precision in all three translational axes, and less than 1° accuracy and 4° precision in all three rotational axes. Copyright © 2017 Elsevier B.V. All rights reserved.

Quality assurance for a six degrees-of-freedom table using a 3D printed phantom.

PubMed

Woods, Kyle; Ayan, Ahmet S; Woollard, Jeffrey; Gupta, Nilendu

2018-01-01

To establish a streamlined end-to-end test of a 6 degrees-of-freedom (6DoF) robotic table using a 3D printed phantom for periodic quality assurance. A 3D printed phantom was fabricated with translational and rotational offsets and an imbedded central ball-bearing (BB). The phantom underwent each step of the radiation therapy process: CT simulation in a straight orientation, plan generation using the treatment planning software, setup to offset marks at the linac, registration and corrected 6DoF table adjustments via hidden target test, delivery of a Winston-Lutz test to the BB, and verification of table positioning via field and laser lights. The registration values, maximum total displacement of the combined Winston-Lutz fields, and a pass or fail criterion of the laser and field lights were recorded. The quality assurance process for each of the three linacs were performed for the first 30 days. Within a 95% confidence interval, the overall uncertainty values for both translation and rotation were below 1.0 mm and 0.5° for each linac respectively. When combining the registration values and other uncertainties for all three linacs, the average deviations were within 2.0 mm and 1.0° of the designed translation and rotation offsets of the 3D print respectively. For all three linacs, the maximum total deviation for the Winston-Lutz test did not exceed 1.0 mm. Laser and light field verification was within tolerance every day for all three linacs given the latest guidance documentation for table repositioning. The 3D printer is capable of accurately fabricating a quality assurance phantom for 6DoF positioning verification. The end-to-end workflow allows for a more efficient test of the 6DoF mechanics while including other important tests needed for routine quality assurance. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

Attitude control system design using a flywheel suspended by two gimbals

NASA Astrophysics Data System (ADS)

Peres, R. W.; Ricci, M. C.

2015-10-01

This work presents the attitude control system design procedures for a three axis stabilized satellite in geostationary orbit, which contains a flywheel suspended by two gimbals. The use of a flywheel with two DOFs is an interesting option because with only one device it's possible to control the torques about vehicle's three axes; through the wheel speed control and gyrotorquing phenomenon with two DOFs. If the wheel size and speed are determined properly it's possible to cancel cyclic torques using gas jets only periodically to cancel secular disturbance torques. The system, based on a flywheel, takes only one pitch/roll (earth) sensor to maintain precise attitude, unlike mass expulsion based control systems, which uses propellants continuously, beyond roll, pitch and yaw sensors. It is considered the satellite is in nominal orbit and, therefore, that the attitude's acquisition phase has already elapsed. Control laws and system parameters are determined in order to cancel the solar pressure radiation disturbance torque and the torque due to misalignment of the thrusters. Stability is analyzed and step and cyclic responses are obtained.

In vivo six-degree-of-freedom knee-joint kinematics in overground and treadmill walking following total knee arthroplasty.

PubMed

Guan, Shanyuanye; Gray, Hans A; Schache, Anthony G; Feller, Julian; de Steiger, Richard; Pandy, Marcus G

2017-08-01

No data are available to describe six-degree-of-freedom (6-DOF) knee-joint kinematics for one complete cycle of overground walking following total knee arthroplasty (TKA). The aims of this study were firstly, to measure 6-DOF knee-joint kinematics and condylar motion for overground walking following TKA; and secondly, to determine whether such data differed between overground and treadmill gait when participants walked at the same speed during both tasks. A unique mobile biplane X-ray imaging system enabled accurate measurement of 6-DOF TKA knee kinematics during overground walking by simultaneously tracking and imaging the joint. The largest rotations occurred for flexion-extension and internal-external rotation whereas the largest translations were associated with joint distraction and anterior-posterior drawer. Strong associations were found between flexion-extension and adduction-abduction (R 2  = 0.92), joint distraction (R 2  = 1.00), and anterior-posterior translation (R 2  = 0.77), providing evidence of kinematic coupling in the TKA knee. Although the measured kinematic profiles for overground walking were grossly similar to those for treadmill walking, several statistically significant differences were observed between the two conditions with respect to temporo-spatial parameters, 6-DOF knee-joint kinematics, and condylar contact locations and sliding. Thus, caution is advised when making recommendations regarding knee implant performance based on treadmill-measured knee-joint kinematic data. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1634-1643, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

A Sub-Millimetric 3-DOF Force Sensing Instrument with Integrated Fiber Bragg Grating for Retinal Microsurgery

PubMed Central

He, Xingchi; Handa, James; Gehlbach, Peter; Taylor, Russell; Iordachita, Iulian

2013-01-01

Vitreoretinal surgery requires very fine motor control to perform precise manipulation of the delicate tissue in the interior of the eye. Besides physiological hand tremor, fatigue, poor kinesthetic feedback, and patient movement, the absence of force sensing is one of the main technical challenges. Previous two degrees of freedom (DOF) force sensing instruments have demonstrated robust force measuring performance. The main design challenge is to incorporate high sensitivity axial force sensing. This paper reports the development of a sub-millimetric 3-DOF force sensing pick instrument based on fiber Bragg grating (FBG) sensors. The configuration of the four FBG sensors is arranged to maximize the decoupling between axial and transverse force sensing. A super-elastic nitinol flexure is designed to achieve high axial force sensitivity. An automated calibration system was developed for repeatability testing, calibration, and validation. Experimental results demonstrate a FBG sensor repeatability of 1.3 pm. The linear model for calculating the transverse forces provides an accurate global estimate. While the linear model for axial force is only locally accurate within a conical region with a 30° vertex angle, a second-order polynomial model can provide a useful global estimate for axial force. Combining the linear model for transverse forces and nonlinear model for axial force, the 3-DOF force sensing instrument can provide sub-millinewton resolution for axial force and a quarter millinewton for transverse forces. Validation with random samples show the force sensor can provide consistent and accurate measurement of three dimensional forces. PMID:24108455

Performance assessment of a programmable five degrees-of-freedom motion platform for quality assurance of motion management techniques in radiotherapy.

PubMed

Huang, Chen-Yu; Keall, Paul; Rice, Adam; Colvill, Emma; Ng, Jin Aun; Booth, Jeremy T

2017-09-01

Inter-fraction and intra-fraction motion management methods are increasingly applied clinically and require the development of advanced motion platforms to facilitate testing and quality assurance program development. The aim of this study was to assess the performance of a 5 degrees-of-freedom (DoF) programmable motion platform HexaMotion (ScandiDos, Uppsala, Sweden) towards clinically observed tumor motion range, velocity, acceleration and the accuracy requirements of SABR prescribed in AAPM Task Group 142. Performance specifications for the motion platform were derived from literature regarding the motion characteristics of prostate and lung tumor targets required for real time motion management. The performance of the programmable motion platform was evaluated against (1) maximum range, velocity and acceleration (5 DoF), (2) static position accuracy (5 DoF) and (3) dynamic position accuracy using patient-derived prostate and lung tumor motion traces (3 DoF). Translational motion accuracy was compared against electromagnetic transponder measurements. Rotation was benchmarked with a digital inclinometer. The static accuracy and reproducibility for translation and rotation was <0.1 mm or <0.1°, respectively. The accuracy of reproducing dynamic patient motion was <0.3 mm. The motion platform's range met the need to reproduce clinically relevant translation and rotation ranges and its accuracy met the TG 142 requirements for SABR. The range, velocity and acceleration of the motion platform are sufficient to reproduce lung and prostate tumor motion for motion management. Programmable motion platforms are valuable tools in the investigation, quality assurance and commissioning of motion management systems in radiation oncology.

Performance evaluation of nonlinear energy harvesting with magnetically coupled dual beams

NASA Astrophysics Data System (ADS)

Lan, Chunbo; Tang, Lihua; Qin, Weiyang

2017-04-01

To enhance the output power and broaden the operation bandwidth of vibration energy harvesters (VEH), nonlinear two degree-of-freedom (DOF) energy harvesters have attracted wide attention recently. In this paper, we investigate the performance of a nonlinear VEH with magnetically coupled dual beams and compare it with the typical Duffing-type VEH to find the advantages and drawbacks of this nonlinear 2-DOF VEH. First, based on the lumped parameter model, the characteristics of potential energy shapes and static equilibriums are analyzed. It is noted that the dual beam configuration is much easy to be transformed from a mono-stable state into a bi-stable state when the repulsive magnet force increases. Based on the equilibrium positions and different kinds of nonlinearities, four nonlinearity regimes are determined. Second, the performance of 1-DOF and 2-DOF configurations are compared respectively in these four nonlinearity regimes by simulating the forward sweep responses of these two nonlinear VEHs under different acceleration levels. Several meaningful conclusions are obtained. First, the main alternative to enlarge the operation bandwidth for dual-beam configuration is chaotic oscillation, in which two beams jump between two stable positions chaotically. However, the large-amplitude periodic oscillations, such as inter-well oscillation, cannot take place in both piezoelectric and parasitic beams at the same time. Generally speaking, both of the magnetically coupled dual-beam energy harvester and Duffingtype energy harvester, have their own advantages and disadvantages, while given a large enough base excitation, the maximum voltages of these two systems are almost the same in all these four regimes.

Nine-degrees-of-freedom flexmap for a cone-beam computed tomography imaging device with independently movable source and detector.

