Sample records for multicopper oxidase gene

  1. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin


    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  2. cumA, a Gene Encoding a Multicopper Oxidase, Is Involved in Mn2+ Oxidation in Pseudomonas putida GB-1

    PubMed Central

    Brouwers, Geert-Jan; de Vrind, Johannes P. M.; Corstjens, Paul L. A. M.; Cornelis, Pierre; Baysse, Christine; de Vrind-de Jong, Elisabeth W.


    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn2+. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu2+ increased the Mn2+-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu2+. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous (level of identity, 45%) to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn2+-oxidizing ability of the organism but resulted in decreased growth. In summary, our data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn2+ and that CumB is required for optimal growth of P. putida GB-1-002. PMID:10103278

  3. cumA Multicopper Oxidase Genes from Diverse Mn(II)-Oxidizing and Non-Mn(II)-Oxidizing Pseudomonas Strains

    PubMed Central

    Francis, Chris A.; Tebo, Bradley M.


    A multicopper oxidase gene, cumA, required for Mn(II) oxidation was recently identified in Pseudomonas putida strain GB-1. In the present study, degenerate primers based on the putative copper-binding regions of the cumA gene product were used to PCR amplify cumA gene sequences from a variety of Pseudomonas strains, including both Mn(II)-oxidizing and non-Mn(II)-oxidizing strains. The presence of highly conserved cumA gene sequences in several apparently non-Mn(II)-oxidizing Pseudomonas strains suggests that this gene may not be expressed, may not be sufficient alone to confer the ability to oxidize Mn(II), or may have an alternative function in these organisms. Phylogenetic analysis of both CumA and 16S rRNA sequences revealed similar topologies between the respective trees, including the presence of several distinct phylogenetic clusters. Overall, our results indicate that both the cumA gene and the capacity to oxidize Mn(II) occur in phylogenetically diverse Pseudomonas strains. PMID:11526033

  4. Crystal Structure of a Two-domain Multicopper Oxidase

    PubMed Central

    Lawton, Thomas J.; Sayavedra-Soto, Luis A.; Arp, Daniel J.; Rosenzweig, Amy C.


    The two-domain multicopper oxidases are proposed to be key intermediates in the evolution of three-domain multicopper oxidases. A number of two-domain multicopper oxidases have been identified from genome sequences and are classified as type A, type B, or type C on the basis of the predicted location of the type 1 copper center. The crystal structure of blue copper oxidase, a type C two-domain multicopper oxidase from Nitrosomonas europaea, has been determined to 1.9 Å resolution. Blue copper oxidase is a trimer, of which each subunit comprises two cupredoxin domains. Each subunit houses a type 1 copper site in domain 1 and a type 2/type 3 trinuclear copper cluster at the subunit-subunit interface. The coordination geometry at the trinuclear copper site is consistent with reduction of the copper ions. Although the overall architecture of blue copper oxidase is similar to nitrite reductases, detailed structural alignments show that the fold and domain orientation more closely resemble the three-domain multicopper oxidases. These observations have important implications for the evolution of nitrite reductases and multicopper oxidases. PMID:19224923

  5. cumA, a gene encoding a multicopper oxidase, is involved in Mn{sup 2+} oxidation in Pseudomonas putida GB-1

    SciTech Connect

    Brouwers, G.J.; Vrind, J.P.M. de; Corstjens, P.L.A.M.; Vrind-de Jong, E.W. de; Cornelis, P.; Baysse, C.


    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn{sup 2+}. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu{sup 2+} increased the Mn{sup 2+}-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu{sup 2+}. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn{sup 2+}-oxidizing ability of the organism but resulted in decreased growth. In summary, the data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn{sup 2+} and that CumB is required for optimal growth of P. putida GB-1-002.

  6. [Ceruloplasmin, hephaestin and zyklopen: the three multicopper oxidases important for human iron metabolism].


    Wierzbicka, Diana; Gromadzka, Grazyna


    Multi-copper oxidases are a group of proteins which demonstrate enzymatic activity and are capable of oxidizing their substrates with the concomitant reduction of dioxygen to two water molecules. For some multi-copper oxidases there has been demonstrated ferroxidase activity which is related to their specific structure characterized by the presence of copper centres and iron-binding sites. Three multi-copper oxidases have been included in this group: ceruloplasmin, hephaestin and zyklopen. Multi-copper oxidases which are expressed in different tissues are capable of oxidizing a wide spectrum of substrates. Multi-copper oxidases are capable of oxidizing a wide spectrum of substrates. Ceruloplasmin exhibits antioxidant activity as well as being involved in many other biological processes. The observations of phenotypic effects of absence or low expression of multi-copper ferroxidase-coding genes suggest that the main role of these proteins is taking part in iron metabolism. The main role of ceruloplasmin in iron turnover is oxidizing Fe2+ into Fe3+, a process which is essential for iron binding to transferrin (the main iron-transporting protein), as well as to ferritin (the main iron-storage protein). The function of hephaestin as ferroxidase is essential for iron binding to apotransferrin in the lamina propria of the intestinal mucosa, a process that is important for further transport of iron to the liver by the portal vein. Available data indicate that zyklopen is responsible for the placental iron transport. The presence of three multi-copper oxidases with ferroxidase activity emphasizes the significance of oxidation for iron metabolism. The distribution of multi-copper ferroxidases in many tissues ensures the proper iron turnover in the body as well as preventing toxic effects related to the presence of Fe2+ ions. These ions contribute to generation of free radicals, including the highly reactive hydroxyl radical, through the Fenton and Haber-Weiss reactions

  7. Elimination of Manganese(II,III) Oxidation in Pseudomonas putida GB-1 by a Double Knockout of Two Putative Multicopper Oxidase Genes

    PubMed Central

    McCarthy, James K.; Tebo, Bradley M.


    Bacterial manganese(II) oxidation impacts the redox cycling of Mn, other elements, and compounds in the environment; therefore, it is important to understand the mechanisms of and enzymes responsible for Mn(II) oxidation. In several Mn(II)-oxidizing organisms, the identified Mn(II) oxidase belongs to either the multicopper oxidase (MCO) or the heme peroxidase family of proteins. However, the identity of the oxidase in Pseudomonas putida GB-1 has long remained unknown. To identify the P. putida GB-1 oxidase, we searched its genome and found several homologues of known or suspected Mn(II) oxidase-encoding genes (mnxG, mofA, moxA, and mopA). To narrow this list, we assumed that the Mn(II) oxidase gene would be conserved among Mn(II)-oxidizing pseudomonads but not in nonoxidizers and performed a genome comparison to 11 Pseudomonas species. We further assumed that the oxidase gene would be regulated by MnxR, a transcription factor required for Mn(II) oxidation. Two loci met all these criteria: PputGB1_2447, which encodes an MCO homologous to MnxG, and PputGB1_2665, which encodes an MCO with very low homology to MofA. In-frame deletions of each locus resulted in strains that retained some ability to oxidize Mn(II) or Mn(III); loss of oxidation was attained only upon deletion of both genes. These results suggest that PputGB1_2447 and PputGB1_2665 encode two MCOs that are independently capable of oxidizing both Mn(II) and Mn(III). The purpose of this redundancy is unclear; however, differences in oxidation phenotype for the single mutants suggest specialization in function for the two enzymes. PMID:23124227

  8. A versatile and efficient markerless gene disruption system for Acidithiobacillus thiooxidans: application for characterizing a copper tolerance related multicopper oxidase gene.


    Wen, Qing; Liu, Xiangmei; Wang, Huiyan; Lin, Jianqun


    The acidophilic bioleaching bacteria can usually survive in high concentrations of copper ions because of their special living environment. However, little is known about the copper homeostatic mechanisms of Acidithiobacillus thiooxidans, an important member of bioleaching bacteria. Here, a putative multicopper oxidase gene (cueO) was detected from the draft genome of A. thiooxidans ATCC 19377. The transcriptional level of cueO in response to 10 mM CuSO₄was upregulated 25.01 ± 2.59 folds. The response of P(cueO) to copper was also detected and might be stimulated by a putative CueR protein. Then, by using the counter-selectable marker lacZ and enhancing the expression of endonuclease I-SceI with tac promoter, a modified markerless gene disruption system was developed and the cueO gene disruption mutant (ΔcueO) of A. thiooxidans was successfully constructed with a markedly improved second homologous recombination frequency of 0.28 ± 0.048. The ΔcueO mutant was more sensitive to external copper and nearly completely lost the phenoloxidase activity; however, the activity could be restored after complementing the cueO gene. All results suggest the close relation of cueO gene to copper tolerance in A. thiooxidans. In addition, the developed efficient markerless gene knockout method can also be introduced into other Acidithiobacillus strains.

  9. Molecular cloning, chromosomal mapping, and sequence analysis of copper resistance genes from Xanthomonas campestris pv. juglandis: homology with small blue copper proteins and multicopper oxidase.

    PubMed Central

    Lee, Y A; Hendson, M; Panopoulos, N J; Schroth, M N


    Copper-resistant strains of Xanthomonas campestris pv. juglandis occur in walnut orchards throughout northern California. The copper resistance genes from a copper-resistant strain C5 of X. campestris pv. juglandis were cloned and located on a 4.9-kb ClaI fragment, which hybridized only to DNA of copper-resistant strains of X. campestris pv. juglandis, and was part of an approximately 20-kb region which was conserved among such strains of X. campestris pv. juglandis. Hybridization analysis indicated that the copper resistance genes were located on the chromosome. Plasmids conferring copper resistance were not detected in copper-resistant strains, nor did mating with copper-sensitive strains result in copper-resistant transconjugants. Copper resistance genes from X. campestris pv. juglandis shared nucleotide sequence similarity with copper resistance genes from Pseudomonas syringae pv. tomato, P. syringae, and X. campestris pv. vesicatoria. DNA sequence analysis of the 4.9-kb fragment from strain C5 revealed that the sequence had an overall G+C content of 58.7%, and four open reading frames (ORF1 to ORF4), oriented in the same direction. All four ORFs were required for full expression of copper resistance, on the basis of Tn3-spice insertional inactivation and deletion analysis. The predicted amino acid sequences of ORF1 to ORF4 showed 65, 45, 47, and 40% identity with CopA, CopB, CopC, and CopD, respectively, from P. syringae pv. tomato. The most conserved regions are ORF1 and CopA and the C-terminal region (166 amino acids from the C terminus) of ORF2 and CopB. The hydrophobicity profiles of each pair of predicted polypeptides are similar except for the N terminus of ORF2 and CopB. Four histidine-rich polypeptide regions in ORF1 and CopA strongly resembled the copper-binding motifs of small blue copper proteins and multicopper oxidases, such as fungal laccases, plant ascorbate oxidase, and human ceruloplasmin. Putative copper ligands of the ORF1 polypeptide

  10. Multicopper manganese oxidase accessory proteins bind Cu and heme.


    Butterfield, Cristina N; Tao, Lizhi; Chacón, Kelly N; Spiro, Thomas G; Blackburn, Ninian J; Casey, William H; Britt, R David; Tebo, Bradley M


    Multicopper oxidases (MCOs) catalyze the oxidation of a diverse group of metal ions and organic substrates by successive single-electron transfers to O2 via four bound Cu ions. MnxG, which catalyzes MnO2 mineralization by oxidizing both Mn(II) and Mn(III), is unique among multicopper oxidases in that it carries out two energetically distinct electron transfers and is tightly bound to accessory proteins. There are two of these, MnxE and MnxF, both approximately 12kDa. Although their sequences are similar to those found in the genomes of several Mn-oxidizing Bacillus species, they are dissimilar to those of proteins with known function. Here, MnxE and MnxF are co-expressed independent of MnxG and are found to oligomerize into a higher order stoichiometry, likely a hexamer. They bind copper and heme, which have been characterized by electron paramagnetic resonance (EPR), X-ray absorption spectroscopy (XAS), and UV-visible (UV-vis) spectrophotometry. Cu is found in two distinct type 2 (T2) copper centers, one of which appears to be novel; heme is bound as a low-spin species, implying coordination by two axial ligands. MnxE and MnxF do not oxidize Mn in the absence of MnxG and are the first accessory proteins to be required by an MCO. This may indicate that Cu and heme play roles in electron transfer and/or Cu trafficking.

  11. A Multicopper Oxidase Is Required for Copper Resistance in Mycobacterium tuberculosis

    PubMed Central

    Rowland, Jennifer L.


    Mycobacterium tuberculosis, the causative agent of tuberculosis, is one of the most important bacterial pathogens. Recent work has revealed that the natural bactericidal properties of copper are utilized by the host immune system to combat infections with bacteria, including M. tuberculosis. However, M. tuberculosis employs multiple mechanisms to reduce the internal copper amount by efflux and sequestration, which are required for virulence of M. tuberculosis. Here, we describe an alternative mechanism of copper resistance by M. tuberculosis. Deletion of the rv0846c gene increased the susceptibility of M. tuberculosis to copper at least 10-fold, establishing Rv0846c as a major component of copper resistance in M. tuberculosis. In vitro assays showed that Rv0846c oxidized organic substrates and Fe(II). Importantly, mutation of the predicted copper-coordinating cysteine 486 resulted in inactive Rv0846c protein which did not protect M. tuberculosis against copper stress. Hence, Rv0846c is a multicopper oxidase of M. tuberculosis and was renamed mycobacterial multicopper oxidase (MmcO). MmcO is membrane associated, probably by lipidation after export across the inner membrane by the twin-arginine translocation system. However, mutation of the lipidation site did not affect the oxidase activity or the copper protective function of MmcO. Our study revealed MmcO as an important copper resistance mechanism of M. tuberculosis, which possibly acts by oxidation of toxic Cu(I) in the periplasm. PMID:23772064

  12. A Multicopper Oxidase-Related Protein Is Essential for Insect Viability, Longevity and Ovary Development

    PubMed Central

    Peng, Zeyu; Green, Peter G.; Arakane, Yasuyuki; Kanost, Michael R.; Gorman, Maureen J.


    Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests. PMID:25330116

  13. CotA, a multicopper oxidase from Bacillus pumilus WH4, exhibits manganese-oxidase activity.


    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin


    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10(-6)±0.21 M·min(-1) and 0.32±0.02 s(-1), respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  14. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin


    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  15. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity.


    Peng, Zeyu; Dittmer, Neal T; Lang, Minglin; Brummett, Lisa M; Braun, Caroline L; Davis, Lawrence C; Kanost, Michael R; Gorman, Maureen J


    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surprising because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  16. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity

    PubMed Central

    Peng, Zeyu; Dittmer, Neal T.; Lang, Minglin; Brummett, Lisa M.; Braun, Caroline L.; Davis, Lawrence C.; Kanost, Michael R.; Gorman, Maureen J.


    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surpring because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  17. Multicopper Oxidase-3 Is a Laccase Associated with the Peritrophic Matrix of Anopheles gambiae

    PubMed Central

    Lang, Minglin; Kanost, Michael R.; Gorman, Maureen J.


    The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including polyphenols and phenylendiamines; ferroxidases, which oxidize ferrous iron; and several other oxidases with specific substrates such as ascorbate, bilirubin or copper. The genome of Anopheles gambiae, a species of mosquito, encodes five putative multicopper oxidases. Of these five, only AgMCO2 has known enzymatic and physiological functions: it is a highly conserved laccase that functions in cuticle pigmentation and tanning by oxidizing dopamine and dopamine derivatives. AgMCO3 is a mosquito-specific gene that is expressed predominantly in adult midguts and Malpighian tubules. To determine its enzymatic function, we purified recombinant AgMCO3 and analyzed its activity. AgMCO3 oxidized hydroquinone (a p-diphenol), the five o-diphenols tested, 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), and p-phenylenediamine, but not ferrous iron. The catalytic efficiencies of AgMCO3 were similar to those of cuticular laccases (MCO2 orthologs), except that AgMCO3 oxidized all of the phenolic substrates with similar efficiencies whereas the MCO2 isoforms were less efficient at oxidizing catechol or dopa. These results demonstrate that AgMCO3 can be classified as a laccase and suggest that AgMCO3 has a somewhat broader substrate specificity than MCO2 orthologs. In addition, we observed AgMCO3 immunoreactivity in the peritrophic matrix, which functions as a selective barrier between the blood meal and midgut epithelial cells, protecting the midgut from mechanical damage, pathogens, and toxic molecules. We propose that AgMCO3 may oxidize toxic molecules in the blood meal leading to detoxification or to cross-linking of the molecules to the peritrophic matrix, thus targeting them for excretion. PMID:22479493

  18. Direct Identification of a Bacterial Manganese(II) Oxidase, the Multicopper Oxidase MnxG, from Spores of Several Different Marine Bacillus Species▿ †

    PubMed Central

    Dick, Gregory J.; Torpey, Justin W.; Beveridge, Terry J.; Tebo, Bradley M.


    Microorganisms catalyze the formation of naturally occurring Mn oxides, but little is known about the biochemical mechanisms of this important biogeochemical process. We used tandem mass spectrometry to directly analyze the Mn(II)-oxidizing enzyme from marine Bacillus spores, identified as an Mn oxide band with an in-gel activity assay. Nine distinct peptides recovered from the Mn oxide band of two Bacillus species were unique to the multicopper oxidase MnxG, and one peptide was from the small hydrophobic protein MnxF. No other proteins were detected in the Mn oxide band, indicating that MnxG (or a MnxF/G complex) directly catalyzes biogenic Mn oxide formation. The Mn(II) oxidase was partially purified and found to be resistant to many proteases and active even at high concentrations of sodium dodecyl sulfate. Comparative analysis of the genes involved in Mn(II) oxidation from three diverse Bacillus species revealed a complement of conserved Cu-binding regions not present in well-characterized multicopper oxidases. Our results provide the first direct identification of a bacterial enzyme that catalyzes Mn(II) oxidation and suggest that MnxG catalyzes two sequential one-electron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV), a novel type of reaction for a multicopper oxidase. PMID:18165363

  19. Crystal Structure of a Two-domain Multicopper Oxidase: Implications for the Evolution of Multicooper Blue Proteins

    SciTech Connect

    Lawton, Thomas J.; Sayavedra-Soto, Luis A.; Arp, Daniel J.; Rosenzweig, Amy C.


    The two-domain multicopper oxidases are proposed to be key intermediates in the evolution of three-domain multicopper oxidases. A number of two-domain multicopper oxidases have been identified from genome sequences and are classified as type A, type B, or type C on the basis of the predicted location of the type 1 copper center. The crystal structure of blue copper oxidase, a type C two-domain multicopper oxidase from Nitrosomonas europaea, has been determined to 1.9 A resolution. Blue copper oxidase is a trimer, of which each subunit comprises two cupredoxin domains. Each subunit houses a type 1 copper site in domain 1 and a type 2/type 3 trinuclear copper cluster at the subunit-subunit interface. The coordination geometry at the trinuclear copper site is consistent with reduction of the copper ions. Although the overall architecture of blue copper oxidase is similar to nitrite reductases, detailed structural alignments show that the fold and domain orientation more closely resemble the three-domain multicopper oxidases. These observations have important implications for the evolution of nitrite reductases and multicopper oxidases.

  20. Ericoid mycorrhizal root fungi and their multicopper oxidases from a temperate forest shrub

    PubMed Central

    Wurzburger, Nina; Higgins, Brian P; Hendrick, Ronald L


    Ericoid mycorrhizal fungi (ERM) may specialize in capturing nutrients from their host's litter as a strategy for regulating nutrient cycles in terrestrial ecosystems. In spite of their potential significance, we know little about the structure of ERM fungal communities and the genetic basis of their saprotrophic traits (e.g., genes encoding extracellular enzymes). Rhododendron maximum is a model ERM understory shrub that influences the nutrient cycles of montane hardwood forests in the southern Appalachians (North Carolina, USA). We sampled ERM roots of R. maximum from organic and mineral soil horizons and identified root fungi by amplifying and sequencing internal transcribed spacer (ITS) ribosomal DNA (rDNA) collected from cultures and clones. We observed 71 fungal taxa on ERM roots, including known symbionts Rhizoscyphus ericae and Oidiodendron maius, putative symbionts from the Helotiales, Chaetothyriales, and Sebacinales, ectomycorrhizal symbionts, and saprotrophs. Supporting the idea that ERM fungi are adept saprotrophs, richness of root-fungi was greater in organic than in mineral soil horizons. To study the genetic diversity of oxidative enzymes that contribute to decomposition, we amplified and sequenced a portion of genes encoding multicopper oxidases (MCOs) from ERM ascomycetes. Most fungi possessed multiple copies of MCO sequences with strong similarities to known ferroxidases and laccases. Our findings indicate that R. maximum associates with a taxonomically and ecologically diverse fungal community. The study of MCO gene diversity and expression may be useful for understanding how ERM root fungi regulate the cycling of nutrients between the host plant and the soil environment. PMID:22408727

  1. Determining the Role of Multicopper Oxidases in Manganese(II) Oxidation by Marine Bacillus Spores

    NASA Astrophysics Data System (ADS)

    Dick, G. J.; Tebo, B. M.


    Bacteria play an important role in the environmental cycling of Mn by oxidizing soluble Mn(II) and forming insoluble Mn(III/IV) oxides. These biogenic Mn oxides are renowned for their strong sorptive and oxidative properties, which control the speciation and availability of many metals and organic compounds. A wide variety of bacteria are known to catalyze the oxidation of Mn(II); one of the most frequently isolated types are Bacillus species that oxidize Mn(II) only as metabolically dormant spores. We are using genetic and biochemical methods to study the molecular mechanisms of this process in these organisms. mnxG, a gene related to the multicopper oxidase (MCO) family of enzymes, is required for Mn(II) oxidation in the model organism, Bacillus sp. strain SG-1. Mn(II)-oxidizing activity can be detected in crude protein extracts of the exosporium and as a discrete band in SDS-PAGE gels, however previous attempts to purify or identify this Mn(II)-oxidizing enzyme have failed. A direct link between the Mn(II)-oxidizing enzyme and the MCO gene suspected to encode it has never been made. We used genetic and biochemical methods to investigate the role of the MCO in the mechanism of Mn(II) oxidation. Comparative analysis of the mnx operon from several diverse Mn(II)-oxidizing Bacillus spores revealed that mnxG is the most highly conserved gene in the operon, and that copper binding sites are highly conserved. As with Mn(II) oxidases from other organisms, heterologous expression of the Bacillus mnxG in E. coli did not yield an active Mn(II) oxidase. Purifying sufficient quantities of the native Mn(II) oxidase from Bacillus species for biochemical characterization has proven difficult because the enzyme does not appear to be abundant, and it is highly insoluble. We were able to partially purify the Mn(II) oxidase, and to analyze the active band by in-gel trypsin digestion followed by tandem mass spectrometry (MS/MS). MS/MS spectra provided a conclusive match to mnx

  2. Iodide Oxidation by a Novel Multicopper Oxidase from the Alphaproteobacterium Strain Q-1

    PubMed Central

    Suzuki, Mio; Eda, Yoshifumi; Ohsawa, Shiaki; Kanesaki, Yu; Yoshikawa, Hirofumi; Tanaka, Kan; Muramatsu, Yasuyuki; Yoshikawa, Jun; Sato, Ikuo; Fujii, Takaaki


    Alphaproteobacterium strain Q-1 is able to oxidize iodide (I−) to molecular iodine (I2) by an oxidase-like enzyme. One of the two isoforms of the iodide-oxidizing enzyme (IOE-II) produced by this strain was excised from a native polyacrylamide gel, eluted, and purified. IOE-II appeared as a single band (51 kDa) and showed significant in-gel iodide-oxidizing activity in sodium dodecyl sulfate-polyacrylamide gel electrophoresis without heat treatment. However, at least two bands with much higher molecular masses (150 and 230 kDa) were observed with heat treatment (95°C, 3 min). IOE-II was inhibited by NaN3, KCN, EDTA, and a copper chelator, o-phenanthroline. In addition to iodide, IOE-II showed significant activities toward phenolic compounds such as syringaldazine, 2,6-dimethoxy phenol, and p-phenylenediamine. IOE-II contained copper atoms as prosthetic groups and had UV/VIS absorption peaks at 320 and 590 nm. Comparison of several internal amino acid sequences obtained from trypsin-digested IOE-II with a draft genome sequence of strain Q-1 revealed that the products of two open reading frames (IoxA and IoxC), with predicted molecular masses of 62 and 71 kDa, are involved in iodide oxidation. Furthermore, subsequent tandem mass spectrometric analysis repeatedly detected peptides from IoxA and IoxC with high sequence coverage (32 to 40%). IoxA showed homology with the family of multicopper oxidases and included four copper-binding regions that are highly conserved among various multicopper oxidases. These results suggest that IOE-II is a multicopper oxidase and that it may occur as a multimeric complex in which at least two proteins (IoxA and IoxC) are associated. PMID:22447601

  3. Catalytic Cycle of Multicopper Oxidases Studied by Combined Quantum- and Molecular-Mechanical Free-Energy Perturbation Methods.


    Li, Jilai; Farrokhnia, Maryam; Rulíšek, Lubomír; Ryde, Ulf


    We have used combined quantum mechanical and molecular mechanical free-energy perturbation methods in combination with explicit solvent simulations to study the reaction mechanism of the multicopper oxidases, in particular, the regeneration of the reduced state from the native intermediate. For 52 putative states of the trinuclear copper cluster, differing in the oxidation states of the copper ions and the protonation states of water- and O2-derived ligands, we have studied redox potentials, acidity constants, isomerization reactions, as well as water- and O2 binding reactions. Thereby, we can propose a full reaction mechanism of the multicopper oxidases with atomic detail. We also show that the two copper sites in the protein communicate so that redox potentials and acidity constants of one site are affected by up to 0.2 V or 3 pKa units by a change in the oxidation state of the other site. PMID:26039490

  4. Catalytic Cycle of Multicopper Oxidases Studied by Combined Quantum- and Molecular-Mechanical Free-Energy Perturbation Methods.


    Li, Jilai; Farrokhnia, Maryam; Rulíšek, Lubomír; Ryde, Ulf


    We have used combined quantum mechanical and molecular mechanical free-energy perturbation methods in combination with explicit solvent simulations to study the reaction mechanism of the multicopper oxidases, in particular, the regeneration of the reduced state from the native intermediate. For 52 putative states of the trinuclear copper cluster, differing in the oxidation states of the copper ions and the protonation states of water- and O2-derived ligands, we have studied redox potentials, acidity constants, isomerization reactions, as well as water- and O2 binding reactions. Thereby, we can propose a full reaction mechanism of the multicopper oxidases with atomic detail. We also show that the two copper sites in the protein communicate so that redox potentials and acidity constants of one site are affected by up to 0.2 V or 3 pKa units by a change in the oxidation state of the other site.

  5. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli

    PubMed Central

    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael


    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  6. Multicopper oxidases: a workshop on copper coordination chemistry, electron transfer, and metallophysiology.


    Kosman, Daniel J


    Multicopper oxidases (MCOs) are unique among copper proteins in that they contain at least one each of the three types of biologic copper sites, type 1, type 2, and the binuclear type 3. MCOs are descended from the family of small blue copper proteins (cupredoxins) that likely arose as a complement to the heme-iron-based cytochromes involved in electron transport; this event corresponded to the aerobiosis of the biosphere that resulted in the conversion of Fe(II) to Fe(III) as the predominant redox state of this essential metal and the solubilization of copper from Cu(2)S to Cu(H(2)O)( n ) (2+). MCOs are encoded in genomes in all three kingdoms and play essential roles in the physiology of essentially all aerobes. With four redox-active copper centers, MCOs share with terminal copper-heme oxidases the ability to catalyze the four-electron reduction of O(2) to two molecules of water. The electron transfers associated with this reaction are both outer and inner sphere in nature and their mechanisms have been fairly well established. A subset of MCO proteins exhibit specificity for Fe(2+), Cu(+), and/or Mn(2+) as reducing substrates and have been designated as metallooxidases. These enzymes, in particular the ferroxidases found in all fungi and metazoans, play critical roles in the metal metabolism of the expressing organism.

  7. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli.


    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael


    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  8. Multicopper oxidase-1 is required for iron homeostasis in Malpighian tubules of Helicoverpa armigera

    PubMed Central

    Liu, Xiaoming; Sun, Chengxian; Liu, Xiaoguang; Yin, Xinming; Wang, Baohai; Du, Mengfang; An, Shiheng


    Multicopper oxidases (MCOs) are enzymes that contain 10 conserved histidine residues and 1 cysteine residue. MCO1 has been extensively investigated in the midgut because this MCO is implicated in ascorbate oxidation, iron homeostasis and immune responses. However, information regarding the action of MCO1 in Malpighian tubules is limited. In this study, Helicoverpa armigera was used as a model to investigate the function of MCO1 in Malpighian tubules. Sequence analysis results revealed that HaMCO1 exhibits typical MCO characteristics, with 10 histidine and 1 cysteine residues for copper ion binding. HaMCO1 was also found to be highly abundant in Malpighian tubules. Temporal expression patterns indicated that HaMCO1 is mainly expressed during larval molting stages. Hormone treatments [the molting hormone 20-hydroxyecdysone (20E) and juvenile hormone (JH)] revealed that 20E inhibits HaMCO1 transcript expression via its heterodimer receptor, which consists of ecdysone receptor (EcR) and ultraspiracle (USP), and that JH counteracts the action of 20E to activate HaMCO1 transcript expression via its intracellular receptor methoprene-tolerant (Met). HaMCO1 knockdown caused a significant decrease in iron accumulation and also significantly reduced transferrin and ferritin transcript expression. Therefore, HaMCO1 is coordinately regulated by 20E and JH and is required for iron homeostasis in Malpighian tubules. PMID:26437857

  9. Linkage between Catecholate Siderophores and the Multicopper Oxidase CueO in Escherichia coli

    PubMed Central

    Grass, Gregor; Thakali, Keshari; Klebba, Phillip E.; Thieme, Daniel; Müller, Axel; Wildner, Günter F.; Rensing, Christopher


    The multicopper oxidase CueO had previously been demonstrated to exhibit phenoloxidase activity and was implicated in intrinsic copper resistance in Escherichia coli. Catecholates can potentially reduce Cu(II) to the prooxidant Cu(I). In this report we provide evidence that CueO protects E. coli cells by oxidizing enterobactin, the catechol iron siderophore of E. coli, in the presence of copper. In vitro, a mixture of enterobactin and copper was toxic for E. coli cells, but the addition of purified CueO led to their survival. Deletion of fur resulted in copper hypersensitivity that was alleviated by additional deletion of entC, preventing synthesis of enterobactin. In addition, copper added together with 2,3-dihydroxybenzoic acid or enterobactin was able to induce a Φ(cueO-lacZ) operon fusion more efficiently than copper alone. The reaction product of the 2,3-dihydroxybenzoic acid oxidation by CueO that can complex Cu(II) ions was determined by gas chromatography-mass spectroscopy and identified as 2-carboxymuconate. PMID:15317788

  10. Multireference Ab Initio Calculations of g tensors for Trinuclear Copper Clusters in Multicopper Oxidases

    PubMed Central

    Vancoillie, Steven; Chalupský, Jakub; Ryde, Ulf; Solomon, Edward I.; Pierloot, Kristine; Neese, Frank; Rulíšek, Lubomír


    EPR spectroscopy has proven to be an indispensable tool in elucidating the structure of metal sites in proteins. In recent years, experimental EPR data have been complemented by theoretical calculations, which have become a standard tool of many quantum chemical packages. However, there have only been a few attempts to calculate EPR g tensors for exchange-coupled systems with more than two spins. In this work, we present a quantum chemical study of structural, electronic, and magnetic properties of intermediates in the reaction cycle of multicopper oxidases and of their inorganic models. All these systems contain three copper(II) ions bridged by hydroxide or O2− anions and their ground states are antiferromagnetically coupled doublets. We demonstrate that only multireference methods, such as CASSCF/CASPT2 or MRCI can yield qualitatively correct results (compared to the experimental values) and consider the accuracy of the calculated EPR g tensors as the current benchmark of quantum chemical methods. By decomposing the calculated g tensors into terms arising from interactions of the ground state with the various excited states, the origin of the zero-field splitting is explained. The results of the study demonstrate that a truly quantitative prediction of the g tensors of exchange-coupled systems is a great challenge to contemporary theory. The predictions strongly depend on small energy differences that are difficult to predict with sufficient accuracy by any quantum chemical method that is applicable to systems of the size of our target systems. PMID:20469875

  11. A putative multicopper oxidase, IoxA, is involved in iodide oxidation by Roseovarius sp. strain A-2.


    Shiroyama, Kanna; Kawasaki, Yasutaka; Unno, Yusuke; Amachi, Seigo


    Roseovarius sp. strain A-2 is an aerobic heterotrophic bacterium with a capacity for oxidizing iodide ion (I(-)) to form molecular iodine (I2). In this study, iodide-oxidizing enzyme of strain A-2 was characterized. The enzyme was an extracellular protein, and Cu(2+) ion significantly enhanced the enzyme activity in the culture supernatant. When iodide was used as the substrate, the crude enzyme showed Km and Vmax values of 4.78 mM and 25.1 U mg(-1), respectively. The enzyme was inhibited by NaN3, EDTA, KCN, and o-phenanthroline, and also had significant activities toward p-phenylenediamine and hydroquinone. Tandem mass spectrometric analysis of an active band excised from SDS-PAGE gel revealed that at least two proteins are involved in the enzyme. One of these proteins was closely related with IoxA, a multicopper oxidase previously found as a component of iodide-oxidizing enzyme of Alphaproteobacterium strain Q-1. Furthermore, a terrestrial bacterium Rhodanobacter denitrificans 116-2, which possesses an ioxA-like gene in its genome, was found to oxidize iodide. These results suggest that IoxA catalyzes the oxidation of iodide in phylogenetically distinct bacteria.

  12. Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase.


    Butterfield, Cristina N; Soldatova, Alexandra V; Lee, Sung-Woo; Spiro, Thomas G; Tebo, Bradley M


    Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of the enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. With the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs. PMID:23818588

  13. Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase

    PubMed Central

    Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung-Woo; Spiro, Thomas G.; Tebo, Bradley M.


    Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of the enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. With the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs. PMID:23818588

  14. Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase


    Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung -Woo; Spiro, Thomas G.; Tebo, Bradley M.


    Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of themore » enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. Lastly, with the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs.« less

  15. Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase

    SciTech Connect

    Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung -Woo; Spiro, Thomas G.; Tebo, Bradley M.


    Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of the enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. Lastly, with the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs.

  16. Multicopper Oxidase Involvement in Both Mn(II) and Mn(III) Oxidation during Bacterial Formation of MnO2

    PubMed Central

    Soldatova, Alexandra V.; Butterfield, Cristina; Oyerinde, Oyeyemi F.; Tebo, Bradley M.; Spiro, Thomas G.


    Global cycling of environmental manganese requires catalysis by bacteria and fungi for MnO2 formation, since abiotic Mn(II) oxidation is slow under ambient conditions. Genetic evidence from several bacteria implicates multicopper oxidases (MCOs) as being required for MnO2 formation. However, MCOs catalyze one-electron oxidations, whereas conversion of Mn(II) to MnO2 is a two-electron process. Trapping experiments with pyrophosphate (PP), a Mn(III) chelator, have demonstrated that Mn(III) is an intermediate in Mn(II) oxidation when mediated by exosporium from the Mn-oxidizing bacterium Bacillus SG-1. The reaction of Mn(II) depends on O2 and is inhibited by azide, consistent with MCO catalysis. We show that the subsequent conversion of Mn(III) to MnO2 also depends on O2 and is inhibited by azide. Thus, both oxidation steps appear to be MCO-mediated, likely by the same enzyme, indicated by genetic evidence to be the MnxG gene product. We propose a model of how the manganese oxidase active site may be organized to couple successive electron transfers to the formation of polynuclear Mn(IV) complexes as precursors to MnO2 formation. PMID:22892957

  17. Multicopper oxidase involvement in both Mn(II) and Mn(III) oxidation during bacterial formation of MnO(2).


    Soldatova, Alexandra V; Butterfield, Cristina; Oyerinde, Oyeyemi F; Tebo, Bradley M; Spiro, Thomas G


    Global cycling of environmental manganese requires catalysis by bacteria and fungi for MnO(2) formation, since abiotic Mn(II) oxidation is slow under ambient conditions. Genetic evidence from several bacteria indicates that multicopper oxidases (MCOs) are required for MnO(2) formation. However, MCOs catalyze one-electron oxidations, whereas the conversion of Mn(II) to MnO(2) is a two-electron process. Trapping experiments with pyrophosphate (PP), a Mn(III) chelator, have demonstrated that Mn(III) is an intermediate in Mn(II) oxidation when mediated by exosporium from the Mn-oxidizing bacterium Bacillus SG-1. The reaction of Mn(II) depends on O(2) and is inhibited by azide, consistent with MCO catalysis. We show that the subsequent conversion of Mn(III) to MnO(2) also depends on O(2) and is inhibited by azide. Thus, both oxidation steps appear to be MCO-mediated, likely by the same enzyme, which is indicated by genetic evidence to be the MnxG gene product. We propose a model of how the manganese oxidase active site may be organized to couple successive electron transfers to the formation of polynuclear Mn(IV) complexes as precursors to MnO(2) formation. PMID:22892957

  18. Biochemical studies of the multicopper oxidase (small laccase) from Streptomyces coelicolor using bioactive phytochemicals and site-directed mutagenesis

    PubMed Central

    Sherif, Mohammed; Waung, Debbie; Korbeci, Bihter; Mavisakalyan, Valentina; Flick, Robert; Brown, Greg; Abou-Zaid, Mamdouh; Yakunin, Alexander F; Master, Emma R


    Summary Multicopper oxidases can act on a broad spectrum of phenolic and non-phenolic compounds. These enzymes include laccases, which are widely distributed in plants and fungi, and were more recently identified in bacteria. Here, we present the results of biochemical and mutational studies of small laccase (SLAC), a multicopper oxidase from Streptomyces coelicolor (SCO6712). In addition to typical laccase substrates, SLAC was tested using phenolic compounds that exhibit antioxidant activity. SLAC showed oxidase activity against 12 of 23 substrates tested, including caffeic acid, ferulic acid, resveratrol, quercetin, morin, kaempferol and myricetin. The kinetic parameters of SLAC were determined for 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid), 2,6-dimethoxyphenol, quercetin, morin and myricetin, and maximum reaction rates were observed with myricetin, where kcat and Km values at 60°C were 8.1 (± 0.8) s−1 and 0.9 (± 0.3) mM respectively. SLAC had a broad pH optimum for activity (between pH 4 and 8) and temperature optimum at 60–70°C. It demonstrated remarkable thermostability with a half-life of over 10 h at 80°C and over 7 h at 90°C. Site-directed mutagenesis revealed 17 amino acid residues important for SLAC activity including the 10 His residues involved in copper coordination. Most notably, the Y229A and Y230A mutant proteins showed over 10-fold increase in activity compared with the wild-type SLAC, which was correlated to higher copper incorporation, while kinetic analyses with S929A predicts localization of this residue near the meta-position of aromatic substrates. Funding Information Funding for this research was provided by the Government of Ontario for the project ‘FFABnet: Functionalized Fibre and Biochemicals’ (ORF-RE-05-005), and the Natural Sciences and Engineering Research Council of Canada. PMID:23815400

  19. Agaricus bisporus and related Agaricus species on lignocellulose: production of manganese peroxidase and multicopper oxidases.


    Hildén, Kristiina; Mäkelä, Miia R; Lankinen, Pauliina; Lundell, Taina


    Biotechnological, microbiological, and genetic studies of Agaricus species other than A. bisporus, the white button mushroom, have been limited so far. To expand the knowledge in the genus Agaricus, six novel wild-type isolates of Agaricus spp. were studied on their nutritional demands for enzyme production and mycelial growth. All the selected Agaricus species produced extracellular manganese peroxidase (MnP) and laccase activities in semi-solid rye bran cultures. Moderate MnP activities were measured for A. bisporus, A. bernardii and A. campestris. The highest laccase activities were obtained for A. bisporus and A. campestris. On soy medium, the highest mycelial tyrosinase activity was determined for A. bernardii. For A. bisporus, addition of copper caused no increase in laccase or tyrosinase activities on soy or malt extract media. Hyphal growth rate of the isolates was studied on lignocellulose amended agar plates. Fastest growth was obtained for A. bisporus on wheat bran and birch leaf litter agar. Except for A. bernardii, hyphal growth rates correlated well with MnP and laccase production levels between Agaricus species. Molecular taxonomy of the novel Agaricus spp. positioned them to distinct phylogenetic clusters with species-level identity. In conclusion, our data point to the importance of both MnP and multicopper enzymes in Agaricus spp. while growing on lignocelluloses.

