Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

PubMed

Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

2016-01-01

Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.

Multicopper Oxidase Involvement in Both Mn(II) and Mn(III) Oxidation during Bacterial Formation of MnO2

PubMed Central

Soldatova, Alexandra V.; Butterfield, Cristina; Oyerinde, Oyeyemi F.; Tebo, Bradley M.; Spiro, Thomas G.

2013-01-01

Global cycling of environmental manganese requires catalysis by bacteria and fungi for MnO2 formation, since abiotic Mn(II) oxidation is slow under ambient conditions. Genetic evidence from several bacteria implicates multicopper oxidases (MCOs) as being required for MnO2 formation. However, MCOs catalyze one-electron oxidations, whereas conversion of Mn(II) to MnO2 is a two-electron process. Trapping experiments with pyrophosphate (PP), a Mn(III) chelator, have demonstrated that Mn(III) is an intermediate in Mn(II) oxidation when mediated by exosporium from the Mn-oxidizing bacterium Bacillus SG-1. The reaction of Mn(II) depends on O2 and is inhibited by azide, consistent with MCO catalysis. We show that the subsequent conversion of Mn(III) to MnO2 also depends on O2 and is inhibited by azide. Thus, both oxidation steps appear to be MCO-mediated, likely by the same enzyme, indicated by genetic evidence to be the MnxG gene product. We propose a model of how the manganese oxidase active site may be organized to couple successive electron transfers to the formation of polynuclear Mn(IV) complexes as precursors to MnO2 formation. PMID:22892957

Mn(II,III) oxidation and MnO 2 mineralization by an expressed bacterial multicopper oxidase

DOE PAGES

Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung -Woo; ...

2013-07-01

Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of themore » enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. Lastly, with the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs.« less

Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase

PubMed Central

Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung-Woo; Spiro, Thomas G.; Tebo, Bradley M.

2013-01-01

Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of the enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. With the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs. PMID:23818588

Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase

NASA Astrophysics Data System (ADS)

Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung-Woo; Spiro, Thomas G.; Tebo, Bradley M.

2013-07-01

Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of the enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. With the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs.

Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli

PubMed Central

Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael

2015-01-01

Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

Terminal oxidase diversity and function in "Metallosphaera yellowstonensis": gene expression and protein modeling suggest mechanisms of Fe(II) oxidation in the sulfolobales.

PubMed

Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P

2011-03-01

"Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores.

Characterization of three multicopper oxidases in the filamentous fungus Podospora anserina: A new role of an ABR1-like protein in fungal development?

PubMed

Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Herbert, Eric; Ferrari, Roselyne; Chapeland-Leclerc, Florence

2018-07-01

The Podospora anserina genome contains a large family of 15 multicopper oxidases (MCOs), including three genes encoding a FET3-like protein, an ABR1-like protein and an ascorbate oxidase (AO)-like protein. FET3, ABR1 and AO1 are involved in global laccase-like activity since deletion of the relevant genes led to a decrease of activity when laccase substrate (ABTS) was used as substrate. However, contrary to the P. anserina MCO proteins previously characterized, none of these three MCOs seemed to be involved in lignocellulose degradation and in resistance to phenolic compounds and oxidative stress. We showed that the bulk of ferroxidase activity was clearly due to ABR1, and only in minor part to FET3, although ABR1 does not contain all the residues typical of FET3 proteins. Moreover, we showed that ABR1, related to the Aspergillus fumigatus ABR1 protein, was clearly and specifically involved in pigmentation of ascospores. Surprisingly, phenotypes were more severe in mutants lacking both abr1 and ao1. Deletion of the ao1 gene led to an almost total loss of AO activity. No direct involvement of AO1 in fungal developmental process in P. anserina was evidenced, except in a abr1 Δ background. Overall, unlike other previously characterized MCOs, we thus evidence a clear involvement of ABR1 protein in fungal development. Copyright © 2018 Elsevier Inc. All rights reserved.

Construction of a biocathode using the multicopper oxidase from the hyperthermophilic archaeon, Pyrobaculum aerophilum: towards a long-life biobattery.

PubMed

Sakamoto, Hiroaki; Uchii, Toshiki; Yamaguchi, Kayo; Koto, Ayako; Takamura, Ei-Ichiro; Satomura, Takenori; Sakuraba, Haruhiko; Ohshima, Toshihisa; Suye, Shin-Ichiro

2015-07-01

The life of biobatteries remains an issue due to loss of enzyme activity over time. In this study, we sought to develop a biobattery with a long life using a hyperthermophilic enzyme. We hypothesized that use of such hyperthermophilic enzymes would allow for the biofuel cells to have a long battery life. Using pyrroloquinoline quinone-glucose dehydrogenase and the multicopper oxidase from Pyrobaculum aerophilum, we constructed an anode and cathode. The maximum output was 11 μW at 0.2 V, and the stability of the both electrode was maintained at 70 % after 14 days. The biofuel cells that use hyperthermophilic enzymes may prolong their life.

Three-dimensional organization of three-domain copper oxidases: A review

NASA Astrophysics Data System (ADS)

Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaĭtsev, V. N.; Mikhaĭlov, A. M.

2008-01-01

“Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

Three-dimensional organization of three-domain copper oxidases: A review

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhukhlistova, N. E., E-mail: amm@ns.crys.ras.ru; Zhukova, Yu. N.; Lyashenko, A. V.

2008-01-15

'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrenamore » maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.« less

Characterization of a novel high-pH-tolerant laccase-like multicopper oxidase and its sequence diversity in Thioalkalivibrio sp.

PubMed

Ausec, Luka; Črnigoj, Miha; Šnajder, Marko; Ulrih, Nataša Poklar; Mandic-Mulec, Ines

2015-12-01

Laccases are oxidoreductases mostly studied in fungi, while bacterial laccases remain poorly studied despite their high genetic diversity and potential for biotechnological application. Our previous bioinformatic analysis identified alkaliphilic bacterial strains Thioalkalivibrio sp. as potential sources of robust bacterial laccases that would be stable at high pH. In the present work, a gene for a laccase-like enzyme from Thioalkalivibrio sp. ALRh was cloned and expressed as a 6× His-tagged protein in Escherichia coli. The purified enzyme was a pH-tolerant laccase stable in the pH range between 2.1 and 9.9 at 20 °C as shown by intrinsic fluorescence emission spectrometry. It had optimal activities at pH 5.0 and pH 9.5 with the laccase substrates 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and 2,6-dimethoxyphenol, respectively. In addition, it could oxidize several other monophenolic compounds and potassium hexacyanoferrate(II) but not tyrosine. It showed highest activity at 50 °C, making it suitable for prolonged incubations at this temperature. The present study shows that Thioalkalivibrio sp. encodes an active, alkaliphilic, and thermo-tolerant laccase and contributes to our understanding of the versatility of bacterial laccase-like multicopper oxidases in general.

Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1

PubMed Central

Smesrud, Logan; Tebo, Bradley M.

2016-01-01

ABSTRACT The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. IMPORTANCE The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the

Spectroscopy of Cu(II)-PcoC and the multicopper oxidase function of PcoA, two essential components of Escherichia coli pco copper resistance operon.

PubMed

Huffman, David L; Huyett, Jennifer; Outten, F Wayne; Doan, Peter E; Finney, Lydia A; Hoffman, Brian M; O'Halloran, Thomas V

2002-08-06

The plasmid-encoded pco copper resistance operon in Escherichia coli consists of seven genes that are expressed from two pco promoters in response to elevated copper; however, little is known about how they mediate resistance to excess environmental copper. Two of the genes encode the soluble periplasmic proteins PcoA and PcoC. We show here that inactivation of PcoC, and PcoA to a lesser extent, causes cells to become more sensitive to copper than wild-type nonresistant strains, consistent with a tightly coupled detoxification pathway. Periplasmic extracts show copper-inducible oxidase activity, attributed to the multicopper oxidase function of PcoA. PcoC, a much smaller protein than PcoA, binds one Cu(II) and exhibits a weak electronic transition characteristic of a type II copper center. ENDOR and ESEEM spectroscopy of Cu(II)-PcoC and the (15)N- and Met-CD(3)-labeled samples are consistent with a tetragonal ligand environment of three nitrogens and one aqua ligand "in the plane". A weakly associated S-Met and aqua are likely axial ligands. At least one N is a histidine and is likely trans to the in-plane aqua ligand. The copper chemistry of PcoC and the oxidase function of PcoA are consistent with the emerging picture of the chromosomally encoded copper homeostasis apparatus in the E. coli cell envelope [Outten, F. W., Huffman, D. L., Hale, J. A., and O'Halloran, T. V. (2001) J. Biol. Chem. 276, 30670-30677]. We propose a model for the plasmid system in which Cu(I)-PcoC functions in this copper efflux pathway as a periplasmic copper binding protein that docks with the multiple repeats of Met-rich domains in PcoA to effect oxidation of Cu(I) to the less toxic Cu(II) form. The solvent accessibility of the Cu(II) in PcoC may allow for metal transfer to other plasmid and chromosomal factors and thus facilitate removal of Cu(II) from the cell envelope.

X-ray-induced catalytic active-site reduction of a multicopper oxidase: structural insights into the proton-relay mechanism and O 2 -reduction states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia Patricia

2015-11-26

During X-ray data collection from a multicopper oxidase (MCO) crystal, electrons and protons are mainly released into the system by the radiolysis of water molecules, leading to the X-ray-induced reduction of O 2 to 2H 2O at the trinuclear copper cluster (TNC) of the enzyme. In this work, 12 crystallographic structures of Thermus thermophilus HB27 multicopper oxidase (Tth-MCO) in holo, apo and Hg-bound forms and with different X-ray absorbed doses have been determined. In holo Tth -MCO structures with four Cu atoms, the proton-donor residue Glu451 involved in O 2 reduction was found in a double conformation: Glu451a (~7 Åmore » from the TNC) and Glu451b (~4.5 Å from the TNC). A positive peak of electron density above 3.5σ in anF o-F c map for Glu451a O ε2 indicates the presence of a carboxyl functional group at the side chain, while its significant absence in Glu451b strongly suggests a carboxylate functional group. In contrast, for apo Tth -MCO and in Hg-bound structures neither the positive peak nor double conformations were observed. Together, these observations provide the first structural evidence for a proton-relay mechanism in the MCO family and also support previous studies indicating that Asp106 does not provide protons for this mechanism. In addition, eight composite structures (Tth -MCO-C1–8) with different X-ray-absorbed doses allowed the observation of different O 2-reduction states, and a total depletion of T2Cu at doses higher than 0.2 MGy showed the high susceptibility of this Cu atom to radiation damage, highlighting the importance of taking radiation effects into account in biochemical interpretations of an MCO structure.« less

Substrate specificity and copper loading of the manganese-oxidizing multicopper oxidase Mnx from Bacillus sp. PL-12.

PubMed

Butterfield, Cristina N; Tebo, Bradley M

2017-02-22

Manganese(ii) oxidation in the environment is thought to be driven by bacteria because enzymatic catalysis is many orders of magnitude faster than the abiotic processes. The heterologously purified Mn oxidase (Mnx) from marine Bacillus sp. PL-12 is made up of the multicopper oxidase (MCO) MnxG and two small Cu and heme-binding proteins of unknown function, MnxE and MnxF. Mnx binds Cu and oxidizes both Mn(ii) and Mn(iii), generating Mn(iv) oxide minerals that resemble those found on the Bacillus spore surface. Spectroscopic techniques have illuminated details about the metallo-cofactors of Mnx, but very little is known about their requirement for catalytic activity, and even less is known about the substrate specificity of Mnx. Here we quantify the canonical MCO Cu and persistent peripheral Cu bound to Mnx, and test Mnx oxidizing ability toward different substrates at varying pH. Mn(ii) appears to be the best substrate in terms of k cat , but its oxidation does not follow Michaelis-Menten kinetics, instead showing a sigmoidal cooperative behavior. Mnx also oxidizes Fe(ii) substrate, but in a Michaelis-Menten manner and with a decreased activity, as well as organic substrates. The reduced metals are more rapidly consumed than the larger organic substrates, suggesting the hypothesis that the Mnx substrate site is small and tuned for metal oxidation. Of biological relevance is the result that Mnx has the highest catalytic efficiency for Mn(ii) at the pH of sea water, especially when the protein is loaded with greater than the requisite four MCO copper atoms, suggesting that the protein has evolved specifically for Mn oxidation.

Biochemical, spectroscopic and X-ray structural analysis of deuterated multicopper oxidase CueO prepared from a new expression construct for neutron crystallography.

PubMed

Akter, Mahfuza; Inoue, Chika; Komori, Hirofumi; Matsuda, Nana; Sakurai, Takeshi; Kataoka, Kunishige; Higuchi, Yoshiki; Shibata, Naoki

2016-10-01

Multicopper oxidases oxidize various phenolic and nonphenolic compounds by using molecular oxygen as an electron acceptor to produce water. A multicopper oxidase protein, CueO, from Escherichia coli is involved in copper homeostasis in the bacterial cell. Although X-ray crystallographic studies have been conducted, the reduction mechanism of oxygen and the proton-transfer pathway remain unclear owing to the difficulty in identifying H atoms from X-ray diffraction data alone. To elucidate the reaction mechanism using neutron crystallography, a preparation system for obtaining large, high-quality single crystals of deuterated CueO was developed. Tiny crystals were obtained from the deuterated CueO initially prepared from the original construct. The X-ray crystal structure of the deuterated CueO showed that the protein contained an incompletely truncated signal sequence at the N-terminus, which resulted in the heterogeneity of the protein sample for crystallization. Here, a new CueO expression system that had an HRV3C cleavage site just after the signal sequence was constructed. Deuterated CueO from the new construct was expressed in cells cultured in deuterated algae-extract medium and the signal sequence was completely eliminated by HRV3C protease. The deuteration level of the purified protein was estimated by MALDI-TOF mass spectrometry to be at least 83.2% compared with nondeuterated protein. Nondeuterated CueO crystallized in space group P2 1 , with unit-cell parameters a = 49.51, b = 88.79, c = 53.95 Å, β = 94.24°, and deuterated CueO crystallized in space group P2 1 2 1 2 1 , with unit-cell parameters a = 49.91, b = 106.92, c = 262.89 Å. The crystallographic parameters for the crystals of the new construct were different from those previously reported for nondeuterated crystals. The nondeuterated and deuterated CueO from the new construct had similar UV-Vis spectra, enzymatic activities and overall structure and geometry of the ligands of the Cu atoms

Effect of enzymatic orientation through the use of syringaldazine molecules on multiple multi-copper oxidase enzymes.

PubMed

Ulyanova, Yevgenia; Babanova, Sofia; Pinchon, Erica; Matanovic, Ivana; Singhal, Sameer; Atanassov, Plamen

2014-07-14

The effect of proper enzyme orientation at the electrode surface was explored for two multi-copper oxygen reducing enzymes: Bilirubin Oxidase (BOx) and Laccase (Lac). Simultaneous utilization of "tethering" agent (1-pyrenebutanoic acid, succinimidyl ester; PBSE), for stable enzyme immobilization, and syringaldazine (Syr), for enzyme orientation, of both Lac and BOx led to a notable enhancement of the electrode performance. For Lac cathodes tested in solution it was established that PBSE-Lac and PBSE-Syr-Lac modified cathodes demonstrated approximately 6 and 9 times increase in current density, respectively, compared to physically adsorbed and randomly oriented Lac cathodes. Further testing in solution utilizing BOx showed an even higher increase in achievable current densities, thus BOx was chosen for additional testing in air-breathing mode. In subsequent air-breathing experiments the incorporation of PBSE and Syr with BOx resulted in current densities of 0.65 ± 0.1 mA cm(-2); 2.5 times higher when compared to an unmodified BOx cathode. A fully tethered/oriented BOx cathode was combined with a NAD-dependent Glucose Dehydrogenase anode for the fabrication of a complete enzymatic membraneless fuel cell. A maximum power of 1.03 ± 0.06 mW cm(-2) was recorded for the complete fuel cell. The observed significant enhancement in the performance of "oriented" cathodes was a result of proper enzyme orientation, leading to facilitated enzyme/electrode interface interactions.

Mn(II) Oxidation by the Multicopper Oxidase Complex Mnx: A Coordinated Two-Stage Mn(II)/(III) and Mn(III)/(IV) Mechanism.

PubMed

Soldatova, Alexandra V; Romano, Christine A; Tao, Lizhi; Stich, Troy A; Casey, William H; Britt, R David; Tebo, Bradley M; Spiro, Thomas G

2017-08-23

The bacterial manganese oxidase MnxG of the Mnx protein complex is unique among multicopper oxidases (MCOs) in carrying out a two-electron metal oxidation, converting Mn(II) to MnO 2 nanoparticles. The reaction occurs in two stages: Mn(II) → Mn(III) and Mn(III) → MnO 2 . In a companion study , we show that the electron transfer from Mn(II) to the low-potential type 1 Cu of MnxG requires an activation step, likely forming a hydroxide bridge at a dinuclear Mn(II) site. Here we study the second oxidation step, using pyrophosphate (PP) as a Mn(III) trap. PP chelates Mn(III) produced by the enzyme and subsequently allows it to become a substrate for the second stage of the reaction. EPR spectroscopy confirms the presence of Mn(III) bound to the enzyme. The Mn(III) oxidation step does not involve direct electron transfer to the enzyme from Mn(III), which is shown by kinetic measurements to be excluded from the Mn(II) binding site. Instead, Mn(III) is proposed to disproportionate at an adjacent polynuclear site, thereby allowing indirect oxidation to Mn(IV) and recycling of Mn(II). PP plays a multifaceted role, slowing the reaction by complexing both Mn(II) and Mn(III) in solution, and also inhibiting catalysis, likely through binding at or near the active site. An overall mechanism for Mnx-catalyzed MnO 2 production from Mn(II) is presented.

Biogenic Manganese-Oxide Mineralization is Enhanced by an Oxidative Priming Mechanism for the Multi-Copper Oxidase, MnxEFG.

PubMed

Tao, Lizhi; Simonov, Alexandr N; Romano, Christine A; Butterfield, Cristina N; Fekete, Monika; Tebo, Bradley M; Bond, Alan M; Spiccia, Leone; Martin, Lisandra L; Casey, William H

2017-01-26

In a natural geochemical cycle, manganese-oxide minerals (MnO x ) are principally formed through a microbial process, where a putative multicopper oxidase MnxG plays an essential role. Recent success in isolating the approximately 230 kDa, enzymatically active MnxEFG protein complex, has advanced our understanding of biogenic MnO x mineralization. Here, the kinetics of MnO x formation catalyzed by MnxEFG are examined using a quartz crystal microbalance (QCM), and the first electrochemical characterization of the MnxEFG complex is reported using Fourier transformed alternating current voltammetry. The voltammetric studies undertaken using near-neutral solutions (pH 7.8) establish the apparent reversible potentials for the Type 2 Cu sites in MnxEFG immobilized on a carboxy-terminated monolayer to be in the range 0.36-0.40 V versus a normal hydrogen electrode. Oxidative priming of the MnxEFG protein complex substantially enhances the enzymatic activity, as found by in situ electrochemical QCM analysis. The biogeochemical significance of this enzyme is clear, although the role of an oxidative priming of catalytic activity might be either an evolutionary advantage or an ancient relic of primordial existence. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Surface Induced Dissociation Coupled with High Resolution Mass Spectrometry Unveils Heterogeneity of a 211 kDa Multicopper Oxidase Protein Complex

NASA Astrophysics Data System (ADS)

Zhou, Mowei; Yan, Jing; Romano, Christine A.; Tebo, Bradley M.; Wysocki, Vicki H.; Paša-Tolić, Ljiljana

2018-01-01

Manganese oxidation is an important biogeochemical process that is largely regulated by bacteria through enzymatic reactions. However, the detailed mechanism is poorly understood due to challenges in isolating and characterizing these unknown enzymes. A manganese oxidase, Mnx, from Bacillus sp. PL-12 has been successfully overexpressed in active form as a protein complex with a molecular mass of 211 kDa. We have recently used surface induced dissociation (SID) and ion mobility-mass spectrometry (IM-MS) to release and detect folded subcomplexes for determining subunit connectivity and quaternary structure. The data from the native mass spectrometry experiments led to a plausible structural model of this multicopper oxidase, which has been difficult to study by conventional structural biology methods. It was also revealed that each Mnx subunit binds a variable number of copper ions. Becasue of the heterogeneity of the protein and limited mass resolution, ambiguities in assigning some of the observed peaks remained as a barrier to fully understanding the role of metals and potential unknown ligands in Mnx. In this study, we performed SID in a modified Fourier transform-ion cyclotron resonance (FTICR) mass spectrometer. The high mass accuracy and resolution offered by FTICR unveiled unexpected artificial modifications on the protein that had been previously thought to be iron bound species based on lower resolution spectra. Additionally, isotopically resolved spectra of the released subcomplexes revealed the metal binding stoichiometry at different structural levels. This method holds great potential for in-depth characterization of metalloproteins and protein-ligand complexes. [Figure not available: see fulltext.

Surface Induced Dissociation Coupled with High Resolution Mass Spectrometry Unveils Heterogeneity of a 211 kDa Multicopper Oxidase Protein Complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Mowei; Yan, Jing; Romano, Christine A.

Manganese oxidation is an important biogeochemical process that is largely regulated by bacteria through enzymatic reactions. However, the detailed mechanism is poorly understood due to challenges in isolating and characterizing these unknown enzymes. A manganese oxidase Mnx from Bacillus sp. PL-12 has been successfully overexpressed in active form, unexpectedly, as a protein complex with a molecular weight of 211 kDa with no homology to known proteins in the database. We have recently used surface induced dissociation (SID) and ion mobility – mass spectrometry (IM-MS) to release and detect folded subcomplexes for determining subunit connectivity and quaternary structure. The data frommore » the native mass spectrometry experiment led to a plausible model of this unknown multicopper oxidase which has been difficult to study by conventional structural biology methods. However, because each subunit of Mnx binds copper ions as cofactor at varying ratios, there were remaining ambiguities in assigning some of the observed peaks to metal-binding species because of the sample heterogeneity and limited mass resolution. In this study, we performed SID in a modified Fourier transform – ion cyclotron resonance (FT-ICR) mass spectrometer for obtaining the ultimate resolution on the released subcomplexes of Mnx. The high mass accuracy and resolution unveiled unexpected artificial modifications in the protein that have been previously thought to be iron bound species based on lower resolution data. Additionally, most released subcomplexes were isotopically resolved for defining metal binding stoichiometry at each structural level. This method holds great potential for in-depth characterization of metalloproteins and protein-ligand complexes.« less

Cloning of a phenol oxidase gene from Acremonium murorum and its expression in Aspergillus awamori.

PubMed

Gouka, R J; van der Heiden, M; Swarthoff, T; Verrips, C T

2001-06-01

Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60 degrees C) and is fully stable for at least 1 h at 60 degrees C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning.

Cloning of a Phenol Oxidase Gene from Acremonium murorum and Its Expression in Aspergillus awamori

PubMed Central

Gouka, Robin J.; van der Heiden, Monique; Swarthoff, Ton; Verrips, C. Theo

2001-01-01

Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60°C) and is fully stable for at least 1 h at 60°C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning. PMID:11375170

Two-electron Reduction versus One-electron Oxidation of the Type 3 Pair in the Multicopper Oxidases

PubMed Central

Kjaergaard, Christian H.; Jones, Stephen M.; Gounel, Sébastien; Mano, Nicolas; Solomon, Edward I.

2015-01-01

Multicopper Oxidases (MCOs) utilize an electron shuttling Type 1 Cu (T1) site in conjunction with a mononuclear Type 2 (T2) and a binuclear Type 3 (T3) site, arranged in a trinuclear copper cluster (TNC), to reduce O2 to H2O. Reduction of O2 occurs with limited overpotential indicating that all the coppers in the active site can be reduced via high-potential electron donors. Two forms of the resting enzyme have been observed in MCOs: the Alternative Resting form (AR), where only one of the three TNC Cu’s is oxidized, and the Resting Oxidized form (RO), where all three TNC Cu’s are oxidized. In contrast to the AR form, we show that in the RO form of a high-potential MCO, the binuclear T3 Cu(II) site can be reduced via the 700 mV T1 Cu. Systematic spectroscopic evaluation reveals that this proceeds by a two-electron process, where delivery of the first electron, forming a high energy, meta-stable half reduced T3 state, is followed by the rapid delivery of a second energetically favorable electron to fully reduce the T3 site. Alternatively, when this fully reduced binuclear T3 site is oxidized via the T1 Cu, a different thermodynamically favored half oxidized T3 form, i.e. the AR site, is generated. This behavior is evaluated by DFT calculations, which reveal that the protein backbone plays a significant role in controlling the environment of the active site coppers. This allows for the formation of the meta-stable, half reduced state and thus the complete reductive activation of the enzyme for catalysis. PMID:26075678

A novel enzyme-based antimicrobial system comprising iodide and a multicopper oxidase isolated from Alphaproteobacterium strain Q-1.

PubMed

Yuliana, Tri; Ebihara, Kyota; Suzuki, Mio; Shimonaka, Chie; Amachi, Seigo

2015-12-01

Alphaproteobacterium strain Q-1 produces an extracellular multicopper oxidase (IOX), which catalyzes iodide (I-) oxidation to form molecular iodine (I2). In this study, the antimicrobial activity of the IOX/iodide system was determined. Both Gram-positive and Gram-negative bacteria tested were killed completely within 5 min by 50 mU mL(-1) of IOX and 10 mM iodide. The sporicidal activity of the system was also tested and compared with a common iodophor, povidone-iodine (PVP-I). IOX (300 mU mL(-1)) killed Bacillus cereus, B. subtilis, and Geobacillus stearothermophilus spores with decimal reduction times of 2.58, 7.62, and 40.9 min, respectively. However, 0.1% PVP-I killed these spores with much longer decimal reduction times of 5.46, 38.0, and 260 min, respectively. To evaluate the more superior sporicidal activity of the IOX system over PVP-I, the amount of free iodine (non-complexed I2) was determined by an equilibrium dialysis technique. The IOX system included more than 40 mg L(-1) of free iodine, while PVP-I included at most 25 mg L(-1) free iodine. Our results suggest that the new enzyme-based antimicrobial system is effective against a wide variety of microorganisms and bacterial spores, and that its strong biocidal activity is due to its high free iodine content, which is probably maintained by re-oxidation of iodide released after oxidation of cell components by I2.

Engineering Klebsiella sp. 601 multicopper oxidase enhances the catalytic efficiency towards phenolic substrates.

PubMed

Li, Yadong; Gong, Zijun; Li, Xin; Li, Yang; Wang, Xing-Guo

2011-05-31

Structural comparison between bacterial CueO and fungal laccases has suggested that a charged residue Glu (E106) in CueO replaces the corresponding residue Phe in fungal laccases at the gate of the tunnel connecting type II copper to the protein surface and an extra α-helix (L351-G378) near the type I copper site covers the substrate binding pocket and might compromise the electron transfer from substrate to type I copper. To test this hypothesis, several mutants were made in Klebsiella sp. 601 multicopper oxidase, which is highly homologous to E. coli CueO with a similarity of 90% and an identity of 78%. The E106F mutant gave smaller K(m) (2.4-7 fold) and k(cat) (1-4.4 fold) values for all three substrates DMP, ABTS and SGZ as compared with those for the wild-type enzyme. Its slightly larger k(cat)/K(m) values for three substrates mainly come from the decreased K(m). Deleting α-helix (L351-G378) resulted in the formation of inactive inclusion body when the mutant (Δ)α351-378 was expressed in E. coli. Another mutant α351-380M was then made via substitution of seven amino acid residues in the α-helix (L351-G378) region. The α351-380M mutant was active, and displayed a far-UV CD spectrum markedly different from that for wild-type enzyme. Kinetic studies showed the α351-380M mutant gave very low K(m) values for DMP, ABTS and SGZ, 4.5-, 1.9- and 7-fold less than those for the wild type. In addition, k(cat)/K(m) values were increased, 9.4-fold for DMP, similar for ABTS and 3-fold for SGZ. The Glu residue at position 106 appears not to be the only factor affecting the copper binding, and it may also play a role in maintaining enzyme conformation. The α-helix (L351-G378) may not only block access to the type I copper site but also play a role in substrate specificities of bacterial MCOs. The α351-380M mutant catalyzing oxidation of the phenolic substrate DMP effectively would be very useful in green chemistry.

Mn(II) Oxidation by the Multicopper Oxidase Complex Mnx: A Binuclear Activation Mechanism.

PubMed

Soldatova, Alexandra V; Tao, Lizhi; Romano, Christine A; Stich, Troy A; Casey, William H; Britt, R David; Tebo, Bradley M; Spiro, Thomas G

2017-08-23

The bacterial protein complex Mnx contains a multicopper oxidase (MCO) MnxG that, unusually, catalyzes the two-electron oxidation of Mn(II) to MnO 2 biomineral, via a Mn(III) intermediate. Although Mn(III)/Mn(II) and Mn(IV)/Mn(III) reduction potentials are expected to be high, we find a low reduction potential, 0.38 V (vs Normal Hydrogen Electrode, pH 7.8), for the MnxG type 1 Cu 2+ , the electron acceptor. Indeed the type 1 Cu 2+ is not reduced by Mn(II) in the absence of molecular oxygen, indicating that substrate oxidation requires an activation step. We have investigated the enzyme mechanism via electronic absorption spectroscopy, using chemometric analysis to separate enzyme-catalyzed MnO 2 formation from MnO 2 nanoparticle aging. The nanoparticle aging time course is characteristic of nucleation and particle growth; rates for these processes followed expected dependencies on Mn(II) concentration and temperature, but exhibited different pH optima. The enzymatic time course is sigmoidal, signaling an activation step, prior to turnover. The Mn(II) concentration and pH dependence of a preceding lag phase indicates weak Mn(II) binding. The activation step is enabled by a pK a > 8.6 deprotonation, which is assigned to Mn(II)-bound H 2 O; it induces a conformation change (consistent with a high activation energy, 106 kJ/mol) that increases Mn(II) affinity. Mnx activation is proposed to decrease the Mn(III/II) reduction potential below that of type 1 Cu(II/I) by formation of a hydroxide-bridged binuclear complex, Mn(II)(μ-OH)Mn(II), at the substrate site. Turnover is found to depend cooperatively on two Mn(II) and is enabled by a pK a 7.6 double deprotonation. It is proposed that turnover produces a Mn(III)(μ-OH) 2 Mn(III) intermediate that proceeds to the enzyme product, likely Mn(IV)(μ-O) 2 Mn(IV) or an oligomer, which subsequently nucleates MnO 2 nanoparticles. We conclude that Mnx exploits manganese polynuclear chemistry in order to facilitate an otherwise

Surface Mn(II) oxidation actuated by a multicopper oxidase in a soil bacterium leads to the formation of manganese oxide minerals

PubMed Central

Zhang, Zhen; Zhang, Zhongming; Chen, Hong; Liu, Jin; Liu, Chang; Ni, Hong; Zhao, Changsong; Ali, Muhammad; Liu, Fan; Li, Lin

2015-01-01

In this manuscript, we report that a bacterial multicopper oxidase (MCO266) catalyzes Mn(II) oxidation on the cell surface, resulting in the surface deposition of Mn(III) and Mn(IV) oxides and the gradual formation of bulky oxide aggregates. These aggregates serve as nucleation centers for the formation of Mn oxide micronodules and Mn-rich sediments. A soil-borne Escherichia coli with high Mn(II)-oxidizing activity formed Mn(III)/Mn(IV) oxide deposit layers and aggregates under laboratory culture conditions. We engineered MCO266 onto the cell surfaces of both an activity-negative recipient and wild-type strains. The results confirmed that MCO266 governs Mn(II) oxidation and initiates the formation of deposits and aggregates. By contrast, a cell-free substrate, heat-killed strains, and intracellularly expressed or purified MCO266 failed to catalyze Mn(II) oxidation. However, purified MCO266 exhibited Mn(II)-oxidizing activity when combined with cell outer membrane component (COMC) fractions in vitro. We demonstrated that Mn(II) oxidation and aggregate formation occurred through an oxygen-dependent biotic transformation process that requires a certain minimum Mn(II) concentration. We propose an approximate electron transfer pathway in which MCO266 transfers only one electron to convert Mn(II) to Mn(III) and then cooperates with other COMC electron transporters to transfer the other electron required to oxidize Mn(III) to Mn(IV). PMID:26039669

Surface Mn(II) oxidation actuated by a multicopper oxidase in a soil bacterium leads to the formation of manganese oxide minerals.

PubMed

Zhang, Zhen; Zhang, Zhongming; Chen, Hong; Liu, Jin; Liu, Chang; Ni, Hong; Zhao, Changsong; Ali, Muhammad; Liu, Fan; Li, Lin

2015-06-03

In this manuscript, we report that a bacterial multicopper oxidase (MCO266) catalyzes Mn(II) oxidation on the cell surface, resulting in the surface deposition of Mn(III) and Mn(IV) oxides and the gradual formation of bulky oxide aggregates. These aggregates serve as nucleation centers for the formation of Mn oxide micronodules and Mn-rich sediments. A soil-borne Escherichia coli with high Mn(II)-oxidizing activity formed Mn(III)/Mn(IV) oxide deposit layers and aggregates under laboratory culture conditions. We engineered MCO266 onto the cell surfaces of both an activity-negative recipient and wild-type strains. The results confirmed that MCO266 governs Mn(II) oxidation and initiates the formation of deposits and aggregates. By contrast, a cell-free substrate, heat-killed strains, and intracellularly expressed or purified MCO266 failed to catalyze Mn(II) oxidation. However, purified MCO266 exhibited Mn(II)-oxidizing activity when combined with cell outer membrane component (COMC) fractions in vitro. We demonstrated that Mn(II) oxidation and aggregate formation occurred through an oxygen-dependent biotic transformation process that requires a certain minimum Mn(II) concentration. We propose an approximate electron transfer pathway in which MCO266 transfers only one electron to convert Mn(II) to Mn(III) and then cooperates with other COMC electron transporters to transfer the other electron required to oxidize Mn(III) to Mn(IV).

Manganese(IV) Oxide Production by Acremonium sp. Strain KR21-2 and Extracellular Mn(II) Oxidase Activity

PubMed Central

Miyata, Naoyuki; Tani, Yukinori; Maruo, Kanako; Tsuno, Hiroshi; Sakata, Masahiro; Iwahori, Keisuke

2006-01-01

Ascomycetes that can deposit Mn(III, IV) oxides are widespread in aquatic and soil environments, yet the mechanism(s) involved in Mn oxide deposition remains unclear. A Mn(II)-oxidizing ascomycete, Acremonium sp. strain KR21-2, produced a Mn oxide phase with filamentous nanostructures. X-ray absorption near-edge structure (XANES) spectroscopy showed that the Mn phase was primarily Mn(IV). We purified to homogeneity a laccase-like enzyme with Mn(II) oxidase activity from cultures of strain KR21-2. The purified enzyme oxidized Mn(II) to yield suspended Mn particles; XANES spectra indicated that Mn(II) had been converted to Mn(IV). The pH optimum for Mn(II) oxidation was 7.0, and the apparent half-saturation constant was 0.20 mM. The enzyme oxidized ABTS [2,2′-azinobis(3-ethylbenzothiazoline-6-sulfonic acid)] (pH optimum, 5.5; Km, 1.2 mM) and contained two copper atoms per molecule. Moreover, the N-terminal amino acid sequence (residues 3 to 25) was 61% identical with the corresponding sequence of an Acremonium polyphenol oxidase and 57% identical with that of a Myrothecium bilirubin oxidase. These results provide the first evidence that a fungal multicopper oxidase can convert Mn(II) to Mn(IV) oxide. The present study reinforces the notion of the contribution of multicopper oxidase to microbially mediated precipitation of Mn oxides and suggests that Acremonium sp. strain KR21-2 is a good model for understanding the oxidation of Mn in diverse ascomycetes. PMID:17021194

Draft Genome Sequence of Roseovarius sp. A-2, an Iodide-Oxidizing Bacterium Isolated from Natural Gas Brine Water, Chiba, Japan.

PubMed

Yuliana, Tri; Nakajima, Nobuyoshi; Yamamura, Shigeki; Tomita, Masaru; Suzuki, Haruo; Amachi, Seigo

2017-01-01

Roseovarius sp. A-2 is a heterotrophic iodide (I - )-oxidizing bacterium isolated from iodide-rich natural gas brine water in Chiba, Japan. This strain oxidizes iodide to molecular iodine (I 2 ) by means of an extracellular multicopper oxidase. Here we report the draft genome sequence of strain A-2. The draft genome contained 46 tRNA genes, 1 copy of a 16S-23S-5S rRNA operon, and 4,514 protein coding DNA sequences, of which 1,207 (27%) were hypothetical proteins. The genome contained a gene encoding IoxA, a multicopper oxidase previously found to catalyze the oxidation of iodide in Iodidimonas sp. Q-1. This draft genome provides detailed insights into the metabolism and potential application of Roseovarius sp. A-2.

A novel extracellular multicopper oxidase from Phanerochaete chrysosporium with ferroxidase activity

Treesearch

Luis F. Larrondo; Loreto Salas; Francisco Melo; Rafael Vicuna; Daniel Cullen

2003-01-01

Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified...

Design parameters for tuning the type 1 Cu multicopper oxidase redox potential: insight from a combination of first principles and empirical molecular dynamics simulations.

PubMed

Hong, Gongyi; Ivnitski, Dmitri M; Johnson, Glenn R; Atanassov, Plamen; Pachter, Ruth

2011-04-06

The redox potentials and reorganization energies of the type 1 (T1) Cu site in four multicopper oxidases were calculated by combining first principles density functional theory (QM) and QM/MM molecular dynamics (MD) simulations. The model enzymes selected included the laccase from Trametes versicolor, the laccase-like enzyme isolated from Bacillus subtilis, CueO required for copper homeostasis in Escherichia coli, and the small laccase (SLAC) from Streptomyces coelicolor. The results demonstrated good agreement with experimental data and provided insight into the parameters that influence the T1 redox potential. Effects of the immediate T1 Cu site environment, including the His(N(δ))-Cys(S)-His(N(δ)) and the axial coordinating amino acid, as well as the proximate H(N)(backbone)-S(Cys) hydrogen bond, were discerned. Furthermore, effects of the protein backbone and side-chains, as well as of the aqueous solvent, were studied by QM/MM molecular dynamics (MD) simulations, providing an understanding of influences beyond the T1 Cu coordination sphere. Suggestions were made regarding an increase of the T1 redox potential in SLAC, i.e., of Met198 and Thr232 in addition to the axial amino acid Met298. Finally, the results of this work presented a framework for understanding parameters that influence the Type 1 Cu MCO redox potential, useful for an ever-growing range of laccase-based applications. © 2011 American Chemical Society

Study on dioxygen reduction by mutational modifications of the hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morishita, Hirotoshi; Kurita, Daisuke; Kataoka, Kunishige

2014-07-18

Highlights: • Proton transport pathway in bilirubin oxidase was mutated. • Two intermediates in the dioxygen reduction steps were trapped and characterized. • A specific glutamate for dioxygen reduction by multicopper oxidases was identified. - Abstract: The hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase is constructed with Glu463 and water molecules to transport protons for the four-electron reduction of dioxygen. Substitutions of Glu463 with Gln or Ala were attributed to virtually complete loss or significant reduction in enzymatic activities due to an inhibition of the proton transfer steps to dioxygen. The singlemore » turnover reaction of the Glu463Gln mutant afforded the highly magnetically interacted intermediate II (native intermediate) with a broad g = 1.96 electron paramagnetic resonance signal detectable at cryogenic temperatures. Reactions of the double mutants, Cys457Ser/Glu463Gln and Cys457Ser/Glu463Ala afforded the intermediate I (peroxide intermediate) because the type I copper center to donate the fourth electron to dioxygen was vacant in addition to the interference of proton transport due to the mutation at Glu463. The intermediate I gave no electron paramagnetic resonance signal, but the type II copper signal became detectable with the decay of the intermediate I. Structural and functional similarities between multicopper oxidases are discussed based on the present mutation at Glu463 in bilirubin oxidase.« less

Dexamethasone but not indomethacin inhibits human phagocyte nicotinamide adenine dinucleotide phosphate oxidase activity by down-regulating expression of genes encoding oxidase components.

PubMed

Condino-Neto, A; Whitney, C; Newburger, P E

1998-11-01

We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.

Highly efficient perturbative + variational strategy based on orthogonal valence bond theory for the evaluation of magnetic coupling constants. Application to the trinuclear Cu(ii) site of multicopper oxidases.

PubMed

Tenti, Lorenzo; Maynau, Daniel; Angeli, Celestino; Calzado, Carmen J

2016-07-21

A new strategy based on orthogonal valence-bond analysis of the wave function combined with intermediate Hamiltonian theory has been applied to the evaluation of the magnetic coupling constants in two AF systems. This approach provides both a quantitative estimate of the J value and a detailed analysis of the main physical mechanisms controlling the coupling, using a combined perturbative + variational scheme. The procedure requires a selection of the dominant excitations to be treated variationally. Two methods have been employed: a brute-force selection, using a logic similar to that of the CIPSI approach, or entanglement measures, which identify the most interacting orbitals in the system. Once a reduced set of excitations (about 300 determinants) is established, the interaction matrix is dressed at the second-order of perturbation by the remaining excitations of the CI space. The diagonalization of the dressed matrix provides J values in good agreement with experimental ones, at a very low-cost. This approach demonstrates the key role of d → d* excitations in the quantitative description of the magnetic coupling, as well as the importance of using an extended active space, including the bridging ligand orbitals, for the binuclear model of the intermediates of multicopper oxidases. The method is a promising tool for dealing with complex systems containing several active centers, as an alternative to both pure variational and DFT approaches.

Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

Treesearch

Diane Dietrich; Casey Crooks

2009-01-01

A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

Four-electron Reduction of Dioxygen by a Multicopper Oxidase, CueO, and Roles of Asp112 and Glu506 Located Adjacent to the Trinuclear Copper Center*S⃞

PubMed Central

Kataoka, Kunishige; Sugiyama, Ryosuke; Hirota, Shun; Inoue, Megumi; Urata, Kanae; Minagawa, Yoichi; Seo, Daisuke; Sakurai, Takeshi

2009-01-01

The mechanism of the four-electron reduction of dioxygen by a multicopper oxidase, CueO, was studied based on reactions of single and double mutants with Cys500, a type I copper ligand, and the noncoordinating Asp112 and Glu506, which form hydrogen bonds with the trinuclear copper center directly and indirectly via a water molecule. The reaction of C500S containing a vacant type I copper center produced intermediate I in an EPR-silent peroxide-bound form. The formation of intermediate I from C500S/D112N was restricted due to a reduction in the affinity of the trinuclear copper center for dioxygen. The state of intermediate I was realized to be the resting form of C500S/E506Q and C500S of the truncated mutant Δα5–7CueO, in which the 50 amino acids covering the substrate-binding site were removed. Reactions of the recombinant CueO and E506Q afforded intermediate II, a fully oxidized form different from the resting one, with a very broad EPR signal, g < 2, detectable only at cryogenic temperatures and unsaturated with high power microwaves. The lifetime of intermediate II was prolonged by the mutation at Glu506 involved in the donation of protons. The structure of intermediates I and II and the mechanism of the four-electron reduction of dioxygen driven by Asp112 and Glu506 are discussed. PMID:19297322

Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa

PubMed Central

Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.

1996-01-01

Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590

Molecular evolution of the polyamine oxidase gene family in Metazoa

PubMed Central

2012-01-01

Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including

Molecular evolution of the polyamine oxidase gene family in Metazoa.

PubMed

Polticelli, Fabio; Salvi, Daniele; Mariottini, Paolo; Amendola, Roberto; Cervelli, Manuela

2012-06-20

Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all

Cotton Ascorbate Oxidase Promotes Cell Growth in Cultured Tobacco Bright Yellow-2 Cells through Generation of Apoplast Oxidation

PubMed Central

Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin

2017-01-01

Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407

Spectroscopic characterization and O2 reactivity of the trinuclear Cu cluster of mutants of the multicopper oxidase Fet3p.

PubMed

Palmer, Amy E; Quintanar, Liliana; Severance, Scott; Wang, Tzu-Pin; Kosman, Daniel J; Solomon, Edward I

2002-05-21

Fet3p is a multicopper oxidase that uses four copper ions (one type 1, one type 2, and one type 3 binuclear site) to couple substrate oxidation to the reduction of O(2) to H(2)O. The type 1 Cu site shuttles electrons between the substrate and the type 2/type 3 Cu sites which form a trinuclear Cu cluster that is the active site for O(2) reduction. This study extends the spectroscopic and reactivity studies that have been conducted with type 1-substituted Hg (T1Hg) laccase to Fet3p and a mutant of Fet3p in which the trinuclear Cu cluster is perturbed. To examine the reaction between the trinuclear Cu cluster and O(2), the type 1 Cu Cys(484) was mutated to Ser, resulting in a type 1-depleted (T1D) form of the enzyme. Additional His to Gln mutations were made at the trinuclear cluster to further probe specific contributions to reactivity. One of these mutants (His(126)Gln) produces the first stable but perturbed trinuclear Cu cluster (T1DT3' Fet3p). Spectroscopic characterization (absorption, circular dichroism, magnetic circular dichroism, and electron paramagnetic resonance) of the resting trinuclear sites in T1D and T1DT3' Fet3p reveal that the His(126)Gln mutation changes the electronic structure of both the type 3 and type 2 Cu sites. The trinuclear clusters in T1D and T1DT3' Fet3p react with O(2) to produce peroxide intermediates analogous to that observed in T1Hg laccase. Spectroscopic data on the peroxide intermediates in the three forms provide further insight into the structure of this intermediate. In T1D Fet3p, the decay of this peroxide intermediate is pH-dependent, and the rate of decay is 10-fold higher at low pH. In T1DT3' Fet3p, the decay of the peroxide intermediate is pH-independent and is slow at all pH's. This change in the pH dependence provides new insight into the mechanism of intermediate decay involving reductive cleavage of the O-O bond.

Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

PubMed Central

Hiesel, Rudolf; Brennicke, Axel

1983-01-01

The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene

PubMed Central

Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji

2001-01-01

We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

Bilirubin oxidase-like proteins from Podospora anserina: promising thermostable enzymes for application in transformation of plant biomass.

PubMed

Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence

2015-03-01

Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

A gene encoding the plant-like alternative oxidase is present in Phytomonas but absent in Leishmania spp.

PubMed

Van Hellemond, J J; Simons, B; Millenaar, F F; Tielens, A G

1998-01-01

The constituents of the respiratory chain are believed to differ among the trypanosomatids; bloodstream stages of African trypanosomes and Phytomonas promastigotes oxidize ubiquinol by a ubiquinol:oxygen oxidoreductase, also known as alternative oxidase, whereas Leishmania spp. oxidize ubiquinol via a classic cytochrome-containing respiratory chain. The molecular basis for this elementary difference in ubiquinol oxidation by the mitochondrial electron-transport chain in distinct trypanosomatids was investigated. The presence of a gene encoding the plant-like alternative oxidase could be demonstrated in Phytomonas and Trypanosoma brucei, trypanosomatids that are known to contain alternative oxidase activity. Our results further demonstrated that Leishmania spp. lack a gene encoding the plant-like alternative oxidase, and therefore, all stages of Leishmania spp. will lack the alternative oxidase protein. The observed fundamental differences between the respiratory chains of distinct members of the trypanosomatid family are thus caused by the presence or absence of a gene encoding the plant-like alternative oxidase.

Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

PubMed

Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

2015-09-29

The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

PubMed

Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

1997-04-01

A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.

Characterization of two brassinosteroid C-6 oxidase genes in pea.

PubMed

Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

2007-04-01

C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea.

Finding New Enzymes from Bacterial Physiology: A Successful Approach Illustrated by the Detection of Novel Oxidases in Marinomonas mediterranea

PubMed Central

Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elío, Patricia

2010-01-01

The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid l-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for l-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (1.4.3.20), has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113

Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

PubMed Central

Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

2010-01-01

In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

Systematic Perturbation of the Trinuclear Copper Cluster in the Multicopper Oxidases: The Role of Active Site Asymmetry in its Reduction of O2 to H2O

PubMed Central

Augustine, Anthony J.; Kjaergaard, Christian; Qayyum, Munzarin; Ziegler, Lynn; Kosman, Daniel J.; Hodgson, Keith O.; Hedman, Britt; Solomon, Edward I.

2010-01-01

The multicopper oxidase Fet3p catalyzes the four-electron reduction of dioxygen to water, coupled to the one-electron oxidation of four equivalents of substrate. To carry out this process the enzyme utilizes four Cu atoms: a type 1, a type 2, and a coupled binuclear, type 3 site. Substrates are oxidized at the T1 Cu, which rapidly transfers electrons, 13 Å away, to a trinuclear copper cluster composed of the T2 and T3 sites where dioxygen is reduced to water in two sequential 2e− steps. This study focuses on two variants of Fet3p, H126Q and H483Q, that perturb the two T3 Cu's, T3α and T3β, respectively. The variants have been isolated in both holo and type 1 depleted (T1D) forms, T1DT3αQ and T1DT3βQ, and their trinuclear copper clusters have been characterized in their oxidized and reduced states. While the variants are only mildly perturbed relative to T1D in the resting oxidized state, in contrast to T1D they are both found to have lost a ligand in their reduced states. Importantly, T1DT3αQ reacts with O2 but T1DT3βQ does not. Thus loss of a ligand at T3β, but not at T3α, turns off O2 reactivity, indicating that T3β and T2 are required for the 2e− reduction of O2 to form the peroxide intermediate (PI), whereas T3α remains reduced. This is supported by the spectroscopic features of PI in T1DT3αQ, which are identical to T1D PI. This selective redox activity of one edge of the trinuclear cluster demonstrates its asymmetry in O2 reactivity. The structural origin of this asymmetry between the T3α and T3β is discussed as is its contribution to reactivity. PMID:20377263

Association of monoamine oxidase A gene polymorphism with Alzheimer's disease and Lewy body variant.

PubMed

Takehashi, Masanori; Tanaka, Seigo; Masliah, Eliezer; Ueda, Kunihiro

2002-07-19

The association between (GT)n dinucleotide repeats in monoamine oxidase gene loci, monoamine oxidase A (MAOA) and B (MAOB), and Parkinson's disease (PD), Alzheimer's disease (AD), and Lewy body variant (LBV) of AD were determined. MAOA-GT polymorphisms were significantly associated with pure AD and LBV. MAOA-GT allele 113 was excessively represented in pure AD and LBV compared with controls. Furthermore, the frequency of females homozygous for MAOA-GT allele 113 was higher in pure AD and LBV than controls by 2.79- and 2.77-fold, respectively. In contrast, there was no association between MAOA-GT or MAOB-GT polymorphisms and PD. These results suggest that polymorphisms within the MAOA gene may have implication in AD pathology shared by pure AD and LBV.

MONOAMINE OXIDASE: From Genes to Behavior

PubMed Central

Shih, J. C.; Chen, K.; Ridd, M. J.

2010-01-01

Cloning of MAO (monoamine oxidase) A and B has demonstrated unequivocally that these enzymes are made up of different polypeptides, and our understanding of MAO structure, regulation, and function has been significantly advanced by studies using their cDNA. MAO A and B genes are located on the X-chromosome (Xp11.23) and comprise 15 exons with identical intron-exon organization, which suggests that they are derived from the same ancestral gene. MAO A and B knockout mice exhibit distinct differences in neurotransmitter metabolism and behavior. MAO A knock-out mice have elevated brain levels of serotonin, norephinephrine, and dopamine and manifest aggressive behavior similar to human males with a deletion of MAO A. In contrast, MAO B knock-out mice do not exhibit aggression and only levels of phenylethylamine are increased. Mice lacking MAO B are resistant to the Parkinsongenic neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetra-hydropyridine. Both MAO A and B knock-out mice show increased reactivity to stress. These knock-out mice are valuable models for investigating the role of monoamines in psychoses and neurodegenerative and stress-related disorders. PMID:10202537

Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy

PubMed Central

Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.

2014-01-01

Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264

Spectroscopic Studies of Perturbed T1 Cu Sites in the Multicopper Oxidases Saccharomyces Cerevisiae Fet3p And Rhus Vernicifera Laccase: Allosteric Coupling Between the T1 And Trinuclear Cu Sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Augustine, A.J.; Kragh, M.E.; Sarangi, R.

2009-04-30

The multicopper oxidases catalyze the 4e{sup -} reduction of O{sub 2} to H{sub 2}O coupled to the 1e{sup -} oxidation of 4 equiv of substrate. This activity requires four Cu atoms, including T1, T2, and coupled binuclear T3 sites. The T2 and T3 sites form a trinuclear cluster (TNC) where O{sub 2} is reduced. The T1 is coupled to the TNC through a T1-Cys-His-T3 electron transfer (ET) pathway. In this study the two T3 Cu coordinating His residues which lie in this pathway in Fet3 have been mutated, H483Q, H483C, H485Q, and H485C, to study how perturbation at the TNCmore » impacts the T1 Cu site. Spectroscopic methods, in particular resonance Raman (rR), show that the change from His to Gln to Cys increases the covalency of the T1 Cu?S Cys bond and decreases its redox potential. This study of T1?TNC interactions is then extended to Rhus vernicifera laccase where a number of well-defined species including the catalytically relevant native intermediate (NI) can be trapped for spectroscopic study. The T1 Cu?S covalency and potential do not change in these species relative to resting oxidized enzyme, but interestingly the differences in the structure of the TNC in these species do lead to changes in the T1 Cu rR spectrum. This helps to confirm that vibrations in the cysteine side chain of the T1 Cu site and the protein backbone couple to the Cu?S vibration. These changes in the side chain and backbone provide a possible mechanism for regulating intramolecular T1 to TNC ET in NI and partially reduced enzyme forms for efficient turnover.« less

Ferric reductase genes involved in high-affinity iron uptake are differentially regulated in yeast and hyphae of Candida albicans.

PubMed

Jeeves, Rose E; Mason, Robert P; Woodacre, Alexandra; Cashmore, Annette M

2011-09-01

The pathogenic yeast Candida albicans possesses a reductive iron uptake system which is active in iron-restricted conditions. The sequestration of iron by this mechanism initially requires the reduction of free iron to the soluble ferrous form, which is catalysed by ferric reductase proteins. Reduced iron is then taken up into the cell by a complex of a multicopper oxidase protein and an iron transport protein. Multicopper oxidase proteins require copper to function and so reductive iron and copper uptake are inextricably linked. It has previously been established that Fre10 is the major cell surface ferric reductase in C. albicans and that transcription of FRE10 is regulated in response to iron levels. We demonstrate here that Fre10 is also a cupric reductase and that Fre7 also makes a significant contribution to cell surface ferric and cupric reductase activity. It is also shown, for the first time, that transcription of FRE10 and FRE7 is lower in hyphae compared to yeast and that this leads to a corresponding decrease in cell surface ferric, but not cupric, reductase activity. This demonstrates that the regulation of two virulence determinants, the reductive iron uptake system and the morphological form of C. albicans, are linked. Copyright © 2011 John Wiley & Sons, Ltd.

Genetic Mapping of a new family of Seed-Expressed Polyphenol Oxidase genes in Wheat (Triticum aestivum L.)

USDA-ARS?s Scientific Manuscript database

Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...

[THE INFLUENCE OF SEROTONIN TRANSPORTER AND MONOAMINE OXIDASE A GENES POLYMORPHISM ON PSYCHO-EMOTION AND KARYOLOGICAL STABILITY OF ATHLETES].

PubMed

Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A

2015-11-01

The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.

X-ray structure of a two-domain type laccase: a missing link in the evolution of multi-copper proteins.

PubMed

Komori, Hirofumi; Miyazaki, Kentaro; Higuchi, Yoshiki

2009-04-02

A multi-copper protein with two cupredoxin-like domains was identified from our in-house metagenomic database. The recombinant protein, mgLAC, contained four copper ions/subunits, oxidized various phenolic and non-phenolic substrates, and had spectroscopic properties similar to common laccases. X-ray structure analysis revealed a homotrimeric architecture for this enzyme, which resembles nitrite reductase (NIR). However, a difference in copper coordination was found at the domain interface. mgLAC contains a T2/T3 tri-nuclear copper cluster at this site, whereas a mononuclear T2 copper occupies this position in NIR. The trimer is thus an essential part of the architecture of two-domain multi-copper proteins, and mgLAC may be an evolutionary precursor of NIR.

A bacterial laccase from marine microbial metagenome exhibiting chloride tolerance and dye decolorization ability.

PubMed

Fang, Zemin; Li, Tongliang; Wang, Quan; Zhang, Xuecheng; Peng, Hui; Fang, Wei; Hong, Yuzhi; Ge, Honghua; Xiao, Yazhong

2011-02-01

Laccases are blue multicopper oxidases with potential applications in environmental and industrial biotechnology. In this study, a new bacterial laccase gene of 1.32 kb was obtained from a marine microbial metagenome of the South China Sea by using a sequence screening strategy. The protein (named as Lac15) of 439 amino acids encoded by the gene contains three conserved Cu(2+)-binding domains, but shares less than 40% of sequence identities with all of the bacterial multicopper oxidases characterized. Lac15, recombinantly expressed in Escherichia coli, showed high activity towards syringaldazine at pH 6.5-9.0 with an optimum pH of 7.5 and with the highest activity occurring at 45 °C. Lac15 was stable at pH ranging from 5.5 to 9.0 and at temperatures from 15 to 45 °C. Distinguished from fungal laccases, the activity of Lac15 was enhanced twofold by chloride at concentrations lower than 700 mM, and kept the original level even at 1,000 mM chloride. Furthermore, Lac15 showed an ability to decolorize several industrial dyes of reactive azo class under alkalescent conditions. The properties of alkalescence-dependent activity, high chloride tolerance, and dye decolorization ability make the new laccase Lac15 an alternative for specific industrial applications.

Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

PubMed

Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

1998-01-01

In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.

Association between a promoter variant in the monoamine oxidase A gene and schizophrenia.

PubMed

Jönsson, Erik G; Norton, Nadine; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Owen, Michael J; Sedvall, Göran C

2003-05-01

Monoaminergic transmission has been implicated in the pathophysiology of schizophrenia. We investigated a putative functional promoter polymorphism in the monoamine oxidase A (MAOA) gene in schizophrenic patients (n=133) and control subjects (n=377). In men, there was an association between the less efficiently transcribed alleles and schizophrenia (chi(2)=4.01, df=1, p<0.05). In women, no significant differences were found. The present results support the involvement of the MAOA gene in men with schizophrenia in the investigated Swedish population but should be interpreted with caution until replicated.

Genetic mapping of new seed-expressed polyphenol oxidase genes in wheat (Triticum aestivum L.).

PubMed

Beecher, Brian S; Carter, Arron H; See, Deven R

2012-05-01

Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. Recently a novel PPO gene family consisting of the PPO-A2, PPO-B2, and PPO-D2 genes has been identified and shown to be expressed in wheat kernels. In this study, the sequences of these five kernel PPO genes were determined for the spring wheat cultivars Louise and Penawawa. The two cultivars were found to be polymorphic at each of the PPO loci. Three novel alleles were isolated from Louise. The Louise X Penawawa mapping population was used to genetically map all five PPO genes. All map to the long arm of homeologous group 2 chromosomes. PPO-A2 was found to be located 8.9 cM proximal to PPO-A1 on the long arm of chromosome 2A. Similarly, PPO-D1 and PPO-D2 were separated by 10.7 cM on the long arm of chromosome 2D. PPO-B2 mapped to the long arm of chromosome 2B and was the site of a novel QTL for polyphenol oxidase activity. Five other PPO QTL were identified in this study. One QTL corresponds to the previously described PPO-D1 locus, one QTL corresponds to the PPO-D2 locus, whereas the remaining three are located on chromosome 2B.

Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

PubMed

Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

2016-08-01

Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

USDA-ARS?s Scientific Manuscript database

The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

Cloning and expression analysis of the ATP-binding cassette transporter gene MFABC1 and the alternative oxidase gene MfAOX1 from Monilinia fructicola.

PubMed

Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R

2003-10-01

Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels.

Cytokinin oxidase/dehydrogenase genes in barley and wheat: cloning and heterologous expression.

PubMed

Galuszka, Petr; Frébortová, Jitka; Werner, Tomás; Yamada, Mamoru; Strnad, Miroslav; Schmülling, Thomas; Frébort, Ivo

2004-10-01

The cloning of two novel genes that encode cytokinin oxidase/dehydrogenase (CKX) in barley is described in this work. Transformation of both genes into Arabidopsis and tobacco showed that at least one of the genes codes for a functional enzyme, as its expression caused a cytokinin-deficient phenotype in the heterologous host plants. Additional cloning of two gene fragments, and an in silico search in the public expressed sequence tag clone databases, revealed the presence of at least 13 more members of the CKX gene family in barley and wheat. The expression of three selected barley genes was analyzed by RT-PCR and found to be organ-specific with peak expression in mature kernels. One barley CKX (HvCKX2) was characterized in detail after heterologous expression in tobacco. Interestingly, this enzyme shows a pH optimum at 4.5 and a preference for cytokinin ribosides as substrates, which may indicate its vacuolar targeting. Different substrate specificities, and the pH profiles of cytokinin-degrading enzymes extracted from different barley tissues, are also presented.

Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

ERIC Educational Resources Information Center

May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

2009-01-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

Direct electron-transfer conduits constructed at the interface between multicopper oxidase and nanocrystalline semiconductive Fe oxides

NASA Astrophysics Data System (ADS)

Nakamura, Ryuhei; Kamiya, Kazuhide; Hashimoto, Kazuhito

2010-10-01

Herein, the electron-transfer reactions occurring at the interface between bilirubin oxidase (BOD) and nanocrystalline hematite (α-Fe 2O 3) were characterized. Cyclic voltammograms indicated that BOD has an affinity for hematite surfaces and establishes a direct electron-transfer (DET) conduit between the primary electron acceptor T1 site and the conduction band of α-Fe 2O 3. DET was also confirmed photo-electrochemically, as cathodic photocurrents were generated when a nanocomposite of BOD and α-Fe 2O 3 was illuminated under oxygenated conditions. A proline residue displayed a high-binding affinity for hematite surfaces and is therefore likely part of an orientation-controlled motif which serves to locate BOD at the T1 site at a suitable distance for DET to α-Fe 2O 3.

The absence of genes for cytochrome c oxidase and reductase subunits in maxicircle kinetoplast DNA of the respiration-deficient plant trypanosomatid Phytomonas serpens.

PubMed

Nawathean, P; Maslov, D A

2000-08-01

By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs.

A novel proteolytic processing of prolysyl oxidase

PubMed Central

Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E.; Yamauchi, Mitsuo

2012-01-01

Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residue Gly162 and Asp163 (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity and mass spectrometry. One form was identified as a well characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX (tLOX) resulting from the cleavage at the carboxy terminus of Arg192. The tLOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX. PMID:21591931

A novel proteolytic processing of prolysyl oxidase.

PubMed

Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E; Yamauchi, Mitsuo

2011-01-01

Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residues Gly(162) and Asp(163) (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity, and mass spectrometry. One form was identified as a well-characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX resulting from the cleavage at the carboxy terminus of Arg(192). The truncated form of LOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX.

Fine structure of OXI1, the mitochondrial gene coding for subunit II of yeast cytochrome c oxidase.

PubMed

Weiss-Brummer, B; Guba, R; Haid, A; Schweyen, R J

1979-12-01

Genetic and biochemical studies have been performed with 110 mutants which are defective in cytochrome a·a3 and map in the regions on mit DNA previously designated OXI1 and OXI2. With 88 mutations allocated to OXI1 fine structure mapping was achieved by the analysis of rho (-) deletions. The order of six groups of mutational sites (A 1, A2, B 1, B2, C 1, C2) thus determined was confirmed by oxi i x oxi j recombination analysis.Analysis of mitochondrially translated polypeptides of oxil mutants by SDS-polyacrylamide electrophoresis reveals three classes of mutant patterns: i) similar to wild-tpye (19 mutants); ii) lacking SU II of cytochrome c oxidase (53 mutants); iii) lacking this subunit and exhibiting a single new polypeptide of lower Mr (16 mutants). Mutations of each of these classes are scattered over the OXI1 region without any detectable clustering; this is consistent with the assumption that all oxil mutations studied are within the same gene.New polypeptides observed in oxil mutants of class iii) vary in Mr in the range from 10,500 to 33,000. Those of Mr 17,000 to 33,000 are shown to be antigenically related to subunit II of cytochrome c oxidase. Colinearity is established between the series of new polypeptides of Mr values increasing from 10,500 to 31,500 and the order of the respective mutational sites on the map, e.g. mutations mapping in A 1 generate the smallest and mutations mapping in C2 the largest mutant fragments.From these data we conclude that i) all mutations allocated to the OXI1 region are in the same gene; ii) this gene codes for subunit II of cytochrome c oxidase; iii) the direction of translation is from CAP to 0X12. Out of 19 mutants allocated to OXI2 three exhibit a new polypeptide; these and all the other oxi2 mutants lack subunit III of cytochrome oxidase. This result provides preliminary evidence that the OXI2 region harbours the structural gene for this subunit III.

Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization.

PubMed

Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki

2013-02-01

In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.

Isolation and characterization of the pea cytochrome c oxidase Vb gene.

PubMed

Kubo, Nakao; Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Kadowaki, Koh-Ichi; Hirai, Masashi

2006-11-01

Three copies of the gene that encodes cytochrome c oxidase subunit Vb were isolated from the pea (PscoxVb-1, PscoxVb-2, and PscoxVb-3). Northern Blot and reverse transcriptase-PCR analyses suggest that all 3 genes are transcribed in the pea. Each pea coxVb gene has an N-terminal extended sequence that can encode a mitochondrial targeting signal, called a presequence. The localization of green fluorescent proteins fused with the presequence strongly suggests the targeting of pea COXVb proteins to mitochondria. Each pea coxVb gene has 5 intron sites within the coding region. These are similar to Arabidopsis and rice, although the intron lengths vary greatly. A phylogenetic analysis of coxVb suggests the occurrence of gene duplication events during angiosperm evolution. In particular, 2 duplication events might have occurred in legumes, grasses, and Solanaceae. A comparison of amino acid sequences in COXVb or its counterpart shows the conservation of several amino acids within a zinc finger motif. Interestingly, a homology search analysis showed that bacterial protein COG4391 and a mitochondrial complex I 13 kDa subunit also have similar amino acid compositions around this motif. Such similarity might reflect evolutionary relationships among the 3 proteins.

Adipogenesis-related increase of semicarbazide-sensitive amine oxidase and monoamine oxidase in human adipocytes.

PubMed

Bour, Sandy; Daviaud, Danièle; Gres, Sandra; Lefort, Corinne; Prévot, Danielle; Zorzano, Antonio; Wabitsch, Martin; Saulnier-Blache, Jean-Sébastien; Valet, Philippe; Carpéné, Christian

2007-08-01

A strong induction of semicarbazide-sensitive amine oxidase (SSAO) has previously been reported during murine preadipocyte lineage differentiation but it remains unknown whether this emergence also occurs during adipogenesis in man. Our aim was to compare SSAO and monoamine oxidase (MAO) expression during in vitro differentiation of human preadipocytes and in adipose and stroma-vascular fractions of human fat depots. A human preadipocyte cell strain from a patient with Simpson-Golabi-Behmel syndrome was first used to follow amine oxidase expression during in vitro differentiation. Then, human preadipocytes isolated from subcutaneous adipose tissues were cultured under conditions promoting ex vivo adipose differentiation and tested for MAO and SSAO expression. Lastly, human adipose tissue was separated into mature adipocyte and stroma-vascular fractions for analyses of MAO and SSAO at mRNA, protein and activity levels. Both SSAO and MAO were increased from undifferentiated preadipocytes to lipid-laden cells in all the models: 3T3-F442A and 3T3-L1 murine lineages, human SGBS cell strain or human preadipocytes in primary culture. In human subcutaneous adipose tissue, the adipocyte-enriched fraction exhibited seven-fold higher amine oxidase activity and contained three- to seven-fold higher levels of mRNAs encoded by MAO-A, MAO-B, AOC3 and AOC2 genes than the stroma-vascular fraction. MAO-A and AOC3 genes accounted for the majority of their respective MAO and SSAO activities in human adipose tissue. Most of the SSAO and MAO found in adipose tissue originated from mature adipocytes. Although the mechanism and role of adipogenesis-related increase in amine oxidase expression remain to be established, the resulting elevated levels of amine oxidase activities found in human adipocytes may be of potential interest for therapeutic intervention in obesity.

Unfolding pathway of CotA-laccase and the role of copper on the prevention of refolding through aggregation of the unfolded state

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fernandes, Andre T.; Lopes, Carlos; Martins, Ligia O.

2012-06-08

Highlights: Black-Right-Pointing-Pointer CotA-laccase unfolds with an intermediate state. Black-Right-Pointing-Pointer Copper stabilizes the native and the intermediate state. Black-Right-Pointing-Pointer Copper binding to the unfolded state prevents refolding through protein aggregation. Black-Right-Pointing-Pointer Copper incorporation in CotA-laccase occurs as a later step during folding. -- Abstract: Copper is a redox-active metal and the main player in electron transfer reactions occurring in multicopper oxidases. The role of copper in the unfolding pathway and refolding of the multicopper oxidase CotA laccase in vitro was solved using double-jump stopped-flow experiments. Unfolding of apo- and holo-CotA was described as a three-state process with accumulation of an intermediatemore » in between the native and unfolded state. Copper stabilizes the native holo-CotA but also the intermediate state showing that copper is still bound to this state. Also, copper binds to unfolded holo-CotA in a non-native coordination promoting CotA aggregation and preventing refolding to the native structure. These results gather information on unfolding/folding pathways of multicopper oxidases and show that copper incorporation in vivo should be a tight controlled process as copper binding to the unfolded state under native conditions promotes protein aggregation.« less

Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus

Treesearch

Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds

2016-01-01

The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...

Alteration of respiration capacity and transcript accumulation level of alternative oxidase genes in necrosis lines of common wheat.

PubMed

Sugie, Atsushi; Murai, Koji; Takumi, Shigeo

2007-06-01

Mitochondrial alternative oxidase (AOX) is the terminal oxidase responsible for cyanide-insensitive and salicylhydroxamic acid-sensitive respiration in plants. AOX is a key enzyme of the alternative respiration pathway. To study the effects of necrotic cell death on the mitochondrial function, production of reactive oxygen species (ROS), respiration capacities and accumulation patterns of mitochondria-targeted protein-encoding gene transcripts were compared between wild-type, lesion-mimic mutant and hybrid necrosis wheat plants. Around cells with the necrosis symptom, ROS accumulated abundantly in the intercellular spaces. The ratio of the alternative pathway to the cytochrome pathway was markedly enhanced in the necrotic leaves. Transcripts of a wheat AOX gene, Waox1a, were more abundant in a novel lesion-mimic mutant of common wheat than in the wild-type plants. An increased level of the Waox1a transcripts was also observed in hybrid plants containing Ne1 and Ne2 genes. These results indicated that an increase of the wheat AOX transcript level resulted in enhancement of respiration capacity of the alternative pathway in the necrotic cells.

Microprojectile Bombardment Transformation of Date Palm Using the Insecticidal Cholesterol Oxidase (ChoA) Gene.

PubMed

Allam, Mai A; Saker, Mahmoud M

2017-01-01

The overall objective of this work is to optimize the transformation system for date palm as a first step toward production of date palm clones resistant to noxious pests. A construct harboring the cholesterol oxidase (ChoA) gene, which renders plant resistance against insect attack, is introduced into embryogenic date palm callus using the PDS-1000/He particle bombardment system. The process involves the establishment of embryogenic callus cultures as well as immature embryo-derived microcalli that are used as target tissues for shooting and optimization of transformation conditions. This chapter in addition explains molecular and histochemical assays conducted to confirm gene integration and expression.

Monoamine Oxidase A Gene (MAOA) Associated with Attitude Towards Longshot Risks

PubMed Central

Zhong, Songfa; Israel, Salomon; Xue, Hong; Ebstein, Richard P.; Chew, Soo Hong

2009-01-01

Decision making often entails longshot risks involving a small chance of receiving a substantial outcome. People tend to be risk preferring (averse) when facing longshot risks involving significant gains (losses). This differentiation towards longshot risks underpins the markets for lottery as well as for insurance. Both lottery and insurance have emerged since ancient times and continue to play a useful role in the modern economy. In this study, we observe subjects' incentivized choices in a controlled laboratory setting, and investigate their association with a widely studied, promoter-region repeat functional polymorphism in monoamine oxidase A gene (MAOA). We find that subjects with the high activity (4-repeat) allele are characterized by a preference for the longshot lottery and also less insurance purchasing than subjects with the low activity (3-repeat) allele. This is the first result to link attitude towards longshot risks to a specific gene. It complements recent findings on the neurobiological basis of economic risk taking. PMID:20046877

Isolated sulfite oxidase deficiency.

PubMed

Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

1996-12-01

Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

Gene-Gene-Environment Interactions of Serotonin Transporter, Monoamine Oxidase A and Childhood Maltreatment Predict Aggressive Behavior in Chinese Adolescents

PubMed Central

Zhang, Yun; Ming, Qing-sen; Yi, Jin-yao; Wang, Xiang; Chai, Qiao-lian; Yao, Shu-qiao

2017-01-01

Gene-environment interactions that moderate aggressive behavior have been identified independently in the serotonin transporter (5-HTT) gene and monoamine oxidase A gene (MAOA). The aim of the present study was to investigate epistasis interactions between MAOA-variable number tandem repeat (VNTR), 5-HTTlinked polymorphism (LPR) and child abuse and the effects of these on aggressive tendencies in a group of otherwise healthy adolescents. A group of 546 Chinese male adolescents completed the Child Trauma Questionnaire and Youth self-report of the Child Behavior Checklist. Buccal cells were collected for DNA analysis. The effects of childhood abuse, MAOA-VNTR, 5-HTTLPR genotypes and their interactive gene-gene-environmental effects on aggressive behavior were analyzed using a linear regression model. The effect of child maltreatment was significant, and a three-way interaction among MAOA-VNTR, 5-HTTLPR and sexual abuse (SA) relating to aggressive behaviors was identified. Chinese male adolescents with high expression of the MAOA-VNTR allele and 5-HTTLPR “SS” genotype exhibited the highest aggression tendencies with an increase in SA during childhood. The findings reported support aggression being a complex behavior involving the synergistic effects of gene-gene-environment interactions. PMID:28203149

Genetics Home Reference: cytochrome c oxidase deficiency

MedlinePlus

... are caused by mutations in genes found within nuclear DNA; however, in some rare instances, mutations in genes located within mtDNA cause this condition. The genes associated with cytochrome c oxidase deficiency are involved in energy production in mitochondria through a process called oxidative ...

Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee

2014-08-08

Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed duringmore » myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.« less

Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity.

PubMed

Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio

2013-08-01

A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. © 2013 The Authors. Microbiology Open published by John Wiley & Sons Ltd.

Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

PubMed

Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

2015-02-01

Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.

Evolution of cytochrome oxidase, an enzyme older than atmospheric oxygen.

PubMed

Castresana, J; Lübben, M; Saraste, M; Higgins, D G

1994-06-01

Cytochrome oxidase is a key enzyme in aerobic metabolism. All the recorded eubacterial (domain Bacteria) and archaebacterial (Archaea) sequences of subunits 1 and 2 of this protein complex have been used for a comprehensive evolutionary analysis. The phylogenetic trees reveal several processes of gene duplication. Some of these are ancient, having occurred in the common ancestor of Bacteria and Archaea, whereas others have occurred in specific lines of Bacteria. We show that eubacterial quinol oxidase was derived from cytochrome c oxidase in Gram-positive bacteria and that archaebacterial quinol oxidase has an independent origin. A considerable amount of evidence suggests that Proteobacteria (Purple bacteria) acquired quinol oxidase through a lateral gene transfer from Gram-positive bacteria. The prevalent hypothesis that aerobic metabolism arose several times in evolution after oxygenic photosynthesis, is not sustained by two aspects of the molecular data. First, cytochrome oxidase was present in the common ancestor of Archaea and Bacteria whereas oxygenic photosynthesis appeared in Bacteria. Second, an extant cytochrome oxidase in nitrogen-fixing bacteria shows that aerobic metabolism is possible in an environment with a very low level of oxygen, such as the root nodules of leguminous plants. Therefore, we propose that aerobic metabolism in organisms with cytochrome oxidase has a monophyletic and ancient origin, prior to the appearance of eubacterial oxygenic photosynthetic organisms.

Altered gene expression in early postnatal monoamine oxidase A knockout mice.

PubMed

Chen, Kevin; Kardys, Abbey; Chen, Yibu; Flink, Stephen; Tabakoff, Boris; Shih, Jean C

2017-08-15

We reported previously that monoamine oxidase (MAO) A knockout (KO) mice show increased serotonin (5-hydroxytryptamine, 5-HT) levels and autistic-like behaviors characterized by repetitive behaviors, and anti-social behaviors. We showed that administration of the serotonin synthesis inhibitor para-chlorophenylalanine (pCPA) from post-natal day 1 (P1) through 7 (P7) in MAO A KO mice reduced the serotonin level to normal and reverses the repetitive behavior. These results suggested that the altered gene expression at P1 and P7 may be important for the autistic-like behaviors seen in MAO A KO mice and was studied here. In this study, Affymetrix mRNA array data for P1 and P7 MAO A KO mice were analyzed using Partek Genomics Suite and Ingenuity Pathways Analysis to identify genes differentially expressed versus wild-type and assess their functions and relationships. The number of significant differentially expressed genes (DEGs) varied with age: P1 (664) and P7 (3307) [false discovery rate (FDR) <0.05, fold-change (FC) >1.5 for autism-linked genes and >2.0 for functionally categorized genes]. Eight autism-linked genes were differentially expressed in P1 (upregulated: NLGN3, SLC6A2; down-regulated: HTR2C, MET, ADSL, MECP2, ALDH5A1, GRIN3B) while four autism-linked genes were differentially expressed at P7 (upregulated: HTR2B; downregulated: GRIN2D, GRIN2B, CHRNA4). Many other genes involved in neurodevelopment, apoptosis, neurotransmission, and cognitive function were differentially expressed at P7 in MAO A KO mice. This result suggests that modulation of these genes by the increased serotonin may lead to neurodevelopmental alteration in MAO A KO mice and results in autistic-like behaviors. Copyright © 2017 Elsevier B.V. All rights reserved.

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study

PubMed Central

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-01-01

Abstract Background Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Methods Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. Results In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). Conclusions The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study.

PubMed

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-05-01

Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of

Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins.

PubMed

Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo

2003-04-01

We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.

Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose.

PubMed

Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L

2017-03-01

It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

Monoamine oxidase a promoter gene associated with problem behavior in adults with intellectual/developmental disabilities.

PubMed

May, Michael E; Srour, Ali; Hedges, Lora K; Lightfoot, David A; Phillips, John A; Blakely, Randy D; Kennedy, Craig H

2009-07-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a gender, ethnicity, and age-matched contrast sample. About 43% (15/35) of adults with intellectual/developmental disabilities and problem behavior possessed the low-efficiency version of the MAOA gene. In comparison, 20% (7/35) of adults with intellectual/developmental disabilities and no problem behavior and 20% (7/35) of the contrast group had the short-allele MAOA polymorphism. Therefore, a common variant in the MAOA gene may be associated with problem behavior in adults with intellectual/developmental disabilities.

Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

PubMed

Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

2009-01-01

The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.

The Importance of NADPH Oxidases and Redox Signaling in Angiogenesis

PubMed Central

Prieto-Bermejo, Rodrigo; Hernández-Hernández, Angel

2017-01-01

Eukaryotic cells have to cope with the constant generation of reactive oxygen species (ROS). Although the excessive production of ROS might be deleterious for cell biology, there is a plethora of evidence showing that moderate levels of ROS are important for the control of cell signaling and gene expression. The family of the nicotinamide adenine dinucleotide phosphate oxidases (NADPH oxidases or Nox) has evolved to produce ROS in response to different signals; therefore, they fulfil a central role in the control of redox signaling. The role of NADPH oxidases in vascular physiology has been a field of intense study over the last two decades. In this review we will briefly analyze how ROS can regulate signaling and gene expression. We will address the implication of NADPH oxidases and redox signaling in angiogenesis, and finally, the therapeutic possibilities derived from this knowledge will be discussed. PMID:28505091

Associations Between Genetic Variants of NADPH Oxidase-Related Genes and Blood Pressure Responses to Dietary Sodium Intervention: The GenSalt Study.

PubMed

Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng

2017-04-01

The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

PubMed

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

Transcriptome Sequencing Identifies SPL7-Regulated Copper Acquisition Genes FRO4/FRO5 and the Copper Dependence of Iron Homeostasis in Arabidopsis[C][W

PubMed Central

Bernal, María; Casero, David; Singh, Vasantika; Wilson, Grandon T.; Grande, Arne; Yang, Huijun; Dodani, Sheel C.; Pellegrini, Matteo; Huijser, Peter; Connolly, Erin L.; Merchant, Sabeeha S.; Krämer, Ute

2012-01-01

The transition metal copper (Cu) is essential for all living organisms but is toxic when present in excess. To identify Cu deficiency responses comprehensively, we conducted genome-wide sequencing-based transcript profiling of Arabidopsis thaliana wild-type plants and of a mutant defective in the gene encoding SQUAMOSA PROMOTER BINDING PROTEIN-LIKE7 (SPL7), which acts as a transcriptional regulator of Cu deficiency responses. In response to Cu deficiency, FERRIC REDUCTASE OXIDASE5 (FRO5) and FRO4 transcript levels increased strongly, in an SPL7-dependent manner. Biochemical assays and confocal imaging of a Cu-specific fluorophore showed that high-affinity root Cu uptake requires prior FRO5/FRO4-dependent Cu(II)-specific reduction to Cu(I) and SPL7 function. Plant iron (Fe) deficiency markers were activated in Cu-deficient media, in which reduced growth of the spl7 mutant was partially rescued by Fe supplementation. Cultivation in Cu-deficient media caused a defect in root-to-shoot Fe translocation, which was exacerbated in spl7 and associated with a lack of ferroxidase activity. This is consistent with a possible role for a multicopper oxidase in Arabidopsis Fe homeostasis, as previously described in yeast, humans, and green algae. These insights into root Cu uptake and the interaction between Cu and Fe homeostasis will advance plant nutrition, crop breeding, and biogeochemical research. PMID:22374396

Development of recombinant biocatalysts expressing laccase enzyme from Trametes versicolor

USDA-ARS?s Scientific Manuscript database

Increasing demands for sustainable energy necessitate the use of biorenewable sources such as agricultural and forestry wastes. A major challenge of using lignocellulosic biomass for biofuel production is the recalcitrant nature of the lignin structure. Laccase is a multi-copper oxidase that catal...

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Systematic gene deletions evidences that laccases are involved in several stages of wood degradation in the filamentous fungus Podospora anserina.

PubMed

Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël

2014-01-01

Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(Δ), lac8(Δ) and mco(Δ) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(Δ), lac7(Δ), mco(Δ) and lac6(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

PubMed Central

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira

1995-12-18

The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD.more » 7 refs., 2 figs., 1 tab.« less

R1, a novel repressor of the human monoamine oxidase A.

PubMed

Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C

2005-03-25

Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.

A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

PubMed Central

Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

2000-01-01

The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

PubMed

Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

1991-01-01

Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

PubMed

Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

2016-01-01

It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

PubMed Central

2012-01-01

Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

Epistatic interaction between the monoamine oxidase A and serotonin transporter genes in anorexia nervosa.

PubMed

Urwin, Ruth Elizabeth; Nunn, Kenneth Patrick

2005-03-01

The serotonin (5-HT) and norepinephrine (NE) systems are likely involved in the aetiology of anorexia nervosa (AN) as sufferers are premorbidly anxious. Specifically, we hypothesize that genes encoding proteins, which clear 5-HT and NE from the synapse, are prime candidates for affecting susceptibility to AN. Supporting our hypothesis, we earlier showed that the NE transporter (NET) and monoamine oxidase A (MAOA) genes appear to contribute additively to increased risk of developing restricting AN (AN-R). With regard to the MAOA gene, a sequence variant that increases MAOA activity and has suggested association with the anxiety condition, panic disorder was preferentially transmitted from parents to affected children. Here we provide evidence in support of interaction between the MAOA and serotonin transporter (SERT) genes in 114 AN nuclear families (patient with AN plus biological parents). A SERT gene genotype with no apparent individual effect on risk and known to be associated with anxiety is preferentially transmitted to children with AN (chi2 trend=9.457, 1 df, P=0.0021) and AN-R alone (chi2 trend=7.477, 1 df, P=0.0063) when the 'more active' MAOA gene variant is also transmitted. The increased risk of developing the disorder is up to eight times greater than the risk imposed by the MAOA gene variant alone--an example of synergistic epistatic interaction. If independently replicated, our findings to date suggest that we may have identified three genes affecting susceptibility to AN, particularly AN-R: the MAOA, SERT, and NET genes.