PubMed

Keuschnigg, Peter; Kellner, Daniel; Fritscher, Karl; Zechner, Andrea; Mayer, Ulrich; Huber, Philipp; Sedlmayer, Felix; Deutschmann, Heinz; Steininger, Philipp

2017-01-01

Couch-mounted cone-beam computed tomography (CBCT) imaging devices with independently rotatable x-ray source and flat-panel detector arms for acquisitions of arbitrary regions of interest (ROI) have recently been introduced in image-guided radiotherapy (IGRT). This work analyzes mechanical limitations and gravity-induced effects influencing the geometric accuracy of images acquired with arbitrary angular constellations of source and detector in nonisocentric trajectories, which is considered essential for IGRT. In order to compensate for geometric inaccuracies of this modality, a 9-degrees-of-freedom (9-DOF) flexmap correction approach is presented, focusing especially on the separability of the flexmap parameters of the independently movable components of the device. The 9-DOF comprise a 3D translation of the x-ray source focal spot, a 3D translation of the flat-panel's active area center and three Euler-rotations of the detector's row and column vectors. The flexmap parameters are expressed with respect to the angular position of each of the devices arms. Estimation of the parameters is performed, using a CT-based structure set of a table-mounted, cylindrical ball-bearing phantom. Digitally reconstructed radiograph (DRR) patches are derived from the structure set followed by local 2D in-plane registration and subsequent 3D transform estimation by nonlinear regression with outlier detection. Flexmap parameter evaluations for the factory-calibrated system in clockwise and counter-clockwise rotation direction have shown only minor differences for the overall set of flexmap parameters. High short-term reproducibility of the flexmap parameters has been confirmed by experiments over 10 acquisitions for both directions, resulting in standard deviation values of ≤0.183 mm for translational components and ≤0.0219 deg for rotational components, respectively. A comparison of isocentric and nonisocentric flexmap evaluations showed that the mean differences of the parameter curves reside within their standard deviations, confirming the ability of the proposed calibration method to handle both types of trajectories equally well. Reconstructions of 0.1 mm and 0.25 mm steel wires showed similar results for the isocentric and nonisocentric cases. The full-width at half maximum (FWHM) measure indicates an average improvement of the calibrated reconstruction of 85% over the uncalibrated reconstruction. The contrast of the point spread function (PSF) improved by 310% on average over all experiments. Moreover, a reduced amount of artifacts visible in nonisocentric reconstructions of a head phantom and a line-pair phantom has been achieved by separate application of the 9-DOF flexmap on the geometry described by the independently moving source arm and detector arm. Using a 9-DOF flexmap approach for correcting the geometry of projections acquired with a device capable of independent movements of the source and panel arms has been shown to be essential for IGRT use cases such as CBCT reconstruction and 2D/3D registration tasks. The proposed pipeline is able to create flexmap curves which are easy to interpret, useful for mechanical description of the device and repetitive quality assurance as well as system-level preventive maintenance. Application of the flexmap has shown improvements of image quality for planar imaging and volumetric imaging which is crucial for patient alignment accuracy. © 2016 American Association of Physicists in Medicine.

Numerical study of the geometry of the phase space of the Augmented Hill Three-Body problem

NASA Astrophysics Data System (ADS)

Farrés, Ariadna; Jorba, Àngel; Mondelo, Josep-Maria

2017-09-01

The Augmented Hill Three-Body problem is an extension of the classical Hill problem that, among other applications, has been used to model the motion of a solar sail around an asteroid. This model is a 3 degrees of freedom (3DoF) Hamiltonian system that depends on four parameters. This paper describes the bounded motions (periodic orbits and invariant tori) in an extended neighbourhood of some of the equilibrium points of the model. An interesting feature is the existence of equilibrium points with a 1:1 resonance, whose neighbourhood we also describe. The main tools used are the computation of periodic orbits (including their stability and bifurcations), the reduction of the Hamiltonian to centre manifolds at equilibria, and the numerical approximation of invariant tori. It is remarkable how the combination of these techniques allows the description of the dynamics of a 3DoF Hamiltonian system.

Combined Feature Based and Shape Based Visual Tracker for Robot Navigation

NASA Technical Reports Server (NTRS)

Deans, J.; Kunz, C.; Sargent, R.; Park, E.; Pedersen, L.

2005-01-01

We have developed a combined feature based and shape based visual tracking system designed to enable a planetary rover to visually track and servo to specific points chosen by a user with centimeter precision. The feature based tracker uses invariant feature detection and matching across a stereo pair, as well as matching pairs before and after robot movement in order to compute an incremental 6-DOF motion at each tracker update. This tracking method is subject to drift over time, which can be compensated by the shape based method. The shape based tracking method consists of 3D model registration, which recovers 6-DOF motion given sufficient shape and proper initialization. By integrating complementary algorithms, the combined tracker leverages the efficiency and robustness of feature based methods with the precision and accuracy of model registration. In this paper, we present the algorithms and their integration into a combined visual tracking system.

A surgical parallel continuum manipulator with a cable-driven grasper.

PubMed

Orekhov, Andrew L; Bryson, Caroline E; Till, John; Chung, Scotty; Rucker, D Caleb

2015-01-01

In this paper, we present the design, construction, and control of a six-degree-of-freedom (DOF), 12 mm diameter, parallel continuum manipulator with a 2-DOF, cable-driven grasper. This work is a proof-of-concept first step towards miniaturization of this type of manipulator design to provide increased dexterity and stability in confined-space surgical applications, particularly for endoscopic procedures. Our robotic system consists of six superelastic NiTi (Nitinol) tubes in a standard Stewart-Gough configuration and an end effector with 180 degree motion of its two jaws. Two Kevlar cables pass through the centers of the tube legs to actuate the end effector. A computationally efficient inverse kinematics model provides low-level control inputs to ten independent linear actuators, which drive the Stewart-Gough platform and end-effector actuation cables. We demonstrate the performance and feasibility of this design by conducting open-loop range-of-motion tests for our system.

Distance-to-Agreement Investigation of Tomotherapy's Bony Anatomy-Based Autoregistration and Planning Target Volume Contour-Based Optimization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suh, Steve, E-mail: ssuh@coh.org; Schultheiss, Timothy E.

Purpose: To compare Tomotherapy's megavoltage computed tomography bony anatomy autoregistration with the best achievable registration, assuming no deformation and perfect knowledge of planning target volume (PTV) location. Methods and Materials: Distance-to-agreement (DTA) of the PTV was determined by applying a rigid-body shift to the PTV region of interest of the prostate from its reference position, assuming no deformations. Planning target volume region of interest of the prostate was extracted from the patient archives. The reference position was set by the 6 degrees of freedom (dof)—x, y, z, roll, pitch, and yaw—optimization results from the previous study at this institution. Themore » DTA and the compensating parameters were calculated by the shift of the PTV from the reference 6-dof to the 4-dof—x, y, z, and roll—optimization. In this study, the effectiveness of Tomotherapy's 4-dof bony anatomy–based autoregistration was compared with the idealized 4-dof PTV contour-based optimization. Results: The maximum DTA (maxDTA) of the bony anatomy-based autoregistration was 3.2 ± 1.9 mm, with the maximum value of 8.0 mm. The maxDTA of the contour-based optimization was 1.8 ± 1.3 mm, with the maximum value of 5.7 mm. Comparison of Pearson correlation of the compensating parameters between the 2 4-dof optimization algorithms shows that there is a small but statistically significant correlation in y and z (0.236 and 0.300, respectively), whereas there is very weak correlation in x and roll (0.062 and 0.025, respectively). Conclusions: We find that there is an average improvement of approximately 1 mm in terms of maxDTA on the PTV going from 4-dof bony anatomy-based autoregistration to the 4-dof contour-based optimization. Pearson correlation analysis of the 2 4-dof optimizations suggests that uncertainties due to deformation and inadequate resolution account for much of the compensating parameters, but pitch variation also makes a statistically significant contribution.« less

Gene- and environment-dependent neuroendocrine etiogenesis of homosexuality and transsexualism.

PubMed

Dörner, G; Poppe, I; Stahl, F; Kölzsch, J; Uebelhack, R

1991-01-01

Sexual brain organization is dependent on sex hormone and neurotransmitter levels occurring during critical developmental periods. The higher the androgen levels during brain organization, caused by genetic and/or environmental factors, the higher is the biological predisposition to bi- and homosexuality or even transsexualism in females and the lower it is in males. Adrenal androgen excess, leading to heterotypical sexual orientation and/or gender role behavior in genetic females, can be caused by 21-hydroxylase deficiency, especially when associated with prenatal stress. The cortisol (F) precursor 21-deoxycortisol (21-DOF) was found to be significantly increased after ACTH stimulation in homosexual as compared to heterosexual females. 21-DOF was increased significantly before and even highly significantly after ACTH stimulation in female-to-male transsexuals. In view of these data, heterozygous and homozygous forms, respectively, of 21-hydroxylase deficiency represent a genetic predisposition to androgen-dependent development of homosexuality and transsexualism in females. Testicular androgen deficiency in prenatal life, giving rise to heterotypical sexual orientation and/or gender role behavior in genetic males, may be induced by prenatal stress and/or maternal or fetal genetic alterations. Most recently, in mothers of homosexual men--following ACTH stimulation--a significantly increased prevalence of high 21-DOF plasma values and 21-DOF/F ratios was found, which surpassed the mean + 1 SD level of heterosexual control women. In homosexual men as well--following ACTH stimulation--most of the 21-DOF plasma values and 21-DOF/F ratios also surpassed the mean + 1 SD level of heterosexual men. In only one out of 9 homosexual males, neither in his blood nor in that of his mother increased 21-DOF values and 21-DOF/F ratios were found after ACTH stimulation. In this homosexual man, however, the plasma dehydroepiandrosterone sulfate (DHEA-S) values and the DHEA-S/1000 x A (A = androstenedione) ratio were increased before and after ACTH stimulation. Furthermore, highly significantly increased basal plasma levels of dehydroepiandrosterone sulfate were found in male-to-female transsexuals as compared to normal males, suggesting partial 3 beta-ol hydroxysteroid dehydrogenase deficiency to be a predisposing factor for the development of male-to-female transsexualism.