  20. Magnetic Ganoderma lucidum spore microspheres: A novel material to immobilize CotA multicopper oxidase for dye decolorization.


    Fan, Lili; Wang, Yan; Zhao, Min; Song, Jinzhu; Wang, Jueyu; Jin, Zijing


    In this study, hollow microspheres were obtained from Ganoderma lucidum spores. Then the hollow microspheres were loaded with Fe3O4 nanoparticles to prepare novel magnetic spore microspheres. TEM images and X-ray diffractometry demonstrated that the Fe3O4 nanoparticles were incorporated throughout the spore microsphere. CotA multicopper oxidase was chosen as biomacromolecule to study the loading ability of the magnetic spore microspheres. The combination of the CotA enzyme with the microsphere was observed by laser scanning confocal microscope. The loaded amount of CotA on the microspheres was 75mg/g when the CotA concentration was 1.2mg/mL and the activity recovery of the immobilized CotA was 81%. The magnetic microspheres loaded with CotA, which can be easily and quickly recovered by an external magnetic field, were used for dye decolorization. After 1h decolorization, 99% of the indigo carmine has been removed by 10mg microspheres. In addition, the immobilized CotA retained 75% of activity after 10 consecutive cycles, which indicated that the magnetic spore microspheres are good support material for immobilization of the enzyme.

  1. Magnetic Ganoderma lucidum spore microspheres: A novel material to immobilize CotA multicopper oxidase for dye decolorization.


    Fan, Lili; Wang, Yan; Zhao, Min; Song, Jinzhu; Wang, Jueyu; Jin, Zijing


    In this study, hollow microspheres were obtained from Ganoderma lucidum spores. Then the hollow microspheres were loaded with Fe3O4 nanoparticles to prepare novel magnetic spore microspheres. TEM images and X-ray diffractometry demonstrated that the Fe3O4 nanoparticles were incorporated throughout the spore microsphere. CotA multicopper oxidase was chosen as biomacromolecule to study the loading ability of the magnetic spore microspheres. The combination of the CotA enzyme with the microsphere was observed by laser scanning confocal microscope. The loaded amount of CotA on the microspheres was 75mg/g when the CotA concentration was 1.2mg/mL and the activity recovery of the immobilized CotA was 81%. The magnetic microspheres loaded with CotA, which can be easily and quickly recovered by an external magnetic field, were used for dye decolorization. After 1h decolorization, 99% of the indigo carmine has been removed by 10mg microspheres. In addition, the immobilized CotA retained 75% of activity after 10 consecutive cycles, which indicated that the magnetic spore microspheres are good support material for immobilization of the enzyme. PMID:27058768

  2. Using planktonic microorganisms to supply the unpurified multi-copper oxidases laccase and copper efflux oxidases at a biofuel cell cathode.


    Sané, Sabine; Richter, Katrin; Rubenwolf, Stefanie; Matschke, Nina Joan; Jolivalt, Claude; Madzak, Catherine; Zengerle, Roland; Gescher, Johannes; Kerzenmacher, Sven


    The feasibility to apply crude culture supernatants that contain the multicopper oxidases laccase or copper efflux oxidase (CueO) as oxygen reducing catalysts in a biofuel cell cathode is shown. As enzyme-secreting recombinant planktonic microorganisms, the yeast Yarrowia lipolytica and the bacterium Escherichia coli were investigated. The cultivation and operation conditions (choice of medium, pH) had distinct effects on the electro-catalytic performance. The highest current density of 119 ± 23 μA cm(-2) at 0.400 V vs. NHE was obtained with the crude culture supernatant of E. coli cells overexpressing CueO and tested at pH 5.0. In comparison, at pH 7.4 the electrode potential at 100 μA cm(-2) is 0.25 V lower. Laccase-containing supernatants of Y. lipolytica yielded a maximum current density of 6.7 ± 0.4 μAcm(-2) at 0.644 V vs. NHE. These results open future possibilities to circumvent elaborate enzyme purification procedures and realize cost effective and easy-to-operate enzymatic biofuel cells.

  3. Geometric and electronic structure differences between the type 3 copper sites of the multicopper oxidases and hemocyanin/tyrosinase

    PubMed Central

    Yoon, Jungjoo; Fujii, Satoshi; Solomon, Edward I.


    The coupled binuclear “type 3” Cu sites are found in hemocyanin (Hc), tyrosinase (Tyr), and the multicopper oxidases (MCOs), such as laccase (Lc), and play vital roles in O2 respiration. Although all type 3 Cu sites share the same ground state features, those of Hc/Tyr have very different ligand-binding properties relative to those of the MCOs. In particular, the type 3 Cu site in the MCOs (LcT3) is a part of the trinuclear Cu cluster, and if the third (i.e., type 2) Cu is removed, the LcT3 site does not react with O2. Density functional theory calculations indicate that O2 binding in Hc is ≈9 kcal mol−1 more favorable than for LcT3. The difference is mostly found in the total energy difference of the deoxy states (≈7 kcal mol−1), where the stabilization of deoxy LcT3 derives from its long equilibrium Cu–Cu distance of ≈5.5–6.5 Å, relative to ≈4.2 Å in deoxy Hc/Tyr. The O2 binding in Hc is driven by the electrostatic destabilization of the deoxy Hc site, in which the two Cu(I) centers are kept close together by the protein for facile 2-electron reduction of O2. Alternatively, the lack of O2 reactivity in LcT3 reflects the flexibility of the active site, capable of minimizing the electrostatic repulsion of the 2 Cu(I)s. Thus, the O2 reactivity of the MCOs is intrinsic to the trinuclear Cu cluster, leading to different O2 intermediates as required by its function of irreversible reduction of O2 to H2O. PMID:19346471

  4. Catalytic oxidation of manganese(II) by multicopper oxidase CueO and characterization of the biogenic Mn oxide.


    Su, Jianmei; Deng, Lin; Huang, Liangbo; Guo, Shujin; Liu, Fan; He, Jin


    Manganese(II) contamination is naturally occurring in many groundwater and surface water sources. Moreover, industrial wastewater is also responsible for much of the Mn(II) contamination. Nowadays, Mn(II) contamination has become a serious environmental problem in some regions of the world. To explore a biological approach for removing excessive amounts of aqueous Mn(II) from water, we found a new biocatalyst multicopper oxidase CueO, which was firstly proved to catalyze the oxidation of Mn(II) both in vitro and in vivo. Subsequently, we established a CueO-mediated catalysis system to prepare biogenic Mn oxide (BioMnOx), which was confirmed to be γ-Mn3O4 by X-ray diffraction. This newly prepared BioMnOx consisted of 53.6% Mn(II), 18.4% Mn(III) and 28.0% Mn(IV) characterized by X-ray photoelectron spectroscopy. It exhibited distinct polyhedral structure with nanoparticles of 150-350 nm diameters observed by transmission electron microscopy. Importantly, CueO could remove 35.7% of Mn(II) after a seven-day reaction, and on the other hand, the cueO-overexpressing Escherichia coli strain (ECueO) could also oxidize 58.1% dissolved Mn(II), and simultaneously remove 97.7% Mn(II). Based on these results, we suggest that ECueO strain and CueO enzyme have potential applications on Mn(II) decontamination in water treatment.

  5. A novel enzyme-based antimicrobial system comprising iodide and a multicopper oxidase isolated from Alphaproteobacterium strain Q-1.


    Yuliana, Tri; Ebihara, Kyota; Suzuki, Mio; Shimonaka, Chie; Amachi, Seigo


    Alphaproteobacterium strain Q-1 produces an extracellular multicopper oxidase (IOX), which catalyzes iodide (I-) oxidation to form molecular iodine (I2). In this study, the antimicrobial activity of the IOX/iodide system was determined. Both Gram-positive and Gram-negative bacteria tested were killed completely within 5 min by 50 mU mL(-1) of IOX and 10 mM iodide. The sporicidal activity of the system was also tested and compared with a common iodophor, povidone-iodine (PVP-I). IOX (300 mU mL(-1)) killed Bacillus cereus, B. subtilis, and Geobacillus stearothermophilus spores with decimal reduction times of 2.58, 7.62, and 40.9 min, respectively. However, 0.1% PVP-I killed these spores with much longer decimal reduction times of 5.46, 38.0, and 260 min, respectively. To evaluate the more superior sporicidal activity of the IOX system over PVP-I, the amount of free iodine (non-complexed I2) was determined by an equilibrium dialysis technique. The IOX system included more than 40 mg L(-1) of free iodine, while PVP-I included at most 25 mg L(-1) free iodine. Our results suggest that the new enzyme-based antimicrobial system is effective against a wide variety of microorganisms and bacterial spores, and that its strong biocidal activity is due to its high free iodine content, which is probably maintained by re-oxidation of iodide released after oxidation of cell components by I2. PMID:26254787

  6. Molecular Dynamics of a Thermostable Multicopper Oxidase from Thermus thermophilus HB27: Structural Differences between the Apo and Holo Forms

    PubMed Central

    Bello, Martiniano; Valderrama, Brenda; Serrano-Posada, Hugo; Rudiño-Piñera, Enrique


    Molecular dynamic (MD) simulations have been performed on Tth-MCO, a hyperthermophilic multicopper oxidase from thermus thermophilus HB27, in the apo as well as the holo form, with the aim of exploring the structural dynamic properties common to the two conformational states. According to structural comparison between this enzyme and other MCOs, the substrate in process to electron transfer in an outer-sphere event seems to transiently occupy a shallow and overall hydrophobic cavity near the Cu type 1 (T1Cu). The linker connecting the β-strands 21 and 24 of the second domain (loop (β21–β24)D2) has the same conformation in both states, forming a flexible lid at the entrance of the electron-transfer cavity. Loop (β21–β24)D2 has been tentatively assigned a role occluding the access to the electron-transfer site. The dynamic of the loop (β21–β24)D2 has been investigated by MD simulation, and results show that the structures of both species have the same secondary and tertiary structure during almost all the MD simulations. In the simulation, loop (β21–β24)D2 of the holo form undergoes a higher mobility than in the apo form. In fact, loop (β21–β24)D2 of the holo form experiences a conformational change which enables exposure to the electron-transfer site (open conformation), while in the apo form the opposite effect takes place (closed conformation). To confirm the hypothesis that the open conformation might facilitate the transient electron-donor molecule occupation of the site, the simulation was extended another 40 ns with the electron-donor molecule docked into the protein cavity. Upon electron-donor molecule stabilization, loops near the cavity reduce their mobility. These findings show that coordination between the copper and the protein might play an important role in the general mobility of the enzyme, and that the open conformation seems to be required for the electron transfer process to T1Cu. PMID:22808237

  7. Crystal structure of a blue laccase from Lentinus tigrinus: evidences for intermediates in the molecular oxygen reductive splitting by multicopper oxidases

    PubMed Central

    Ferraroni, Marta; Myasoedova, Nina M; Schmatchenko, Vadim; Leontievsky, Alexey A; Golovleva, Ludmila A; Scozzafava, Andrea; Briganti, Fabrizio


    Background Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in pathogenesis, immunogenesis and morphogenesis of organisms and in the metabolic turnover of complex organic substances. They catalyze the coupling between the four one-electron oxidations of a broad range of substrates with the four-electron reduction of dioxygen to water. These catalytic processes are made possible by the contemporaneous presence of at least four copper ion sites, classified according to their spectroscopic properties: one type 1 (T1) site where the electrons from the reducing substrates are accepted, one type 2 (T2), and a coupled binuclear type 3 pair (T3) which are assembled in a T2/T3 trinuclear cluster where the electrons are transferred to perform the O2 reduction to H2O. Results The structure of a laccase from the white-rot fungus Lentinus (Panus) tigrinus, a glycoenzyme involved in lignin biodegradation, was solved at 1.5 Å. It reveals a asymmetric unit containing two laccase molecules (A and B). The progressive reduction of the copper ions centers obtained by the long-term exposure of the crystals to the high-intensity X-ray synchrotron beam radiation under aerobic conditions and high pH allowed us to detect two sequential intermediates in the molecular oxygen reduction pathway: the "peroxide" and the "native" intermediates, previously hypothesized through spectroscopic, kinetic and molecular mechanics studies. Specifically the electron-density maps revealed the presence of an end-on bridging, μ-η1:η1 peroxide ion between the two T3 coppers in molecule B, result of a two-electrons reduction, whereas in molecule A an oxo ion bridging the three coppers of the T2/T3 cluster (μ3-oxo bridge) together with an hydroxide ion externally bridging the two T3 copper ions, products of the four-electrons reduction of molecular oxygen, were best modelled. Conclusion This is the first structure of a multicopper oxidase which

  8. X-ray-induced catalytic active-site reduction of a multicopper oxidase: structural insights into the proton-relay mechanism and O2-reduction states.


    Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia Patricia; Rodríguez-Almazán, Claudia; Stojanoff, Vivian; Rudiño-Piñera, Enrique


    During X-ray data collection from a multicopper oxidase (MCO) crystal, electrons and protons are mainly released into the system by the radiolysis of water molecules, leading to the X-ray-induced reduction of O2 to 2H2O at the trinuclear copper cluster (TNC) of the enzyme. In this work, 12 crystallographic structures of Thermus thermophilus HB27 multicopper oxidase (Tth-MCO) in holo, apo and Hg-bound forms and with different X-ray absorbed doses have been determined. In holo Tth-MCO structures with four Cu atoms, the proton-donor residue Glu451 involved in O2 reduction was found in a double conformation: Glu451a (∼7 Å from the TNC) and Glu451b (∼4.5 Å from the TNC). A positive peak of electron density above 3.5σ in an Fo - Fc map for Glu451a O(ℇ2) indicates the presence of a carboxyl functional group at the side chain, while its significant absence in Glu451b strongly suggests a carboxylate functional group. In contrast, for apo Tth-MCO and in Hg-bound structures neither the positive peak nor double conformations were observed. Together, these observations provide the first structural evidence for a proton-relay mechanism in the MCO family and also support previous studies indicating that Asp106 does not provide protons for this mechanism. In addition, eight composite structures (Tth-MCO-C1-8) with different X-ray-absorbed doses allowed the observation of different O2-reduction states, and a total depletion of T2Cu at doses higher than 0.2 MGy showed the high susceptibility of this Cu atom to radiation damage, highlighting the importance of taking radiation effects into account in biochemical interpretations of an MCO structure.

  9. Simulation of the cavity-binding site of three bacterial multicopper oxidases upon complex stabilization: interactional profile and electron transference pathways.


    Bello, Martiniano; Correa-Basurto, Jose; Rudiño-Piñera, Enrique


    Previous studies have shown that multicopper oxidases (MCOs) oxidize organic and inorganic compounds through oxidation-reduction reactions in which three structurally and functionally arranged copper centers coordinate the uptake of an electron from a reduced substrate. Structural comparisons among three bacterial MCOs, with high structural homology and available three-dimensional information, reveal that the primary structural differences between these MCOs are located near the mononuclear copper center (T1Cu), where substrate oxidation occurs, as opposed to where the reduction of oxygen to water occurs at the trinuclear center. Nevertheless, this substrate oxidation is achieved through an outer-sphere electron transfer mechanism that does not generate a stable substrate-enzyme complex. In this study, MCOs from Thermus thermophilus (Tth-MCO), Bacillus subtilis (CotA), and Escherichia coli (CueO), which have been previously determined through X-ray crystallography, were used as models to analyze the binding modes of these MCOs to three organic molecules, with specific interest in the substrate-binding site. The binding mode of the electron-donor molecule to the electron transfer binding site was primarily attributed to hydrophobic contacts, which likely play an important role in the determination of substrate specificity. Some complexes generated in this study showed an electron donor molecule conformation in which an electron could be directly transferred to the histidines coordinating T1Cu, while for others additional electron transference pathways were also possible through the participation of charged residues during electron transfer.

  10. Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase

    PubMed Central

    De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique


    X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O2. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UV–Vis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-­ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations of the metal centres, were observed at both acidic pH and high absorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O2 reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account. PMID:22525754

  11. Thermostable multicopper oxidase from Thermus thermophilus HB27: crystallization and preliminary X-ray diffraction analysis of apo and holo forms

    PubMed Central

    Serrano-Posada, Hugo; Valderrama, Brenda; Stojanoff, Vivian; Rudiño-Piñera, Enrique


    A thermostable multicopper oxidase from Thermus thermophilus HB27 (Tth-MCO) was successfully crystallized using the sitting-drop and hanging-drop vapour-diffusion methods. Crystallization conditions and preliminary X-ray diffraction data to 1.5 Å resolution obtained using synchrotron radiation at 100 K are reported. The crystals belonged to space group C2221, with unit-cell parameters a = 93.6, b = 110.3, c = 96.3 Å. A monomer in the asymmetric unit yielded a Matthews coefficient (V M) of 2.60 Å3 Da−1 and a solvent content of 53%. An inactive enzyme form, apo-Tth-MCO, was also crystallized and diffraction data were collected to 1.7 Å resolution. In addition, a second inactive form of the enzyme, Hg-Tth-MCO, was obtained by soaking apo-Tth-MCO crystals with mercury(II) chloride and data were collected to a resolution of 1.7 Å. PMID:22139175

  12. Surface Mn(II) oxidation actuated by a multicopper oxidase in a soil bacterium leads to the formation of manganese oxide minerals

    PubMed Central

    Zhang, Zhen; Zhang, Zhongming; Chen, Hong; Liu, Jin; Liu, Chang; Ni, Hong; Zhao, Changsong; Ali, Muhammad; Liu, Fan; Li, Lin


    In this manuscript, we report that a bacterial multicopper oxidase (MCO266) catalyzes Mn(II) oxidation on the cell surface, resulting in the surface deposition of Mn(III) and Mn(IV) oxides and the gradual formation of bulky oxide aggregates. These aggregates serve as nucleation centers for the formation of Mn oxide micronodules and Mn-rich sediments. A soil-borne Escherichia coli with high Mn(II)-oxidizing activity formed Mn(III)/Mn(IV) oxide deposit layers and aggregates under laboratory culture conditions. We engineered MCO266 onto the cell surfaces of both an activity-negative recipient and wild-type strains. The results confirmed that MCO266 governs Mn(II) oxidation and initiates the formation of deposits and aggregates. By contrast, a cell-free substrate, heat-killed strains, and intracellularly expressed or purified MCO266 failed to catalyze Mn(II) oxidation. However, purified MCO266 exhibited Mn(II)-oxidizing activity when combined with cell outer membrane component (COMC) fractions in vitro. We demonstrated that Mn(II) oxidation and aggregate formation occurred through an oxygen-dependent biotic transformation process that requires a certain minimum Mn(II) concentration. We propose an approximate electron transfer pathway in which MCO266 transfers only one electron to convert Mn(II) to Mn(III) and then cooperates with other COMC electron transporters to transfer the other electron required to oxidize Mn(III) to Mn(IV). PMID:26039669

  13. Crystal Structures of Multicopper Oxidase CueO Bound to Copper(I) and Silver(I): Functional Role of a Methonine-Rich Sequence

    SciTech Connect

    Singh, Satish K.; Roberts, Sue A.; McDevitt, Sylvia F.; Weichsel, Andrzej; Wildner, Guenter F.; Grass, Gregor B.; Rensing, Christopher; Montfort, William R.


    The multicopper oxidase CueO oxidizes toxic Cu(I) and is required for copper homeostasis in Escherichia coli. Like many proteins involved in copper homeostasis, CueO has a methionine-rich segment that is thought to be critical for copper handling. How such segments function is poorly understood. Here, we report the crystal structure of CueO at 1.1 {angstrom} with the 45-residue methionine-rich segment fully resolved, revealing an N-terminal helical segment with methionine residues juxtaposed for Cu(I) ligation and a C-terminal highly mobile segment rich in methionine and histidine residues. We also report structures of CueO with a C500S mutation, which leads to loss of the T1 copper, and CueO with six methionines changed to serine. Soaking C500S CueO crystals with Cu(I), or wild-type CueO crystals with Ag(I), leads to occupancy of three sites, the previously identified substrate-binding site and two new sites along the methionine-rich helix, involving methionines 358, 362, 368, and 376. Mutation of these residues leads to a {approx}4-fold reduction in kcat for Cu(I) oxidation. Ag(I), which often appears with copper in nature, strongly inhibits CueO oxidase activities in vitro and compromises copper tolerance in vivo, particularly in the absence of the complementary copper efflux cus system. Together, these studies demonstrate a role for the methionine-rich insert of CueO in the binding and oxidation of Cu(I) and highlight the interplay among cue and cus systems in copper and silver homeostasis.

  14. Ground State Electronic and Magnetic Properties of a μ3-Oxo Bridged Trinuclear Cu(II) Complex: Correlation to the Native Intermediate of the Multicopper Oxidases

    PubMed Central

    Yoon, Jungjoo; Solomon, Edward I.


    The ground state electronic and magnetic properties of one of the possible structures of the trinuclear CuII site in the native intermediate (NI) of the multicopper oxidases, the μ3-oxo bridged structure, are evaluated using the C3-symmetric Cu3II complex, μ3O. μ3O is unique in that no ligand, other than the oxo, contributes to the exchange coupling. However, μ3O has a ferromagnetic ground state, inconsistent with that of NI. Therefore, two perturbations have been considered: protonation of the μ3-oxo ligand and relaxation of the μ3-oxo ligand into the Cu3 plane. Notably, when the oxo-ligand is sufficiently close to the Cu3 plane (< 0.3 Å), the ground state of μ3O becomes antiferromagnetic and can be correlated to that of NI. In addition, the ferromagnetic 4A ground state of μ3O is found from variable-temperature EPR to undergo a zero-field splitting (ZFS) of 2D = -5.0 cm-1, which derives from the second-order anisotropic exchange. This allows evaluation of the σ-to-π excited state exchange pathways and provides experimental evidence that the orbitally-degenerate 2E ground state of the antiferromagnetic μ3O would also undergo a ZFS by the first-order antisymmetric exchange that has the same physical origin as the anisotropic exchange. The important contribution of the μ3-oxo bridge to the ground-to-ground and ground-to-excited state superexchange pathways that are responsible for the isotropic, antisymmetric and anisotropic exchange are discussed. PMID:16241158

  15. Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase

    SciTech Connect

    De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique


    Radiation-induced reduction, radiolysis of copper sites and the effect of pH value together with the concomitant geometrical distortions of the active centres were analysed in several fungal (C. gallica) laccase structures collected at cryotemperature. This study emphasizes the importance of careful interpretation when the crystallographic structure of a metalloprotein is described. X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O{sub 2}. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UV–Vis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations of the metal centres, were observed at both acidic pH and high absorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O{sub 2} reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account.

  16. Electronic structure of the peroxy intermediate and its correlation to the native intermediate in the multicopper oxidases: insights into the reductive cleavage of the o-o bond.


    Yoon, Jungjoo; Solomon, Edward I


    The multicopper oxidases (MCOs) utilize a blue type 1 (T1) copper site and a trinuclear Cu cluster composed of a type 2 (T2) and a binuclear type 3 (T3) site that together catalyze the four-electron reduction of O2 to H2O. Reaction of the fully reduced enzyme with O2 proceeds via two sequential two-electron steps generating the peroxy intermediate (PI) and the native intermediate (NI). While a detailed description of the geometric and electronic structure of NI has been developed, this has been more elusive for PI largely due to the diamagnetic nature of its ground state. Density functional theory (DFT) calculations have been used to correlate to spectroscopic data to generate a description of the geometric and electronic structure of PI. A highly conserved carboxylate residue near the T2 site is found to play a critical role in stabilizing the PI structure, which induces oxidation of the T2 and one T3 Cu center and strong superexchange stabilization via the peroxide bridge, allowing irreversible binding of O2 at the trinuclear Cu site. Correlation of PI to NI is achieved using a two-dimensional potential energy surface generated to describe the catalytic two-electron reduction of the peroxide O-O bond by the MCOs. It is found that the reaction is thermodynamically driven by the relative stability of NI and the involvement of the simultaneous two-electron-transfer process. A low activation barrier (calculated approximately 5-6 kcal/mol and experimental approximately 3-5 kcal/mol) is produced by the triangular topology of the trinuclear Cu cluster site, as this symmetry provides good donor-acceptor frontier molecular orbital (FMO) overlap. Finally, the O-O bond cleavage in the trinuclear Cu cluster can be achieved via either a proton-assisted or a proton-unassisted process, allowing the MCOs to function over a wide range of pH. It is found that while the proton helps to stabilize the acceptor O22- sigma* orbital in the proton-assisted process for better donor

  17. Highly efficient perturbative + variational strategy based on orthogonal valence bond theory for the evaluation of magnetic coupling constants. Application to the trinuclear Cu(ii) site of multicopper oxidases.


    Tenti, Lorenzo; Maynau, Daniel; Angeli, Celestino; Calzado, Carmen J


    A new strategy based on orthogonal valence-bond analysis of the wave function combined with intermediate Hamiltonian theory has been applied to the evaluation of the magnetic coupling constants in two AF systems. This approach provides both a quantitative estimate of the J value and a detailed analysis of the main physical mechanisms controlling the coupling, using a combined perturbative + variational scheme. The procedure requires a selection of the dominant excitations to be treated variationally. Two methods have been employed: a brute-force selection, using a logic similar to that of the CIPSI approach, or entanglement measures, which identify the most interacting orbitals in the system. Once a reduced set of excitations (about 300 determinants) is established, the interaction matrix is dressed at the second-order of perturbation by the remaining excitations of the CI space. The diagonalization of the dressed matrix provides J values in good agreement with experimental ones, at a very low-cost. This approach demonstrates the key role of d → d* excitations in the quantitative description of the magnetic coupling, as well as the importance of using an extended active space, including the bridging ligand orbitals, for the binuclear model of the intermediates of multicopper oxidases. The method is a promising tool for dealing with complex systems containing several active centers, as an alternative to both pure variational and DFT approaches.

  18. ALTERNATIVE OXIDASE: From Gene to Function.


    Vanlerberghe, Greg C.; McIntosh, Lee


    Plants, some fungi, and protists contain a cyanide-resistant, alternative mitochondrial respiratory pathway. This pathway branches at the ubiquinone pool and consists of an alternative oxidase encoded by the nuclear gene Aox1. Alternative pathway respiration is only linked to proton translocation at Complex 1 (NADH dehydrogenase). Alternative oxidase expression is influenced by stress stimuli-cold, oxidative stress, pathogen attack-and by factors constricting electron flow through the cytochrome pathway of respiration. Control is exerted at the levels of gene expression and in response to the availability of carbon and reducing potential. Posttranslational control involves reversible covalent modification of the alternative oxidase and activation by specific carbon metabolites. This dynamic system of coarse and fine control may function to balance upstream respiratory carbon metabolism and downstream electron transport when these coupled processes become imbalanced as a result of changes in the supply of, or demand for, carbon, reducing power, and ATP.

  19. Prokaryotic origins for the mitochondrial alternative oxidase and plastid terminal oxidase nuclear genes.


    Finnegan, Patrick M; Umbach, Ann L; Wilce, Jackie A


    The mitochondrial alternative oxidase is a diiron carboxylate quinol oxidase (Dox) found in plants and some fungi and protists, but not animals. The plastid terminal oxidase is distantly related to alternative oxidase and is most likely also a Dox protein. Database searches revealed that the alpha-proteobacterium Novosphingobium aromaticivorans and the cyanobacteria Nostoc sp. PCC7120, Synechococcus sp. WH8102 and Prochlorococcus marinus subsp. pastoris CCMP1378 each possess a Dox homolog. Each prokaryotic protein conforms to the current structural models of the Dox active site and phylogenetic analyses suggest that the eukaryotic Dox genes arose from an ancestral prokaryotic gene.

  20. Identification of Zyklopen, a New Member of the Vertebrate Multicopper Ferroxidase Family, and Characterization in Rodents and Human Cells123

    PubMed Central

    Chen, Huijun; Attieh, Zouhair K.; Syed, Basharut A.; Kuo, Yien‐Ming; Stevens, Valerie; Fuqua, Brie K.; Andersen, Henriette S.; Naylor, Claire E.; Evans, Robert W.; Gambling, Lorraine; Danzeisen, Ruth; Bacouri‐Haidar, Mhenia; Usta, Julnar; Vulpe, Chris D.; McArdle, Harry J.


    We previously detected a membrane-bound, copper-containing oxidase that may be involved in iron efflux in BeWo cells, a human placental cell line. We have now identified a gene encoding a predicted multicopper ferroxidase (MCF) with a putative C-terminal membrane-spanning sequence and high sequence identity to hephaestin (Heph) and ceruloplasmin (Cp), the other known vertebrate MCF. Molecular modeling revealed conservation of all type I, II, and III copper-binding sites as well as a putative iron-binding site. Protein expression was observed in multiple diverse mouse tissues, including placenta and mammary gland, and the expression pattern was distinct from that of Cp and Heph. The protein possessed ferroxidase activity, and protein levels decreased in cellular copper deficiency. Knockdown with small interfering RNA in BeWo cells indicates that this gene represents the previously detected oxidase. We propose calling this new member of the MCF family “zyklopen.” PMID:20685892

  1. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )


    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  2. Characterization of two brassinosteroid C-6 oxidase genes in pea.


    Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B


    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea. PMID:17322341

  3. Lysyl Oxidase (Lox) Gene Deficiency Affects Osteoblastic Phenotype

    PubMed Central

    Pischon, N.; Mäki, J. M.; Weisshaupt, P.; Heng, N.; Palamakumbura, A. H.; N'Guessan, P.; Ding, A.; Radlanski, R.; Renz, H.; Bronckers, T. A. L. J. J.; Myllyharju, J.; Kielbassa, A.; Kleber, B. M.; Bernimoulin, J.-P.; Trackman, P.C.


    Lysyl oxidase (LOX) catalyzes cross-linking of elastin and collagen, which is essential for structural integrity and function of bone tissue. The present study examined the role of Lox gene deficiency for the osteoblast phenotype in primary calvarial osteoblasts from E18.5 Lox knockout (Lox-/-) and wild type (wt) (C57 BL/6) mice. Next to Lox gene depletion, mRNA expression of Lox isoforms, LOXL1-4, was significantly down-regulated in Lox-/- bone tissue. A significant decrease of DNA synthesis of Lox-/- osteoblasts compared to wt was found. Early stages of osteoblastic apoptosis studied by Annexin-V binding as well as later stages of DNA fragmentation were not affected. However, mineral nodule formation and osteoblastic differentiation were markedly decreased, as revealed by significant down-regulation of osteoblastic markers, type I collagen, BSP and Runx2/Cbfa1. PMID:19458888

  4. Evolution of the primate cytochrome c oxidase subunit II gene.


    Adkins, R M; Honeycutt, R L


    We examined the nucleotide and amino acid sequence variation of the cytochrome c oxidase subunit II (COII) gene from 25 primates (4 hominoids, 8 Old World monkeys, 2 New World monkeys, 2 tarsiers, 7 lemuriforms, 2 lorisiforms). Marginal support was found for three phylogenetic conclusions: (1) sister-group relationship between tarsiers and a monkey/ape clade, (2) placement of the aye-aye (Daubentonia) sister to all other strepsirhine primates, and (3) rejection of a sister-group relationship of dwarf lemurs (i.e., Cheirogaleus) with lorisiform primates. Stronger support was found for a sister-group relationship between the ring-tail lemur (Lemur catta) and the gentle lemurs (Hapalemur). In congruence with previous studies on COII, we found that the monkeys and apes have undergone a nearly two-fold increase in the rate of amino acid replacement relative to other primates. Although functionally important amino acids are generally conserved among all primates, the acceleration in amino acid replacements in higher primates is associated with increased variation in the amino terminal end of the protein. Additionally, the replacement of two carboxyl-bearing residues (glutamate and aspartate) at positions 114 and 115 may provide a partial explanation for the poor enzyme kinetics in cross-reactions between the cytochromes c and cytochrome c oxidases of higher primates and other mammals. PMID:8006990

  5. Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation.


    McDermott, Rose; Tingley, Dustin; Cowden, Jonathan; Frazzetto, Giovanni; Johnson, Dominic D P


    Monoamine oxidase A gene (MAOA) has earned the nickname "warrior gene" because it has been linked to aggression in observational and survey-based studies. However, no controlled experimental studies have tested whether the warrior gene actually drives behavioral manifestations of these tendencies. We report an experiment, synthesizing work in psychology and behavioral economics, which demonstrates that aggression occurs with greater intensity and frequency as provocation is experimentally manipulated upwards, especially among low activity MAOA (MAOA-L) subjects. In this study, subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent. There is some evidence of a main effect for genotype and some evidence for a gene by environment interaction, such that MAOA is less associated with the occurrence of aggression in a low provocation condition, but significantly predicts such behavior in a high provocation situation. This new evidence for genetic influences on aggression and punishment behavior complicates characterizations of humans as "altruistic" punishers and supports theories of cooperation that propose mixed strategies in the population. It also suggests important implications for the role of individual variance in genetic factors contributing to everyday behaviors and decisions.

  6. A putative multicopper protein secreted by an atypical type II secretion system involved in the reduction of insoluble electron acceptors in Geobacter sulfurreducens.


    Mehta, Teena; Childers, Susan E; Glaven, Richard; Lovley, Derek R; Mester, Tünde


    Extracellular electron transfer onto Fe(III) oxides in Geobacter sulfurreducens is considered to require proteins that must be exported to the outer surface of the cell. In order to investigate this, the putative gene for OxpG, the pseudopilin involved in a type II general secretion pathway of Gram-negative bacteria, was deleted. The mutant was unable to grow with insoluble Fe(III) oxide as the electron acceptor. Growth on soluble Fe(III) was not affected. An analysis of proteins that accumulated in the periplasm of the oxpG mutant, but not in the wild-type, led to the identification of a secreted protein, OmpB. OmpB is predicted to be a multicopper protein, with highest homology to the manganese oxidase, MofA, from Leptothrix discophora. OmpB contains a potential Fe(III)-binding site and a fibronectin type III domain, suggesting a possible role for this protein in accessing Fe(III) oxides. OmpB was localized to the membrane fraction of G. sulfurreducens and in the supernatant of growing cultures, consistent with the type II secretion system exporting OmpB. A mutant in which ompB was deleted had the same phenotype as the oxpG mutant, suggesting that the failure to export OmpB was responsible for the inability of the oxpG-deficient mutant to reduce Fe(III) oxide. This is the first report that proposes a role for a multicopper oxidase-like protein in an anaerobic organism. These results further emphasize the importance of outer-membrane proteins in Fe(III) oxide reduction and suggest that outer-membrane proteins other than c-type cytochromes are required for Fe(III) oxide reduction in Geobacter species. PMID:16849792

  7. The pea gene NA encodes ent-kaurenoic acid oxidase.


    Davidson, Sandra E; Elliott, Robert C; Helliwell, Chris A; Poole, Andrew T; Reid, James B


    The gibberellin (GA)-deficient dwarf na mutant in pea (Pisum sativum) has severely reduced internode elongation, reduced root growth, and decreased leaflet size. However, the seeds develop normally. Two genes, PsKAO1 and PsKAO2, encoding cytochrome P450 monooxygenases of the subfamily CYP88A were isolated. Both PsKAO1 and PsKAO2 had ent-kaurenoic acid oxidase (KAO) activity, catalyzing the three steps of the GA biosynthetic pathway from ent-kaurenoic acid to GA(12) when expressed in yeast (Saccharomyces cerevisiae). In addition to the intermediates ent-7alpha-hydroxykaurenoic acid and GA(12)-aldehyde, some additional products of the pea KAO activity were detected, including ent-6alpha,7alpha-dihydroxykaurenoic acid and 7beta-hydroxykaurenolide. The NA gene encodes PsKAO1, because in two independent mutant alleles, na-1 and na-2, PsKAO1 had altered sequences and the five-base deletion in PsKAO1 associated with the na-1 allele cosegregated with the dwarf na phenotype. PsKAO1 was expressed in the stem, apical bud, leaf, pod, and root, organs in which GA levels have previously been shown to be reduced in na plants. PsKAO2 was expressed only in seeds and this may explain the normal seed development and normal GA biosynthesis in seeds of na plants.

  8. An ACC Oxidase Gene Essential for Cucumber Carpel Development.


    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen


    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon.

  9. An ACC Oxidase Gene Essential for Cucumber Carpel Development.


    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen


    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  10. Suppression substractive hybridisation (SSH) and real time PCR reveal differential gene expression in the Pacific cupped oyster, Crassostrea gigas, challenged with Ostreid herpesvirus 1.


    Renault, T; Faury, N; Barbosa-Solomieu, V; Moreau, K


    Virus-induced genes were identified using suppression subtractive hybridisation (SSH) from Pacific cupped oyster, Crassostrea gigas, haemocytes challenged by OsHV-1. A total of 304 clones from SSH forward library were sequenced. Among these sequences, some homologues corresponded to (i) immune related genes (macrophage express protein, IK cytokine, interferon-induced protein 44 or multicopper oxidase), (ii) apoptosis related genes (Bcl-2) and (iii) cell signalling and virus receptor genes (glypican). Molecular characterization and phylogenic analysis of 3 immune-related genes (macrophage expressed protein, multicopper oxidase and immunoglobulin domain cell adhesion molecule) were performed. Finally, quantitative PCR revealed significant changes in the expression of immune related genes (multicopper oxidase, macrophage expressed protein, myeloid differentiation factor 88 and interferon-induced protein 44) in oysters experimentally challenged with OsHV-1. These findings provide a first basis for studying the role of innate immunity in response to viruses in bivalves and identified genes may serve as markers of interest in breeding programs in order to obtain selected oysters presenting OsHV-1 resistance.

  11. Overexpression of NADH oxidase gene from Deinococcus geothermalis in Escherichia coli.


    Kazuya, Sase; Tomomi, Iwasaki; Hatsune, Karasaki; Masahide, Ishikawa


    When using stable enzyme genes from a thermophile to create a biosensor in Escherichia coli, it is vital that these genes be overexpressed in order to provide a sufficient supply of enzymes. In this study, overexpression of the NADH oxidase (Nox) gene from the thermophile Deinococcus geothermalis was successfully achieved with the aim of creating a stable biosensor active at room temperatures. To do so, modification of 10 nucleotides, GAAATTAACT, upstream of the start codon of the Nox gene was necessary.

  12. Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.


    van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge


    The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity.

  13. Transcriptional changes of gibberellin oxidase genes in grapevines with or without gibberellin application during inflorescence development.


    Jung, Chan Jin; Hur, Youn Young; Jung, Sung-Min; Noh, Jung-Ho; Do, Gyung-Ran; Park, Seo-June; Nam, Jong-Chul; Park, Kyo-Sun; Hwang, Hae-Sung; Choi, Doil; Lee, Hee Jae


    The concept that gibberellin (GA) application on seeded grapevines induces seedlessness has been known for decades in viticulture. GA was applied to inflorescence clusters of seeded diploid grapevine cultivar 'Tamnara' (Vitis spp.) at 14 days before full bloom (DBF). Morphological and molecular effects of GA application were examined on the induction of parthenocarpic fruit development. With GA application, ovaries were enlarged and pollen tube growth was completely inhibited. Vitis GA oxidase enzymes, key determinants for GA level, were characterized through phylogenetic analysis with Arabidopsis GA oxidase enzymes. Five VvGA 20-oxidase (VvGA20ox), three VvGA 3-oxidase (VvGA3ox), and nine VvGA 2-oxidase (VvGA2ox) family proteins, and one VvGA methyltransferase (VvGAMT) and one Vitis cytochrome P450 714A1 proteins were identified, and their expression patterns were analyzed during inflorescence development from 14 DBF to 5 days after full bloom (DAF). VvGA2ox1, VvGA20ox3, and VvGA3ox2 were the most abundantly expressed genes in each gene family at 7, 5, and 2 DBF, respectively. Following GA application at 14 DBF inducing seedlessness, GA catabolic genes such as VvGAMT2, VvGA2ox3, and VvGA2ox4 were up-regulated at 12 DBF, full bloom, and 5 DAF, respectively. Conversely, most GA biosynthetic genes, VvGA20oxs and VvGA3oxs, were down-regulated at near full bloom, and the timing of their peak expression was changed. These results suggest that GA application at pre-bloom changes the GA biosynthesis into GA catabolic pathway at near full bloom by altering the transcription level and timing of GA oxidase genes during grapevine inflorescence development.

  14. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.


    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  15. Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...