Androgen receptor and monoamine oxidase polymorphism in wild bonobos

PubMed Central

Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

2014-01-01

Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

The plant energy-dissipating mitochondrial systems: depicting the genomic structure and the expression profiles of the gene families of uncoupling protein and alternative oxidase in monocots and dicots.

PubMed

Borecky, Jirí; Nogueira, Fábio T S; de Oliveira, Kívia A P; Maia, Ivan G; Vercesi, Aníbal E; Arruda, Paulo

2006-01-01

The simultaneous existence of alternative oxidases and uncoupling proteins in plants has raised the question as to why plants need two energy-dissipating systems with apparently similar physiological functions. A probably complete plant uncoupling protein gene family is described and the expression profiles of this family compared with the multigene family of alternative oxidases in Arabidopsis thaliana and sugarcane (Saccharum sp.) employed as dicot and monocot models, respectively. In total, six uncoupling protein genes, AtPUMP1-6, were recognized within the Arabidopsis genome and five (SsPUMP1-5) in a sugarcane EST database. The recombinant AtPUMP5 protein displayed similar biochemical properties as AtPUMP1. Sugarcane possessed four Arabidopsis AOx1-type orthologues (SsAOx1a-1d); no sugarcane orthologue corresponding to Arabidopsis AOx2-type genes was identified. Phylogenetic and expression analyses suggested that AtAOx1d does not belong to the AOx1-type family but forms a new (AOx3-type) family. Tissue-enriched expression profiling revealed that uncoupling protein genes were expressed more ubiquitously than the alternative oxidase genes. Distinct expression patterns among gene family members were observed between monocots and dicots and during chilling stress. These findings suggest that the members of each energy-dissipating system are subject to different cell or tissue/organ transcriptional regulation. As a result, plants may respond more flexibly to adverse biotic and abiotic conditions, in which oxidative stress is involved.

Recovery of choline oxidase activity by in vitro recombination of individual segments.

PubMed

Heinze, Birgit; Hoven, Nina; O'Connell, Timothy; Maurer, Karl-Heinz; Bartsch, Sebastian; Bornscheuer, Uwe T

2008-11-01

Initial attempts to express a choline oxidase from Arthrobacter pascens (APChO-syn) in Escherichia coli starting from a synthetic gene only led to inactive protein. However, activity was regained by the systematic exchange of individual segments of the gene with segments from a choline oxidase-encoding gene from Arthrobacter globiformis yielding a functional chimeric enzyme. Next, a sequence alignment of the exchanged segment with other choline oxidases revealed a mutation in the APChO-syn, showing that residue 200 was a threonine instead of an asparagine, which is, thus, crucial for confering enzyme activity and, hence, provides an explanation for the initial lack of activity. The active recombinant APChO-syn-T200N variant was biochemically characterized showing an optimum at pH 8.0 and at 37 degrees C. Furthermore, the substrate specificity was examined using N,N-dimethylethanolamine, N-methylethanolamine and 3,3-dimethyl-1-butanol.

Function of the Pyruvate Oxidase-Lactate Oxidase Cascade in Interspecies Competition between Streptococcus oligofermentans and Streptococcus mutans

PubMed Central

Liu, Lei

2012-01-01

Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002

Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

PubMed

Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

2015-12-01

Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

PubMed Central

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.

2010-01-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

PubMed

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

2010-06-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

Potassium and the K+/H+ Exchanger Kha1p Promote Binding of Copper to ApoFet3p Multi-copper Ferroxidase*

PubMed Central

Wu, Xiaobin; Kim, Heejeong; Seravalli, Javier; Barycki, Joseph J.; Hart, P. John; Gohara, David W.; Di Cera, Enrico; Jung, Won Hee; Kosman, Daniel J.; Lee, Jaekwon

2016-01-01

Acquisition and distribution of metal ions support a number of biological processes. Here we show that respiratory growth of and iron acquisition by the yeast Saccharomyces cerevisiae relies on potassium (K+) compartmentalization to the trans-Golgi network via Kha1p, a K+/H+ exchanger. K+ in the trans-Golgi network facilitates binding of copper to the Fet3p multi-copper ferroxidase. The effect of K+ is not dependent on stable binding with Fet3p or alteration of the characteristics of the secretory pathway. The data suggest that K+ acts as a chemical factor in Fet3p maturation, a role similar to that of cations in folding of nucleic acids. Up-regulation of KHA1 gene in response to iron limitation via iron-specific transcription factors indicates that K+ compartmentalization is linked to cellular iron homeostasis. Our study reveals a novel functional role of K+ in the binding of copper to apoFet3p and identifies a K+/H+ exchanger at the secretory pathway as a new molecular factor associated with iron uptake in yeast. PMID:26966178

Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

PubMed Central

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

PubMed Central

Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

2016-01-01

Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

PubMed

De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

2016-08-01

Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

Genetics Home Reference: isolated sulfite oxidase deficiency

MedlinePlus

... Metabolic Disorders (CLIMB) March of Dimes: Amino Acid Metabolism Disorders The Compassionate Friends GeneReviews (1 link) Isolated Sulfite Oxidase Deficiency ClinicalTrials.gov (1 link) ClinicalTrials.gov Scientific Articles on PubMed (1 link) PubMed OMIM (1 link) ...

A Novel (S)-6-Hydroxynicotine Oxidase Gene from Shinella sp. Strain HZN7

PubMed Central

Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong

2014-01-01

Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s−1) and nicotine (Km = 2.03 mM, kcat = 0.396 s−1) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425

Copper Deficiency Leads to Anemia, Duodenal Hypoxia, Upregulation of HIF-2α and Altered Expression of Iron Absorption Genes in Mice

PubMed Central

Matak, Pavle; Zumerle, Sara; Mastrogiannaki, Maria; El Balkhi, Souleiman; Delga, Stephanie; Mathieu, Jacques R. R.; Canonne-Hergaux, François; Poupon, Joel; Sharp, Paul A.; Vaulont, Sophie; Peyssonnaux, Carole

2013-01-01

Iron and copper are essential trace metals, actively absorbed from the proximal gut in a regulated fashion. Depletion of either metal can lead to anemia. In the gut, copper deficiency can affect iron absorption through modulating the activity of hephaestin - a multi-copper oxidase required for optimal iron export from enterocytes. How systemic copper status regulates iron absorption is unknown. Mice were subjected to a nutritional copper deficiency-induced anemia regime from birth and injected with copper sulphate intraperitoneally to correct the anemia. Copper deficiency resulted in anemia, increased duodenal hypoxia and Hypoxia inducible factor 2α (HIF-2α) levels, a regulator of iron absorption. HIF-2α upregulation in copper deficiency appeared to be independent of duodenal iron or copper levels and correlated with the expression of iron transporters (Ferroportin - Fpn, Divalent Metal transporter – Dmt1) and ferric reductase – Dcytb. Alleviation of copper-dependent anemia with intraperitoneal copper injection resulted in down regulation of HIF-2α-regulated iron absorption genes in the gut. Our work identifies HIF-2α as an important regulator of iron transport machinery in copper deficiency. PMID:23555700

Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.

PubMed Central

Clary, D O; Wolstenholme, D R

1983-01-01

Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262

A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis.

PubMed

Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming

2013-05-01

A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

PubMed

Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

2016-04-15

The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.

POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5.

PubMed

Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

2014-01-01

POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5.

High-level expression of the Penicillium notatum glucose oxidase gene in Pichia pastoris using codon optimization.

PubMed

Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei

2012-03-01

The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry.

Exploiting algal NADPH oxidase for biophotovoltaic energy

DOE PAGES

Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; ...

2015-01-29

Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anionmore » production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. Furthermore, the results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices.« less

Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1

PubMed Central

Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.

2001-01-01

It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345

Direct electrochemistry and intramolecular electron transfer of ascorbate oxidase confined on L-cysteine self-assembled gold electrode.

PubMed

Patil, Bhushan; Kobayashi, Yoshiki; Fujikawa, Shigenori; Okajima, Takeyoshi; Mao, Lanqun; Ohsaka, Takeo

2014-02-01

A direct electrochemistry and intramolecular electron transfer of multicopper oxidases are of a great importance for the fabrication of these enzyme-based bioelectrochemical-devices. Ascorbate oxidase from Acremonium sp. (ASOM) has been successfully immobilized via a chemisorptive interaction on the l-cysteine self-assembled monolayer modified gold electrode (cys-SAM/AuE). Thermodynamics and kinetics of adsorption of ASOM on the cys-SAM/AuE were studied using cyclic voltammetry. A well-defined redox wave centered at 166±3mV (vs. Ag│AgCl│KCl(sat.)) was observed in 5.0mM phosphate buffer solution (pH7.0) at the fabricated ASOM electrode, abbreviated as ASOM/cys-SAM/AuE, confirming a direct electrochemistry, i.e., a direct electron transfer (DET) between ASOM and cys-SAM/AuE. The direct electrochemistry of ASOM was further confirmed by taking into account the chemical oxidation of ascorbic acid (AA) by O2 via an intramolecular electron transfer in the ASOM as well as the electrocatalytic oxidation of AA at the ASOM/cys-SAM/AuE. Thermodynamics and kinetics of the adsorption of ASOM on the cys-SAM/AuE have been elaborated along with its direct electron transfer at the modified electrodes on the basis of its intramolecular electron transfer and electrocatalytic activity towards ascorbic acid oxidation and O2 reduction. ASOM saturated surface area was obtained as 2.41×10(-11)molcm(-2) with the apparent adsorption coefficient of 1.63×10(6)Lmol(-1). The ASOM confined on the cys-SAM/AuE possesses its essential enzymatic function. © 2013.

Diversity and Evolutionary History of Iron Metabolism Genes in Diatoms

PubMed Central

Groussman, Ryan D.; Parker, Micaela S.; Armbrust, E. Virginia

2015-01-01

Ferroproteins arose early in Earth’s history, prior to the emergence of oxygenic photosynthesis and the subsequent reduction of bioavailable iron. Today, iron availability limits primary productivity in about 30% of the world’s oceans. Diatoms, responsible for nearly half of oceanic primary production, have evolved molecular strategies for coping with variable iron concentrations. Our understanding of the evolutionary breadth of these strategies has been restricted by the limited number of species for which molecular sequence data is available. To uncover the diversity of strategies marine diatoms employ to meet cellular iron demands, we analyzed 367 newly released marine microbial eukaryotic transcriptomes, which include 47 diatom species. We focused on genes encoding proteins previously identified as having a role in iron management: iron uptake (high-affinity ferric reductase, multi-copper oxidase, and Fe(III) permease); iron storage (ferritin); iron-induced protein substitutions (flavodoxin/ferredoxin, and plastocyanin/cytochrome c6) and defense against reactive oxygen species (superoxide dismutases). Homologs encoding the high-affinity iron uptake system components were detected across the four diatom Classes suggesting an ancient origin for this pathway. Ferritin transcripts were also detected in all Classes, revealing a more widespread utilization of ferritin throughout diatoms than previously recognized. Flavodoxin and plastocyanin transcripts indicate possible alternative redox metal strategies. Predicted localization signals for ferredoxin identify multiple examples of gene transfer from the plastid to the nuclear genome. Transcripts encoding four superoxide dismutase metalloforms were detected, including a putative nickel-coordinating isozyme. Taken together, our results suggest that the majority of iron metabolism genes in diatoms appear to be vertically inherited with functional diversity achieved via possible neofunctionalization of paralogs. This

Y Chromosome Regulation of Autism Susceptibility Genes

DTIC Science & Technology

2009-06-01

with human -like spontaneous mutation. Neuroreport, 2008. 19(7): p. 739-43. 60. Lin, Y.M., et al., Association analysis of monoamine oxidase A gene and...susceptibility genes, including the monoamine oxidase A (MOAA), mediator complex subunit 12 (MED12), homeobox B1 (HOXB1) gastrin-releasing peptide...autism susceptibility genes, the RET proto- oncogene and monoamine oxidase A (MAOA) gene for detail studies. MAOA deaminates monoamines and is involved

A novel (S)-6-hydroxynicotine oxidase gene from Shinella sp. strain HZN7.

PubMed

Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong; Liu, Weiping

2014-09-01

Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s(-1)) and nicotine (Km = 2.03 mM, kcat = 0.396 s(-1)) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.

PubMed

Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D

2017-01-23

The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

Diazonium Functionalisation of Carbon Nanotubes for Specific Orientation of Multicopper Oxidases: Controlling Electron Entry Points and Oxygen Diffusion to the Enzyme.

PubMed

Lalaoui, Noémie; Holzinger, Michael; Le Goff, Alan; Cosnier, Serge

2016-07-18

We report the controlled orientation of bilirubin oxidases (BOD) from Myrothecium verrucaria on multiwalled carbon nanotubes (MWCNTs) functionalised by electrografting of 6-carboxynaphthalenediazonium and 4-(2-aminoethyl)benzenediazonium salts. On negatively charged naphthoate-modified MWCNTs, a high-potential (0.44 V vs. SCE) oxygen reduction electrocatalysis is observed, occurring via the T1 copper centre. On positively charged ammonium-modified MWCNTs, a low-potential (0.15 V) oxygen reduction electrocatalysis is observed, occurring through a partially oxidised state of the T2/T3 trinuclear copper cluster. Finally, chemically modified naphthoate MWCNTs exhibit high bioelectrocatalytic current densities of 3.9 mA cm(-2) under air at gas-diffusion electrode. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The monoamine oxidase A gene promoter repeat and prostate cancer risk.

PubMed

White, Thomas A; Kwon, Erika M; Fu, Rong; Lucas, Jared M; Ostrander, Elaine A; Stanford, Janet L; Nelson, Peter S

2012-11-01

Amine catabolism by monoamine oxidase A (MAOA) contributes to oxidative stress, which plays a role in prostate cancer (PCa) development and progression. An upstream variable-number tandem repeat (uVNTR) in the MAOA promoter influences gene expression and activity, and may thereby affect PCa susceptibility. Caucasian (n = 2,572) men from two population-based case-control studies of PCa were genotyped for the MAOA-VNTR. Logistic regression was used to assess PCa risk in relation to genotype. Common alleles of the MAOA-VNTR were not associated with the relative risk of PCa, nor did the relationship differ by clinical features of the disease. The rare 5-copy variant (frequency: 0.5% in cases; 1.8% in controls), however, was associated with a reduced PCa risk (odds ratio, OR = 0.30, 95% CI 0.13-0.71). A rare polymorphism of the MAOA promoter previously shown to confer low expression was associated with a reduced risk of developing PCa. This novel finding awaits confirmation in other study populations. Copyright © 2012 Wiley Periodicals, Inc.

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

CotA of Bacillus subtilis Is a Copper-Dependent Laccase

PubMed Central

Hullo, Marie-Françoise; Moszer, Ivan; Danchin, Antoine; Martin-Verstraete, Isabelle

2001-01-01

The spore coat protein CotA of Bacillus subtilis displays similarities with multicopper oxidases, including manganese oxidases and laccases. B. subtilis is able to oxidize manganese, but neither CotA nor other sporulation proteins are involved. We demonstrate that CotA is a laccase. Syringaldazine, a specific substrate of laccases, reacted with wild-type spores but not with ΔcotA spores. CotA may participate in the biosynthesis of the brown spore pigment, which appears to be a melanin-like product and to protect against UV light. PMID:11514528

Molecular Characterization of the Oxalate Oxidase Involved in the Response of Barley to the Powdery Mildew Fungus1

PubMed Central

Zhou, Fasong; Zhang, Ziguo; Gregersen, Per L.; Mikkelsen, Jørn D.; de Neergaard, Eigil; Collinge, David B.; Thordal-Christensen, Hans

1998-01-01

Previously we reported that oxalate oxidase activity increases in extracts of barley (Hordeum vulgare) leaves in response to the powdery mildew fungus (Blumeria [syn. Erysiphe] graminis f.sp. hordei) and proposed this as a source of H2O2 during plant-pathogen interactions. In this paper we show that the N terminus of the major pathogen-response oxalate oxidase has a high degree of sequence identity to previously characterized germin-like oxalate oxidases. Two cDNAs were isolated, pHvOxOa, which represents this major enzyme, and pHvOxOb', representing a closely related enzyme. Our data suggest the presence of only two oxalate oxidase genes in the barley genome, i.e. a gene encoding HvOxOa, which possibly exists in several copies, and a single-copy gene encoding HvOxOb. The use of 3′ end gene-specific probes has allowed us to demonstrate that the HvOxOa transcript accumulates to 6 times the level of the HvOxOb transcript in response to the powdery mildew fungus. The transcripts were detected in both compatible and incompatible interactions with a similar accumulation pattern. The oxalate oxidase is found exclusively in the leaf mesophyll, where it is cell wall located. A model for a signal transduction pathway in which oxalate oxidase plays a central role is proposed for the regulation of the hypersensitive response. PMID:9576772

Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

PubMed Central

Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping

2016-01-01

Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

Exercise Training, NADPH Oxidase p22phox Gene Polymorphisms, and Hypertension

PubMed Central

FEAIRHELLER, DEBORAH L.; BROWN, MICHAEL D.; PARK, JOON-YOUNG; BRINKLEY, TINA E.; BASU, SAMAR; HAGBERG, JAMES M.; FERRELL, ROBERT E.; FENTY-STEWART, NICOLA M.

2010-01-01

Introduction Oxidative stress that is mediated through NADPH oxidase activity plays a role in the pathology of hypertension, and aerobic exercise training reduces NADPH oxidase activity. The involvement of genetic variation in the p22phox (CYBA) subunit genes in individual oxidative stress responses to aerobic exercise training has yet to be examined in Pre and Stage 1 hypertensives. Methods Ninety-four sedentary Pre and Stage 1 hypertensive adults underwent 6 months of aerobic exercise training at a level of 70% V̇O2max to determine whether the CYBA polymorphisms, C242T and A640G, were associated with changes in urinary 8-iso-prostaglandin F2α (8-iso-PGF2α), urinary nitric oxide metabolites (NOx), and plasma total antioxidant capacity (TAC). Results Demographic and subject characteristics were similar among genotype groups for both polymorphisms. At baseline, a significant (P = 0.03) difference among the C2424T genotype groups in 8-iso-PGF2α levels was detected, with the TT homozygotes having the lowest levels and the CC homozygotes having the highest levels. However, no differences were found at baseline between the A640G genotype groups. After 6 months of aerobic exercise training, there was a significant increase in V̇O2max (P < 0.0001) in the entire study population. In addition, there were significant increases in both urinary 8-iso-PGF2α (P = 0.002) and plasma TAC (P = 0.03) levels and a significant decrease in endogenous urinary NOx (P < 0.0001). Overall, aerobic exercise training elicited no significant differences among genotype groups in either CYBA variant for any of the oxidative stress variables. Conclusions We found that compared with CYBA polymorphisms C242T and A640G, it was aerobic exercise training that had the greatest influence on the selected biomarkers; furthermore, our results suggest that the C242T CYBA variant influences baseline levels of urinary 8-iso-PGF2α but not the aerobic exercise-induced responses. PMID:19516159

Combination of polymorphic variants in serotonin transporter and monoamine oxidase-A genes may influence the risk for early-onset alcoholism.

PubMed

Bordukalo-Niksic, Tatjana; Stefulj, Jasminka; Matosic, Ana; Mokrovic, Gordana; Cicin-Sain, Lipa

2012-12-30

The combinatory effect of polymorphisms in serotonin transporter and monoamine oxidase-A genes on the aetiopathogenesis of alcoholism was investigated in a sample of 714 individuals. Increased frequency of subjects having three 'suspected' genotypes (5-HTTLPR-LL, STin2-1010 and MAO-A 3-repeat allele) was found among type-2 alcoholic patients (P=0.0189). Results highlight serotonergic/genetic contribution to early-onset alcoholism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Identification of NADPH oxidase family members associated with cold stress in strawberry.

PubMed

Zhang, Yunting; Li, Yali; He, Yuwei; Hu, Wenjie; Zhang, Yong; Wang, Xiaorong; Tang, Haoru

2018-04-01

NADPH oxidase is encoded by a small gene family (Respiratory burst oxidase homologs, Rbohs ) and plays an important role in regulating various biological processes. However, little information about this gene family is currently available for strawberry. In this study, a total of seven Rboh genes were identified from strawberry through genomewide analysis. Gene structure analysis showed the number of exons ranged from 10 to 23, implying that this variation occurred in FvRboh genes by the insertion and distribution of introns; the order and approximate size of exons were relatively conserved. FvRbohC was predicted to localize to the thylakoid membrane of the chloroplast, while other members were computed to localize to the plasma membrane, indicating different functions. Amino acid sequence alignment, conserved domain, and motif analysis showed that all identified FvRbohs had typical features of plant Rbohs. Phylogenetic analysis of Rbohs from strawberry, grape, Arabidopsis, and rice suggested that the FvRbohs could be divided into five subgroups and showed a closer relationship with those from grape and Arabidopsis than those from rice. The expression patterns of FvRboh genes in root, stem, leaf, flower, and fruit revealed robust tissue specificity. The expression levels of FvRbohA and FvRbohD were quickly induced by cold stress, followed by an increase in NADPH oxidase activity, leading to O2- accumulation and triggering the antioxidant reaction by the transient increases in SOD activity. This suggested these two genes may be involved in cold stress and defense responses in strawberry.

Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

PubMed Central

Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

2001-01-01

The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that

Culture-Independent Identification of Manganese-Oxidizing Genes from Deep-Sea Hydrothermal Vent Chemoautotrophic Ferromanganese Microbial Communities Using a Metagenomic Approach

NASA Astrophysics Data System (ADS)

Davis, R.; Tebo, B. M.

2013-12-01

Microbial activity has long been recognized as being important to the fate of manganese (Mn) in hydrothermal systems, yet we know very little about the organisms that catalyze Mn oxidation, the mechanisms by which Mn is oxidized or the physiological function that Mn oxidation serves in these hydrothermal systems. Hydrothermal vents with thick ferromanganese microbial mats and Mn oxide-coated rocks observed throughout the Pacific Ring of Fire are ideal models to study the mechanisms of microbial Mn oxidation, as well as primary productivity in these metal-cycling ecosystems. We sampled ferromanganese microbial mats from Vai Lili Vent Field (Tmax=43°C) located on the Eastern Lau Spreading Center and Mn oxide-encrusted rhyolytic pumice (4°C) from Niua South Seamount on the Tonga Volcanic Arc. Metagenomic libraries were constructed and assembled from these samples and key genes known to be involved in Mn oxidation and carbon fixation pathways were identified in the reconstructed genomes. The Vai Lili metagenome assembled to form 121,157 contiguous sequences (contigs) greater than 1000bp in length, with an N50 of 8,261bp and a total metagenome size of 593 Mbp. Contigs were binned using an emergent self-organizing map of tetranucleotide frequencies. Putative homologs of the multicopper Mn-oxidase MnxG were found in the metagenome that were related to both the Pseudomonas-like and Bacillus-like forms of the enzyme. The bins containing the Pseudomonas-like mnxG genes are most closely related to uncultured Deltaproteobacteria and Chloroflexi. The Deltaproteobacteria bin appears to be an obligate anaerobe with possible chemoautotrophic metabolisms, while the Chloroflexi appears to be a heterotrophic organism. The metagenome from the Mn-stained pumice was assembled into 122,092 contigs greater than 1000bp in length with an N50 of 7635 and a metagenome size of 385 Mbp. Both forms of mnxG genes are present in this metagenome as well as the genes encoding the putative Mn

Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brunner, H.G.; Nelen, M.; Ropers, H.H.

1993-10-22

Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated completemore » MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.« less

Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.

PubMed

Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu

2015-02-01

To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.

Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1

PubMed Central

Frisse, Andrea; Pimenta, Maria João; Lange, Theo

2003-01-01

Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

PubMed Central

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

PubMed

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

Transcript Profiling Reveals the Presence of Abiotic Stress and Developmental Stage Specific Ascorbate Oxidase Genes in Plants

PubMed Central

Batth, Rituraj; Singh, Kapil; Kumari, Sumita; Mustafiz, Ananda

2017-01-01

Abiotic stress and climate change is the major concern for plant growth and crop yield. Abiotic stresses lead to enhanced accumulation of reactive oxygen species (ROS) consequently resulting in cellular damage and major losses in crop yield. One of the major scavengers of ROS is ascorbate (AA) which acts as first line of defense against external oxidants. An enzyme named ascorbate oxidase (AAO) is known to oxidize AA and deleteriously affect the plant system in response to stress. Genome-wide analysis of AAO gene family has led to the identification of five, three, seven, four, and six AAO genes in Oryza sativa, Arabidopsis, Glycine max, Zea mays, and Sorghum bicolor genomes, respectively. Expression profiling of these genes was carried out in response to various abiotic stresses and during various stages of vegetative and reproductive development using publicly available microarray database. Expression analysis in Oryza sativa revealed tissue specific expression of AAO genes wherein few members were exclusively expressed in either root or shoot. These genes were found to be regulated by both developmental cues as well as diverse stress conditions. The qRT-PCR analysis in response to salinity and drought stress in rice shoots revealed OsAAO2 to be the most stress responsive gene. On the other hand, OsAAO3 and OsAAO4 genes showed enhanced expression in roots under salinity/drought stresses. This study provides lead about important stress responsive AAO genes in various crop plants, which could be used to engineer climate resilient crop plants. PMID:28261251

Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds1

PubMed Central

González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.

2004-01-01

The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034

Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

PubMed

Wang, Wei; Liu, Ji-Hong

2015-01-25

Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. Copyright © 2014 Elsevier B.V. All rights reserved.

NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys

PubMed Central

Peck, Ammon B.; Khan, Saeed R.

2013-01-01

A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917

Genetic Dissection of Nutritional Copper Signaling in Chlamydomonas Distinguishes Regulatory and Target Genes

PubMed Central

Eriksson, Mats; Moseley, Jeffrey L.; Tottey, Stephen; del Campo, Jose A.; Quinn, Jeanette; Kim, Youngbae; Merchant, Sabeeha

2004-01-01

A genetic screen for Chlamydomonas reinhardtii mutants with copper-dependent growth or nonphotosynthetic phenotypes revealed three loci, COPPER RESPONSE REGULATOR 1 (CRR1), COPPER RESPONSE DEFECT 1 (CRD1), and COPPER RESPONSE DEFECT 2 (CRD2), distinguished as regulatory or target genes on the basis of phenotype. CRR1 was shown previously to be required for transcriptional activation of target genes like CYC6, CPX1, and CRD1, encoding, respectively, cytochrome c6 (which is a heme-containing substitute for copper-containing plastocyanin), coproporphyrinogen III oxidase, and Mg-protoporphyrin IX monomethylester cyclase. We show here that CRR1 is required also for normal accumulation of copper proteins like plastocyanin and ferroxidase in copper-replete medium and for apoplastocyanin degradation in copper-deficient medium, indicating that a single pathway controls nutritional copper homeostasis at multiple levels. CRR1 is linked to the SUPPRESSOR OF PCY1-AC208 13 (SOP13) locus, which corresponds to a gain-of-function mutation resulting in copper-independent expression of CYC6. CRR1 is required also for hypoxic growth, pointing to a physiologically meaningful regulatory connection between copper deficiency and hypoxia. The growth phenotype of crr1 strains results primarily from secondary iron deficiency owing to reduced ferroxidase abundance, suggesting a role for CRR1 in copper distribution to a multicopper ferroxidase involved in iron assimilation. Mutations at the CRD2 locus also result in copper-conditional iron deficiency, which is consistent with a function for CRD2 in a pathway for copper delivery to the ferroxidase. Taken together, the observations argue for a specialized copper-deficiency adaptation for iron uptake in Chlamydomonas. PMID:15514054

RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.

PubMed

Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

2014-06-19

The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

Distribution in microbial genomes of genes similar to lodA and goxA which encode a novel family of quinoproteins with amino acid oxidase activity.

PubMed

Campillo-Brocal, Jonatan C; Chacón-Verdú, María Dolores; Lucas-Elío, Patricia; Sánchez-Amat, Antonio

2015-03-24

L-Amino acid oxidases (LAOs) have been generally described as flavoproteins that oxidize amino acids releasing the corresponding ketoacid, ammonium and hydrogen peroxide. The generation of hydrogen peroxide gives to these enzymes antimicrobial characteristics. They are involved in processes such as biofilm development and microbial competition. LAOs are of great biotechnological interest in different applications such as the design of biosensors, biotransformations and biomedicine. The marine bacterium Marinomonas mediterranea synthesizes LodA, the first known LAO that contains a quinone cofactor. LodA is encoded in an operon that contains a second gene coding for LodB, a protein required for the post-translational modification generating the cofactor. Recently, GoxA, a quinoprotein with sequence similarity to LodA but with a different enzymatic activity (glycine oxidase instead of lysine-ε-oxidase) has been described. The aim of this work has been to study the distribution of genes similar to lodA and/or goxA in sequenced microbial genomes and to get insight into the evolution of this novel family of proteins through phylogenetic analysis. Genes encoding LodA-like proteins have been detected in several bacterial classes. However, they are absent in Archaea and detected only in a small group of fungi of the class Agaromycetes. The vast majority of the genes detected are in a genome region with a nearby lodB-like gene suggesting a specific interaction between both partner proteins. Sequence alignment of the LodA-like proteins allowed the detection of several conserved residues. All of them showed a Cys and a Trp that aligned with the residues that are forming part of the cysteine tryptophilquinone (CTQ) cofactor in LodA. Phylogenetic analysis revealed that LodA-like proteins can be clustered in different groups. Interestingly, LodA and GoxA are in different groups, indicating that those groups are related to the enzymatic activity of the proteins detected. Genome

Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*

PubMed Central

Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun

2010-01-01

Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

[Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidase Ⅱ gene variations and the risk of noise-induced hearing loss].

PubMed

Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

2017-01-06

Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

PubMed

Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

2015-03-01

Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

PubMed Central

Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

2015-01-01

Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression.

PubMed

Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

2015-01-01

Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression.

Surface Characterization and Direct Bioelectrocatalysis of Multicopper Oxidases (POSTPRINT)

DTIC Science & Technology

2010-01-01

4620. [29] M. Tarasevich, V. Bogdanovskaya, A. Kapustin, Electrochem. Commun. 5 (2003) 491. [30] S. Tsujimura , Y. Kamitaka, K. Kano, Fuel Cells 7 (2007...463. [31] S. Tsujimura , K. Kano, T. Ikeda, J. Electroanal. Chem. 576 (2005) 113. [32] S. Varfolomeev, I. Kurochkin, A. Yaropolov, Biosens...L. Rulisek, E. Solomon, U. Ryde, Inorg. Chem. 44 (2005) 5612. [42] S. Tsujimura , H. Tatsumi, J. Ogawa, S. Shimizu, K. Kano, T. Ikeda, J. Electroanal

[Molecular identification of human Diphyllobothrium nihonkaiense using mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequence].

PubMed

Ono, Sayaka; Morimoto, Norihito; Korenaga, Masataka; Kumazawa, Hideo; Komatsu, Yutaka; Kuge, Itsu; Higashidani, Yoshihumi; Ogura, Katsumi; Sugiura, Tetsuro

2010-11-01

Identification of Diphyllobothrium species has been carried out based on their morphology, especially sexual organs. In addition to these criteria, PCR-based identification methods have been developed recently. A 20 year-old Japanese living in Kochi Prefecture passed tapeworm. He was successfully treated with single dose of gastrografin. We examined the morphologic features of the proglottids and eggs using histology and scanning electron microscope. We also analyzed mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the proglottids. The causative tapeworm species was identified as D. nihonkaiense based on the results of morphologic features and genetic analysis. We discussed the advantage of PCR-based identification methods of Diphyllobothrium species using cox1 sequence in the clinical laboratory.

Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.

PubMed

Haruta, M; Murata, M; Kadokura, H; Homma, S

1999-03-01

An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.

Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

PubMed

Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

2014-01-01

Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.

Transcriptional and posttranscriptional regulation of the glycolate oxidase gene in tobacco seedlings.

PubMed

Barak, S; Nejidat, A; Heimer, Y; Volokita, M

2001-03-01

The roles of light and of the putative plastid signal in glycolate oxidase (GLO) gene expression were investigated in tobacco (Nicotiana tabacum cv. Samsun NN) seedlings during their shift from skotomorphogenic to photomorphogenic development. GLO transcript and enzyme activities were detected in etiolated seedlings. Their respective levels increased three- and six-fold during 96 h of exposure to light. The GLO transcript was almost undetectable in seedlings in which chloroplast development was impaired by photooxidation with the herbicide norflurazon. In transgenic tobacco seedlings, photooxidation inhibited the light-dependent increase in GUS activity when it was placed under the regulation of the GLO promoter P(GLO). However, even under these photooxidative conditions, a continuous increase in GUS activity was observed as compared to etiolated seedlings. When GUS expression was driven by the CaMV 35S promoter (P35S), no apparent difference was observed between etiolated, deetiolated and photooxidized seedlings. These observations indicate that the effects of the putative plastid development signal and light on GUS expression can be separated. Translational yield analysis indicated that the translation of the GUS transcript in P(GLO)::GUS seedlings was enhanced 30-fold over that of the GUS transcript in P35S::GUS seedlings. The overall picture emerging from these results is that in etiolated seedlings GLO transcript, though present at a substantial level, is translated at a low rate. Increased GLO transcription is enhanced, however, in response to signals originating from the developing plastids. GLO gene expression is further enhanced at the translational level by a yet undefined light-dependent mechanism.

The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

PubMed Central

Buades-Rotger, Macià; Gallardo-Pujol, David

2014-01-01

Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

Molecular-clinical correlation in a family with a novel heteroplasmic Leigh syndrome missense mutation in the mitochondrial cytochrome c oxidase III gene.

PubMed

Mkaouar-Rebai, Emna; Ellouze, Emna; Chamkha, Imen; Kammoun, Fatma; Triki, Chahnez; Fakhfakh, Faiza

2011-01-01

Cytochrome c oxidase is an essential component of the mitochondrial respiratory chain that catalyzes the reduction of molecular oxygen by reduced cytochrome c. In this study, the authors report the second mutation associated with Leigh syndrome in the blood and buccal mucosa of 2 affected members of a Tunisian family. It was a novel heteroplasmic missense mitochondrial mutation at nucleotide 9478 in the gene specifying subunit III of cytochrome c oxidase substituting the valine at position 91 to alanine in a highly conserved amino acid. It was found with a high mutant load in tissues derived from endoderm (buccal mucosa) and mesoderm (blood). However, it was nearly absent in tissue derived from ectoderm (hair follicles). It was absent in 120 healthy controls, and PolyPhen analysis showed that the hydropathy index changed from +1.276 to +0.242, and the number of structures of the 3D protein decreased from 39 to 32.

Identification and biochemical characterization of polyamine oxidases in amphioxus: Implications for emergence of vertebrate-specific spermine and acetylpolyamine oxidases.

PubMed

Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui

2016-01-10

Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. Copyright © 2015 Elsevier B.V. All rights reserved.

Purification and properties of two terminal oxidase complexes of Escherichia coli aerobic respiratory chain.

PubMed

Kita, K; Konishi, K; Anraku, Y

1986-01-01

Two terminal oxidase complexes, cytochrome b-562-o complex and cytochrome b-558-d complex, are isolated in highly purified forms which show ubiquinol oxidase activities. From the result of steady-state kinetics of cytochromes in the membrane and E'm values of purified cytochromes, we propose a branched arrangement of the late exponential phase of aerobic growth, as shown in Fig. 10. Cytochrome b-556 is reduced by several dehydrogenases and the gene for this cytochrome (cybA) is located in the sdh gene cluster. Recently, we found another low-potential b-type cytochrome, cytochrome b-561 (Em' = 20 mV), which is also reduced by dehydrogenases. The position of this new cytochrome in the aerobic respiratory chain is under investigation. Two terminal oxidase complexes branch at the site of ubiquinone-8, and the Km value for oxygen of the purified cytochrome b-558-d complex is about 8-fold lower than that of the purified cytochrome b-562-o complex when ubiquinol-1 is used as substrate. This result is consistent with the idea that the cytochrome b-558-d complex is synthesized as an alternative oxidase for more efficient utilization of oxygen at low oxygen concentration. Thus, E. coli cells can maintain efficient oxidative energy conservation over a wide range of oxygen pressures by simply changing the contents of the two terminal oxidases, each of which functions as a coupling site.

Isolation, Oxygen Sensitivity, and Virulence of NADH Oxidase Mutants of the Anaerobic Spirochete Brachyspira (Serpulina) hyodysenteriae, Etiologic Agent of Swine Dysentery

PubMed Central

Stanton, Thad B.; Rosey, Everett L.; Kennedy, Michael J.; Jensen, Neil S.; Bosworth, Brad T.

1999-01-01

Brachyspira (Serpulina) hyodysenteriae, the etiologic agent of swine dysentery, uses the enzyme NADH oxidase to consume oxygen. To investigate possible roles for NADH oxidase in the growth and virulence of this anaerobic spirochete, mutant strains deficient in oxidase activity were isolated and characterized. The cloned NADH oxidase gene (nox; GenBank accession no. U19610) on plasmid pER218 was inactivated by replacing 321 bp of coding sequence with either a gene for chloramphenicol resistance (cat) or a gene for kanamycin resistance (kan). The resulting plasmids, respectively, pCmΔNOX and pKmΔNOX, were used to transform wild-type B. hyodysenteriae B204 cells and generate the antibiotic-resistant strains Nox-Cm and Nox-Km. PCR and Southern hybridization analyses indicated that the chromosomal wild-type nox genes in these strains had been replaced, through allelic exchange, by the inactivated nox gene containing cat or kan. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western immunoblot analysis revealed that both nox mutant cell lysates were missing the 48-kDa Nox protein. Soluble NADH oxidase activity levels in cell lysates of Nox-Cm and Nox-Km were reduced 92 to 96% compared to the activity level in parent strain B204. In an aerotolerance test, cells of both nox mutants were at least 100-fold more sensitive to oxygen exposure than were cells of the wild-type parent strain B204. In swine experimental infections, both nox mutants were less virulent than strain B204 in that fewer animals were colonized by the mutant cells and infected animals displayed mild, transient signs of disease, with no deaths. These results provide evidence that NADH oxidase serves to protect B. hyodysenteriae cells against oxygen toxicity and that the enzyme, in that role, contributes to the pathogenic ability of the spirochete. PMID:10543819

Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

PubMed

Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

2016-11-05

As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.

The coxBAC Operon Encodes a Cytochrome c Oxidase Required for Heterotrophic Growth in the Cyanobacterium Anabaena variabilis Strain ATCC 29413

PubMed Central

Schmetterer, Georg; Valladares, Ana; Pils, Dietmar; Steinbach, Susanne; Pacher, Margit; Muro-Pastor, Alicia M.; Flores, Enrique; Herrero, Antonia

2001-01-01

Three genes, coxB, coxA, and coxC, found in a clone from a gene library of the cyanobacterium Anabaena variabilis strain ATCC 29413, were identified by hybridization with an oligonucleotide specific for aa3-type cytochrome c oxidases. Deletion of these genes from the genome of A. variabilis strain ATCC 29413 FD yielded strain CSW1, which displayed no chemoheterotrophic growth and an impaired cytochrome c oxidase activity. Photoautotrophic growth of CSW1, however, was unchanged, even with dinitrogen as the nitrogen source. A higher cytochrome c oxidase activity was detected in membrane preparations from dinitrogen-grown CSW1 than from nitrate-grown CSW1, but comparable activities of respiratory oxygen uptake were found in the wild type and in CSW1. Our data indicate that the identified cox gene cluster is essential for fructose-dependent growth in the dark, but not for growth on dinitrogen, and that other terminal respiratory oxidases are expressed in this cyanobacterium. Transcription analysis showed that coxBAC constitutes an operon which is expressed from two transcriptional start points. The use of one of them was stimulated by fructose. PMID:11591688

A DNA microarray for identification of selected Korean birds based on mitochondrial cytochrome c oxidase I gene sequences.

PubMed

Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae

2010-10-01

DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.

Monoamine oxidase-A polymorphisms might modify the association between the dopamine D2 receptor gene and alcohol dependence.

PubMed

Huang, San-Yuan; Lin, Wei-Wen; Wan, Fang-Jung; Chang, Ai-Ju; Ko, Huei-Chen; Wang, Tso-Jen; Wu, Pei-Lin; Lu, Ru-Band

2007-05-01

Low monoamine oxidase (MAO) activity and the neurotransmitter dopamine are 2 important factors in the development of alcohol dependence. MAO is an important enzyme associated with the metabolism of biogenic amines. Therefore, the present study investigates whether the association between the dopamine D2 receptor (DRD2) gene and alcoholism is affected by different polymorphisms of the MAO type A (MAOA) gene. A total of 427 Han Chinese men in Taiwan (201 control subjects and 226 with alcoholism) were recruited for the study. Of the subjects with alcoholism, 108 had pure alcohol dependence (ALC) and 118 had both alcohol dependence and anxiety, depression or both (ANX/DEP ALC). All subjects were assessed with the Chinese Version of the Modified Schedule of Affective Disorders and Schizophrenia-Lifetime. Alcohol dependence, anxiety and major depressive disorders were diagnosed according to Diagnostic and Statistical Manual of Mental Disorders, fourth edition criteria. The genetic variant of the DRD2 gene was only associated with the ANX/DEP ALC phenotype, and the genetic variant of the MAOA gene was associated with pure ALC. Subjects carrying the MAOA 3-repeat allele and genotype A1/A1 of the DRD2 were 3.48 times (95% confidence interval = 1.47-8.25) more likely to be ANX/DEP ALC than the subjects carrying the MAOA 3-repeat allele and DRD2 A2/A2 genotype. The MAOA gene may modify the association between the DRD2 gene and ANX/DEP ALC phenotype.

Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.

PubMed

Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine

2017-08-01

Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.

A promoter polymorphism in the monoamine oxidase A gene is associated with the pineal MAOA activity in Alzheimer's disease patients.

PubMed

Wu, Ying-Hui; Fischer, David F; Swaab, Dick F

2007-09-05

Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

PubMed

Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

1995-07-03

The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

Increase in expression of brain serotonin transporter and monoamine oxidase a genes induced by repeated experience of social defeats in male mice.