CRUX: a Compliant Robotic Upper-Extremity eXosuit for Lightweight, Portable, Multi-DoF Muscular Augmentation

NASA Technical Reports Server (NTRS)

Lessard, Steven; Pansodtee, Pattawong; Robbins, Ash; Baltaxe-Admony, Leya Breanna; Teodorescu, Mircea; Kurniawan,Sri; Agogino, Adrian; Kurniawan, Sri

2017-01-01

Wearable robots can potentially offer their users enhanced stability and strength. These augmentations are ideally designed to actuate harmoniously with the users movements and provide extra force as needed. The creation of such robots, however, is particularly challenging due to the complexity of the underlying human body. In this paper, we present a compliant, robotic exosuit for upper-extremities called CRUX. This exosuit, inspired by tensegrity models of the human arm, features a lightweight (1.3 kg), flexible design for portability. We also show how CRUX maintains full flexibility of the upper-extremities for its users while providing multi- DoF augmentative strength to the major muscles of the arm, as evident by tracking the heart rate of an individual exercising said arm. Exosuits such as CRUX may be useful in physical therapy and in extreme environments where users are expected to exert their bodies to the fullest extent.

I(CES)-cubes: a modular self-reconfigurable bipartite robotic system

NASA Astrophysics Data System (ADS)

Unsal, Cem; Kiliccote, Han; Khosla, Pradeep K.

1999-08-01

In this manuscript, we introduce I(CES)-Cubes, a class of 3D modular robotic system that is capable of reconfiguring itself in order to adapt to its environment. This is a bipartite system, i.e. a collection of (i) active elements capable of actuation, and (ii) passive elements acting as connectors between actuated elements. Active elements, called links, are 3-DOF manipulators that are capable of attaching/detaching themselves to/from the passive elements. The cubes can then be positioned and oriented using links, which are independent mechatronic elements. Self- reconfiguration property enables the system to performed locomotion tasks over difficult terrain. For example, the system would be capable of moving over obstacles and climbing stairs. These task are performed by positing and orienting cubes and links to form a 3D network with required shape and position. This paper describes the design of the passive and active elements, the attachment mechanics, and several reconfiguration scenarios. Specifics of the hardware implementation and result of experiments with current prototypes are also given.

Compensation for Unconstrained Catheter Shaft Motion in Cardiac Catheters

PubMed Central

Degirmenci, Alperen; Loschak, Paul M.; Tschabrunn, Cory M.; Anter, Elad; Howe, Robert D.

2016-01-01

Cardiac catheterization with ultrasound (US) imaging catheters provides real time US imaging from within the heart, but manually navigating a four degree of freedom (DOF) imaging catheter is difficult and requires extensive training. Existing work has demonstrated robotic catheter steering in constrained bench top environments. Closed-loop control in an unconstrained setting, such as patient vasculature, remains a significant challenge due to friction, backlash, and physiological disturbances. In this paper we present a new method for closed-loop control of the catheter tip that can accurately and robustly steer 4-DOF cardiac catheters and other flexible manipulators despite these effects. The performance of the system is demonstrated in a vasculature phantom and an in vivo porcine animal model. During bench top studies the robotic system converged to the desired US imager pose with sub-millimeter and sub-degree-level accuracy. During animal trials the system achieved 2.0 mm and 0.65° accuracy. Accurate and robust robotic navigation of flexible manipulators will enable enhanced visualization and treatment during procedures. PMID:27525170

Gait Planning and Stability Control of a Quadruped Robot

PubMed Central

Li, Junmin; Wang, Jinge; Yang, Simon X.; Zhou, Kedong; Tang, Huijuan

2016-01-01

In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype. PMID:27143959

Gait Planning and Stability Control of a Quadruped Robot.

PubMed

Li, Junmin; Wang, Jinge; Yang, Simon X; Zhou, Kedong; Tang, Huijuan

2016-01-01

In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype.

Methods for multi-material stereolithography

DOEpatents

Wicker, Ryan [El Paso, TX; Medina, Francisco [El Paso, TX; Elkins, Christopher [Redwood City, CA

2011-06-14

Methods and systems of stereolithography for building cost-efficient and time-saving multi-material, multi-functional and multi-colored prototypes, models and devices configured for intermediate washing and curing/drying is disclosed including: laser(s), liquid and/or platform level sensing system(s), controllable optical system(s), moveable platform(s), elevator platform(s), recoating system(s) and at least one polymer retaining receptacle. Multiple polymer retaining receptacles may be arranged in a moveable apparatus, wherein each receptacle is adapted to actively/passively maintain a uniform, desired level of polymer by including a recoating device and a material fill/remove system. The platform is movably accessible to the polymer retaining receptacle(s), elevator mechanism(s) and washing and curing/drying area(s) which may be housed in a shielded enclosure(s). The elevator mechanism is configured to vertically traverse and rotate the platform, thus providing angled building, washing and curing/drying capabilities. A horizontal traversing mechanism may be included to facilitate manufacturing between components of SL cabinet(s) and/or alternative manufacturing technologies.

Dimensional synthesis of a leg mechanism

NASA Astrophysics Data System (ADS)

Pop, F.; Lovasz, E.-Ch; Pop, C.; Dolga, V.

2016-08-01

An eight bar leg mechanism dimensional synthesis is presented. The mathematical model regarding the synthesis is described and the results obtained after computation are verified with help of 2D mechanism simulation in Matlab. This mechanism, inspired from proposed solution of Theo Jansen, is integrated into the structure of a 2 DOF quadruped robot. With help of the kinematic synthesis method described, it is tried to determine new dimensions for the mechanism, based on a set of initial conditions. These are established by taking into account the movement of the end point of the leg mechanism, which enters in contact with the ground, during walking. An optimization process based on the results obtained can be conducted further in order to find a better solution for the leg mechanism.

SPARTAN: A High-Fidelity Simulation for Automated Rendezvous and Docking Applications

NASA Technical Reports Server (NTRS)

Turbe, Michael A.; McDuffie, James H.; DeKock, Brandon K.; Betts, Kevin M.; Carrington, Connie K.

2007-01-01

bd Systems (a subsidiary of SAIC) has developed the Simulation Package for Autonomous Rendezvous Test and ANalysis (SPARTAN), a high-fidelity on-orbit simulation featuring multiple six-degree-of-freedom (6DOF) vehicles. SPARTAN has been developed in a modular fashion in Matlab/Simulink to test next-generation automated rendezvous and docking guidance, navigation,and control algorithms for NASA's new Vision for Space Exploration. SPARTAN includes autonomous state-based mission manager algorithms responsible for sequencing the vehicle through various flight phases based on on-board sensor inputs and closed-loop guidance algorithms, including Lambert transfers, Clohessy-Wiltshire maneuvers, and glideslope approaches The guidance commands are implemented using an integrated translation and attitude control system to provide 6DOF control of each vehicle in the simulation. SPARTAN also includes high-fidelity representations of a variety of absolute and relative navigation sensors that maybe used for NASA missions, including radio frequency, lidar, and video-based rendezvous sensors. Proprietary navigation sensor fusion algorithms have been developed that allow the integration of these sensor measurements through an extended Kalman filter framework to create a single optimal estimate of the relative state of the vehicles. SPARTAN provides capability for Monte Carlo dispersion analysis, allowing for rigorous evaluation of the performance of the complete proposed AR&D system, including software, sensors, and mechanisms. SPARTAN also supports hardware-in-the-loop testing through conversion of the algorithms to C code using Real-Time Workshop in order to be hosted in a mission computer engineering development unit running an embedded real-time operating system. SPARTAN also contains both runtime TCP/IP socket interface and post-processing compatibility with bdStudio, a visualization tool developed by bd Systems, allowing for intuitive evaluation of simulation results. A description of the SPARTAN architecture and capabilities is provided, along with details on the models and algorithms utilized and results from representative missions.

Spectral domain optical coherence tomography with extended depth-of-focus by aperture synthesis

NASA Astrophysics Data System (ADS)

Bo, En; Liu, Linbo

2016-10-01

We developed a spectral domain optical coherence tomography (SD-OCT) with an extended depth-of-focus (DOF) by synthetizing aperture. For a designated Gaussian-shape light source, the lateral resolution was determined by the numerical aperture (NA) of the objective lens and can be approximately maintained over the confocal parameter, which was defined as twice the Rayleigh range. However, the DOF was proportional to the square of the lateral resolution. Consequently, a trade-off existed between the DOF and lateral resolution, and researchers had to weigh and judge which was more important for their research reasonably. In this study, three distinct optical apertures were obtained by imbedding a circular phase spacer in the sample arm. Due to the optical path difference between three distinct apertures caused by the phase spacer, three images were aligned with equal spacing along z-axis vertically. By correcting the optical path difference (OPD) and defocus-induced wavefront curvature, three images with distinct depths were coherently summed together. This system digitally refocused the sample tissue and obtained a brand new image with higher lateral resolution over the confocal parameter when imaging the polystyrene calibration beads.