  16. The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities.


    Marelja, Zvonimir; Dambowsky, Miriam; Bolis, Marco; Georgiou, Marina L; Garattini, Enrico; Missirlis, Fanis; Leimkühler, Silke


    In the genome of Drosophila melanogaster, four genes coding for aldehyde oxidases (AOX1-4) were identified on chromosome 3. Phylogenetic analysis showed that the AOX gene cluster evolved via independent duplication events in the vertebrate and invertebrate lineages. The functional role and the substrate specificity of the distinct Drosophila AOX enzymes is unknown. Two loss-of-function mutant alleles in this gene region, low pyridoxal oxidase (Po(lpo)) and aldehyde oxidase-1 (Aldox-1(n1)) are associated with a phenotype characterized by undetectable AOX enzymatic activity. However, the genes involved and the corresponding mutations have not yet been identified. In this study we characterized the activities, substrate specificities and expression profiles of the four AOX enzymes in D. melanogaster. We show that the Po(lpo)-associated phenotype is the consequence of a structural alteration of the AOX1 gene. We identified an 11-bp deletion in the Po(lpo) allele, resulting in a frame-shift event, which removes the molybdenum cofactor domain of the encoded enzyme. Furthermore, we show that AOX2 activity is detectable only during metamorphosis and characterize a Minos-AOX2 insertion in this developmental gene that disrupts its activity. We demonstrate that the Aldox-1(n1) phenotype maps to the AOX3 gene and AOX4 activity is not detectable in our assays.

  17. The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities

    PubMed Central

    Marelja, Zvonimir; Dambowsky, Miriam; Bolis, Marco; Georgiou, Marina L.; Garattini, Enrico; Missirlis, Fanis; Leimkühler, Silke


    In the genome of Drosophila melanogaster, four genes coding for aldehyde oxidases (AOX1–4) were identified on chromosome 3. Phylogenetic analysis showed that the AOX gene cluster evolved via independent duplication events in the vertebrate and invertebrate lineages. The functional role and the substrate specificity of the distinct Drosophila AOX enzymes is unknown. Two loss-of-function mutant alleles in this gene region, low pyridoxal oxidase (Polpo) and aldehyde oxidase-1 (Aldox-1n1) are associated with a phenotype characterized by undetectable AOX enzymatic activity. However, the genes involved and the corresponding mutations have not yet been identified. In this study we characterized the activities, substrate specificities and expression profiles of the four AOX enzymes in D. melanogaster. We show that the Polpo-associated phenotype is the consequence of a structural alteration of the AOX1 gene. We identified an 11-bp deletion in the Polpo allele, resulting in a frame-shift event, which removes the molybdenum cofactor domain of the encoded enzyme. Furthermore, we show that AOX2 activity is detectable only during metamorphosis and characterize a Minos-AOX2 insertion in this developmental gene that disrupts its activity. We demonstrate that the Aldox-1n1 phenotype maps to the AOX3 gene and AOX4 activity is not detectable in our assays. PMID:24737760

  18. Structure and evolution of vertebrate aldehyde oxidases: from gene duplication to gene suppression.


    Kurosaki, Mami; Bolis, Marco; Fratelli, Maddalena; Barzago, Maria Monica; Pattini, Linda; Perretta, Gemma; Terao, Mineko; Garattini, Enrico


    Aldehyde oxidases (AOXs) and xanthine dehydrogenases (XDHs) belong to the family of molybdo-flavoenzymes. Although AOXs are not identifiable in fungi, these enzymes are represented in certain protists and the majority of plants and vertebrates. The physiological functions and substrates of AOXs are unknown. Nevertheless, AOXs are major drug metabolizing enzymes, oxidizing a wide range of aromatic aldehydes and heterocyclic compounds of medical/toxicological importance. Using genome sequencing data, we predict the structures of AOX genes and pseudogenes, reconstructing their evolution. Fishes are the most primitive organisms with an AOX gene (AOXα), originating from the duplication of an ancestral XDH. Further evolution of fishes resulted in the duplication of AOXα into AOXβ and successive pseudogenization of AOXα. AOXβ is maintained in amphibians and it is the likely precursors of reptilian, avian, and mammalian AOX1. Amphibian AOXγ is a duplication of AOXβ and the likely ancestor of reptilian and avian AOX2, which, in turn, gave rise to mammalian AOX3L1. Subsequent gene duplications generated the two mammalian genes, AOX3 and AOX4. The evolution of mammalian AOX genes is dominated by pseudogenization and deletion events. Our analysis is relevant from a structural point of view, as it provides information on the residues characterizing the three domains of each mammalian AOX isoenzyme. We cloned the cDNAs encoding the AOX proteins of guinea pig and cynomolgus monkeys, two unique species as to the evolution of this enzyme family. We identify chimeric RNAs from the human AOX3 and AOX3L1 pseudogenes with potential to encode a novel microRNA.

  19. Polyphenol Oxidase Activity Expression in Ralstonia solanacearum

    PubMed Central

    Hernández-Romero, Diana; Solano, Francisco; Sanchez-Amat, Antonio


    Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for polyphenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this microorganism. The conditions for the PPO assays were optimized for the phenolic substrate, pH, and sodium dodecyl sulfate concentration used. It was demonstrated that three different PPOs are expressed. The genes coding for the enzymes were unambiguously correlated with the enzymatic activities detected by generation of null mutations in the genes by using insertional mutagenesis with a suicide plasmid and estimating the changes in the levels of enzymatic activities compared to the levels in the wild-type strain. The protein encoded by the RSp1530 locus is a multicopper protein with laccase activity. Two other genes, RSc0337 and RSc1501, code for nonblue copper proteins exhibiting homology to tyrosinases. The product of RSc0337 has strong tyrosine hydroxylase activity, and it has been shown that this enzyme is involved in melanin synthesis by R. solanacearum. The product of the RSc1501 gene is an enzyme that shows a clear preference for oxidation of o-diphenols. Preliminary characterization of the mutants obtained indicated that PPOs expressed by R. solanacearum may participate in resistance to phenolic compounds since the mutants exhibited higher sensitivity to l-tyrosine than the wild-type strain. These results suggest a possible role in the pathogenic process to avoid plant resistance mechanisms involving the participation of phenolic compounds. PMID:16269713

  20. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James


    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  1. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.


    Szuplewski, S; Terracol, R


    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  2. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R


    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  3. A Phaseolus vulgaris NADPH oxidase gene is required for root infection by Rhizobia.


    Montiel, Jesús; Nava, Noreide; Cárdenas, Luis; Sánchez-López, Rosana; Arthikala, Manoj-Kumar; Santana, Olivia; Sánchez, Federico; Quinto, Carmen


    Plant NADPH oxidases [respiratory burst oxidase homologs (RBOHs)] have emerged as key players in the regulation of plant-pathogen interactions. Nonetheless, their role in mutualistic associations, such as the rhizobia-legume symbiosis, is poorly understood. In this work, nine members of the Phaseolus vulgaris Rboh gene family were identified. The transcript of one of these, PvRbohB, accumulated abundantly in shoots, roots and nodules. PvRbohB promoter activity was detected in meristematic regions of P. vulgaris roots, as well as during infection thread (IT) progression and nodule development. RNA interference (RNAi)-mediated PvRbohB down-regulation in transgenic roots reduced reactive oxygen species (ROS) production and lateral root density, and greatly impaired nodulation. Microscopy analysis revealed that progression of the ITs was impeded at the base of root hairs in PvRbohB-RNAi roots. Furthermore, the few nodules that formed in PvRbohB-down-regulated roots displayed abnormally wide ITs and reduced nitrogen fixation. These findings indicate that this common bean NADPH oxidase is crucial for successful rhizobial colonization and probably maintains proper IT growth and shape.

  4. Phylogenetic positions of insectivora in eutheria inferred from mitochondrial cytochrome c oxidase subunit II gene.


    Onuma, M; Kusakabe, T; Kusakabe, S


    For the elucidation of the phylogenetic position of insectivora in eutheria, we have sequenced the cytochrome c oxidase subunit II (COII) gene of mitochondria for three insectivoran species [musk screw (Suncus murinus), shrew mole (Urotrichus talpoides), Japanese mole (Mogera wogura)] and analyzed these amino acid sequences with neighbor-joining (NJ) method and maximum likelihood (ML) method. NJ analysis shows polyphyly of Insectivora and Chiroptera. Assuming that each of Primates, Ferungulata, Chiroptera, Insectivora and Rodentia is a monophyletic group, ML analysis suggests that Chiroptera is a sister group of Insectivora and that Ferungulata is the closest outgroup to the (Insectivora and Chiroptera) clade.

  5. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.


    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L


    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions.

  6. The insect cytochrome oxidase I gene: evolutionary patterns and conserved primers for phylogenetic studies.


    Lunt, D H; Zhang, D X; Szymura, J M; Hewitt, G M


    Insect mitochondrial cytochrome oxidase I (COI) genes are used as a model to examine the within-gene heterogeneity of evolutionary rate and its implications for evolutionary analyses. The complete sequence (1537 bp) of the meadow grasshopper (Chorthippus parallelus) COI gene has been determined, and compared with eight other insect COI genes at both the DNA and amino acid sequence levels. This reveals that different regions evolve at different rates, and the patterns of sequence variability seems associated with functional constraints on the protein. The COOH-terminal was found to be significantly more variable than internal loops (I), external loops (E), transmembrane helices (M) or the NH2 terminal. The central region of COI (M5-M8) has lower levels of sequence variability, which is related to several important functional domains in this region. Highly conserved primers which amplify regions of different variabilities have been designed to cover the entire insect COI gene. These primers have been shown to amplify COI in a wide range of species, representing all the major insect groups; some even in an arachnid. Implications of the observed evolutionary pattern for phylogenetic analysis are discussed, with particular regard to the choice of regions of suitable variability for specific phylogenetic projects.

  7. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.


    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L


    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions. PMID:23066664

  8. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.


    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  9. Potato tuber cytokinin oxidase/dehydrogenase genes: biochemical properties, activity, and expression during tuber dormancy progression.


    Suttle, Jeffrey C; Huckle, Linda L; Lu, Shunwen; Knauber, Donna C


    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in lateral buds isolated from field-grown tubers. All five putative StCKX genes encoded proteins with in vitro CKX activity. All five enzymes were maximally active at neutral to slightly alkaline pH with 2,6-dichloro-indophenol as the electron acceptor. In silico analyses indicated that four proteins were likely secreted. Substrate dependence of two of the most active enzymes varied; one exhibiting greater activity with isopentenyl-type cytokinins while the other was maximally active with cis-zeatin as a substrate. [(3)H]-isopentenyl-adenosine was readily metabolized by excised tuber buds to adenine/adenosine demonstrating that CKX was active in planta. There was no change in apparent in planta CKX activity during either natural or chemically forced dormancy progression. Similarly although expression of individual StCKX genes varied modestly during tuber dormancy, there was no clear correlation between StCKX gene expression and tuber dormancy status. Thus although CKX gene expression and enzyme activity are present in potato tuber buds throughout dormancy, they do not appear to play a significant role in the regulation of cytokinin content during tuber dormancy progression.

  10. Potato tuber cytokinin oxidase/dehydrogenase genes: biochemical properties, activity, and expression during tuber dormancy progression.


    Suttle, Jeffrey C; Huckle, Linda L; Lu, Shunwen; Knauber, Donna C


    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in lateral buds isolated from field-grown tubers. All five putative StCKX genes encoded proteins with in vitro CKX activity. All five enzymes were maximally active at neutral to slightly alkaline pH with 2,6-dichloro-indophenol as the electron acceptor. In silico analyses indicated that four proteins were likely secreted. Substrate dependence of two of the most active enzymes varied; one exhibiting greater activity with isopentenyl-type cytokinins while the other was maximally active with cis-zeatin as a substrate. [(3)H]-isopentenyl-adenosine was readily metabolized by excised tuber buds to adenine/adenosine demonstrating that CKX was active in planta. There was no change in apparent in planta CKX activity during either natural or chemically forced dormancy progression. Similarly although expression of individual StCKX genes varied modestly during tuber dormancy, there was no clear correlation between StCKX gene expression and tuber dormancy status. Thus although CKX gene expression and enzyme activity are present in potato tuber buds throughout dormancy, they do not appear to play a significant role in the regulation of cytokinin content during tuber dormancy progression. PMID:24594397

  11. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.


    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu


    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

  12. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings.


    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan


    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-alpha1, -alpha2, -gamma1, and -delta, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-gamma1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-gamma 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PA(PLD) signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity.

  13. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    PubMed Central


    Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

  14. Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.


    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua


    Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene. PMID:26546307

  15. Differential Expression and Turnover of the Tomato Polyphenol Oxidase Gene Family during Vegetative and Reproductive Development.

    PubMed Central

    Thipyapong, P.; Joel, D. M.; Steffens, J. C.


    Polyphenol oxidases (PPOs) are encoded by a highly conserved, seven-member gene family clustered within a 165-kb locus on chromosome 8 of tomato (Lycopersicon esculentum). Using gene-specific probes capable of differentiating between PPO A/C, PPO B, PPO D, and PPO E/F, we examined the spatial and temporal expression of this gene family during vegetative and reproductive development. RNA blots and in situ hybridization using these probes showed that although PPO expression is primarily confined to early stages of development, the steady-state mRNA levels of these genes are subject to complex patterns of spatial and temporal regulation in vegetative and reproductive organs. Young tomato leaves and flowers possess the most abundant PPO transcripts. PPO B is the most abundant in young leaves, whereas in the inflorescence PPO B and E/F transcripts are dominant. Differential expression of PPOs is also observed in various trichome types. PPO A/C are specifically expressed in type I and type IV trichomes. In contrast, PPO D is only expressed in type VI trichomes. Type I, IV, and VI trichomes possess PPO E/F transcripts. Immunolocalization verified the translational activity of PPOs identified by in situ hybridization and suggested cell-type-specific, developmentally programmed PPO turnover. In addition, immunolocalization demonstrated the accumulation of PPO in specific idioblast cells of stems, leaves, and fruits. PMID:12223637

  16. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    SciTech Connect

    Brunner, H.G. ); Nelen, M.; Ropers, H.H.; van Oost, B.A. )


    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

  17. Phylogenetic relationships among onychophora from Australasia inferred from the mitochondrial cytochrome oxidase subunit I gene.


    Gleeson, D M; Rowell, D M; Tait, N N; Briscoe, D A; Higgins, A V


    Nucleotide sequence variation in a region of the mitochondrial cytochrome oxidase subunit I (COI) gene (456 bp) was examined for 26 onychophorans representing 15 genera of the family Peripatopsidae from Australasia. Sequence analysis revealed high intergeneric COI sequence divergence (up to 20.6% corrected) but low amino acid substitution rates, with high levels of transitional saturation evident. Among unambiguously alignable sequences, parsimony and distance analyses revealed a broadly congruent tree topology, robust to various algorithms and statistical analysis. There are two major groupings. One, largely unresolved, consists entirely of Australian mainland taxa. The other, for which there is convincing support, includes all of the New Zealand and Tasmanian taxa together with one mainland Australian species. In respect of the two major groupings, this topology is consistent with previous morphologically based phylogenies and provides further evidence for an ancient radiation within the mainland Australian Onychophora. The biogeographic implications of the close affinities revealed between the Tasmanian and New Zealand taxa are discussed.

  18. DNA barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase gene.


    Elmeer, K; Almalki, A; Mohran, K A; Al-Qahtani, K N; Almarri, M


    The massive destruction and deterioration of the habitat of Oryx leucoryx and illegal hunting have decimated Oryx populations significantly, and now these animals are almost extinct in the wild. Molecular analyses can significantly contribute to captive breeding and reintroduction strategies for the conservation of this endangered animal. A representative 32 identical sequences used for species identification through BOLD and GenBank/NCBI showed maximum homology 96.06% with O. dammah, which is a species of Oryx from Northern Africa, the next closest species 94.33% was O. gazella, the African antelope. DNA barcode sequences of the mitochondrial cytochrome C oxidase (COI) gene were determined for O. leucoryx; identification through BOLD could only recognize the genus correctly, whereas the species could not be identified. This was due to a lack of sequence data for O. leucoryx on BOLD. Similarly, BLAST analysis of the NCBI data base also revealed no COI sequence data for the genus Oryx. PMID:22535389

  19. Collection of mitochondrial cytochrome oxidase I gene sequences from Rhipicephalus ticks from various geographic locations around the world

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Determining the origin of the cattle tick, Rhipicephalus microplus, will be helpful to the effort to find biological control agents. Molecular phylogenetics can assist in this determination. Thus, we sequenced and assembled partial gene sequences from the mitochondrial cytochrome oxidase I coding r...

  20. Isolation and transcript analysis of gibberellin 20-oxidase genes in pea and bean in relation to fruit development.


    García-Martínez, J L; López-Diaz, I; Sánchez-Beltrán, M J; Phillips, A L; Ward, D A; Gaskin, P; Hedden, P


    PCR was used with degenerate primers based on conserved amino acid sequences in gibberellin (GA) 20-oxidases to isolate cDNA clones for these enzymes from young seeds of pea (Pisum sativum) and developing embryos of French bean (Phaseolus vulgaris). One GA 20-oxidase cDNA (Ps27-12) was obtained from pea and three (Pv 15-11, Pv73-1 and Pv85-26) from bean. Their identities were confirmed by demonstrating that fusion proteins expressed in Escherichia coli exhibited GA 20-oxidase activity, converting [14C]GA12 to [14C]GA9. The intermediates in this three-step reaction, GA15 and GA24, were also identified as products. The expression proteins from three of the clones (Ps27-12, Pv15-11 and Pv73-1) were also shown to convert GA53 to GA20, as effectively as they did GA12. On the basis of transcript levels measured by northern blot analysis, the pea GA 20-oxidase gene is most highly expressed in young leaves, fully expanded internodes, very young seeds (until 4 days after anthesis) and expanding pods (from 3 days after anthesis at least until day 6). Expression in pods from 3-day-old unpollinated ovaries is higher than in those from pollinated ovaries. Treatment of unpollinated ovaries with GA3 to induce parthenocarpic fruit-set severely reduced the amount of GA 20-oxidase mRNA, whereas treatment with 2,4-D, although inducing fruit-set, did not reduce the levels of these transcripts. Plant decapitation above an unpollinated ovary resulted in very high levels of GA 20-oxidase mRNA in the pod. The three GA 20-oxidase genes from French bean showed very different patterns of expression: Pv 15-1 was expressed in the roots, young leaves, and developing seeds, but most highly in immature cotyledons, while Pv73-1 has a similar expression pattern to Ps27-12, with transcripts found only in young seeds and young leaves, where it was particularly abundant. Transcripts corresponding to Pv85-26 were detected in developing seeds, and just traces in the young leaves. Southern blot analysis

  1. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    PubMed Central

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling


    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  2. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene

    PubMed Central

    LI, Xiu-Feng; HAN, Chong; ZHONG, Cai-Rong; XU, Jun-Qiu; HUANG, Jian-Rong


    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans. PMID:27686791

  3. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene.


    Li, Xiu-Feng; Han, Chong; Zhong, Cai-Rong; Xu, Jun-Qiu; Huang, Jian-Rong


    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans. PMID:27686791

  4. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

    PubMed Central

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad


    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  5. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene.


    Li, Xiu-Feng; Han, Chong; Zhong, Cai-Rong; Xu, Jun-Qiu; Huang, Jian-Rong


    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans.

  6. Characterization of ascorbate oxidase from Acremonium sp. HI-25.


    Hirose, J; Sakurai, T; Imamura, K; Watanabe, H; Iwamoto, H; Hiromi, K; Itoh, H; Shin, T; Murao, S


    The ascorbate oxidase obtained from a microorganism, Acremonium sp. HI-25 (molecular weight, 80 kDa; monomeric protein), was studied with respect to atomic absorption, EPR, absorption spectra, circular dichroism (CD) spectra, and steady-state kinetics. The enzyme was found to be a multicopper protein, containing four copper atoms of three kinds, types 1, 2, and 3 copper, in the ratio of 1:1:2. The EPR parameters of the type 1 and 2 copper atoms in the ascorbate oxidase are very similar to those in the case of the ascorbate oxidase obtained from cucumber, which is a dimeric protein. The apparent Km and kcat values for ascorbic acid of the ascorbate oxidase from Acremonium sp. HI-25 are almost the same as those of the monomeric unit of the ascorbate oxidase from cucumber. PMID:7961590

  7. Transcriptional activation through ETS domain binding sites in the cytochrome c oxidase subunit IV gene

    SciTech Connect

    Virbasius, J.V.; Scarpulla, R.C. )


    A mutational analysis of the rat cytochrome c oxidase subunit IV (RCO4) promoter region revealed the presence of a major control element consisting of a tandemly repeated pair of binding sites for a nuclear factor from HeLa cells. This factor was designated NRF-2 (nuclear respiratory factor 2) because a functional recognition site was also found in the human ATP synthase {beta}-subunit gene. Deletion or site-directed point mutations of the NRF-2 binding sites in the RCO4 promoter resulted in substantial loss of transcriptional activity, and synthetic oligomers of the NRF-2 binding sites from both genes stimulated a heterologous promoter when cloned in cis. NRF-2 binding a transcriptional activation required a purine-rich core sequence, GGAA. This motif is characteristic of the recognition site for a family of activators referred to as ETS domain proteins because of the similarity within their DNA-binding domains to the ets-1 proto-oncogene product. NRF-2 recognized an authentic Ets-1 site within the Moloney murine sarcoma virus long terminal repeat, and this site was able to compete for NRF-2 binding to the RCO4 promoter sequence. However, in contrast to Ets-1, which appears to be exclusive to lymphoid tissues, NRF-2 has the broad tissue distribution expected of a regulator of respiratory chain expression.

  8. Monoamine oxidase A gene DNA hypomethylation - a risk factor for panic disorder?


    Domschke, Katharina; Tidow, Nicola; Kuithan, Henriette; Schwarte, Kathrin; Klauke, Benedikt; Ambrée, Oliver; Reif, Andreas; Schmidt, Hartmut; Arolt, Volker; Kersting, Anette; Zwanzger, Peter; Deckert, Jürgen


    The monoamine oxidase A (MAOA) gene has been suggested as a prime candidate in the pathogenesis of panic disorder. In the present study, DNA methylation patterns in the MAOA regulatory and exon 1/intron 1 region were investigated for association with panic disorder with particular attention to possible effects of gender and environmental factors. Sixty-five patients with panic disorder (44 females, 21 males) and 65 healthy controls were analysed for DNA methylation status at 42 MAOA CpG sites via direct sequencing of sodium bisulfate treated DNA extracted from blood cells. The occurrence of recent positive and negative life events was ascertained. Male subjects showed no or only very minor methylation with some evidence for relative hypomethylation at one CpG site in intron 1 in patients compared to controls. Female patients exhibited significantly lower methylation than healthy controls at 10 MAOA CpG sites in the promoter as well as in exon/intron 1, with significance surviving correction for multiple testing at four CpG sites (p≤0.001). Furthermore, in female subjects the occurrence of negative life events was associated with relatively decreased methylation, while positive life events were associated with increased methylation. The present pilot data suggest a potential role of MAOA gene hypomethylation in the pathogenesis of panic disorder particularly in female patients, possibly mediating a detrimental influence of negative life events. Future studies are warranted to replicate the present finding in independent samples, preferably in a longitudinal design.

  9. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants.


    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José


    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  10. Modulation of NADPH-oxidase gene expression in rolB-transformed calli of Arabidopsis thaliana and Rubia cordifolia.


    Veremeichik, Galina; Bulgakov, Victor; Shkryl, Yury


    Expression of rol genes from Agrobacterium rhizogenes induces reprogramming of transformed plant cells and provokes pleiotropic effects on primary and secondary metabolism. We have previously established that the rolB and rolC genes impair reactive oxygen species (ROS) generation in transformed cells of Rubia cordifolia and Arabidopsis thaliana. In the present investigation, we tested whether this effect is associated with changes in the expression levels of NADPH oxidases, which are considered to be the primary source of ROS during plant-microbe interactions. We identified two full-length NADPH oxidase genes from R. cordifolia and examined their expression in non-transformed and rolB-transformed calli. In addition, we examined the expression of their homologous genes from A. thaliana in non-transformed and rolB-expressing cells. The expression of Rboh isoforms was 3- to 7-fold higher in both R. cordifolia and A. thaliana rolB-transformed cells compared with non-transformed cells. Our results for the first time show that Agrobacterium rolB gene regulates particular NADPH oxidase isoforms. PMID:27208504

  11. Molecular evolution of the cytochrome c oxidase subunit 5A gene in primates

    PubMed Central


    Background Many electron transport chain (ETC) genes show accelerated rates of nonsynonymous nucleotide substitutions in anthropoid primate lineages, yet in non-anthropoid lineages the ETC proteins are typically highly conserved. Here, we test the hypothesis that COX5A, the ETC gene that encodes cytochrome c oxidase subunit 5A, shows a pattern of anthropoid-specific adaptive evolution, and investigate the distribution of this protein in catarrhine brains. Results In a dataset comprising 29 vertebrate taxa, including representatives from all major groups of primates, there is nearly 100% conservation of the COX5A amino acid sequence among extant, non-anthropoid placental mammals. The most recent common ancestor of these species lived about 100 million years (MY) ago. In contrast, anthropoid primates show markedly elevated rates of nonsynonymous evolution. In particular, branch site tests identify five positively selected codons in anthropoids, and ancestral reconstructions infer that substitutions in these codons occurred predominantly on stem lineages (anthropoid, ape and New World monkey) and on the human terminal branch. Examination of catarrhine brain samples by immunohistochemistry characterizes for the first time COX5A protein distribution in the primate neocortex, and suggests that the protein is most abundant in the mitochondria of large-size projection neurons. Real time quantitative PCR supports previous microarray results showing COX5A is expressed in cerebral cortical tissue at a higher level in human than in chimpanzee or gorilla. Conclusion Taken together, these results suggest that both protein structural and gene regulatory changes contributed to COX5A evolution during humankind's ancestry. Furthermore, these findings are consistent with the hypothesis that adaptations in ETC genes contributed to the emergence of the energetically expensive anthropoid neocortex. PMID:18197981

  12. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.


    Vanlerberghe, G. C.; McLntosh, L.


    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  13. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.

    PubMed Central

    Vanlerberghe, G. C.; McLntosh, L.


    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  14. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.


    Xin, Shan; Tao, Chengcheng; Li, Hongbin


    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  15. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    PubMed Central

    Xin, Shan; Tao, Chengcheng; Li, Hongbin


    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  16. Three-dimensional organization of three-domain copper oxidases: A review

    NASA Astrophysics Data System (ADS)

    Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaĭtsev, V. N.; Mikhaĭlov, A. M.


    “Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  17. The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene

    PubMed Central

    Clem, Stian A.; Wu, Wenbi; Lorena Passarelli, A.


    The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, Tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

  18. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.


    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan


    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks.

  19. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.


    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan


    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. PMID:27106120

  20. [Prolonging the vase life of carnation "Mabel" through integrating repeated ACC oxidase genes into its genome].


    Yu, Yi-Xun; Bao, Man-Zhu


    Carnation (Dianthus caryophyllus L.) is one of the most important cut flowers. The cultivar "Mabel" of carnation was transformed with direct repeat gene of ACC oxidase, the key enzyme in ethylene synthesis, driven by the CaMV35S promoter mediated by Agrobacterium tumefacien. Hygromycin phosphotransferase (HPT) gene was used as selection marker. Leaf explants were pre-cultured on shoot-inducing medium for 2 d, then immersed in Agrobacterium suspension for 8-12 min. Co-cultivation was carried out on the medium (MS+BA 1.0 mg/L+NAA 0.3 mg/L +Acetosyringone 100 micromol/L, pH 5.8-6.0) for 3 d. After that transformants were obtained by transferring explants to selection medium supplemented with 5 mg/L hygromycin (Hyg) and 400 mg/L cefotaxime (Cef). Southern blotting detection showed that a foreign gene was integrated into the carnation genome and 3 transgenic lines (T257, T299 and T273 line) obtained. Addition of acetosyringone and the time of co-culture were the main factors that influenced transformation frequency. After being transplanted to soil, transgenic plants were grew normally in greenhouse. Ethylene production of cut flower of transgenic T257 line was 95% lower than that of the control, and that of T299 line was reduced by 90% than that of the control, while that of transgenic T273 line has no of significantly different from control. Vase life of transgenic T257 line was 5 d longer than that of the control line at 25 degrees C.



    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy


    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand.



    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy


    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand. PMID:27405119

  3. Cortical Enlargement in Autism is Associated With a Functional VNTR in the Monoamine Oxidase A Gene

    PubMed Central

    Davis, Lea K.; Hazlett, Heather C.; Librant, Amy L.; Nopoulos, Peggy; Sheffield, Val C.; Piven, Joesph; Wassink, Thomas H.


    Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that “low activity” alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the “low activity” allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2–3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the “low activity” allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the “low activity” allele in a separate sample of 114 affected sib pairfamilies. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the “low activity” genotype and the larger brain volumes in our sample. PMID:18361446

  4. Differential expression of two 1-aminocyclopropane-1-carboxylic acid oxidase genes in broccoli after harvest.

    PubMed Central

    Pogson, B J; Downs, C G; Davies, K M


    Broccoli (Brassica oleracea L.) floral tissues rapidly differentiate and grow before harvest and then senesce rapidly after harvest. Associated with this postharvest deterioration is an increase in ethylene production by florets. Two cDNA clones having high nucleotide identity to sequences encoding 1-amino-cyclopropane-1-carboxylic acid (ACC) oxidase were isolated from senescing florets. The cDNAs, ACC Ox1 and ACC Ox2, apparently encode mRNAs from different genes. ACC Ox1 transcripts were found at low levels in whole florets at the time of harvest and increased markedly in abundance after harvest. ACC Ox1 transcript abundance also increased in sepals after harvest and in excised yellowing leaves. Transcripts corresponding to ACC Ox2 were found exclusively within the reproductive structures. These ACC Ox2 transcripts were absent at harvest but started to increase in abundance within 2 h of harvest and then accumulated to high levels. Hormone treatment did not alter the abundance of ACC Ox1 transcripts, whereas ACC Ox2 transcripts increased in abundance after treatment with abscisic acid and propylene. Wounding did not affect the levels of ACC Ox1 or Ox2 transcripts after harvest. At harvest, individual broccoli florets were closed and remained unpollinated. We propose a model whereby the rapid increase in ACC Ox1 and Ox2 transcript abundance after harvest contributes to increased ethylene production by florets. This ethylene may regulate aspects of postharvest senescence, in particular chlorophyll loss. PMID:7610162

  5. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.


    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  6. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central


    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of

  7. Increased Incidence of Mitochondrial Cytochrome C Oxidase 1 Gene Mutations in Patients with Primary Ovarian Insufficiency

    PubMed Central

    Zhen, Xiumei; Wu, Bailin; Wang, Jian; Lu, Cuiling; Gao, Huafang; Qiao, Jie


    Primary ovarian insufficiency (POI), also known as premature ovarian failure (POF), is defined as more than six months of cessation of menses before the age of 40 years, with two serum follicle stimulating hormone (FSH) levels (at least 1 month apart) falling in the menopause range. The cause of POI remains undetermined in the majority of cases, although some studies have reported increased levels of reactive oxygen species (ROS) in idiopathic POF. The role of mitochondrial DNA in the pathogenesis of POI has not been studied extensively. This aim of this study was to uncover underlying mitochondrial genetic defects in patients with POI. The entire region of the mitochondrial genome was amplified in subjects with idiopathic POI (n=63) and age-matched healthy female controls (n=63) using nine pair sets of primers, followed by screening of the mitochondrial genome using an Illumina MiSeq. We identified a total of 96 non-synonymous mitochondrial variations in POI patients and 93 non-synonymous variations in control subjects. Of these, 21 (9 in POI and 12 in control) non-synonymous variations had not been reported previously. Eight mitochondrial cytochrome coxidase 1 (MT-CO1) missense variants were identified in POI patients, whereas only four missense mutations were observed in controls. A high incidence of MT-CO1 missense variants were identified in POI patients compared with controls, and the difference between the groups was statistically significant (13/63 vs. 5/63, p=0.042). Our results show that patients with primary ovarian insufficiency exhibit an increased incidence of mitochondrial cytochrome c oxidase 1 gene mutations, suggesting that MT-CO1 gene mutation may be causal in POI. PMID:26225554

  8. Identification, cloning and expression of Pseudomonas aeruginosa Ps-x putative urate oxidase gene in Escherichia coli.


    Saeed, Hesham M; Abdel-Fattah, Yasser R; Berekaa, Mahmoud M; Gohar, Yousry M; Elbaz, Mohamed A


    In a previous study we reported for the first time the isolation and characterization ofurate oxidase enzyme from Pseudomonas aeruginosa. In this work we isolated and cloned a 1.350 kilobase DNA fragment that encode a putative urate oxidase gene from the genomic library of P. aeruginosa Ps-x. The nucleotide sequence of the cloned DNA insert revealed an open reading frame that encodes a protein of a molecular weight of 54.0 kDa. The cloned DNA fragment showed an uricolytic activity when expressed in E. coli DH5alpha. Surprisingly, the nucleotide sequence of the cloned gene showed more than 99% identity to the gene encoding hypothetical protein of P. aeruginosa PAO1. Moreover, the sequence of the cloned gene was closely similar to the corresponding uricase gene of Cellulomonas flavigena (44% similarity), but showed lower similarity values to that of Bacillus sp. BT-90 (24% similarity), Candida utilis (24% similarity). Interestingly, the isolated uricase gene showed closer similarity to uricase from yeast-like symbiotic fungi Beauveria bassiana (35%), Tolypocladium inflatum (29%), Paecilomyces tenuipes (27%) and Cerataphis fransseni (24%).

  9. The use of mitochondrial cytochrome oxidase I gene (COI) to differentiate two UK blowfly species -- Calliphora vicina and Calliphora vomitoria.


    Ames, Carole; Turner, Bryan; Daniel, Barbara


    Traditionally identification of forensically important insects has been carried out based upon morphological differences between species. However insect evidence found at a crime scene may on occasion be difficult to distinguish by morphological techniques and under these circumstances another method of accurate identification is required. This work utilises a cytochrome oxidase I partial mitochondrial gene region (COI) to distinguish the two of the main UK blowfly species -- Calliphora vicina (Robineau Desvoidy) and Calliphora vomitoria (Linnaeus) (Diptera:Calliphoridae). Seventeen interspecific differences in COI sequence were located. Use of the restriction enzyme SfcI on this gene region provides a simple method for distinguishing between C. vicina and C. vomitoria.

  10. NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis.


    Kwak, June M; Mori, Izumi C; Pei, Zhen-Ming; Leonhardt, Nathalie; Torres, Miguel Angel; Dangl, Jeffery L; Bloom, Rachel E; Bodde, Sara; Jones, Jonathan D G; Schroeder, Julian I


    Reactive oxygen species (ROS) have been proposed to function as second messengers in abscisic acid (ABA) signaling in guard cells. However, the question whether ROS production is indeed required for ABA signal transduction in vivo has not yet been addressed, and the molecular mechanisms mediating ROS production during ABA signaling remain unknown. Here, we report identification of two partially redundant Arabidopsis guard cell-expressed NADPH oxidase catalytic subunit genes, AtrbohD and AtrbohF, in which gene disruption impairs ABA signaling. atrbohD/F double mutations impair ABA-induced stomatal closing, ABA promotion of ROS production, ABA-induced cytosolic Ca(2+) increases and ABA- activation of plasma membrane Ca(2+)-permeable channels in guard cells. Exogenous H(2)O(2) rescues both Ca(2+) channel activation and stomatal closing in atrbohD/F. ABA inhibition of seed germination and root elongation are impaired in atrbohD/F, suggesting more general roles for ROS and NADPH oxidases in ABA signaling. These data provide direct molecular genetic and cell biological evidence that ROS are rate-limiting second messengers in ABA signaling, and that the AtrbohD and AtrbohF NADPH oxidases function in guard cell ABA signal transduction.

  11. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    SciTech Connect

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho


    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  12. Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.

    PubMed Central

    Clary, D O; Wolstenholme, D R


    Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262

  13. The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Trypanosoma brucei mitochrondrial maxi-circle DNA.

    PubMed Central

    Hensgens, L A; Brakenhoff, J; De Vries, B F; Sloof, P; Tromp, M C; Van Boom, J H; Benne, R


    A 9.2 kb segment of the maxi-circle of Trypanosoma brucei mitochondrial DNA contains the genes for cytochrome c oxidase subunits I and II (coxI and coxII) and seven Unassigned Reading Frames ("URFs"). The genes for coxI and coxII display considerable homology at the aminoacid level (38 and 25%, respectively) to the corresponding genes in fungal and mammalian mtDNA, the only striking point of divergence being an unusually high cysteine content (about 4.5%). The reading frame coding for cytochrome c oxidase subunit II is discontinuous: the C-terminal portion of about 40 aminoacids, is present in the DNA-sequence in a -1 reading frame with respect to the N-terminal moiety. URF5, 8 and 10, show a low but distinct homology (about 20%) to mammalian mitochondrial URF-1, 4 and 5, respectively. In URF5, the first AUG is found at codon 145, whereas extensive homology to mammalian URF-1 sequences occurs upstream of this position. The possibility exists that UUG can serve as an initiator codon. URF7 and URF9 have a highly unusual aminoacid composition and do not possess AUG or UUG initiator codons. These URFs probably do not have a protein-coding function. The segment does not contain conventional tRNA genes. Images PMID:6093040

  14. Linking microbial oxidation of arsenic with detection and phylogenetic analysis of arsenite oxidase genes in diverse geothermal environments.


    Hamamura, N; Macur, R E; Korf, S; Ackerman, G; Taylor, W P; Kozubal, M; Reysenbach, A-L; Inskeep, W P


    The identification and characterization of genes involved in the microbial oxidation of arsenite will contribute to our understanding of factors controlling As cycling in natural systems. Towards this goal, we recently characterized the widespread occurrence of aerobic arsenite oxidase genes (aroA-like) from pure-culture bacterial isolates, soils, sediments and geothermal mats, but were unable to detect these genes in all geothermal systems where we have observed microbial arsenite oxidation. Consequently, the objectives of the current study were to measure arsenite-oxidation rates in geochemically diverse thermal habitats in Yellowstone National Park (YNP) ranging in pH from 2.6 to 8, and to identify corresponding 16S rRNA and aroA genotypes associated with these arsenite-oxidizing environments. Geochemical analyses, including measurement of arsenite-oxidation rates within geothermal outflow channels, were combined with 16S rRNA gene and aroA functional gene analysis using newly designed primers to capture previously undescribed aroA-like arsenite oxidase gene diversity. The majority of bacterial 16S rRNA gene sequences found in acidic (pH 2.6-3.6) Fe-oxyhydroxide microbial mats were closely related to Hydrogenobaculum spp. (members of the bacterial order Aquificales), while the predominant sequences from near-neutral (pH 6.2-8) springs were affiliated with other Aquificales including Sulfurihydrogenibium spp., Thermocrinis spp. and Hydrogenobacter spp., as well as members of the Deinococci, Thermodesulfobacteria and beta-Proteobacteria. Modified primers designed around previously characterized and newly identified aroA-like genes successfully amplified new lineages of aroA-like genes associated with members of the Aquificales across all geothermal systems examined. The expression of Aquificales aroA-like genes was also confirmed in situ, and the resultant cDNA sequences were consistent with aroA genotypes identified in the same environments. The aroA sequences

  15. Expression of thiamin biosynthetic genes (thiCOGE) and production of symbiotic terminal oxidase cbb3 in Rhizobium etli.

    PubMed Central

    Miranda-Ríos, J; Morera, C; Taboada, H; Dávalos, A; Encarnación, S; Mora, J; Soberón, M


    In this paper we report the cloning and sequence analysis of four genes, located on plasmid pb, which are involved in the synthesis of thiamin in Rhizobium etli (thiC, thiO, thiG, and thiE). Two precursors, 4-methyl-5-(beta-hydroxyethyl)thiazole monophosphate and 4-amino-5-hydroxymethylpyrimidine pyrophosphate, are coupled to form thiamin monophosphate, which is then phosphorylated to make thiamin pyrophosphate. The first open reading frame (ORF) product, of 610 residues, has significant homology (69% identity) with the product of thiC from Escherichia coli, which is involved in the synthesis of hydroxymethylpyrimidine. The second ORF product, of 327 residues, is the product of a novel gene denoted thiO. A protein motif involved in flavin adenine dinucleotide binding was found in the amino-terminal part of ThiO; also, residues involved in the catalytic site of D-amino acid oxidases are conserved in ThiO, suggesting that it catalyzes the oxidative deamination of some intermediate of thiamin biosynthesis. The third ORF product, of 323 residues, has significant homology (38% identity) with ThiG from E. coli, which is involved in the synthesis of the thiazole. The fourth ORF product, of 204 residues, has significant homology (47% identity) with the product of thiE from E. coli, which is involved in the condensation of hydroxymethylpyrimidine and thiazole. Strain CFN037 is an R. etli mutant induced by a single Tn5mob insertion in the promoter region of the thiCOGE gene cluster. The Tn5mob insertion in CFN037 occurred within a 39-bp region which is highly conserved in all of the thiC promoters analyzed and promotes constitutive expression of thiC. Primer extension analysis showed that thiC transcription in strain CFN037 originates within the Tn5 element. Analysis of c-type protein content and expression of the fixNOQP operon, which codes for the symbiotic terminal oxidase cbb3, revealed that CFN037 produces the cbb3 terminal oxidase. These data show a direct relationship

  16. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells.