PubMed

Filipenko, M L; Beilina, A G; Alekseyenko, O V; Dolgov, V V; Kudryavtseva, N N

2002-04-01

Serotonin transporter and monoamine oxidase (MAO) A are involved in the inactivation of serotonin. The former is responsible for serotonin re-uptake from the synapse, whereas the latter catalyzes serotonin deamination in presynaptic terminals. Expression of serotonin transporter and MAO A genes was investigated in raphe nuclei of midbrain of CBA/Lac male mice with repeated experience of social victories or defeats in 10 daily aggressive confrontations. The amount of cDNA of these genes was evaluated using multiplex RT-PCR. Two independent experiments revealed that the defeated mice were characterized by significantly higher levels of serotonin transporter and MAO A mRNAs than the control and aggressive animals. Increased expression of MAO A and serotonin transporter genes is suggested to reflect the accelerated serotonin degradation in response to activation of the serotonergic system functioning induced by social stress. Significant positive correlation between MAO A and serotonin transporter mRNA levels suggests common pathways of regulation of transcriptional activity of these genes.

Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

PubMed

Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

2012-01-01

The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

Involvement of alternative oxidase in the regulation of sensitivity of Sclerotinia sclerotiorum to the fungicides azoxystrobin and procymidone.

PubMed

Xu, Ting; Wang, Ya-Ting; Liang, Wu-Sheng; Yao, Fei; Li, Yong-Hong; Li, Dian-Rong; Wang, Hao; Wang, Zheng-Yi

2013-06-01

Sclerotinia sclerotiorum is a filamentous fungal pathogen that can infect many economically important crops and vegetables. Alternative oxidase is the terminal oxidase of the alternative respiratory pathway in fungal mitochondria. The function of alternative oxidase was investigated in the regulation of sensitivity of S. sclerotiorum to two commercial fungicides, azoxystrobin and procymidone which have different fungitoxic mechanisms. Two isolates of S. sclerotiorum were sensitive to both fungicides. Application of salicylhydroxamic acid, a specific inhibitor of alternative oxidase, significantly increased the values of effective concentration causing 50% mycelial growth inhibition (EC50) of azoxystrobin to both S. sclerotiorum isolates, whereas notably decreased the EC50 values of procymidone. In mycelial respiration assay azoxystrobin displayed immediate inhibitory effect on cytochrome pathway capacity, but had no immediate effect on alternative pathway capacity. In contrast, procymidone showed no immediate impact on capacities of both cytochrome and alternative pathways in the mycelia. However, alternative oxidase encoding gene (aox) transcript and protein levels, alternative respiration pathway capacity of the mycelia were obviously increased by pre-treatment for 24 h with both azoxystrobin and procymidone. These results indicate that alternative oxidase was involved in the regulation of sensitivity of S. sclerotiorum to the fungicides azoxystrobin and procymidone, and that both fungicides could affect aox gene expression and the alternative respiration pathway capacity development in mycelia of this fungal pathogen.

Analysis of promoter polymorphism in monoamine oxidase A (MAOA) gene in completed suicide on Slovenian population.

PubMed

Uršič, Katarina; Zupanc, Tomaž; Paska, Alja Videtič

2018-04-23

Suicide is a well-defined public health problem and is a complex phenomenon influenced by a number of different risk factors, including genetic ones. Numerous studies have examined serotonin system genes. Monoamine oxidase A (MAO-A) is an outer mitochondrial membrane enzyme which is involved in the metabolic pathway of serotonin degradation. Upstream variable number of tandem repeats (uVNTR) in the promoter region of MAOA gene affects the activity of transcription. In the present study we genotyped MAOA-uVNTR polymorphism in 266 suicide victims and 191 control subjects of Slovenian population, which ranks among the European and world populations with the highest suicide rate. Genotyping was performed with polymerase chain reaction and agarose gel electrophoresis. Using a separate statistical analysis for female and male subjects we determined the differences in genotype distributions of MAOA-uVNTR polymorphism between the studied groups. Statistical analysis showed a trend towards 3R allele and suicide, and associated 3R allele with non-violent suicide method on stratified data (20 suicide victims). This is the first study associating highly suicidal Slovenian population with MAOA-uVNTR polymorphism. Copyright © 2018 Elsevier B.V. All rights reserved.

NADPH oxidases in the arbuscular mycorrhizal symbiosis.

PubMed

Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

2016-01-01

Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules.

NADPH oxidases in the arbuscular mycorrhizal symbiosis

PubMed Central

Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

2016-01-01

ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

PubMed

Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

2015-09-01

Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

The dual oxidase gene BdDuox regulates the intestinal bacterial community homeostasis of Bactrocera dorsalis

PubMed Central

Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu

2016-01-01

The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723

Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

Treesearch

Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

2004-01-01

Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.

PubMed

Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver

2011-07-20

Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.

Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population.

PubMed

Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi

2012-01-01

Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.

Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.

PubMed

Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori

2017-11-01

Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

PubMed

Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

2000-06-01

Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

PubMed

Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

2015-09-01

Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.

NADPH Oxidase-Dependent Signaling in Endothelial Cells: Role in Physiology and Pathophysiology

PubMed Central

Ushio-Fukai, Masuko; Malik, Asrar B.

2009-01-01

Abstract Reactive oxygen species (ROS) including superoxide (O2·−) and hydrogen peroxide (H2O2) are produced endogenously in response to cytokines, growth factors; G-protein coupled receptors, and shear stress in endothelial cells (ECs). ROS function as signaling molecules to mediate various biological responses such as gene expression, cell proliferation, migration, angiogenesis, apoptosis, and senescence in ECs. Signal transduction activated by ROS, “oxidant signaling,” has received intense investigation. Excess amount of ROS contribute to various pathophysiologies, including endothelial dysfunction, atherosclerosis, hypertension, diabetes, and acute respiratory distress syndrome (ARDS). The major source of ROS in EC is a NADPH oxidase. The prototype phagaocytic NADPH oxidase is composed of membrane-bound gp91phox and p22hox, as well as cytosolic subunits such as p47phox, p67phox and small GTPase Rac. In ECs, in addition to all the components of phagocytic NADPH oxidases, homologues of gp91phox (Nox2) including Nox1, Nox4, and Nox5 are expressed. The aim of this review is to provide an overview of the emerging area of ROS derived from NADPH oxidase and oxidant signaling in ECs linked to physiological and pathophysiological functions. Understanding these mechanisms may provide insight into the NADPH oxidase and oxidant signaling components as potential therapeutic targets. Antioxid. Redox Signal. 11, 791–810. PMID:18783313

Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

PubMed

Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

2014-01-01

A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

Comparative in Silico Analysis of Ferric Reduction Oxidase (FRO) Genes Expression Patterns in Response to Abiotic Stresses, Metal and Hormone Applications.

PubMed

Muhammad, Izhar; Jing, Xiu-Qing; Shalmani, Abdullah; Ali, Muhammad; Yi, Shi; Gan, Peng-Fei; Li, Wen-Qiang; Liu, Wen-Ting; Chen, Kun-Ming

2018-05-12

The ferric reduction oxidase (FRO) gene family is involved in various biological processes widely found in plants and may play an essential role in metal homeostasis, tolerance and intricate signaling networks in response to a number of abiotic stresses. Our study describes the identification, characterization and evolutionary relationships of FRO genes families. Here, total 50 FRO genes in Plantae and 15 ‘FRO like’ genes in non-Plantae were retrieved from 16 different species. The entire FRO genes have been divided into seven clades according to close similarity in biological and functional behavior. Three conserved domains were common in FRO genes while in two FROs sub genome have an extra NADPH-Ox domain, separating the function of plant FROs. OsFRO1 and OsFRO7 genes were expressed constitutively in rice plant. Real-time RT-PCR analysis demonstrated that the expression of OsFRO1 was high in flag leaf, and OsFRO7 gene expression was maximum in leaf blade and flag leaf. Both genes showed vigorous expressions level in response to different abiotic and hormones treatments. Moreover, the expression of both genes was also substantial under heavy metal stresses. OsFRO1 gene expression was triggered following 6 h under Zn, Pb, Co and Ni treatments, whereas OsFRO7 gene expression under Fe, Pb and Ni after 12 h, Zn and Cr after 6 h, and Mn and Co after 3 h treatments. These findings suggest the possible involvement of both the genes under abiotic and metal stress and the regulation of phytohormones. Therefore, our current work may provide the foundation for further functional characterization of rice FRO genes family.

Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

PubMed Central

Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry

2015-01-01

Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes

Treesearch

Phil Kersten; Dan Cullen

2014-01-01

Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...

Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases

PubMed Central

Giacomelli, Lisa

2013-01-01

Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

Discovery and Characterization of a 5-Hydroxymethylfurfural Oxidase from Methylovorus sp. Strain MP688

PubMed Central

Dijkman, Willem P.

2014-01-01

In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187

Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes.

PubMed

Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E

1992-01-01

Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

Combined sequence and structure analysis of the fungal laccase family.

PubMed

Kumar, S V Suresh; Phale, Prashant S; Durani, S; Wangikar, Pramod P

2003-08-20

Plant and fungal laccases belong to the family of multi-copper oxidases and show much broader substrate specificity than other members of the family. Laccases have consequently been of interest for potential industrial applications. We have analyzed the essential sequence features of fungal laccases based on multiple sequence alignments of more than 100 laccases. This has resulted in identification of a set of four ungapped sequence regions, L1-L4, as the overall signature sequences that can be used to identify the laccases, distinguishing them within the broader class of multi-copper oxidases. The 12 amino acid residues in the enzymes serving as the copper ligands are housed within these four identified conserved regions, of which L2 and L4 conform to the earlier reported copper signature sequences of multi-copper oxidases while L1 and L3 are distinctive to the laccases. The mapping of regions L1-L4 on to the three-dimensional structure of the Coprinus cinerius laccase indicates that many of the non-copper-ligating residues of the conserved regions could be critical in maintaining a specific, more or less C-2 symmetric, protein conformational motif characterizing the active site apparatus of the enzymes. The observed intraprotein homologies between L1 and L3 and between L2 and L4 at both the structure and the sequence levels suggest that the quasi C-2 symmetric active site conformational motif may have arisen from a structural duplication event that neither the sequence homology analysis nor the structure homology analysis alone would have unraveled. Although the sequence and structure homology is not detectable in the rest of the protein, the relative orientation of region L1 with L2 is similar to that of L3 with L4. The structure duplication of first-shell and second-shell residues has become cryptic because the intraprotein sequence homology noticeable for a given laccase becomes significant only after comparing the conservation pattern in several fungal

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Yun-Ling; Li, Li; Wu, Keqiang

1995-07-03

The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6

Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis

PubMed Central

Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

2015-01-01

Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822

NADPH oxidase inhibitors: a patent review.

PubMed

Kim, Jung-Ae; Neupane, Ganesh Prasad; Lee, Eung Seok; Jeong, Byeong-Seon; Park, Byung Chul; Thapa, Pritam

2011-08-01

NADPH oxidases, a family of multi-subunit enzyme complexes, catalyze the production of reactive oxygen species (ROS), which may contribute to the pathogenesis of a variety of diseases. In addition to the first NADPH oxidase found in phagocytes, four non-phagocytic NADPH oxidase isoforms have been identified, which all differ in their catalytic subunit (Nox1-5) and tissue distribution. This paper provides a comprehensive review of the patent literature on NADPH oxidase inhibitors, small molecule Nox inhibitors, peptides and siRNAs. Since each member of the NADPH oxidase family has great potential as a therapeutic target, several different compounds have been registered as NADPH oxidase inhibitors in the patent literature. As yet, none have gone through clinical trials, and some have not completed preclinical trials, including safety and specificity evaluation. Recently, small molecule pyrazolopyridine and triazolopyrimidine derivatives have been submitted as potent NADPH oxidase inhibitors and reported as first-in-class inhibitors for idiopathic pulmonary fibrosis and acute stroke, respectively. Further clinical efficacy and safety data are warranted to prove their actual clinical utility.

Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

PubMed Central

Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

2015-01-01

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates

Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

PubMed

Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

2015-01-01

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates

Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs.

PubMed

Chi, Ming; Bhagwat, Basdeo; Lane, W David; Tang, Guiliang; Su, Yinquan; Sun, Runcang; Oomah, B Dave; Wiersma, Paul A; Xiang, Yu

2014-03-11

Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. StuPPO1 to StuPPO4 genes contributed to browning

[Relationship between the Fnu4HI site polymorphism of monoamine oxidase A gene and Parkinson's disease].

PubMed

Jiang, Xiao-hua; Yang, Hui; Yang, Jing-fang; Dong, Xiu-min; Xu, Qun-yuan; Chen, Biao

2003-06-01

To study the association between the polymorphism of human monoamine oxidase type A (MAO-A) gene and Parkinson's disease(PD). Fnu4HI restriction fragment length polymorphism(RFLP) and PCR-RFLP were used to detect the mutation of MAO-A gene. The frequencies of alleles and genotypes at the MAO-A Fnu4HI locus on the X chromosome in different PD group were compared with those of the control group. It was found that the frequencies of G allele in the patients with PD and controls were 0.613 and 0.527 respectively, P=0.039 "the frequencies of TT genotype were 0.303 and 0.415(P=0.014), and the frequencies of GG genotype were 0.564 and 0.451 respectively(P=0.021). When the patients were divided into two groups by age-onset, significant difference in the allelic and genotypic frequencies was observed only between early-onset PD group and control group. And when the PD patients were grouped by sex, significant difference was observed only between male PD group and male control group (the frequencies of G allele being 0.669 and 0.500 respectively, P=0.005). This study revealed significant differences between PD group and control group in allelic and genotypic frequencies. The findings supported the hypothesis about an association between MAO-A gene and PD, suggesting that age at onset of PD and gender predisposition might be related to the putative association, and Fnu4HI SNP be a risk factor for PD.

The wheat cytochrome oxidase subunit II gene has an intron insert and three radical amino acid changes relative to maize

PubMed Central

Bonen, Linda; Boer, Poppo H.; Gray, Michael W.

1984-01-01

We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565

Characterization of three bioenergetically active respiratory terminal oxidases in the cyanobacterium Synechocystis sp. strain PCC 6803.

PubMed

Pils, D; Schmetterer, G

2001-09-25

Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene

PubMed Central

Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip

2017-01-01

The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281

[Involvement of hydrogen peroxide in the regulation of coexpression of alternative oxidase and rotenone-insensitive NADH dehydrogenase in tomato leaves and calluses].

PubMed

Eprintsev, A T; Mal'tseva, E V; Shatskikh, A S; Popov, V N

2011-01-01

The involvement of active oxygen forms in the regulation of the expression of mitochondrial respiratory chain components, which are not related to energy storing, has been in vitro and in vivo studied in Lycopersicum esculentum L. The highest level of transcription of genes encoding alternative oxidase and NADH dehydrogenase has been observed in green tomato leaves. It has been shown that even low H2O2 concentrations activate both aoxlalpha and ndb1 genes, encoding alternative oxidase and external mitochondrial rotenone-insensitive NADH dehydrogenase, respectively. According to our results, in the case of an oxidative stress, alternative oxidase and NADH dehydrogenase are coexpressed in tomato plant tissues, and active oxygen forms serve as the secondary messengers of their coexpression.

Mutations in the SURF1 gene associated with Leigh syndrome and cytochrome C oxidase deficiency.

PubMed

Péquignot, M O; Dey, R; Zeviani, M; Tiranti, V; Godinot, C; Poyau, A; Sue, C; Di Mauro, S; Abitbol, M; Marsac, C

2001-05-01

Cytochrome c oxidase (COX) deficiency is one of the major causes of Leigh Syndrome (LS), a fatal encephalopathy of infancy or childhood, characterized by symmetrical lesions in the basal ganglia and brainstem. Mutations in the nuclear genes encoding COX subunits have not been found in patients with LS and COX deficiency, but mutations have been identified in SURF1. SURF1 encodes a factor involved in COX biogenesis. To date, 30 different mutations have been reported in 40 unrelated patients. We aim to provide an overview of all known mutations in SURF1, and to propose a common nomenclature. Twelve of the mutations were insertion/deletion mutations in exons 1, 4, 6, 8, and 9; 10 were missense/nonsense mutations in exons 2, 4, 5, 7, and 8; and eight were detected at splicing sites in introns 3 to 7. The most frequent mutation was 312_321del 311_312insAT which was found in 12 patients out of 40. Twenty mutations have been described only once. We also list all polymorphisms discovered to date. Copyright 2001 Wiley-Liss, Inc.

Heterologous expression of the Crassostrea gigas (Pacific oyster) alternative oxidase in the yeast Saccharomyces cerevisiae.

PubMed

Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E

2016-10-01

Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.

Norrie disease gene is distinct from the monoamine oxidase genes.

PubMed

Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A

1989-09-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.

Manganese(II)-oxidizing Bacillus spores in Guaymas Basin hydrothermal sediments and plumes.

PubMed

Dick, Gregory J; Lee, Yifan E; Tebo, Bradley M

2006-05-01

Microbial oxidation and precipitation of manganese at deep-sea hydrothermal vents are important oceanic biogeochemical processes, yet nothing is known about the types of microorganisms or mechanisms involved. Here we report isolation of a number of diverse spore-forming Mn(II)-oxidizing Bacillus species from Guaymas Basin, a deep-sea hydrothermal vent environment in the Gulf of California, where rapid microbially mediated Mn(II) oxidation was previously observed. mnxG multicopper oxidase genes involved in Mn(II) oxidation were amplified from all Mn(II)-oxidizing Bacillus spores isolated, suggesting that a copper-mediated mechanism of Mn(II) oxidation could be important at deep-sea hydrothermal vents. Phylogenetic analysis of 16S rRNA and mnxG genes revealed that while many of the deep-sea Mn(II)-oxidizing Bacillus species are very closely related to previously recognized isolates from coastal sediments, other organisms represent novel strains and clusters. The growth and Mn(II) oxidation properties of these Bacillus species suggest that in hydrothermal sediments they are likely present as spores that are active in oxidizing Mn(II) as it emerges from the seafloor.

Targeting NADPH oxidases in vascular pharmacology

PubMed Central

Schramm, Agata; Matusik, Paweł; Osmenda, Grzegorz; Guzik, Tomasz J

2012-01-01

Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the

Norrie disease gene is distinct from the monoamine oxidase genes

PubMed Central

Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

1989-01-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondeletion” Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease. ImagesFigure 2Figure 3 PMID:2773935

Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

PubMed

Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

2015-12-01

The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

Sequence conservation from human to prokaryotes of Surf1, a protein involved in cytochrome c oxidase assembly, deficient in Leigh syndrome.

PubMed

Poyau, A; Buchet, K; Godinot, C

1999-12-03

The human SURF1 gene encoding a protein involved in cytochrome c oxidase (COX) assembly, is mutated in most patients presenting Leigh syndrome associated with COX deficiency. Proteins homologous to the human Surf1 have been identified in nine eukaryotes and six prokaryotes using database alignment tools, structure prediction and/or cDNA sequencing. Their sequence comparison revealed a remarkable Surf1 conservation during evolution and put forward at least four highly conserved domains that should be essential for Surf1 function. In Paracoccus denitrificans, the Surf1 homologue is found in the quinol oxidase operon, suggesting that Surf1 is associated with a primitive quinol oxidase which belongs to the same superfamily as cytochrome oxidase.

Engineering laccases: in search for novel catalysts.

PubMed

Robert, Viviane; Mekmouche, Yasmina; Pailley, Pierre R; Tron, Thierry

2011-04-01

Laccases (p-diphenol oxidase, EC 1.10.3.2) are blue multicopper oxidases that catalyze the reduction of dioxygen to water, with a concomitant oxidation of small organic substrates. Since the description at the end of the nineteenth century of a factor catalyzing the rapid hardening of the latex of the Japanese lacquer trees (Rhus sp.) exposed to air laccases from different origins (plants, fungi bacteria) have been continuously discovered and extensively studied. Nowadays, molecular evolution and other powerful protein modification techniques offer possibilities to develop tailored laccases for a wide array of applications including drug synthesis, biosensors or biofuel cells. Here, we give an overview on strategies and results of our laboratory in the design of new biocatalysts based on laccases.

Engineering Laccases: In Search for Novel Catalysts

PubMed Central

Robert, Viviane; Mekmouche, Yasmina; Pailley, Pierre R; Tron, Thierry

2011-01-01

Laccases (p-diphenol oxidase, EC 1.10.3.2) are blue multicopper oxidases that catalyze the reduction of dioxygen to water, with a concomitant oxidation of small organic substrates. Since the description at the end of the nineteenth century of a factor catalyzing the rapid hardening of the latex of the Japanese lacquer trees (Rhus sp.) exposed to air laccases from different origins (plants, fungi bacteria) have been continuously discovered and extensively studied. Nowadays, molecular evolution and other powerful protein modification techniques offer possibilities to develop tailored laccases for a wide array of applications including drug synthesis, biosensors or biofuel cells. Here, we give an overview on strategies and results of our laboratory in the design of new biocatalysts based on laccases. PMID:21966250

A New Primer Set to Amplify the Mitochondrial Cytochrome C Oxidase Subunit I (COI) Gene in the DHA-Rich Microalgae, the Genus Aurantiochytrium.

PubMed

Nishitani, Goh; Yoshida, Masaki

2018-06-01

This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.

Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

PubMed Central

2014-01-01

Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

PubMed Central

Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

2012-01-01

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

Cognitive Function in Prepubertal Children with Obstructive Sleep Apnea: A Modifying Role for NADPH Oxidase p22 Subunit Gene Polymorphisms?

PubMed Central

Khalyfa, Abdelnaby; Capdevila, Oscar Sans; Kheirandish-Gozal, Leila; Khalyfa, Ahamed A.; Kim, Jinkwan

2012-01-01

Abstract Pediatric obstructive sleep apnea (OSA) may lead to neurocognitive dysfunction, but not in everyone affected. The frequencies of NADPH oxidase (NOX) polymorphisms in the p22phox subunit were similar between children with OSA and controls, except for rs6520785 and rs4673, the latter being significantly more frequent among the OSA children without deficits than with deficits (p<0.02). Similarly, 8-hydroxydeoxyguanine urine levels and NOX activity were lower among children without cognitive deficits and particularly among those with the rs4673 polymorphism. Thus, polymorphisms within the NOX gene or its functional subunits may account for important components of the variance in cognitive function deficits associated with OSA in children. Antioxid. Redox Signal. 16, 171–177. PMID:21902598

The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea.

PubMed

Giesbert, Sabine; Schürg, Timo; Scheele, Sandra; Tudzynski, Paul

2008-05-01

The role of reactive oxygen species (ROS) in interactions between phytopathogenic fungi and their hosts is well established. An oxidative burst mainly caused by superoxide formation by membrane-associated NADPH oxidases is an essential element of plant defence reactions. Apart from primary effects, ROS play a major role as a second messenger in host response. Recently, NADPH oxidase (nox)-encoding genes have been identified in filamentous fungi. Functional analyses have shown that these fungal enzymes are involved in sexual differentiation, and there is growing evidence that they also affect developmental programmes involved in fungus-plant interactions. Here we show that in the biotrophic plant pathogen Claviceps purpurea deletion of the cpnox1 gene, probably encoding an NADPH oxidase, has impact on germination of conidia and pathogenicity: Deltacpnox1 mutants can penetrate the host epidermis, but they are impaired in colonization of the plant ovarian tissue. In the few cases where macroscopic signs of infection (honeydew) appear, they are extremely delayed and fully developed sclerotia have never been observed. C. purpurea Nox1 is important for the interaction with its host, probably by directly affecting pathogenic differentiation of the fungus.

NADPH Oxidases in Vascular Pathology

PubMed Central

Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta

2014-01-01

Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

Adaptive responses of heart and skeletal muscle to spermine oxidase overexpression: Evaluation of a new transgenic mouse model.

PubMed

Ceci, Roberta; Duranti, Guglielmo; Leonetti, Alessia; Pietropaoli, Stefano; Spinozzi, Federico; Marcocci, Lucia; Amendola, Roberto; Cecconi, Francesco; Sabatini, Stefania; Mariottini, Paolo; Cervelli, Manuela

2017-02-01

Spermine oxidase oxidizes spermine to produce H 2 O 2 , spermidine, and 3-aminopropanal. It is involved in cell drug response, apoptosis, and in the etiology of several pathologies, including cancer. Spermine oxidase is an important positive regulator of muscle gene expression and fiber size and, when repressed, leads to muscle atrophy. We have generated a transgenic mouse line overexpressing Smox gene in all organs, named Total-Smox. The spermine oxidase overexpression was revealed by β-Gal staining and reverse-transcriptase/PCR analysis, in all tissues analysed. Spermine oxidase activity resulted higher in Total-Smox than controls. Considering the important role of this enzyme in muscle physiology, we have focused our study on skeletal muscle and heart of Total-Smox mice by measuring redox status and oxidative damage. We assessed the redox homeostasis through the analysis of the reduced/oxidized glutathione ratio. Chronic H 2 O 2 production induced by spermine oxidase overexpression leads to a cellular redox state imbalance in both tissues, although they show different redox adaptation. In skeletal muscle, catalase and glutathione S-transferase activities were significantly increased in Total-Smox mice compared to controls. In the heart, no differences were found in CAT activity level, while GST activity decreased compared to controls. The skeletal muscle showed a lower oxidative damage than in the heart, evaluated by lipid peroxidation and protein carbonylation. Altogether, our findings illustrate that skeletal muscle adapts more efficiently than heart to oxidative stress H 2 O 2 -induced. The Total-Smox line is a new genetic model useful to deepen our knowledge on the role of spermine oxidase in muscle atrophy and muscular pathological conditions like dystrophy. Copyright © 2016 Elsevier Inc. All rights reserved.

A Novel Colletotrichum graminicola Raffinose Oxidase in the AA5 Family

PubMed Central

Mollerup, Filip; Parikka, Kirsti; Koutaniemi, Sanna; Boer, Harry; Juvonen, Minna; Master, Emma; Tenkanen, Maija; Kruus, Kristiina

2017-01-01

ABSTRACT We describe here the identification and characterization of a copper radical oxidase from auxiliary activities family 5 (AA5_2) that was distinguished by showing preferential activity toward raffinose. Despite the biotechnological potential of carbohydrate oxidases from family AA5, very few members have been characterized. The gene encoding raffinose oxidase from Colletotrichum graminicola (CgRaOx; EC 1.1.3.−) was identified utilizing a bioinformatics approach based on the known modular structure of a characterized AA5_2 galactose oxidase. CgRaOx was expressed in Pichia pastoris, and the purified enzyme displayed the highest activity on the trisaccharide raffinose, whereas the activity on the disaccharide melibiose was three times lower and more than ten times lower activity was detected on d-galactose at a 300 mM substrate concentration. Thus, the substrate preference of CgRaOx was distinguished clearly from the substrate preferences of the known galactose oxidases. The site of oxidation for raffinose was studied by 1H nuclear magnetic resonance and mass spectrometry, and we confirmed that the hydroxyl group at the C-6 position was oxidized to an aldehyde and that in addition uronic acid was produced as a side product. A new electrospray ionization mass spectrometry method for the identification of C-6 oxidized products was developed, and the formation mechanism of the uronic acid was studied. CgRaOx presented a novel activity pattern in the AA5 family. IMPORTANCE Currently, there are only a few characterized members of the CAZy AA5 protein family. These enzymes are interesting from an application point of view because of their ability to utilize the cheap and abundant oxidant O2 without the requirement of complex cofactors such as FAD or NAD(P). Here, we present the identification and characterization of a novel AA5 member from Colletotrichum graminicola. As discussed in the present study, the bioinformatics approach using the modular structure of

Ectopic expression of pumpkin gibberellin oxidases alters gibberellin biosynthesis and development of transgenic Arabidopsis plants.

PubMed

Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta

2006-02-01

Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development.

Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

PubMed

Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

2013-04-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

Varroa destructor parasitism reduces hemocyte concentrations and prophenol oxidase gene expression in bees from two populations.

PubMed

Koleoglu, Gun; Goodwin, Paul H; Reyes-Quintana, Mariana; Hamiduzzaman, Mollah Md; Guzman-Novoa, Ernesto

2018-04-01

Circulating hemocytes are responsible for defensive and healing mechanisms in the honey bee, Apis mellifera. Parasitism by the mite Varroa destructor and injection of V. destructor homogenate in buffer, but not buffer injection, showed similar reductions in total hemocyte concentrations in both Africanized and European adult honey bees. This indicated that compounds in V. destructor homogenate can have similar effects as V. destructor parasitism and that the response is not solely due to wounding. Samples from honey bees with different hemocyte concentrations were compared for the expression patterns of hemolectin (AmHml), prophenol oxidase (AmPpo), and class C scavenger receptor (AmSRC-C). Of the genes tested, only the expression of AmPpo correlated well with hemocyte counts for all the treatments, indicating that melanization is associated with those responses. Thus, the expression of AmPpo might be a suitable biomarker for hemocyte counts as part of cellular defenses against injection of buffer or mite compounds and V. destructor parasitism and perhaps other conditions involving healing and immunity.

Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

PubMed

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.

PubMed

Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K

2009-09-01

Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.

Heterologous Production and Characterization of Two Glyoxal Oxidases from Pycnoporus cinnabarinus

PubMed Central

Daou, Marianne; Piumi, François; Cullen, Daniel; Record, Eric

2016-01-01

ABSTRACT The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium is physiologically coupled to lignin-oxidizing peroxidases via generation of extracellular H2O2 and utilizes an array of aldehydes and α-hydroxycarbonyls as the substrates. Two of the predicted glyoxal oxidases of P. cinnabarinus, GLOX1 (PciGLOX1) and GLOX2 (PciGLOX2), were heterologously produced in Aspergillus niger strain D15#26 (pyrG negative) and purified using immobilized metal ion affinity chromatography, yielding 59 and 5 mg of protein for PciGLOX1 and PciGLOX2, respectively. Both proteins were approximately 60 kDa in size and N-glycosylated. The optimum temperature for the activity of these enzymes was 50°C, and the optimum pH was 6. The enzymes retained most of their activity after incubation at 50°C for 4 h. The highest relative activity and the highest catalytic efficiency of both enzymes occurred with glyoxylic acid as the substrate. The two P. cinnabarinus enzymes generally exhibited similar substrate preferences, but PciGLOX2 showed a broader substrate specificity and was significantly more active on 3-phenylpropionaldehyde. IMPORTANCE This study addresses the poorly understood role of how fungal peroxidases obtain an in situ supply of hydrogen peroxide to enable them to oxidize a variety of organic and inorganic compounds. This cooperative activity is intrinsic in the living organism to control the amount of toxic H2O2 in its environment, thus providing a feed-on-demand scenario, and can be used biotechnologically to supply a cheap source of peroxide for the peroxidase reaction. The secretion of multiple glyoxal oxidases by filamentous fungi as part of a lignocellulolytic mechanism suggests a controlled system, especially as these

[Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test].

PubMed

Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo

2006-11-01

Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P < 0.01). With GLM analysis of SAS software, association analysis was conducted between MAOB gene polymorphisms and locomotion and vocalization behavior parameters in the open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P < 0.01 or P < 0.05) and were associated with the times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P < 0.05) and the times of posture change and standing up against walls were also higher than those in CC (P < 0.05). In addition, lying time in CC genotype puppies were higher than that in TT (P < 0.05). MAOB had a positive effect on walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P < 0.01 or P < 0.05). Our results imply that MAOB gene significantly affects the excitability, activity and exploration behavior of puppies in open-field test and TT genotype has favorable effects in these behavior traits.

Exploiting the synthetic lethality between terminal respiratory oxidases to kill Mycobacterium tuberculosis and clear host infection

PubMed Central

Kalia, Nitin P.; Hasenoehrl, Erik J.; Ab Rahman, Nurlilah B.; Koh, Vanessa H.; Ang, Michelle L. T.; Sajorda, Dannah R.; Hards, Kiel; Grüber, Gerhard; Alonso, Sylvie; Cook, Gregory M.; Berney, Michael; Pethe, Kevin

2017-01-01

The recent discovery of small molecules targeting the cytochrome bc1:aa3 in Mycobacterium tuberculosis triggered interest in the terminal respiratory oxidases for antituberculosis drug development. The mycobacterial cytochrome bc1:aa3 consists of a menaquinone:cytochrome c reductase (bc1) and a cytochrome aa3-type oxidase. The clinical-stage drug candidate Q203 interferes with the function of the subunit b of the menaquinone:cytochrome c reductase. Despite the affinity of Q203 for the bc1:aa3 complex, the drug is only bacteriostatic and does not kill drug-tolerant persisters. This raises the possibility that the alternate terminal bd-type oxidase (cytochrome bd oxidase) is capable of maintaining a membrane potential and menaquinol oxidation in the presence of Q203. Here, we show that the electron flow through the cytochrome bd oxidase is sufficient to maintain respiration and ATP synthesis at a level high enough to protect M. tuberculosis from Q203-induced bacterial death. Upon genetic deletion of the cytochrome bd oxidase-encoding genes cydAB, Q203 inhibited mycobacterial respiration completely, became bactericidal, killed drug-tolerant mycobacterial persisters, and rapidly cleared M. tuberculosis infection in vivo. These results indicate a synthetic lethal interaction between the two terminal respiratory oxidases that can be exploited for anti-TB drug development. Our findings should be considered in the clinical development of drugs targeting the cytochrome bc1:aa3, as well as for the development of a drug combination targeting oxidative phosphorylation in M. tuberculosis. PMID:28652330

Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

Treesearch

Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

2006-01-01

The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.

PubMed

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-03-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

SPERMINE OXIDASE: AN AMINE OXIDASE WITH SPECIFICITY FOR SPERMINE AND SPERMIDINE

PubMed Central

Hirsch, James G.

1953-01-01

Sheep serum and bovine serum contain an enzyme which brings about a rapid oxidative deamination of certain biological amines. This enzyme differs from previously described amine oxidases in several regards and especially in its substrate specificity. Studies thus far indicate that only spermine and the closely related compound spermidine serve as substrates for the enzyme in sheep serum. For this reason, the enzyme has been named spermine oxidase. Spermine oxidase is active in a variety of fluids of various ionic strength and buffer composition. The reaction takes place between pH 6.0 and pH 8.0 with an optimal rate in the vicinity of neutrality. Under certain conditions, the rate of oxygen consumption during the initial phase of the reaction is independent of the concentration of substrate. The diminution in rate observed during the latter phase of the enzymatic attack appears to be due to an alteration in the kinetics at low concentrations of substrate, or to competitive inhibition by a product of the reaction. Carbonyl reagents almost completely block the action of spermine oxidase, while certain amines and the cyanide ion bring about partial inhibition. Thiol reagents and sequestering compounds do not alter the course of the oxidative process. In the presence of low concentrations of mercuric chloride, the sheep serum-spermine system consumes approximately twice as much oxygen as controls containing no mercuric ion. The mechanism by which the mercuric ion stimulates additional oxygen uptake is obscure. PMID:13052805

Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

USDA-ARS?s Scientific Manuscript database

In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

Evidence for a Key Role of Cytochrome bo3 Oxidase in Respiratory Energy Metabolism of Gluconobacter oxydans

PubMed Central

Richhardt, Janine; Luchterhand, Bettina; Büchs, Jochen

2013-01-01

The obligatory aerobic acetic acid bacterium Gluconobacter oxydans oxidizes a variety of substrates in the periplasm by membrane-bound dehydrogenases, which transfer the reducing equivalents to ubiquinone. Two quinol oxidases, cytochrome bo3 and cytochrome bd, then catalyze transfer of the electrons from ubiquinol to molecular oxygen. In this study, mutants lacking either of these terminal oxidases were characterized. Deletion of the cydAB genes for cytochrome bd had no obvious influence on growth, whereas the lack of the cyoBACD genes for cytochrome bo3 severely reduced the growth rate and the cell yield. Using a respiration activity monitoring system and adjusting different levels of oxygen availability, hints of a low-oxygen affinity of cytochrome bd oxidase were obtained, which were supported by measurements of oxygen consumption in a respirometer. The H+/O ratio of the ΔcyoBACD mutant with mannitol as the substrate was 0.56 ± 0.11 and more than 50% lower than that of the reference strain (1.26 ± 0.06) and the ΔcydAB mutant (1.31 ± 0.16), indicating that cytochrome bo3 oxidase is the main component for proton extrusion via the respiratory chain. Plasmid-based overexpression of cyoBACD led to increased growth rates and growth yields, both in the wild type and the ΔcyoBACD mutant, suggesting that cytochrome bo3 might be a rate-limiting factor of the respiratory chain. PMID:23852873

Nanoparticle strategies for cancer therapeutics: Nucleic acids, polyamines, bovine serum amine oxidase and iron oxide nanoparticles (Review).

PubMed

Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J

2015-01-01

Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other

Various applications of immobilized glucose oxidase and polyphenol oxidase in a conducting polymer matrix.

PubMed

Cil, M; Böyükbayram, A E; Kiralp, S; Toppare, L; Yağci, Y

2007-06-01

In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively.

Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression

PubMed Central

Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra

2013-01-01

Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms. PMID:23669573

Monoamine Oxidase A: A Novel Target for Progression and Metastasis of Prostate Cancer

DTIC Science & Technology

2013-10-01

Paik, J.H. 2011. FoxO family members in cancer. Cancer biology & therapy 12:253-259. 31. Myatt, S.S., and Lam , E.W. 2007. The emerging roles of...J.B., Chen, K., Li, Y., Lau , Y.F., and Shih, J.C. 2009. Regulation of monoamine oxidase A by the SRY gene on the Y chromosome. FASEB journal

Effects of losartan on hepatic expression of nonphagocytic NADPH oxidase and fibrogenic genes in patients with chronic hepatitis C.

PubMed

Colmenero, Jordi; Bataller, Ramón; Sancho-Bru, Pau; Domínguez, Marlene; Moreno, Montserrat; Forns, Xavier; Bruguera, Miquel; Arroyo, Vicente; Brenner, David A; Ginès, Pere

2009-10-01

Angiotensin II promotes liver fibrogenesis by stimulating nonphagocytic NADPH oxidase (NOX)-induced oxidative stress. Angiotensin II type 1 (AT1) receptor blockers attenuate experimental liver fibrosis, yet their effects in human liver fibrosis are unknown. We investigated the effects of losartan on hepatic expression of fibrogenic, inflammatory, and NOX genes in patients with chronic hepatitis C (CHC). Fourteen patients with CHC and liver fibrosis received oral losartan (50 mg/day) for 18 mo. Liver biopsies were performed at baseline and after treatment. The degree of inflammation and fibrosis was evaluated by histological analysis (METAVIR). Collagen content was measured by morphometric quantification of Sirius red staining. Overall collagen content and fibrosis stage remained stable in the whole series, yet the fibrosis stage decreased in seven patients. Inflammatory activity improved in seven patients. The effect of losartan on hepatic expression of 31 profibrogenic and inflammatory genes and components of the NOX complex was assessed by quantitative PCR. Losartan treatment was associated with a significant decrease in the expression of several profibrogenic and NOX genes including procollagen alpha1(I) and alpha1(IV), urokinase-type plasminogen activator, metalloproteinase type 2, NOX activator 1 (NOXA-1) and organizer 1 (NOXO-1), and Rac-1. Losartan was well tolerated in all patients and was effective in attenuating the activity of the systemic renin-angiotensin system. No effects on serum liver tests or viral load were observed. We conclude that prolonged administration of losartan, an oral AT1 receptor blocker, is associated with downregulation of NOX components and fibrogenic genes in patients with CHC. Controlled studies are warranted to assess the effect of AT1 receptor blockers in chronic liver injury.

The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

PubMed Central

Pietan, Lucas L.; Spradling, Theresa A.

2016-01-01

In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids.

PubMed

Sytykiewicz, Hubert

2016-07-22

Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.

Congenital hypothyroidism, dwarfism, and hearing impairment caused by a missense mutation in the mouse dual oxidase 2 gene, Duox2.

PubMed

Johnson, Kenneth R; Marden, Coleen C; Ward-Bailey, Patricia; Gagnon, Leona H; Bronson, Roderick T; Donahue, Leah Rae

2007-07-01

Dual oxidases generate the hydrogen peroxide needed by thyroid peroxidase for the incorporation of iodine into thyroglobulin, an essential step in thyroid hormone synthesis. Mutations in the human dual oxidase 2 gene, DUOX2, have been shown to underlie several cases of congenital hypothyroidism. We report here the first mouse Duox2 mutation, which provides a new genetic model for studying the specific function of DUOX2 in the thyroid gland and in other organ systems where it is hypothesized to play a role. We mapped the new spontaneous mouse mutation to chromosome 2 and identified it as a T>G base pair change in exon 16 of Duox2. The mutation changes a highly conserved valine to glycine at amino acid position 674 (V674G) and was named "thyroid dyshormonogenesis" (symbol thyd) to signify a defect in thyroid hormone synthesis. Thyroid glands of mutant mice are goitrous and contain few normal follicles, and anterior pituitaries are dysplastic. Serum T(4) in homozygotes is about one-tenth the level of controls and is accompanied by a more than 100-fold increase in TSH. The weight of adult mutant mice is approximately half that of littermate controls, and serum IGF-I is reduced. The cochleae of mutant mice exhibit abnormalities characteristic of hypothyroidism, including a delayed formation of the inner sulcus and tunnel of Corti and an abnormally thickened tectorial membrane. Hearing thresholds of adult mutant mice are on average 50-60 decibels (dB) above those of controls.

New Insights Into the Roles of NADPH Oxidases in Sexual Development and Ascospore Germination in Sordaria macrospora

PubMed Central

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-01-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by ∆nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in ∆nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and ∆nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of ∆nox2, lacking the NADPH oxidase 2 gene, ∆nor1, and transcription factor deletion mutant ∆ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906

NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun

2012-08-15

Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed thatmore » 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.« less

Association analysis of the functional MAOA gene promoter and MAOB gene intron 13 polymorphisms in tension type headache patients.