Development of a Smooth Trajectory Maneuver Method to Accommodate the Ares I Flight Control Constraints

NASA Technical Reports Server (NTRS)

Pinson, Robin M.; Schmitt, Terri L.; Hanson, John M.

2008-01-01

Six degree-of-freedom (DOF) launch vehicle trajectories are designed to follow an optimized 3-DOF reference trajectory. A vehicle has a finite amount of control power that it can allocate to performing maneuvers. Therefore, the 3-DOF trajectory must be designed to refrain from using 100% of the allowable control capability to perform maneuvers, saving control power for handling off-nominal conditions, wind gusts and other perturbations. During the Ares I trajectory analysis, two maneuvers were found to be hard for the control system to implement; a roll maneuver prior to the gravity turn and an angle of attack maneuver immediately after the J-2X engine start-up. It was decided to develop an approach for creating smooth maneuvers in the optimized reference trajectories that accounts for the thrust available from the engines. A feature of this method is that no additional angular velocity in the direction of the maneuver has been added to the vehicle after the maneuver completion. This paper discusses the equations behind these new maneuvers and their implementation into the Ares I trajectory design cycle. Also discussed is a possible extension to adjusting closed-loop guidance.

Coded aperture solution for improving the performance of traffic enforcement cameras

NASA Astrophysics Data System (ADS)

Masoudifar, Mina; Pourreza, Hamid Reza

2016-10-01

A coded aperture camera is proposed for automatic license plate recognition (ALPR) systems. It captures images using a noncircular aperture. The aperture pattern is designed for the rapid acquisition of high-resolution images while preserving high spatial frequencies of defocused regions. It is obtained by minimizing an objective function, which computes the expected value of perceptual deblurring error. The imaging conditions and camera sensor specifications are also considered in the proposed function. The designed aperture improves the depth of field (DoF) and subsequently ALPR performance. The captured images can be directly analyzed by the ALPR software up to a specific depth, which is 13 m in our case, though it is 11 m for the circular aperture. Moreover, since the deblurring results of images captured by our aperture yield fewer artifacts than those captured by the circular aperture, images can be first deblurred and then analyzed by the ALPR software. In this way, the DoF and recognition rate can be improved at the same time. Our case study shows that the proposed camera can improve the DoF up to 17 m while it is limited to 11 m in the conventional aperture.

[The relation of workspace and installation space of epicyclic kinematics with six degrees of freedom].

PubMed

Pott, Peter P; Schwarz, Markus L R

2007-10-01

The kinematics of a robotic device significantly determines its installation space when it comes to technical realisation. With regard to the deployment of robotic manipulators in surgery, manipulators with a preferably small installation space are needed. This study describes six versions of novel epicyclic kinematics with six degrees of freedom (DOF). At first, the kinematics functionality was analysed using Gruebler's formula. Subsequently, the quantitative determination of the relation of workspace and installation space was performed using Matlab algorithms. To qualitatively describe the shape of the workspace, the Matlab visualisation features were utilised. For comparison, the well-known Hexapod was used. The assessed kinematics had 6-DOF-functionality. It became apparent that one version of the epicyclic kinematics having two 3-DOF disk systems mounted in a parallel way featured a particularly good relation of workspace and installation space. Compared to the Hexapod, this is approximately four times better. The shape of the workspaces of all epicyclic kinematics assessed was convex and compact. It could be shown that a novel epicyclic kinematics has a notably advantageous relation of workspace and installation space. Apparently, it seems to be well suited for the deployment in robotic machines for surgical procedures.

Feedback control of arm movements using Neuro-Muscular Electrical Stimulation (NMES) combined with a lockable, passive exoskeleton for gravity compensation

PubMed Central

Klauer, Christian; Schauer, Thomas; Reichenfelser, Werner; Karner, Jakob; Zwicker, Sven; Gandolla, Marta; Ambrosini, Emilia; Ferrante, Simona; Hack, Marco; Jedlitschka, Andreas; Duschau-Wicke, Alexander; Gföhler, Margit; Pedrocchi, Alessandra

2014-01-01

Within the European project MUNDUS, an assistive framework was developed for the support of arm and hand functions during daily life activities in severely impaired people. This contribution aims at designing a feedback control system for Neuro-Muscular Electrical Stimulation (NMES) to enable reaching functions in people with no residual voluntary control of the arm and shoulder due to high level spinal cord injury. NMES is applied to the deltoids and the biceps muscles and integrated with a three degrees of freedom (DoFs) passive exoskeleton, which partially compensates gravitational forces and allows to lock each DOF. The user is able to choose the target hand position and to trigger actions using an eyetracker system. The target position is selected by using the eyetracker and determined by a marker-based tracking system using Microsoft Kinect. A central controller, i.e., a finite state machine, issues a sequence of basic movement commands to the real-time arm controller. The NMES control algorithm sequentially controls each joint angle while locking the other DoFs. Daily activities, such as drinking, brushing hair, pushing an alarm button, etc., can be supported by the system. The robust and easily tunable control approach was evaluated with five healthy subjects during a drinking task. Subjects were asked to remain passive and to allow NMES to induce the movements. In all of them, the controller was able to perform the task, and a mean hand positioning error of less than five centimeters was achieved. The average total time duration for moving the hand from a rest position to a drinking cup, for moving the cup to the mouth and back, and for finally returning the arm to the rest position was 71 s. PMID:25228853

Feedback control of arm movements using Neuro-Muscular Electrical Stimulation (NMES) combined with a lockable, passive exoskeleton for gravity compensation.

PubMed

Klauer, Christian; Schauer, Thomas; Reichenfelser, Werner; Karner, Jakob; Zwicker, Sven; Gandolla, Marta; Ambrosini, Emilia; Ferrante, Simona; Hack, Marco; Jedlitschka, Andreas; Duschau-Wicke, Alexander; Gföhler, Margit; Pedrocchi, Alessandra

2014-01-01

Within the European project MUNDUS, an assistive framework was developed for the support of arm and hand functions during daily life activities in severely impaired people. This contribution aims at designing a feedback control system for Neuro-Muscular Electrical Stimulation (NMES) to enable reaching functions in people with no residual voluntary control of the arm and shoulder due to high level spinal cord injury. NMES is applied to the deltoids and the biceps muscles and integrated with a three degrees of freedom (DoFs) passive exoskeleton, which partially compensates gravitational forces and allows to lock each DOF. The user is able to choose the target hand position and to trigger actions using an eyetracker system. The target position is selected by using the eyetracker and determined by a marker-based tracking system using Microsoft Kinect. A central controller, i.e., a finite state machine, issues a sequence of basic movement commands to the real-time arm controller. The NMES control algorithm sequentially controls each joint angle while locking the other DoFs. Daily activities, such as drinking, brushing hair, pushing an alarm button, etc., can be supported by the system. The robust and easily tunable control approach was evaluated with five healthy subjects during a drinking task. Subjects were asked to remain passive and to allow NMES to induce the movements. In all of them, the controller was able to perform the task, and a mean hand positioning error of less than five centimeters was achieved. The average total time duration for moving the hand from a rest position to a drinking cup, for moving the cup to the mouth and back, and for finally returning the arm to the rest position was 71 s.

Non-orthogonal tool/flange and robot/world calibration.

PubMed

Ernst, Floris; Richter, Lars; Matthäus, Lars; Martens, Volker; Bruder, Ralf; Schlaefer, Alexander; Schweikard, Achim

2012-12-01

For many robot-assisted medical applications, it is necessary to accurately compute the relation between the robot's coordinate system and the coordinate system of a localisation or tracking device. Today, this is typically carried out using hand-eye calibration methods like those proposed by Tsai/Lenz or Daniilidis. We present a new method for simultaneous tool/flange and robot/world calibration by estimating a solution to the matrix equation AX = YB. It is computed using a least-squares approach. Because real robots and localisation are all afflicted by errors, our approach allows for non-orthogonal matrices, partially compensating for imperfect calibration of the robot or localisation device. We also introduce a new method where full robot/world and partial tool/flange calibration is possible by using localisation devices providing less than six degrees of freedom (DOFs). The methods are evaluated on simulation data and on real-world measurements from optical and magnetical tracking devices, volumetric ultrasound providing 3-DOF data, and a surface laser scanning device. We compare our methods with two classical approaches: the method by Tsai/Lenz and the method by Daniilidis. In all experiments, the new algorithms outperform the classical methods in terms of translational accuracy by up to 80% and perform similarly in terms of rotational accuracy. Additionally, the methods are shown to be stable: the number of calibration stations used has far less influence on calibration quality than for the classical methods. Our work shows that the new method can be used for estimating the relationship between the robot's and the localisation device's coordinate systems. The new method can also be used for deficient systems providing only 3-DOF data, and it can be employed in real-time scenarios because of its speed. Copyright © 2012 John Wiley & Sons, Ltd.

The 2 Degrees of Freedom facility in Firenze for the study of weak forces

NASA Astrophysics Data System (ADS)

Marconi, L.; Stanga, R.; Lorenzini, M.; Grimani, C.; Bassan, M.; Pucacco, G.; Di Fiore, L.; De Rosa, R.; Garufi, F.; Milano, L.