    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho


    Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1kd cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1kd cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H2O2) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H2O2 among AOX1kd cells confirmed production of H2O2 in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H2O2.

  17. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    SciTech Connect

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko


    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

  18. Cytochrome oxidase subunit V gene of Neurospora crassa: DNA sequences, chromosomal mapping, and evidence that the cya-4 locus specifies the structural gene for subunit V.

    PubMed Central

    Sachs, M S; Bertrand, H; Metzenberg, R L; RajBhandary, U L


    The sequences of cDNA and genomic DNA clones for Neurospora cytochrome oxidase subunit V show that the protein is synthesized as a 171-amino-acid precursor containing a 27-amino-acid N-terminal extension. The subunit V protein sequence is 34% identical to that of Saccharomyces cerevisiae subunit V; these proteins, as well as the corresponding bovine subunit, subunit IV, contain a single hydrophobic domain which most likely spans the inner mitochondrial membrane. The Neurospora crassa subunit V gene (cox5) contains two introns, 398 and 68 nucleotides long, which share the conserved intron boundaries 5'GTRNGT...CAG3' and the internal consensus sequence ACTRACA. Two short sequences, YGCCAG and YCCGTTY, are repeated four times each in the cox5 gene upstream of the mRNA 5' termini. The cox5 mRNA 5' ends are heterogeneous, with the major mRNA 5' end located 144 to 147 nucleotides upstream from the translational start site. The mRNA contains a 3'-untranslated region of 186 to 187 nucleotides. Using restriction-fragment-length polymorphism, we mapped the cox5 gene to linkage group IIR, close to the arg-5 locus. Since one of the mutations causing cytochrome oxidase deficiency in N. crassa, cya-4-23, also maps there, we transformed the cya-4-23 strain with the wild-type cox5 gene. In contrast to cya-4-23 cells, which grow slowly, cox5 transformants grew quickly, contained cytochrome oxidase, and had 8- to 11-fold-higher levels of subunit V in their mitochondria. These data suggest (i) that the cya-4 locus in N. crassa specifies structural information for cytochrome oxidase subunit V and (ii) that, in N. crassa, as in S. cerevisiae, deficiencies in the production of nuclearly encoded cytochrome oxidase subunits result in deficiency in cytochrome oxidase activity. Finally, we show that the lower levels of subunit V in cya-4-23 cells are most likely due to substantially reduced levels of translatable subunit V mRNA. Images PMID:2540423

  19. Over-expression of polyphenol oxidase gene in strawberry fruit delays the fungus infection process

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenols are secondary metabolites widely present in plants and beneficial to human health. In this study, the changes of polyphenol contents during strawberry fruit development as well as changes of polyphenol oxidase (PPO) was analyzed. The polyphenol content showed declining trend during fruit...

  20. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    PubMed Central

    Buades-Rotger, Macià; Gallardo-Pujol, David


    Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

  1. Transcriptome analysis of PPARγ target genes reveals the involvement of lysyl oxidase in human placental cytotrophoblast invasion.


    Segond, Nadine; Degrelle, Séverine A; Berndt, Sarah; Clouqueur, Elodie; Rouault, Christine; Saubamea, Bruno; Dessen, Philippe; Fong, Keith S K; Csiszar, Katalin; Badet, Josette; Evain-Brion, Danièle; Fournier, Thierry


    Human placental development is characterized by invasion of extravillous cytotrophoblasts (EVCTs) into the uterine wall during the first trimester of pregnancy. Peroxisome proliferator-activated receptor γ (PPARγ) plays a major role in placental development, and activation of PPARγ by its agonists results in inhibition of EVCT invasion in vitro. To identify PPARγ target genes, microarray analysis was performed using GeneChip technology on EVCT primary cultures obtained from first-trimester human placentas. Gene expression was compared in EVCTs treated with the PPARγ agonist rosiglitazone versus control. A total of 139 differentially regulated genes were identified, and changes in the expression of the following 8 genes were confirmed by reverse transcription-quantitative polymerase chain reaction: a disintegrin and metalloproteinase domain12 (ADAM12), connexin 43 (CX43), deleted in liver cancer 1 (DLC1), dipeptidyl peptidase 4 (DPP4), heme oxygenase 1 (HMOX-1), lysyl oxidase (LOX), plasminogen activator inhibitor 1 (PAI-1) and PPARγ. Among the upregulated genes, lysyl oxidase (LOX) was further analyzed. In the LOX family, only LOX, LOXL1 and LOXL2 mRNA expression was significantly upregulated in rosiglitazone-treated EVCTs. RNA and protein expression of the subfamily members LOX, LOXL1 and LOXL2 were analyzed by absolute RT-qPCR and western blotting, and localized by immunohistochemistry and immunofluorescence-confocal microscopy. LOX protein was immunodetected in the EVCT cytoplasm, while LOXL1 was found in the nucleus and nucleolus. No signal was detected for LOXL2 protein. Specific inhibition of LOX activity by β-aminopropionitrile in cell invasion assays led to an increase in EVCT invasiveness. These results suggest that LOX, LOXL1 and LOXL2 are downstream PPARγ targets and that LOX activity is a negative regulator of trophoblastic cell invasion.

  2. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.


    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo


    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. PMID:26784655

  3. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.


    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo


    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses.

  4. The copper-iron connection in biology: Structure of the metallo-oxidase Fet3p

    SciTech Connect

    Taylor, A. B.; Stoj, C. S.; Ziegler, L.; Kosman, D. J.; Hart, P. J.


    Fet3p is a multicopper-containing glycoprotein localized to the yeast plasma membrane that catalyzes the oxidation of Fe(II) to Fe(III). This ferrous iron oxidation is coupled to the reduction of O2 to H2O and is termed the ferroxidase reaction. Fet3p-produced Fe(III) is transferred to the permease Ftr1p for import into the cytosol. The posttranslational insertion of four copper ions into Fet3p is essential for its activity, thus linking copper and iron homeostasis. The mammalian ferroxidases ceruloplasmin and hephaestin are homologs of Fet3p. Loss of the Fe(II) oxidation catalyzed by these proteins results in a spectrum of pathological states, including death. Here, we present the structure of the Fet3p extracellular ferroxidase domain and compare it with that of human ceruloplasmin and other multicopper oxidases that are devoid of ferroxidase activity. The Fet3p structure delineates features that underlie the unique reactivity of this and homologous multicopper oxidases that support the essential trafficking of iron in diverse eukaryotic organisms. The findings are correlated with biochemical and physiological data to cross-validate the elements of Fet3p that define it as both a ferroxidase and cuprous oxidase.

  5. Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder

    SciTech Connect

    Lim, L.C.C.; Sham, P.; Castle, D.


    We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

  6. Exploring Regulation Genes Involved in the Expression of L-Amino Acid Oxidase in Pseudoalteromonas sp. Rf-1

    PubMed Central

    Wang, Ju; Lin, Jianxun; Zhao, Minyan


    Bacterial L-amino acid oxidase (LAAO) is believed to play important biological and ecological roles in marine niches, thus attracting increasing attention to understand the regulation mechanisms underlying its production. In this study, we investigated genes involved in LAAO production in marine bacterium Pseudoalteromonas sp. Rf-1 using transposon mutagenesis. Of more than 4,000 mutants screened, 15 mutants showed significant changes in LAAO activity. Desired transposon insertion was confirmed in 12 mutants, in which disrupted genes and corresponding functionswere identified. Analysis of LAAO activity and lao gene expression revealed that GntR family transcriptional regulator, methylase, non-ribosomal peptide synthetase, TonB-dependent heme-receptor family, Na+/H+ antiporter and related arsenite permease, N-acetyltransferase GCN5, Ketol-acid reductoisomerase and SAM-dependent methytransferase, and their coding genes may be involved in either upregulation or downregulation pathway at transcriptional, posttranscriptional, translational and/or posttranslational level. The nhaD and sdmT genes were separately complemented into the corresponding mutants with abolished LAAO-activity. The complementation of either gene can restore LAAO activity and lao gene expression, demonstrating their regulatory role in LAAO biosynthesis. This study provides, for the first time, insights into the molecular mechanisms regulating LAAO production in Pseudoalteromonas sp. Rf-1, which is important to better understand biological and ecological roles of LAAO. PMID:25815733

  7. Diversity of laccase-coding genes in Fusarium oxysporum genomes.


    Kwiatos, Natalia; Ryngajłło, Małgorzata; Bielecki, Stanisław


    Multiple studies confirm laccase role in fungal pathogenicity and lignocellulose degradation. In spite of broad genomic research, laccases from plant wilt pathogen Fusarium oxysporum are still not characterized. The study aimed to identify F. oxysporum genes that may encode laccases sensu stricto and to characterize the proteins in silico in order to facilitate further research on their impact on the mentioned processes. Twelve sequenced F. oxysporum genomes available on Broad Institute of Harvard and MIT (2015) website were analyzed and three genes that may encode laccases sensu stricto were found. Their amino acid sequences possess all features essential for their catalytic activity, moreover, the homology models proved the characteristic 3D laccase structures. The study shades light on F. oxysporum as a new source of multicopper oxidases, enzymes with possible high redox potential and broad perspective in biotechnological applications.

  8. Environmental factors shaping the abundance and distribution of laccase-encoding bacterial community with potential phenolic oxidase capacity during composting.


    Lu, Lunhui; Zeng, Guangming; Fan, Changzheng; Guo, Jinsong; Zhang, Jiachao; Chen, Ming; Wu, Haipeng; Yuan, Yujie; He, Xiaoxiao; He, Yan


    Increasing molecular evidence points to a wide occurrence of laccase-like multicopper oxidase (LMCO)-encoding genes in bacteria. Most researches mainly focused on the bacterial LMCO diversity, whereas the processes and the environmental factors responsible for structuring bacterial LMCO communities remain relatively unknown in a composting system. Six gene libraries were constructed from samples in representative stages during composting. A total of 185 sequences obtained from sample DNA extracts were classified to 59 operational taxonomic units (OTUs) based on 10 % cutoff. The distribution profile of bacterial LMCO genes showed that proteobacterial- and actinobacterial-associated species were the dominant communities during composting. Pearson correlation analysis indicated that the pile temperature and water-soluble carbon (WSC) content were significantly positively correlated with bacterial LMCO gene OTU numbers, Chao1 and Shannon index, whereas the humic acid (HA)-like carbon content had the most significant effect on the distribution of the bacterial LMCO genes during composting by redundancy analysis. These findings will improve the understanding of the mutual relationship between environmental factors and bacterial LMCO community compositions in composting.

  9. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).


    Clouse, Ronald M; Carraro, Nicola


    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived.

  10. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola


    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  11. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).


    Clouse, Ronald M; Carraro, Nicola


    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  12. [Influence of polymorphism's of endothelial nitric oxide synthase gene and polymorphism of NADPH oxidase gene on development of complications of arterial hypertension].


    Kuznetsova, T Iu; Gavrilov, D V; Dudanov, I P; Makarevich, P I; Balatskiĭ, A V; Samokhodskaia, L M; Parfenova, E V


    The aim of the study was to analyze the prevalence of polymorphism Glu298Asp of endothelial nitric oxide synthase gene and C242T p22 phox polymorphism of NADPH oxidase gene in patients with arterial hypertension (AH) and their influence on AH complications. The study included 272 AH patients, average age 50,7 years. The following analyses were performed: clinical analysis of the blood, general analysis of the urine, lipid spectrum, plasma electrolytes, creatinine, glucose, electrocardiography, echocardioscopy, examination of eye vessels, ultrasound examination of the carotid arteries, determination of microalbuminuria. The polymorphism Glu298Asp of endothelial nitric oxide synthase gene and C242T p22 phox polymorphism of NADPH oxidase gene were detected with two methods: polymerase chain reaction and restrictase reaction. The control group for Glu298Asp polymorphism detection included 102 healthy Russian donors aged 18 to 50 years. Genotypes prevalence in AH patients was as follows: GG 58,8%, GA 32,3%, AA 8,9%, and CC 48,2%, CT 44,9%, TT 6.9%. In the control group: GG 53%, GA 36%, AA 11% and CC 42%, CT 54%, TT 4%. These polymorphisms did not affect the incidence of complications, such as obliterating atherosclerosis of the lower extremity vessels, ischemic heart disease, and acute insufficiency of cerebral circulation, chronic heart failure, left ventricular hypertrophy, microalbuminuria, carotid arteries atherosclerosis. PMID:18429753

  13. Cloning and expression analysis of the ATP-binding cassette transporter gene MFABC1 and the alternative oxidase gene MfAOX1 from Monilinia fructicola.


    Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R


    Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels. PMID:14561072

  14. Engineering the alternative oxidase gene to better understand and counteract mitochondrial defects: state of the art and perspectives

    PubMed Central

    El-Khoury, Riyad; Kemppainen, Kia K; Dufour, Eric; Szibor, Marten; Jacobs, Howard T; Rustin, Pierre


    Mitochondrial disorders are nowadays recognized as impinging on most areas of medicine. They include specific and widespread organ involvement, including both tissue degeneration and tumour formation. Despite the spectacular progresses made in the identification of their underlying molecular basis, effective therapy remains a distant goal. Our still rudimentary understanding of the pathophysiological mechanisms by which these diseases arise constitutes an obstacle to developing any rational treatments. In this context, the idea of using a heterologous gene, encoding a supplemental oxidase otherwise absent from mammals, potentially bypassing the defective portion of the respiratory chain, was proposed more than 10 years ago. The recent progress made in the expression of the alternative oxidase in a wide range of biological systems and disease conditions reveals great potential benefit, considering the broad impact of mitochondrial diseases. This review addresses the state of the art and the perspectives that can be now envisaged by using this strategy. Linked Articles This article is part of a themed issue on Mitochondrial Pharmacology: Energy, Injury & Beyond. To view the other articles in this issue visit PMID:24383965

  15. Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.


    Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong


    As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae.

  16. Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.


    Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong


    As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. PMID:27421668

  17. Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds1

    PubMed Central

    González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.


    The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034

  18. The LOXL2 gene encodes a new lysyl oxidase-like protein and is expressed at high levels in reproductive tissues.


    Jourdan-Le Saux, C; Tronecker, H; Bogic, L; Bryant-Greenwood, G D; Boyd, C D; Csiszar, K


    We have reported in this paper the complete cDNA sequence, gene structure, and tissue-specific expression of LOXL2, a new amine oxidase and a member of an emerging family of human lysyl oxidases. The predicted amino acid sequence, from several overlapping cDNA clones isolated from placenta and spleen cDNA libraries, shared extensive sequence homology with the conserved copper-binding and catalytic domains of both lysyl oxidase (LOX) and the lysyl oxidase-like (LOXL) protein. These conserved domains are encoded by five consecutive exons within the LOX, LOXL, and LOXL2 genes that also maintained exon-intron structure conservation. In contrast, six exons encoding the amino-terminal domains diverged both in sequence and structure. Exon 1 of the LOXL2 gene does not encode a signal sequence that is present in LOX and LOXL, suggesting a different processing and intracellular localization for this new protein. Expression of the LOXL2 gene was detected in almost all tissues with the highest steady state mRNA levels in the reproductive tissues, placenta, uterus and prostate. In situ hybridization identified placental syncytial and cytotrophoblasts responsible for the synthesis of LOXL2 mRNA and demonstrated a spatial and temporal expression pattern unique to the LOXL2 gene.

  19. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).


    Wang, Wei; Liu, Ji-Hong


    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future.

  20. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).


    Wang, Wei; Liu, Ji-Hong


    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. PMID:25445392

  1. Ligand-Bound GeneSwitch Causes Developmental Aberrations in Drosophila that Are Alleviated by the Alternative Oxidase

    PubMed Central

    Andjelković, Ana; Kemppainen, Kia K.; Jacobs, Howard T.


    Culture of Drosophila expressing the steroid-dependent GeneSwitch transcriptional activator under the control of the ubiquitous α-tubulin promoter was found to produce extensive pupal lethality, as well as a range of dysmorphic adult phenotypes, in the presence of high concentrations of the inducing drug RU486. Prominent among these was cleft thorax, seen previously in flies bearing mutant alleles of the nuclear receptor Ultraspiracle and many other mutants, as well as notched wings, leg malformations, and bristle abnormalities. Neither the α-tubulin-GeneSwitch driver nor the inducing drug on their own produced any of these effects. A second GeneSwitch driver, under the control of the daughterless promoter, which gave much lower and more tissue-restricted transgene expression, exhibited only mild bristle abnormalities in the presence of high levels of RU486. Coexpression of the alternative oxidase (AOX) from Ciona intestinalis produced a substantial shift in the developmental outcome toward a wild-type phenotype, which was dependent on the AOX expression level. Neither an enzymatically inactivated variant of AOX, nor GFP, or the alternative NADH dehydrogenase Ndi1 from yeast gave any such rescue. Users of the GeneSwitch system should be aware of the potential confounding effects of its application in developmental studies. PMID:27412986

  2. Ligand-Bound GeneSwitch Causes Developmental Aberrations in Drosophila that Are Alleviated by the Alternative Oxidase.


    Andjelković, Ana; Kemppainen, Kia K; Jacobs, Howard T


    Culture of Drosophila expressing the steroid-dependent GeneSwitch transcriptional activator under the control of the ubiquitous α-tubulin promoter was found to produce extensive pupal lethality, as well as a range of dysmorphic adult phenotypes, in the presence of high concentrations of the inducing drug RU486. Prominent among these was cleft thorax, seen previously in flies bearing mutant alleles of the nuclear receptor Ultraspiracle and many other mutants, as well as notched wings, leg malformations, and bristle abnormalities. Neither the α-tubulin-GeneSwitch driver nor the inducing drug on their own produced any of these effects. A second GeneSwitch driver, under the control of the daughterless promoter, which gave much lower and more tissue-restricted transgene expression, exhibited only mild bristle abnormalities in the presence of high levels of RU486. Coexpression of the alternative oxidase (AOX) from Ciona intestinalis produced a substantial shift in the developmental outcome toward a wild-type phenotype, which was dependent on the AOX expression level. Neither an enzymatically inactivated variant of AOX, nor GFP, or the alternative NADH dehydrogenase Ndi1 from yeast gave any such rescue. Users of the GeneSwitch system should be aware of the potential confounding effects of its application in developmental studies. PMID:27412986

  3. NADPH oxidase complex and IBD candidate gene studies: identification of a rare variant in NCF2 that results in reduced binding to RAC2

    PubMed Central

    Muise, Aleixo M; Xu, Wei; Guo, Cong-Hui; Walters, Thomas D; Wolters, Victorien M; Fattouh, Ramzi; Lam, Grace Y; Hu, Pingzhao; Murchie, Ryan; Sherlock, Mary; Gana, Juan Cristóbal; Russell, Richard K; Glogauer, Michael; Duerr, Richard H; Cho, Judy H; Lees, Charlie W; Satsangi, Jack; Wilson, David C; Paterson, Andrew D; Griffiths, Anne M; Silverberg, Mark S; Brumell, John H


    Objective The NOX2 NADPH oxidase complex produces reactive oxygen species and plays a critical role in the killing of microbes by phagocytes. Genetic mutations in genes encoding components of the complex result in both X-linked and autosomal recessive forms of chronic granulomatous disease (CGD). Patients with CGD often develop intestinal inflammation that is histologically similar to Crohn's colitis, suggesting a common aetiology for both diseases. The aim of this study is to determine if polymorphisms in NOX2 NADPH oxidase complex genes that do not cause CGD are associated with the development of inflammatory bowel disease (IBD). Methods Direct sequencing and candidate gene approaches were used to identify susceptibility loci in NADPH oxidase complex genes. Functional studies were carried out on identified variants. Novel findings were replicated in independent cohorts. Results Sequence analysis identified a novel missense variant in the neutrophil cytosolic factor 2 (NCF2) gene that is associated with very early onset IBD (VEO-IBD) and subsequently found in 4% of patients with VEO-IBD compared with 0.2% of controls (p=1.3×10−5, OR 23.8 (95% CI 3.9 to 142.5); Fisher exact test). This variant reduced binding of the NCF2 gene product p67phox to RAC2. This study found a novel genetic association of RAC2 with Crohn's disease (CD) and replicated the previously reported association of NCF4 with ileal CD. Conclusion These studies suggest that the rare novel p67phox variant results in partial inhibition of oxidase function and are associated with CD in a subgroup of patients with VEO-IBD; and suggest that components of the NADPH oxidase complex are associated with CD. PMID:21900546

  4. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central


    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

  5. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.


    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto


    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  6. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.


    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto


    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  7. Expression of a Streptomyces 3-hydroxysteroid oxidase gene in oilseeds for converting phytosterols to phytostanols.


    Venkatramesh, Mylavarapu; Karunanandaa, Balasulojini; Sun, Bin; Gunter, Catharine A; Boddupalli, Sekhar; Kishore, Ganesh M


    Plant sterols and their hydrogenated forms, stanols, have attracted much attention because of their benefits to human health in reducing serum and LDL cholesterol levels, with vegetable oil processing being their major source in several food products currently sold. The predominant forms of plant sterol end products are sitosterol, stigmasterol, campesterol and brassicasterol (in brassica). In this study, 3-hydroxysteroid oxidase from Streptomyces hygroscopicus was utilized to engineer oilseeds from rapeseed (Brassica napus) and soybean (Glycine max), respectively, to modify the relative amounts of specific sterols to stanols. Each of the major phytosterols had its C-5 double bond selectively reduced to the corresponding phytostanol without affecting other functionalities, such as the C-22 double bond of stigmasterol in soybean seed and of brassicasterol in rapeseed. Additionally, several novel phytostanols were obtained that are not produced by chemical hydrogenation of phytosterols normally present in plants.

  8. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.


    Zhou, Yuchan; Underhill, Steven J R


    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit.

  9. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.


    Zhou, Yuchan; Underhill, Steven J R


    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. PMID:26646240

  10. The genetic basis of "Scarsdale Gourmet Diet" variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.


    Frank, J; Poh-Fitzpatrick, M B; King, L E; Christiano, A M


    The porphyrias are disorders of porphyrin or porphyrin-precursor metabolism that result from inherited or acquired aberrations in the control of the porphyrin-heme biosynthetic pathway. Variegate porphyria (VP), one of the acute hepatic porphyrias, is characterized by a partial reduction in the activity of protoporphyrinogen oxidase (PPO), and recently, mutations in the PPO gene on chromosome 1q22-23 have been described. Our purpose was to identify the underlying genetic lesion in a severely affected patient with VP and to detect the silent mutation carriers in her family. The disease in this patient was precipitated by carbohydrate restriction as outlined in the "Scarsdale Gourmet Diet". Our mutation detection and confirmation strategy included PCR, automated sequencing, and restriction enzyme digestion. We identified a missense mutation in the patient and five family members. The mutation consisted of a previously unreported C-to-T transition in exon 5 of the PPO gene, resulting in the substitution of arginine by cysteine, designated R152C. This arginine residue is evolutionarily highly conserved in humans, mice, bacteria, yeast, and plants, indicating the importance of this residue in PPO. Our study established that a missense mutation in the PPO gene was the underlying mutation in this patient with VP and explained the occurrence of the phenotype in this family.

  11. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.


    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M


    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia. PMID:27269511

  12. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.


    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M


    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

  13. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells*

    PubMed Central

    ZONG, Wen; JIANG, Yan; ZHAO, Jing; ZHANG, Jian; GAO, Jian-gang


    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  14. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells.


    Zong, Wen; Jiang, Yan; Zhao, Jing; Zhang, Jian; Gao, Jian-gang


    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  15. Genetic characterization of Bagarius species using cytochrome c oxidase I and cytochrome b genes.


    Nagarajan, Muniyandi; Raja, Manikam; Vikram, Potnuru


    In this study, we first inferred the genetic variability of two Bagarius bagarius populations collected from Ganges and Brahmaputra rivers of India using two mtDNA markers. Sequence analysis of COI gene did not show significant differences between two populations whereas cytochrome b gene showed significant differences between two populations. Followed by, genetic relationship of B. bagarius and B. yarrielli was analyzed using COI and cytochrome b gene and the results showed a higher level genetic variation between two species. The present study provides support for the suitability of COI and cytochrome b genes for the identification of B. bagarius and B. yarrielli.

  16. Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans

    PubMed Central

    Dlugos, Andrea M.; Palmer, Abraham A.


    Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression. PMID:19657584

  17. Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans.


    Dlugos, Andrea M; Palmer, Abraham A; de Wit, Harriet


    Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression.

  18. Cloning of a human gene involved in cytochrome oxidase assembly by functional complementation of an oxa1- mutation in Saccharomyces cerevisiae.

    PubMed Central

    Bonnefoy, N; Kermorgant, M; Groudinsky, O; Minet, M; Slonimski, P P; Dujardin, G


    The yeast nuclear gene OXA1 is essential for cytochrome oxidase assembly, so that a null mutation in the OXA1 gene leads to complete respiratory deficiency. We have cloned by genetic selection a human OXA1 (OXA1Hs) cDNA that complements the respiratory defect of yeast oxa1 mutants. The deduced sequence of the human protein shares 33% identity with the yeast OXA1 protein. The OXA1Hs cDNA corresponds to a single and relatively highly expressed gene. Oxygen consumption measurements and cytochrome absorption spectra show that replacement of the yeast protein with the human homolog leads to the correct assembly of cytochrome oxidase, suggesting that the proteins play essentially the same role in both organisms. Images PMID:7991568

  19. The NADPH Oxidase Subunit NOX4 Is a New Target Gene of the Hypoxia-inducible Factor-1

    PubMed Central

    Diebold, Isabel; Petry, Andreas; Hess, John


    NADPH oxidases are important sources of reactive oxygen species (ROS), possibly contributing to various disorders associated with enhanced proliferation. NOX4 appears to be involved in vascular signaling and may contribute to the response to hypoxia. However, the exact mechanisms controlling NOX4 levels under hypoxia are not resolved. We found that hypoxia rapidly enhanced NOX4 mRNA and protein levels in pulmonary artery smooth-muscle cells (PASMCs) as well as in pulmonary vessels from mice exposed to hypoxia. This response was dependent on the hypoxia-inducible transcription factor HIF-1α because overexpression of HIF-1α increased NOX4 expression, whereas HIF-1α depletion prevented this response. Mutation of a putative hypoxia-responsive element in the NOX4 promoter abolished hypoxic and HIF-1α–induced activation of the NOX4 promoter. Chromatin immunoprecipitation confirmed HIF-1α binding to the NOX4 gene. Induction of NOX4 by HIF-1α contributed to maintain ROS levels after hypoxia and hypoxia-induced proliferation of PASMCs. These findings show that NOX4 is a new target gene of HIF-1α involved in the response to hypoxia. Together with our previous findings that NOX4 mediates HIF-1α induction under normoxia, these data suggest an important role of the signaling axis between NOX4 and HIF-1α in various cardiovascular disorders under hypoxic and also nonhypoxic conditions. PMID:20427574

  20. [Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test].


    Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo


    Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P < 0.01). With GLM analysis of SAS software, association analysis was conducted between MAOB gene polymorphisms and locomotion and vocalization behavior parameters in the open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P < 0.01 or P < 0.05) and were associated with the times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P < 0.05) and the times of posture change and standing up against walls were also higher than those in CC (P < 0.05). In addition, lying time in CC genotype puppies were higher than that in TT (P < 0.05). MAOB had a positive effect on walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P < 0.01 or P < 0.05). Our results imply that MAOB gene significantly affects the excitability, activity and exploration behavior of puppies in open-field test and TT genotype has favorable effects in these behavior traits.

  1. Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits

    PubMed Central

    Hwu, Hai-Gwo; Fann, Cathy Shen-Jang; Yang, Ueng-Cheng; Yang, Wei-Chih; Hsu, Pei-Chun; Chang, Chien-Ching; Wen, Chun-Chiang; Tsai-Wu, Jyy-Jih; Hwang, Tzung-Jeng; Hsieh, Ming H.; Liu, Chen-Chung; Chien, Yi-Ling; Fang, Chiu-Ping; Faraone, Stephen V.; Tsuang, Ming T.; Chen, Wei J.; Liu, Chih-Min


    D-amino acid oxidase (DAO) has been reported to be associated with schizophrenia. This study aimed to search for genetic variants associated with this gene. The genomic regions of all exons, highly conserved regions of introns, and promoters of this gene were sequenced. Potentially meaningful single-nucleotide polymorphisms (SNPs) obtained from direct sequencing were selected for genotyping in 600 controls and 912 patients with schizophrenia and in a replicated sample consisting of 388 patients with schizophrenia. Genetic associations were examined using single-locus and haplotype association analyses. In single-locus analyses, the frequency of the C allele of a novel SNP rs55944529 located at intron 8 was found to be significantly higher in the original large patient sample (p = 0.016). This allele was associated with a higher level of DAO mRNA expression in the Epstein-Barr virus-transformed lymphocytes. The haplotype distribution of a haplotype block composed of rs11114083-rs2070586-rs2070587-rs55944529 across intron 1 and intron 8 was significantly different between the patients and controls and the haplotype frequencies of AAGC were significantly higher in patients, in both the original (corrected p < 0.0001) and replicated samples (corrected p = 0.0003). The CGTC haplotype was specifically associated with the subgroup with deficits in sustained attention and executive function and the AAGC haplotype was associated with the subgroup without such deficits. The DAO gene was a susceptibility gene for schizophrenia and the genomic region between intron 1 and intron 8 may harbor functional genetic variants, which may influence the mRNA expression of DAO and neurocognitive functions in schizophrenia. PMID:26986737

  2. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.


    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai


    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

  3. NAD(P)H oxidase p22phox gene C242T polymorphism, nitric oxide production, salt sensitivity and cardiovascular risk factors in Hispanics.


    Castejon, A M; Bracero, J; Hoffmann, I S; Alfieri, A B; Cubeddu, L X


    Mutations in the NAD(P)H oxidase gene may be associated with abnormal superoxide generation, nitric oxide (NO) availability and cardiovascular diseases. We investigated the prevalence of the NAD(P)H oxidase p22phox gene C242T polymorphism, and its possible association with blood pressure, NO production, salt sensitivity and cardiovascular risk factors in Hispanics. Genotype frequencies were as follows: CC, 52.9%; CT, 40.3%; and TT, 6.8%. There were no significant differences in systolic blood pressure, diastolic blood pressure, age, weight, fasting and post-load glucose levels, LDL and HDL cholesterol, triglyceride and urinary albumin levels in subjects with CC, CT or the TT genotypes. Presence of the T allele was associated with increased salt sensitivity in women, but not in men. NO metabolite excretion was markedly decreased both in women and men with the TT genotype (CC: 868+/-79 micromol/day; CT: 839+/-75 micromol/day; TT: 534+/-78 micromol/day; P<0.05). In conclusion, the prevalence of the NAD(P)H oxidase p22phox gene C242T polymorphism in Venezuelans was comparable to that of Caucasians, but different from that of Chinese and Japanese. Although the T allele was not associated with cardiovascular risk factors, hyperinsulinaemia or hypertension, in women, it appeared to be a genetic susceptibility factor for salt sensitivity. Both in women and men, the p22phox gene may play a role in the genetic control of NO levels.

  4. Finding New Enzymes from Bacterial Physiology: A Successful Approach Illustrated by the Detection of Novel Oxidases in Marinomonas mediterranea

    PubMed Central

    Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elío, Patricia


    The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid l-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for l-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (, has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113

  5. NADPH Oxidase-derived Reactive Oxygen Species Increases Expression of Monocyte Chemotactic Factor Genes in Cultured Adipocytes*

    PubMed Central

    Han, Chang Yeop; Umemoto, Tomio; Omer, Mohamed; Den Hartigh, Laura J.; Chiba, Tsuyoshi; LeBoeuf, Renee; Buller, Carolyn L.; Sweet, Ian R.; Pennathur, Subramaniam; Abel, E. Dale; Chait, Alan


    Excess glucose and free fatty acids delivered to adipose tissue causes local inflammation, which contributes to insulin resistance. Glucose and palmitate generate reactive oxygen species (ROS) in adipocytes, leading to monocyte chemotactic factor gene expression. Docosahexaenoate (DHA) has the opposite effect. In this study, we evaluated the potential sources of ROS in the presence of excess nutrients. Differentiated 3T3-L1 adipocytes were exposed to palmitate and DHA (250 μm) in either 5 or 25 mm glucose to evaluate the relative roles of mitochondrial electron transport and NADPH oxidases (NOX) as sources of ROS. Excess glucose and palmitate did not increase mitochondrial oxidative phosphorylation. However, glucose exposure increased glycolysis. Of the NOX family members, only NOX4 was expressed in adipocytes. Moreover, its activity was increased by excess glucose and palmitate and decreased by DHA. Silencing NOX4 inhibited palmitate- and glucose-stimulated ROS generation and monocyte chemotactic factor gene expression. NADPH, a substrate for NOX, and pentose phosphate pathway activity increased with glucose but not palmitate and decreased with DHA exposure. Inhibition of the pentose phosphate pathway by glucose-6-phosphate dehydrogenase inhibitors and siRNA suppressed ROS generation and monocyte chemotactic factor gene expression induced by both glucose and palmitate. Finally, both high glucose and palmitate induced NOX4 translocation into lipid rafts, effects that were blocked by DHA. Excess glucose and palmitate generate ROS via NOX4 rather than by mitochondrial oxidation in cultured adipocytes. NOX4 is regulated by both NADPH generated in the PPP and translocation of NOX4 into lipid rafts, leading to expression of monocyte chemotactic factors. PMID:22287546

  6. Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression.


    Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra


    Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms.

  7. Population genetic structure of Gasterophilus pecorum in the Kalamaili Nature Reserve, Xinjiang, based on mitochondrial cytochrome oxidase (COI) gene sequence.


    Wang, W; Zhang, D; Hu, D; Chu, H; Cao, J; Ente, M; Jiang, G; Li, K


    Gasterophilosis is a significant threat to equids in the desert steppe of Xinjiang, China, where Gasterophilus pecorum (Fabricius) (Diptera: Gasterophilidae) is the dominant botfly species. A population analysis was conducted on 195 individual G. pecorum larvae from three host species, Przewalski's horse, the domestic horse and the Asiatic wild ass. The distribution of haplotypes of the maternally inherited mitochondrial cytochrome oxidase subunit I (COI) gene was analysed to assess the population differentiation of G. pecorum. High haplotype diversity was observed among G. pecorum populations from all host species, indicating that the G. pecorum infecting one host had multiple maternal ancestors. A phylogenetic tree showed six clades, suggesting a high degree of genetic differentiation. A constructed haplotype network described both the origin of the haplotypes and the population structure. The findings indicated that G. pecorum infections within Przewalski's horses were mainly transmitted from Asiatic wild asses. Clade 1 was found to be the most primitive group and to have evolved to be highly adaptable to the desert steppe. Clade 2 originated from Clade 1, potentially as a result of the annual migration of domestic horses. Revealing the differentiation of the G. pecorum population is important for elucidating the aetiology of Gasterophilus infection in Xinjiang and for planning appropriate control measures.

  8. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase.


    Velada, Isabel; Cardoso, Hélia G; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit


    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  9. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase

    PubMed Central

    Velada, Isabel; Cardoso, Hélia G.; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit


    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  10. Functional Restoration of gp91phox-Oxidase Activity by BAC Transgenesis and Gene Targeting in X-linked Chronic Granulomatous Disease iPSCs

    PubMed Central

    Laugsch, Magdalena; Rostovskaya, Maria; Velychko, Sergiy; Richter, Cornelia; Zimmer, Ariane; Klink, Barbara; Schröck, Evelin; Haase, Michael; Neumann, Katrin; Thieme, Sebastian; Roesler, Joachim; Brenner, Sebastian; Anastassiadis, Konstantinos


    Chronic granulomatous disease (CGD) is an inherited immunodeficiency, caused by the inability of neutrophils to produce functional NADPH oxidase required for fighting microbial infections. The X-linked form of CGD (X-CGD), which is due to mutations in the CYBB (gp91phox) gene, a component of NADPH oxidase, accounts for about two-thirds of CGD cases. We derived induced pluripotent stem cells (iPSCs) from X-CGD patient keratinocytes using a Flp recombinase excisable lentiviral reprogramming vector. For restoring gp91phox function, we applied two strategies: transposon-mediated bacterial artificial chromosome (BAC) transgenesis and gene targeting using vectors with a fixed 5′ homology arm (HA) of 8 kb and 3′HA varying in size from 30 to 80 kb. High efficiency of homologous recombination (up to 22%) was observed with increased size of the 3′HA. Both, BAC transgenesis and gene targeting resulted in functional restoration of the gp91phox measured by an oxidase activity assay in X-CGD iPSCs differentiated into the myeloid lineage. In conclusion, we delivered an important milestone towards the use of genetically corrected autologous cells for the treatment of X-CGD and monogenic diseases in general. PMID:26316390

  11. Coptotermes gestroi (Isoptera: Rhinotermitidae) in Brazil: possible origins inferred by mitochondrial cytochrome oxidase II gene sequences.


    Martins, C; Fontes, L R; Bueno, O C; Martins, V G


    The Asian subterranean termite, Coptotermes gestroi, originally from northeast India through Burma, Thailand, Malaysia, and the Indonesian archipelago, is a major termite pest introduced in several countries around the world, including Brazil. We sequenced the mitochondrial COII gene from individuals representing 23 populations. Phylogenetic analysis of COII gene sequences from this and other studies resulted in two main groups: (1) populations of Cleveland (USA) and four populations of Malaysia and (2) populations of Brazil, four populations of Malaysia, and one population from each of Thailand, Puerto Rico, and Key West (USA). Three new localities are reported here, considerably enlarging the distribution of C. gestroi in Brazil: Campo Grande (state of Mato Grosso do Sul), Itajaí (state of Santa Catarina), and Porto Alegre (state of Rio Grande do Sul).

  12. No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

    SciTech Connect

    Craddock, N.; Daniels, J.; Roberts, E.


    We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

  13. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.


    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M


    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

  14. Regulation of gibberellin 20-oxidase gene expression and gibberellin content in citrus by temperature and citrus exocortis viroid.


    Vidal, Ana M; Ben-Cheikh, Waddi; Talón, Manuel; García-Martínez, José L


    A cDNA clone coding for a gibberellin (GA) 20-oxidase ( CcGA20ox1), an enzyme of GA biosynthesis, which when expressed in vitro catalyzed the conversion of GA(12) to GA(9) and of GA(53) to GA(20), was isolated from the citrus hybrid Carrizo citrange (C itrus sinensis x Poncirus trifoliata). Transcripts of CcGA20ox1 were abundant in the apex and leaves and much less abundant in internodes, nodes and roots. Seedlings of Carrizo citrange cultured under a 32 degrees C/27 degrees C (day/night) regime elongated more than seedlings growing under 17 degrees C/12 degrees C conditions. The effect of higher temperature was associated with more CcGA20ox1 transcripts and with higher content of GA(1), the main active GA in citrus, in the shoot. The infection of Etrog citron ( Citrus medica) plants with citrus exocortis viroid (CEVd), which produces a stunted phenotype, reduced the levels of transcripts in the apical shoot hybridizing to the gene CcGA20ox1 of Carrizo citrange and the content of GA(1). Thus GA(1) content correlated with CcGA20ox1 transcript levels. In contrast, results for gibberellic acid (GA(3)) and paclobutrazol applications to Carrizo citrange showed that CcGA20ox1 expression was subject to feed-back regulation. These observations indicate that the feed-back regulation of GA20ox operates mostly when the levels of active GAs have been dramatically altered. The results also show that the growth reduction induced by environmental (temperature) and biotic (CEVd) factors may be partially due to the modulation of the expression of GA20ox genes.

  15. Lysyl oxidase is a tumor suppressor gene inactivated by methylation and loss of heterozygosity in human gastric cancers.