PubMed

Edgnülü, Tuba G; Özge, Aynur; Erdal, Nurten; Kuru, Oktay; Erdal, Mehmet E

2014-01-01

Monoamine oxidase (MAO) enzymes play an important role in the etiology of many neurological diseases. Tension type headache (TTH) treatments contain inhibitors for selective re-uptake of serotonin and monoamine oxidase inhibitors. MAO (EC 1.4.3.4) has two isoenzymes known as MAOA and MAOB. A promoter polymorphism of a variable number of tandem repeats (VNTR) in the MAOA gene seems to affect MAOA transcriptional activity in vitro. Also, G/A polymorphism in intron 13 (rs1799836) of the MAOB gene have been previously found to be associated with the variability of MAOB enzyme activity. The aim of our study was to investigate a possible association of monoamine oxidase (MAOA and MAOB) gene polymorphisms in tension type headache. MAO gene polymorphisms were examined in a group of 120 TTH patients and in another 168 unrelated healthy volunteers (control group). MAOA promoter and MAOB intron 13 polymorphisms were genotyped using PCR-based methods. An overall comparison between the genotype of MAOA and MAOB genes and allele frequencies of the patients and the control group did not reveal any statistically significant difference between the patients and the control group (p=0.162). Factors like estrogen dosage, the limited number of male patients and other genes' neurotransmitters involved in the etiology of TTH could be responsible for our non-significant results.

Mitochondrial Group II Introns, Cytochrome c Oxidase, and Senescence in Podospora anserina†

PubMed Central

Begel, Odile; Boulay, Jocelyne; Albert, Beatrice; Dufour, Eric; Sainsard-Chanet, Annie

1999-01-01

Podospora anserina is a filamentous fungus with a limited life span. It expresses a degenerative syndrome called senescence, which is always associated with the accumulation of circular molecules (senDNAs) containing specific regions of the mitochondrial chromosome. A mobile group II intron (α) has been thought to play a prominent role in this syndrome. Intron α is the first intron of the cytochrome c oxidase subunit I gene (COX1). Mitochondrial mutants that escape the senescence process are missing this intron, as well as the first exon of the COX1 gene. We describe here the first mutant of P. anserina that has the α sequence precisely deleted and whose cytochrome c oxidase activity is identical to that of wild-type cells. The integration site of the intron is slightly modified, and this change prevents efficient homing of intron α. We show here that this mutant displays a senescence syndrome similar to that of the wild type and that its life span is increased about twofold. The introduction of a related group II intron into the mitochondrial genome of the mutant does not restore the wild-type life span. These data clearly demonstrate that intron α is not the specific senescence factor but rather an accelerator or amplifier of the senescence process. They emphasize the role that intron α plays in the instability of the mitochondrial chromosome and the link between this instability and longevity. Our results strongly support the idea that in Podospora, “immortality” can be acquired not by the absence of intron α but rather by the lack of active cytochrome c oxidase. PMID:10330149

Ectopic Expression of Pumpkin Gibberellin Oxidases Alters Gibberellin Biosynthesis and Development of Transgenic Arabidopsis Plants1

PubMed Central

Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta

2006-01-01

Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development. PMID:16384902

Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

NASA Technical Reports Server (NTRS)

Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

1995-01-01

In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

PubMed

Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

2013-07-01

The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

Treesearch

Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

2009-01-01

The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

Silver nanoparticles embedded in zeolite membranes: release of silver ions and mechanism of antibacterial action

PubMed Central

Nagy, Amber; Harrison, Alistair; Sabbani, Supriya; Munson, Robert S; Dutta, Prabir K; Waldman, W James

2011-01-01

Background The focus of this study is on the antibacterial properties of silver nanoparticles embedded within a zeolite membrane (AgNP-ZM). Methods and Results These membranes were effective in killing Escherichia coli and were bacteriostatic against methicillin-resistant Staphylococcus aureus. E. coli suspended in Luria Bertani (LB) broth and isolated from physical contact with the membrane were also killed. Elemental analysis indicated slow release of Ag+ from the AgNP-ZM into the LB broth. The E. coli killing efficiency of AgNP-ZM was found to decrease with repeated use, and this was correlated with decreased release of silver ions with each use of the support. Gene expression microarrays revealed upregulation of several antioxidant genes as well as genes coding for metal transport, metal reduction, and ATPase pumps in response to silver ions released from AgNP-ZM. Gene expression of iron transporters was reduced, and increased expression of ferrochelatase was observed. In addition, upregulation of multiple antibiotic resistance genes was demonstrated. The expression levels of multicopper oxidase, glutaredoxin, and thioredoxin decreased with each support use, reflecting the lower amounts of Ag+ released from the membrane. The antibacterial mechanism of AgNP-ZM is proposed to be related to the exhaustion of antioxidant capacity. Conclusion These results indicate that AgNP-ZM provide a novel matrix for gradual release of Ag+. PMID:21931480

Analysis of in situ manganese(II) oxidation in the Columbia River and offshore plume: Linking microbial community structure to active biogeochemical cycles

PubMed Central

Anderson, C. R.; Davis, R. E.; Bandolin, N. S.; Baptista, A. M.; Tebo, B. M.

2017-01-01

The Columbia River is a major source of dissolved nutrients and trace metals for the west coast of North America. A large proportion of these nutrients are sourced from the Columbia River Estuary where coastal and terrestrial waters mix and resuspend particulate matter within the water column. As estuarine water is discharged off the coast it transports the particulate matter, dissolved nutrients and microorganisms forming nutrient rich and metabolically dynamic plumes. In this study, bacterial manganese oxidation within the plume and estuary was investigated during spring and neap tides. The microbial community proteome was fractionated and assayed for Mn oxidation activity. Proteins from the outer membrane and the loosely bound outer membrane fractions were separated using size exclusion chromatography and Mn(II)-oxidizing eluates were analyzed with tandem mass spectrometry to identify potential Mn oxidase protein targets. Multi-copper oxidase (MCO) and heme-peroxidase enzymes were identified in active fractions. T-RFLP cluster analysis indicates that the organisms oxidizing the most Mn(II) were sourced from the Columbia River estuary and nearshore coastal ocean. These organisms are producing up to 10 fM MnO2 cell−1 day−1. Evidence for the presence of Mn(II)-oxidizing bacterial isolates from the genera Aurantimonas, Rhodobacter, Bacillus, and Shewanella was found in T-RFLP profiles. Q-PCR was used to quantify the gene copies of the heme-peroxidase, Aurantimonas SSU rRNA and total bacterial SSU rRNA gene copies. The probes used suggested that Aurantimonas could only account for 1.7% of heme-peroxidase genes quantified suggesting that peroxidase driven manganese oxidation capabilities are widespread throughout other organisms in this environment. PMID:21418498

Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

PubMed Central

Li, Wande

2013-01-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

Molecular Insights of p47phox Phosphorylation Dynamics in the Regulation of NADPH Oxidase Activation and Superoxide Production*

PubMed Central

Meijles, Daniel N.; Fan, Lampson M.; Howlin, Brendan J.; Li, Jian-Mei

2014-01-01

Phagocyte superoxide production by a multicomponent NADPH oxidase is important in host defense against microbial invasion. However inappropriate NADPH oxidase activation causes inflammation. Endothelial cells express NADPH oxidase and endothelial oxidative stress due to prolonged NADPH oxidase activation predisposes many diseases. Discovering the mechanism of NADPH oxidase activation is essential for developing novel treatment of these diseases. The p47phox is a key regulatory subunit of NADPH oxidase; however, due to the lack of full protein structural information, the mechanistic insight of p47phox phosphorylation in NADPH oxidase activation remains incomplete. Based on crystal structures of three functional domains, we generated a computational structural model of the full p47phox protein. Using a combination of in silico phosphorylation, molecular dynamics simulation and protein/protein docking, we discovered that the C-terminal tail of p47phox is critical for stabilizing its autoinhibited structure. Ser-379 phosphorylation disrupts H-bonds that link the C-terminal tail to the autoinhibitory region (AIR) and the tandem Src homology 3 (SH3) domains, allowing the AIR to undergo phosphorylation to expose the SH3 pocket for p22phox binding. These findings were confirmed by site-directed mutagenesis and gene transfection of p47phox−/− coronary microvascular cells. Compared with wild-type p47phox cDNA transfected cells, the single mutation of S379A completely blocked p47phox membrane translocation, binding to p22phox and endothelial O2⨪ production in response to acute stimulation of PKC. p47phox C-terminal tail plays a key role in stabilizing intramolecular interactions at rest. Ser-379 phosphorylation is a molecular switch which initiates p47phox conformational changes and NADPH oxidase-dependent superoxide production by cells. PMID:24970888

Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm

NASA Astrophysics Data System (ADS)

Xu, Wei; Liao, Yalin

2017-12-01

Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.

Yeast ERV2p is the first microsomal FAD-linked sulfhydryl oxidase of the Erv1p/Alrp protein family.

PubMed

Gerber, J; Mühlenhoff, U; Hofhaus, G; Lill, R; Lisowsky, T

2001-06-29

Saccharomyces cerevisiae Erv2p was identified previously as a distant homologue of Erv1p, an essential mitochondrial protein exhibiting sulfhydryl oxidase activity. Expression of the ERV2 (essential for respiration and vegetative growth 2) gene from a high-copy plasmid cannot substitute for the lack of ERV1, suggesting that the two proteins perform nonredundant functions. Here, we show that the deletion of the ERV2 gene or the depletion of Erv2p by regulated gene expression is not associated with any detectable growth defects. Erv2p is located in the microsomal fraction, distinguishing it from the mitochondrial Erv1p. Despite their distinct subcellular localization, the two proteins exhibit functional similarities. Both form dimers in vivo and in vitro, contain a conserved YPCXXC motif in their carboxyl-terminal part, bind flavin adenine dinucleotide (FAD) as a cofactor, and catalyze the formation of disulfide bonds in protein substrates. The catalytic activity, the ability to form dimers, and the binding of FAD are associated with the carboxyl-terminal domain of the protein. Our findings identify Erv2p as the first microsomal member of the Erv1p/Alrp protein family of FAD-linked sulfhydryl oxidases. We propose that Erv2p functions in the generation of microsomal disulfide bonds acting in parallel with Ero1p, the essential, FAD-dependent oxidase of protein disulfide isomerase.

Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

PubMed

Rathinam, T; Gadde, U; Chapman, H D

2015-07-01

Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.

PubMed

Hinkkanen, A; Maly, F E; Decker, K

1983-04-01

The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.

Identification of seven polyamine oxidase genes in tomato (Solanum lycopersicum L.) and their expression profiles under physiological and various stress conditions.

PubMed

Hao, Yanwei; Huang, Binbin; Jia, Dongyu; Mann, Taylor; Jiang, Xinyi; Qiu, Yuxing; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu; Liu, Taibo

2018-05-15

Polyamines (PAs) are implicated in developmental processes and stress responses of plants. Polyamine oxidases (PAOs), flavin adenine dinucleotide-dependent enzymes that function in PA catabolism, play a critical role. Even though PAO gene families of Arabidopsis and rice have been intensely characterized and their expression in response to developmental and environmental changes has been investigated, little is known about PAOs in tomato (Solanum lycopersicum). We found seven PAO genes in S. lycopersicum and named them SlPAO1∼7. Plant PAOs form four clades in phylogenetic analysis, of which SlPAO1 belongs to clade-I, SlPAO6 and SlPAO7 to clade-III, and the residual four (SlPAO2∼5) to clade-IV, while none belongs to clade-II. All the clade-IV members in tomato also retain the putative peroxisomal-targeting signals in their carboxy termini, suggesting their peroxisome localization. SlPAO1 to SlPAO5 genes consist of 10 exons and 9 introns, while SlPAO6 and SlPAO7 are intronless genes. To address the individual roles of SlPAOs, we analyzed their expression in various tissues and during flowering and fruit development. The expression of SlPAO2∼4 was constitutively high, while that of the other SlPAO members was relatively lower. We further analyzed the expressional changes of SlPAOs upon abiotic stresses, oxidative stresses, phytohormone application, and PA application. Based on the data obtained, we discuss the distinctive roles of SlPAOs. Copyright © 2018 Elsevier GmbH. All rights reserved.

Mutations in the human SC4MOL gene encoding a methyl sterol oxidase cause psoriasiform dermatitis, microcephaly, and developmental delay

PubMed Central

He, Miao; Kratz, Lisa E.; Michel, Joshua J.; Vallejo, Abbe N.; Ferris, Laura; Kelley, Richard I.; Hoover, Jacqueline J.; Jukic, Drazen; Gibson, K. Michael; Wolfe, Lynne A.; Ramachandran, Dhanya; Zwick, Michael E.; Vockley, Jerry

2011-01-01

Defects in cholesterol synthesis result in a wide variety of symptoms, from neonatal lethality to the relatively mild dysmorphic features and developmental delay found in individuals with Smith-Lemli-Opitz syndrome. We report here the identification of mutations in sterol-C4-methyl oxidase–like gene (SC4MOL) as the cause of an autosomal recessive syndrome in a human patient with psoriasiform dermatitis, arthralgias, congenital cataracts, microcephaly, and developmental delay. This gene encodes a sterol-C4-methyl oxidase (SMO), which catalyzes demethylation of C4-methylsterols in the cholesterol synthesis pathway. C4-Methylsterols are meiosis-activating sterols (MASs). They exist at high concentrations in the testis and ovary and play roles in meiosis activation. In this study, we found that an accumulation of MASs in the patient led to cell overproliferation in both skin and blood. SMO deficiency also substantially altered immunocyte phenotype and in vitro function. MASs serve as ligands for liver X receptors α and β (LXRα and LXRβ), which are important in regulating not only lipid transport in the epidermis, but also innate and adaptive immunity. Deficiency of SMO represents a biochemical defect in the cholesterol synthesis pathway, the clinical spectrum of which remains to be defined. PMID:21285510

Identification, expression, and taxonomic distribution of alternative oxidases in non-angiosperm plants.

PubMed

Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E

2013-09-10

Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.

The BLI-3/TSP-15/DOXA-1 Dual Oxidase Complex Is Required for Iodide Toxicity in Caenorhabditis elegans

PubMed Central

Xu, Zhaofa; Luo, Jintao; Li, Yu; Ma, Long

2014-01-01

Iodine is an essential trace element for life. Iodide deficiency can lead to defective biosynthesis of thyroid hormones and is a major cause of hypothyroidism and mental retardation. Excess iodide intake, however, has been linked to different thyroidal diseases. How excess iodide causes harmful effects is not well understood. Here, we found that the nematode Caenorhabditis elegans exhibits developmental arrest and other pleiotropic defects when exposed to excess iodide. To identify the responsible genes, we performed a forward genetic screen and isolated 12 mutants that can survive in excess iodide. These mutants define at least four genes, two of which we identified as bli-3 and tsp-15. bli-3 encodes the C. elegans ortholog of the mammalian dual oxidase DUOX1 and tsp-15 encodes the tetraspanin protein TSP-15, which was previously shown to interact with BLI-3. The C. elegans dual oxidase maturation factor DOXA-1 is also required for the arresting effect of excess iodide. Finally, we detected a dramatically increased biogenesis of reactive oxygen species in animals treated with excess iodide, and this effect can be partially suppressed by bli-3 and tsp-15 mutations. We propose that the BLI-3/TSP-15/DOXA-1 dual oxidase complex is required for the toxic pleiotropic effects of excess iodide. PMID:25480962

Erv1p from Saccharomyces cerevisiae is a FAD-linked sulfhydryl oxidase.

PubMed

Lee, J; Hofhaus, G; Lisowsky, T

2000-07-14

The yeast ERV1 gene encodes a small polypeptide of 189 amino acids that is essential for mitochondrial function and for the viability of the cell. In this study we report the enzymatic activity of this protein as a flavin-linked sulfhydryl oxidase catalyzing the formation of disulfide bridges. Deletion of the amino-terminal part of Erv1p shows that the enzyme activity is located in the 15 kDa carboxy-terminal domain of the protein. This fragment of Erv1p still binds FAD and catalyzes the formation of disulfide bonds but is no longer able to form dimers like the complete protein. The carboxy-terminal fragment contains a conserved CXXC motif that is present in all homologous proteins from yeast to human. Thus Erv1p represents the first FAD-linked sulfhydryl oxidase from yeast and the first of these enzymes that is involved in mitochondrial biogenesis.

Cytochrome oxidase assembly does not require catalytically active cytochrome C.

PubMed

Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander

2003-03-14

Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.

Correlation Between Monoamine Oxidase Inhibitors and Anticonvulsants

PubMed Central

Dwivedi, Chandradhar; Misra, Radhey S.; Chaudhari, Anshumali; Parmar, Surendra S.

1980-01-01

Monoamine oxidase inhibitory and anticonvulsant properties of 2-substituted styryl-6-bromo-3-(4-ethylbenzoate/4 benzhydrazide)-4-quinazoles are studied. All styryl quinazolone esters except compound number 9 exhibited monoamine oxidase inhibitory properties during oxidative deamination of kynuramine. Corresponding hydrazides were found to have relatively higher activity. All these quinazolones were able to protect against pentylenetetrazol induced seizures. These observations in general do not prove that monoamine oxidase inhibitory properties represent the biochemical basis for the anticonvulsant activity of these compounds. PMID:7420438

Overexpression of Plastidic Protoporphyrinogen IX Oxidase Leads to Resistance to the Diphenyl-Ether Herbicide Acifluorfen1

PubMed Central

Lermontova, Inna; Grimm, Bernhard

2000-01-01

The use of herbicides to control undesirable vegetation has become a universal practice. For the broad application of herbicides the risk of damage to crop plants has to be limited. We introduced a gene into the genome of tobacco (Nicotiana tabacum) plants encoding the plastid-located protoporphyrinogen oxidase of Arabidopsis, the last enzyme of the common tetrapyrrole biosynthetic pathway, under the control of the cauliflower mosaic virus 35S promoter. The transformants were screened for low protoporphyrin IX accumulation upon treatment with the diphenyl ether-type herbicide acifluorfen. Leaf disc incubation and foliar spraying with acifluorfen indicated the lower susceptibility of the transformants against the herbicide. The resistance to acifluorfen is conferred by overexpression of the plastidic isoform of protoporphyrinogen oxidase. The in vitro activity of this enzyme extracted from plastids of selected transgenic lines was at least five times higher than the control activity. Herbicide treatment that is normally inhibitory to protoporphyrinogen IX oxidase did not significantly impair the catalytic reaction in transgenic plants and, therefore, did not cause photodynamic damage in leaves. Therefore, overproduction of protoporphyrinogen oxidase neutralizes the herbicidal action, prevents the accumulation of the substrate protoporphyrinogen IX, and consequently abolishes the light-dependent phytotoxicity of acifluorfen. PMID:10631251

Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.

PubMed

Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H

2008-10-05

Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.

Deficiency of Rac1 Blocks NADPH Oxidase Activation, Inhibits Endoplasmic Reticulum Stress, and Reduces Myocardial Remodeling in a Mouse Model of Type 1 Diabetes

PubMed Central

Li, Jianmin; Zhu, Huaqing; Shen, E; Wan, Li; Arnold, J. Malcolm O.; Peng, Tianqing

2010-01-01

OBJECTIVE Our recent study demonstrated that Rac1 and NADPH oxidase activation contributes to cardiomyocyte apoptosis in short-term diabetes. This study was undertaken to investigate if disruption of Rac1 and inhibition of NADPH oxidase would prevent myocardial remodeling in chronic diabetes. RESEARCH DESIGN AND METHODS Diabetes was induced by injection of streptozotocin in mice with cardiomyocyte-specific Rac1 knockout and their wild-type littermates. In a separate experiment, wild-type diabetic mice were treated with vehicle or apocynin in drinking water. Myocardial hypertrophy, fibrosis, endoplasmic reticulum (ER) stress, inflammatory response, and myocardial function were investigated after 2 months of diabetes. Isolated adult rat cardiomyocytes were cultured and stimulated with high glucose. RESULTS In diabetic hearts, NADPH oxidase activation, its subunits' expression, and reactive oxygen species production were inhibited by Rac1 knockout or apocynin treatment. Myocardial collagen deposition and cardiomyocyte cross-sectional areas were significantly increased in diabetic mice, which were accompanied by elevated expression of pro-fibrotic genes and hypertrophic genes. Deficiency of Rac1 or apocynin administration reduced myocardial fibrosis and hypertrophy, resulting in improved myocardial function. These effects were associated with a normalization of ER stress markers' expression and inflammatory response in diabetic hearts. In cultured cardiomyocytes, high glucose–induced ER stress was inhibited by blocking Rac1 or NADPH oxidase. CONCLUSIONS Rac1 via NADPH oxidase activation induces myocardial remodeling and dysfunction in diabetic mice. The role of Rac1 signaling may be associated with ER stress and inflammation. Thus, targeting inhibition of Rac1 and NADPH oxidase may be a therapeutic approach for diabetic cardiomyopathy. PMID:20522592

Polymorphisms in the canine monoamine oxidase a (MAOA) gene: identification and variation among five broad dog breed groups.

PubMed

Sacco, James; Ruplin, Andrew; Skonieczny, Paul; Ohman, Michael

2017-01-01

In humans, reduced activity of the enzyme monoamine oxidase type A (MAOA) due to genetic polymorphisms within the MAOA gene leads to increased brain neurotransmitter levels associated with aggression. In order to study MAOA genetic diversity in dogs, we designed a preliminary study whose objectives were to identify novel alleles in functionally important regions of the canine MAOA gene, and to investigate whether the frequencies of these polymorphisms varied between five broad breed groups (ancient, herding, mastiff, modern European, and mountain). Fifty dogs representing these five breed groups were sequenced. A total of eleven polymorphisms were found. Seven were single nucleotide polymorphisms (SNPs; two exonic, two intronic and three in the promoter), while four were repeat intronic variations. The most polymorphic loci were repeat regions in introns 1, 2 (7 alleles) and 10 (3 alleles), while the exonic and the promoter regions were highly conserved. Comparison of the allele frequencies of certain microsatellite polymorphisms among the breed groups indicated a decreasing or increasing trend in the number of repeats at different microsatellite loci, as well as the highest genetic diversity for the ancient breeds and the lowest for the most recent mountain breeds, perhaps attributable to canine domestication and recent breed formation. While a specific promoter SNP (-212A > G) is rare in the dog, it is the major allele in wolves. Replacement of this ancestral allele in domestic dogs may lead to the deletion of heat shock factor binding sites on the MAOA promoter. Dogs exhibit significant variation in certain intronic regions of the MAOA gene, while the coding and promoter regions are well-conserved. Distinct genetic differences were observed between breed groups. Further studies are now required to establish whether such polymorphisms are associated in any way with MAOA level and canine behaviour including aggression.

A New Transgenic Mouse Model for Studying the Neurotoxicity of Spermine Oxidase Dosage in the Response to Excitotoxic Injury

PubMed Central

Cervelli, Manuela; Bellavia, Gabriella; D'Amelio, Marcello; Cavallucci, Virve; Moreno, Sandra; Berger, Joachim; Nardacci, Roberta; Marcoli, Manuela; Maura, Guido; Piacentini, Mauro; Amendola, Roberto; Cecconi, Francesco; Mariottini, Paolo

2013-01-01

Spermine oxidase is a FAD-containing enzyme involved in polyamines catabolism, selectively oxidizing spermine to produce H2O2, spermidine, and 3-aminopropanal. Spermine oxidase is highly expressed in the mouse brain and plays a key role in regulating the levels of spermine, which is involved in protein synthesis, cell division and cell growth. Spermine is normally released by neurons at synaptic sites where it exerts a neuromodulatory function, by specifically interacting with different types of ion channels, and with ionotropic glutamate receptors. In order to get an insight into the neurobiological roles of spermine oxidase and spermine, we have deregulated spermine oxidase gene expression producing and characterizing the transgenic mouse model JoSMOrec, conditionally overexpressing the enzyme in the neocortex. We have investigated the effects of spermine oxidase overexpression in the mouse neocortex by transcript accumulation, immunohistochemical analysis, enzymatic assays and polyamine content in young and aged animals. Transgenic JoSMOrec mice showed in the neocortex a higher H2O2 production in respect to Wild-Type controls, indicating an increase of oxidative stress due to SMO overexpression. Moreover, the response of transgenic mice to excitotoxic brain injury, induced by kainic acid injection, was evaluated by analysing the behavioural phenotype, the immunodistribution of neural cell populations, and the ultrastructural features of neocortical neurons. Spermine oxidase overexpression and the consequently altered polyamine levels in the neocortex affects the cytoarchitecture in the adult and aging brain, as well as after neurotoxic insult. It resulted that the transgenic JoSMOrec mouse line is more sensitive to KA than Wild-Type mice, indicating an important role of spermine oxidase during excitotoxicity. These results provide novel evidences of the complex and critical functions carried out by spermine oxidase and spermine in the mammalian brain. PMID

Regulation of tyramine oxidase synthesis in Klebsiella aerogenes.

PubMed Central

Okamura, H; Murooka, Y; Harada, T

1976-01-01

Tyramine oxidase in Klebsiella aerogenes is highly specific for tyramine, dopamine, octopamine, and norepinephrine, and its synthesis is induced specifically by these compounds. The enzyme is present in a membrane-bound form. The Km value for tyramine is 9 X 10(-4) M. Tyramine oxidase synthesis was subjected to catabolite repression by glucose in the presence of ammonium salts. Addition of cyclic adenosine 3',5'-monophosphate (cAMP) overcame the catabolite repression. A mutant strain, K711, which can produce a high level of beta-galactosidase in the presence of glucose and ammonium chloride, can also synthesize tyramine oxidase and histidase in the presence of inducer in glucose ammonium medium. Catabolite repression of tyramine oxidase synthesis was relieved when the cells were grown under conditions of nitrogen limitation, whereas beta-galactosidase was strongly repressed under these conditions. A cAMP-requiring mutant, MK54, synthesized tyramine oxidase rapidly when tyramine was used as the sole source of nitrogen in the absence of cAMP. However, a glutamine synthetase-constitutive mutant, MK94, failed to synthesize tyramine oxidase in the presence of glucose and ammonium chloride, although it synthesized histidase rapidly under these conditions. These results suggest that catabolite repression of tyramine oxidase synthesis in K. aerogenes is regulated by the intracellular level of cAMP and an unknown cytoplasmic factor that acts independently of cAMP and is formed under conditions of nitrogen limitation. PMID:179974

Enhanced removal of aqueous acetaminophen by a laccase-catalyzed oxidative coupling reaction under a dual-pH optimization strategy.

PubMed

Wang, Kaidong; Huang, Ke; Jiang, Guoqiang

2018-03-01

Acetaminophen is one kind of pharmaceutical contaminant that has been detected in municipal water and is hard to digest. A laccase-catalyzed oxidative coupling reaction is a potential method of removing acetaminophen from water. In the present study, the kinetics of radical polymerization combined with precipitation was studied, and the dual-pH optimization strategy (the enzyme solution at pH7.4 being added to the substrate solution at pH4.2) was proposed to enhance the removal efficiency of acetaminophen. The reaction kinetics that consisted of the laccase-catalyzed oxidation, radical polymerization and precipitation were studied by UV in situ, LC-MS and DLS (dynamic light scattering) in situ. The results showed that the laccase-catalyzed oxidation is the rate-limiting step in the whole process. The higher rate of enzyme-catalyzed oxidation under a dual-pH optimization strategy led to much faster formation of the dimer, trimer and tetramer. Similarly, the formation of polymerized products that could precipitate naturally from water was faster. Under the dual-pH optimization strategy, the initial laccase activity was increased approximately 2.9-fold, and the activity remained higher for >250s, during which approximately 63.7% of the total acetaminophen was transformed into biologically inactive polymerized products, and part of these polymerized products precipitated from the water. Laccase belongs to the family of multi-copper oxidases, and the present study provides a universal method to improve the activity of multi-copper oxidases for the high-performance removal of phenol and its derivatives. Copyright © 2017 Elsevier B.V. All rights reserved.

Enzymatic Manganese(II) Oxidation by Metabolically Dormant Spores of Diverse Bacillus Species

PubMed Central

Francis, Chris A.; Tebo, Bradley M.

2002-01-01

Bacterial spores are renowned for their longevity, ubiquity, and resistance to environmental insults, but virtually nothing is known regarding whether these metabolically dormant structures impact their surrounding chemical environments. In the present study, a number of spore-forming bacteria that produce dormant spores which enzymatically oxidize soluble Mn(II) to insoluble Mn(IV) oxides were isolated from coastal marine sediments. The highly charged and reactive surfaces of biogenic metal oxides dramatically influence the oxidation and sorption of both trace metals and organics in the environment. Prior to this study, the only known Mn(II)-oxidizing sporeformer was the marine Bacillus sp. strain SG-1, an extensively studied bacterium in which Mn(II) oxidation is believed to be catalyzed by a multicopper oxidase, MnxG. Phylogenetic analysis based on 16S rRNA and mnxG sequences obtained from 15 different Mn(II)-oxidizing sporeformers (including SG-1) revealed extensive diversity within the genus Bacillus, with organisms falling into several distinct clusters and lineages. In addition, active Mn(II)-oxidizing proteins of various sizes, as observed in sodium dodecyl sulfate-polyacrylamide electrophoresis gels, were recovered from the outer layers of purified dormant spores of the isolates. These are the first active Mn(II)-oxidizing enzymes identified in spores or gram-positive bacteria. Although extremely resistant to denaturation, the activities of these enzymes were inhibited by azide and o-phenanthroline, consistent with the involvement of multicopper oxidases. Overall, these studies suggest that the commonly held view that bacterial spores are merely inactive structures in the environment should be revised. PMID:11823231

Crystal structure of a four-copper laccase complexed with an arylamine: insights into substrate recognition and correlation with kinetics.

PubMed

Bertrand, Thomas; Jolivalt, Claude; Briozzo, Pierre; Caminade, Eliane; Joly, Nathalie; Madzak, Catherine; Mougin, Christian

2002-06-11

Laccases are multicopper oxidases that catalyze the oxidation of a wide range of phenols or arylamines, and their use in industrial oxidative processes is increasing. We purified from the white rot fungus Trametes versicolor a laccase that exists as five different isozymes, depending on glycosylation. The 2.4 A resolution structure of the most abundant isozyme of the glycosylated enzyme was solved. The four copper atoms are present, and it is the first crystal structure of a laccase in its active form. The crystallized enzyme binds 2,5-xylidine, which was used as a laccase inducer in the fungus culture. This arylamine is a very weak reducing substrate of the enzyme. The cavity enclosing 2,5-xylidine is rather wide, allowing the accommodation of substrates of various sizes. Several amino acid residues make hydrophobic interactions with the aromatic ring of the ligand. In addition, two charged or polar residues interact with its amino group. The first one is an histidine that also coordinates the copper that functions as the primary electron acceptor. The second is an aspartate conserved among fungal laccases. The purified enzyme can oxidize various hydroxylated compounds of the phenylurea family of herbicides that we synthesized. These phenolic substrates have better affinities at pH 5 than at pH 3, which could be related to the 2,5-xylidine binding by the aspartate. This is the first high-resolution structure of a multicopper oxidase complexed to a reducing substrate. It provides a model for engineering laccases that are either more efficient or with a wider substrate specificity.

Role of NADPH Oxidase-4 in Human Endothelial Progenitor Cells

PubMed Central

Hakami, Nora Y.; Ranjan, Amaresh K.; Hardikar, Anandwardhan A.; Dusting, Greg J.; Peshavariya, Hitesh M.

2017-01-01

Introduction: Endothelial progenitor cells (EPCs) display a unique ability to promote angiogenesis and restore endothelial function in injured blood vessels. NADPH oxidase 4 (NOX4)-derived hydrogen peroxide (H2O2) serves as a signaling molecule and promotes endothelial cell proliferation and migration as well as protecting against cell death. However, the role of NOX4 in EPC function is not completely understood. Methods: EPCs were isolated from human saphenous vein and mammary artery discarded during bypass surgery. NOX4 gene and protein expression in EPCs were measured by real time-PCR and Western blot analysis respectively. NOX4 gene expression was inhibited using an adenoviral vector expressing human NOX4 shRNA (Ad-NOX4i). H2O2 production was measured by Amplex red assay. EPC migration was evaluated using a transwell migration assay. EPC proliferation and viability were measured using trypan blue counts. Results: Inhibition of NOX4 using Ad-NOX4i reduced Nox4 gene and protein expression as well as H2O2 formation in EPCs. Inhibition of NOX4-derived H2O2 decreased both proliferation and migration of EPCs. Interestingly, pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) decreased NOX4 expression and reduced survival of EPCs. However, the survival of EPCs was further diminished by TNF-α in NOX4-knockdown cells, suggesting that NOX4 has a protective role in EPCs. Conclusion: These findings suggest that NOX4-type NADPH oxidase is important for proliferation and migration functions of EPCs and protects against pro-inflammatory cytokine induced EPC death. These properties of NOX4 may facilitate the efficient function of EPCs which is vital for successful neovascularization. PMID:28386230

[The regulation of peroxisomal matrix enzymes (alcohol oxidase and catalase) formation by the product of the gene Mth1 in methylotrophic yeast Pichia methanolica].

PubMed

Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M

2009-01-01

Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.

A survey of genes encoding H2O2-producing GMC oxidoreductases in 10 Polyporales genomes.

PubMed

Ferreira, Patricia; Carro, Juan; Serrano, Ana; Martínez, Angel T

2015-01-01

The genomes of three representative Polyporales (Bjerkandera adusta, Phlebia brevispora and a member of the Ganoderma lucidum complex) recently were sequenced to expand our knowledge on the diversity and distribution of genes involved in degradation of plant polymers in this Basidiomycota order, which includes most wood-rotting fungi. Oxidases, including members of the glucose-methanol-choline (GMC) oxidoreductase superfamily, play a central role in the above degradative process because they generate extracellular H2O2 acting as the ultimate oxidizer in both white-rot and brown-rot decay. The survey was completed by analyzing the GMC genes in the available genomes of seven more species to cover the four Polyporales clades. First, an in silico search for sequences encoding members of the aryl-alcohol oxidase, glucose oxidase, methanol oxidase, pyranose oxidase, cellobiose dehydrogenase and pyranose dehydrogenase families was performed. The curated sequences were subjected to an analysis of their evolutionary relationships, followed by estimation of gene duplication/reduction history during fungal evolution. Second, the molecular structures of the near one hundred GMC oxidoreductases identified were modeled to gain insight into their structural variation and expected catalytic properties. In contrast to ligninolytic peroxidases, whose genes are present in all white-rot Polyporales genomes and absent from those of brown-rot species, the H2O2-generating oxidases are widely distributed in both fungal types. This indicates that the GMC oxidases provide H2O2 for both ligninolytic peroxidase activity (in white-rot decay) and Fenton attack on cellulose (in brown-rot decay), after the transition between both decay patterns in Polyporales occurred. © 2015 by The Mycological Society of America.

Confirmation of Two Sibling Species among Anopheles fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene.

PubMed

Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan

2012-12-01

Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

The CYP88A cytochrome P450, ent-kaurenoic acid oxidase, catalyzes three steps of the gibberellin biosynthesis pathway

PubMed Central

Helliwell, Chris A.; Chandler, Peter M.; Poole, Andrew; Dennis, Elizabeth S.; Peacock, W. James

2001-01-01

We have shown that ent-kaurenoic acid oxidase, a member of the CYP88A subfamily of cytochrome P450 enzymes, catalyzes the three steps of the gibberellin biosynthetic pathway from ent-kaurenoic acid to GA12. A gibberellin-responsive barley mutant, grd5, accumulates ent-kaurenoic acid in developing grains. Three independent grd5 mutants contain mutations in a gene encoding a member of the CYP88A subfamily of cytochrome P450 enzymes, defined by the maize Dwarf3 protein. Mutation of the Dwarf3 gene gives rise to a gibberellin-responsive dwarf phenotype, but the lesion in the gibberellin biosynthesis pathway has not been identified. Arabidopsis thaliana has two CYP88A genes, both of which are expressed. Yeast strains expressing cDNAs encoding each of the two Arabidopsis and the barley CYP88A enzymes catalyze the three steps of the GA biosynthesis pathway from ent-kaurenoic acid to GA12. Sequence comparison suggests that the maize Dwarf3 locus also encodes ent-kaurenoic acid oxidase. PMID:11172076

NADPH oxidase is not an essential mediator of oxidative stress or liver injury in murine MCD diet-induced steatohepatitis.

PubMed

dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C

2007-02-01

Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.

NADPH oxidase activity and reactive oxygen species production in brain and kidney of adult male hypertensive Ren-2 transgenic rats.

PubMed

Vokurková, M; Rauchová, H; Řezáčová, L; Vaněčková, I; Zicha, J

2015-01-01

Hypothalamic paraventricular nucleus (PVN) and rostral ventrolateral medulla (RVLM) play an important role in brain control of blood pressure (BP). One of the important mechanisms involved in the pathogenesis of hypertension is the elevation of reactive oxygen species (ROS) production by nicotine adenine dinucleotide phosphate (NADPH) oxidase. The aim of our present study was to investigate NADPH oxidase-mediated superoxide (O(2)(-)) production and to search for the signs of lipid peroxidation in hypothalamus and medulla oblongata as well as in renal medulla and cortex of hypertensive male rats transgenic for the murine Ren-2 renin gene (Ren-2 TGR) and their age-matched normotensive controls - Hannover Sprague Dawley rats (HanSD). We found no difference in the activity of NADPH oxidase measured as a lucigenin-mediated O(2)(-) production in the hypothalamus and medulla oblongata. However, we observed significantly elevated NADPH oxidase in both renal cortex and medulla of Ren-2 TGR compared with HanSD. Losartan (LOS) treatment (10 mg/kg body weight/day) for 2 months (Ren-2 TGR+LOS) did not change NADPH oxidase-dependent O(2)(-) production in the kidney. We detected significantly elevated indirect markers of lipid peroxidation measured as thiobarbituric acid-reactive substances (TBARS) in Ren-2 TGR, while they were significantly decreased in Ren-2 TGR+LOS. In conclusion, the present study shows increased NADPH oxidase activities in renal cortex and medulla with significantly increased TBARS in renal cortex. No significant changes of NADPH oxidase and markers of lipid peroxidation were detected in the studied brain regions.

Inhibition of arsenic induced-rat liver injury by grape seed exact through suppression of NADPH oxidase and TGF-{beta}/Smad activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan Xinjuan; Dai Yujie; Li Xing

2011-08-01

Chronic arsenic exposure induces oxidative damage to liver leading to liver fibrosis. We aimed to define the effect of grape seed extract (GSE), an antioxidant dietary supplement, on arsenic-induced liver injury. First, Male Sprague-Dawley rats were exposed to a low level of arsenic in drinking water (30 ppm) with or without GSE (100 mg/kg, every other day by oral gavage) for 12 months and the effect of GSE on arsenic-induced hepatotoxicity was examined. The results from this study revealed that GSE co-treatment significantly attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines and fibrogenic genes. Moreover, GSE reduced arsenic-stimulated Smad2/3more » phosphorylation and protein levels of NADPH oxidase subunits (Nox2, Nox4 and p47phox). Next, we explored the molecular mechanisms underlying GSE inhibition of arsenic toxicity using cultured rat hepatic stellate cells (HSCs). From the in vitro study, we found that GSE dose-dependently reduced arsenic-stimulated ROS production and NADPH oxidase activities. Both NADPH oxidases flavoprotein inhibitor DPI and Nox4 siRNA blocked arsenic-induced ROS production, whereas Nox4 overexpression suppressed the inhibitory effects of GSE on arsenic-induced ROS production and NADPH oxidase activities, as well as expression of TGF-{beta}1, type I procollagen (Coll-I) and {alpha}-smooth muscle actin ({alpha}-SMA) mRNA. We also observed that GSE dose-dependently inhibited TGF-{beta}1-induced transactivation of the TGF-{beta}-induced smad response element p3TP-Lux, and that forced expression of Smad3 attenuated the inhibitory effects of GSE on TGF-{beta}1-induced mRNA expression of Coll-I and {alpha}-SMA. Collectively, GSE could be a potential dietary therapeutic agent for arsenic-induced liver injury through suppression of NADPH oxidase and TGF-{beta}/Smad activation. - Research Highlights: > GSE attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines

Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis

PubMed Central

Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd

2016-01-01

Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD+. The oxidation of NADH to NAD+ was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. PMID:26930704

Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.

PubMed

Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping

2016-05-01

Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.

NADPH oxidases of the brain: distribution, regulation, and function.

PubMed

Infanger, David W; Sharma, Ram V; Davisson, Robin L

2006-01-01

The NADPH oxidase is a multi-subunit enzyme that catalyzes the reduction of molecular oxygen to form superoxide (O(2)(-)). While classically linked to the respiratory burst in neutrophils, recent evidence now shows that O(2)(-) (and associated reactive oxygen species, ROS) generated by NADPH oxidase in nonphagocytic cells serves myriad functions in health and disease. An entire new family of NADPH Oxidase (Nox) homologues has emerged, which vary widely in cell and tissue distribution, as well as in function and regulation. A major concept in redox signaling is that while NADPH oxidase-derived ROS are necessary for normal cellular function, excessive oxidative stress can contribute to pathological disease. This certainly is true in the central nervous system (CNS), where normal NADPH oxidase function appears to be required for processes such as neuronal signaling, memory, and central cardiovascular homeostasis, but overproduction of ROS contributes to neurotoxicity, neurodegeneration, and cardiovascular diseases. Despite implications of NADPH oxidase in normal and pathological CNS processes, still relatively little is known about the mechanisms involved. This paper summarizes the evidence for NADPH oxidase distribution, regulation, and function in the CNS, emphasizing the diversity of Nox isoforms and their new and emerging role in neuro-cardiovascular function. In addition, perspectives for future research and novel therapeutic targets are offered.

Gravity Responsive NADH Oxidase of the Plasma Membrane

NASA Technical Reports Server (NTRS)

Morre, D. James (Inventor)

2002-01-01

A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.

PubMed

Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C

2001-05-04

The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.

Immobilization of Pichia pastoris cells containing alcohol oxidase activity

PubMed Central

Maleknia, S; Ahmadi, H; Norouzian, D

2011-01-01

Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090

The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Long, C.M.; Rohrmann, G.F.; Merrill, G.F., E-mail: merrillg@onid.orst.ed

2009-06-05

Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involvedmore » in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.« less

The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase.

PubMed

Long, C M; Rohrmann, G F; Merrill, G F

2009-06-05

Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.

Cyanobacterial Lactate Oxidases Serve as Essential Partners in N2 Fixation and Evolved into Photorespiratory Glycolate Oxidases in Plants[w

PubMed Central

Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin

2011-01-01

Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292

Crystal Structure of Alcohol Oxidase from Pichia pastoris

PubMed Central

Valerius, Oliver; Feussner, Ivo; Ficner, Ralf

2016-01-01

FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908

Calcium transport in vesicles energized by cytochrome oxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosier, Randy N.