2010-05-01

The LISA test-mass (TM) is sensitive to weak forces along all 6 Degrees of Freedom (DoFs). Extensi ve ground test ing is required in order to evaluate the influence of cross-talks of read-outs and actuators operating on different DoFs. To best represent the flight conditions, we developed in Firenze a facility with 2 soft DoFs. Using this facility we measure the forces and stiffnesses acting simultaneously along the 2 soft DoFs, and, more specifically, we will be able to de b ug residual couplings between the TM and the capacitive position sensor that reads the TM position, and to measure actuation cross talks with closed feedback loop. The facility is now ready, and here we report on the co mmi ssioning test s, and on the first measurements.

25th Space Simulation Conference. Environmental Testing: The Earth-Space Connection

NASA Technical Reports Server (NTRS)

Packard, Edward

2008-01-01

Topics covered include: Methods of Helium Injection and Removal for Heat Transfer Augmentation; The ESA Large Space Simulator Mechanical Ground Support Equipment for Spacecraft Testing; Temperature Stability and Control Requirements for Thermal Vacuum/Thermal Balance Testing of the Aquarius Radiometer; The Liquid Nitrogen System for Chamber A: A Change from Original Forced Flow Design to a Natural Flow (Thermo Siphon) System; Return to Mercury: A Comparison of Solar Simulation and Flight Data for the MESSENGER Spacecraft; Floating Pressure Conversion and Equipment Upgrades of Two 3.5kw, 20k, Helium Refrigerators; Affect of Air Leakage into a Thermal-Vacuum Chamber on Helium Refrigeration Heat Load; Special ISO Class 6 Cleanroom for the Lunar Reconnaissance Orbiter (LRO) Project; A State-of-the-Art Contamination Effects Research and Test Facility Martian Dust Simulator; Cleanroom Design Practices and Their Influence on Particle Counts; Extra Terrestrial Environmental Chamber Design; Contamination Sources Effects Analysis (CSEA) - A Tool to Balance Cost/Schedule While Managing Facility Availability; SES and Acoustics at GSFC; HST Super Lightweight Interchangeable Carrier (SLIC) Static Test; Virtual Shaker Testing: Simulation Technology Improves Vibration Test Performance; Estimating Shock Spectra: Extensions beyond GEVS; Structural Dynamic Analysis of a Spacecraft Multi-DOF Shaker Table; Direct Field Acoustic Testing; Manufacture of Cryoshroud Surfaces for Space Simulation Chambers; The New LOTIS Test Facility; Thermal Vacuum Control Systems Options for Test Facilities; Extremely High Vacuum Chamber for Low Outgassing Processing at NASA Goddard; Precision Cleaning - Path to Premier; The New Anechoic Shielded Chambers Designed for Space and Commercial Applications at LIT; Extraction of Thermal Performance Values from Samples in the Lunar Dust Adhesion Bell Jar; Thermal (Silicon Diode) Data Acquisition System; Aquarius's Instrument Science Data System (ISDS) Automated to Acquire, Process, Trend Data and Produce Radiometric System Assessment Reports; Exhaustive Thresholds and Resistance Checkpoints; Reconfigurable HIL Testing of Earth Satellites; FPGA Control System for the Automated Test of MicroShutters; Ongoing Capabilities and Developments of Re-Entry Plasma Ground Tests at EADS-ASTRIUM; Operationally Responsive Space Standard Bus Battery Thermal Balance Testing and Heat Dissipation Analysis; Galileo - The Serial-Production AIT Challenge; The Space Systems Environmental Test Facility Database (SSETFD), Website Development Status; Simulated Reentry Heating by Torching; Micro-Vibration Measurements on Thermally Loaded Multi-Layer Insulation Samples in Vacuum; High Temperature Life Testing of 80Ni-20Cr Wire in a Simulated Mars Atmosphere for the Sample Analysis at Mars (SAM) Instrument Suit Gas Processing System (GPS) Carbon Dioxide Scrubber; The Planning and Implementation of Test Facility Improvements; and Development of a Silicon Carbide Molecular Beam Nozzle for Simulation Planetary Flybys and Low-Earth Orbit.

Pressure-constrained, reduced-DOF, interconnected parallel manipulators with applications to space suit design

NASA Astrophysics Data System (ADS)

Jacobs, Shane Earl

This dissertation presents the concept of a Morphing Upper Torso, an innovative pressure suit design that incorporates robotic elements to enable a resizable, highly mobile and easy to don/doff spacesuit. The torso is modeled as a system of interconnected, pressure-constrained, reduced-DOF, wire-actuated parallel manipulators, that enable the dimensions of the suit to be reconfigured to match the wearer. The kinematics, dynamics and control of wire-actuated manipulators are derived and simulated, along with the Jacobian transforms, which relate the total twist vector of the system to the vector of actuator velocities. Tools are developed that allow calculation of the workspace for both single and interconnected reduced-DOF robots of this type, using knowledge of the link lengths. The forward kinematics and statics equations are combined and solved to produce the pose of the platforms along with the link tensions. These tools allow analysis of the full Morphing Upper Torso design, in which the back hatch of a rear-entry torso is interconnected with the waist ring, helmet ring and two scye bearings. Half-scale and full-scale experimental models are used along with analytical models to examine the feasibility of this novel space suit concept. The analytical and experimental results demonstrate that the torso could be expanded to facilitate donning and doffng, and then contracted to match different wearer's body dimensions. Using the system of interconnected parallel manipulators, suit components can be accurately repositioned to different desired configurations. The demonstrated feasibility of the Morphing Upper Torso concept makes it an exciting candidate for inclusion in a future planetary suit architecture.

Development of a multipurpose hand controller for JEMRMS

NASA Technical Reports Server (NTRS)

Matsuhira, Nobuto; Iikura, Shoichi; Asakura, Makoto; Shinomiya, Yasuo

1990-01-01

A prototype multipurpose hand controller for the JEMRMS (Japanese Experiment Module Remote Manipulator System) was developed. The hand controller (H/C) is an orthogonal type, with 6 degrees of freedom (DOF) and small size. The orthogonal type H/C is very simple for coordinate transformations and can easily control any type of manipulators. In fact, the JEMRMS is planned to have two manipulators controlled by a common H/C at this stage. The H/C was able to be used as a rate control joystick and a force reflection master arm, using an experimental 6 DOF manipulator. Good maneuverability was confirmed in the verification test. The orthogonal type H/C is suitable for use as a common H/C for the two manipulators of the JEMRMS.

Multi-layer plastic/glass microfluidic systems containing electrical and mechanical functionality.

PubMed

Han, Arum; Wang, Olivia; Graff, Mason; Mohanty, Swomitra K; Edwards, Thayne L; Han, Ki-Ho; Bruno Frazier, A

2003-08-01

This paper describes an approach for fabricating multi-layer microfluidic systems from a combination of glass and plastic materials. Methods and characterization results for the microfabrication technologies underlying the process flow are presented. The approach is used to fabricate and characterize multi-layer plastic/glass microfluidic systems containing electrical and mechanical functionality. Hot embossing, heat staking of plastics, injection molding, microstenciling of electrodes, and stereolithography were combined with conventional MEMS fabrication techniques to realize the multi-layer systems. The approach enabled the integration of multiple plastic/glass materials into a single monolithic system, provided a solution for the integration of electrical functionality throughout the system, provided a mechanism for the inclusion of microactuators such as micropumps/valves, and provided an interconnect technology for interfacing fluids and electrical components between the micro system and the macro world.

Experimental evaluation of a Dielectric Elastomer robotic arm for space applications

NASA Astrophysics Data System (ADS)

Branz, F.; Francesconi, A.

2017-04-01

A growing interest within the space community focuses on robotics due to the large number of possible applications in many mission scenarios. On-Orbit Servicing (OOS) is arguably the most appealing implementation of space automatic systems. In several cases, OOS requires the capture of orbital objects, which is a complex and risky operation that can be successfully performed by robotic manipulators. Soft robotics, in particular, seems to be suitable for such applications given its intrinsic compliance to the operative environment. Devices based on Dielectric Elastomers (DE) can be employed for the implementation of soft robotic systems and showed promising performances. The introduction of DEs to orbital systems would represent a breakthrough in space technologies. In addition, space conditions could further advantage DE robotics, given the reduced environmental loads experienced and the longer times for operations. Nevertheless, Dielectric Elastomer Actuators (DEA) are a low-TRL (Technology Readiness Level) technology that needs to prove its maturity and suitability to space implementation. In this work, the performances of a redundant manipulator based on DEAs are presented in terms of numerical and experimental results. A 4-DoF planar manipulator has been tested in a gravity-compensated setup. The system is composed by two double-cone actuators mounted in series, each of them providing actuation of two DoF. The end-effector is an optical marker whose position is detected by a vision system. The system has a total of four joint DoF and operates in the xy horizontal plane; only the x and y positions of the end-effector are controlled. Two degrees of redundancy are obtained and exploited for the optimization of joint torques to avoid the saturation of actuators. Numerical simulations have been conducted to predict the system behaviour. The laboratory facility emulates the zero-gravity orbital environment by means of a suspending cable. Detailed experimental results are presented and exploited for the validation of control algorithm and numerical models.

Passive broadband targeted energy transfers and control of self-excited vibrations

NASA Astrophysics Data System (ADS)

Lee, Young S.