    Kaneda, Atsushi; Wakazono, Kuniko; Tsukamoto, Tetsuya; Watanabe, Naoko; Yagi, Yukiko; Tatematsu, Masae; Kaminishi, Michio; Sugimura, Takashi; Ushijima, Toshikazu


    Lysyl oxidase (LOX) and HRAS-like suppressor (HRASLS) are silenced in human gastric cancers and are reported to have growth-suppressive activities in ras-transformed mouse/rat fibroblasts. Here, we analyzed whether or not LOX and HRASLS are tumor suppressor genes in human gastric cancers. Loss of heterozygosity and promoter methylation of LOX were detected in 33% (9 of 27) and 27% (26 of 96) of gastric cancers, respectively. Biallelic methylation and loss of heterozygosity with promoter methylation were also demonstrated in gastric cancers. Silencing of LOX was also observed in colon, lung, and ovarian cancer cell lines. As for mutations, only one possible somatic mutation was found by analysis of 96 gastric cancer samples and 58 gastric and other cancer cell lines. When LOX was introduced into a gastric cancer cell line, MKN28, in which LOX and HRASLS were silenced, it reduced the number of anchorage-dependent colonies to 57 to 61%, and the number of anchorage-independent colonies to 11 to 23%. Sizes of tumors formed in nude mice were reduced to 19 to 26%. Growth suppression in soft agar assay was also observed in another gastric cancer cell line, KATOIII. On the other hand, neither loss of heterozygosity nor a somatic mutation was detected in HRASLS, and its introduction into MKN28 did not suppress the growth in vitro or in vivo. These data showed that LOX is a tumor suppressor gene inactivated by methylation and loss of heterozygosity in gastric cancers, and possibly also in other cancers. PMID:15374948

  16. Prolonged production of NADPH oxidase-corrected granulocytes after gene therapy of chronic granulomatous disease

    PubMed Central

    Malech, Harry L.; Maples, Phillip B.; Whiting-Theobald, Narda; Linton, Gilda F.; Sekhsaria, Sudhir; Vowells, Sarah J.; Li, Fei; Miller, Judi A.; DeCarlo, Ellen; Holland, Steven M.; Leitman, Susan F.; Carter, Charles S.; Butz, Robert E.; Read, Elizabeth J.; Fleisher, Thomas A.; Schneiderman, Richard D.; Van Epps, Dennis E.; Spratt, S. Kaye; Maack, Christopher A.; Rokovich, Joseph A.; Cohen, Lawrence K.; Gallin, John I.


    Little is known about the potential for engraftment of autologous hematopoietic stem cells in human adults not subjected to myeloablative conditioning regimens. Five adult patients with the p47phox deficiency form of chronic granulomatous disease received intravenous infusions of autologous CD34+ peripheral blood stem cells (PBSCs) that had been transduced ex vivo with a recombinant retrovirus encoding normal p47phox. Although marrow conditioning was not given, functionally corrected granulocytes were detectable in peripheral blood of all five patients. Peak correction occurred 3–6 weeks after infusion and ranged from 0.004 to 0.05% of total peripheral blood granulocytes. Corrected cells were detectable for as long as 6 months after infusion in some individuals. Thus, prolonged engraftment of autologous PBSCs and continued expression of the transduced gene can occur in adults without conditioning. This trial also piloted the use of animal protein-free medium and a blood-bank-compatible closed system of gas-permeable plastic containers for culture and transduction of the PBSCs. These features enhance the safety of PBSCs directed gene therapy. PMID:9342375

  17. Gibberellin 3-oxidase gene expression patterns influence gibberellin biosynthesis, growth, and development in pea.


    Reinecke, Dennis M; Wickramarathna, Aruna D; Ozga, Jocelyn A; Kurepin, Leonid V; Jin, Alena L; Good, Allen G; Pharis, Richard P


    Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3β-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth.

  18. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )


    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  19. CYP99A3: Functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice

    PubMed Central

    Wang, Qiang; Hillwig, Matthew L.; Peters, Reuben J.


    SUMMARY Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochromes P450 mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNAi double knock-down of this pair of closely related CYP reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which ultimately was achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that, while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-γ-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  20. Human retina-specific amine oxidase: genomic structure of the gene (AOC2), alternatively spliced variant, and mRNA expression in retina.


    Imamura, Y; Noda, S; Mashima, Y; Kudoh, J; Oguchi, Y; Shimizu, N


    Previously, we reported the isolation of cDNA for human retina-specific amine oxidase (RAO) and the expression of RAO exclusively in retina. Bacterial artificial chromosome clones containing the human RAO gene (AOC2) were mapped to human chromosome 17q21 (Imamura et al., 1997, Genomics 40: 277-283). Here, we report the complete genomic structure of the RAO gene, including 5' flanking sequence, and mRNA expression in retina. The human RAO gene spans 6 kb and is composed of four exons corresponding to the amino acid sequence 1-530, 530-598, 598-641, and 642-729 separated by three introns of 3000, 310, and 351 bp. Screening of a human retina cDNA library revealed the existence of an alternatively spliced cDNA variant with an additional 81 bp at the end of exon 2. The sizes of exons and the locations of exon/intron boundaries in the human RAO gene showed remarkable similarity to those of the human kidney diamine oxidase gene (AOC1). In situ hybridization revealed that mRNA coding for RAO is expressed preferentially in the ganglion cell layer of the mouse retina. We designed four sets of PCR primers to amplify four exons, which will be valuable for analyzing mutations in patients with ocular diseases affecting the retinal ganglion cell layer.

  1. Systematic screening of lysyl oxidase-like (LOXL) family genes demonstrates that LOXL2 is a susceptibility gene to intracranial aneurysms.


    Akagawa, Hiroyuki; Narita, Akira; Yamada, Haruhiko; Tajima, Atsushi; Krischek, Boris; Kasuya, Hidetoshi; Hori, Tomokatsu; Kubota, Motoo; Saeki, Naokatsu; Hata, Akira; Mizutani, Tohru; Inoue, Ituro


    Four lysyl oxidase family genes (LOXL1, LOXL2, LOXL3, and LOXL4), which catalyze cross-linking of collagen and elastin, were considered to be functional candidates for intracranial aneurysms (IA) and were extensively screened for genetic susceptibility in Japanese IA patients. Total RNA was isolated from four paired ruptured IA and superficial temporal artery (STA) tissue and examined by real-time RT-PCR. The expression of LOXL2 in the paired IA and STA tissues was elevated in the IA tissue. A total of 55 single nucleotide polymorphisms (SNPs) of LOXL1-4 were genotyped for an allelic association study in 402 Japanese IA patients and 462 Japanese non-IA controls. Allelic associations were evaluated with the chi-square test and the permutation test especially designed for adjustment of multiple testing. SNPs of LOXL1 and LOXL4 were not significantly associated with IA, while several SNPs of LOXL2 and LOXL3 showed nominally significant associations in IA patients. We detected an empirically significant association with one SNP of LOXL2 in familial IA patients after adjustment for multiple testing [chi(2) = 10.23, empirical P = 0.023, OR (95% CI) = 1.49 (1.17, 1.90)]. Furthermore, multilocus interaction was evaluated by multifactor dimensionality reduction analysis. We found that the SNPs of LOXL2 have an interactive effect with elastin (ELN) and LIM kinase 1 (LIMK1) that have been previously found to be associated with IA. In conclusion, one SNP of LOXL2 showed a significant association with IA individually, and we also detected a gene-gene interaction of LOXL2 with ELN/LIMK1, which may play an important role in susceptibility to IA.

  2. RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.


    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini


    The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

  3. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

    PubMed Central

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.


    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

  4. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).


    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K


    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

  5. Cloning and expression analysis of litchi (Litchi Chinensis Sonn.) polyphenol oxidase gene and relationship with postharvest pericarp browning.


    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua


    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit.

  6. Cloning and Expression Analysis of Litchi (Litchi Chinensis Sonn.) Polyphenol Oxidase Gene and Relationship with Postharvest Pericarp Browning

    PubMed Central

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua


    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  7. Cloning and expression analysis of litchi (Litchi Chinensis Sonn.) polyphenol oxidase gene and relationship with postharvest pericarp browning.


    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua


    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  8. Phenolic profiles and polyphenol oxidase (PPO) gene expression of red clover (Trifolium pratense) selected for decreased postharvest browning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Red clover (Trifolium pratense L.) is a legume forage abundant in phenolic compounds. It tends to brown when cut for hay, due to oxidation of phenolic compounds catalyzed by polyphenol oxidase (PPO), and subsequent binding to proteins. Selecting for a greener hay may provide information about the re...

  9. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.


    Sell, Simone; Hehl, Reinhard


    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  10. Phylogenetic position of Indian termites (Isoptera: Termitidae) with their respective genera inferred from DNA sequence analysis of the mitochondrial cytochrome oxidase gene subunit I compared to subunit II.


    Sharma, Vijay Lakshmi; Singla, Mandakini; Sobti, Ranbir Chander


    The present work was aimed to investigate the phylogenetic analysis of different species of Indian termites belonging to the family termitidae based on mitochondrial genes COI and COII. The sequences so obtained from public database revealed grouping of termites according to their ecological distribution. The sequences of the species under investigation were characterized on the basis of frequencies of nucleotide bases and in most of the species, a significantly high percentage of A+T base composition was observed. Phylogenetic tree revealed positioning of species according to the analysis of their cytochrome oxidase subunits.

  11. Rice oxalate oxidase gene driven by green tissue-specific promoter increases tolerance to sheath blight pathogen (Rhizoctonia solani) in transgenic rice.


    Molla, Kutubuddin A; Karmakar, Subhasis; Chanda, Palas K; Ghosh, Satabdi; Sarkar, Sailendra N; Datta, Swapan K; Datta, Karabi


    Rice sheath blight, caused by the necrotrophic fungus Rhizoctonia solani, is one of the most devastating and intractable diseases of rice, leading to a significant reduction in rice productivity worldwide. In this article, in order to examine sheath blight resistance, we report the generation of transgenic rice lines overexpressing the rice oxalate oxidase 4 (Osoxo4) gene in a green tissue-specific manner which breaks down oxalic acid (OA), the pathogenesis factor secreted by R. solani. Transgenic plants showed higher enzyme activity of oxalate oxidase (OxO) than nontransgenic control plants, which was visualized by histochemical assays and sodium dodecylsulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Transgenic rice leaves were more tolerant than control rice leaves to exogenous OA. Transgenic plants showed a higher level of expression of other defence-related genes in response to pathogen infection. More importantly, transgenic plants exhibited significantly enhanced durable resistance to R. solani. The overexpression of Osoxo4 in rice did not show any detrimental phenotypic or agronomic effect. Our findings indicate that rice OxO can be utilized effectively in plant genetic manipulation for sheath blight resistance, and possibly for resistance to other diseases caused by necrotrophic fungi, especially those that secrete OA. This is the first report of the expression of defence genes in rice in a green tissue-specific manner for sheath blight resistance.

  12. Study on dioxygen reduction by mutational modifications of the hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase

    SciTech Connect

    Morishita, Hirotoshi; Kurita, Daisuke; Kataoka, Kunishige; Sakurai, Takeshi


    Highlights: • Proton transport pathway in bilirubin oxidase was mutated. • Two intermediates in the dioxygen reduction steps were trapped and characterized. • A specific glutamate for dioxygen reduction by multicopper oxidases was identified. - Abstract: The hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase is constructed with Glu463 and water molecules to transport protons for the four-electron reduction of dioxygen. Substitutions of Glu463 with Gln or Ala were attributed to virtually complete loss or significant reduction in enzymatic activities due to an inhibition of the proton transfer steps to dioxygen. The single turnover reaction of the Glu463Gln mutant afforded the highly magnetically interacted intermediate II (native intermediate) with a broad g = 1.96 electron paramagnetic resonance signal detectable at cryogenic temperatures. Reactions of the double mutants, Cys457Ser/Glu463Gln and Cys457Ser/Glu463Ala afforded the intermediate I (peroxide intermediate) because the type I copper center to donate the fourth electron to dioxygen was vacant in addition to the interference of proton transport due to the mutation at Glu463. The intermediate I gave no electron paramagnetic resonance signal, but the type II copper signal became detectable with the decay of the intermediate I. Structural and functional similarities between multicopper oxidases are discussed based on the present mutation at Glu463 in bilirubin oxidase.

  13. Evidence for lateral transfer of genes encoding ferredoxins, nitroreductases, NADH oxidase, and alcohol dehydrogenase 3 from anaerobic prokaryotes to Giardia lamblia and Entamoeba histolytica.


    Nixon, Julie E J; Wang, Amy; Field, Jessica; Morrison, Hilary G; McArthur, Andrew G; Sogin, Mitchell L; Loftus, Brendan J; Samuelson, John


    Giardia lamblia and Entamoeba histolytica are amitochondriate, microaerophilic protists which use fermentation enzymes like those of bacteria to survive anaerobic conditions within the intestinal lumen. Genes encoding fermentation enzymes and related electron transport peptides (e.g., ferredoxins) in giardia organisms and amebae are hypothesized to be derived from either an ancient anaerobic eukaryote (amitochondriate fossil hypothesis), a mitochondrial endosymbiont (hydrogen hypothesis), or anaerobic bacteria (lateral transfer hypothesis). The goals here were to complete the molecular characterization of giardial and amebic fermentation enzymes and to determine the origins of the genes encoding them, when possible. A putative giardia [2Fe-2S]ferredoxin which had a hypothetical organelle-targeting sequence at its N terminus showed similarity to mitochondrial ferredoxins and the hydrogenosomal ferredoxin of Trichomonas vaginalis (another luminal protist). However, phylogenetic trees were star shaped, with weak bootstrap support, so we were unable to confirm or rule out the endosymbiotic origin of the giardia [2Fe-2S]ferredoxin gene. Putative giardial and amebic 6-kDa ferredoxins, ferredoxin-nitroreductase fusion proteins, and oxygen-insensitive nitroreductases each tentatively supported the lateral transfer hypothesis. Although there were not enough sequences to perform meaningful phylogenetic analyses, the unique common occurrence of these peptides and enzymes in giardia organisms, amebae, and the few anaerobic prokaryotes suggests the possibility of lateral transfer. In contrast, there was more robust phylogenetic evidence for the lateral transfer of G. lamblia genes encoding an NADH oxidase from a gram-positive coccus and a microbial group 3 alcohol dehydrogenase from thermoanaerobic prokaryotes. In further support of lateral transfer, the G. lamblia NADH oxidase and adh3 genes appeared to have an evolutionary history distinct from those of E. histolytica.

  14. Overexpression of a maize sulfite oxidase gene in tobacco enhances tolerance to sulfite stress via sulfite oxidation and CAT-mediated H2O2 scavenging.


    Xia, Zongliang; Sun, Kaile; Wang, Meiping; Wu, Ke; Zhang, Hua; Wu, Jianyu


    Sulfite oxidase (SO) plays an important role in sulfite metabolism. To date, the molecular mechanisms of sulfite metabolism in plants are largely unknown. Previously, a full-length cDNA of the putative sulfite oxidase gene from maize (ZmSO) was cloned, and its response to SO(2)/sulfite stress at the transcriptional level was characterized. In this study, the recombinant ZmSO protein was purified from E. coli. It exhibited sulfite-dependent activity and had strong affinity for the substrate sulfite. Over-expression (OE) of ZmSO in tobacco plants enhanced their tolerance to sulfite stress. The plants showed much less damage, less sulfite accumulation, but greater amounts of sulfate. This suggests that tolerance of transgenic plants to sulfite was enhanced by increasing SO expression levels. Interestingly, H(2)O(2) accumulation levels by histochemical detection and quantitative determination in the OE plants were much less than those in the wild-type upon sulfite stress. Furthermore, reductions of catalase levels detected in the OE lines were considerably less than in the wild-type plants. This indicates that SO may play an important role in protecting CAT from inhibition by excess sulfite. Collectively, these data demonstrate that transgenic tobacco plants over-expressing ZmSO enhance tolerance to excess sulfite through sulfite oxidation and catalase-mediated hydrogen peroxide scavenging. This is the first SO gene from monocots to be functionally characterized. PMID:22693572

  15. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    PubMed Central

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E.


    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD. PMID:24701363

  16. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease.


    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E; Ortiz, Genaro Gabriel


    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

  17. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor.


    Pietan, Lucas L; Spradling, Theresa A; Demastes, James W


    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916-1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  18. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

    PubMed Central

    Pietan, Lucas L.; Spradling, Theresa A.


    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  19. Defects in NADPH Oxidase Genes NOX1 and DUOX2 in Very Early Onset Inflammatory Bowel Disease

    PubMed Central

    Hayes, Patti; Dhillon, Sandeep; O'Neill, Kim; Thoeni, Cornelia; Hui, Ken Y.; Elkadri, Abdul; Guo, Conghui H.; Kovacic, Lidija; Aviello, Gabriella; Alvarez, Luis A.; Griffiths, Anne M.; Snapper, Scott B.; Brant, Steven R.; Doroshow, James H.; Silverberg, Mark S.; Peter, Inga; McGovern, Dermot P. B.; Cho, Judy; Brumell, John H.; Uhlig, Holm H.; Bourke, Billy; Muise, Aleixo A.; Knaus, Ulla G.


    Background & Aims Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD). Reactive oxygen species (ROS) generated by nicotinamide-adenine dinucleotide phosphate (NADPH) oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 209 children with very early onset inflammatory bowel disease (VEOIBD), the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn) and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys) in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. PMID:26301257

  20. [Integration of different T-DNA structures of ACC oxidase gene into carnation genome extended cut flower vase-life differently].


    Yu, Yi-Xun; Bao, Man-Zhu


    The cultivar 'Master' of carnation (Dianthus caryophyllus L.) was transformed with four T-DNA structures containing sense, antisense, sense direct repeat and antisense direct repeat gene of ACC oxidase mediated by Agrobacterium tumefaciens. Southern blotting detection showed that foreign gene was integrated into the carnation genome and 14 transgenic lines were obtained. The transgenic plants were transplanted to soil and grew normally in greenhouse. Of the 12 transgenic lines screened, the cut flower vase life of 8 transgenic lines is up to 11 days and the longest one is 12.8 days while the vase life of the control is 5.8 days under 25 degrees C. The vase life of 2 lines out of 3 with single sense ACO gene is same as that of the control, while the vase life of 3 lines out of 4 with single antisense ACO gene is prolonged. The vase life of cut flowers of 5 lines with direct repeat ACO genes is all prolonged by about 6 days, while the vase life of 3 out of 7 lines with single ACO gene is same as that of the control. During the senescence of cut flowers, the ethylene production of the most of the transgenic lines decreased significantly, and the production of ethylene is not detectable in lines T456, T556 and T575. The results of the research demonstrate that antisense foreign gene inhibits expression of endogenesis gene more significantly than sense one. Both sense direct repeat and antisense direct repeat foreign genes can suppress endogenous gene expression more significantly comparing to single foreign genes. The transgenic lines obtained from this research are useful to minimize carnation cut flower transportation and storage expenses.

  1. Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.


    Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu


    To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.

  2. Molecular cloning and sequence analysis of a PVGOX gene encoding glucose oxidase in Penicillium viticola F1 strain and it's expression quantitation.


    Khan, Ibrar; Qayyum, Sadia; Ahmed, Shehzad; Niaz, Zeeshan; Fatima, Nighat; Chi, Zhen-Ming


    The PVGOX gene (accession number: KT452630) was isolated from genomic DNA of the marine fungi Penicillium viticola F1 by Genome Walking and their expression analysis was done by Fluorescent RT-PCR. An open reading frame of 1806bp encoding a 601 amino acid protein (isoelectric point: 5.01) with a calculated molecular weight of 65,535.4 was characterized. The deduced protein showed 75%, 71%, 69% and 64% identity to those deduced from the glucose oxidase (GOX) genes from different fungal strains including; Talaromyces variabilis, Beauveria bassiana, Aspergillus terreus, and Aspergillus niger, respectively. The promoter of the gene (intronless) had two TATA boxes around the base pair number -88 and -94 and as well as a CAAT box at -100. However, the terminator of the PVGOX gene does not contain any polyadenylation site (AATAAA). The protein deduced from the PVGOX gene had a signal peptide containing 17 amino acids, three cysteine residues and six potential N-linked glycosylation sites, among them, -N-K-T-Y- at 41 amino acid, -N-R-S-L- at 113 amino acid, -N-G-T-I- at 192 amino acid, -N-T-T-A at 215 amino acid, -N-F-T-E at 373 amino acid and -N-V-T-A- at 408 amino acid were the most possible N-glycosylation sites. Furthermore, the relative transcription level of the PVGOX gene was also stimulated in the presence of 4% (w/v) of calcium carbonate and 0.5 % (v/v) of CSL in the production medium compared with that of the PVGOX gene when the fungal strain F1 was grown in the absence of calcium carbonate and CSL in the production medium, suggesting that under the optimal conditions, the expression of the PVGOX gene responsible for gluconic acid biosynthesis was enhanced, leading to increased gluconic acid production. Therefore, the highly glycosylated oxidase enzyme produced by P. viticola F1 strain might be a good producer in the fermentation process for the industrial level production of gluconic acid.

  3. Molecular cloning and sequence analysis of a PVGOX gene encoding glucose oxidase in Penicillium viticola F1 strain and it's expression quantitation.


    Khan, Ibrar; Qayyum, Sadia; Ahmed, Shehzad; Niaz, Zeeshan; Fatima, Nighat; Chi, Zhen-Ming


    The PVGOX gene (accession number: KT452630) was isolated from genomic DNA of the marine fungi Penicillium viticola F1 by Genome Walking and their expression analysis was done by Fluorescent RT-PCR. An open reading frame of 1806bp encoding a 601 amino acid protein (isoelectric point: 5.01) with a calculated molecular weight of 65,535.4 was characterized. The deduced protein showed 75%, 71%, 69% and 64% identity to those deduced from the glucose oxidase (GOX) genes from different fungal strains including; Talaromyces variabilis, Beauveria bassiana, Aspergillus terreus, and Aspergillus niger, respectively. The promoter of the gene (intronless) had two TATA boxes around the base pair number -88 and -94 and as well as a CAAT box at -100. However, the terminator of the PVGOX gene does not contain any polyadenylation site (AATAAA). The protein deduced from the PVGOX gene had a signal peptide containing 17 amino acids, three cysteine residues and six potential N-linked glycosylation sites, among them, -N-K-T-Y- at 41 amino acid, -N-R-S-L- at 113 amino acid, -N-G-T-I- at 192 amino acid, -N-T-T-A at 215 amino acid, -N-F-T-E at 373 amino acid and -N-V-T-A- at 408 amino acid were the most possible N-glycosylation sites. Furthermore, the relative transcription level of the PVGOX gene was also stimulated in the presence of 4% (w/v) of calcium carbonate and 0.5 % (v/v) of CSL in the production medium compared with that of the PVGOX gene when the fungal strain F1 was grown in the absence of calcium carbonate and CSL in the production medium, suggesting that under the optimal conditions, the expression of the PVGOX gene responsible for gluconic acid biosynthesis was enhanced, leading to increased gluconic acid production. Therefore, the highly glycosylated oxidase enzyme produced by P. viticola F1 strain might be a good producer in the fermentation process for the industrial level production of gluconic acid. PMID:27425865

  4. Additive effect of polymorphisms in the β2 -adrenoceptor and NADPH oxidase p22 phox genes contributes to the loss of estimated glomerular filtration rate in Chinese.


    Wang, Tao; Zhang, Yan; Ma, JingTao; Feng, Zhen; Niu, Kai; Liu, Bing


    Because increased oxidative stress may mediate the detrimental actions of enhanced sympathetic nervous activity on renal function and vice versa, we investigated the effect of the polymorphic Arg16Gly in the β2 -adrenoceptor (ADRB2) gene, Trp64Arg in the β3 -adrenoceptor (ADRB3) gene and C242T in the NADPH oxidase p22phox (CYBA) gene on estimated glomerular filtration rate (eGFR) in a Chinese population. Initially recruited from different outpatient services of HeBei General Hospital in northern China, 668 individuals were finally included in the study, with complete demographic information. Laboratory tests were performed and estimated glomerular filtration rate (eGFR) was derived from the Modification of Diet in Renal Disease (MDRD) equation for the Chinese population. Plasma noradrenaline levels and genotype were determined by HPLC and the TaqMan method, respectively. Only across the Arg16Gly polymorphism did eGFR show significant difference: it was lower in individuals with the Gly16Gly variation, who also had the highest plasma noradrenaline levels. This polymorphism remained a significant determinant of eGFR after multivariate analysis. Of importance, the multifactor dimensionality reduction method further detected a significant synergism between the Arg16Gly and C242T polymorphisms in reducing eGFR. These observations clarify the effects of the studied polymorphisms on eGFR and exemplify gene-gene interactions influencing renal function.

  5. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.


    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing


    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

  6. Gene flow between Drosophila yakuba and Drosophila santomea in subunit V of cytochrome c oxidase: A potential case of cytonuclear cointrogression

    PubMed Central

    Beck, Emily A.; Thompson, Aaron C.; Sharbrough, Joel; Brud, Evgeny; Llopart, Ana


    Introgression is the effective exchange of genetic information between species through natural hybridization. Previous genetic analyses of the Drosophila yakuba—D. santomea hybrid zone showed that the mitochondrial genome of D. yakuba had introgressed into D. santomea and completely replaced its native form. Since mitochondrial proteins work intimately with nuclear‐encoded proteins in the oxidative phosphorylation (OXPHOS) pathway, we hypothesized that some nuclear genes in OXPHOS cointrogressed along with the mitochondrial genome. We analyzed nucleotide variation in the 12 nuclear genes that form cytochrome c oxidase (COX) in 33 Drosophila lines. COX is an OXPHOS enzyme composed of both nuclear‐ and mitochondrial‐encoded proteins and shows evidence of cytonuclear coadaptation in some species. Using maximum‐likelihood methods, we detected significant gene flow from D. yakuba to D. santomea for the entire COX complex. Interestingly, the signal of introgression is concentrated in the three nuclear genes composing subunit V, which shows population migration rates significantly greater than the background level of introgression in these species. The detection of introgression in three proteins that work together, interact directly with the mitochondrial‐encoded core, and are critical for early COX assembly suggests this could be a case of cytonuclear cointrogression. PMID:26155926

  7. Stress-induced co-expression of two alternative oxidase (VuAox1 and 2b) genes in Vigna unguiculata.


    Costa, José Hélio; Mota, Erika Freitas; Cambursano, Mariana Virginia; Lauxmann, Martin Alexander; de Oliveira, Luciana Maia Nogueira; Silva Lima, Maria da Guia; Orellano, Elena Graciela; Fernandes de Melo, Dirce


    Cowpea (Vigna unguiculata) alternative oxidase is encoded by a small multigene family (Aox1, 2a and 2b) that is orthologous to the soybean Aox family. Like most of the identified Aox genes in plants, VuAox1 and VuAox2 consist of 4 exons interrupted by 3 introns. Alignment of the orthologous Aox genes revealed high identity of exons and intron variability, which is more prevalent in Aox1. In order to determine Aox gene expression in V. unguiculata, a steady-state analysis of transcripts involved in seed development (flowers, pods and dry seeds) and germination (soaked seeds) was performed and systemic co-expression of VuAox1 and VuAox2b was observed during germination. The analysis of Aox transcripts in leaves from seedlings under different stress conditions (cold, PEG, salicylate and H2O2 revealed stress-induced co-expression of both VuAox genes. Transcripts of VuAox2a and 2b were detected in all control seedlings, which was not the case for VuAox1 mRNA. Estimation of the primary transcript lengths of V. unguiculata and soybean Aox genes showed an intron length reduction for VuAox1 and 2b, suggesting that the two genes have converged in transcribed sequence length. Indeed, a bioinformatics analysis of VuAox1 and 2b promoters revealed a conserved region related to a cis-element that is responsive to oxidative stress. Taken together, the data provide evidence for co-expression of Aox1 and Aox2b in response to stress and also during the early phase of seed germination. The dual nature of VuAox2b expression (constitutive and induced) suggests that the constitutive Aox2b gene of V. unguiculata has acquired inducible regulatory elements.

  8. A negative regulating element controlling transcription of the gene encoding acyl-CoA oxidase in Saccharomyces cerevisiae.

    PubMed Central

    Wang, T W; Lewin, A S; Small, G M


    Peroxisomes are induced in Saccharomyces cerevisiae when this yeast is grown in the presence of oleate, and are repressed when glucose is supplied as the carbon source. Concomitant with this is an induction/repression of peroxisomal beta-oxidation enzymes. We are investigating the transcriptional control of acyl-CoA oxidase, the first and rate-limiting enzyme in the peroxisomal beta-oxidation cycle. The promoter region of POX1 from S. cerevisiae has been analyzed in POX1/lacZ fusions. Expression of the POX1/lacZ fusion protein underwent glucose repression and oleate induction. By deletion, DNA band shift and DNase I footprinting analyses we have identified a region that is involved in transcriptional repression of POX1. Elimination of this DNA sequence results in constitutive expression of POX1 when S. cerevisiae is grown on a fermentable carbon source or glycerol. Images PMID:1630920

  9. Mitochondrial encephalomyopathy with cytochrome c oxidase deficiency caused by a novel mutation in the MTCO1 gene.


    Debray, François-Guillaume; Seneca, Sara; Gonce, Michel; Vancampenhaut, Kim; Bianchi, Elettra; Boemer, François; Weekers, Laurent; Smet, Joél; Van Coster, Rudy


    Cytochrome c oxidase (COX) deficiency is one of the most common respiratory chain deficiencies. A woman was presented at the age of 18y with acute loss of consciousness, non-convulsive status epilepticus, slow neurological deterioration, transient cortical blindness, exercise intolerance, muscle weakness, hearing loss, cataract and cognitive decline. Muscle biopsy revealed ragged-red fibers, COX negative fibers and a significant decreased activity of complex IV in a homogenate. Using next generation massive parallel sequencing of the mtDNA, a novel heteroplasmic mutation was identified in MTCO1, m.7402delC, causing frameshift and a premature termination codon. Single fiber PCR showed co-segregation of high mutant load in COX negative fibers. Mutation in mitochondrially encoded complex IV subunits should be considered in mitochondrial encephalomyopathies and COX negative fibers after the common mtDNA mutations have been excluded.

  10. A wheat superoxide dismutase gene TaSOD2 enhances salt resistance through modulating redox homeostasis by promoting NADPH oxidase activity.


    Wang, Mengcheng; Zhao, Xin; Xiao, Zhen; Yin, Xunhao; Xing, Tian; Xia, Guangmin


    Superoxide dismutase (SOD) is believed to enhance abiotic stress resistance by converting superoxide radical (O2 (-)) to H2O2 to lower ROS level and maintain redox homeostasis. ROS level is controlled via biphasic machinery of ROS production and scavenging. However, whether the role of SOD in abiotic stress resistance is achieved through influencing the biophasic machinery is not well documented. Here, we identified a wheat copper-zinc (Cu/Zn) SOD gene, TaSOD2, who was responsive to NaCl and H2O2. TaSOD2 overexpression in wheat and Arabidopsis elevated SOD activities, and enhanced the resistance to salt and oxidative stress. TaSOD2 overexpression reduced H2O2 level but accelerated O2 (-) accumulation. Further, it improved the activities of H2O2 metabolic enzymes, elevated the activity of O2 (-) producer NADPH oxidase (NOX), and promoted the transcription of NOX encoding genes. The inhibition of NOX activity and the mutation of NOX encoding genes both abolished the salt resistance of TaSOD2 overexpression lines. These data indicate that Cu/Zn SOD enhances salt resistance, which is accomplished through modulating redox homeostasis via promoting NOX activity. PMID:26869262

  11. A wheat superoxide dismutase gene TaSOD2 enhances salt resistance through modulating redox homeostasis by promoting NADPH oxidase activity.


    Wang, Mengcheng; Zhao, Xin; Xiao, Zhen; Yin, Xunhao; Xing, Tian; Xia, Guangmin


    Superoxide dismutase (SOD) is believed to enhance abiotic stress resistance by converting superoxide radical (O2 (-)) to H2O2 to lower ROS level and maintain redox homeostasis. ROS level is controlled via biphasic machinery of ROS production and scavenging. However, whether the role of SOD in abiotic stress resistance is achieved through influencing the biophasic machinery is not well documented. Here, we identified a wheat copper-zinc (Cu/Zn) SOD gene, TaSOD2, who was responsive to NaCl and H2O2. TaSOD2 overexpression in wheat and Arabidopsis elevated SOD activities, and enhanced the resistance to salt and oxidative stress. TaSOD2 overexpression reduced H2O2 level but accelerated O2 (-) accumulation. Further, it improved the activities of H2O2 metabolic enzymes, elevated the activity of O2 (-) producer NADPH oxidase (NOX), and promoted the transcription of NOX encoding genes. The inhibition of NOX activity and the mutation of NOX encoding genes both abolished the salt resistance of TaSOD2 overexpression lines. These data indicate that Cu/Zn SOD enhances salt resistance, which is accomplished through modulating redox homeostasis via promoting NOX activity.

  12. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.


    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  13. Manganese(IV) Oxide Production by Acremonium sp. Strain KR21-2 and Extracellular Mn(II) Oxidase Activity

    PubMed Central

    Miyata, Naoyuki; Tani, Yukinori; Maruo, Kanako; Tsuno, Hiroshi; Sakata, Masahiro; Iwahori, Keisuke


    Ascomycetes that can deposit Mn(III, IV) oxides are widespread in aquatic and soil environments, yet the mechanism(s) involved in Mn oxide deposition remains unclear. A Mn(II)-oxidizing ascomycete, Acremonium sp. strain KR21-2, produced a Mn oxide phase with filamentous nanostructures. X-ray absorption near-edge structure (XANES) spectroscopy showed that the Mn phase was primarily Mn(IV). We purified to homogeneity a laccase-like enzyme with Mn(II) oxidase activity from cultures of strain KR21-2. The purified enzyme oxidized Mn(II) to yield suspended Mn particles; XANES spectra indicated that Mn(II) had been converted to Mn(IV). The pH optimum for Mn(II) oxidation was 7.0, and the apparent half-saturation constant was 0.20 mM. The enzyme oxidized ABTS [2,2′-azinobis(3-ethylbenzothiazoline-6-sulfonic acid)] (pH optimum, 5.5; Km, 1.2 mM) and contained two copper atoms per molecule. Moreover, the N-terminal amino acid sequence (residues 3 to 25) was 61% identical with the corresponding sequence of an Acremonium polyphenol oxidase and 57% identical with that of a Myrothecium bilirubin oxidase. These results provide the first evidence that a fungal multicopper oxidase can convert Mn(II) to Mn(IV) oxide. The present study reinforces the notion of the contribution of multicopper oxidase to microbially mediated precipitation of Mn oxides and suggests that Acremonium sp. strain KR21-2 is a good model for understanding the oxidation of Mn in diverse ascomycetes. PMID:17021194

  14. Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.


    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T


    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons.

  15. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande


    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  16. Laccase Gene Family in Cerrena sp. HYB07: Sequences, Heterologous Expression and Transcriptional Analysis.


    Yang, Jie; Xu, Xinqi; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun


    Laccases are a class of multi-copper oxidases with industrial potential. In this study, eight laccases (Lac1-8) from Cerrena sp. strain HYB07, a white-rot fungus with high laccase yields, were analyzed. The laccases showed moderate identities to each other as well as with other fungal laccases and were predicted to have high redox potentials except for Lac6. Selected laccase isozymes were heterologously expressed in the yeast Pichia pastoris, and different enzymatic properties were observed. Transcription of the eight laccase genes was differentially regulated during submerged and solid state fermentation, as shown by quantitative real-time polymerase chain reaction and validated reference genes. During 6-day submerged fermentation, Lac7 and 2 were successively the predominantly expressed laccase gene, accounting for over 95% of all laccase transcripts. Interestingly, accompanying Lac7 downregulation, Lac2 transcription was drastically upregulated on days 3 and 5 to 9958-fold of the level on day 1. Consistent with high mRNA abundance, Lac2 and 7, but not other laccases, were identified in the fermentation broth by LC-MS/MS. In solid state fermentation, less dramatic differences in transcript abundance were observed, and Lac3, 7 and 8 were more highly expressed than other laccase genes. Elucidating the properties and expression profiles of the laccase gene family will facilitate understanding, production and commercialization of the fungal strain and its laccases. PMID:27527131

  17. Phylogeography of stable fly (Diptera: Muscidae) estimated by diversity at ribosomal 16S and cytochrome oxidase I mitochondrial genes.


    Marquez, J G; Cummings, M A; Krafsur, E S


    The blood-feeding cosmopolitan stable fly, Stomoxys calcitrans L. (Diptera: Muscidae), is thought to disperse rapidly and widely, and earlier studies of allozyme variation were consistent with high vagility in this species. The geographic origins of New World populations are unknown. Diversity at mitochondrial loci r16S and cytochrome oxidase I was examined in 277 stable flies from 11 countries, including five zoogeographical regions. Of 809 nucleotides, 174 were polymorphic and 133 were parsimony informative. Seventy-six haplotypes were found in frequencies consistent with the Wright-Fisher infinite allele model. None were shared among four or more zoogeographical regions. The null hypothesis of mutation neutrality was not rejected, thereby validating the observed distribution. Fifty-nine haplotypes were singular, eight were private and confined to the Old World, and three of 76 haplotypes were shared between the Old and New World. Only 19 haplotypes were found in the New World, 14 of which were singletons. Haplotype and nucleotide diversities were heterogeneous among countries and regions. The most diversity was observed in sub-Saharan Africa. Regional differentiation indices were C(RT) = 0.26 and N(RT) = 0.31, indicating populations were highly structured macrogeographically. Palearctic and New World flies were the least differentiated from each other. There were strong genetic similarities among populations in the Nearctic, Neotropical, and Palearctic regions, and it is most likely that New World populations were derived from the Palearctic after 1492 CE, in the colonial era. PMID:18047198

  18. A role for active oxygen species as second messengers in the induction of alternative oxidase gene expression in Petunia hybrida cells.


    Wagner, A M


    Incubation of Petunia hybrida cells with H2O2 leads to an increase in alternative oxidase activity measured after 24 h. This increased activity is accompanied by an increase in alternative oxidase protein. A model is presented for the regulation of alternative oxidase protein synthesis in which active oxygen species and especially H2O2 play a crucial role as second messengers in the signal transducing pathway from the mitochondria to the nucleus. It is proposed that also the induction of the alternative oxidase by salicylic acid is mediated via H2O2.

  19. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants.


    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab


    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants.

  20. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

    PubMed Central

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.


    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  1. Prokaryotic orthologues of mitochondrial alternative oxidase and plastid terminal oxidase.


    McDonald, Allison E; Amirsadeghi, Sasan; Vanlerberghe, Greg C


    The mitochondrial alternative oxidase (AOX) and the plastid terminal oxidase (PTOX) are two similar members of the membrane-bound diiron carboxylate group of proteins. AOX is a ubiquinol oxidase present in all higher plants, as well as some algae, fungi, and protists. It may serve to dampen reactive oxygen species generation by the respiratory electron transport chain. PTOX is a plastoquinol oxidase in plants and some algae. It is required in carotenoid biosynthesis and may represent the elusive oxidase in chlororespiration. Recently, prokaryotic orthologues of both AOX and PTOX proteins have appeared in sequence databases. These include PTOX orthologues present in four different cyanobacteria as well as an AOX orthologue in an alpha-proteobacterium. We used PCR, RT-PCR and northern analyses to confirm the presence and expression of the PTOX gene in Anabaena variabilis PCC 7120. An extensive phylogeny of newly found prokaryotic and eukaryotic AOX and PTOX proteins supports the idea that AOX and PTOX represent two distinct groups of proteins that diverged prior to the endosymbiotic events that gave rise to the eukaryotic organelles. Using multiple sequence alignment, we identified residues conserved in all AOX and PTOX proteins. We also provide a scheme to readily distinguish PTOX from AOX proteins based upon differences in amino acid sequence in motifs around the conserved iron-binding residues. Given the presence of PTOX in cyanobacteria, we suggest that this acronym now stand for plastoquinol terminal oxidase. Our results have implications for the photosynthetic and respiratory metabolism of these prokaryotes, as well as for the origin and evolution of eukaryotic AOX and PTOX proteins.

  2. The effects of child maltreatment on early signs of antisocial behavior: genetic moderation by tryptophan hydroxylase, serotonin transporter, and monoamine oxidase A genes.


    Cicchetti, Dante; Rogosch, Fred A; Thibodeau, Eric L


    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes were examined: tryptophan hydroxylase 1 (TPH1), serotonin transporter linked polymorphic region (5-HTTLPR), and monoamine oxidase A (MAOA) upstream variable number tandem repeat. In addition to child maltreatment status, we considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer, and adult counselor reports. In a series of analyses of covariance, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all report forms. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer reports of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. The TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult reports of antisocial behavior; again, the genetic effects were strongest for children who were abused. In addition, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult reports of antisocial behavior. The findings elucidate how genetic

  3. Cytochrome oxidase 1 gene sequence analysis in six flatfish species (Teleostei, Pleuronectidae) of Far East Russia with inferences in phylogeny and taxonomy.