1979-01-01

Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K + selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K + flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interactionmore » with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.« less

ArxA, a new clade of arsenite oxidase within the DMSO reductase family of molybdenum oxidoreductases

USGS Publications Warehouse

Zargar, Kamrun; Conrad, Alison; Bernick, David L.; Lowe, Todd M.; Stolc, Viktor; Hoeft, Shelley; Oremland, Ronald S.; Stolz, John; Saltikov, Chad W.

2012-01-01

Arsenotrophy, growth coupled to autotrophic arsenite oxidation or arsenate respiratory reduction, occurs only in the prokaryotic domain of life. The enzymes responsible for arsenotrophy belong to distinct clades within the DMSO reductase family of molybdenum-containing oxidoreductases: specifically arsenate respiratory reductase, ArrA, and arsenite oxidase, AioA (formerly referred to as AroA and AoxB). A new arsenite oxidase clade, ArxA, represented by the haloalkaliphilic bacterium Alkalilimnicola ehrlichii strain MLHE-1 was also identified in the photosynthetic purple sulfur bacterium Ectothiorhodospira sp. strain PHS-1. A draft genome sequence of PHS-1 was completed and an arx operon similar to MLHE-1 was identified. Gene expression studies showed that arxA was strongly induced with arsenite. Microbial ecology investigation led to the identification of additional arxA-like sequences in Mono Lake and Hot Creek sediments, both arsenic-rich environments in California. Phylogenetic analyses placed these sequences as distinct members of the ArxA clade of arsenite oxidases. ArxA-like sequences were also identified in metagenome sequences of several alkaline microbial mat environments of Yellowstone National Park hot springs. These results suggest that ArxA-type arsenite oxidases appear to be widely distributed in the environment presenting an opportunity for further investigations of the contribution of Arx-dependent arsenotrophy to the arsenic biogeochemical cycle.

Key role of alternative oxidase in lovastatin solid-state fermentation.

PubMed

Pérez-Sánchez, Ailed; Uribe-Carvajal, Salvador; Cabrera-Orefice, Alfredo; Barrios-González, Javier

2017-10-01

Lovastatin is a commercially important secondary metabolite produced by Aspergillus terreus, either by solid-state fermentation or by submerged fermentation. In a previous work, we showed that reactive oxygen species (ROS) accumulation in idiophase positively regulates lovastatin biosynthetic genes. In addition, it has been found that lovastatin-specific production decreases with aeration in solid-state fermentation (SSF). To study this phenomenon, we determined ROS accumulation during lovastatin SSF, under high and low aeration conditions. Paradoxically, high aeration caused lower ROS accumulation, and this was the underlying reason of the aeration effect on lovastatin production. Looking for a mechanism that is lowering ROS production under those conditions, we studied alternative respiration. The alternative oxidase provides an alternative route for electrons passing through the electron transport chain to reduce oxygen. Here, we showed that an alternative oxidase (AOX) is expressed in SSF, and only during idiophase. It was shown that higher aeration induces higher alternative respiration (AOX activity), and this is a mechanism that limits ROS generation and keeps them within healthy limits and adequate signaling limits for lovastatin production. Indeed, the aox gene was induced in idiophase, i.e., at the time of ROS accumulation. Moreover, exogenous ROS (H 2 O 2 ), added to lovastatin solid-state fermentation, induced higher AOX activity. This suggests that high O 2 availability in SSF generates dangerously high ROS, so alternative respiration is induced in SSF, indirectly favoring lovastatin production. Conversely, alternative respiration was not detected in lovastatin-submerged fermentation (SmF), although exogenous ROS also induced relatively low AOX activity in SmF.

Enzymatic improvement of mitochondrial thiol oxidase Erv1 for oxidized glutathione fermentation by Saccharomyces cerevisiae.

PubMed

Kobayashi, Jyumpei; Sasaki, Daisuke; Hara, Kiyotaka Y; Hasunuma, Tomohisa; Kondo, Akihiko

2017-03-15

Oxidized glutathione (GSSG) is the preferred form for industrial mass production of glutathione due to its high stability compared with reduced glutathione (GSH). In our previous study, over-expression of the mitochondrial thiol oxidase ERV1 gene was the most effective for high GSSG production in Saccharomyces cerevisiae cells among three types of different thiol oxidase genes. We improved Erv1 enzyme activity for oxidation of GSH and revealed that S32 and N34 residues are critical for the oxidation. Five engineered Erv1 variant proteins containing S32 and/or N34 replacements exhibited 1.7- to 2.4-fold higher in vitro GSH oxidation activity than that of parental Erv1, whereas the oxidation activities of these variants for γ-glutamylcysteine were comparable. According to three-dimensional structures of Erv1 and protein stability assays, S32 and N34 residues interact with nearby residues through hydrogen bonding and greatly contribute to protein stability. These results suggest that increased flexibility by amino acid replacements around the active center decrease inhibitory effects on GSH oxidation. Over-expressions of mutant genes coding these Erv1 variants also increased GSSG and consequently total glutathione production in S. cerevisiae cells. Over-expression of the ERV1 S32A gene was the most effective for GSSG production in S. cerevisiae cells among the parent and other mutant genes, and it increased GSSG production about 1.5-fold compared to that of the parental ERV1 gene. This is the first study demonstrating the pivotal effects of S32 and N34 residues to high GSH oxidation activity of Erv1. Furthermore, in vivo validity of Erv1 variants containing these S32 and N34 replacements were also demonstrated. This study indicates potentials of Erv1 for high GSSG production.

Pacific oyster polyamine oxidase: a protein missing link in invertebrate evolution.

PubMed

Cervelli, Manuela; Polticelli, Fabio; Angelucci, Emanuela; Di Muzio, Elena; Stano, Pasquale; Mariottini, Paolo

2015-05-01

Polyamine oxidases catalyse the oxidation of polyamines and acetylpolyamines and are responsible for the polyamine interconversion metabolism in animal cells. Polyamine oxidases from yeast can oxidize spermine, N(1)-acetylspermine, and N(1)-acetylspermidine, while in vertebrates two different enzymes, namely spermine oxidase and acetylpolyamine oxidase, specifically catalyse the oxidation of spermine, and N(1)-acetylspermine/N(1)-acetylspermidine, respectively. In this work we proved that the specialized vertebrate spermine and acetylpolyamine oxidases have arisen from an ancestor invertebrate polyamine oxidase with lower specificity for polyamine substrates, as demonstrated by the enzymatic activity of the mollusc polyamine oxidase characterized here. This is the first report of an invertebrate polyamine oxidase, the Pacific oyster Crassostrea gigas (CgiPAO), overexpressed as a recombinant protein. This enzyme was biochemically characterized and demonstrated to be able to oxidase both N(1)-acetylspermine and spermine, albeit with different efficiency. Circular dichroism analysis gave an estimation of the secondary structure content and modelling of the three-dimensional structure of this protein and docking studies highlighted active site features. The availability of this pluripotent enzyme can have applications in crystallographic studies and pharmaceutical biotechnologies, including anticancer therapy as a source of hydrogen peroxide able to induce cancer cell death.

Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

PubMed

Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

2017-02-09

In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

PubMed

Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

2014-07-15

Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.

Diverse Bacteria with Lignin Degrading Potentials Isolated from Two Ranks of Coal

PubMed Central

Wang, Lu; Nie, Yong; Tang, Yue-Qin; Song, Xin-Min; Cao, Kun; Sun, Li-Zhu; Wang, Zhi-Jian; Wu, Xiao-Lei

2016-01-01

Taking natural coal as a “seed bank” of bacterial strains able to degrade lignin that is with molecular structure similar to coal components, we isolated 393 and 483 bacterial strains from a meager lean coal sample from Hancheng coalbed and a brown coal sample from Bayannaoer coalbed, respectively, by using different media. Statistical analysis showed that isolates were significantly more site-specific than medium-specific. Of the 876 strains belonging to 27 genera in Actinobacteria, Firmicutes, and Proteobacteria, 612 were positive for lignin degradation function, including 218 strains belonging to 35 species in Hancheng and 394 strains belonging to 19 species in Zhongqi. Among them, the dominant lignin-degrading strains were Thauera (Hancheng), Arthrobacter (Zhongqi) and Rhizobium (both). The genes encoding the laccases- or laccase-like multicopper oxidases, key enzymes in lignin production and degradation, were detected in three genera including Massila for the first time, which was in high expression by real time PCR (qRT-PCR) detection, confirming coal as a good seed bank. PMID:27667989

D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate.

PubMed

El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K

2012-01-01

Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.

1-Aminocyclopropane-1-carboxylic acid oxidase reaction mechanism and putative post-translational activities of the ACCO protein

PubMed Central

Dilley, David R.; Wang, Zhenyong; Kadirjan-Kalbach, Deena K.; Ververidis, Fillipos; Beaudry, Randolph; Padmanabhan, Kallaithe

2013-01-01

1-Aminocyclopropane-1-carboxylic acid (ACC) oxidase (ACCO) catalyses the final step in ethylene biosynthesis converting ACC to ethylene, cyanide, CO2, dehydroascorbate and water with inputs of Fe(II), ascorbate, bicarbonate (as activators) and oxygen. Cyanide activates ACCO. A ‘nest’ comprising several positively charged amino acid residues from the C-terminal α-helix 11 along with Lys158 and Arg299 are proposed as binding sites for ascorbate and bicarbonate to coordinately activate the ACCO reaction. The binding sites for ACC, bicarbonate and ascorbic acid for Malus domestica ACCO1 include Arg175, Arg244, Ser246, Lys158, Lys292, Arg299 and Phe300. Glutamate 297, Phe300 and Glu301 in α-helix 11 are also important for the ACCO reaction. Our proposed reaction pathway incorporates cyanide as an ACCO/Fe(II) ligand after reaction turnover. The cyanide ligand is likely displaced upon binding of ACC and ascorbate to provide a binding site for oxygen. We propose that ACCO may be involved in the ethylene signal transduction pathway not directly linked to the ACCO reaction. ACC oxidase has significant homology with Lycopersicon esculentum cysteine protease LeCp, which functions as a protease and as a regulator of 1-aminocyclopropane-1-carboxylic acid synthase (Acs2) gene expression. ACC oxidase may play a similar role in signal transduction after post-translational processing. ACC oxidase becomes inactivated by fragmentation and apparently has intrinsic protease and transpeptidase activity. ACC oxidase contains several amino acid sequence motifs for putative protein–protein interactions, phosphokinases and cysteine protease. ACC oxidase is subject to autophosphorylaton in vitro and promotes phosphorylation of some apple fruit proteins in a ripening-dependent manner. PMID:24244837

Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution

PubMed Central

Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

2013-01-01

Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

PubMed Central

Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren

2015-01-01

Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

Inhibition of Human Vascular NADPH Oxidase by Apocynin Derived Oligophenols

PubMed Central

Mora-Pale, Mauricio; Weïwer, Michel; Yu, Jingjing; Linhardt, Robert J.; Dordick, Jonathan S.

2009-01-01

Enzymatic oxidation of apocynin, which may mimic in vivo metabolism, affords a large number of oligomers (apocynin oxidation products, AOP) that inhibit vascular NADPH oxidase. In vitro studies of NADPH oxidase activity were performed to identify active inhibitors, resulting in a trimer hydroxylated quinone (IIIHyQ) that inhibited NADPH oxidase with an IC50 = 31 nM. Apocynin itself possessed minimal inhibitory activity. NADPH oxidase is believed to be inhibited through prevention of the interaction between two NADPH oxidase subunits, p47phox and p22phox. To that end, while apocynin was unable to block the interaction of his-tagged p47phox with a surface immobilized biotinalyted p22phox peptide, the IIIHyQ product strongly interfered with this interaction (apparent IC50 = 1.6 μM). These results provide evidence that peroxidase-catalyzed AOP, which consist of oligomeric phenols and quinones, inhibit critical interactions that are involved in the assembly and activation of human vascular NADPH oxidase. PMID:19523836

Current status of NADPH oxidase research in cardiovascular pharmacology.

PubMed

Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Alvarez, Ezequiel

2013-01-01

The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new

Current status of NADPH oxidase research in cardiovascular pharmacology

PubMed Central

Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Álvarez, Ezequiel

2013-01-01

The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new

Investigating the Production of Foreign Membrane Proteins in Tobacco Chloroplasts: Expression of an Algal Plastid Terminal Oxidase

PubMed Central

Ahmad, Niaz; Michoux, Franck; Nixon, Peter J.

2012-01-01

Chloroplast transformation provides an inexpensive, easily scalable production platform for expression of recombinant proteins in plants. However, this technology has been largely limited to the production of soluble proteins. Here we have tested the ability of tobacco chloroplasts to express a membrane protein, namely plastid terminal oxidase 1 from the green alga Chlamydomonas reinhardtii (Cr-PTOX1), which is predicted to function as a plastoquinol oxidase. A homoplastomic plant containing a codon-optimised version of the nuclear gene encoding PTOX1, driven by the 16S rRNA promoter and 5′UTR of gene 10 from phage T7, was generated using a particle delivery system. Accumulation of Cr-PTOX1 was shown by immunoblotting and expression in an enzymatically active form was confirmed by using chlorophyll fluorescence to measure changes in the redox state of the plastoquinone pool in leaves. Growth of Cr-PTOX1 expressing plants was, however, more sensitive to high light than WT. Overall our results confirm the feasibility of using plastid transformation as a means of expressing foreign membrane proteins in the chloroplast. PMID:22848578

Oxygen activation in flavoprotein oxidases: the importance of being positive.

PubMed

Gadda, Giovanni

2012-04-03

The oxidation of flavin hydroquinones by O(2) in solution is slow, with second-order rate constants of ~250 M(-1) s(-1). This is due to the obligatory, single-electron transfer that initiates the reaction being thermodynamically unfavored and poorly catalyzed. Notwithstanding considerations of O(2) accessibility to the reaction site, its desolvation and geometry and other factors that can also contribute to further rate acceleration, flavoprotein oxidases must activate O(2) for reaction with flavin hydroquinones to be able to achieve the 100-1000-fold rate enhancements typically observed. Protein positive charges have been identified in glucose oxidase, monomeric sarcosine oxidase, N-methyltryptophan oxidase and fructosamine oxidase that electrostatically stabilize the transition state for the initial single electron transfer that generates the O(2)(-•)/flavin semiquinone radical pair. In choline oxidase despite the presence of three histidines in the active site, the trimethylammonium group of the reaction product provides such an electrostatic stabilization. A nonpolar site proximal to the flavin C(4a) atom in choline oxidase has also been identified, which contributes to the geometry and desolvation of the O(2) reaction site. The relevance of O(2) activation by product charges to other flavoprotein oxidases, such as for example those catalyzing amine oxidations, is discussed in this review. A nonpolar site close to the flavin C(4a) atom and a positive charge is identified through structural analysis in several flavoprotein oxidases. Mutagenesis has disclosed nonpolar sites in O(2)-reducing enzymes that utilize copper/TPQ or iron. It is predicted that classes of O(2)-reducing enzymes utilizing other cofactors also contain a similar catalytic motif.

The First Mammalian Aldehyde Oxidase Crystal Structure

PubMed Central

Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T. P.; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João

2012-01-01

Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 Å. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity. PMID:23019336

Generating disulfides with the quiescin sulfhydryl oxidases

PubMed Central

Heckler, Erin J.; Rancy, Pumtiwitt C.; Kodali, Vamsi K.; Thorpe, Colin

2008-01-01

The Quiescin-sulfhydryl oxidase (QSOX) family of flavoenzymes catalyzes the direct and facile insertion of disulfide bonds into unfolded reduced proteins with concomitant reduction of oxygen to hydrogen peroxide. This review discusses the chemical mechanism of these enzymes and the involvement of thioredoxin and flavin-binding domains in catalysis. The variability of CxxC motifs in the QSOX family is highlighted and attention is drawn to the steric factors that may promote efficient thiol/disulfide exchange during oxidative protein folding. The varied cellular location of these multi-domain sulfhydryl oxidases is reviewed and potential intracellular and extracellular roles are summarized. Finally, this review identifies important unresolved questions concerning this ancient family of sulfhydryl oxidases. PMID:17980160

Analysis of the 5′ untranslated region (5′UTR) of the alcohol oxidase 1 (AOX1) gene in recombinant protein expression in Pichia pastoris

PubMed Central

Staley, Chris A.; Huang, Amy; Nattestad, Maria; Oshiro, Kristin T.; Ray, Laura E.; Mulye, Tejas; Li, Zhiguo Harry; Le, Thu; Stephens, Justin J.; Gomez, Seth R.; Moy, Allison D.; Nguyen, Jackson C.; Franz, Andreas H.; Lin-Cereghino, Joan; Lin-Cereghino, Geoff P.

2012-01-01

Pichia pastoris is a methylotrophic yeast that has been genetically engineered to express over one thousand heterologous proteins valued for industrial, pharmaceutical and basic research purposes. In most cases, the 5′ untranslated region (UTR) of the alcohol oxidase 1 (AOX1) gene is fused to the coding sequence of the recombinant gene for protein expression in this yeast. Because the effect of the AOX1 5′UTR on protein expression is not known, site-directed mutagenesis was performed in order to decrease or increase the length of this region. Both of these types of changes were shown to affect translational efficiency, not transcript stability. While increasing the length of the 5′UTR clearly decreased expression of a β-galactosidase reporter in a proportional manner, a deletion analysis demonstrated that the AOX1 5′UTR contains a complex mixture of both positive and negative cis-acting elements, suggesting that the construction of a synthetic 5′UTR optimized for a higher level of expression may be challenging. PMID:22285974

Monoamine Oxidase A gene polymorphisms and self reported aggressive behaviour in a Pakistani ethnic group.

PubMed

Shah, Syed Shoaib; Mohyuddin, Aisha; Colonna, Vincenza; Mehdi, Syed Qasim; Ayub, Qasim

2015-08-01

To investigate the association of monoamine oxidase Agene polymorphisms with aggression. The study was conducted in an ethnic community in Lahore, Pakistan, from August 2008 to December 2009 on the basis of data that was collected through a questionnaire between August 2004 and September 2005. It analysed 10 single nucleotide polymorphisms of monoamine oxidase A in unrelated males from the same ethnic background who were administered a Punjabi translation of the Buss and Perry aggression questionnaire. SPSS 13 was used for statistical analysis. Of the total 133 haplotypes studied, 52(39%) were Haplotype A, 58(43.6%) B, 8(6%) C, 3(2.3%) D, 9(6.8%) E and 3(2.3%) F. The six haplotypes were analysed for association with scores of the four subscales of the aggression questionnaire and multivariate analysis of variance showed no significant differences (p>0.05 each) in the error variances of the total scores and scores for three of the sub-scales across the haplotypes. The variance was significantly different only for the anger sub-scale (p<0.05). The association of an extended haplotype with low levels of self-reported aggression in this study should assist in characterisation of functional variants responsible for non-aggressive behaviour in male subjects.

Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

PubMed Central

Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

2014-01-01

Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

THE PREPARATION AND PROPERTIES OF HIGHLY PURIFIED ASCORBIC ACID OXIDASE

PubMed Central

Powers, Wendell H.; Lewis, Stanley; Dawson, Charles R.

1944-01-01

1. A method is described for the preparation of a highly purified ascorbic acid oxidase containing 0.24 per cent copper. 2. Using comparable activity measurements, this oxidase is about one and a half times as active on a dry weight basis as the hitherto most highly purified preparation described by Lovett-Janison and Nelson. The latter contained 0.15 per cent copper. 3. The oxidase activity is proportional to the copper content and the proportionality factor is the same as that reported by Lovett-Janison and Nelson. 4. When dialyzed free of salt, the blue concentrated oxidase solutions precipitate a dark green-blue protein which carries the activity. This may be prevented by keeping the concentrated solutions about 0.1 M in Na2HPO4. 5. When highly diluted for activity measurements the oxidase rapidly loses activity (irreversibly) previous to the measurement, unless the dilution is made with a dilute inert protein (gelatin) solution. Therefore activity values obtained using such gelatin-stabilized dilute solutions of the oxidase run considerably higher than values obtained by the Lovett-Janison and Nelson technique. 6. The effect of pH and substrate concentration on the activity of the purified oxidase in the presence and absence of inert protein was studied. PMID:19873382

Genome-Wide Identification and Expression Profiling of Cytokinin Oxidase/Dehydrogenase (CKX) Genes Reveal Likely Roles in Pod Development and Stress Responses in Oilseed Rape (Brassica napus L.).

PubMed

Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na

2018-03-16

Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.

Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.

PubMed

Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang

2013-02-01

Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.

Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats.

PubMed

Gudkova, O O; Latyshko, N V; Shandrenko, S G

2016-01-01

In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.

Why Orange Guaymas Basin Beggiatoa spp. Are Orange: Single-Filament-Genome-Enabled Identification of an Abundant Octaheme Cytochrome with Hydroxylamine Oxidase, Hydrazine Oxidase, and Nitrite Reductase Activities

PubMed Central

Biddle, Jennifer F.; Siebert, Jason R.; Staunton, Eric; Hegg, Eric L.; Matthysse, Ann G.; Teske, Andreas

2013-01-01

Orange, white, and yellow vacuolated Beggiatoaceae filaments are visually dominant members of microbial mats found near sea floor hydrothermal vents and cold seeps, with orange filaments typically concentrated toward the mat centers. No marine vacuolate Beggiatoaceae are yet in pure culture, but evidence to date suggests they are nitrate-reducing, sulfide-oxidizing bacteria. The nearly complete genome sequence of a single orange Beggiatoa (“Candidatus Maribeggiatoa”) filament from a microbial mat sample collected in 2008 at a hydrothermal site in Guaymas Basin (Gulf of California, Mexico) was recently obtained. From this sequence, the gene encoding an abundant soluble orange-pigmented protein in Guaymas Basin mat samples (collected in 2009) was identified by microcapillary reverse-phase high-performance liquid chromatography (HPLC) nano-electrospray tandem mass spectrometry (μLC–MS-MS) of a pigmented band excised from a denaturing polyacrylamide gel. The predicted protein sequence is related to a large group of octaheme cytochromes whose few characterized representatives are hydroxylamine or hydrazine oxidases. The protein was partially purified and shown by in vitro assays to have hydroxylamine oxidase, hydrazine oxidase, and nitrite reductase activities. From what is known of Beggiatoaceae physiology, nitrite reduction is the most likely in vivo role of the octaheme protein, but future experiments are required to confirm this tentative conclusion. Thus, while present-day genomic and proteomic techniques have allowed precise identification of an abundant mat protein, and its potential activities could be assayed, proof of its physiological role remains elusive in the absence of a pure culture that can be genetically manipulated. PMID:23220958

Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.

PubMed

Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P

1995-07-01

Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.

Two NADPH oxidase isoforms are required for sexual reproduction and ascospore germination in the filamentous fungus Podospora anserina.

PubMed

Malagnac, Fabienne; Lalucque, Hervé; Lepère, Gersende; Silar, Philippe

2004-11-01

NADPH oxidases are enzymes that produce reactive oxygen species (ROS) using electrons derived from intracellular NADPH. In plants and mammals, ROS have been proposed to be second messengers that signal defence responses or cell proliferation. By inactivating PaNox1 and PaNox2, two genes encoding NADPH oxidases, we demonstrate the crucial role of these enzymes in the control of two key steps of the filamentous fungus Podospora anserina life cycle. PaNox1 mutants are impaired in the differentiation of fruiting bodies from their progenitor cells, and the deletion of the PaNox2 gene specifically blocks ascospore germination. Furthermore, we show that PaNox1 likely acts upstream of PaASK1, a MAPKKK previously implicated in stationary phase differentiation and cell degeneration. Using nitro blue tetrazolium (NBT) and diaminobenzidine (DAB) assays, we detect a regulated secretion of both superoxide and peroxide during P. anserina vegetative growth. In addition, two oxidative bursts are shown to occur during fruiting body development and ascospore germination. Analysis of mutants establishes that PaNox1, PaNox2, and PaASK1, as well as a still unknown additional source of ROS, modulate these secretions. Altogether, our data point toward a role for NADPH oxidases in signalling fungal developmental transitions with respect to nutrient availability. These enzymes are conserved in other multicellular eukaryotes, suggesting that early eukaryotes were endowed with a redox network used for signalling purposes.

Expression and functional analysis of the lysine decarboxylase and copper amine oxidase genes from the endophytic fungus Colletotrichum gloeosporioides ES026.

PubMed

Zhang, Xiangmei; Wang, Zhangqian; Jan, Saad; Yang, Qian; Wang, Mo

2017-06-05

Huperzine A (HupA) isolated from Huperzia serrata is an important compound used to treat Alzheimer's disease (AD). Recently, HupA was reported in various endophytic fungi, with Colletotrichum gloeosporioides ES026 previously isolated from H. serrata shown to produce HupA. In this study, we performed next-generation sequencing and de novo RNA sequencing of C. gloeosporioides ES026 to elucidate the molecular functions, biological processes, and biochemical pathways of these unique sequences. Gene ontology and Kyoto Encyclopedia of Genes and Genomes assignments allowed annotation of lysine decarboxylase (LDC) and copper amine oxidase (CAO) for their conversion of L-lysine to 5-aminopentanal during HupA biosynthesis. Additionally, we constructed a stable, high-yielding HupA-expression system resulting from the overexpression of CgLDC and CgCAO from the HupA-producing endophytic fungus C. gloeosporioides ES026 in Escherichia coli. Quantitative reverse transcription polymerase chain reaction analysis confirmed CgLDC and CgCAO expression, and quantitative determination of HupA levels was assessed by liquid chromatography high-resolution mass spectrometry, which revealed that elevated expression of CgLDC and CgCAO produced higher yields of HupA than those derived from C. gloeosporioides ES026. These results revealed CgLDC and CgCAO involvement in HupA biosynthesis and their key role in regulating HupA content in C. gloeosporioides ES026.

Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza

PubMed Central

Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

2017-01-01

Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag+-responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism. PMID:28304398

Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza.

PubMed

Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

2017-03-17

Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.

Heterologous expression and characterization of mouse spermine oxidase.

PubMed

Cervelli, Manuela; Polticelli, Fabio; Federico, Rodolfo; Mariottini, Paolo

2003-02-14

Polyamine oxidases are key enzymes responsible of the polyamine interconversion metabolism in animal cells. Recently, a novel enzyme belonging to this class of enzymes has been characterized for its capability to oxidize preferentially spermine and designated as spermine oxidase. This is a flavin adenine dinucleotide-containing enzyme, and it has been expressed both in vitro and in vivo systems. The primary structure of mouse spermine oxidase (mSMO) was deduced from a cDNA clone (Image Clone 264769) recovered by a data base search utilizing the human counterpart of polyamine oxidases, PAOh1. The open reading frame predicts a 555-amino acid protein with a calculated M(r) of 61,852.30, which shows a 95.1% identity with PAOh1. To understand the biochemical properties of mSMO and its structure/function relationship, the mSMO cDNA has been subcloned and expressed in secreted and secreted-tagged forms into Escherichia coli BL21 DE3 cells. The recombinant enzyme shows an optimal pH value of 8.0 and is able to oxidize rapidly spermine to spermidine and 3-aminopropanal and fails to act upon spermidine and N(1)-acetylpolyamines. The purified recombinant-tagged form enzyme (M(r) approximately 68,000) has K(m) and k(cat) values of 90 microm and 4.5 s(-1), respectively, using spermine as substrate at pH 8.0. Molecular modeling of mSMO protein based on maize polyamine oxidase three-dimensional structure suggests that the general features of maize polyamine oxidase active site are conserved in mSMO.

A transgenic apple callus showing reduced polyphenol oxidase activity and lower browning potential.

PubMed

Murata, M; Nishimura, M; Murai, N; Haruta, M; Homma, S; Itoh, Y

2001-02-01

Polyphenol oxidase (PPO) is responsible for enzymatic browning of apples. Apples lacking PPO activity might be useful not only for the food industry but also for studies of the metabolism of polyphenols and the function of PPO. Transgenic apple calli were prepared by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistant gene and antisense PPO gene. Four KM-resistant callus lines were obtained from 356 leaf explants. Among these transgenic calli, three calli grew on the medium containing KM at the same rate as non-transgenic callus on the medium without KM. One callus line had an antisense PPO gene, in which the amount and activity of PPO were reduced to half the amount and activity in non-transgenic callus. The browning potential of this line, which was estimated by adding chlorogenic acid, was also half the browning potential of non-transgenic callus.

Monoamine Oxidase A (MAOA) Gene and Personality Traits from Late Adolescence through Early Adulthood: A Latent Variable Investigation

PubMed Central

Xu, Man K.; Gaysina, Darya; Tsonaka, Roula; Morin, Alexandre J. S.; Croudace, Tim J.; Barnett, Jennifer H.; Houwing-Duistermaat, Jeanine; Richards, Marcus; Jones, Peter B.

2017-01-01

Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene (MAOA) on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD). The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606). Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG) was associated with lower extraversion score at age 16 (β = −0.167; CI: −0.289, −0.045; p = 0.007, FDRp = 0.042), as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036). No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits. PMID:29075213

Monoamine Oxidase A (MAOA) Gene and Personality Traits from Late Adolescence through Early Adulthood: A Latent Variable Investigation.

PubMed

Xu, Man K; Gaysina, Darya; Tsonaka, Roula; Morin, Alexandre J S; Croudace, Tim J; Barnett, Jennifer H; Houwing-Duistermaat, Jeanine; Richards, Marcus; Jones, Peter B

2017-01-01

Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene ( MAOA ) on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD). The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606). Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG) was associated with lower extraversion score at age 16 (β = -0.167; CI: -0.289, -0.045; p = 0.007, FDRp = 0.042), as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036). No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits.

Putting together a plasma membrane NADH oxidase: a tale of three laboratories.

PubMed

Löw, Hans; Crane, Frederick L; Morré, D James

2012-11-01

The observation that high cellular concentrations of NADH were associated with low adenylate cyclase activity led to a search for the mechanism of the effect. Since cyclase is in the plasma membrane, we considered the membrane might have a site for NADH action, and that NADH might be oxidized at that site. A test for NADH oxidase showed very low activity, which could be increased by adding growth factors. The plasma membrane oxidase was not inhibited by inhibitors of mitochondrial NADH oxidase such as cyanide, rotenone or antimycin. Stimulation of the plasma membrane oxidase by iso-proterenol or triiodothyronine was different from lack of stimulation in endoplasmic reticulum. After 25 years of research, three components of a trans membrane NADH oxidase have been discovered. Flavoprotein NADH coenzyme Q reductases (NADH cytochrome b reductase) on the inside, coenzyme Q in the middle, and a coenzyme Q oxidase on the outside as a terminal oxidase. The external oxidase segment is a copper protein with unique properties in timekeeping, protein disulfide isomerase and endogenous NADH oxidase activity, which affords a mechanism for control of cell growth by the overall NADH oxidase and the remarkable inhibition of oxidase activity and growth of cancer cells by a wide range of anti-tumor drugs. A second trans plasma membrane electron transport system has been found in voltage dependent anion channel (VDAC), which has NADH ferricyanide reductase activity. This activity must be considered in relation to ferricyanide stimulation of growth and increased VDAC antibodies in patients with autism. Copyright © 2012 Elsevier Ltd. All rights reserved.

In Situ Enzymatically Generated Photoswitchable Oxidase Mimetics and Their Application for Colorimetric Detection of Glucose Oxidase.

PubMed

Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li

2016-07-09

In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.

DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

PubMed

Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R

1994-10-01

We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

Characterization of oxidative phosphorylation in the colorless chlorophyte Polytomella sp. Its mitochondrial respiratory chain lacks a plant-like alternative oxidase.

PubMed

Reyes-Prieto, Adrián; El-Hafidi, Mohammed; Moreno-Sánchez, Rafael; González-Halphen, Diego

2002-07-01

The presence of an alternative oxidase (AOX) in Polytomella sp., a colorless relative of Chlamydomonas reinhardtii, was explored. Oxygen uptake in Polytomella sp. mitochondria was inhibited by KCN (94%) or antimycin (96%), and the remaining cyanide-resistant respiration was not blocked by the AOX inhibitors salicylhydroxamic acid (SHAM) or n-propylgallate. No stimulation of an AOX activity was found upon addition of either pyruvate, alpha-ketoglutarate, or AMP, or by treatment with DTT. An antibody raised against C. reinhardtii AOX did not recognized any polypeptide band of Polytomella sp. mitochondria in Western blots. Also, PCR experiments and Southern blot analysis failed to identify an Aox gene in this colorless alga. Finally, KCN exposure of cell cultures failed to stimulate an AOX activity. Nevertheless, KCN exposure of Polytomella sp. cells induced diminished mitochondrial respiration (20%) and apparent changes in cytochrome c oxidase affinity towards cyanide. KCN-adapted cells exhibited a significant increase of a-type cytochromes, suggesting accumulation of inactive forms of cytochrome c oxidase. Another effect of KCN exposure was the reduction of the protein/fatty acid ratio of mitochondrial membranes, which may affect the observed respiratory activity. We conclude that Polytomella lacks a plant-like AOX, and that its corresponding gene was probably lost during the divergence of this colorless genus from its close photosynthetic relatives.

Thermostable and highly specific L-aspartate oxidase from Thermococcus litoralis DSM 5473: cloning, overexpression, and enzymological properties.

PubMed

Washio, Tsubasa; Oikawa, Tadao

2018-01-01

We successfully expressed the L-aspartate oxidase homolog gene (accession no: OCC_06611) of Thermococcus litoralis DSM 5473 in the soluble fraction of Escherichia coli BL21 (DE3) using a pET21b vector with 6X His tag at its C-terminus. The gene product (Tl-LASPO) showed L-aspartate oxidase activity in the presence of FAD in vitro, and this report is the first that details an L-aspartate oxidase derived from a Thermococcus species. The homologs of Tl-LASPO existed mainly in archaea, especially in the genus of Thermococcus, Pyrococcus, Sulfolobus, and Halobacteria. The quaternary structure of Tl-LASPO was homotrimeric with a subunit molecular mass of 52 kDa. The enzyme activity of Tl-LASPO increased with temperature up to 70 °C. Tl-LASPO was active from pH 6.0 to 9.0, and its highest activity was at pH 8.0. Tl-LASPO was stable at 80 °C for 1 h. The highest k cat /K m value was observed in assays at 70 °C. Tl-LASPO was highly specific for L-aspartic acid. Tl-LASPO utilized fumaric acid, 2,6-dichlorophenolindophenol, and ferricyanide in addition to FAD as a cofactor under anaerobic conditions. The absorption spectrum of holo-Tl-LASPO exhibited maxima at 380 and 450 nm. The FAD dissociation constant, K d , of the FAD-Tl-LASPO complex was determined to be 5.9 × 10 -9 M.

NADPH oxidases: novel therapeutic targets for neurodegenerative diseases.

PubMed

Gao, Hui-Ming; Zhou, Hui; Hong, Jau-Shyong

2012-06-01

Oxidative stress is a key pathologic factor in neurodegenerative diseases such as Alzheimer and Parkinson diseases (AD, PD). The failure of free-radical-scavenging antioxidants in clinical trials pinpoints an urgent need to identify and to block major sources of oxidative stress in neurodegenerative diseases. As a major superoxide-producing enzyme complex in activated phagocytes, phagocyte NADPH oxidase (PHOX) is essential for host defense. However, recent preclinical evidence has underscored a pivotal role of overactivated PHOX in chronic neuroinflammation and progressive neurodegeneration. Deficiency in PHOX subunits mitigates neuronal damage induced by diverse insults/stresses relevant to neurodegenerative diseases. More importantly, suppression of PHOX activity correlates with reduced neuronal impairment in models of neurodegenerative diseases. The discovery of PHOX and non-phagocyte NADPH oxidases in astroglia and neurons further reinforces the crucial role of NADPH oxidases in oxidative stress-mediated chronic neurodegeneration. Thus, proper modulation of NADPH oxidase activity might hold therapeutic potential for currently incurable neurodegenerative diseases. Published by Elsevier Ltd.

Molecular cloning, expression, and functional analysis of the copper amine oxidase gene in the endophytic fungus Shiraia sp. Slf14 from Huperzia serrata.

PubMed

Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du

2016-12-01

Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.

Pulse-radiolysis studies on the interaction of one-electron reduced species with blue oxidases. Reduction of type-2-copper-depleted ascorbate oxidase.

PubMed

O'Neill, P; Fielden, E M; Avigliano, L; Marcozzi, G; Ballini, A; Agrò, F

1984-08-15

The interaction of one-electron reduced metronidazole (ArNO2.-) with native and Type-2-copper-depleted ascorbate oxidase were studied in buffered aqueous solution at pH 6.0 and 7.4 by using the technique of pulse radiolysis. With ArNO2.-, reduction of Type 1 copper of the native enzyme and of the Type-2-copper-depleted ascorbate oxidase occurs via a bimolecular step and at the same rate. Whereas the native protein accepts, in the absence of O2, 6-7 reducing equivalents, Type-2-copper-depleted ascorbate oxidase accepts only 3 reducing equivalents with stoichiometric reduction of Type 1 copper. On reaction of O2.- with ascorbate oxidase under conditions of [O2.-] much greater than [ascorbate oxidase], removal of Type 2 copper results in reduction of all the Type 1 copper atoms, in contrast with reduction of the equivalent of only one Type 1 copper atom in the holoprotein. From observations at 610 nm, the rate of reduction of ascorbate oxidase by O2.- is not dependent on the presence of Type 2 copper. For the holoprotein, no significant optical-absorption changes were observed at 330 nm. It is proposed that electrons enter the protein via Type 1 copper in a rate-determining step followed by a fast intramolecular transfer of electrons within the protein. For the Type-2-copper-depleted protein, intramolecular transfer within the protein, however, is slow or does not occur. In the presence of O2, it is also suggested that re-oxidation of the partially reduced holoprotein occurs at steady state, as inferred from the observations at 330 nm and 610 nm. The role of Type 2 copper in ascorbate oxidase is discussed in terms of its involvement in redistribution of electrons within the protein or structural considerations.

Genotypes and clinical phenotypes in children with cytochrome-c oxidase deficiency.

PubMed

Darin, N; Moslemi, A-R; Lebon, S; Rustin, P; Holme, E; Oldfors, A; Tulinius, M

2003-12-01

Cytochrome c oxidase (COX) deficiency has been associated with a wide spectrum of clinical features and may be caused by mutations in different genes of both the mitochondrial and the nuclear DNA. In an attempt to correlate the clinical phenotype with the genotype in 16 childhood cases, mtDNA was analysed for deletion, depletion, and mutations in the three genes encoding COX subunits and the 22 tRNA genes. Furthermore, nuclear DNA was analysed for mutations in the SURF1, SCO2, COX10, and COX17 genes and cases with mtDNA depletion were analysed for mutations in the TK2 gene. SURF1-mutations were identified in three out of four cases with Leigh syndrome while a mutation in the mitochondrial tRNA (trp) gene was identified in the fourth. One case with mtDNA depletion had mutations in the TK2 gene. In two cases with leukoencephalopathy, one case with encephalopathy, five cases with fatal infantile myopathy and cardiomyopathy, two cases with benign infantile myopathy, and one case with mtDNA depletion, no mutations were identified. We conclude that COX deficiency in childhood should be suspected in a wide range of clinical settings and although an increasing number of genetic defects have been identified, the underlying mutations remain unclear in the majority of the cases.

Supramolecular organization of cytochrome c oxidase- and alternative oxidase-dependent respiratory chains in the filamentous fungus Podospora anserina.

PubMed

Krause, Frank; Scheckhuber, Christian Q; Werner, Alexandra; Rexroth, Sascha; Reifschneider, Nicole H; Dencher, Norbert A; Osiewacz, Heinz D

2004-06-18

To elucidate the molecular basis of the link between respiration and longevity, we have studied the organization of the respiratory chain of a wild-type strain and of two long-lived mutants of the filamentous fungus Podospora anserina. This established aging model is able to respire by either the standard or the alternative pathway. In the latter pathway, electrons are directly transferred from ubiquinol to the alternative oxidase and thus bypass complexes III and IV. We show that the cytochrome c oxidase pathway is organized according to the mammalian "respirasome" model (Schägger, H., and Pfeiffer, K. (2000) EMBO J. 19, 1777-1783). In contrast, the alternative pathway is composed of distinct supercomplexes of complexes I and III (i.e. I(2) and I(2)III(2)), which have not been described so far. Enzymatic analysis reveals distinct functional properties of complexes I and III belonging to either cytochrome c oxidase- or alternative oxidase-dependent pathways. By a gentle colorless-native PAGE, almost all of the ATP synthases from mitochondria respiring by either pathway were preserved in the dimeric state. Our data are of significance for the understanding of both respiratory pathways as well as lifespan control and aging.

In vitro study of 6-mercaptopurine oxidation catalysed by aldehyde oxidase and xanthine oxidase.

PubMed

Rashidi, Mohammad-Reza; Beedham, Christine; Smith, John S; Davaran, Soodabeh

2007-08-01

In spite of over 40 years of clinical use of 6-mercaptopurine, many aspects of complex pharmacology and metabolism of this drug remain unclear. It is thought that 6-mercaptopurine is oxidized to 6-thiouric acid through 6-thioxanthine or 8-oxo-6-mercaptopurine by one of two molybdenum hydroxylases, xanthine oxidase (XO), however, the role of other molybdenum hydroxylase, aldehyde oxidase (AO), in the oxidation of 6-mercaptopurine and possible interactions of AO substrates and inhibitors has not been investigated in more details. In the present study, the role of AO and XO in the oxidation of 6- mercaptopurine has been investigated. 6-mercaptopurine was incubated with bovine milk xanthine oxidase or partially purified guinea pig liver molybdenum hydroxylase fractions in the absence and presence of XO and AO inhibitor/substrates, and the reactions were monitored by spectrophotometric and HPLC methods. According to the results obtained from the inhibition studies, it is more likely that 6- mercaptopurine is oxidized to 6-thiouric acid via 6-thioxanthine rather than 8-oxo-6-mercaptopurine. The first step which is the rate limiting step is catalyzed solely by XO, whereas both XO and AO are involved in the oxidation of 6-thioxanthine to 6-thiouric acid.

Mitochondrial cytochrome c oxidase subunit 1 gene and nuclear rDNA regions of Enterobius vermicularis parasitic in captive chimpanzees with special reference to its relationship with pinworms in humans.