This work consists of the three main parts---Nonlinear energy pumping (that is, passive broadband targeted energy transfers---TETs), and its applications to theoretical and experimental suppression of aeroelastic instabilities. In the first part, nonlinear energy pumping (or TETs) in coupled oscillators is studied. The system is composed of a primary linear subsystem coupled through an essentially nonlinear stiffness and a linear viscous damper to an additional mass (which is called, as a whole, a nonlinear energy sink---NES). By considering the linear damping as a perturbation to the system, periodic solutions of the underlying Hamiltonian system are formulated by means of the non-smooth temporal transformation and solved numerically by a shooting method. The special periodic orbits, which are corresponding to the impulsive initial conditions for the primary subsystem, bear their importance as baits for initiating localized transfers of a significant portion of energy to the NES. The second part theoretically deals with suppression of limit cycle oscillations (LCOs) in self-excited systems by means of passive energy localizations. As a pilot scheme, suppression or even complete elimination of the LCO in a van der Pol (VDP) oscillator coupled with two types of NESS---grounded and ungrounded---is studied. Computational parametric study proves the efficacy of LCO elimination by means of passive nonlinear energy pumping from the VDP oscillator to appropriately designed NESs. The numerical study of the transient dynamics of the system showed that the dynamical mechanism for LCO suppression is a series of 1:1 and 1:3 transient resonance captures, with the damped transient dynamics following closely corresponding resonant manifolds of the underlying Hamiltonian system. It is through the TRCs that energy gets transferred from the VDP oscillator to the NES, thus causing LCO suppression. By performing an additional bifurcation analysis of the steady state responses through a numerical continuation of equilibria and periodic solutions, the parameter dependence and bifurcations of the steady-state solutions are examined. It is also proved that a Hopf bifurcation is the global dynamical mechanism for generation and elimination of the LCOs in the configurations considered. The bifurcation analysis revealed that it is possible to design grounded or ungrounded NESs that robustly and completely eliminate the LCO instability of the system. This should be possible when the system parameters are chosen such that a subcritical Hopf bifurcation occurs, thus assuring the existence of a unique global trivial attractor of the dynamics in the parameter ranges of interest. Then, triggering mechanisms of aeroelastic instability is investigated for a two-DOF rigid wing model in subsonic flow with cubic nonlinear stiffnesses at the support. Based on the observation of the instability triggering, a single-degree-of-freedom (SDOF) NES is applied to the wing model. The NES is attached at an offset from the elastic axis for its additional interaction with the pitch mode, as well as being parallel with the heave mode, primarily to hinder initial triggering of the heave mode by the flow. It is shown that it is feasible to partially or even completely suppress aeroelastic instabilities of the wing by passively transferring vibration energy from the wing to the NES in a one-way irreversible fashion. Moreover, this aeroelastic instability suppression is performed by partially or completely eliminating the triggering mechanists for aeroelastic suppression. Through numerical parametric studies three main mechanisms for suppressing aeroelastic instability are identified: (i) Recurring burst-out and suppression; (ii) intermediate suppression; (iii) complete elimination of instability. In general, the relative occurrence of one of the two limit point cycle (LPC) bifurcations with respect to the Hopf bifurcation decides whether or not the suppression mechanisms are robust. In order to improve robustness of instability suppression, several types of multi-DOF NES configurations are introduced. In the last part, experimental suppression of aeroelastic instability by means of targeted energy transfers is investigated. In order to gain insights into the experiments, theoretical triggering mechanism of the aeroelastic instability in the nonlinear aeroelastic test apparatus (NATA) in a low-speed wind tunnel at Texas A&M University is studied. Finally, experimental results are presented in connection to the theoretical investigation, and all the predictions on the instability suppression mechanisms are demonstrated experimentally. It is also revealed that the dry friction affects only the robustness of an instability suppression by changing the unstable trivial equilibrium into an equilibrium set. (Abstract shortened by UMI.)

Design and evaluation of prosthetic shoulder controller

PubMed Central

Barton, Joseph E.; Sorkin, John D.

2015-01-01

We developed a 2-degree-of-freedom (DOF) shoulder position transducer (sensing shoulder protraction-retraction and elevation-depression) that can be used to control two of a powered prosthetic humerus' DOFs. We also developed an evaluation protocol based on Fitts' law to assess the performance of our device. The primary motivation for this work was to support development of powered prosthetic shoulder joints of a new generation of prosthetic arms for people with shoulder disarticulation and very high-level transhumeral amputation. We found that transducers that provided resistance to shoulder movement performed better than those providing no resistance. We also found that a position control scheme, where effector position is proportional to shoulder position, performed better than a velocity control scheme, where effector velocity is proportional to shoulder position. More generally, our transducer can be used to control motion along any two DOFs. It can also be used in a more general 4-DOF control scheme by sequentially controlling two DOFs at a time. The evaluation protocol has general applicability for researchers and practitioners. Researchers can employ it to compare different prosthesis designs and control schemes, while practitioners may find the evaluation protocol useful in evaluating and training people with amputation in the use of prostheses. PMID:25357185

Design and Evaluation of Shape-Changing Haptic Interfaces for Pedestrian Navigation Assistance.

PubMed

Spiers, Adam J; Dollar, Aaron M

2017-01-01

Shape-changing interfaces are a category of device capable of altering their form in order to facilitate communication of information. In this work, we present a shape-changing device that has been designed for navigation assistance. 'The Animotus' (previously, 'The Haptic Sandwich' ), resembles a cube with an articulated upper half that is able to rotate and extend (translate) relative to the bottom half, which is fixed in the user's grasp. This rotation and extension, generally felt via the user's fingers, is used to represent heading and proximity to navigational targets. The device is intended to provide an alternative to screen or audio based interfaces for visually impaired, hearing impaired, deafblind, and sighted pedestrians. The motivation and design of the haptic device is presented, followed by the results of a navigation experiment that aimed to determine the role of each device DOF, in terms of facilitating guidance. An additional device, 'The Haptic Taco', which modulated its volume in response to target proximity (negating directional feedback), was also compared. Results indicate that while the heading (rotational) DOF benefited motion efficiency, the proximity (translational) DOF benefited velocity. Combination of the two DOF improved overall performance. The volumetric Taco performed comparably to the Animotus' extension DOF.

Electrical generation and control of the valley carriers in a monolayer transition metal dichalcogenide

NASA Astrophysics Data System (ADS)

Ye, Yu; Xiao, Jun; Wang, Hailong; Ye, Ziliang; Zhu, Hanyu; Zhao, Mervin; Wang, Yuan; Zhao, Jianhua; Yin, Xiaobo; Zhang, Xiang

2016-07-01

Electrically controlling the flow of charge carriers is the foundation of modern electronics. By accessing the extra spin degree of freedom (DOF) in electronics, spintronics allows for information processes such as magnetoresistive random-access memory. Recently, atomic membranes of transition metal dichalcogenides (TMDCs) were found to support unequal and distinguishable carrier distribution in different crystal momentum valleys. This valley polarization of carriers enables a new DOF for information processing. A variety of valleytronic devices such as valley filters and valves have been proposed, and optical valley excitation has been observed. However, to realize its potential in electronics it is necessary to electrically control the valley DOF, which has so far remained a significant challenge. Here, we experimentally demonstrate the electrical generation and control of valley polarization. This is achieved through spin injection via a diluted ferromagnetic semiconductor and measured through the helicity of the electroluminescence due to the spin-valley locking in TMDC monolayers. We also report a new scheme of electronic devices that combine both the spin and valley DOFs. Such direct electrical generation and control of valley carriers opens up new dimensions in utilizing both the spin and valley DOFs for next-generation electronics and computing.

IceBreaker: Mars Drill and Sample Delivery System

NASA Astrophysics Data System (ADS)

Mellerowicz, B. L.; Paulsen, G. L.; Zacny, K.; McKay, C.; Glass, B. J.; Dave, A.; Davila, A. F.; Marinova, M.

2012-12-01

We report on the development and testing of a one meter class prototype Mars drill and cuttings sample delivery system. The IceBreaker drill consists of a rotary-percussive drill head, a sampling auger with a bit at the end having an integrated temperature sensor, a Z-stage for advancing the auger into the ground, and a sam-pling station for moving the augered ice shavings or soil cuttings into a sample cup. The drill is deployed from a 3 Degree of Freedom (DOF) robotic arm. The drill demonstrated drilling in ice-cemented ground, ice, and rocks at the 1-1-100-100 level; that is the drill reached 1 meter in 1 hour with 100 Watts of power and 100 Newton Weight on Bit. This cor-responds to an average energy of 100 Whr. The drill has been extensively tested in the Mars chamber to a depth of 1 meter, as well as in the Antarctic and the Arctic Mars analog sites. We also tested three sample delivery systems: 1) 4 DOF arm with a custom soil scoop at the end; 2) Pneumatic based, and 3) Drill based enabled by the 3 (DOF) drill deployment boom. In all approaches there is an air-gap between the sterilized drill (which penetrates subsurface) and the sample transfer hardware (which is not going to be sterilized). The air gap satisfies the planetary protection requirements. The scoop acquires cuttings sample once they are augered to the surface, and drops them into an in-strument inlet port. The system has been tested in the Mars chamber and in the Arctic. The pneumatic sample delivery system uses compressed gas to move the sample captured inside a small chamber inte-grated with the auger, directly into the instrument. The system was tested in the Mars chamber. In the third approach the drill auger captures the sample on its flutes, the 3 DOF boom positions the tip of the auger above the instrument, and then the auger discharges the sample into an instrument. This approach was tested in the labolatory (at STP). The above drilling and sample delivery tests have shown that drilling and sample transfer on Mars, in ice cemented ground with limited power, energy and Weight on Bit, and collecting samples in dis-crete depth intervals is possible within the given mass, power, and energy levels of a Phoenix-size lander and within the duration of a Phoenix-like mission.