    Kartavtsev, Yuri Ph; Sharina, Svetlana N; Goto, Tadasuke; Chichvarkhin, Anton Y; Balanov, Andrey A; Vinnikov, Kirill A; Ivankov, Vyacheslav N; Hanzawa, Naoto


    Mitochondrial DNA at the cytochrome oxidase 1 (Co-1) gene region was sequenced for six flatfish species (in total, 11 sequences of at least 539 base pairs) from the Far East of Russia and compared with other sequences of Pleuronectiformes, comprising altogether 26 flatfish sequences and two outgroup sequences (Perciformes). An analysis of the protein-coding Co-1 gene revealed a statistically substantiated bias in (T + C):(A + G) content, supporting earlier findings. Average scores of the p-distances for different scales of the evolutionary history at the Co-1 gene revealed a clear pattern of increased nucleotide diversity at four different levels: (1) intraspecies, (2) intragenus, (3) intrafamily, and (4) intra-order. Scores of average p-distances of the four categories of comparison in flatfishes were (1) 0.17 +/- 0.09%, (2) 10.60 +/- 1.57%, (3) 12.40 +/- 0.27%, and (4) 19.93 +/- 0.05%, respectively (mean +/- standard error). These data jointly with current knowledge support the concept that speciation in the order Pleuronectiformes mostly follows a geographic mode through accumulation of numerous small genetic changes over a long period of time. A phylogenetic tree for 26 sequences of flatfishes and two other fishes belonging to ray-finned fishes (Actinopterigii) was developed using the Co-1 gene and four different analytical approaches: neighbour-joining, Bayesian (BA), maximum parsimony (MP), and maximum likelihood. The analysis revealed a monophyletic origin for the representatives of Pleuronectidae, which is the principal flatfish family investigated (73-100% support level in our MP and BA analyses). According to the current and literary data, the monophyletic origin for the six compared flatfish families was well supported. Species identification on a per-individual basis (barcoding tagging) was high.

  4. Eimeria ninakohlyakimovae induces NADPH oxidase-dependent monocyte extracellular trap formation and upregulates IL-12 and TNF-α, IL-6 and CCL2 gene transcription.


    Pérez, D; Muñoz, M C; Molina, J M; Muñoz-Caro, T; Silva, L M R; Taubert, A; Hermosilla, C; Ruiz, A


    Extracellular trap (ET) formation has been demonstrated as novel effector mechanism against diverse pathogens in polymorphonuclear neutrophils (PMN), eosinophils, mast cells, macrophages and recently also in monocytes. In the current study, we show that E. ninakohlyakimovae triggers the deliverance of monocyte-derived ETs in vitro. Fluorescence illustrations as well as scanning electron microscopy (SEM) analyses showed that monocyte-derived ET formation was rapidly induced upon exposure to viable sporozoites, sporocysts and oocysts of E. ninakohlyakimovae. Classical features of monocyte-released ETs were confirmed by the co-localization of extracellular DNA adorned with myeloperoxidase (MPO) and histones (H3) in parasite-entrapping structures. The treatment of caprine monocyte ET structures with NADPH oxidase inhibitor diphenylene iodondium (DPI) significantly reduced ETosis confirming the essential role of reactive oxygen species (ROS) in monocyte mediated ETs formation. Additionally, co-culture of monocytes with viable sporozoites and soluble oocyst antigen (SOA) induced distinct levels of cytokine and chemokine gene transcription. Thus, the transcription of genes encoding for IL-12 and TNF-α was significantly upregulated after sporozoite encounter. In contrast IL-6 and CCL2 gene transcripts were rather weakly induced by parasites. Conversely, SOA only induced the up-regulation of IL-6 and CCL2 gene transcription, and failed to enhance transcripts of IL-12 and TNF-α in vitro. We here report on monocyte-triggered ETs as novel effector mechanism against E. ninakohlyakimovae. Our results strongly suggest that monocyte-mediated innate immune reactions might play an important role in early host immune reactions against E. ninakohlyakimovae in goats. PMID:27523951

  5. Agrobacterium-mediated transformation of Eucalyptus globulus using explants with shoot apex with introduction of bacterial choline oxidase gene to enhance salt tolerance.


    Matsunaga, Etsuko; Nanto, Kazuya; Oishi, Masatoshi; Ebinuma, Hiroyasu; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa


    Eucalyptus globulus is one of the most economically important plantation hardwoods for paper making. However, its low transformation frequency has prevented genetic engineering of this species with useful genes. We found the hypocotyl section with a shoot apex has the highest regeneration ability among another hypocotyl sections, and have developed an efficient Agrobacterium-mediated transformation method using these materials. We then introduced a salt tolerance gene, namely a bacterial choline oxidase gene (codA) with a GUS reporter gene, into E. globulus. The highest frequency of transgenic shoot regeneration from hypocotyls with shoot apex was 7.4% and the average frequency in four experiments was 4.0%, 12-fold higher than that from hypocotyls without shoot apex. Using about 10,000 explants, over 250 regenerated buds were confirmed as transformants by GUS analysis. Southern blot analysis of 100 elongated shoots confirmed successful generation of stable transformants. Accumulation of glycinebetaine was investigated in 44 selected transgenic lines, which showed 1- to 12-fold higher glycinebetaine levels than non-transgenic controls. Rooting of 16 transgenic lines was successful using a photoautotrophic method under enrichment with 1,000 ppm CO(2). The transgenic whole plantlets were transplanted into potting soil and grown normally in a growth room. They showed salt tolerance to 300 mM NaCl. The points of our system are using explants with shoot apex as materials, inhibiting the elongation of the apex on the selection medium, and regenerating transgenic buds from the side opposite to the apex. This approach may also solve transformation problems in other important plants.

  6. Identification and genetic characterization of a gibberellin 2-oxidase gene that controls tree stature and reproductive growth in plum

    PubMed Central

    El-Sharkawy, I.; El Kayal, W.; Prasath, D.; Fernández, H.; Bouzayen, M.; Svircev, A. M.; Jayasankar, S.


    Several dwarf plum genotypes (Prunus salicina L.), due to deficiency of unknown gibberellin (GA) signalling, were identified. A cDNA encoding GA 2-oxidase (PslGA2ox), the major gibberellin catabolic enzyme in plants, was cloned and used to screen the GA-deficient hybrids. This resulted in the identification of a dwarf plum hybrid, designated as DGO24, that exhibits a markedly elevated PslGA2ox signal. Grafting ‘Early Golden’ (EG), a commercial plum cultivar, on DGO24 (EG/D) enhanced PslGA2ox accumulation in the scion part and generated trees of compact stature. Assessment of active GAs in such trees revealed that DGO24 and EG/D accumulated relatively much lower quantities of main bioactive GAs (GA1 and GA4) than control trees (EG/M). Moreover, the physiological function of PslGA2ox was studied by determining the molecular and developmental consequences due to ectopic expression in Arabidopsis. Among several lines, two groups of homozygous transgenics that exhibited contrasting phenotypes were identified. Group-1 displayed a dwarf growth pattern typical of mutants with a GA deficiency including smaller leaves, shorter stems, and delay in the development of reproductive events. In contrast, Group-2 exhibited a ‘GA overdose’ phenotype as all the plants showed elongated growth, a typical response to GA application, even under limited GA conditions, potentially due to co-suppression of closely related Arabidopsis homologous. The studies reveal the possibility of utilizing PslGA2ox as a marker for developing size-controlling rootstocks in Prunus. PMID:22080981

  7. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence.


    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul


    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  8. Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser

    SciTech Connect

    Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J


    Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

  9. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence

    PubMed Central

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul


    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  10. Molecular mechanism of monoamine oxidase A gene regulation under inflammation and ischemia-like conditions: key roles of the transcription factors GATA2, Sp1 and TBP.


    Gupta, Vinayak; Khan, Abrar A; Sasi, Binu K; Mahapatra, Nitish R


    Monoamine oxidase A (MAOA) plays important roles in the pathogenesis of several neurological and cardiovascular disorders. The mechanism of transcriptional regulation of MAOA under basal and pathological conditions, however, remains incompletely understood. Here, we report systematic identification and characterization of cis elements and transcription factors that govern the expression of MAOA gene. Extensive computational analysis of MAOA promoter, followed by 5'-promoter deletion/reporter assays, revealed that the -71/-40 bp domain was sufficient for its basal transcription. Gel-shift and chromatin immunoprecipitation assays provided evidence of interactions of the transcription factors GATA-binding protein 2 (GATA2), Sp1 and TATA-binding protein (TBP) with this proximal promoter region. Consistently, over-expression of GATA2, Sp1 and TBP augmented MAOA promoter activity in a coordinated manner. In corroboration, siRNA-mediated down-regulation of GATA2/Sp1/TBP repressed the endogenous MAOA expression as well as transfected MAOA promoter activity. Tumor necrosis factor-α and forskolin activated MAOA transcription that was reversed by Sp1 siRNA; in support, tumor necrosis factor-α- and forskolin-induced activities were enhanced by ectopic over-expression of Sp1. On the other hand, MAOA transcription was diminished upon exposure of neuroblasts or cardiac myoblasts to ischemia-like conditions because of reduced binding of GATA2/Sp1/TBP with MAOA promoter. In conclusion, this study revealed previously unknown roles of GATA2, Sp1 and TBP in modulating MAOA expression under basal as well as pathophysiological conditions such as inflammation and ischemia, thus providing new insights into the molecular basis of aberrant MAOA expression in neuronal/cardiovascular disease states. Dysregulation of monoamine oxidase A (MAOA) have been implicated in several behavioral and neuronal disease states. Here, we identified three crucial transcription factors (GATA2, Sp1 and TBP

  11. Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

  12. Increasing the catalytic activity of Bilirubin oxidase from Bacillus pumilus: Importance of host strain and chaperones proteins.


    Gounel, Sébastien; Rouhana, Jad; Stines-Chaumeil, Claire; Cadet, Marine; Mano, Nicolas


    Aggregation of recombinant proteins into inclusion bodies (IBs) is the main problem of the expression of multicopper oxidase in Escherichia coli. It is usually attributed to inefficient folding of proteins due to the lack of copper and/or unavailability of chaperone proteins. The general strategies reported to overcome this issue have been focused on increasing the intracellular copper concentration. Here we report a complementary method to optimize the expression in E. coli of a promising Bilirubin oxidase (BOD) isolated from Bacillus pumilus. First, as this BOD has a disulfide bridge, we switched E.coli strain from BL21 (DE3) to Origami B (DE3), known to promote the formation of disulfide bridges in the bacterial cytoplasm. In a second step, we investigate the effect of co-expression of chaperone proteins on the protein production and specific activity. Our strategy allowed increasing the final amount of enzyme by 858% and its catalytic rate constant by 83%. PMID:27165502

  13. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains.


    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi


    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3'-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley.

  14. A Penicillium expansum glucose oxidase-encoding gene, GOX2, is essential for gluconic acid production and acidification during colonization of deciduous fruit.


    Barad, Shiri; Horowitz, Sigal Brown; Moscovitz, Oren; Lichter, Amnon; Sherman, Amir; Prusky, Dov


    Penicillium expansum, the causal agent of blue mold rot, causes severe postharvest maceration of fruit through secretion of total, d-gluconic acid (GLA). Two P. expansum glucose oxidase (GOX)-encoding genes, GOX1 and GOX2, were analyzed. GOX activity and GLA accumulation were strongly related to GOX2 expression, which increased with pH to a maximum at pH 7.0, whereas GOX1 was expressed at pH 4.0, where no GOX activity or extracellular GLA were detected. This differential expression was also observed at the leading edge of the decaying tissue, where GOX2 expression was dominant. The roles of the GOX genes in pathogenicity were further studied through i) development of P. expansum goxRNAi mutants exhibiting differential downregulation of GOX2, ii) heterologous expression of the P. expansum GOX2 gene in the nondeciduous fruit-pathogen P. chrysogenum, and iii) modulation of GLA production by FeSO(4) chelation. Interestingly, in P. expansum, pH and GLA production elicited opposite effects on germination and biomass accumulation: 26% of spores germinated at pH 7.0 when GOX activity and GLA were highest whereas, in P. chrysogenum at the same pH, when GLA did not accumulate, 72% of spores germinated. Moreover, heterologous expression of P. expansum GOX2 in P. chrysogenum resulted in enhanced GLA production and reduced germination, suggesting negative regulation of spore germination and GLA production. These results demonstrate that pH modulation, mediated by GLA accumulation, is an important factor in generating the initial signal or signals for fungal development leading to host-tissue colonization by P. expansum.

  15. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains

    PubMed Central

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi


    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3′-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  16. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression

    PubMed Central

    Sagor, G. H. M.; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu


    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  17. Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.

    PubMed Central

    Nakai, T; Yasuhara, T; Fujiki, Y; Ohashi, A


    Cytochrome c oxidase consists of three mitochondrion- and several nucleus-encoded subunits. We previously found that in a mutant of Saccharomyces cerevisiae lacking nucleus-encoded subunit 4 of this enzyme (CoxIV), subunits 2 and 3 (CoxII and CoxIII), both encoded by the mitochondrial DNA, were unstable and rapidly degraded in mitochondria, presumably because the subunits cannot assemble normally. To analyze the molecular machinery involved in this proteolytic pathway, we obtained four mutants defective in the degradation of unassembled CoxII (osd mutants) by screening CoxIV-deficient cells for the accumulation of CoxII. All of the mutants were recessive and were classified into three different complementation groups. Tetrad analyses revealed that the phenotype of each mutant was caused by a single nuclear mutation. These results suggest strongly that at least three nuclear genes (the OSD genes) are required for this degradation system. Interestingly, degradation of CoxIII was not affected in the mutants, implying that the two subunits are degraded by distinct pathways. We also cloned the OSD1 gene by complementation of the temperature sensitivity of osd1-1 mutants with a COXIV+ genetic background on a nonfermentable glycerol medium. We found it to encode a member of a family (the AAA family) of putative ATPases, which proved to be identical to recently described YME1 and YTA11. Immunological analyses revealed that Osd1 protein is localized to the mitochondrial inner membrane. Disruption of the predicted ATP-binding cassette by site-directed mutagenesis eliminated biological activities, thereby underscoring the importance of ATP for function. PMID:7623837

  18. Association analysis of the monoamine oxidase A gene in bipolar affective disorder by using family-based internal controls

    SciTech Connect

    Noethen, M.M.; Eggermann, K.; Propping, P.


    It is well accepted that association studies are a major tool in investigating the contribution of single genes to the development of diseases that do not follow simple Mendelian inheritance pattern (so-called complex traits). Such major psychiatric diseases as bipolar affective disorder and schizophrenia clearly fall into this category of diseases. 7 refs., 1 tab.

  19. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.


    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  20. Mutations in monoamine oxidase (MAO) genes in mice lead to hypersensitivity to serotonin-enhancing drugs: implications for drug side effects in humans

    PubMed Central

    Fox, MA; Panessiti, MG; Moya, PR; Tolliver, TJ; Chen, K; Shih, JC; Murphy, DL


    A possible side effect of serotonin-enhancing drugs is the serotonin syndrome, which can be lethal. Here we examined possible hypersensitivity to two such drugs, the serotonin precursor 5-hydroxy-L-tryptophan (5-HTP) and the atypical opioid tramadol, in mice lacking the genes for both monoamine oxidase A (MAOA) and MAOB. MAOA/B-knockout (KO) mice displayed baseline serotonin syndrome behaviors, and these behavioral responses were highly exaggerated following 5-HTP or tramadol versus baseline and wild-type (WT) littermates. Compared with MAOA/B-WT mice, baseline tissue serotonin levels were increased ~2.6–3.9-fold in MAOA/B-KO mice. Following 5-HTP, serotonin levels were further increased ~4.5–6.2-fold in MAOA/B-KO mice. These exaggerated responses are in line with the exaggerated responses following serotonin-enhancing drugs that we previously observed in mice lacking the serotonin transporter (SERT). These findings provide a second genetic mouse model suggestive of possible human vulnerability to the serotonin syndrome in individuals with lesser-expressing MAO or SERT polymorphisms that confer serotonergic system changes. PMID:22964922

  1. Immunohistochemical observations on tumor suppressor gene p53 status in mouse fibrosarcoma following in-vivo photodynamic therapy: the role of xanthine oxidase activity

    NASA Astrophysics Data System (ADS)

    Ziolkowski, Piotr P.; Symonowicz, Krzysztof; Milnerowicz, Artur; Osiecka, Beata J.


    Tumor suppressor gene p53 expression in a mouse fibrosarcoma following in-vivo photodynamic therapy has been studied using the immunohistochemical method. Photodynamic treatment involved injections of the well known sensitizer -- hematoporphyrin derivative at the doses 1.25 and 2.5 mg/kg of body weight and irradiations at the doses 25 and 50 J/sq cm. Glass slide preparations from PDT-treated tumors were obtained at different time points (15, 60 minutes, 2 and 24 hours) after therapy, subsequently stained for wild type/mutant p53, and assessed for positive reaction. High PDT doses (HpD -- 2.5 mg/kg; light dose -- 50 J/sq cm) correlated with decreased expression of p53 in tumor cells. The other part of the study was directed to measure the xanthine oxidase (XO) activity in the tumor cells. PDT included injections of HpD and light exposure at the same doses as for p53 study. We observed a complete inhibition of the enzyme activity. The slight increase in XO activity was found following treatment with either light or HpD alone.

  2. Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

    PubMed Central

    Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren


    Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

  3. A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.


    Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N


    A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial. PMID:24927812

  4. Mutation T318M in the CYP11B2 gene encoding P450c11AS (aldosterone synthase) causes corticosterone methyl oxidase II deficiency

    SciTech Connect

    Zhang, G.; Rodriguez, H.; Miller, W.L.


    Corticosterone methyl oxidase (CMO) deficiency refers to disorders of aldosterone synthesis due to mutations in the CYP11B2 gene encoding cytochrome P450c11AS, which is the adrenal aldosterone synthase. Type I CMO deficiency is associated with low concentrations of 18OH-corticosterone and aldosterone, due to severe mutations in P450c11AS, while type III CMO deficiency is associated with high concentrations of 18OH-corticosterone and low concentrations of aldosterone, due to less severe mutations of P450c11AS. A single type of mutation, compound homozygosity for R181W and V386A, has been reported as the cause of CMOII deficiency in an inbred population. We now report a patient with a typical clinical and hormonal picture of CMOII deficiency. Direct sequencing of patient and parent DNAs showed that the mother`s allele contributed R181W and the deletion/frameshift mutation {Delta}C372, while the father`s allele contributed T318M and V386A. These mutants were recreated in cDNA expression vectors singly and in the parental pairs, showing that neither allele contributed any measurable activity. This would suggest the patient should have CMOI deficiency. These studies suggest that other factors besides P450c11AS are involved in the genesis of the distinctive CMOI and CMOII phenotypes. 31 refs., 2 figs., 3 tabs.

  5. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.


    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor


    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.

  6. An mtDNA mutation in the initiation codon of the cytochrome C oxidase subunit II gene results in lower levels of the protein and a mitochondrial encephalomyopathy.

    PubMed Central

    Clark, K M; Taylor, R W; Johnson, M A; Chinnery, P F; Chrzanowska-Lightowlers, Z M; Andrews, R M; Nelson, I P; Wood, N W; Lamont, P J; Hanna, M G; Lightowlers, R N; Turnbull, D M


    A novel heteroplasmic 7587T-->C mutation in the mitochondrial genome which changes the initiation codon of the gene encoding cytochrome c oxidase subunit II (COX II), was found in a family with mitochondrial disease. This T-->C transition is predicted to change the initiating methionine to threonine. The mutation load was present at 67% in muscle from the index case and at 91% in muscle from the patient's clinically affected son. Muscle biopsy samples revealed isolated COX deficiency and mitochondrial proliferation. Single-muscle-fiber analysis revealed that the 7587C copy was at much higher load in COX-negative fibers than in COX-positive fibers. After microphotometric enzyme analysis, the mutation was shown to cause a decrease in COX activity when the mutant load was >55%-65%. In fibroblasts from one family member, which contained >95% mutated mtDNA, there was no detectable synthesis or any steady-state level of COX II. This new mutation constitutes a new mechanism by which mtDNA mutations can cause disease-defective initiation of translation. PMID:10205264

  7. Genetic variation of Gongylonema pulchrum from wild animals and cattle in Japan based on ribosomal RNA and mitochondrial cytochrome c oxidase subunit I genes.


    Makouloutou, P; Setsuda, A; Yokoyama, M; Tsuji, T; Saita, E; Torii, H; Kaneshiro, Y; Sasaki, M; Maeda, K; Une, Y; Hasegawa, H; Sato, H


    The gullet worm (Gongylonema pulchrum) has been recorded from a variety of mammals worldwide, including monkeys and humans. Due to its wide host range, it has been suggested that the worm may be transmitted locally to any mammalian host by chance. To investigate this notion, the ribosomal RNA gene (rDNA), mainly regions of the internal transcribed spacers (ITS) 1 and 2, and a cytochrome c oxidase subunit I (COI) region of mitochondrial DNA of G. pulchrum were characterized using parasites from the following hosts located in Japan: cattle, sika deer, wild boars, Japanese macaques, a feral Reeves's muntjac and captive squirrel monkeys. The rDNA nucleotide sequences of G. pulchrum were generally well conserved regardless of their host origin. However, a few insertions/deletions of nucleotides along with a few base substitutions in the ITS1 and ITS2 regions were observed in G. pulchrum from sika deer, wild boars and Japanese macaques, and those differed from G. pulchrum in cattle, the feral Reeves's muntjac and captive squirrel monkeys. The COI sequences of G. pulchrum were further divided into multiple haplotypes and two groups of haplotypes, i.e. those from a majority of sika deer, wild boars and Japanese macaques and those from cattle and zoo animals, were clearly differentiated. Our findings indicate that domestic and sylvatic transmission cycles of the gullet worm are currently present, at least in Japan.

  8. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.


    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor


    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  9. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors

    PubMed Central

    Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor


    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and FST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  10. Increase in BrAO1 gene expression and aldehyde oxidase activity during clubroot development in Chinese cabbage (Brassica rapa L.).


    Ando, Sugihiro; Tsushima, Seiya; Tagiri, Akemi; Kamachi, Shinichiro; Konagaya, Ken-Ichi; Hagio, Takashi; Tabei, Yutaka


    SUMMARY In clubroot disease, gall formation is induced by infection with the obligate biotroph Plasmodiophora brassicae due to increased levels of auxins and cytokinins. Because aldehyde oxidase (AO) may be involved in auxin biosynthesis in plants, we isolated two AO genes (BrAO1 and BrAO2) from Chinese cabbage (Brassica rapa ssp. pekinensis cv. Muso), which are the most similar to AAO1 among Arabidopsis AO genes, and examined their expressions during clubroot development. The expression of BrAO1 was enhanced in inoculated roots from 15 days post-inoculation (dpi) when visible clubroots were still undetectable. Thereafter, BrAO1 expression increased with clubroot development compared with uninoculated roots, although BrAO2 expression was repressed. In situ hybridization revealed that BrAO1 was strongly expressed in tissues that were invaded by immature plasmodia at 35 dpi, suggesting that BrAO1 expression was enhanced by the pathogen in order to establish its pathogenesis. In addition, we detected AO activity, as evidenced by the occurrence of at least six bands (BrAO-a to BrAO-f) in the roots of Chinese cabbage using an active staining method with benzaldehyde and indlole-3-aldehyde as the substrate. Coincidental with BrAO1 expression, the signals of BrAO-a and BrAO-d increased with inoculation by P. brassicae during clubroot development compared with healthy roots, resulting in an increase in total AO activity. By contrast, the band BrAO-b decreased post-inoculation, in parallel with the expression of BrAO2. The other bands of activity were not clearly influenced by the infection. Based on these results, we discuss the involvement of AO in auxin-overproduction during clubroot development in Chinese cabbage.

  11. Deletion of genes encoding cytochrome oxidases and quinol monooxygenase blocks the aerobic-anaerobic shift in Escherichia coli K-12 MG1655.


    Portnoy, Vasiliy A; Scott, David A; Lewis, Nathan E; Tarasova, Yekaterina; Osterman, Andrei L; Palsson, Bernhard Ø


    The constitutive activation of the anoxic redox control transcriptional regulator (ArcA) in Escherichia coli during aerobic growth, with the consequent production of a strain that exhibits anaerobic physiology even in the presence of air, is reported in this work. Removal of three terminal cytochrome oxidase genes (cydAB, cyoABCD, and cbdAB) and a quinol monooxygenase gene (ygiN) from the E. coli K-12 MG1655 genome resulted in the activation of ArcA aerobically. These mutations resulted in reduction of the oxygen uptake rate by nearly 98% and production of d-lactate as a sole by-product under oxic and anoxic conditions. The knockout strain exhibited nearly identical physiological behaviors under both conditions, suggesting that the mutations resulted in significant metabolic and regulatory perturbations. In order to fully understand the physiology of this mutant and to identify underlying metabolic and regulatory reasons that prevent the transition from an aerobic to an anaerobic phenotype, we utilized whole-genome transcriptome analysis, (13)C tracing experiments, and physiological characterization. Our analysis showed that the deletions resulted in the activation of anaerobic respiration under oxic conditions and a consequential shift in the content of the quinone pool from ubiquinones to menaquinones. An increase in menaquinone concentration resulted in the activation of ArcA. The activation of the ArcB/ArcA regulatory system led to a major shift in the metabolic flux distribution through the central metabolism of the mutant strain. Flux analysis indicated that the mutant strain had undetectable fluxes around the tricarboxylic acid (TCA) cycle and elevated flux through glycolysis and anaplerotic input to oxaloacetate. Flux and transcriptomics data were highly correlated and showed similar patterns.

  12. Sex-specific associations of variants in regulatory regions of NADPH oxidase-2 (CYBB) and glutathione peroxidase 4 (GPX4) genes with kidney disease in type 1 diabetes.


    Monteiro, M B; Patente, T A; Mohammedi, K; Queiroz, M S; Azevedo, M J; Canani, L H; Parisi, M C; Marre, M; Velho, G; Corrêa-Giannella, M L


    Oxidative stress is involved in the pathophysiology of diabetic nephropathy. The superoxide-generating nicotinamide adenine dinucleotide phosphate-oxidase 2 (NOX2, encoded by the CYBB gene) and the antioxidant enzyme glutathione peroxidase 4 (GPX4) play opposing roles in the balance of cellular redox status. In the present study, we investigated associations of single nucleotide polymorphisms (SNPs) in the regulatory regions of CYBB and GPX4 with kidney disease in patients with type 1 diabetes. Two functional SNPs, rs6610650 (CYBB promoter region, chromosome X) and rs713041 (GPX4 3'untranslated region, chromosome 19), were genotyped in 451 patients with type 1 diabetes from a Brazilian cohort (diabetic nephropathy: 44.6%) and in 945 French/Belgian patients with type 1 diabetes from Genesis and GENEDIAB cohorts (diabetic nephropathy: 62.3%). The minor A-allele of CYBB rs6610650 was associated with lower estimated glomerular filtration rate (eGFR) in Brazilian women, and with the prevalence of established/advanced nephropathy in French/Belgian women (odds ratio 1.75, 95% CI 1.11-2.78, p = 0.016). The minor T-allele of GPX4 rs713041 was inversely associated with the prevalence of established/advanced nephropathy in Brazilian men (odds ratio 0.30, 95% CI 0.13-0.68, p = 0.004), and associated with higher eGFR in French/Belgian men. In conclusion, these heterogeneous results suggest that neither CYBB nor GPX4 are major genetic determinants of diabetic nephropathy, but nevertheless, they could modulate in a gender-specific manner the risk for renal disease in patients with type 1 diabetes. PMID:23919599

  13. Sex-specific associations of variants in regulatory regions of NADPH oxidase-2 (CYBB) and glutathione peroxidase 4 (GPX4) genes with kidney disease in type 1 diabetes.


    Monteiro, M B; Patente, T A; Mohammedi, K; Queiroz, M S; Azevedo, M J; Canani, L H; Parisi, M C; Marre, M; Velho, G; Corrêa-Giannella, M L


    Oxidative stress is involved in the pathophysiology of diabetic nephropathy. The superoxide-generating nicotinamide adenine dinucleotide phosphate-oxidase 2 (NOX2, encoded by the CYBB gene) and the antioxidant enzyme glutathione peroxidase 4 (GPX4) play opposing roles in the balance of cellular redox status. In the present study, we investigated associations of single nucleotide polymorphisms (SNPs) in the regulatory regions of CYBB and GPX4 with kidney disease in patients with type 1 diabetes. Two functional SNPs, rs6610650 (CYBB promoter region, chromosome X) and rs713041 (GPX4 3'untranslated region, chromosome 19), were genotyped in 451 patients with type 1 diabetes from a Brazilian cohort (diabetic nephropathy: 44.6%) and in 945 French/Belgian patients with type 1 diabetes from Genesis and GENEDIAB cohorts (diabetic nephropathy: 62.3%). The minor A-allele of CYBB rs6610650 was associated with lower estimated glomerular filtration rate (eGFR) in Brazilian women, and with the prevalence of established/advanced nephropathy in French/Belgian women (odds ratio 1.75, 95% CI 1.11-2.78, p = 0.016). The minor T-allele of GPX4 rs713041 was inversely associated with the prevalence of established/advanced nephropathy in Brazilian men (odds ratio 0.30, 95% CI 0.13-0.68, p = 0.004), and associated with higher eGFR in French/Belgian men. In conclusion, these heterogeneous results suggest that neither CYBB nor GPX4 are major genetic determinants of diabetic nephropathy, but nevertheless, they could modulate in a gender-specific manner the risk for renal disease in patients with type 1 diabetes.

  14. Phylogenetic position of Linguatula arctica and Linguatula serrata (Pentastomida) as inferred from the nuclear 18S rRNA gene and the mitochondrial cytochrome c oxidase subunit I gene.


    Gjerde, Bjørn


    Genomic DNA was isolated from a Linguatula serrata female expelled from a dog imported to Norway from Romania and from four Linguatula arctica females collected from semi-domesticated reindeer from northern Norway and subjected to PCR amplification of the complete nuclear 18S rRNA gene and a 1,045-bp portion of the mitochondrial cytochrome c oxidase subunit I gene (cox1). The two species differed at two of 1,830 nucleotide positions (99.9% identity) of the complete 18S rRNA gene sequences and at 102 of 1,045 nucleotide positions (90.2% identity) of the partial cox1 sequences. The four isolates of L. arctica showed no genetic variation in either gene. The new cox1 primers may facilitate the diagnosis of various developmental stages of L. arctica and L. serrata in their hosts. In separate phylogenetic analyses using the maximum likelihood method on sequence data from either gene, L. arctica and L. serrata clustered with members of the order Cephalobaenida rather than with members of the order Porocephalida, in which the genus Linguatula is currently placed based on morphological characters. The phylogenetic relationship of L. arctica, L. serrata and other pentastomids to other metazoan groups could not be clearly resolved, but the pentastomids did not seem to have a sister relationship to crustaceans of the subclass Branchiura as found in other studies. A more extensive taxon sampling, including molecular characterisation of more pentastomid taxa across different genera, seems to be necessary in order to estimate the true relationship of the Pentastomida to other metazoan groups.

  15. Isolation and characterization of a potato cDNA corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene differentially activated by stress.


    Zanetti, María Eugenia; Terrile, María Cecilia; Arce, Débora; Godoy, Andrea Verónica; Segundo, Blanca San; Casalongué, Claudia


    1-Aminocyclopropane-1-carboxylate (ACC) oxidase enzyme catalyses the final step in ethylene biosynthesis, converting 1-aminocyclopropane-1-carboxylic acid to ethylene. A cDNA clone encoding an ACC oxidase, ST-ACO3, was isolated from potato (Solanum tuberosum L.) by differential screening of a Fusarium eumartii infected-tuber cDNA library. The deduced amino acid sequence exhibited similarity to other ACC oxidase proteins from several plants species. Northern blot analysis revealed that the ST-ACO3 mRNA level increased in potato tubers upon inoculation with F. eumartii, as well as after treatment with salicylic acid and indole-3-acetic acid, suggesting a cross-talk between different signalling pathways involved in the defence response of potato tubers against F. eumartii attack.

  16. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.


    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth


    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  17. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis1[OPEN

    PubMed Central

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth


    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  18. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat.


    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou


    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight

  19. Physiological and biochemical characterisation of watered and drought-stressed barley mutants in the HvDWARF gene encoding C6-oxidase involved in brassinosteroid biosynthesis.


    Janeczko, Anna; Gruszka, Damian; Pociecha, Ewa; Dziurka, Michał; Filek, Maria; Jurczyk, Barbara; Kalaji, Hazem M; Kocurek, Maciej; Waligórski, Piotr


    Brassinosteroids (BR) are plant steroid hormones that were discovered more than thirty years ago, but their physiological function has yet to be fully explained. The aim of the study was to answer the question of whether/how disturbances in the production of BR in barley affects the plant's metabolism and development under conditions of optimal watering and drought. Mutants with an impaired production of BR are one of the best tools in research aimed at understanding the mechanisms of action of these hormones. The study used barley cultivars with a normal BR synthesis (wild type) and semi-dwarf allelic mutants with an impaired activity of C6-oxidase (mutation in HvDWARF), which resulted in a decreased BR synthesis. Half of the plants were subjected to drought stress in the seedling stage and the other half were watered optimally. Plants with impaired BR production were characterised by a lower height and developmental retardation. Under both optimal watering and drought, BR synthesis disorders caused the reduced production of ABA and cytokinins, but not auxins. The BR mutants also produced less osmoprotectant (proline). The optimally watered and drought-stressed mutants accumulated less sucrose, which was accompanied by changes in the production of other soluble sugars. The increased content of fructooligosaccharide (kestose) in optimally watered mutants would suggest that BR is a negative regulator of kestose production. The decreased level of nystose in the drought-stressed mutants also suggests BR involvement in the regulation of the production of this fructooligosaccharide. The accumulation of the transcripts of genes associated with stress response (hsp90) was lower in the watered and drought-stressed BR-deficient mutants. In turn, the lower efficiency of photosystem II and the net photosynthetic rate in mutants was revealed only under drought conditions. The presented research allows for the physiological and biochemical traits of two BR-barley mutants to be

  20. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat

    PubMed Central

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou


    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight

  1. Mitochondrial Cytochrome c Oxidase Deficiency

    PubMed Central

    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre


    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance to study different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  2. Gene × environment effects of serotonin transporter, dopamine receptor D4, and monoamine oxidase A genes with contextual and parenting risk factors on symptoms of oppositional defiant disorder, anxiety, and depression in a community sample of 4-year-old children.


    Lavigne, John V; Herzing, Laura B K; Cook, Edwin H; Lebailly, Susan A; Gouze, Karen R; Hopkins, Joyce; Bryant, Fred B


    Genetic factors can play a key role in the multiple level of analyses approach to understanding the development of child psychopathology. The present study examined gene-environment correlations and gene × environment interactions for polymorphisms of three target genes, the serotonin transporter gene, the D4 dopamine receptor gene, and the monoamine oxidase A gene in relation to symptoms of anxiety, depression, and oppositional behavior. Saliva samples were collected from 175 non-Hispanic White, 4-year-old children. Psychosocial risk factors included socioeconomic status, life stress, caretaker depression, parental support, hostility, and scaffolding skills. In comparison with the short forms (s/s, s/l) of the serotonin transporter linked polymorphic repeat, the long form (l/l) was associated with greater increases in symptoms of oppositional defiant disorder in interaction with family stress and with greater increases in symptoms of child depression and anxiety in interaction with caretaker depression, family conflict, and socioeconomic status. In boys, low-activity monoamine oxidase A gene was associated with increases in child anxiety and depression in interaction with caretaker depression, hostility, family conflict, and family stress. The results highlight the important of gene-environment interplay in the development of symptoms of child psychopathology in young children.

  3. Diversity and Evolutionary History of Iron Metabolism Genes in Diatoms.


    Groussman, Ryan D; Parker, Micaela S; Armbrust, E Virginia


    Ferroproteins arose early in Earth's history, prior to the emergence of oxygenic photosynthesis and the subsequent reduction of bioavailable iron. Today, iron availability limits primary productivity in about 30% of the world's oceans. Diatoms, responsible for nearly half of oceanic primary production, have evolved molecular strategies for coping with variable iron concentrations. Our understanding of the evolutionary breadth of these strategies has been restricted by the limited number of species for which molecular sequence data is available. To uncover the diversity of strategies marine diatoms employ to meet cellular iron demands, we analyzed 367 newly released marine microbial eukaryotic transcriptomes, which include 47 diatom species. We focused on genes encoding proteins previously identified as having a role in iron management: iron uptake (high-affinity ferric reductase, multi-copper oxidase, and Fe(III) permease); iron storage (ferritin); iron-induced protein substitutions (flavodoxin/ferredoxin, and plastocyanin/cytochrome c6) and defense against reactive oxygen species (superoxide dismutases). Homologs encoding the high-affinity iron uptake system components were detected across the four diatom Classes suggesting an ancient origin for this pathway. Ferritin transcripts were also detected in all Classes, revealing a more widespread utilization of ferritin throughout diatoms than previously recognized. Flavodoxin and plastocyanin transcripts indicate possible alternative redox metal strategies. Predicted localization signals for ferredoxin identify multiple examples of gene transfer from the plastid to the nuclear genome. Transcripts encoding four superoxide dismutase metalloforms were detected, including a putative nickel-coordinating isozyme. Taken together, our results suggest that the majority of iron metabolism genes in diatoms appear to be vertically inherited with functional diversity achieved via possible neofunctionalization of paralogs. This

  4. Diversity and Evolutionary History of Iron Metabolism Genes in Diatoms

    PubMed Central

    Groussman, Ryan D.; Parker, Micaela S.; Armbrust, E. Virginia


    Ferroproteins arose early in Earth’s history, prior to the emergence of oxygenic photosynthesis and the subsequent reduction of bioavailable iron. Today, iron availability limits primary productivity in about 30% of the world’s oceans. Diatoms, responsible for nearly half of oceanic primary production, have evolved molecular strategies for coping with variable iron concentrations. Our understanding of the evolutionary breadth of these strategies has been restricted by the limited number of species for which molecular sequence data is available. To uncover the diversity of strategies marine diatoms employ to meet cellular iron demands, we analyzed 367 newly released marine microbial eukaryotic transcriptomes, which include 47 diatom species. We focused on genes encoding proteins previously identified as having a role in iron management: iron uptake (high-affinity ferric reductase, multi-copper oxidase, and Fe(III) permease); iron storage (ferritin); iron-induced protein substitutions (flavodoxin/ferredoxin, and plastocyanin/cytochrome c6) and defense against reactive oxygen species (superoxide dismutases). Homologs encoding the high-affinity iron uptake system components were detected across the four diatom Classes suggesting an ancient origin for this pathway. Ferritin transcripts were also detected in all Classes, revealing a more widespread utilization of ferritin throughout diatoms than previously recognized. Flavodoxin and plastocyanin transcripts indicate possible alternative redox metal strategies. Predicted localization signals for ferredoxin identify multiple examples of gene transfer from the plastid to the nuclear genome. Transcripts encoding four superoxide dismutase metalloforms were detected, including a putative nickel-coordinating isozyme. Taken together, our results suggest that the majority of iron metabolism genes in diatoms appear to be vertically inherited with functional diversity achieved via possible neofunctionalization of paralogs. This

  5. Activity-stability relationships revisited in blue oxidases catalyzing electron transfer at extreme temperatures.


    Roulling, Frédéric; Godin, Amandine; Cipolla, Alexandre; Collins, Tony; Miyazaki, Kentaro; Feller, Georges


    Cuproxidases are a subset of the blue multicopper oxidases that catalyze the oxidation of toxic Cu(I) ions into less harmful Cu(II) in the bacterial periplasm. Cuproxidases from psychrophilic, mesophilic, and thermophilic bacteria display the canonical features of temperature adaptation, such as increases in structural stability and apparent optimal temperature for activity with environmental temperature as well as increases in the binding affinity for catalytic and substrate copper ions. In contrast, the oxidative activities at 25 °C for both the psychrophilic and thermophilic enzymes are similar, suggesting that the nearly temperature-independent electron transfer rate does not require peculiar adjustments. Furthermore, the structural flexibilities of both the psychrophilic and thermophilic enzymes are also similar, indicating that the firm and precise bindings of the four catalytic copper ions are essential for the oxidase function. These results show that the requirements for enzymatic electron transfer, in the absence of the selective pressure of temperature on electron transfer rates, produce a specific adaptive pattern, which is distinct from that observed in enzymes possessing a well-defined active site and relying on conformational changes such as for the induced fit mechanism. PMID:27315165

  6. Molecular characterization of Fasciola hepatica and phylogenetic analysis based on mitochondrial (nicotiamide adenine dinucleotide dehydrogenase subunit I and cytochrome oxidase subunit I) genes from the North-East of Iran

    PubMed Central

    Reaghi, Saber; Haghighi, Ali; Harandi, Majid Fasihi; Spotin, Adel; Arzamani, Kourosh; Rouhani, Soheila


    Aim: Fascioliasis is one of the most zoonotic diseases with global extension. As the epidemiological distribution of Fasciola may lead to various genetic patterns of the parasite, the aim of this study is to identify Fasciola hepatica based on spermatogenesis, and phylogenetic analysis using mitochondrial (nicotiamide adenine dinucleotide dehydrogenase subunit I [ND1] and cytochrome oxidase subunit I) gene marker. Materials and Methods: In this study, 90 F. hepatica collected from 30 cattle at slaughterhouse located in three different geographical locations in the North-East of Iran were evaluated based on spermatogenetic ability and internal transcribed spacer 1 gene restriction fragment length polymorphism pattern. Genetic diversity and phylogenetic relationship using mtDNA gene marker for the isolates from the North-East of Iran, and other countries were then analyzed. Results: Partial sequences of mtDNA showed eight haplotypes in both genes. The phylogenic analysis using neighbor joining as well as maximum likelihood methods showed similar topologies of trees. Pairwise fixation index between different F. hepatica populations calculated from the nucleotide data set of ND1 gene are statistically significant and show the genetic difference. Conclusion: F. hepatica found in this region of Iran has different genetic structures through the other Fasciola populations in the world. PMID:27733809

  7. Engineering Human Urate Oxidase: Towards Reactivating It as an Important Therapeutic Enzyme.


    Dabbagh, Fatemeh; Ghoshoon, Mohammad B; Hemmati, Shiva; Zamani, Mozhdeh; Mohkam, Milad; Ghasemi, Younes


    Urate oxidase is considered as an important therapeutic enzyme used to control hyperuricemia. In spite of widespread distribution in numerous (micro)organisms, active urate oxidase is absent in higher primates (humans and apes) due to gene mutations. Considering the therapeutic significance of urate oxidase, further understanding on the inactivation process of the enzyme during primate evolution is critical. This study, therefore, aims to express genetically modified human urate oxidase in the methylotrophic yeast Pichia pastoris. Accordingly, the genetically modified human urate oxidase was successfully expressed intracellularly and extracellularly under the control of an alcohol oxidase promoter and was subjected to the enzyme activity assay. The results demonstrated that reactivating the non-functional human urate oxidase gene fully or even moderately by simply replacing the premature stop codons is impossible. This finding confirms the idea that a number of successive loss-of-function missense mutations occurred during evolution, making higher primates functional uricase-deficit and vulnerable to hyperuricemic disorders.