PubMed

Nakano, Tadao; Okamoto, Munehiro; Ikeda, Yatsukaho; Hasegawa, Hideo

2006-12-01

Sequences of mitochondrial cytochrome c oxidase subunit 1 (CO1) gene, nuclear internal transcribed spacer 2 (ITS2) region of ribosomal DNA (rDNA), and 5S rDNA of Enterobius vermicularis from captive chimpanzees in five zoos/institutions in Japan were analyzed and compared with those of pinworm eggs from humans in Japan. Three major types of variants appearing in both CO1 and ITS2 sequences, but showing no apparent connection, were observed among materials collected from the chimpanzees. Each one of them was also observed in pinworms in humans. Sequences of 5S rDNA were identical in the materials from chimpanzees and humans. Phylogenetic analysis of CO1 gene revealed three clusters with high bootstrap value, suggesting considerable divergence, presumably correlated with human evolution, has occurred in the human pinworms. The synonymy of E. gregorii with E. vermicularis is supported by the molecular evidence.

Discovery of a Xylooligosaccharide Oxidase from Myceliophthora thermophila C1.

PubMed

Ferrari, Alessandro R; Rozeboom, Henriëtte J; Dobruchowska, Justyna M; van Leeuwen, Sander S; Vugts, Aniek S C; Koetsier, Martijn J; Visser, Jaap; Fraaije, Marco W

2016-11-04

By inspection of the predicted proteome of the fungus Myceliophthora thermophila C1 for vanillyl-alcohol oxidase (VAO)-type flavoprotein oxidases, a putative oligosaccharide oxidase was identified. By homologous expression and subsequent purification, the respective protein could be obtained. The protein was found to contain a bicovalently bound FAD cofactor. By screening a large number of carbohydrates, several mono- and oligosaccharides could be identified as substrates. The enzyme exhibits a strong substrate preference toward xylooligosaccharides; hence it is named xylooligosaccharide oxidase (XylO). Chemical analyses of the product formed upon oxidation of xylobiose revealed that the oxidation occurs at C1, yielding xylobionate as product. By elucidation of several XylO crystal structures (in complex with a substrate mimic, xylose, and xylobiose), the residues that tune the unique substrate specificity and regioselectivity could be identified. The discovery of this novel oligosaccharide oxidase reveals that the VAO-type flavoprotein family harbors oxidases tuned for specific oligosaccharides. The unique substrate profile of XylO hints at a role in the degradation of xylan-derived oligosaccharides by the fungus M. thermophila C1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Lipid levels are associated with a regulatory polymorphism of the monoamine oxidase-A gene promoter (MAOA-uVNTR).

PubMed

Brummett, Beverly H; Boyle, Stephen H; Siegler, Ilene C; Zuchner, Stephan; Ashley-Koch, Allison; Williams, Redford B

2008-02-01

The monoamine oxidase-A (MAOA) gene plays a vital role in the metabolism of neurotransmitters, e.g, serotonin, norepinephrine, and dopamine. A polymorphism in the promoter region (MAOA-uVNTR) affects transcriptional efficiency. Allelic variation in MAOA-uVNTR has been associated with body mass index (BMI). We extended previous work by examining relations among this polymorphism and serum lipid levels. The sample consisted of 74 males enrolled in a study of caregivers for relatives with dementia. Regression models, adjusted for age, race, group status (caregiver/control), and cholesterol lowering medication (yes/no), were used to examine associations between high verses low MAOA-uVNTR activity alleles and total cholesterol, HDL, LDL, VLDL, LDL/HDL ratio, triglycerides, and BMI. Higher total cholesterol (p<0.03), LDL/HDL ratio (p<0.01), triglycerides (p<0.02), and VLDL (p<0.02) were associated with low activity MAOA-uVNTR alleles. HDL and LDL were modestly related to MAOA-uVNTR activity, however, they did not reach the conventional significance level (p<0.07 and p<0.10, respectively). BMI (p<0.74) was unrelated to MAOA-uVNTR transcription. The present findings suggest that MAOA-uVNTR may influence lipid levels and individuals with less active alleles are at increased health risk.

Stability of spermine oxidase to thermal and chemical denaturation: comparison with bovine serum amine oxidase.

PubMed

Cervelli, Manuela; Leonetti, Alessia; Cervoni, Laura; Ohkubo, Shinji; Xhani, Marla; Stano, Pasquale; Federico, Rodolfo; Polticelli, Fabio; Mariottini, Paolo; Agostinelli, Enzo

2016-10-01

Spermine oxidase (SMOX) is a flavin-containing enzyme that specifically oxidizes spermine to produce spermidine, 3-aminopropanaldehyde and hydrogen peroxide. While no crystal structure is available for any mammalian SMOX, X-ray crystallography showed that the yeast Fms1 polyamine oxidase has a dimeric structure. Based on this scenario, we have investigated the quaternary structure of the SMOX protein by native gel electrophoresis, which revealed a composite gel band pattern, suggesting the formation of protein complexes. All high-order protein complexes are sensitive to reducing conditions, showing that disulfide bonds were responsible for protein complexes formation. The major gel band other than the SMOX monomer is the covalent SMOX homodimer, which was disassembled by increasing the reducing conditions, while being resistant to other denaturing conditions. Homodimeric and monomeric SMOXs are catalytically active, as revealed after gel staining for enzymatic activity. An engineered SMOX mutant deprived of all but two cysteine residues was prepared and characterized experimentally, resulting in a monomeric species. High-sensitivity differential scanning calorimetry of SMOX was compared with that of bovine serum amine oxidase, to analyse their thermal stability. Furthermore, enzymatic activity assays and fluorescence spectroscopy were used to gain insight into the unfolding process.

Plant sterol biosynthesis: identification of two distinct families of sterol 4alpha-methyl oxidases.

PubMed Central

Darnet, Sylvain; Rahier, Alain

2004-01-01

In plants, the conversion of cycloartenol into functional phytosterols requires the removal of the two methyl groups at C-4 by an enzymic complex including a sterol 4alpha-methyl oxidase (SMO). We report the cloning of candidate genes for SMOs in Arabidopsis thaliana, belonging to two distinct families termed SMO1 and SMO2 and containing three and two isoforms respectively. SMO1 and SMO2 shared low sequence identity with each other and were orthologous to the ERG25 gene from Saccharomyces cerevisiae which encodes the SMO. The plant SMO amino acid sequences possess all the three histidine-rich motifs (HX3H, HX2HH and HX2HH), characteristic of the small family of membrane-bound non-haem iron oxygenases that are involved in lipid oxidation. To elucidate the precise functions of SMO1 and SMO2 gene families, we have reduced their expression by using a VIGS (virus-induced gene silencing) approach in Nicotiana benthamiana. SMO1 and SMO2 cDNA fragments were inserted into a viral vector and N. benthamiana inoculated with the viral transcripts. After silencing with SMO1, a substantial accumulation of 4,4-dimethyl-9beta,19-cyclopropylsterols (i.e. 24-methylenecycloartanol) was obtained, whereas qualitative and quantitative levels of 4alpha-methylsterols were not affected. In the case of silencing with SMO2, a large accumulation of 4alpha-methyl-Delta7-sterols (i.e. 24-ethylidenelophenol and 24-ethyllophenol) was found, with no change in the levels of 4,4-dimethylsterols. These clear and distinct biochemical phenotypes demonstrate that, in contrast with animals and fungi, in photosynthetic eukaryotes, these two novel families of cDNAs are coding two distinct types of C-4-methylsterol oxidases controlling the level of 4,4-dimethylsterol and 4alpha-methylsterol precursors respectively. PMID:14653780

d-Aspartate oxidase influences glutamatergic system homeostasis in mammalian brain.

PubMed

Cristino, Luigia; Luongo, Livio; Squillace, Marta; Paolone, Giovanna; Mango, Dalila; Piccinin, Sonia; Zianni, Elisa; Imperatore, Roberta; Iannotta, Monica; Longo, Francesco; Errico, Francesco; Vescovi, Angelo Luigi; Morari, Michele; Maione, Sabatino; Gardoni, Fabrizio; Nisticò, Robert; Usiello, Alessandro

2015-05-01

We have investigated the relevance of d-aspartate oxidase, the only enzyme known to selectively degrade d-aspartate (d-Asp), in modulating glutamatergic system homeostasis. Interestingly, the lack of the Ddo gene, by raising d-Asp content, induces a substantial increase in extracellular glutamate (Glu) levels in Ddo-mutant brains. Consistent with an exaggerated and persistent N-methyl-d-aspartate receptor (NMDAR) stimulation, we documented in Ddo knockouts severe age-dependent structural and functional alterations mirrored by expression of active caspases 3 and 7 along with appearance of dystrophic microglia and reactive astrocytes. In addition, prolonged elevation of d-Asp triggered in mutants alterations of NMDAR-dependent synaptic plasticity associated to reduction of hippocampal GluN1 and GluN2B subunits selectively located at synaptic sites and to increase in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-to-N-methyl-d-aspartate ratio. These effects, all of which converged on a progressive hyporesponsiveness at NMDAR sites, functionally resulted in a greater vulnerability to phencyclidine-induced prepulse inhibition deficits in mutants. In conclusion, our results indicate that d-aspartate oxidase, by strictly regulating d-Asp levels, impacts on the homeostasis of glutamatergic system, thus preventing accelerated neurodegenerative processes. Copyright © 2015 Elsevier Inc. All rights reserved.

Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases

PubMed Central

Molitor, Christian; Mauracher, Stephan Gerhard

2016-01-01

Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze the o-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme’s interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate–enzyme complexes were performed, and a key residue was identified that influences the plant PPO’s acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their—so far unknown—natural substrates in vivo. PMID:26976571

Chemoheterotrophic Growth of the Cyanobacterium Anabaena sp. Strain PCC 7120 Dependent on a Functional Cytochrome c Oxidase

PubMed Central

Stebegg, Ronald; Wurzinger, Bernhard; Mikulic, Markus

2012-01-01

Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium commonly used as a model organism for studying cyanobacterial cell differentiation and nitrogen fixation. For many decades, this cyanobacterium was considered an obligate photo-lithoautotroph. We now discovered that this strain is also capable of mixotrophic, photo-organoheterotrophic, and chemo-organoheterotrophic growth if high concentrations of fructose (at least 50 mM and up to 200 mM) are supplied. Glucose, a substrate used by some facultatively organoheterotrophic cyanobacteria, is not effective in Anabaena sp. PCC 7120. The gtr gene from Synechocystis sp. PCC 6803 encoding a glucose carrier was introduced into Anabaena sp. PCC 7120. Surprisingly, the new strain containing the gtr gene did not grow on glucose but was very sensitive to glucose, with a 5 mM concentration being lethal, whereas the wild-type strain tolerated 200 mM glucose. The Anabaena sp. PCC 7120 strain containing gtr can grow mixotrophically and photo-organoheterotrophically, but not chemo-organoheterotrophically with fructose. Anabaena sp. PCC 7120 contains five respiratory chains ending in five different respiratory terminal oxidases. One of these enzymes is a mitochondrial-type cytochrome c oxidase. As in almost all cyanobacteria, this enzyme is encoded by three adjacent genes called coxBAC1. When this locus was disrupted, the cells lost the capability for chemo-organoheterotrophic growth. PMID:22730128

Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.

PubMed

Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T

2013-11-01

Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.

Association of a variant in the regulatory region of NADPH oxidase 4 gene and metabolic syndrome in patients with chronic hepatitis C.

PubMed

Siqueira, Erika Rabelo Forte de; Pereira, Luciano Beltrao; Stefano, Jose Tadeu; Patente, Thiago; Cavaleiro, Ana Mercedes; Silva Vasconcelos, Luydson Richardson; Carmo, Rodrigo Feliciano; Moreira Beltrao Pereira, Leila Maria; Carrilho, Flair Jose; Corrêa-Giannella, Maria Lucia; Oliveira, Claudia P

2015-03-28

Given the important contribution of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system to the generation of reactive oxygen species induced by hepatitis C virus (HCV), we investigated two single nucleotide polymorphisms (SNPs) in the putative regulatory region of the genes encoding NADPH oxidase 4 catalytic subunit (NOX4) and its regulatory subunit p22phox (CYBA) and their relation with metabolic and histological variables in patients with HCV. One hundred seventy eight naïve HCV patients (49.3% male; 65% HCV genotype 1) with positive HCV RNA were genotyped using specific primers and fluorescent-labeled probes for SNPs rs3017887 in NOX4 and -675 T → A in CYBA. No association was found between the genotype frequencies of NOX4 and CYBA SNPs and inflammation scores or fibrosis stages in the overall population. The presence of the CA + AA genotypes of the NOX4 SNP was nominally associated with a lower alanine aminotransferase (ALT) concentration in the male population (CA + AA = 72.23 ± 6.34 U/L versus CC = 100.22 ± 9.85; mean ± SEM; P = 0.05). The TT genotype of the CYBA SNP was also nominally associated with a lower ALT concentration in the male population (TT = 84.01 ± 6.77 U/L versus TA + AA = 109.67 ± 18.37 U/L; mean ± SEM; P = 0.047). The minor A-allele of the NOX4 SNP was inversely associated with the frequency of metabolic syndrome (MS) in the male population (odds ratio (OR): 0.15; 95% confidence interval (CI): 0.03 to 0.79; P = 0.025). The results suggest that the evaluated NOX4 and CYBA SNPs are not direct genetic determinants of fibrosis in HCV patients, but nevertheless NOX4 rs3017887 SNP could indirectly influence fibrosis susceptibility due to its inverse association with MS in male patients.

NADPH OXIDASE: STRUCTURE AND ACTIVATION MECHANISMS (REVIEW). NOTE I.

PubMed

Filip-Ciubotaru, Florina; Manciuc, Carmen; Stoleriu, Gabriela; Foia, Liliana

2016-01-01

NADPH oxidase (nicotinamide adenine dinucleotide phosphate-oxidase), with its generically termed NOX isoforms, is the major source of ROS (reactive oxigen species) in biological systems. ROS are small oxygen-derived molecules with an important role in various biological processes (physiological or pathological). If under physiological conditions some processes are beneficial and necessary for life, under pathophysiological conditions they are noxious, harmful. NADPH oxidases are present in phagocytes and in a wide variety of nonphagocytic cells. The enzyme generates superoxide by transferring electrons from NADPH inside the cell across the membrane and coupling them to molecular oxygen to produce superoxide anion, a reactive free-radical. Structurally, NADPH oxidase is a multicomponent enzyme which includes two integral membrane proteins, glycoprotein gp9 1 Phox and adaptor protein p22(phox), which together form the heterodimeric flavocytochrome b558 that constitutes the core of the enzyme. During the resting state, the multidomain regulatory subunits p40P(phox), p47(phox), p67(Phox) are located in the cytosol organized as a complex. The activation of phagocytic NADPH oxidase occurs through a complex series of protein interactions.

Hypoxia-Inducible Factor 1-Regulated Lysyl Oxidase Is Involved in Staphylococcus aureus Abscess Formation

PubMed Central

Beerlage, Christiane; Greb, Jessica; Kretschmer, Dorothee; Assaggaf, Mohammad; Trackman, Philip C.; Hansmann, Martin-Leo; Bonin, Michael; Eble, Johannes A.; Peschel, Andreas; Brüne, Bernhard

2013-01-01

Hypoxia-inducible factor 1 (HIF-1) is the key transcription factor involved in the adaptation of mammals to hypoxia and plays a crucial role in cancer angiogenesis. Recent evidence suggests a leading role for HIF-1 in various inflammatory and infectious diseases. Here we describe the role of HIF-1 in Staphylococcus aureus infections by investigating the HIF-1-dependent host cell response. For this purpose, transcriptional profiling of HIF-1α-deficient HepG2 and control cells, both infected with Staphylococcus aureus, was performed. Four hours after infection, the expression of 190 genes, 24 of which were regulated via HIF-1, was influenced. LOX (encoding lysyl oxidase) was one of the upregulated genes with a potential impact on the course of S. aureus infection. LOX is an amine oxidase required for biosynthetic cross-linking of extracellular matrix components. LOX was upregulated in vitro in different cell cultures infected with S. aureus and also in vivo, in kidney abscesses of mice intravenously infected with S. aureus and in clinical skin samples from patients with S. aureus infections. Inhibition of LOX by β-aminopropionitrile (BAPN) did not affect the bacterial load in kidneys or blood but significantly influenced abscess morphology and collagenization. Our data provide evidence for a crucial role of HIF-1-regulated LOX in abscess formation. PMID:23649089

Monoamine Oxidase-A Genetic Variants and Childhood Abuse Predict Impulsiveness in Borderline Personality Disorder.

PubMed

Kolla, Nathan J; Meyer, Jeffrey; Sanches, Marcos; Charbonneau, James

2017-11-30

Impulsivity is a core feature of borderline personality disorder (BPD) and antisocial personality disorder (ASPD) that likely arises from combined genetic and environmental influences. The interaction of the low activity variant of the monoamine oxidase-A (MAOA-L) gene and early childhood adversity has been shown to predict aggression in clinical and non-clinical populations. Although impulsivity is a risk factor for aggression in BPD and ASPD, little research has investigated potential gene-environment (G×E) influences impacting its expression in these conditions. Moreover, G×E interactions may differ by diagnosis. Full factorial analysis of variance was employed to investigate the influence of monoamine oxidase-A (MAO-A) genotype, childhood abuse, and diagnosis on Barratt Impulsiveness Scale-11 (BIS-11) scores in 61 individuals: 20 subjects with BPD, 18 subjects with ASPD, and 23 healthy controls. A group×genotype×abuse interaction was present (F(2,49)=4.4, p =0.018), such that the interaction of MAOA-L and childhood abuse predicted greater BIS-11 motor impulsiveness in BPD. Additionally, BPD subjects reported higher BIS-11 attentional impulsiveness versus ASPD participants (t(1,36)=2.3, p =0.025). These preliminary results suggest that MAOA-L may modulate the impact of childhood abuse on impulsivity in BPD. Results additionally indicate that impulsiveness may be expressed differently in BPD and ASPD.

Phenolic profiles and polyphenol oxidase (PPO) gene expression of red clover (Trifolium pratense) selected for decreased postharvest browning

USDA-ARS?s Scientific Manuscript database

Red clover (Trifolium pratense L.) is a legume forage abundant in phenolic compounds. It tends to brown when cut for hay, due to oxidation of phenolic compounds catalyzed by polyphenol oxidase (PPO), and subsequent binding to proteins. Selecting for a greener hay may provide information about the re...

Comparative Activity-Based Flavin-Dependent Oxidase Profiling.

PubMed

Krysiak, Joanna; Breinbauer, Rolf

2017-01-01

Activity-based protein profiling (ABPP) has become a powerful chemoproteomic technology allowing for the dissection of complex ligand-protein interactions in their native cellular environment. One of the biggest challenges for ABPP is the extension of the proteome coverage. In this chapter a new ABPP strategy dedicated to monoamine oxidases (MAO) is presented. These enzymes are representative examples of flavin-dependent oxidases, playing a crucial role in the regulation of nervous system signaling.

Multidomain flavin-dependent sulfhydryl oxidases.

PubMed

Coppock, Donald L; Thorpe, Colin

2006-01-01

Eukaryotic flavin-dependent sulfhydryl oxidases catalyze oxidative protein folding with the generation of disulfides and the reduction of oxygen to hydrogen peroxide. This review deals principally with the Quiescinsulfhydryl oxidases (QSOX) that are found in multiple forms in multicellular organisms and singly in a number of protozoan parasites. QSOX is an ancient fusion of thioredoxin domains and an FAD-binding module, ERV1/ALR. Interdomain disulfide exchanges transmit reducing equivalents from substrates to the flavin cofactor and thence to molecular oxygen. The in vitro substrate specificity of avian QSOX1 and the likely substrates of QSOXs in vivo are discussed. The location of QSOX immunoreactivity and mRNA expression levels in human cells and tissues is reviewed. Generally, there is a marked association of QSOX1 expression with cell types that have a high secretory load of disulfide-containing peptides and proteins. The abundance of sulfhydryl oxidases in the islets of Langerhans suggests that oxidative protein folding may directly contribute to the oxidative stress believed to be a factor in the progression to type II diabetes. Finally, the structure and mechanism of QSOX proteins is compared to their smaller stand-alone cousins: yeast ERV1p and ERV2p, the mammalian augmenter of liver regeneration (ALR), and the viral ALR homologs.

Effect of contraceptive steroids on monoamine oxidase activity

PubMed Central

Southgate, Jennifer; Collins, G. G. S.; Pryse-Davies, J.; Sandler, M.

1969-01-01

Cyclical variations in monoamine oxidase activity during the human menstrual cycle, specific to the endometrium and modified in women undergoing contraceptive steroid treatment, may reflect changes in hormonal environment. Treatment of rats with individual constituents of the contraceptive pill causes analogous changes: oestrogens inhibit and progestogens potentiate uterine monoamine oxidase activity. ImagesFig. 2Fig. 3

Monoamine Oxidase A (MAOA) and Catechol-O-Methyltransferase (COMT) Gene Polymorphisms Interact with Maternal Parenting in Association with Adolescent Reactive Aggression but not Proactive Aggression: Evidence of Differential Susceptibility.

PubMed

Zhang, Wenxin; Cao, Cong; Wang, Meiping; Ji, Linqin; Cao, Yanmiao

2016-04-01

To date, whether and how gene-environment (G × E) interactions operate differently across distinct subtypes of aggression remains untested. More recently, in contrast with the diathesis-stress hypothesis, an alternative hypothesis of differential susceptibility proposes that individuals could be differentially susceptible to environments depending on their genotypes in a "for better and for worse" manner. The current study examined interactions between monoamine oxidase A (MAOA) T941G and catechol-O-methyltransferase (COMT) Val158Met polymorphisms with maternal parenting on two types of aggression: reactive and proactive. Moreover, whether these potential G × E interactions would be consistent with the diathesis-stress versus the differential susceptibility hypothesis was tested. Within the sample of 1399 Chinese Han adolescents (47.2 % girls, M age = 12.32 years, SD = 0.50), MAOA and COMT genes both interacted with positive parenting in their associations with reactive but not proactive aggression. Adolescents with T alleles/TT homozygotes of MAOA gene or Met alleles of COMT gene exhibited more reactive aggression when exposed to low positive parenting, but less reactive aggression when exposed to high positive parenting. These findings provide the first evidence for distinct G × E interaction effects on reactive versus proactive aggression and lend further support for the differential susceptibility hypothesis.

Evidence for Lignin Oxidation by the Giant Panda Fecal Microbiome

PubMed Central

Zhou, Peng; Chang, Fei; Hong, Yuzhi; Zhang, Xuecheng; Peng, Hui; Xiao, Yazhong

2012-01-01

The digestion of lignin and lignin-related phenolic compounds from bamboo by giant pandas has puzzled scientists because of the lack of lignin-degrading genes in the genome of the bamboo-feeding animals. We constructed a 16S rRNA gene library from the microorganisms derived from the giant panda feces to identify the possibility for the presence of potential lignin-degrading bacteria. Phylogenetic analysis showed that the phylotypes of the intestinal bacteria were affiliated with the phyla Proteobacteria (53%) and Firmicutes (47%). Two phylotypes were affiliated with the known lignin-degrading bacterium Pseudomonas putida and the mangrove forest bacteria. To test the hypothesis that microbes in the giant panda gut help degrade lignin, a metagenomic library of the intestinal bacteria was constructed and screened for clones that contained genes encoding laccase, a lignin-degrading related enzyme. A multicopper oxidase gene, designated as lac51, was identified from a metagenomic clone. Sequence analysis and copper content determination indicated that Lac51 is a laccase rather than a metallo-oxidase and may work outside its original host cell because it has a TAT-type signal peptide and a transmembrane segment at its N-terminus. Lac51 oxidizes a variety of lignin-related phenolic compounds, including syringaldazine, 2,6-dimethoxyphenol, ferulic acid, veratryl alcohol, guaiacol, and sinapinic acid at conditions that simulate the physiologic environment in giant panda intestines. Furthermore, in the presence of 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), syringic acid, or ferulic acid as mediators, the oxidative ability of Lac51 on lignin was promoted. The absorbance of lignin at 445 nm decreased to 36% for ABTS, 51% for syringic acid, and 51% for ferulic acid after incubation for 10 h. Our findings demonstrate that the intestinal bacteria of giant pandas may facilitate the oxidation of lignin moieties, thereby clarifying the digestion of bamboo

Functional Analysis of the Trichoderma harzianum nox1 Gene, Encoding an NADPH Oxidase, Relates Production of Reactive Oxygen Species to Specific Biocontrol Activity against Pythium ultimum▿†

PubMed Central

Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.

2011-01-01

The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791

Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.

PubMed Central

Legge, M; Duff, G B

1981-01-01

Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less gave little useful information. PMID:6785320

Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.

PubMed

Legge, M; Duff, G B

1981-02-01

Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less gave little useful information.

Expression of Ascorbic Acid Oxidase in Zucchini Squash (Cucurbita pepo L.).

PubMed

Lin, L S; Varner, J E

1991-05-01

The expression of ascorbic acid oxidase was studied in zucchini squash (Cucurbita pepo L.), one of the most abundant natural sources of the enzyme. In the developing fruit, specific activity of ascorbic acid oxidase was highest between 4 and 6 days after anthesis. Protein and mRNA levels followed the same trend as enzyme activity. Highest growth rate of the fruit occurred before 6 days after anthesis. Within a given fruit, ascorbic acid oxidase activity and mRNA level were highest in the epidermis, and lowest in the central placental region. In leaf tissue, ascorbic acid oxidase activity was higher in young leaves, and very low in old leaves. Within a given leaf, enzyme activity was highest in the fast-growing region (approximately the lower third of the blade), and lowest in the slow-growing region (near leaf apex). High expression of ascorbic acid oxidase at a stage when rapid growth is occurring (in both fruits and leaves), and localization of the enzyme in the fruit epidermis, where cells are under greatest tension during rapid growth in girth, suggest that ascorbic acid oxidase might be involved in reorganization of the cell wall to allow for expansion. Based on the known chemistry of dehydroascorbic acid, the end product of the ascorbic acid oxidase-catalyzed reaction, we have proposed several hypotheses to explain how dehydroascorbic acid might cause cell wall "loosening."

Development of multiplex PCR assay for authentication of Cornu Cervi Pantotrichum in traditional Chinese medicine based on cytochrome b and C oxidase subunit 1 genes.

PubMed

Gao, Lijun; Xia, Wei; Ai, Jinxia; Li, Mingcheng; Yuan, Guanxin; Niu, Jiamu; Fu, Guilian; Zhang, Lihua

2016-07-01

This study describes a method for discriminating the true Cervus antlers from its counterfeits using multiplex PCR. Bioinformatics were carried out to design the specific alleles primers for mitochondrial (mt) cytochrome b (Cyt b) and cytochrome C oxidase subunit 1 (Cox 1) genes. The mt DNA and genomic DNA were extracted from Cervi Cornu Pantotrichum through the modified alkaline and the salt-extracting method in addition to its counterfeits, respectively. Sufficient DNA templates were extracted from all samples used in two methods, and joint fragments of 354 bp and 543 bp that were specifically amplified from both of true Cervus antlers served as a standard control. The data revealed that the multiplex PCR-based assays using two primer sets can be used for forensic and quantitative identification of original Cervus deer products from counterfeit antlers in a single step.

Dithiocarbamates are teratogenic to developing zebrafish through inhibition of lysyl oxidase activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boxtel, Antonius L. van, E-mail: thijs.van.boxtel@ivm.vu.n; Kamstra, Jorke H.; Fluitsma, Donna M.

2010-04-15

Dithiocarbamates (DTCs) are a class of compounds that are extensively used in agriculture as pesticides. As such, humans and wildlife are undoubtedly exposed to these chemicals. Although DTCs are thought to be relatively safe due to their short half lives, it is well established that they are teratogenic to vertebrates, especially to fish. In zebrafish, these teratogenic effects are characterized by distorted notochord development and shortened anterior to posterior axis. DTCs are known copper (Cu) chelators but this does not fully explain the observed teratogenic effects. We show here that DTCs cause malformations in zebrafish that highly resemble teratogenic effectsmore » observed by direct inhibition of a group of cuproenzymes termed lysyl oxidases (LOX). Additionally, we demonstrate that partial knockdown of three LOX genes, lox, loxl1 and loxl5b, sensitizes the developing embryo to DTC exposure. Finally, we show that DTCs directly inhibit zebrafish LOX activity in an ex vivo amine oxidase assay. Taken together, these results provide the first evidence that DTC induced teratogenic effects are, at least in part, caused by direct inhibition of LOX activity.« less

Micro-RNA 21 inhibition of SMAD7 enhances fibrogenesis via leptin-mediated NADPH oxidase in experimental and human nonalcoholic steatohepatitis.

PubMed

Dattaroy, Diptadip; Pourhoseini, Sahar; Das, Suvarthi; Alhasson, Firas; Seth, Ratanesh Kumar; Nagarkatti, Mitzi; Michelotti, Gregory A; Diehl, Anna Mae; Chatterjee, Saurabh

2015-02-15

Hepatic fibrosis in nonalcoholic steatohepatitis (NASH) is the common pathophysiological process resulting from chronic liver inflammation and oxidative stress. Although significant research has been carried out on the role of leptin-induced NADPH oxidase in fibrogenesis, the molecular mechanisms that connect the leptin-NADPH oxidase axis in upregulation of transforming growth factor (TGF)-β signaling have been unclear. We aimed to investigate the role of leptin-mediated upregulation of NADPH oxidase and its subsequent induction of micro-RNA 21 (miR21) in fibrogenesis. Human NASH livers and a high-fat (60% kcal) diet-fed chronic mouse model, where hepatotoxin bromodichloromethane was used to induce NASH, were used for this study. To prove the role of the leptin-NADPH oxidase-miR21 axis, mice deficient in genes for leptin, p47phox, and miR21 were used. Results showed that wild-type mice and human livers with NASH had increased oxidative stress, increased p47phox expression, augmented NF-κB activation, and increased miR21 levels. These mice and human livers showed increased TGF-β, SMAD2/3-SMAD4 colocalizations in the nucleus, increased immunoreactivity against Col1α, and α-SMA with a concomitant decrease in protein levels of SMAD7. Mice that were deficient in leptin or p47phox had decreased activated NF-κB and miR21 levels, suggesting the role of leptin and NADPH oxidase in inducing NF-κB-mediated miR21 expression. Further miR21 knockout mice had decreased colocalization events of SMAD2/3-SMAD4 in the nucleus, increased SMAD7 levels, and decreased fibrogenesis. Taken together, the studies show the novel role of leptin-NADPH oxidase induction of miR21 as a key regulator of TGF-β signaling and fibrogenesis in experimental and human NASH. Copyright © 2015 the American Physiological Society.

Structure-function relationships in the evolutionary framework of spermine oxidase.

PubMed

Cervelli, Manuela; Salvi, Daniele; Polticelli, Fabio; Amendola, Roberto; Mariottini, Paolo

2013-06-01

Spermine oxidase is a FAD-dependent enzyme that specifically oxidizes spermine, and plays a central role in the highly regulated catabolism of polyamines in vertebrates. The spermine oxidase substrate is specifically spermine, a tetramine that plays mandatory roles in several cell functions, such as DNA synthesis, cellular proliferation, modulation of ion channels function, cellular signalling, nitric oxide synthesis and inhibition of immune responses. The oxidative products of spermine oxidase activity are spermidine, H2O2 and the aldehyde 3-aminopropanal that spontaneously turns into acrolein. In this study the reconstruction of the phylogenetic relationships among spermine oxidase proteins from different vertebrate taxa allowed to infer their molecular evolutionary history, and assisted in elucidating the conservation of structural and functional properties of this enzyme family. The amino acid residues, which have been hypothesized or demonstrated to play a pivotal role in the enzymatic activity, and substrate specificity are here analysed to obtain a comprehensive and updated view of the structure-function relationships in the evolution of spermine oxidase.

Catalase deficiency may complicate urate oxidase (rasburicase) therapy.

PubMed

Góth, László; Bigler, N William

2007-09-01

Patients with low (inherited and acquired) catalase activities who are treated with infusion of uric acid oxidase because they are at risk of tumour lysis syndrome may experience very high concentrations of hydrogen peroxide. They may suffer from methemoglobinaemia and haemolytic anaemia which may be attributed either to deficiency of glucose-6-phosphate dehydrogenase or to other unknown circumstances. Data have not been reported from catalase deficient patients who were treated with uric acid oxidase. It may be hypothesized that their decreased blood catalase could lead to the increased concentration of hydrogen peroxide which may cause haemolysis and formation of methemoglobin. Blood catalase activity should be measured for patients at risk of tumour lysis syndrome prior to uric acid oxidase treatment.

Monoamine oxidase A gene polymorphisms and enzyme activity associated with risk of gout in Taiwan aborigines.

PubMed

Tu, Hung-Pin; Ko, Albert Min-Shan; Wang, Shu-Jung; Lee, Chien-Hung; Lea, Rod A; Chiang, Shang-Lun; Chiang, Hung-Che; Wang, Tsu-Nai; Huang, Meng-Chuan; Ou, Tsan-Teng; Lin, Gau-Tyan; Ko, Ying-Chin

2010-02-01

Taiwanese aborigines have a high prevalence of hyperuricemia and gout. Uric acid levels and urate excretion have correlated with dopamine-induced glomerular filtration response. MAOs represent one of the major renal dopamine metabolic pathways. We aimed to identify the monoamine oxidase A (MAOA, Xp11.3) gene variants and MAO-A enzyme activity associated with gout risk. This study was to investigate the association between gout and the MAOA single-nucleotide polymorphisms (SNPs) rs5953210, rs2283725, and rs1137070 as well as between gout and the COMT SNPs rs4680 Val158Met for 374 gout cases and 604 controls. MAO-A activity was also measured. All three MAOA SNPs were significantly associated with gout. A synonymous MAOA SNP, rs1137070 Asp470Asp, located in exon 14, was associated with the risk of having gout (P = 4.0 x 10(-5), adjusted odds ratio 1.46, 95% confidence intervals [CI]: 1.11-1.91). We also showed that, when compared to individuals with the MAOA GAT haplotype, carriers of the AGC haplotype had a 1.67-fold (95% CI: 1.28-2.17) higher risk of gout. Moreover, we found that MAOA enzyme activity correlated positively with hyperuricemia and gout (P for trend = 2.00 x 10(-3) vs. normal control). We also found that MAOA enzyme activity by rs1137070 allele was associated with hyperuricemia and gout (P for trend = 1.53 x 10(-6) vs. wild-type allele). Thus, our results show that some MAOA alleles, which have a higher enzyme activity, predispose to the development of gout.

[Respiratory oxidases: the enzymes which use most of the oxygen which living things breathe].

PubMed

Toledo-Cuevas, E M

1997-01-01

The respiratory oxidases are the last enzymes of the aerobic respiratory chain. They catalize the reduction of molecular oxygen to water, with generation of an electrochemical gradient useful for the energy demanding cellular processes. Most of the oxidases belong to the heme-copper superfamily. They possess a heme-copper center, constituted of a high spin heme and a CuB center, where the reduction of oxygen takes place and probably where the link to proton pumping is located. The superfamily is divided in two classes: the quinol- and the cytochrome c-oxidases. The latter are divided in the aa3 and the cbb3-type cytochrome c oxidases. The main difference between quinol- and the aa3-type cytochrome c-oxidases is the CuA center, which is absent in the quinol oxidases. The cbb3-type cytochrome oxidases have the binuclear center, but lack the CuA center. They also does not have the classical subunits II and III. These differences seem not to affect the oxygen reduction or the proton pumping. Probably the oxidases have evolved from some denitrification enzymes and prior the photosynthetic process. Also is possible that the cbb3-type cytochrome oxidases or others very similar have been the first oxidases to appear.

The maize lilliputian1 (lil1) gene, encoding a brassinosteroid cytochrome P450 C-6 oxidase, is involved in plant growth and drought response.

PubMed

Castorina, Giulia; Persico, Martina; Zilio, Massimo; Sangiorgio, Stefano; Carabelli, Laura; Consonni, Gabriella

2018-05-16

Brassinosteroids (BRs) are plant hormones involved in many developmental processes as well as in plant-environment interactions. Their role was investigated in this study through the analysis of lilliputian1-1 (lil1-1), a dwarf mutant impaired in BR biosynthesis in maize (Zea mays). We isolated lil1-1 through transposon tagging in maize. The action of lil1 was investigated through morphological and genetic analysis. Moreover, by comparing lil1-1 mutant and wild-type individuals grown under drought stress, the effect of BR reduction on the response to drought stress was examined. lil1-1 is a novel allele of the brassinosteroid-deficient dwarf1 (brd1) gene, encoding a brassinosteroid C-6 oxidase. We show in this study that lil1 is epistatic to nana plant1 (na1), a BR gene involved in earlier steps of the pathway. The lill-1 mutation causes alteration in the root gravitropic response, leaf epidermal cell density, epicuticular wax deposition and seedling adaptation to water scarcity conditions. Lack of active BR molecules in maize causes a pleiotropic effect on plant development and improves seedling tolerance of drought. BR-deficient maize mutants can thus be instrumental in unravelling novel mechanisms on which plant adaptations to abiotic stress are based.

Identification of the alternative terminal oxidase of higher plant mitochondria

PubMed Central

Elthon, Thomas E.; McIntosh, Lee

1987-01-01

In addition to cytochrome oxidase, plant mitochondria have a second terminal oxidase called the alternative oxidase. The alternative oxidase is of great interest in that energy is not conserved when electrons flow through it. The potential energy of the system is thus lost as heat, and, in plants with high levels of the alternative oxidase, this results in thermogenesis. We have purified the alternative oxidase from mitochondria of the thermogenic spadix of Sauromatum guttatum and have identified its polypeptide constituents by using polyclonal antibodies. A 166-fold purification was achieved through a combination of cation-exchange (carboxymethyl-Sepharose) and hydrophobic-interaction (phenyl-Sepharose) chromatography. Polyclonal antibodies raised to the CM-Sepharose fractions readily immunoprecipitated alternative oxidase activity and immunoprecipitated four of the proteins that copurify with the activity. These proteins have apparent molecular masses of 37, 36, 35.5, and 35 kDa. Polyclonal antibodies raised individually to the 37-, 36-, and 35.5- plus 35-kDa proteins cross-reacted with all of these proteins, indicating the presence of common antigenic sites. The 37-kDa protein appears to be constitutive in Sauromatum, whereas expression of the 36- and 35-kDa proteins was correlated with presence of alternative pathway activity. The 35.5-kDa protein appears with loss of alternative pathway activity during senescence, indicating that this protein may be a degradation product of the 36-kDa protein. Binding of anti-36-kDa protein antibodies to total mitochondrial protein blots of five plant species indicated that similar proteins were always present when alternative pathway activity was observed. Images PMID:16593898

21 CFR 866.2420 - Oxidase screening test for gonorrhea.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...

21 CFR 866.2420 - Oxidase screening test for gonorrhea.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...

21 CFR 866.2420 - Oxidase screening test for gonorrhea.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...

21 CFR 866.2420 - Oxidase screening test for gonorrhea.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...

21 CFR 866.2420 - Oxidase screening test for gonorrhea.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...

The first mammalian aldehyde oxidase crystal structure: insights into substrate specificity.

PubMed

Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T P; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João

2012-11-23

Aldehyde oxidases have pharmacological relevance, and AOX3 is the major drug-metabolizing enzyme in rodents. The crystal structure of mouse AOX3 with kinetics and molecular docking studies provides insights into its enzymatic characteristics. Differences in substrate and inhibitor specificities can be rationalized by comparing the AOX3 and xanthine oxidase structures. The first aldehyde oxidase structure represents a major advance for drug design and mechanistic studies. Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 Å. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity.

Vascular lysyl oxidase over-expression alters extracellular matrix structure and induces oxidative stress.

PubMed

Varona, Saray; García-Redondo, Ana B; Martínez-González, Jose; Salaices, Mercedes; Briones, Ana M; Rodríguez, Cristina

Lysyl oxidase (LOX) participates in the assembly of collagen and elastin fibres. The impact of vascular LOX over-expression on extracellular matrix (ECM) structure and its contribution to oxidative stress has been analysed. Studies were conducted on mice over-expressing LOX (Tg), specifically in smooth muscle cells (VSMC). Gene expression was assessed by real-time PCR analysis. Sirius Red staining, H 2 O 2 production and NADPH oxidase activity were analysed in different vascular beds. The size and number of fenestra of the internal elastic lamina were determined by confocal microscopy. LOX activity was up-regulated in VSMC of transgenic mice compared with cells from control animals. At the same time, transgenic cells deposited more organised elastin fibres and their supernatants induced a stronger collagen assembly in in vitro assays. Vascular collagen cross-linking was also higher in Tg mice, which showed a decrease in the size of fenestrae and an enhanced expression of Fibulin-5. Interestingly, higher H 2 O 2 production and NADPH oxidase activity was detected in the vascular wall from transgenic mice. The H 2 O 2 scavenger catalase attenuated the stronger deposition of mature elastin fibres induced by LOX transgenesis. LOX over-expression in VSMC was associated with a change in the structure of collagen and elastin fibres. LOX could constitute a novel source of oxidative stress that might participate in elastin changes and contribute to vascular remodelling. Copyright © 2017 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

[Oxygen and the superoxide anion. Modulation of NADPH oxidase?].

PubMed

Delbosc, S; Cristol, J P; Descomps, B; Chénard, J; Sirois, P

2001-01-01

Oxidative stress which results from an imbalance between oxidant production and antioxidant defense mechanisms can promote modifications of lipids, proteins and nucleic acids. This review focuses on the different pathways leading to Reactive Oxygen Species (ROS) production in particular on NADPH oxidase activation. This enzyme is localized in numerous cells including phagocytes and vascular cells and composed of membrane and cytosolic sub-units. The activation of the NADPH oxidase is largely involved in inflammation associated diseases such as asthma, Systemic Inflammatory Response Syndrome and aging associated diseases such as atherosclerosis and neurodeneratives diseases. The modulation of NADPH oxidase could be a way to limit or prevent the development of these diseases.

Aiding and abetting roles of NOX oxidases in cellular transformation

PubMed Central

Block, Karen; Gorin, Yves

2013-01-01

NADPH oxidases of the NADPH oxidase (NOX) family are dedicated reactive oxygen species-generating enzymes that broadly and specifically regulate redox-sensitive signalling pathways that are involved in cancer development and progression. They act at specific cellular membranes and microdomains through the activation of oncogenes and the inactivation of tumour suppressor proteins. In this Review, we discuss primary targets and redox-linked signalling systems that are influenced by NOX-derived ROS, and the biological role of NOX oxidases in the aetiology of cancer. PMID:22918415

The kinetic role of carboxylate residues in the proximity of the trinuclear centre in the O2 reactivity of CotA-laccase.