Robust and novel two degree of freedom fractional controller based on two-loop topology for inverted pendulum.

PubMed

Dwivedi, Prakash; Pandey, Sandeep; Junghare, A S

2018-04-01

A rotary single inverted pendulum (RSIP) typically represents a space booster rocket, Segway and similar systems with unstable equilibrium. This paper proposes a novel two degree of freedom (2-DOF) fractional control strategy based on 2-loop topology for RSIP system which can be extended to control the systems with unstable equilibrium. It comprises feedback and feed-forward paths. Primary controller relates the perturbation attenuation while the secondary controller is accountable for set point tracking. To tune the parameters of proposed fractional controller a simple graphical tuning method based on frequency response is used. The study will serve the outstanding experimental results for both, stabilization and trajectory tracking tasks. The study will also serve to present a comparison of the performance of the proposed controller with the 1-DOF FOPID controller and sliding mode controller (SMC) for the RSIP system. Further to confirm the usability of the proposed controller and to avoid the random perturbations sensitivity, robustness, and stability analysis through fractional root-locus and Bode-plot is investigated. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

Intervertebral anticollision constraints improve out-of-plane translation accuracy of a single-plane fluoroscopy-to-CT registration method for measuring spinal motion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Cheng-Chung; Tsai, Tsung-Yuan; Hsu, Shih-Jung

2013-03-15

Purpose: The study aimed to propose a new single-plane fluoroscopy-to-CT registration method integrated with intervertebral anticollision constraints for measuring three-dimensional (3D) intervertebral kinematics of the spine; and to evaluate the performance of the method without anticollision and with three variations of the anticollision constraints via an in vitro experiment. Methods: The proposed fluoroscopy-to-CT registration approach, called the weighted edge-matching with anticollision (WEMAC) method, was based on the integration of geometrical anticollision constraints for adjacent vertebrae and the weighted edge-matching score (WEMS) method that matched the digitally reconstructed radiographs of the CT models of the vertebrae and the measured single-plane fluoroscopymore » images. Three variations of the anticollision constraints, namely, T-DOF, R-DOF, and A-DOF methods, were proposed. An in vitro experiment using four porcine cervical spines in different postures was performed to evaluate the performance of the WEMS and the WEMAC methods. Results: The WEMS method gave high precision and small bias in all components for both vertebral pose and intervertebral pose measurements, except for relatively large errors for the out-of-plane translation component. The WEMAC method successfully reduced the out-of-plane translation errors for intervertebral kinematic measurements while keeping the measurement accuracies for the other five degrees of freedom (DOF) more or less unaltered. The means (standard deviations) of the out-of-plane translational errors were less than -0.5 (0.6) and -0.3 (0.8) mm for the T-DOF method and the R-DOF method, respectively. Conclusions: The proposed single-plane fluoroscopy-to-CT registration method reduced the out-of-plane translation errors for intervertebral kinematic measurements while keeping the measurement accuracies for the other five DOF more or less unaltered. With the submillimeter and subdegree accuracy, the WEMAC method was considered accurate for measuring 3D intervertebral kinematics during various functional activities for research and clinical applications.« less

Direct and Inverse Kinematics of a Novel Tip-Tilt-Piston Parallel Manipulator

NASA Technical Reports Server (NTRS)

Tahmasebi, Farhad

2004-01-01

Closed-form direct and inverse kinematics of a new three degree-of-freedom (DOF) parallel manipulator with inextensible limbs and base-mounted actuators are presented. The manipulator has higher resolution and precision than the existing three DOF mechanisms with extensible limbs. Since all of the manipulator actuators are base-mounted; higher payload capacity, smaller actuator sizes, and lower power dissipation can be obtained. The manipulator is suitable for alignment applications where only tip, tilt, and piston motions are significant. The direct kinematics of the manipulator is reduced to solving an eighth-degree polynomial in the square of tangent of half-angle between one of the limbs and the base plane. Hence, there are at most 16 assembly configurations for the manipulator. In addition, it is shown that the 16 solutions are eight pairs of reflected configurations with respect to the base plane. Numerical examples for the direct and inverse kinematics of the manipulator are also presented.

Kinematics of a New High Precision Three Degree-of-Freedom Parallel Manipulator

NASA Technical Reports Server (NTRS)

Tahmasebi, Farhad

2005-01-01

Closed-form direct and inverse kinematics of a new three degree-of-freedom (DOF) parallel manipulator with inextensible limbs and base-mounted actuators are presented. The manipulator has higher resolution and precision than the existing three DOF mechanisms with extensible limbs. Since all of the manipulator actuators are base-mounted; higher payload capacity, smaller actuator sizes, and lower power dissipation can be obtained. The manipulator is suitable for alignment applications where only tip, tilt, and piston motions are significant. The direct kinematics of the manipulator is reduced to solving an eighth-degree polynomial in the square of tangent of half-angle between one of the limbs and the base plane. Hence, there are at most sixteen assembly configurations for the manipulator. In addition, it is shown that the sixteen solutions are eight pairs of reflected configurations with respect to the base plane. Numerical examples for the direct and inverse kinematics of the manipulator are also presented.

Study on Parallel 2-DOF Rotation Machanism in Radar

NASA Astrophysics Data System (ADS)

Jiang, Ming; Hu, Xuelong; Liu, Lei; Yu, Yunfei

The spherical parallel machine has become the world's academic and industrial focus of the field in recent years due to its simple and economical manufacture as well as its structural compactness especially suitable for areas where space gesture changes. This paper dwells upon its present research and development home and abroad. The newer machine (RGRR-II) can rotate around the axis z within 360° and the axis y1 from -90° to +90°. It has the advantages such as less moving parts (only 3 parts), larger ratio of work space to machine size, zero mechanic coupling, no singularity. Constructing rotation machine with spherical parallel 2-DOF rotation join (RGRR-II) may realize semispherical movement with zero dead point and extent the range. Control card (PA8000NT Series CNC) is installed in the computer. The card can run the corresponding software which realizes radar movement control. The machine meets the need of radars in plane and satellite which require larger detection range, lighter weight and compacter structure.

Simulations of 6-DOF Motion with a Cartesian Method

NASA Technical Reports Server (NTRS)

Murman, Scott M.; Aftosmis, Michael J.; Berger, Marsha J.; Kwak, Dochan (Technical Monitor)

2003-01-01

Coupled 6-DOF/CFD trajectory predictions using an automated Cartesian method are demonstrated by simulating a GBU-32/JDAM store separating from an F-18C aircraft. Numerical simulations are performed at two Mach numbers near the sonic speed, and compared with flight-test telemetry and photographic-derived data. Simulation results obtained with a sequential-static series of flow solutions are contrasted with results using a time-dependent flow solver. Both numerical methods show good agreement with the flight-test data through the first half of the simulations. The sequential-static and time-dependent methods diverge over the last half of the trajectory prediction. after the store produces peak angular rates. A cost comparison for the Cartesian method is included, in terms of absolute cost and relative to computing uncoupled 6-DOF trajectories. A detailed description of the 6-DOF method, as well as a verification of its accuracy, is provided in an appendix.

Direct Method Transcription for a Human-Class Translunar Injection Trajectory Optimization

NASA Technical Reports Server (NTRS)

Witzberger, Kevin E.; Zeiler, Tom

2012-01-01

This paper presents a new trajectory optimization software package developed in the framework of a low-to-high fidelity 3 degrees-of-freedom (DOF)/6-DOF vehicle simulation program named Mission Analysis Simulation Tool in Fortran (MASTIF) and its application to a translunar trajectory optimization problem. The functionality of the developed optimization package is implemented as a new "mode" in generalized settings to make it applicable for a general trajectory optimization problem. In doing so, a direct optimization method using collocation is employed for solving the problem. Trajectory optimization problems in MASTIF are transcribed to a constrained nonlinear programming (NLP) problem and solved with SNOPT, a commercially available NLP solver. A detailed description of the optimization software developed is provided as well as the transcription specifics for the translunar injection (TLI) problem. The analysis includes a 3-DOF trajectory TLI optimization and a 3-DOF vehicle TLI simulation using closed-loop guidance.