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC or EC catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  9. Monoamine Oxidase A (MAOA) and Catechol-O-Methyltransferase (COMT) Gene Polymorphisms Interact with Maternal Parenting in Association with Adolescent Reactive Aggression but not Proactive Aggression: Evidence of Differential Susceptibility.


    Zhang, Wenxin; Cao, Cong; Wang, Meiping; Ji, Linqin; Cao, Yanmiao


    To date, whether and how gene-environment (G × E) interactions operate differently across distinct subtypes of aggression remains untested. More recently, in contrast with the diathesis-stress hypothesis, an alternative hypothesis of differential susceptibility proposes that individuals could be differentially susceptible to environments depending on their genotypes in a "for better and for worse" manner. The current study examined interactions between monoamine oxidase A (MAOA) T941G and catechol-O-methyltransferase (COMT) Val158Met polymorphisms with maternal parenting on two types of aggression: reactive and proactive. Moreover, whether these potential G × E interactions would be consistent with the diathesis-stress versus the differential susceptibility hypothesis was tested. Within the sample of 1399 Chinese Han adolescents (47.2 % girls, M age = 12.32 years, SD = 0.50), MAOA and COMT genes both interacted with positive parenting in their associations with reactive but not proactive aggression. Adolescents with T alleles/TT homozygotes of MAOA gene or Met alleles of COMT gene exhibited more reactive aggression when exposed to low positive parenting, but less reactive aggression when exposed to high positive parenting. These findings provide the first evidence for distinct G × E interaction effects on reactive versus proactive aggression and lend further support for the differential susceptibility hypothesis.

  10. Monoamine Oxidase A (MAOA) and Catechol-O-Methyltransferase (COMT) Gene Polymorphisms Interact with Maternal Parenting in Association with Adolescent Reactive Aggression but not Proactive Aggression: Evidence of Differential Susceptibility.


    Zhang, Wenxin; Cao, Cong; Wang, Meiping; Ji, Linqin; Cao, Yanmiao


    To date, whether and how gene-environment (G × E) interactions operate differently across distinct subtypes of aggression remains untested. More recently, in contrast with the diathesis-stress hypothesis, an alternative hypothesis of differential susceptibility proposes that individuals could be differentially susceptible to environments depending on their genotypes in a "for better and for worse" manner. The current study examined interactions between monoamine oxidase A (MAOA) T941G and catechol-O-methyltransferase (COMT) Val158Met polymorphisms with maternal parenting on two types of aggression: reactive and proactive. Moreover, whether these potential G × E interactions would be consistent with the diathesis-stress versus the differential susceptibility hypothesis was tested. Within the sample of 1399 Chinese Han adolescents (47.2 % girls, M age = 12.32 years, SD = 0.50), MAOA and COMT genes both interacted with positive parenting in their associations with reactive but not proactive aggression. Adolescents with T alleles/TT homozygotes of MAOA gene or Met alleles of COMT gene exhibited more reactive aggression when exposed to low positive parenting, but less reactive aggression when exposed to high positive parenting. These findings provide the first evidence for distinct G × E interaction effects on reactive versus proactive aggression and lend further support for the differential susceptibility hypothesis. PMID:26932718

  11. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.


    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi


    D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression.

  12. Utility of Stable Isotope and Cytochrome Oxidase I Gene Sequencing Analyses in Inferring Origin and Authentication of Hairtail Fish and Shrimp.


    Kim, Heejoong; Kumar, K Suresh; Hwang, Seung Yong; Kang, Byeong-Chul; Moon, Hyo-Bang; Shin, Kyung-Hoon


    Mislabeling of fishery products continues to be a serious threat to the global market. Consequently, there is an urgent necessity to develop tools for authenticating and establishing their true origin. This investigation evaluates the suitability of stable isotopes and cytochrome oxidase I (COI) sequencing in identifying and tracing the origin of hairtail fish and shrimp. By use of COI sequencing, the hairtail fish samples were identified as Trichiurus japonicus and Trichiurus lepturus, while the shrimp samples were identified as Pandalus borealis, Marsupenaeus japonicus, Fenneropenaeus chinensis, Litopenaeus vannamei, Penaeus monodon, and Solenocera crassicornis. Linear discriminant analysis (LDA) of stable isotopes further categorized the individuals of the same species based on the country of origin. Natural and farmed shrimp (from the same country) were distinctly differentiated on the basis of stable isotope values. Therefore, these two methods could be cooperatively utilized to identify and authenticate fishery products, the utilization of which would enhance transparency and fair trade.

  13. Spectroscopic and genetic evidence for two heme-Cu-containing oxidases in Rhodobacter sphaeroides.

    PubMed Central

    Shapleigh, J P; Hill, J J; Alben, J O; Gennis, R B


    It has recently become evident that many bacterial respiratory oxidases are members of a superfamily that is related to the eukaryotic cytochrome c oxidase. These oxidases catalyze the reduction of oxygen to water at a heme-copper binuclear center. Fourier transform infrared (FTIR) spectroscopy has been used to examine the heme-copper-containing respiratory oxidases of Rhodobacter sphaeroides Ga. This technique monitors the stretching frequency of CO bound at the oxygen binding site and can be used to characterize the oxidases in situ with membrane preparations. Oxidases that have a heme-copper binuclear center are recognizable by FTIR spectroscopy because the bound CO moves from the heme iron to the nearby copper upon photolysis at low temperature, where it exhibits a diagnostic spectrum. The FTIR spectra indicate that the binuclear center of the R. sphaeroides aa3-type cytochrome c oxidase is remarkably similar to that of the bovine mitochondrial oxidase. Upon deletion of the ctaD gene, encoding subunit I of the aa3-type oxidase, substantial cytochrome c oxidase remains in the membranes of aerobically grown R. sphaeroides. This correlates with a second wild-type R. sphaeroides is grown photosynthetically, the chromatophore membranes lack the aa3-type oxidase but have this second heme-copper oxidase. Subunit I of the heme-copper oxidase superfamily contains the binuclear center. Amino acid sequence alignments show that this subunit is structurally very highly conserved among both eukaryotic and prokaryotic species. The polymerase chain reaction was used to show that the chromosome of R. sphaeroides contains at least one other gene that is a homolog of ctaD, the gene encoding subunit I of the aa3-type cytochrome c oxidase.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1313003

  14. Modifications of laccase activities of copper efflux oxidase, CueO by synergistic mutations in the first and second coordination spheres of the type I copper center.


    Kataoka, Kunishige; Kogi, Hiroki; Tsujimura, Seiya; Sakurai, Takeshi


    The redox potential of type I copper in the Escherichia coli multicopper oxidase CueO was shifted in the positive or negative direction as a result of the single, double, and triple mutations in the first and second coordination spheres: the formation of the NH···S(-)(Cys500 ligand) hydrogen bond, the breakdown of the NH(His443 ligand)···O(-)(Asp439) hydrogen bond, and the substitution of the Met510 ligand for the non-coordinating Leu or coordinating Gln. Laccase activities of CueO were maximally enhanced 140-fold by virtue of the synergistic effect of mild mutations at and at around the ligand groups to type I copper.

  15. Myiasis of the Tracheostomy Wound Caused by Sarcophaga (Liopygia) argyrostoma (Diptera: Sarcophagidae): Molecular Identification Based on the Mitochondrial Cytochrome c Oxidase I Gene.


    Severini, Francesco; Nocita, Emanuela; Tosini, Fabio


    Wound myiasis is the infestation of open wounds of mammalian hosts caused by larvae of various species of flies. This kind of myiasis can be a serious problem for immobilized patients with open wounds. Here, we identify a dipteran larva found in the tracheostomy wound of a child affected by a severe spinal muscular atrophy. The collected larva was dissected and microscopically analyzed. DNA was extracted from part of the larva and used for the molecular identification. A 487 bp fragment, including part of 5.8 S, the internal transcribed spacer 2 (ITS2), and part of 28S, was amplified using a novel PCR assay to be cloned and sequenced. The barcode region of cytochrome oxidase I (COI) was also cloned and sequenced after PCR amplification. The larva, designated as SASI1, was identified as a third instar of Sarcophaga sp. The COI sequencing confirmed a low similarity with Sarcophaga ruficornis (F.) (95%), yet COI showed a 100% similarity with Sarcophaga argyrostoma (Robineau-Desvoidy, 1830) species. Therefore, SASI1 was identified as a S. argyrostoma larva on the basis of its COI barcode. This is one of the rare cases of myiasis of tracheostomy wound and the first caused by S. argyrostoma.

  16. TNF-{alpha} upregulates the A{sub 2B} adenosine receptor gene: The role of NAD(P)H oxidase 4

    SciTech Connect

    St Hilaire, Cynthia; Koupenova, Milka; Carroll, Shannon H.; Smith, Barbara D.; Ravid, Katya


    Proliferation of vascular smooth muscle cells (VSMC), oxidative stress, and elevated inflammatory cytokines are some of the components that contribute to plaque formation in the vasculature. The cytokine tumor necrosis factor-alpha (TNF-{alpha}) is released during vascular injury, and contributes to lesion formation also by affecting VSMC proliferation. Recently, an A{sub 2B} adenosine receptor (A{sub 2B}AR) knockout mouse illustrated that this receptor is a tissue protector, in that it inhibits VSMC proliferation and attenuates the inflammatory response following injury, including the release of TNF-{alpha}. Here, we show a regulatory loop by which TNF-{alpha} upregulates the A{sub 2B}AR in VSMC in vitro and in vivo. The effect of this cytokine is mimicked by its known downstream target, NAD(P)H oxidase 4 (Nox4). Nox4 upregulates the A{sub 2B}AR, and Nox inhibitors dampen the effect of TNF-{alpha}. Hence, our study is the first to show that signaling associated with Nox4 is also able to upregulate the tissue protecting A{sub 2B}AR.

  17. Lysyl Oxidase Gene G473A Polymorphism and Cigarette Smoking in Association with a High Risk of Lung and Colorectal Cancers in a North Chinese Population.


    Wang, Guoli; Shen, Yanqing; Cheng, Guang; Bo, Haimei; Lin, Jia; Zheng, Maogen; Li, Jianmin; Zhao, Yinzhi; Li, Wande


    The relationship among the lysyl oxidase (LOX) G473A single nucleotide polymorphism (SNP), cigarette smoking and lung, colorectal, colon and rectum cancer susceptibility was studied in 200 cases of lung cancer, 335 cases of colorectal cancer including 130 cases of colon cancer and 205 cases of rectum cancer, and 335 healthy people in Tangshan, China. Peripheral blood DNA samples were collected, DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) performed, followed by multivariate logistic regression analysis. In comparison to LOX473GG genotype carriers, individuals with LOX473AA exhibited a higher susceptibility to lung, colon-rectum, colon, and rectum cancers with OR values amounting to 3.84-, 2.74-, 2.75-, and 2.74-fold of the control, respectively. In the LOX 473AA-positive population, females were more susceptible than males to carcinogenesis with OR values (female vs. male): 5.25 vs. 3.23, 2.29 vs. 1.51, 2.27 vs. 1.45, and 2.25 vs. 1.53, respectively, for lung, colon-rectum combined, colon, and rectum cancers. LOX G473A polymorphism apparently elevated human sensitivity to cigarette smoking carcinogens for eliciting cancers in the lung and colon only. Thus, LOX G473A polymorphism positively correlates with carcinogenesis and it may be used as an ideal intrinsic biomarker for prediction or diagnosis of carcinogenesis in humans. PMID:27367711

  18. Improved detection of malaria cases in island settings of Vanuatu and Kenya by PCR that targets the Plasmodium mitochondrial cytochrome c oxidase III (cox3) gene.


    Isozumi, Rie; Fukui, Mayumi; Kaneko, Akira; Chan, Chim W; Kawamoto, Fumihiko; Kimura, Masatsugu


    Detection of sub-microscopic parasitemia is crucial for all malaria elimination programs. PCR-based methods have proven to be sensitive, but two rounds of amplification (nested PCR) are often needed to detect the presence of Plasmodium DNA. To simplify the detection process, we designed a nested PCR method whereby only the primary PCR is required for the detection of the four major human Plasmodium species. Primers designed for the detection of the fifth species, Plasmodium knowlesi, were not included in this study due to the absence of appropriate field samples. Compared to the standard 18S rDNA PCR method, our cytochrome c oxidase III (cox3) method detected 10-50% more cases while maintaining high sensitivities (1.00) for all four Plasmodium species in our samples from Vanuatu (n=77) and Kenya (n=76). Improvement in detection efficiency was more substantial for samples with sub-microscopic parasitemia (54%) than those with observable parasitemia (10-16%). Our method will contribute to improved malaria surveillance in low endemicity settings.

  19. Lysyl Oxidase Gene G473A Polymorphism and Cigarette Smoking in Association with a High Risk of Lung and Colorectal Cancers in a North Chinese Population

    PubMed Central

    Wang, Guoli; Shen, Yanqing; Cheng, Guang; Bo, Haimei; Lin, Jia; Zheng, Maogen; Li, Jianmin; Zhao, Yinzhi; Li, Wande


    The relationship among the lysyl oxidase (LOX) G473A single nucleotide polymorphism (SNP), cigarette smoking and lung, colorectal, colon and rectum cancer susceptibility was studied in 200 cases of lung cancer, 335 cases of colorectal cancer including 130 cases of colon cancer and 205 cases of rectum cancer, and 335 healthy people in Tangshan, China. Peripheral blood DNA samples were collected, DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) performed, followed by multivariate logistic regression analysis. In comparison to LOX473GG genotype carriers, individuals with LOX473AA exhibited a higher susceptibility to lung, colon-rectum, colon, and rectum cancers with OR values amounting to 3.84-, 2.74-, 2.75-, and 2.74-fold of the control, respectively. In the LOX 473AA-positive population, females were more susceptible than males to carcinogenesis with OR values (female vs. male): 5.25 vs. 3.23, 2.29 vs. 1.51, 2.27 vs. 1.45, and 2.25 vs. 1.53, respectively, for lung, colon-rectum combined, colon, and rectum cancers. LOX G473A polymorphism apparently elevated human sensitivity to cigarette smoking carcinogens for eliciting cancers in the lung and colon only. Thus, LOX G473A polymorphism positively correlates with carcinogenesis and it may be used as an ideal intrinsic biomarker for prediction or diagnosis of carcinogenesis in humans. PMID:27367711

  20. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase

    PubMed Central

    Le Laz, Sébastien; kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam


    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  1. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase.


    Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam


    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  2. NADPH oxidases in the arbuscular mycorrhizal symbiosis

    PubMed Central

    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa


    ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

  3. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi


    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 μ m in average length and 5 μ m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and α =β 90 degrees, γ = 126 degrees.

  4. Replacement of a terminal cytochrome c oxidase by ubiquinol oxidase during the evolution of acetic acid bacteria.


    Matsutani, Minenosuke; Fukushima, Kota; Kayama, Chiho; Arimitsu, Misato; Hirakawa, Hideki; Toyama, Hirohide; Adachi, Osao; Yakushi, Toshiharu; Matsushita, Kazunobu


    The bacterial aerobic respiratory chain has a terminal oxidase of the heme-copper oxidase superfamily, comprised of cytochrome c oxidase (COX) and ubiquinol oxidase (UOX); UOX evolved from COX. Acetobacter pasteurianus, an α-Proteobacterial acetic acid bacterium (AAB), produces UOX but not COX, although it has a partial COX gene cluster, ctaBD and ctaA, in addition to the UOX operon cyaBACD. We expressed ctaB and ctaA genes of A. pasteurianus in Escherichia coli and demonstrated their function as heme O and heme A synthases. We also found that the absence of ctaD function is likely due to accumulated mutations. These COX genes are closely related to other α-Proteobacterial COX proteins. However, the UOX operons of AAB are closely related to those of the β/γ-Proteobacteria (γ-type UOX), distinct from the α/β-Proteobacterial proteins (α-type UOX), but different from the other γ-type UOX proteins by the absence of the cyoE heme O synthase. Thus, we suggest that A. pasteurianus has a functional γ-type UOX but has lost the COX genes, with the exception of ctaB and ctaA, which supply the heme O and A moieties for UOX. Our results suggest that, in AAB, COX was replaced by β/γ-Proteobacterial UOX via horizontal gene transfer, while the COX genes, except for the heme O/A synthase genes, were lost. PMID:24862920

  5. Alternative oxidase and plastoquinol terminal oxidase in marine prokaryotes of the Sargasso Sea.


    McDonald, Allison E; Vanlerberghe, Greg C


    Alternative oxidase (AOX) represents a non-energy conserving branch in mitochondrial electron transport while plastoquinol terminal oxidase (PTOX) represents a potential branch in photosynthetic electron transport. Using a metagenomics dataset, we have uncovered numerous and diverse AOX and PTOX genes from the Sargasso Sea. Sequence similarity, synteny and phylogenetic analyses indicate that the large majority of these genes are from prokaryotes. AOX appears to be widely distributed among marine Eubacteria while PTOX is widespread among strains of cyanobacteria closely related to the high-light adapted Prochlorococcus marinus MED4, as well as Synechococcus. The wide distribution of AOX and PTOX in marine prokaryotes may have important implications for productivity in the world's oceans.

  6. Engineering the central pathways in Lactococcus lactis: functional expression of the phosphofructokinase (pfk) and alternative oxidase (aox1) genes from Aspergillus niger in Lactococcus lactis facilitates improved carbon conversion rates under oxidizing conditions.


    Papagianni, Maria; Avramidis, Nicholaos


    The present work describes a novel central pathway engineering method that has been designed with the aim to increase the carbon conversion rates under oxidizing conditions in L. lactis fermentations. The nisin producer L. lactis ATCC11454 strain has been genetically engineered by cloning a truncated version of the phosphofructokinase gene (pfk13), along with the pkaC, encoding for the catalytic subunit of cAMP-dependent protein kinase, and the alternative oxidase (aox1) genes of A. niger. Functional expression of the above genes resulted in enhanced PFK activity and the introduction of AOX activity and alternative respiration in the presence of a source of heme in the substrate, under fully aerobic growth conditions. The constructed strain is capable of fermenting high concentrations of glucose as was demonstrated in a series of glucostat fed-batch fermentations with glucose levels maintained at 55, 138 and 277 mM. The high maximum specific uptake rate of glucose of 1.8 mMs(-1)gCDW(-1) at 277 mM glucose is characteristic of the improved ability of the microorganism to handle elevated glucose concentrations under conditions otherwise causing severe reduction of PFK activity. The increased carbon flow through glycolysis led to increased protein synthesis that was reflected in increased biomass and nisin levels. The pfk 13-pkaC-aox1-transformant strain's fermentation at 277 mM glucose gave a final biomass concentration of 7.5 g/l and nisin activity of 14,000 IU/ml which is, compared to the parental strain's production levels at its optimal 55 mM glucose, increased by a factor of 2.34 for biomass and 4.37 for nisin. PMID:22759530

  7. A complex organization of the gene encoding cytochrome oxidase subunit 1 in the mitochondrial genome of the dinoflagellate, Crypthecodinium cohnii: homologous recombination generates two different cox1 open reading frames.


    Norman, J E; Gray, M W


    In the course of investigating mitochondrial genome organization in Crypthecodinium cohnii, a non-photosynthetic dinoflagellate, we identified four EcoRI fragments that hybridize to a probe specific for cox1, the gene that encodes subunit 1 of cytochrome oxidase. Cloning and sequence characterization of the four fragments (5.7, 5.1, 4.1, 3.5 kilobase pairs) revealed that cox1 exists in four distinct but related contexts in C. cohnii mtDNA, with a central repeat unit flanked by one of two possible upstream (flanking domain 1 or 2) and downstream (flanking domain 3 or 4) regions. The majority of the cox1 gene is located within the central repeat; however, the C-terminal portion of the open reading frame extends into flanking domains 3 and 4, thereby creating two distinct cox1 coding sequences. The 3'-terminal region of one of the cox1 reading frames can assume an elaborate secondary structure, which potentially could act to stabilize the mature mRNA against nucleolytic degradation. In addition, a high density of small inverted repeats (15-22 base pairs) has been identified at the 5'-end of cox1, further suggesting that hairpin structures could be important for gene regulation. The organization of cox1 in C. cohnii mtDNA appears to reflect homologous recombination events within the central repeat between different cox1 sequence contexts. Such recombining repeats are a characteristic feature of plant (angiosperm) mtDNA, but they have not previously been described in the mitochondrial genomes of protists.

  8. Culture-Independent Identification of Manganese-Oxidizing Genes from Deep-Sea Hydrothermal Vent Chemoautotrophic Ferromanganese Microbial Communities Using a Metagenomic Approach

    NASA Astrophysics Data System (ADS)

    Davis, R.; Tebo, B. M.


    Microbial activity has long been recognized as being important to the fate of manganese (Mn) in hydrothermal systems, yet we know very little about the organisms that catalyze Mn oxidation, the mechanisms by which Mn is oxidized or the physiological function that Mn oxidation serves in these hydrothermal systems. Hydrothermal vents with thick ferromanganese microbial mats and Mn oxide-coated rocks observed throughout the Pacific Ring of Fire are ideal models to study the mechanisms of microbial Mn oxidation, as well as primary productivity in these metal-cycling ecosystems. We sampled ferromanganese microbial mats from Vai Lili Vent Field (Tmax=43°C) located on the Eastern Lau Spreading Center and Mn oxide-encrusted rhyolytic pumice (4°C) from Niua South Seamount on the Tonga Volcanic Arc. Metagenomic libraries were constructed and assembled from these samples and key genes known to be involved in Mn oxidation and carbon fixation pathways were identified in the reconstructed genomes. The Vai Lili metagenome assembled to form 121,157 contiguous sequences (contigs) greater than 1000bp in length, with an N50 of 8,261bp and a total metagenome size of 593 Mbp. Contigs were binned using an emergent self-organizing map of tetranucleotide frequencies. Putative homologs of the multicopper Mn-oxidase MnxG were found in the metagenome that were related to both the Pseudomonas-like and Bacillus-like forms of the enzyme. The bins containing the Pseudomonas-like mnxG genes are most closely related to uncultured Deltaproteobacteria and Chloroflexi. The Deltaproteobacteria bin appears to be an obligate anaerobe with possible chemoautotrophic metabolisms, while the Chloroflexi appears to be a heterotrophic organism. The metagenome from the Mn-stained pumice was assembled into 122,092 contigs greater than 1000bp in length with an N50 of 7635 and a metagenome size of 385 Mbp. Both forms of mnxG genes are present in this metagenome as well as the genes encoding the putative Mn

  9. Overexpression of a GmCnx1 Gene Enhanced Activity of Nitrate Reductase and Aldehyde Oxidase, and Boosted Mosaic Virus Resistance in Soybean

    PubMed Central

    Ma, Luping; Yu, Xiaoqian; Mi, Qian; Pang, Jingsong; Tang, Guixiang; Liu, Bao


    Molybdenum cofactor (Moco) is required for the activities of Moco-dependant enzymes. Cofactor for nitrate reductase and xanthine dehydrogenase (Cnx1) is known to be involved in the biosynthesis of Moco in plants. In this work, a soybean (Glycine max L.) Cnx1 gene (GmCnx1) was transferred into soybean using Agrobacterium tumefaciens-mediated transformation method. Twenty seven positive transgenic soybean plants were identified by coating leaves with phosphinothricin, bar protein quick dip stick and PCR analysis. Moreover, Southern blot analysis was carried out to confirm the insertion of GmCnx1 gene. Furthermore, expression of GmCnx1 gene in leaf and root of all transgenic lines increased 1.04-2.12 and 1.55-3.89 folds, respectively, as compared to wild type with GmCnx1 gene and in line 10 , 22 showing the highest expression. The activities of Moco-related enzymes viz nitrate reductase (NR) and aldehydeoxidase (AO) of T1 generation plants revealed that the best line among the GmCnx1 transgenic plants accumulated 4.25 μg g-1 h-1 and30 pmol L-1, respectively (approximately 2.6-fold and 3.9-fold higher than non-transgenic control plants).In addition, overexpression ofGmCnx1boosted the resistance to various strains of soybean mosaic virus (SMV). DAS-ELISA analysis further revealed that infection rate of GmCnx1 transgenic plants were generally lower than those of non-transgenic plants among two different virus strains tested. Taken together, this study showed that overexpression of a GmCnx1 gene enhanced NR and AO activities and SMV resistance, suggesting its important role in soybean genetic improvement. PMID:25886067

  10. Transcriptional coupling of synaptic transmission and energy metabolism: role of nuclear respiratory factor 1 in co-regulating neuronal nitric oxide synthase and cytochrome c oxidase genes in neurons.


    Dhar, Shilpa S; Liang, Huan Ling; Wong-Riley, Margaret T T


    Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts down-regulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level.

  11. Association study of monoamine oxidase-A gene promoter polymorphism (MAOA-uVNTR) with self-reported anxiety and other psychopathological symptoms in a community sample of early adolescents.


    Voltas, Núria; Aparicio, Estefania; Arija, Victoria; Canals, Josefa


    The polymorphism upstream of the gene for monoamine oxidase A (MAOA-uVNTR) is reported to be an important enzyme involved in human physiology and behavior. With a sample of 228 early-adolescents from a community sample (143 girls) and adjusting for environmental variables, we examined the influence of MAOA-uVNTR alleles on the scores obtained in the Screen for Childhood Anxiety and Related Emotional Disorders and in the Child Symptom Inventory-4. Our results showed that girls with the high-activity MAOA allele had higher scores for generalized and total anxiety than their low-activity peers, whereas boys with the low-activity allele had higher social phobia scores than boys with the high-activity allele. Results for conduct disorder symptoms did not show a significant relationship between the MAOA alleles and the presence of these symptoms. Our findings support a possible association, depending on gender, between the MAOA-uVNTR polymorphism and psychopathological disorders such as anxiety, which affects high rates of children and adolescents. PMID:25747527

  12. Exploring the utility of phylogenetic analysis of cytochrome oxidase gene subunit I as a complementary tool to classical taxonomical identification of phlebotomine sand fly species (Diptera, Psychodidae) from southern Europe.


    Maia, Carla; Parreira, Ricardo; Cristóvão, José Manuel; Afonso, Maria Odete; Campino, Lenea


    Phlebotomine sand flies (Diptera, Psychodidae) are known to be vectors of several pathogens such as Leishmania and Phlebovirus genera. The identification of phlebotomine sand fly species is currently based on morphological characters, and requires considerable taxonomic expertise and skilfulness, but may be complemented by DNA-based analyses for (i) accurate species identification and (ii) for estimating sand fly diversity. The aim of this study was to evaluate the utility of mitochondrial cytochrome oxidase gene subunit I (cox1) sequence analysis as a complementary tool to classical taxonomical for the identification of the most prevalent phlebotomine sand fly species from southern Europe (i.e. Phlebotomus ariasi, P. perniciosus, P. sergenti and Sergentomyia minuta). Phylogenetic analyses of cox1 sequences allowed conclusive assignment of most of the sand flies into individual species, and revealed the genetic heterogeneity that characterizes some of the identified genetic clusters. Nevertheless, it showed some limitations, as it failed to (i) allocate correctly all of all species of a given subgenus to a single lineage, or (ii) conclusively identify sequences amplified from individuals classified morphologically as P. ariasi. A more extensive analysis of cox1 sequences together with morphometric characterization of specimens from different geographic areas/regions might be useful for the correct assessment of the phylogenetic relationship within the P. ariasi/P. chadlii cluster and/or help to ascertain the usefulness of cox1 for molecular taxonomy of sand flies.

  13. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G


    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  14. Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells

    SciTech Connect

    Kim, Dong Joon; Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung; Kang, Dong Chul; Sang, Byung Chan; Myung, Pyung Keun; Park, Kyung Chan Yeom, Young Il


    Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

  15. Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.


    Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji


    Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at

  16. Indole-3-ethanol Oxidase

    PubMed Central

    Percival, Frank W.; Purves, William K.; Vickery, Larry E.


    We report the further characterization of indole-3-ethanol oxidase from cucumber seedlings. The effects of various inhibitors suggest that the enzyme may be a flavoprotein with a metal ion and sulfhydryl groups required for full activity. Indole-3-acetaldehyde, a product of the reaction, inhibits the enzyme. This inhibition is overcome by O2 but not by indole-3-ethanol, indicating that the kinetic mechanism of the enzyme is a ping-pong Bi-Bi. The enzyme undergoes cooperative interactions with indoleethanol, yielding Hill coefficients as high as 2.96. Gibberellins are without effect on the enzyme, but it is inhibited by several acidic indoles possessing growth-promoting activity and by two synthetic auxins, 2,4-dichlorophenoxyacetic acid and 2,4,5-trichlorophenoxyacetic acid. Increasing concentrations of indoleacetic acid (IAA) brought about a slight reduction in the indoleethanol concentration producing halfmaximal velocity. Increasing levels of indoleethanol decreased the concentration of IAA required for half-maximal inhibition. At low concentrations of indoleethanol, low levels of IAA activated rather than inhibited. The effect of IAA was not overcome at higher levels of indoleethanol. These results may be interpreted as showing that IAA is a noncompetitive inhibitor which binds to that conformation of the enzyme which also binds indoleethanol. The significance of these interactions for the regulation of IAA biosynthesis is discussed. PMID:16658401

  17. After-ripening alters the gene expression pattern of oxidases involved in the ethylene and gibberellin pathways during early imbibition of Sisymbrium officinale L. seeds.


    Iglesias-Fernández, Raquel; Matilla, Angel


    After-ripening (AR) in Sisymbrium officinale seeds altered SoACS7, SoACO2, SoGA20ox2, SoGA3ox2, and SoGA2ox6 gene expression. Except for SoGA20ox2 expression, which sharply diminished, the expression of the other genes rose during development, particularly that of SoACS7. In contrast, only the SoACO2 and SoGA2ox6 transcripts increased with seed desiccation; the others decreased. AR increased the SoGA3ox2 transcript in dry seed, but dramatically decreased the SoACS7 transcript. At the onset of imbibition, AR inhibited SoACS7 and SoACO2 expression and stimulated that of SoGA20ox2, SoGA3ox2, and SoGA2ox6, demonstrating that the participation of ethylene (ET) and gibberellins (GAs) differs in after-ripened and non-after-ripened seeds. The inhibition of SoACO2 expression in the presence of GA(4+7), paclobutrazol (PB), inhibitors of ET synthesis and signalling (IESS), and notably ET+GA(4+7) indicated ET-GA cross-talk in non-after-ripened seeds. A positive effect of AR in reversing this inhibition was found. The idea of ET-GA cross-talk is also supported by the effect of ET on SoGA3ox2 expression, notably induced by the AR process. In contrast, SoGA20ox2 expression did not appear to be susceptible to AR. SoGA2ox6 expression, poorly known in seeds, suggests that AR prompted an up-regulation under all treatments studied, whereas in non-after-ripened seeds expression was down-regulated. On the other hand, the beta-mannanase (MAN) activity dramatically increased in dry after-ripened seed, being significantly boosted by ET. The absence of MAN inhibition by IESS suggests that although ET seems to be one of the factors controlling MAN, its presence did not appear to be essential. GA(4+7) only increased MAN in seeds which were after-ripened. Here, it is proposed that ET and GAs participate actively in establishing the AR process.

  18. Genetic differentiation of octopuses from different habitats near the Korean Peninsula and eastern China based on analysis of the mDNA cytochrome C oxidase 1 gene.


    Kang, J-H; Park, J-Y; Choi, T-J


    Distributed along the coastal waters of Korea and China, Octopus minor is found in various habitats, including the mud flats in the southern and western coasts of the Korean Peninsula and the rocky areas around Jeju Island; however, the genetic relationships among the different populations are unknown and have not been studied. We compared 630-nucleotide sequences of the CO1 gene from O. minor specimens collected from five regions around the Korean Peninsula and three regions from eastern China in order to determine population structure and genetic relationships. Based on the sequences at 12 polymorphic sites in this region, 11 haplotypes were identified from 85 specimens. Individuals from Jeju Island had unique haplotypes, including two haplotypes not found in the other populations. Nucleotide and haplotype diversity for all populations ranged from 0.03-0.37 and 0.20-0.64, respectively. Pairwise F(ST) values indicated significant genetic differences in populations from Korea and China. An UPGMA dendrogram showed separation of the eight populations into three clusters; one included only the Jeju population, another included the rest of the Korean populations and some from Dalian, China; a third cluster consisted of two other populations from China. We conclude that there are discrete genetic differences in O. minor from the different habitats, suggesting that the populations should be considered as management units in the ongoing recovery program.

  19. Absence of population genetic structure in Heterakis gallinarum of chicken from Sichuan, inferred from mitochondrial cytochrome c oxidase subunit I gene.


    Gu, Xiaobin; Zhu, Jun-Yang; Jian, Ke-Ling; Wang, Bao-Jian; Peng, Xue-Rong; Yang, Guang-You; Wang, Tao; Zhong, Zhi-Jun; Peng, Ke-Yun


    Population genetics information provides a foundation for understanding the transmission and epidemiology of parasite and, therefore, may be used to assist in the control of parasitosis. However, limited available sequence information in Heterakis gallinarum has greatly impeded the study in this area. In this study, we first investigated the genetic variability and genetic structure of H. gallinarum. The 1325 bp fragments of the mitochondrial COX1 gene were amplified in 56 isolates of H. gallinarum from seven different geographical regions in Sichuan province, China. The 56 sequences were classified into 22 haplotypes (H1-H22). The values of haplotype diversity (0.712) and nucleotide diversity (0.00158) in Sichuan population indicate a rapid expansion occurred from a relatively small, short-term effective population in the past. The haplotype network formed a distribution around H1 in a star-like topology, and the haplotypes did not cluster according to their geographical location. Similar conclusions could be made from MP phylogenetic tree. The Fst value (Fst<0.16965) and AMOVA analysis revealed that no significant genetic differentiation was observed among the seven different geographical populations. Neutrality tests (Tajima's D and Fu's Fs) and mismatch analysis indicated that H. gallinarum experienced a population expansion in the past. Our results indicated that H. gallinarum experienced a rapid population expansion in the past, and there was a low genetic diversity and an absence of population structure across the population.

  20. Resurrection of New Caledonian maskray Neotrygon trigonoides (Myliobatoidei: Dasyatidae) from synonymy with N. kuhlii, based on cytochrome-oxidase I gene sequences and spotting patterns.


    Borsa, Philippe; Arlyza, Irma S; Chen, Wei-Jen; Durand, Jean-Dominique; Meekan, Mark G; Shen, Kang-Ning


    The maskray from New Caledonia, Neotrygon trigonoides Castelnau, 1873, has been recently synonymized with the blue-spotted maskray, N. kuhlii (Müller and Henle, 1841), a species with wide Indo-West Pacific distribution, but the reasons for this are unclear. Blue-spotted maskray specimens were collected from the Indian Ocean (Tanzania, Sumatra) and the Coral Triangle (Indonesia, Taiwan, and West Papua), and N. trigonoides specimens were collected from New Caledonia (Coral-Sea). Their partial COI gene sequences were generated to expand the available DNA-barcode database on this species, which currently comprises homologous sequences from Ningaloo Reef, the Coral Triangle and the Great Barrier Reef (Coral-Sea). Spotting patterns were also compared across regions. Haplotypes from the Coral-Sea formed a haplogroup phylogenetically distinct from all other haplotypes sampled in the Indo-West Pacific. No clear-cut geographic composition relative to DNA-barcodes or spotting patterns was apparent in N. kuhlii samples across the Indian Ocean and the Coral Triangle. The New Caledonian maskray had spotting patterns markedly different from all the other samples. This, added to a substantial level of net nucleotide divergence (2.6%) with typical N. kuhlii justifies considering the New Caledonian maskray as a separate species, for which we propose to resurrect the name Neotrygon trigonoides. PMID:23849725

  1. Absence of population genetic structure in Heterakis gallinarum of chicken from Sichuan, inferred from mitochondrial cytochrome c oxidase subunit I gene.


    Gu, Xiaobin; Zhu, Jun-Yang; Jian, Ke-Ling; Wang, Bao-Jian; Peng, Xue-Rong; Yang, Guang-You; Wang, Tao; Zhong, Zhi-Jun; Peng, Ke-Yun


    Population genetics information provides a foundation for understanding the transmission and epidemiology of parasite and, therefore, may be used to assist in the control of parasitosis. However, limited available sequence information in Heterakis gallinarum has greatly impeded the study in this area. In this study, we first investigated the genetic variability and genetic structure of H. gallinarum. The 1325 bp fragments of the mitochondrial COX1 gene were amplified in 56 isolates of H. gallinarum from seven different geographical regions in Sichuan province, China. The 56 sequences were classified into 22 haplotypes (H1-H22). The values of haplotype diversity (0.712) and nucleotide diversity (0.00158) in Sichuan population indicate a rapid expansion occurred from a relatively small, short-term effective population in the past. The haplotype network formed a distribution around H1 in a star-like topology, and the haplotypes did not cluster according to their geographical location. Similar conclusions could be made from MP phylogenetic tree. The Fst value (Fst<0.16965) and AMOVA analysis revealed that no significant genetic differentiation was observed among the seven different geographical populations. Neutrality tests (Tajima's D and Fu's Fs) and mismatch analysis indicated that H. gallinarum experienced a population expansion in the past. Our results indicated that H. gallinarum experienced a rapid population expansion in the past, and there was a low genetic diversity and an absence of population structure across the population. PMID:26394200

  2. Genetic differentiation of octopuses from different habitats near the Korean Peninsula and eastern China based on analysis of the mDNA cytochrome C oxidase 1 gene.