PubMed

Brissos, Vânia; Chen, Zhenjia; Martins, Lígia O

2012-05-28

Multicopper oxidases catalyze the four-electron reduction of dioxygen to water without the release of any reactive oxygen intermediate species. The role of carboxylate residue Asp116 located at the exit channel for water molecules of CotA-laccase has been investigated by site-saturation mutagenesis. A total of 300 clones was picked and screened for activity. Five variant enzymes, D116E, D116A, D116N, D116T and D116L, were selected for further characterisation. Spectroscopic analysis revealed only small perturbations in the geometry of the catalytic Cu sites of variants. However, a severe drop in turnover numbers (k(cat)) and downshifts by approximately 1-2 units of the optimal pH were observed for the oxidation of substrates, as compared with the wild type. The kinetics of formation and decay of peroxide intermediate (PI) was studied in type 1 depleted (T1D) CotA-laccase and in T1D-D116 or T1D-E498 mutants, previously shown to be involved in the mechanism of dioxygen reduction. It is noteworthy that CotA shows 10 times lower rates of PI formation and 10(3) higher PI decay rates as compared with other studied multicopper oxidases. The generation of PI is pH independent and mostly unaffected by the D116 or E498 mutations. In contrast, the decay of PI is markedly compromised by the replacement of D116 or E498 with non-carboxylate residues. The E498 residue appears to be the main protonable species for acceleration of PI decay at low pH. The D116 residue seems to be essential in the modulation of E498 protonation and in assisting protons to hydroxyl groups bound to the T2 Cu.

NADPH Oxidase Activation Contributes to Heavy Ion Irradiation–Induced Cell Death

PubMed Central

Wang, Yupei; Liu, Qing; Zhao, Weiping; Zhou, Xin; Miao, Guoying; Sun, Chao

2017-01-01

Increased oxidative stress plays an important role in heavy ion radiation–induced cell death. The mechanism involved in the generation of elevated reactive oxygen species (ROS) is not fully illustrated. Here we show that NADPH oxidase activation is closely related to heavy ion radiation–induced cell death via excessive ROS generation. Cell death and cellular ROS can be greatly reduced in irradiated cancer cells with the preincubation of diphenyleneiodium, an inhibitor of NADPH oxidase. Most of the NADPH oxidase (NOX) family proteins (NOX1, NOX2, NOX3, NOX4, and NOX5) showed increased expression after heavy ion irradiation. Meanwhile, the cytoplasmic subunit p47phox was translocated to the cell membrane and localized with NOX2 to form reactive NADPH oxidase. Our data suggest for the first time that ROS generation, as mediated by NADPH oxidase activation, could be an important contributor to heavy ion irradiation–induced cell death. PMID:28473742

Mutations in monoamine oxidase (MAO) genes in mice lead to hypersensitivity to serotonin-enhancing drugs: implications for drug side effects in humans.

PubMed

Fox, M A; Panessiti, M G; Moya, P R; Tolliver, T J; Chen, K; Shih, J C; Murphy, D L

2013-12-01

A possible side effect of serotonin-enhancing drugs is the serotonin syndrome, which can be lethal. Here we examined possible hypersensitivity to two such drugs, the serotonin precursor 5-hydroxy-L-tryptophan (5-HTP) and the atypical opioid tramadol, in mice lacking the genes for both monoamine oxidase A (MAOA) and MAOB. MAOA/B-knockout (KO) mice displayed baseline serotonin syndrome behaviors, and these behavioral responses were highly exaggerated following 5-HTP or tramadol versus baseline and wild-type (WT) littermates. Compared with MAOA/B-WT mice, baseline tissue serotonin levels were increased ∼2.6-3.9-fold in MAOA/B-KO mice. Following 5-HTP, serotonin levels were further increased ∼4.5-6.2-fold in MAOA/B-KO mice. These exaggerated responses are in line with the exaggerated responses following serotonin-enhancing drugs that we previously observed in mice lacking the serotonin transporter (SERT). These findings provide a second genetic mouse model suggestive of possible human vulnerability to the serotonin syndrome in individuals with lesser-expressing MAO or SERT polymorphisms that confer serotonergic system changes.

Mutations in monoamine oxidase (MAO) genes in mice lead to hypersensitivity to serotonin-enhancing drugs: implications for drug side effects in humans

PubMed Central

Fox, MA; Panessiti, MG; Moya, PR; Tolliver, TJ; Chen, K; Shih, JC; Murphy, DL

2012-01-01

A possible side effect of serotonin-enhancing drugs is the serotonin syndrome, which can be lethal. Here we examined possible hypersensitivity to two such drugs, the serotonin precursor 5-hydroxy-L-tryptophan (5-HTP) and the atypical opioid tramadol, in mice lacking the genes for both monoamine oxidase A (MAOA) and MAOB. MAOA/B-knockout (KO) mice displayed baseline serotonin syndrome behaviors, and these behavioral responses were highly exaggerated following 5-HTP or tramadol versus baseline and wild-type (WT) littermates. Compared with MAOA/B-WT mice, baseline tissue serotonin levels were increased ~2.6–3.9-fold in MAOA/B-KO mice. Following 5-HTP, serotonin levels were further increased ~4.5–6.2-fold in MAOA/B-KO mice. These exaggerated responses are in line with the exaggerated responses following serotonin-enhancing drugs that we previously observed in mice lacking the serotonin transporter (SERT). These findings provide a second genetic mouse model suggestive of possible human vulnerability to the serotonin syndrome in individuals with lesser-expressing MAO or SERT polymorphisms that confer serotonergic system changes. PMID:22964922

Immobilization of xanthine oxidase on a polyaniline silicone support.

PubMed

Nadruz, W; Marques, E T; Azevedo, W M; Lima-Filho, J L; Carvalho, L B

1996-03-01

A polyaniline silicone support to immobilize xanthine oxidase is proposed as a reactor coil to monitor the action of xanthine oxidase on hypoxanthine, xanthine and 6-mercaptopurine. A purified xanthine oxidase immobilized on this support lost 80% of the initial activity after 12 min of use. Co-immobilization of superoxide dismutase and catalase increased the stability of immobilized xanthine oxidase so that the derivative maintained 79% of its initial activity after 4.6 h of continuous use in which 1.5 mumol purine bases were converted by the immobilized enzyme system. There is no evidence of either polyaniline or protein leaching from the coil during 3 h of continuous use. When solutions (10 ml) of hypoxanthine, xanthine and 6-mercaptopurine were circulated individually through the xanthine oxidase-superoxide dismutase-catalase-polyaniline coil (1 mm internal diameter and 3 m in length, 3 ml internal volume) activities of 8.12, 11.17 and 1.09 nmol min-1 coil-1, respectively, were obtained. The advantages of the reactor configuration and the redox properties of the polymer, particularly with respect to immobilized oxidoreductases, make this methodology attractive for similar enzyme systems. This immobilized enzyme system using polyaniline-silicone as support converted 6-mercaptopurine to 6-thiouric acid with equal efficiency as resins based on polyacrylamide and polyamide 11.

Cytotoxicity of polyamines to Amoeba proteus: role of polyamine oxidase.

PubMed

Schenkel, E; Dubois, J G; Helson-Cambier, M; Hanocq, M

1996-02-01

It has been shown that oxidation of polyamines by polyamine oxidases can produce toxic compounds (H2O2, aldehydes, ammonia) and that the polyamine oxidase-polyamine system is implicated, in vitro, in the death of several parasites. Using Amoeba proteus as an in vitro model, we studied the cytotoxicity to these cells of spermine, spermidine, their acetyl derivatives, and their hypothetical precursors. Spermine and N1-acetylspermine were more toxic than emetine, an amoebicidal reference drug. Spermine presented a short-term toxicity, but a 48-h contact time was necessary for the high toxicity of spermidine. The uptake by Amoeba cells of the different polyamines tested was demonstrated. On the other hand, a high polyamine oxidase activity was identified in Amoeba proteus crude extract. Spermine (theoretical 100%) and N1-acetylspermine (64%) were the best substrates at pH 9.5, while spermidine, its acetyl derivatives, and putrescine were very poorly oxidized by this enzyme (3-20%). Spermine oxidase activity was inhibited by phenylhydrazine (nil) and isoniazid (approximately 50%). Mepacrine did not inhibit the enzyme activity at pH 8. Neither monoamine nor diamine oxidase activity (approximately 10%) was found. It must be emphasized that spermine, the best enzyme substrate, is the most toxic polyamine. This finding suggests that knowledge of polyamine oxidase specificity can be used to modulate the cytotoxicity of polyamine derivatives. Amoeba proteus was revealed as a simple model for investigation of the connection between cytotoxicity and enzyme activity.

Simple, high-yield purification of xanthine oxidase from bovine milk.

PubMed

Ozer, N; Müftüoglu, M; Ataman, D; Ercan, A; Ogüs, I H

1999-05-13

Xanthine oxidase, a commercially important enzyme with a wide area of application, was extracted from fresh milk, without added preservatives, using toluene and heat. The short purification procedure, with high yield, consisted of extraction, ammonium sulfate fractionation, and DEAE-Sepharose (fast flow) column chromatography. Xanthine oxidase was eluted as a single activity peak from the column using a buffer gradient. The purification fold, specific activity and yield for the purified xanthine oxidase were 328, 10.161 U/mg and 69%, respectively. The enzyme was concentrated by ultrafiltration, although 31% of the activity was lost during concentration, no change in specific activity was observed. Activity and protein gave coincident staining bands on native polyacrylamide gels. The intensity and the number of bands were dependent on the oxidative state(s) of the enzyme; reduction by 2-mercaptoethanol decreased the intensity of the slow-moving bands and increased the intensity of the fastest-moving band. Following sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), two major bands (molecular masses of 152 and 131 kDa) were observed, accounting for > or = 95% of xanthine oxidase. Native- and SDS-PAGE showed that the purified xanthine oxidase becomes a heterodimer due to endogenous proteases.

Rhodobacter capsulatus contains a novel cb-type cytochrome c oxidase without a CuA center.

PubMed

Gray, K A; Grooms, M; Myllykallio, H; Moomaw, C; Slaughter, C; Daldal, F

1994-03-15

The facultative phototrophic bacterium Rhodobacter capsulatus is capable of growth in a wide range of environmental conditions using a highly branched electron-transfer chain. During respiratory growth of this organism reducing equivalents are conveyed to oxygen via two terminal oxidases, previously called "cyt b410" (cytochrome c oxidase) and "cyt b260" (quinol oxidase). The cytochrome c oxidase was purified to homogeneity from a semiaerobically grown R. capsulatus strain. The purified enzyme consumes oxygen at a rate of 600 s-1, oxidizes reduced equine cyt c and R. capsulatus cyt c2, and has high sensitivity to cyanide. The complex is composed of three major polypeptides of apparent molecular masses 45, 32, and 28 kDa on SDS-PAGE. The 32- and 28-kDa proteins also stain with tetramethylbenzidine, indicating that they are c-type cytochromes. Partial amino acid sequences obtained from each of the subunits reveal significant homology to the fixN, fixO, and fixP gene products of Bradyrhizobium japonicum and Rhizobium meliloti. The reduced enzyme has an optical absorption spectrum with distinct features near 550 and 560 nm and an asymmetric Soret band centered at 418 nm, indicating the presence of both c- and b-type cytochromes. Two electrochemically distinct cyt c are apparent, with redox midpoint potentials (Em7) of 265 and 320 mV, while the low-spin cyt b has an Em7 value of 385 mV. The enzyme binds carbon monoxide, and the CO difference spectrum indicates that CO binds to a high-spin cyt b. Pyridine hemochrome and HPLC analyses suggest that the complex contains 1 mol of heme C to 1 mol of protoheme and that neither heme O nor heme A is present.(ABSTRACT TRUNCATED AT 250 WORDS)

Elevated Mitochondrial Reactive Oxygen Species and Cellular Redox Imbalance in Human NADPH-Oxidase-Deficient Phagocytes

PubMed Central

Sundqvist, Martina; Christenson, Karin; Björnsdottir, Halla; Osla, Veronica; Karlsson, Anna; Dahlgren, Claes; Speert, David P.; Fasth, Anders; Brown, Kelly L.; Bylund, Johan

2017-01-01

Chronic granulomatous disease (CGD) is caused by mutations in genes that encode the NADPH-oxidase and result in a failure of phagocytic cells to produce reactive oxygen species (ROS) via this enzyme system. Patients with CGD are highly susceptible to infections and often suffer from inflammatory disorders; the latter occurs in the absence of infection and correlates with the spontaneous production of inflammatory cytokines. This clinical feature suggests that NADPH-oxidase-derived ROS are not required for, or may even suppress, inflammatory processes. Experimental evidence, however, implies that ROS are in fact required for inflammatory cytokine production. By using a myeloid cell line devoid of a functional NADPH-oxidase and primary CGD cells, we analyzed intracellular oxidants, signs of oxidative stress, and inflammatory cytokine production. Herein, we demonstrate that phagocytes lacking a functional NADPH-oxidase, namely primary CGD phagocytes and a gp91phox-deficient cell line, display elevated levels of ROS derived from mitochondria. Accordingly, these cells, despite lacking the major source of cellular ROS, display clear signs of oxidative stress, including an induced expression of antioxidants and altered oxidation of cell surface thiols. These observed changes in redox state were not due to abnormalities in mitochondrial mass or membrane integrity. Finally, we demonstrate that increased mitochondrial ROS enhanced phosphorylation of ERK1/2, and induced production of IL8, findings that correlate with previous observations of increased MAPK activation and inflammatory cytokine production in CGD cells. Our data show that elevated baseline levels of mitochondria-derived oxidants lead to the counter-intuitive observation that CGD phagocytes are under oxidative stress and have enhanced MAPK signaling, which may contribute to the elevated basal production of inflammatory cytokines and the sterile inflammatory manifestations in CGD. PMID:29375548

Ectopic expression of GA 2-oxidase 6 from rapeseed (Brassica napus L.) causes dwarfism, late flowering and enhanced chlorophyll accumulation in Arabidopsis thaliana.

PubMed

Yan, Jindong; Liao, Xiaoying; He, Reqing; Zhong, Ming; Feng, Panpan; Li, Xinmei; Tang, Dongying; Liu, Xuanming; Zhao, Xiaoying

2017-02-01

Gibberellins (GAs) are endogenous hormones that play an important role in higher plant growth and development. GA2-oxidase (GA2ox) promotes catabolism and inactivation of bioactive GAs or their precursors. In this study, we identified the GA2-oxidase gene, BnGA2ox6, and found it to be highly expressed in the silique and flower. Overexpression of BnGA2ox6 in Arabidopsis resulted in GA-deficiency symptoms, including inhibited elongation of the hypocotyl and stem, delayed seed germination, and late flowering. BnGA2ox6 overexpression reduced silique growth, but had no effect on seed development. Additionally, BnGA2ox6 overexpression enhanced chlorophyll b and total chlorophyll accumulation, and downregulated mRNA expression levels of the CHL1 and RCCR genes, which are involved in the chlorophyll degradation. These findings suggest that BnGA2ox6 regulates plant hight, silique development, flowering and chlorophyll accumulation in transgenic Arabidopsis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Urate Oxidase Purification by Salting-in Crystallization: Towards an Alternative to Chromatography

PubMed Central

Giffard, Marion; Ferté, Natalie; Ragot, François; El Hajji, Mohamed; Castro, Bertrand; Bonneté, Françoise

2011-01-01

Background Rasburicase (Fasturtec® or Elitek®, Sanofi-Aventis), the recombinant form of urate oxidase from Aspergillus flavus, is a therapeutic enzyme used to prevent or decrease the high levels of uric acid in blood that can occur as a result of chemotherapy. It is produced by Sanofi-Aventis and currently purified via several standard steps of chromatography. This work explores the feasibility of replacing one or more chromatography steps in the downstream process by a crystallization step. It compares the efficacy of two crystallization techniques that have proven successful on pure urate oxidase, testing them on impure urate oxidase solutions. Methodology/Principal Findings Here we investigate the possibility of purifying urate oxidase directly by crystallization from the fermentation broth. Based on attractive interaction potentials which are known to drive urate oxidase crystallization, two crystallization routes are compared: a) by increased polymer concentration, which induces a depletion attraction and b) by decreased salt concentration, which induces attractive interactions via a salting-in effect. We observe that adding polymer, a very efficient way to crystallize pure urate oxidase through the depletion effect, is not an efficient way to grow crystals from impure solution. On the other hand, we show that dialysis, which decreases salt concentration through its strong salting-in effect, makes purification of urate oxidase from the fermentation broth possible. Conclusions The aim of this study is to compare purification efficacy of two crystallization methods. Our findings show that crystallization of urate oxidase from the fermentation broth provides purity comparable to what can be achieved with one chromatography step. This suggests that, in the case of urate oxidase, crystallization could be implemented not only for polishing or concentration during the last steps of purification, but also as an initial capture step, with minimal changes to the

Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity

PubMed Central

Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

2012-01-01

Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor. PMID:23203056

Overexpression of the gibberellin 2-oxidase gene from Torenia fournieri induces dwarf phenotypes in the liliaceous monocotyledon Tricyrtis sp.

PubMed

Otani, Masahiro; Meguro, Shuhei; Gondaira, Haruka; Hayashi, Megumi; Saito, Misaki; Han, Dong-Sheng; Inthima, Phithak; Supaibulwatana, Kanyaratt; Mori, Shiro; Jikumaru, Yusuke; Kamiya, Yuji; Li, Tuoping; Niki, Tomoya; Nishijima, Takaaki; Koshioka, Masaji; Nakano, Masaru

2013-11-01

Gibberellins (GAs) are the plant hormones that control many aspects of plant growth and development, including stem elongation. Genes encoding enzymes related to the GA biosynthetic and metabolic pathway have been isolated and characterized in many plant species. Gibberellin 2-oxidase (GA2ox) catalyzes bioactive GAs or their immediate precursors to inactive forms; therefore, playing a direct role in determining the levels of bioactive GAs. In the present study, we produced transgenic plants of the liliaceous monocotyledon Tricyrtis sp. overexpressing the GA2ox gene from the linderniaceous dicotyledon Torenia fournieri (TfGA2ox2). All six transgenic plants exhibited dwarf phenotypes, and they could be classified into two classes according to the degree of dwarfism: three plants were moderately dwarf and three were severely dwarf. All of the transgenic plants had small or no flowers, and smaller, rounder and darker green leaves. Quantitative real-time reverse transcription-polymerase chain reaction (PCR) analysis showed that the TfGA2ox2 expression level generally correlated with the degree of dwarfism. The endogenous levels of bioactive GAs, GA1 and GA4, largely decreased in transgenic plants as shown by liquid chromatography-mass spectrometry (LC-MS) analysis, and the level also correlated with the degree of dwarfism. Exogenous treatment of transgenic plants with gibberellic acid (GA3) resulted in an increased shoot length, indicating that the GA signaling pathway might normally function in transgenic plants. Thus, morphological changes in transgenic plants may result from a decrease in the endogenous levels of bioactive GAs. Finally, a possibility of molecular breeding for plant form alteration in liliaceous ornamental plants by genetically engineering the GA metabolic pathway is discussed. Copyright © 2013 Elsevier GmbH. All rights reserved.

[Cytochrome c oxydase-deficient Leigh syndrome with homozygous mutation in SURF1 gene].

PubMed

Monnot, S; Chabrol, B; Cano, A; Pellissier, J F; Collignon, P; Montfort, M F; Paquis-Flucklinger, V

2005-05-01

Leigh syndrome is a heterogeneous disorder, usually due to a defect in oxidative metabolism. Mutations in SURF1 gene have been identified in patients with cytochrome c oxidase deficiency. We report a homozygous splice site deletion [516-2_516-1delAG] in a young girl presenting with cytochrome c oxidase-deficient Leigh syndrome. Identification of molecular defect is indispensable for genetic counselling and prenatal diagnosis.

Hyperglycaemia promotes human brain microvascular endothelial cell apoptosis via induction of protein kinase C-ßI and prooxidant enzyme NADPH oxidase.

PubMed

Shao, Beili; Bayraktutan, Ulvi

2014-01-01

Blood-brain barrier disruption represents a key feature in hyperglycaemia-aggravated cerebral damage after an ischaemic stroke. Although the underlying mechanisms remain largely unknown, activation of protein kinase C (PKC) is thought to play a critical role. This study examined whether apoptosis of human brain microvascular endothelial cells (HBMEC) might contribute to hyperglycaemia-evoked barrier damage and assessed the specific role of PKC in this phenomenon. Treatments with hyperglycaemia (25 mM) or phorbol myristate acetate (PMA, a protein kinase C activator, 100 nM) significantly increased NADPH oxidase activity, O2 (•-) generation, proapoptotic protein Bax expression, TUNEL-positive staining and caspase-3/7 activities. Pharmacological inhibition of NADPH oxidase, PKC-a, PKC-ß or PKC-ßI via their specific inhibitors and neutralisation of O2 (•-) by a cell-permeable superoxide dismutase mimetic, MnTBAP normalised all the aforementioned increases induced by hyperglycaemia. Suppression of these PKC isoforms also negated the stimulatory effects of hyperglycaemia on the protein expression of NADPH oxidase membrane-bound components, Nox2 and p22-phox which determine the overall enzymatic activity. Silencing of PKC-ßI gene through use of specific siRNAs abolished the effects of both hyperglycaemia and PMA on endothelial cell NADPH oxidase activity, O2 (•-) production and apoptosis and consequently improved the integrity and function of an in vitro model of human cerebral barrier comprising HBMEC, astrocytes and pericytes. Hyperglycaemia-mediated apoptosis of HBMEC contributes to cerebral barrier dysfunction and is modulated by sequential activations of PKC-ßI and NADPH oxidase.

Hyperglycaemia promotes human brain microvascular endothelial cell apoptosis via induction of protein kinase C-ßI and prooxidant enzyme NADPH oxidase

PubMed Central

Shao, Beili; Bayraktutan, Ulvi

2014-01-01

Blood–brain barrier disruption represents a key feature in hyperglycaemia-aggravated cerebral damage after an ischaemic stroke. Although the underlying mechanisms remain largely unknown, activation of protein kinase C (PKC) is thought to play a critical role. This study examined whether apoptosis of human brain microvascular endothelial cells (HBMEC) might contribute to hyperglycaemia-evoked barrier damage and assessed the specific role of PKC in this phenomenon. Treatments with hyperglycaemia (25 mM) or phorbol myristate acetate (PMA, a protein kinase C activator, 100 nM) significantly increased NADPH oxidase activity, O2•- generation, proapoptotic protein Bax expression, TUNEL-positive staining and caspase-3/7 activities. Pharmacological inhibition of NADPH oxidase, PKC-a, PKC-ß or PKC-ßI via their specific inhibitors and neutralisation of O2•- by a cell-permeable superoxide dismutase mimetic, MnTBAP normalised all the aforementioned increases induced by hyperglycaemia. Suppression of these PKC isoforms also negated the stimulatory effects of hyperglycaemia on the protein expression of NADPH oxidase membrane-bound components, Nox2 and p22-phox which determine the overall enzymatic activity. Silencing of PKC-ßI gene through use of specific siRNAs abolished the effects of both hyperglycaemia and PMA on endothelial cell NADPH oxidase activity, O2•- production and apoptosis and consequently improved the integrity and function of an in vitro model of human cerebral barrier comprising HBMEC, astrocytes and pericytes. Hyperglycaemia-mediated apoptosis of HBMEC contributes to cerebral barrier dysfunction and is modulated by sequential activations of PKC-ßI and NADPH oxidase. PMID:24936444

A TaqMan real-time PCR method based on alternative oxidase genes for detection of plant species in animal feed samples.

PubMed

Campos, Maria Doroteia; Valadas, Vera; Campos, Catarina; Morello, Laura; Braglia, Luca; Breviario, Diego; Cardoso, Hélia G

2018-01-01

Traceability of processed food and feed products has been gaining importance due to the impact that those products can have on human/animal health and to the associated economic and legal concerns, often related to adulterations and frauds as it can be the case for meat and milk. Despite mandatory traceability requirements for the analysis of feed composition, few reliable and accurate methods are presently available to enforce the legislative frame and allow the authentication of animal feeds. In this study, nine sensitive and species-specific real-time PCR TaqMan MGB assays are described for plant species detection in animal feed samples. The method is based on selective real-time qPCR (RT-qPCR) amplification of target genes belonging to the alternative oxidase (AOX) gene family. The plant species selected for detection in feed samples were wheat, maize, barley, soybean, rice and sunflower as common components of feeds, and cotton, flax and peanut as possible undesirable contaminants. The obtained results were compared with end-point PCR methodology. The applicability of the AOX TaqMan assays was evaluated through the screening of commercial feed samples, and by the analysis of plant mixtures with known composition. The RT-qPCR methodology allowed the detection of the most abundant species in feeds but also the identification of contaminant species present in lower amounts, down to 1% w/w. AOX-based methodology provides a suitable molecular marker approach to ascertain plant species composition of animal feed samples, thus supporting feed control and enforcement of the feed sector and animal production.

Association study between monoamine oxidase A (MAOA) gene polymorphisms and schizophrenia: lack of association with schizophrenia and possible association with affective disturbances of schizophrenia.

PubMed

Kim, Su Kang; Park, Hae Jeong; Seok, Hosik; Jeon, Hye Sook; Chung, Joo-Ho; Kang, Won Sub; Kim, Jong Woo; Yu, Gyeong Im; Shin, Dong Hoon

2014-05-01

Monoamine oxidase A (MAOA) catalyzes monoamine neurotransmitters including dopamine, 5-hydroxytryptamine (5-HT, serotonin), and norepinephrine. MAOA also plays a key role in emotional regulation. The aim of this study was to investigate the associations between the exonic single nucleotide polymorphisms (SNPs) of the MAOA gene located on the X chromosome and schizophrenia. We also analyzed the relationships between these SNPs and the common clinical symptoms of schizophrenia such as persecutory delusion, auditory hallucinations, affective disturbances, and poor concentration. Two hundred seventy five Korean schizophrenia patients and 289 control subjects were recruited. Three SNPs [rs6323 (Arg294Arg), rs1137070 (Asp470Asp), and rs3027407 (3'-untranslated region)] of the MAOA gene were selected and genotyped by direct sequencing. The common clinical symptoms of schizophrenia according to the Operation Criteria Checklist were analyzed. Three examined SNPs showed no associations with male and female schizophrenia, respectively (p>0.05). In the analysis of the common clinical symptoms of schizophrenia patients, three examined SNPs were associated with affective disturbances, especially restricted affect and blunted affect in male schizophrenia, respectively (restricted affect, p=0.002, OR=2.71, 95% CI 1.45-5.00; blunted affect, p=0.009, OR 2.25, 95% CI 1.22-4.12). The SNPs were not associated with other clinical symptoms of schizophrenia (persecutory delusion, auditory hallucinations, and poor concentration). These results suggest that exonic SNPs (rs6323, rs1137070, and rs3027407) of the MAOA gene may be contributed to affective disturbances of Korean males schizophrenia, especially restricted affect and blunted affect.

Iron Absorption in Drosophila melanogaster

PubMed Central

Mandilaras, Konstantinos; Pathmanathan, Tharse; Missirlis, Fanis

2013-01-01

The way in which Drosophila melanogaster acquires iron from the diet remains poorly understood despite iron absorption being of vital significance for larval growth. To describe the process of organismal iron absorption, consideration needs to be given to cellular iron import, storage, export and how intestinal epithelial cells sense and respond to iron availability. Here we review studies on the Divalent Metal Transporter-1 homolog Malvolio (iron import), the recent discovery that Multicopper Oxidase-1 has ferroxidase activity (iron export) and the role of ferritin in the process of iron acquisition (iron storage). We also describe what is known about iron regulation in insect cells. We then draw upon knowledge from mammalian iron homeostasis to identify candidate genes in flies. Questions arise from the lack of conservation in Drosophila for key mammalian players, such as ferroportin, hepcidin and all the components of the hemochromatosis-related pathway. Drosophila and other insects also lack erythropoiesis. Thus, systemic iron regulation is likely to be conveyed by different signaling pathways and tissue requirements. The significance of regulating intestinal iron uptake is inferred from reports linking Drosophila developmental, immune, heat-shock and behavioral responses to iron sequestration. PMID:23686013

Structure of caa(3) cytochrome c oxidase--a nature-made enzyme-substrate complex.

PubMed

Noor, Mohamed Radzi; Soulimane, Tewfik

2013-05-01

Aerobic respiration, the energetically most favorable metabolic reaction, depends on the action of terminal oxidases that include cytochrome c oxidases. The latter forms a part of the heme-copper oxidase superfamily and consists of three different families (A, B, and C types). The crystal structures of all families have now been determined, allowing a detailed structural comparison from evolutionary and functional perspectives. The A2-type oxidase, exemplified by the Thermus thermophilus caa(3) oxidase, contains the substrate cytochrome c covalently bound to the enzyme complex. In this article, we highlight the various features of caa(3) enzyme and provide a discussion of their importance, including the variations in the proton and electron transfer pathways.

Degradation of oxalate in rats implanted with immobilized oxalate oxidase.

PubMed

Raghavan, K G; Tarachand, U

1986-01-20

Accumulation of oxalate leads to hyperoxaluria and calcium oxalate nephrolithiasis in man. Since oxalate is a metabolic end product in mammals, the feasibility of its enzymic degradation has been tested in vivo in rats by administering exogenous oxalate oxidase. Oxalate oxidase, isolated from banana fruit peels, in its native form was found to be non-active at the physiological pH of the recipient animal. However, its functional viability in the recipient animal was ensured by its prior binding with ethylenemaleic anhydride, thus shifting its pH activity curve towards the alkaline range. Rats implanted with dialysis membrane capsules containing such immobilized oxalate oxidase in their peritoneal cavities effectively metabolized intraperitoneally injected [14C]oxalate as well as its precursor [14C]glyoxalate. The implantation of capsules containing coentrapped multienzyme preparations of oxalate oxidase, catalase and peroxidase led to a further degradation of administered [14C]oxalate in rats.

Molecular characterization of Taenia multiceps isolates from Gansu Province, China by sequencing of mitochondrial cytochrome C oxidase subunit 1.

PubMed

Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu; Fu, Bao Quan

2013-04-01

A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species.

Molecular Characterization of Taenia multiceps Isolates from Gansu Province, China by Sequencing of Mitochondrial Cytochrome C Oxidase Subunit 1

PubMed Central

Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu

2013-01-01

A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species. PMID:23710087

Urate oxidase is imported into peroxisomes recognizing the C-terminal SKL motif of proteins.

PubMed

Miura, S; Oda, T; Funai, T; Ito, M; Okada, Y; Ichiyama, A

1994-07-01

Rat liver urate oxidase synthesized from cDNA through coupled transcription and translation was incubated at 26 degrees C for 60 min with purified peroxisomes from rat liver. Urate oxidase was efficiently imported into the peroxisomes, as determined by resistance to externally added proteinase K. The amount of imported urate oxidase increased with time and the import was temperature dependent. A synthetic peptide composed of the C-terminal 10 amino acid residues of acyl-CoA oxidase (the C-terminal tripeptide is Ser-Lys-Leu) inhibited the import of urate oxidase, whereas other peptides, in which the C-terminal Ser-Lys-Leu (SKL) sequence was deleted or mutated, were not effective. Two mutant urate oxidase proteins in which the C-terminal Ser-Arg-Leu (SRL) sequence was deleted or mutated to Ser-Glu-Leu (SEL) were not imported into peroxisomes. With substitution of a lysine residue for arginine in the SRL tripeptide at the C-terminus the import activity was retained. These results show that urate oxidase is important into peroxisomes via a common pathway with acyl-CoA oxidase, and that the C-terminal SRL sequence functions as a peroxisomal-targeting signal.

Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

PubMed

Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

2015-12-10

D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

Multilayered Polyelectrolyte Microcapsules: Interaction with the Enzyme Cytochrome C Oxidase

PubMed Central

Pastorino, Laura; Dellacasa, Elena; Noor, Mohamed R.; Soulimane, Tewfik; Bianchini, Paolo; D'Autilia, Francesca; Antipov, Alexei; Diaspro, Alberto; Tofail, Syed A. M.; Ruggiero, Carmelina

2014-01-01

Cell-sized polyelectrolyte capsules functionalized with a redox-driven proton pump protein were assembled for the first time. The interaction of polyelectrolyte microcapsules, fabricated by electrostatic layer-by-layer assembly, with cytochrome c oxidase molecules was investigated. We found that the cytochrome c oxidase retained its functionality, that the functionalized microcapsules interacting with cytochrome c oxidase were permeable and that the permeability characteristics of the microcapsule shell depend on the shell components. This work provides a significant input towards the fabrication of an integrated device made of biological components and based on specific biomolecular functions and properties. PMID:25372607

Genetic characterization and expression analysis of wheat (Triticum aestivum) line 07OR1074 exhibiting very low polyphenol oxidase (PPO) activity

USDA-ARS?s Scientific Manuscript database

Wheat (Triticum aestivum) polyphenol oxidase (PPO) contributes to the time dependent discoloration of Asian noodles. Wheat contains multiple paralogous and orthologous PPO genes , Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2, expressed in wheat kernels, Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2. To d...

Oligoamine analogues in combination with 2-difluoromethylornithine synergistically induce re-expression of aberrantly silenced tumour-suppressor genes

PubMed Central

Wu, Yu; Steinbergs, Nora; Murray-Stewart, Tracy; Marton, Laurence J.; Casero, Robert A.

2011-01-01

Epigenetic gene silencing is an important mechanism in the initiation and progression of cancer. Abnormal DNA CpG island hypermethylation and histone modifications are involved in aberrant silencing of tumour-suppressor genes. LSD1 (lysine-specific demethylase 1) was the first enzyme identified to specifically demethylate H3K4 (Lys4 of histone H3). Methylated H3K4 is an important mark associated with transcriptional activation. The flavin adenine dinucleotide-binding amine oxidase domain of LSD1 is homologous with two polyamine oxidases, SMO (spermine oxidase) and APAO (N1-acetylpolyamine oxidase). We have demonstrated previously that long-chain polyamine analogues, the oligoamines, are inhibitors of LSD1. In the present paper we report the synergistic effects of specific oligoamines in combination with DFMO (2-difluoromethylornithine), an inhibitor of ornithine decarboxylase, in human colorectal cancer cells. DFMO treatment depletes natural polyamines and increases the uptake of exogenous polyamines. The combination of oligoamines and DFMO results in a synergistic re-expression of aberrantly silenced tumour-suppressor genes, including SFRP2 (secreted frizzled-related protein 2), which encodes a Wnt signalling pathway antagonist and plays an anti-tumorigenic role in colorectal cancer. The treatment-induced re-expression of SFRP2 is associated with increased H3K4me2 (di-methyl H3K4) in the gene promoter. The combination of LSD1-inhibiting oligoamines and DFMO represents a novel approach to epigenetic therapy of cancer. PMID:22132744

Cyanide-insensitive quinol oxidase (CIO) from Gluconobacter oxydans is a unique terminal oxidase subfamily of cytochrome bd.

PubMed

Miura, Hiroshi; Mogi, Tatsushi; Ano, Yoshitaka; Migita, Catharina T; Matsutani, Minenosuke; Yakushi, Toshiharu; Kita, Kiyoshi; Matsushita, Kazunobu

2013-06-01

Cyanide-insensitive terminal quinol oxidase (CIO) is a subfamily of cytochrome bd present in bacterial respiratory chain. We purified CIO from the Gluconobacter oxydans membranes and characterized its properties. The air-oxidized CIO showed some or weak peaks of reduced haemes b and of oxygenated and ferric haeme d, differing from cytochrome bd. CO- and NO-binding difference spectra suggested that haeme d serves as the ligand-binding site of CIO. Notably, the purified CIO showed an extraordinary high ubiquinol-1 oxidase activity with the pH optimum of pH 5-6. The apparent Vmax value of CIO was 17-fold higher than that of G. oxydans cytochrome bo3. In addition, compared with Escherichia coli cytochrome bd, the quinol oxidase activity of CIO was much more resistant to cyanide, but sensitive to azide. The Km value for O2 of CIO was 7- to 10-fold larger than that of G. oxydans cytochrome bo3 or E. coli cytochrome bd. Our results suggest that CIO has unique features attributable to the structure and properties of the O2-binding site, and thus forms a new sub-group distinct from cytochrome bd. Furthermore, CIO of acetic acid bacteria may play some specific role for rapid oxidation of substrates under acidic growth conditions.

Nuclear localization of human spermine oxidase isoforms – possible implications in drug response and disease etiology

PubMed Central

Murray-Stewart, Tracy; Wang, Yanlin; Goodwin, Andrew; Hacker, Amy; Meeker, Alan; Casero, Robert A.

2013-01-01

The recent discovery of the direct oxidation of spermine via spermine oxidase (SMO) as a mechanism through which specific antitumor polyamine analogues exert their cytotoxic effects has fueled interest in the study of the polyamine catabolic pathway. A major byproduct of spermine oxidation is H2O2, a source of toxic reactive oxygen species. Recent targeted small interfering RNA studies have confirmed that SMO-produced reactive oxygen species are directly responsible for oxidative stress capable of inducing apoptosis and potentially mutagenic DNA damage. In the present study, we describe a second catalytically active splice variant protein of the human spermine oxidase gene, designated SMO5, which exhibits substrate specificities and affinities comparable to those of the originally identified human spermine oxidase-1, SMO/PAOh1, and, as such, is an additional source of H2O2. Importantly, overexpression of either of these SMO isoforms in NCI-H157 human non-small cell lung carcinoma cells resulted in significant localization of SMO protein in the nucleus, as determined by confocal microscopy. Furthermore, cell lines overexpressing either SMO/PAOh1 or SMO5 demonstrated increased spermine oxidation in the nucleus, with accompanying alterations in individual nuclear polyamine concentrations. This increased oxidation of spermine in the nucleus therefore increases the production of highly reactive H2O2 in close proximity to DNA, as well as decreases nuclear spermine levels, thus altering the protective roles of spermine in free radical scavenging and DNA shielding, and resulting in an overall increased potential for oxidative DNA damage in these cells. The results of these studies therefore have considerable significance both with respect to targeting polyamine oxidation as an antineoplastic strategy, and in regard to the potential role of spermine oxidase in inflammation-induced carcinogenesis. PMID:18422650

Determination of Monoamine Oxidase A and B Activity in Long-Term Treated Patients With Parkinson Disease.

PubMed

Müller, Thomas; Riederer, Peter; Grünblatt, Edna

Biogenic amines and monoamine oxidase inhibitors influence peripheral monoamine oxidase enzyme activity in chronic levodopa/dopa decarboxylase inhibitor-treated patients with Parkinson disease. Rasagiline is an irreversible inhibitor of monoamine oxidase B. Safinamide blocks this isoenzyme in a reversible fashion. The aim of this study was to determine monoamine oxidase A (plasma) and B (platelets) enzyme activity in long-term levodopa-treated patients without and with additional oral intake of 50- or 100-mg safinamide or 1-mg rasagiline or first-time intake of rasagiline. Monoamine oxidase A enzyme activity did not differ between all groups. Patients on rasagiline or safinamide showed lower monoamine oxidase-B enzyme activity compared with patients without monoamine oxidase B inhibitor intake. No impact of the number of previous oral levodopa intakes was found. Rasagiline and safinamide did not essentially differ in terms of inhibition of monoamine oxidase B despite their different pharmacology regarding reversibility of monoamine oxidase B inhibition. In view of the observed, considerable heterogeneity of enzyme activities, we suggest to determine activities of monoamine oxidase A and B to reduce the risk for tyramine-induced hypertension and the serotonergic syndrome during chronic therapy with rasagiline or safinamide.

Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines.

PubMed

Houde, Mario; Diallo, Amadou Oury

2008-08-27

Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive) that differ in their response to Al were performed. Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate) needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

Molecular mechanism of monoamine oxidase A gene regulation under inflammation and ischemia-like conditions: key roles of the transcription factors GATA2, Sp1 and TBP.

PubMed

Gupta, Vinayak; Khan, Abrar A; Sasi, Binu K; Mahapatra, Nitish R

2015-07-01

Monoamine oxidase A (MAOA) plays important roles in the pathogenesis of several neurological and cardiovascular disorders. The mechanism of transcriptional regulation of MAOA under basal and pathological conditions, however, remains incompletely understood. Here, we report systematic identification and characterization of cis elements and transcription factors that govern the expression of MAOA gene. Extensive computational analysis of MAOA promoter, followed by 5'-promoter deletion/reporter assays, revealed that the -71/-40 bp domain was sufficient for its basal transcription. Gel-shift and chromatin immunoprecipitation assays provided evidence of interactions of the transcription factors GATA-binding protein 2 (GATA2), Sp1 and TATA-binding protein (TBP) with this proximal promoter region. Consistently, over-expression of GATA2, Sp1 and TBP augmented MAOA promoter activity in a coordinated manner. In corroboration, siRNA-mediated down-regulation of GATA2/Sp1/TBP repressed the endogenous MAOA expression as well as transfected MAOA promoter activity. Tumor necrosis factor-α and forskolin activated MAOA transcription that was reversed by Sp1 siRNA; in support, tumor necrosis factor-α- and forskolin-induced activities were enhanced by ectopic over-expression of Sp1. On the other hand, MAOA transcription was diminished upon exposure of neuroblasts or cardiac myoblasts to ischemia-like conditions because of reduced binding of GATA2/Sp1/TBP with MAOA promoter. In conclusion, this study revealed previously unknown roles of GATA2, Sp1 and TBP in modulating MAOA expression under basal as well as pathophysiological conditions such as inflammation and ischemia, thus providing new insights into the molecular basis of aberrant MAOA expression in neuronal/cardiovascular disease states. Dysregulation of monoamine oxidase A (MAOA) have been implicated in several behavioral and neuronal disease states. Here, we identified three crucial transcription factors (GATA2, Sp1 and TBP

Chronic ethanol increases calcium/calmodulin-dependent protein kinaseIIδ gene expression and decreases monoamine oxidase amount in rat heart muscles: Rescue effect of Zingiber officinale (ginger) extract.

PubMed

Heshmati, Elaheh; Shirpoor, Alireza; Kheradmand, Fatemeh; Alizadeh, Mohammad; Gharalari, Farzaneh Hosseini

2018-01-01