High-Frequency Ultrasonic Imaging of the Anterior Segment Using an Annular Array Transducer

PubMed Central

Silverman, Ronald H.; Ketterling, Jeffrey A.; Coleman, D. Jackson

2006-01-01

Objective Very-high-frequency (>35 MHz) ultrasound (VHFU) allows imaging of anterior segment structures of the eye with a resolution of less than 40-μm. The low focal ratio of VHFU transducers, however, results in a depth-of-field (DOF) of less than 1-mm. Our aim was to develop a high-frequency annular array transducer for ocular imaging with improved DOF, sensitivity and resolution compared to conventional transducers. Design Experimental Study Participants Cadaver eyes, ex vivo cow eyes, in vivo rabbit eyes. Methods A spherically curved annular array ultrasound transducer was fabricated. The array consisted of five concentric rings of equal area, had an overall aperture of 6 mm and a geometric focus of 12 mm. The nominal center frequency of all array elements was 40 MHz. An experimental system was designed in which a single array element was pulsed and echo data recorded from all elements. By sequentially pulsing each element, echo data were acquired for all 25 transmit/receive annuli combinations. The echo data were then synthetically focused and composite images produced. Transducer operation was tested by scanning a test object consisting of a series of 25-μm diameter wires spaced at increasing range from the transducer. Imaging capabilities of the annular array were demonstrated in ex vivo bovine, in vivo rabbit and human cadaver eyes. Main Outcome Measures Depth of field, resolution and sensitivity. Results The wire scans verified the operation of the array and demonstrated a 6.0 mm DOF compared to the 1.0 mm DOF of a conventional single-element transducer of comparable frequency, aperture and focal length. B-mode images of ex vivo bovine, in vivo rabbit and cadaver eyes showed that while the single-element transducer had high sensitivity and resolution within 1–2 mm of its focus, the array with synthetic focusing maintained this quality over a 6 mm DOF. Conclusion An annular array for high-resolution ocular imaging has been demonstrated. This technology offers improved depth-of-field, sensitivity and lateral resolution compared to single-element fixed focus transducers currently used for VHFU imaging of the eye. PMID:17141314

Two-degree-of-freedom fractional order-PID controllers design for fractional order processes with dead-time.

PubMed

Li, Mingjie; Zhou, Ping; Zhao, Zhicheng; Zhang, Jinggang

2016-03-01

Recently, fractional order (FO) processes with dead-time have attracted more and more attention of many researchers in control field, but FO-PID controllers design techniques available for the FO processes with dead-time suffer from lack of direct systematic approaches. In this paper, a simple design and parameters tuning approach of two-degree-of-freedom (2-DOF) FO-PID controller based on internal model control (IMC) is proposed for FO processes with dead-time, conventional one-degree-of-freedom control exhibited the shortcoming of coupling of robustness and dynamic response performance. 2-DOF control can overcome the above weakness which means it realizes decoupling of robustness and dynamic performance from each other. The adjustable parameter η2 of FO-PID controller is directly related to the robustness of closed-loop system, and the analytical expression is given between the maximum sensitivity specification Ms and parameters η2. In addition, according to the dynamic performance requirement of the practical system, the parameters η1 can also be selected easily. By approximating the dead-time term of the process model with the first-order Padé or Taylor series, the expressions for 2-DOF FO-PID controller parameters are derived for three classes of FO processes with dead-time. Moreover, compared with other methods, the proposed method is simple and easy to implement. Finally, the simulation results are given to illustrate the effectiveness of this method. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

Control Relevant Modeling and Design of Scramjet-Powered Hypersonic Vehicles

NASA Astrophysics Data System (ADS)

Dickeson, Jeffrey James

This report provides an overview of scramjet-powered hypersonic vehicle modeling and control challenges. Such vehicles are characterized by unstable non-minimum phase dynamics with significant coupling and low thrust margins. Recent trends in hypersonic vehicle research are summarized. To illustrate control relevant design issues and tradeoffs, a generic nonlinear 3DOF longitudinal dynamics model capturing aero-elastic-propulsive interactions for wedge-shaped vehicle is used. Limitations of the model are discussed and numerous modifications have been made to address control relevant needs. Two different baseline configurations are examined over a two-stage to orbit ascent trajectory. The report highlights how vehicle level-flight static (trim) and dynamic properties change over the trajectory. Thermal choking constraints are imposed on control system design as a direct consequence of having a finite FER margin. The implication of this state-dependent nonlinear FER margin constraint, the right half plane (RHP) zero, and lightly damped flexible modes, on control system bandwidth (BW) and FPA tracking has been discussed. A control methodology has been proposed that addresses the above dynamics while providing some robustness to modeling uncertainty. Vehicle closure (the ability to fly a trajectory segment subject to constraints) is provided through a proposed vehicle design methodology. The design method attempts to use open loop metrics whenever possible to design the vehicle. The design method is applied to a vehicle/control law closed loop nonlinear simulation for validation. The 3DOF longitudinal modeling results are validated against a newly released NASA 6DOF code.

Effectiveness of base-of-skull immobilization system in a compact proton therapy setting.

PubMed

Shafai-Erfani, Ghazal; Willoughby, Twyla; Ramakrishna, Naren; Meeks, Sanford; Kelly, Patrick; Zeidan, Omar

2018-05-01

The purpose of this study was to investigate daily repositioning accuracy by analyzing inter- and intra-fractional uncertainties associated with patients treated for intracranial or base of skull tumors in a compact proton therapy system with 6 degrees of freedom (DOF) robotic couch and a thermoplastic head mask indexed to a base of skull (BoS) frame. Daily orthogonal kV alignment images at setup position before and after daily treatments were analyzed for 33 patients. The system was composed of a new type of thermoplastic mask, a bite block, and carbon-fiber BoS couch-top insert specifically designed for proton therapy treatments. The correctional shifts in robotic treatment table with 6 DOF were evaluated and recorded based on over 1500 planar kV image pairs. Correctional shifts for patients with and without bite blocks were compared. Systematic and random errors were evaluated for all 6 DOF coordinates available for daily vector corrections. Uncertainties associated with geometrical errors and their sources, in addition to robustness analysis of various combinations of immobilization components were presented. Analysis of 644 fractions including patients with and without a bite block shows that the BoS immobilization system is capable of maintaining intra-fraction localization with submillimeter accuracy (in nearly 83%, 86%, 95% of cases along SI, LAT, and PA, respectively) in translational coordinates and subdegree precision (in 98.85%, 98.85%, and 96.4% of cases for roll, pitch, and yaw respectively) in rotational coordinates. The system overall fares better in intra-fraction localization precision compared to previously reported particle therapy immobilization systems. The use of a mask-attached type bite block has marginal impact on inter- or intra-fraction uncertainties compared to no bite block. © 2018 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

A 6-DOF vibration isolation system for hydraulic hybrid vehicles

NASA Astrophysics Data System (ADS)

Nguyen, The; Elahinia, Mohammad; Olson, Walter W.; Fontaine, Paul

2006-03-01

This paper presents the results of vibration isolation analysis for the pump/motor component of hydraulic hybrid vehicles (HHVs). The HHVs are designed to combine gasoline/diesel engine and hydraulic power in order to improve the fuel efficiency and reduce the pollution. Electric hybrid technology is being applied to passenger cars with small and medium engines to improve the fuel economy. However, for heavy duty vehicles such as large SUVs, trucks, and buses, which require more power, the hydraulic hybridization is a more efficient choice. In function, the hydraulic hybrid subsystem improves the fuel efficiency of the vehicle by recovering some of the energy that is otherwise wasted in friction brakes. Since the operation of the main component of HHVs involves with rotating parts and moving fluid, noise and vibration are an issue that affects both passengers (ride comfort) as well as surrounding people (drive-by noise). This study looks into the possibility of reducing the transmitted noise and vibration from the hydraulic subsystem to the vehicle's chassis by using magnetorheological (MR) fluid mounts. To this end, the hydraulic subsystem is modeled as a six degree of freedom (6-DOF) rigid body. A 6-DOF isolation system, consisting of five mounts connected to the pump/motor at five different locations, is modeled and simulated. The mounts are designed by combining regular elastomer components with MR fluids. In the simulation, the real loading and working conditions of the hydraulic subsystem are considered and the effects of both shock and vibration are analyzed. The transmissibility of the isolation system is monitored in a wide range of frequencies. The geometry of the isolation system is considered in order to sustain the weight of the hydraulic system without affecting the design of the chassis and the effectiveness of the vibration isolating ability. The simulation results shows reduction in the transmitted vibration force for different working cycles of the regenerative system.

Research a Novel Integrated and Dynamic Multi-object Trade-Off Mechanism in Software Project

NASA Astrophysics Data System (ADS)

Jiang, Weijin; Xu, Yuhui

Aiming at practical requirements of present software project management and control, the paper presented to construct integrated multi-object trade-off model based on software project process management, so as to actualize integrated and dynamic trade-oil of the multi-object system of project. Based on analyzing basic principle of dynamic controlling and integrated multi-object trade-off system process, the paper integrated method of cybernetics and network technology, through monitoring on some critical reference points according to the control objects, emphatically discussed the integrated and dynamic multi- object trade-off model and corresponding rules and mechanism in order to realize integration of process management and trade-off of multi-object system.

Flexibility of movement organization in piano performance

PubMed Central

Furuya, Shinichi; Altenmüller, Eckart

2013-01-01

Piano performance involves a large repertoire of highly skilled movements. The acquisition of these exceptional skills despite innate neural and biomechanical constraints requires a sophisticated interaction between plasticity of the neural system and organization of a redundant number of degrees of freedom (DOF) in the motor system. Neuroplasticity subserving virtuosity of pianists has been documented in neuroimaging studies investigating effects of long-term piano training on structure and function of the cortical and subcortical regions. By contrast, recent behavioral studies have advanced the understanding of neuromuscular strategies and biomechanical principles behind the movement organization that enables skilled piano performance. Here we review the motor control and biomechanics literature, introducing the importance of describing motor behaviors not only for understanding mechanisms responsible for skillful motor actions in piano playing, but also for advancing diagnosis and rehabilitation of movement disorders caused by extensive piano practice. PMID:23882199