    Kang, J-H; Park, J-Y; Choi, T-J


    Distributed along the coastal waters of Korea and China, Octopus minor is found in various habitats, including the mud flats in the southern and western coasts of the Korean Peninsula and the rocky areas around Jeju Island; however, the genetic relationships among the different populations are unknown and have not been studied. We compared 630-nucleotide sequences of the CO1 gene from O. minor specimens collected from five regions around the Korean Peninsula and three regions from eastern China in order to determine population structure and genetic relationships. Based on the sequences at 12 polymorphic sites in this region, 11 haplotypes were identified from 85 specimens. Individuals from Jeju Island had unique haplotypes, including two haplotypes not found in the other populations. Nucleotide and haplotype diversity for all populations ranged from 0.03-0.37 and 0.20-0.64, respectively. Pairwise F(ST) values indicated significant genetic differences in populations from Korea and China. An UPGMA dendrogram showed separation of the eight populations into three clusters; one included only the Jeju population, another included the rest of the Korean populations and some from Dalian, China; a third cluster consisted of two other populations from China. We conclude that there are discrete genetic differences in O. minor from the different habitats, suggesting that the populations should be considered as management units in the ongoing recovery program. PMID:23212336

  3. Resurrection of New Caledonian maskray Neotrygon trigonoides (Myliobatoidei: Dasyatidae) from synonymy with N. kuhlii, based on cytochrome-oxidase I gene sequences and spotting patterns.


    Borsa, Philippe; Arlyza, Irma S; Chen, Wei-Jen; Durand, Jean-Dominique; Meekan, Mark G; Shen, Kang-Ning


    The maskray from New Caledonia, Neotrygon trigonoides Castelnau, 1873, has been recently synonymized with the blue-spotted maskray, N. kuhlii (Müller and Henle, 1841), a species with wide Indo-West Pacific distribution, but the reasons for this are unclear. Blue-spotted maskray specimens were collected from the Indian Ocean (Tanzania, Sumatra) and the Coral Triangle (Indonesia, Taiwan, and West Papua), and N. trigonoides specimens were collected from New Caledonia (Coral-Sea). Their partial COI gene sequences were generated to expand the available DNA-barcode database on this species, which currently comprises homologous sequences from Ningaloo Reef, the Coral Triangle and the Great Barrier Reef (Coral-Sea). Spotting patterns were also compared across regions. Haplotypes from the Coral-Sea formed a haplogroup phylogenetically distinct from all other haplotypes sampled in the Indo-West Pacific. No clear-cut geographic composition relative to DNA-barcodes or spotting patterns was apparent in N. kuhlii samples across the Indian Ocean and the Coral Triangle. The New Caledonian maskray had spotting patterns markedly different from all the other samples. This, added to a substantial level of net nucleotide divergence (2.6%) with typical N. kuhlii justifies considering the New Caledonian maskray as a separate species, for which we propose to resurrect the name Neotrygon trigonoides.

  4. The Escherichia coli CydX protein is a member of the CydAB cytochrome bd oxidase complex and is required for cytochrome bd oxidase activity.


    VanOrsdel, Caitlin E; Bhatt, Shantanu; Allen, Rondine J; Brenner, Evan P; Hobson, Jessica J; Jamil, Aqsa; Haynes, Brittany M; Genson, Allyson M; Hemm, Matthew R


    Cytochrome bd oxidase operons from more than 50 species of bacteria contain a short gene encoding a small protein that ranges from ∼30 to 50 amino acids and is predicted to localize to the cell membrane. Although cytochrome bd oxidases have been studied for more than 70 years, little is known about the role of this small protein, denoted CydX, in oxidase activity. Here we report that Escherichia coli mutants lacking CydX exhibit phenotypes associated with reduced oxidase activity. In addition, cell membrane extracts from ΔcydX mutant strains have reduced oxidase activity in vitro. Consistent with data showing that CydX is required for cytochrome bd oxidase activity, copurification experiments indicate that CydX interacts with the CydAB cytochrome bd oxidase complex. Together, these data support the hypothesis that CydX is a subunit of the CydAB cytochrome bd oxidase complex that is required for complex activity. The results of mutation analysis of CydX suggest that few individual amino acids in the small protein are essential for function, at least in the context of protein overexpression. In addition, the results of analysis of the paralogous small transmembrane protein AppX show that the two proteins could have some overlapping functionality in the cell and that both have the potential to interact with the CydAB complex.

  5. Novel genetic diversity within Anopheles punctimacula s.l.: phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2).


    Loaiza, Jose R; Scott, Marilyn E; Bermingham, Eldredge; Sanjur, Oris I; Rovira, Jose R; Dutari, Larissa C; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E


    Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3' COI), the Barcode region in the five prime end of the COI (5' COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3' COI depicted six highly supported molecular lineages (A-F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5' COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3' COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

  6. Molecular identification of sibling species of Sclerodermus (Hymenoptera: Bethylidae) that parasitize buprestid and cerambycid beetles by using partial sequences of mitochondrial DNA cytochrome oxidase subunit 1 and 28S ribosomal RNA gene.


    Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia


    The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1-5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1-4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus.

  7. Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

    PubMed Central

    Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia


    The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

  8. NADPH oxidases in Eukaryotes: red algae provide new hints!


    Hervé, Cécile; Tonon, Thierry; Collén, Jonas; Corre, Erwan; Boyen, Catherine


    The red macro-alga Chondrus crispus is known to produce superoxide radicals in response to cell-free extracts of its green algal pathogenic endophyte Acrochaete operculata. So far, no enzymes involved in this metabolism have been isolated from red algae. We report here the isolation of a gene encoding a homologue of the respiratory burst oxidase gp91(phox) in C. crispus, named Ccrboh. This single copy gene encodes a polypeptide of 825 amino acids. Search performed in available genome and EST algal databases identified sequences showing common features of NADPH oxidases in other algae such as the red unicellular Cyanidioschyzon merolae, the economically valuable red macro-alga Porphyra yezoensis and the two diatoms Phaeodactylum tricornutum and Thalassiosira pseudonana. Domain organization and phylogenetic relationships with plant, animal, fungal and algal NADPH oxidase homologues were analyzed. Transcription analysis of the C. crispus gene revealed that it was over-transcribed during infection of C. crispus gametophyte by the endophyte A. operculata, and after incubation in presence of atrazine, methyl jasmonate and hydroxyperoxides derived from C20 polyunsaturated fatty acids (PUFAs). These results also illustrate the interest of exploring the red algal lineage for gaining insight into the deep evolution of NADPH oxidases in Eukaryotes.

  9. [Alternative oxidase in industrial fungi].


    Gu, Shuai; Liu, Qiang; He, Hao; Li, Shuang


    Filamentous fungi have been used in industrial fermentation extensively. Based on non-phosphorylating electron transport process, alternative respiration pathway (ARP) acts as an energy overflow, which can balance carbon metabolism and electron transport, allow the continuance of tricarboxylic acid cycle without the formation of ATP, and permit the turnover of carbon skeletons. Alternative respiration pathway also plays an important role in the stress response of fungi and the physiological function of conditioned pathogen. Alternative oxidase (AOX) is the terminal oxidase responsible for the activity of alternative respiration pathway, which exists widely in higher plants, parts of fungi and algae. Owing to the property that alternative oxidase (AOX) is sensitive to salicylhydroxamic acid (SHAM) and insensitive to conventional inhibitors of cytochrome respiration, alternative respiration pathway by AOX is also named as cyanide-resistant respiration (CRR). In recent years, the study of the alternative respiration pathway and alternative oxidase has been a hot topic in the area involving cellular respiration metabolism. In this review we summarized the latest research advances about the functions of alternative respiration pathway and alternative oxidase in industrial fungi.

  10. Identification of prokaryotic homologues indicates an endosymbiotic origin for the alternative oxidases of mitochondria (AOX) and chloroplasts (PTOX).


    Atteia, Ariane; van Lis, Robert; van Hellemond, Jaap J; Tielens, Aloysius G M; Martin, William; Henze, Katrin


    The alternative oxidase is a ubiquinol oxidase that has been found to date in the mitochondrial respiratory chain of plants, some fungi and protists. Because of its sparse distribution among eukaryotic lineages and because of its diversity in regulatory mechanisms, the origin of AOX has been a mystery, particularly since no prokaryotic homologues have previously been identified. Here we report the identification of a gene encoding a clear homologue of the mitochondrial alternative oxidase in an alpha-proteobacterium, and the identification of three cyanobacterial genes that encode clear homologues of the plastid-specific alternative oxidase of plants and algae. These findings suggest that the eukaryotic nuclear genes for the alternative oxidases of mitochondria and chloroplasts were acquired via endosymbiotic gene transfer from the eubacterial ancestors of these two organelles, respectively.

  11. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5

    PubMed Central

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu


    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5–2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5–2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5–2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25763711

  12. Plastid terminal oxidase 2 (PTOX2) is the major oxidase involved in chlororespiration in Chlamydomonas

    PubMed Central

    Houille-Vernes, Laura; Rappaport, Fabrice; Wollman, Francis-André; Alric, Jean; Johnson, Xenie


    By homology with the unique plastid terminal oxidase (PTOX) found in plants, two genes encoding oxidases have been found in the Chlamydomonas genome, PTOX1 and PTOX2. Here we report the identification of a knockout mutant of PTOX2. Its molecular and functional characterization demonstrates that it encodes the oxidase most predominantly involved in chlororespiration in this algal species. In this mutant, the plastoquinone pool is constitutively reduced under dark-aerobic conditions, resulting in the mobile light-harvesting complexes being mainly, but reversibly, associated with photosystem I. Accordingly, the ptox2 mutant shows lower fitness than wild type when grown under phototrophic conditions. Single and double mutants devoid of the cytochrome b6f complex and PTOX2 were used to measure the oxidation rates of plastoquinols via PTOX1 and PTOX2. Those lacking both the cytochrome b6f complex and PTOX2 were more sensitive to light than the single mutants lacking either the cytochrome b6f complex or PTOX2, which discloses the role of PTOX2 under extreme conditions where the plastoquinone pool is overreduced. A model for chlororespiration is proposed to relate the electron flow rate through these alternative pathways and the redox state of plastoquinones in the dark. This model suggests that, in green algae and plants, the redox poise results from the balanced accumulation of PTOX and NADPH dehydrogenase. PMID:22143777

  13. Hordeum vulgare Seedlings Amine Oxidase

    PubMed Central

    Cogoni, Antonina; Piras, Carla; Farci, Raffaele; Melis, Antonello; Floris, Giovanni


    Although no amine oxidase could be detected in crude extracts, the enzyme has been purified to apparent homogeneity from Hordeum vulgare seedlings using ammonium sulfate precipitation and chromatography on DEAE cellulose, Hydroxylapatite, and Sephadex G200 columns. Gel filtration experiments indicate a molecular weight of about 150,000. The pH optimum of the enzyme was found to be 7.5 in potassium phosphate buffer. The spectrum of ultraviolet and visible regions were similar to Cuamine oxidase from Leguminosae. PMID:16667542

  14. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

    PubMed Central

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.


    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  15. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping


    Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

  16. HypC, the Anthrone Oxidase Involved in Aflatoxin Biosynthesis▿ †

    PubMed Central

    Ehrlich, Kenneth C.; Li, Ping; Scharfenstein, Leslie; Chang, Perng-Kuang


    On the basis of gene disruption and enzyme activity, hypC, an open reading frame in the region between the pksA (aflC) and nor-1 (aflD) genes in the aflatoxin biosynthesis gene cluster, encodes a 17-kDa oxidase that converts norsolorinic acid anthrone to norsolorinic acid. PMID:20348292

  17. Drugs related to monoamine oxidase activity.


    Fišar, Zdeněk


    Progress in understanding the role of monoamine neurotransmission in pathophysiology of neuropsychiatric disorders was made after the discovery of the mechanisms of action of psychoactive drugs, including monoamine oxidase (MAO) inhibitors. The increase in monoamine neurotransmitter availability, decrease in hydrogen peroxide production, and neuroprotective effects evoked by MAO inhibitors represent an important approach in the development of new drugs for the treatment of mental disorders and neurodegenerative diseases. New drugs are synthesized by acting as multitarget-directed ligands, with MAO, acetylcholinesterase, and iron chelation as targets. Basic information is summarized in this paper about the drug-induced regulation of monoaminergic systems in the brain, with a focus on MAO inhibition. Desirable effects of MAO inhibition include increased availability of monoamine neurotransmitters, decreased oxidative stress, decreased formation of neurotoxins, induction of pro-survival genes and antiapoptotic factors, and improved mitochondrial functions.

  18. Functional characterization of gibberellin oxidases from cucumber, Cucumis sativus L.


    Pimenta Lange, Maria João; Liebrandt, Anja; Arnold, Linda; Chmielewska, Sara-Miriam; Felsberger, André; Freier, Eduard; Heuer, Monika; Zur, Doreen; Lange, Theo


    Cucurbits have been used widely to elucidate gibberellin (GA) biosynthesis. With the recent availability of the genome sequence for the economically important cucurbit Cucumis sativus, sequence data became available for all genes potentially involved in GA biosynthesis for this species. Sixteen cDNAs were cloned from root and shoot of 3-d to 7-d old seedlings and from mature seeds of C. sativus. Two cDNAs code for GA 7-oxidases (CsGA7ox1, and -2), five for GA 20-oxidases (CsGA20ox1, -2, -3, -4, and -5), four for GA 3-oxidases (CsGA3ox1, -2, -3, and -4), and another five for GA 2-oxidases (CsGA2ox1, -2, -3, -4, and -5). Their enzymatic activities were investigated by heterologous expression of the cDNAs in Escherichia coli and incubation of the cell lysates with (14)C-labelled, D2-labelled, or unlabelled GA-substrates. The two GA 7-oxidases converted GA12-aldehyde to GA12 efficiently. CsGA7ox1 converted GA12 to GA14, to 15α-hydroxyGA12, and further to 15α-hydroxyGA14. CsGA7ox2 converted GA12 to its 12α-hydroxylated analogue GA111. All five GA 20-oxidases converted GA12 to GA9 as a major product, and to GA25 as a minor product. The four GA 3-oxidases oxidized the C19-GA GA9 to GA4 as the only product. In addition, three of them (CsGA3ox2, -3, and -4) converted the C20-GA GA12 to GA14. The GA 2-oxidases CsGA2ox1, -2, -3, and -4 oxidized the C19-GAs GA9 and GA4 to GA34 and GA51, respectively. CsGA2ox2, -3, and -4 converted GA51 and GA34 further to respective GA-catabolites. In addition to C19-GAs, CsGA2ox4 also converted the C20-GA GA12 to GA110. In contrast, CsGA2ox5 oxidized only the C20 GA12 to GA110 as the sole product. As shown for CsGA20ox1 and CsGA3ox1, similar reactions were catalysed with 13-hydroxlyated GAs as substrates. It is likely that these enzymes are also responsible for the biosynthesis of 13-hydroxylated GAs in vivo that occur at low levels in cucumber.

  19. Regulation of cytochrome c- and quinol oxidases, and piezotolerance of their activities in the deep-sea piezophile Shewanella violacea DSS12 in response to growth conditions.


    Ohke, Yoshie; Sakoda, Ayaka; Kato, Chiaki; Sambongi, Yoshihiro; Kawamoto, Jun; Kurihara, Tatsuo; Tamegai, Hideyuki


    The facultative piezophile Shewanella violacea DSS12 is known to have respiratory components that alter under the influence of hydrostatic pressure during growth, suggesting that its respiratory system is adapted to high pressure. We analyzed the expression of the genes encoding terminal oxidases and some respiratory components of DSS12 under various growth conditions. The expression of some of the genes during growth was regulated by both the O2 concentration and hydrostatic pressure. Additionally, the activities of cytochrome c oxidase and quinol oxidase of the membrane fraction of DSS12 grown under various conditions were measured under high pressure. The piezotolerance of cytochrome c oxidase activity was dependent on the O2 concentration during growth, while that of quinol oxidase was influenced by pressure during growth. The activity of quinol oxidase was more piezotolerant than that of cytochrome c oxidase under all growth conditions. Even in the membranes of the non-piezophile Shewanella amazonensis, quinol oxidase was more piezotolerant than cytochrome c oxidase, although both were highly piezosensitive as compared to the activities in DSS12. By phylogenetic analysis, piezophile-specific cytochrome c oxidase, which is also found in the genome of DSS12, was identified in piezophilic Shewanella and related genera. Our observations suggest that DSS12 constitutively expresses piezotolerant respiratory terminal oxidases, and that lower O2 concentrations and higher hydrostatic pressures induce higher piezotolerance in both types of terminal oxidases. Quinol oxidase might be the dominant terminal oxidase in high-pressure environments, while cytochrome c oxidase might also contribute. These features should contribute to adaptation of DSS12 in deep-sea environments. PMID:23832349

  20. Regulation of cytochrome c- and quinol oxidases, and piezotolerance of their activities in the deep-sea piezophile Shewanella violacea DSS12 in response to growth conditions.


    Ohke, Yoshie; Sakoda, Ayaka; Kato, Chiaki; Sambongi, Yoshihiro; Kawamoto, Jun; Kurihara, Tatsuo; Tamegai, Hideyuki


    The facultative piezophile Shewanella violacea DSS12 is known to have respiratory components that alter under the influence of hydrostatic pressure during growth, suggesting that its respiratory system is adapted to high pressure. We analyzed the expression of the genes encoding terminal oxidases and some respiratory components of DSS12 under various growth conditions. The expression of some of the genes during growth was regulated by both the O2 concentration and hydrostatic pressure. Additionally, the activities of cytochrome c oxidase and quinol oxidase of the membrane fraction of DSS12 grown under various conditions were measured under high pressure. The piezotolerance of cytochrome c oxidase activity was dependent on the O2 concentration during growth, while that of quinol oxidase was influenced by pressure during growth. The activity of quinol oxidase was more piezotolerant than that of cytochrome c oxidase under all growth conditions. Even in the membranes of the non-piezophile Shewanella amazonensis, quinol oxidase was more piezotolerant than cytochrome c oxidase, although both were highly piezosensitive as compared to the activities in DSS12. By phylogenetic analysis, piezophile-specific cytochrome c oxidase, which is also found in the genome of DSS12, was identified in piezophilic Shewanella and related genera. Our observations suggest that DSS12 constitutively expresses piezotolerant respiratory terminal oxidases, and that lower O2 concentrations and higher hydrostatic pressures induce higher piezotolerance in both types of terminal oxidases. Quinol oxidase might be the dominant terminal oxidase in high-pressure environments, while cytochrome c oxidase might also contribute. These features should contribute to adaptation of DSS12 in deep-sea environments.

  1. Direct electrochemistry and intramolecular electron transfer of ascorbate oxidase confined on L-cysteine self-assembled gold electrode.


    Patil, Bhushan; Kobayashi, Yoshiki; Fujikawa, Shigenori; Okajima, Takeyoshi; Mao, Lanqun; Ohsaka, Takeo


    A direct electrochemistry and intramolecular electron transfer of multicopper oxidases are of a great importance for the fabrication of these enzyme-based bioelectrochemical-devices. Ascorbate oxidase from Acremonium sp. (ASOM) has been successfully immobilized via a chemisorptive interaction on the l-cysteine self-assembled monolayer modified gold electrode (cys-SAM/AuE). Thermodynamics and kinetics of adsorption of ASOM on the cys-SAM/AuE were studied using cyclic voltammetry. A well-defined redox wave centered at 166±3mV (vs. Ag│AgCl│KCl(sat.)) was observed in 5.0mM phosphate buffer solution (pH7.0) at the fabricated ASOM electrode, abbreviated as ASOM/cys-SAM/AuE, confirming a direct electrochemistry, i.e., a direct electron transfer (DET) between ASOM and cys-SAM/AuE. The direct electrochemistry of ASOM was further confirmed by taking into account the chemical oxidation of ascorbic acid (AA) by O2 via an intramolecular electron transfer in the ASOM as well as the electrocatalytic oxidation of AA at the ASOM/cys-SAM/AuE. Thermodynamics and kinetics of the adsorption of ASOM on the cys-SAM/AuE have been elaborated along with its direct electron transfer at the modified electrodes on the basis of its intramolecular electron transfer and electrocatalytic activity towards ascorbic acid oxidation and O2 reduction. ASOM saturated surface area was obtained as 2.41×10(-11)molcm(-2) with the apparent adsorption coefficient of 1.63×10(6)Lmol(-1). The ASOM confined on the cys-SAM/AuE possesses its essential enzymatic function. PMID:24189123

  2. Direct electrochemistry and intramolecular electron transfer of ascorbate oxidase confined on L-cysteine self-assembled gold electrode.


    Patil, Bhushan; Kobayashi, Yoshiki; Fujikawa, Shigenori; Okajima, Takeyoshi; Mao, Lanqun; Ohsaka, Takeo


    A direct electrochemistry and intramolecular electron transfer of multicopper oxidases are of a great importance for the fabrication of these enzyme-based bioelectrochemical-devices. Ascorbate oxidase from Acremonium sp. (ASOM) has been successfully immobilized via a chemisorptive interaction on the l-cysteine self-assembled monolayer modified gold electrode (cys-SAM/AuE). Thermodynamics and kinetics of adsorption of ASOM on the cys-SAM/AuE were studied using cyclic voltammetry. A well-defined redox wave centered at 166±3mV (vs. Ag│AgCl│KCl(sat.)) was observed in 5.0mM phosphate buffer solution (pH7.0) at the fabricated ASOM electrode, abbreviated as ASOM/cys-SAM/AuE, confirming a direct electrochemistry, i.e., a direct electron transfer (DET) between ASOM and cys-SAM/AuE. The direct electrochemistry of ASOM was further confirmed by taking into account the chemical oxidation of ascorbic acid (AA) by O2 via an intramolecular electron transfer in the ASOM as well as the electrocatalytic oxidation of AA at the ASOM/cys-SAM/AuE. Thermodynamics and kinetics of the adsorption of ASOM on the cys-SAM/AuE have been elaborated along with its direct electron transfer at the modified electrodes on the basis of its intramolecular electron transfer and electrocatalytic activity towards ascorbic acid oxidation and O2 reduction. ASOM saturated surface area was obtained as 2.41×10(-11)molcm(-2) with the apparent adsorption coefficient of 1.63×10(6)Lmol(-1). The ASOM confined on the cys-SAM/AuE possesses its essential enzymatic function.

  3. Different recombinant forms of polyphenol oxidase A, a laccase from Marinomonas mediterranea.


    Tonin, Fabio; Rosini, Elena; Piubelli, Luciano; Sanchez-Amat, Antonio; Pollegioni, Loredano


    Polyphenol oxidase from the marine bacterium Marinomonas mediterranea (MmPPOA) is a membrane-bound, blue, multi-copper laccase of 695 residues. It possesses peculiar properties that distinguish it from known laccases, such as a broad substrate specificity (common to tyrosinases) and a high redox potential. In order to push the biotechnological application of this laccase, the full-length enzyme was overexpressed in Escherichia coli cells with and without a C-terminal His-tag. The previous form, named rMmPPOA-695-His, was purified to homogeneity by HiTrap chelating chromatography following solubilization by 1% SDS in the lysis buffer with an overall yield of ≈1 mg/L fermentation broth and a specific activity of 1.34 U/mg protein on 2,6-dimethoxyphenol as substrate. A truncated enzyme form lacking 58 residues at the N-terminus encompassing the putative membrane binding region, namely rMmPPOA-637-His, was successfully expressed in E. coli as soluble protein and was purified by using the same procedure set-up as for the full-length enzyme. Elimination of the N-terminal sequence decreased the specific activity 15-fold (which was partially restored in the presence of 1 M NaCl) and altered the secondary and tertiary structures and the pH dependence of optimal stability. The recombinant rMmPPOA-695-His showed kinetic properties on catechol higher than for known laccases, a very high thermal stability, and a strong resistance to NaCl, DMSO, and Tween-80, all properties that are required for specific, targeted industrial applications. PMID:27050199

  4. Alternative oxidase expression in aged potato tuber slices

    SciTech Connect

    Hiser, C.; Herdies, L.; McIntosh, L. )


    Higher plant mitochondria posses a cyanide-resistant, hydroxamate-sensitive alternative pathway of electron transport that does not conserve energy. Aging of potato tuber slices for 24 hours leads to the development of an alternative pathway capacity. We have shown that a monoclonal antibody raised against the alternative pathway terminal oxidase of Sauromatum guttatum crossreacts with a protein of similar size in aged potato slice mitochondria. This protein was partially purified and characterized by two-dimensional gel electrophoresis, and its relative levels parallel the rise in cyanide-resistant respiration. We are using a putative clone of the S. guttatum alternative oxidase gene to isolate the equivalent gene from potato and to examine its expression.

  5. Androgen receptor and monoamine oxidase polymorphism in wild bonobos.


    Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho


    Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

  6. Essential role of lysyl oxidases in notochord development

    PubMed Central

    Gansner, John M.; Mendelsohn, Bryce A.; Hultman, Keith A.; Johnson, Stephen L.; Gitlin, Jonathan D.


    Recent studies reveal a critical role for copper in the development of the zebrafish notochord, suggesting that specific cuproenzymes are required for the structural integrity of the notochord sheath. We now demonstrate that β-aminopropionitrile, a known inhibitor of the copper-dependent lysyl oxidases, causes notochord distortion in the zebrafish embryo identical to that seen in copper deficiency. Characterization of the zebrafish lysyl oxidase genes reveals eight unique sequences, several of which are expressed in the developing notochord. Specific gene knockdown demonstrates that loss of loxl1 results in notochord distortion, and that loxl1 and loxl5b have overlapping roles in notochord formation. Interestingly, while notochord abnormalities are not observed following partial knockdown of loxl1 or loxl5b alone, in each case this markedly sensitizes developing embryos to notochord distortion if copper availability is diminished. Likewise, partial knockdown of the lysyl oxidase substrate col2a1 results in notochord distortion when combined with reduced copper availability or partial knockdown of loxl1 or loxl5b. These data reveal a complex interplay of gene expression and nutrient availability critical to notochord development. They also provide insight into specific genetic and nutritional factors that may play a role in the pathogenesis of structural birth defects of the axial skeleton. PMID:17543297

  7. Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity

    PubMed Central

    Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio


    Abstract A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. PMID:23873697

  8. Lysyl oxidase modulates the osteoblast differentiation of primary mouse calvaria cells.


    Sharma-Bhandari, Anjali; Park, Sun-Hyang; Kim, Ju-Young; Oh, Jaemin; Kim, Youngho


    Lysyl oxidase (LOX) is an extracellular amine oxidase that mediates the formation of collagen fibers. Thus far, five LOX family genes [LOX, lysyl oxidase-like (LOXL)1, LOXL2, LOXL3 and LOXL4] have been identified in humans, each encoding the characteristic C-terminal domains that are required for amine oxidase activity. During osteoblastogenesis, collagen fibers function as a three-dimensional scaffold for organizing mineral deposition. In this study, to assess the functional roles of the LOX family members in osteoblastogenesis, we investigated the temporal expression of these genes as a function of phenotypic development during the osteoblast differentiation of primary cultured mouse calvaria cells. Of the LOX family members, only LOX was prominently expressed during osteoblast differentiation. LOX expression was highest on day 9 of differentiation, as shown by RT-PCR and western blot analysis. The expression pattern of collagen, type I, alpha 2 (COL1A2), which encodes the α2-chain of mouse collagen type I, was similar to that of LOX. The total amine oxidase activity of the differentiating calvaria cells exhibited a temporal pattern that paralleled LOX expression, reaching the highest level on day 9 of differentiation. We also noted that the inhibition of the amine oxidase activity of LOX significantly suppressed both mineral nodule formation and the expression of osteoblast marker genes during the differentiation of primary calvaria cells. Taken together, these findings suggest that the LOX-mediated organization of collagen fibers in the extracellular matrix is an important regulator of osteoblastogenesis.

  9. Effects of Iodonium-Class Flavin Dehydrogenase Inhibitors on Growth, Reactive Oxygen Production, Cell Cycle Progression, NADPH Oxidase 1 Levels, and Gene Expression in Human Colon Cancer Cells and Xenografts

    PubMed Central

    Doroshow, James H.; Gaur, Shikha; Markel, Susan; Lu, Jiamo; van Balgooy, Josephus; Synold, Timothy W.; Xi, Bixin; Wu, Xiwei; Juhasz, Agnes


    Iodonium-class flavoprotein dehydrogenase inhibitors have been demonstrated to possess antiproliferative potential and to inhibit reactive oxygen production in human tumor cells, although the mechanism(s) that explain the relationship between altered cell growth and the generation of reactive oxygen species (ROS) remain an area of active investigation. Because of the ability of these compounds to inhibit the activity of flavoprotein-containing epithelial NADPH oxidases, we chose to examine the effects of several iodonium-class flavoprotein inhibitors on human colon cancer cell lines that express high, functional levels of a single such oxidase (NADPH oxidase 1 [Nox1]). We found that diphenylene iodonium (DPI), di-2-thienyliodonium (DTI), and iodoniumdiphenyl inhibited the growth of Caco2, HT-29, and LS-174T colon cancer cells at concentrations (10–250 nM for DPI, 0.5–2.5 μM for DTI, and 155 nM to 10 μM for iodoniumdiphenyl) substantially lower than for DU145 human prostate cancer cells that do not possess functional NADPH oxidase activity. Drug treatment was associated with decreased H2O2 production and diminished intracellular ROS levels, lasting up to 24 hr, following short-term (1-hr) exposure to the iodonium analogs. Decreased tumor cell proliferation was caused, in part, by a profound block in cell cycle progression at the G1/S interface in both LS-174T and HT-29 cells exposed to either DPI or DTI; and the G1 block was produced, for LS-174T cells, by upregulation of p27 and a drug concentration-related decrease in the expression of cyclins D1, A, and E that was partially prevented by exogenous H2O2. Not only did DPI and DTI decrease intracellular ROS, they both also significantly decreased the mRNA expression levels of Nox1, potentially contributing to the prolonged reduction in tumor cell reactive oxygen levels. We also found that DPI and DTI significantly decreased the growth of both HT-29 and LS-174T human tumor xenografts, at dose levels that

  10. NADPH oxidase signal transduces angiotensin II in hepatic stellate cells and is critical in hepatic fibrosis

    PubMed Central

    Bataller, Ramón; Schwabe, Robert F.; Choi, Youkyung H.; Yang, Liu; Paik, Yong Han; Lindquist, Jeffrey; Qian, Ting; Schoonhoven, Robert; Hagedorn, Curt H.; Lemasters, John J.; Brenner, David A.


    Angiotensin II (Ang II) is a pro-oxidant and fibrogenic cytokine. We investigated the role of NADPH oxidase in Ang II–induced effects in hepatic stellate cells (HSCs), a fibrogenic cell type. Human HSCs express mRNAs of key components of nonphagocytic NADPH oxidase. Ang II phosphorylated p47phox, a regulatory subunit of NADPH oxidase, and induced reactive oxygen species formation via NADPH oxidase activity. Ang II phosphorylated AKT and MAPKs and increased AP-1 DNA binding in a redox-sensitive manner. Ang II stimulated DNA synthesis, cell migration, procollagen α1(I) mRNA expression, and secretion of TGF-β1 and inflammatory cytokines. These effects were attenuated by N-acetylcysteine and diphenylene iodonium, an NADPH oxidase inhibitor. Moreover, Ang II induced upregulation of genes potentially involved in hepatic wound-healing response in a redox-sensitive manner, as assessed by microarray analysis. HSCs isolated from p47phox–/– mice displayed a blunted response to Ang II compared with WT cells. We also assessed the role of NADPH oxidase in experimental liver fibrosis. After bile duct ligation, p47phox–/– mice showed attenuated liver injury and fibrosis compared with WT counterparts. Moreover, expression of smooth muscle α-actin and expression of TGF-β1 were reduced in p47phox–/– mice. Thus, NADPH oxidase mediates the actions of Ang II on HSCs and plays a critical role in liver fibrogenesis. PMID:14597764

  11. Tyrosine codon corresponds to topa quinone at the active site of copper amine oxidases.


    Mu, D; Janes, S M; Smith, A J; Brown, D E; Dooley, D M; Klinman, J P


    The recently discovered organic cofactor of bovine serum amine oxidase, topa quinone, is an uncommon amino acid residue in the polypeptide backbone (Janes, S. M., Mu, D., Wemmer, D., Smith, A. J., Kaur, S., Maltby, D., Burlingame, A. L., and Klinman, J. P. (1990) Science 248, 981-987). The amine oxidase gene from the yeast Hansenula polymorpha has been cloned and sequenced (Bruinenberg, P. G., Evers, M., Waterham, H. R., Kuipers, J., Arnberg, A. C., and Geert, A. B. (1989) Biochim. Biophys. Acta 1008, 157-167). In order to understand the incorporation of topa quinone in eukaryotes, we have isolated yeast amine oxidase from H. polymorpha. Following protocols established with bovine serum amine oxidase, yeast amine oxidase was derivatized with [14C]phenylhydrazine, followed by thermolytic digestion and isolation of a dominant radiolabeled peptide by high pressure liquid chromatography. Comparison of resonance Raman spectra for this peptide to spectra of a model compound demonstrates that topa quinone is the cofactor. By alignment of a DNA-derived yeast amine oxidase sequence with the topa quinone-containing peptide sequence, it is found that the tyrosine codon, UAC, corresponds to topa quinone in the mature protein. In a similar manner, alignment of a tryptic peptide from bovine serum amine oxidase implicates tyrosine as the precursor to topa quinone in mammals.

  12. Characterization of a cytochrome a1 that functions as a ubiquinol oxidase in Acetobacter aceti.


    Fukaya, M; Tayama, K; Tamaki, T; Ebisuya, H; Okumura, H; Kawamura, Y; Horinouchi, S; Beppu, T


    The terminal oxidase for ethanol oxidation in Acetobacter aceti was purified as a complex consisting of four subunits (subunits I, II, III, and IV) with molecular masses of 72, 34, 21, and 13 kDa, respectively. Spectrophotometric analysis and catalytic properties determined with the purified enzyme showed that it belonged to a family of cytochrome a1 (ba)-type ubiquinol oxidases. A polymerase chain reaction with two oligonucleotides designed for amino acid sequences that are conserved in subunit I of the aa3-type cytochrome c oxidases from various origins and of an Escherichia coli o (bo)-type ubiquinol oxidase was used for cloning the cytochrome a1 gene. A 0.5-kb fragment thus amplified was used as the probe to clone a 4.5-kb KpnI fragment that contained a putative open reading frame for the whole subunit I gene. The molecular weight and amino acid composition of the product of this open reading frame (cyaA) were the same as those of the purified protein from A. aceti. The amino acid sequence of CyaA was homologous to that of subunit I of the E. coli o-type ubiquinol oxidase. Nucleotide sequence analysis of the region neighboring the cyaA gene revealed that the genes (cyaB, cyaC, and cyaD) encoding the other three subunits (subunits II, III, and IV) were clustered upstream and downstream of the cyaA gene in the order cyaB, cyaA, cyaC, and cyaD and with the same transcription polarity, forming an operon. As expected from the enzymatic properties, CyaB, CyaC, and CyaD showed great similarity in amino acid sequence to the corresponding sununits of the E. coli o-type ubiquinol oxidase and as(3)-type cytochrome c oxidases.

  13. Incorporation of copper into lysyl oxidase.


    Kosonen, T; Uriu-Hare, J Y; Clegg, M S; Keen, C L; Rucker, R B


    Lysyl oxidase is a copper-dependent enzyme involved in extracellular processing of collagens and elastin. Although it is known that copper is essential for the functional activity of the enzyme, there is little information on the incorporation of copper. In the present study we examined the insertion of copper into lysyl oxidase using 67Cu in cell-free transcription/translation assays and in normal skin fibroblast culture systems. When a full-length lysyl oxidase cDNA was used as a template for transcription/translation reactions in vitro, unprocessed prolysyl oxidase appeared to bind copper. To examine further the post-translational incorporation of copper into lysyl oxidase, confluent skin fibroblasts were incubated with inhibitors of protein synthesis (cycloheximide, 10 microg/ml), glycosylation (tunicamycin, 10 microg/ml), protein secretion (brefeldin A, 10 microg/ml) and prolysyl oxidase processing (procollagen C-peptidase inhibitor, 2.5 microg/ml) together with 300 microCi of carrier-free 67Cu. It was observed that protein synthesis was a prerequisite for copper incorporation, but inhibition of glycosylation by tunicamycin did not affect the secretion of 67Cu as lysyl oxidase. Brefeldin A inhibited the secretion of 67Ci-labelled lysyl oxidase by 46%, but the intracellular incorporation of copper into lysyl oxidase was not affected. In addition, the inhibition of the extracellular proteolytic processing of prolysyl oxidase to lysyl oxidase had minimal effects on the secretion of protein-bound 67Cu. Our results indicate that, similar to caeruloplasmin processing [Sato and Gitlin (1991) J. Biol. Chem. 266, 5128-5134], copper is inserted into prolysyl oxidase independently of glycosylation. PMID:9355764

  14. Polyphenol oxidase (PPO) in wheat and wild relatives: Molecular evidence for a multigene family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat polyphenol oxidase (PPO) is the major cause of browning reactions that discolor Asian noodles and other wheat products. It has been hypothesized that genes encoding wheat PPOs may have evolved by gene duplication into a multigene family. Here we characterized PPO genomic sequences from diploid...

  15. Monoamine oxidases in major depressive disorder and alcoholism.


    Duncan, Jeremy; Johnson, Shakevia; Ou, Xiao-Ming


    Monoamine oxidases play an integral role in brain function. Both monoamine oxidase A (MAO-A) and monoamine oxidase B (MAO-B) regulate neurochemistry by degrading monoamine neurotransmitters (serotonin, dopamine, and norepinephrine). Any alteration in MAO levels can have devastating effects on the brain and behavior by lowering or raising neurotransmitter levels and producing toxic reactive oxygen species. In this review article, MAO is examined in terms of function and genetic organization, with special focus on recent discoveries related to the transcriptional regulation of MAO. In recent studies, transcriptional regulation involves a repressor protein, R1, for MAO-A and an activator protein, KLF11 (a Krüppel-like factor; also referred to as transforming growth factor-beta early inducible gene 2, TIEG2), for both MAO-A and MAO-B, by binding to Sp/KLF sites in the core promoters of MAO and regulating MAO gene expression. Furthermore, KLF11 may influence MAO-B expression and augment glyceraldehyde-3 phosphate dehydrogenase (GAPDH) to upregulate MAO-B transcription upon exposure to ethanol. Finally, we review recent progress in MAO research and highlight the roles that MAOs play in several psychiatric conditions, including chronic stress, major depressive disorder and alcohol dependence. Further research in this area is needed to better understand MAOs, their transcription factors and signaling pathways in psychiatric illnesses in order to develop new strategies for pharmacological advancement.

  16. Origin and evolution of lysyl oxidases.


    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando


    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea - which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes.

  17. Origin and evolution of lysyl oxidases

    PubMed Central

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando


    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea – which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311

  18. Monoamine Oxidase Inhibitors: Clinical Review

    PubMed Central

    Remick, Ronald A.; Froese, Colleen


    Monoamine oxidase inhibitors (MAOIs) are effective antidepressant agents. They are increasingly and effectively used in a number of other psychiatric and non-psychiatric medical syndromes. Their potential for serious toxicity (i.e., hypertensive reaction) is far less than original reports suggest, and newer reversible substrate-specific MAOIs may offer even less toxicity. The author reviews the pharmacology, mechanism of action, clinical indications, and dosing strategies of MAOIs. The common MAOI side-effects (hypotension, weight gain, sexual dysfunction, insomnia, daytime sedation, myoclonus, and hypertensive episodes) are described and management techniques suggested. Recent clinical developments involving MAOIs are outlined. PMID:21233984

  19. Glucose oxidase activity of actinomycetes.


    St Vlahov, S


    The ability of 311 actiomycete, belonging to 12 species to produce glucose oxidase was studied. It was found that 174 of them formed exoenzymes on solid medium and 133 in liquid medium. The composition of the nutrient medium has an essential effect on the amount of enzyme formed. Strains with considerably higher activity form a greater amount of exoenzymes on soya meal medium and on synthetic medium with KNO2. The highest activity of the culture liquid of some strains was observed between the 6th and 7th day of cultivation. During this phase of growth the highest productivity of the biomas was established. PMID:76424

  20. Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

    PubMed Central

    Moreno, Beatriz


    Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management). Materials and Methods: Humic C (> 104 Da) was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE) for functional bacterial laccase-like multicopper oxidase (LMCO)-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from vegetation decay

  1. Immunological comparison of sulfite oxidase

    SciTech Connect

    Pollock, V.; Barber, M.J. )


    Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

  2. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.


    Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M


    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates

  3. Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

    PubMed Central

    Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.


    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates

  4. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.


    Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M


    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates

  5. A Broad Distribution of the Alternative Oxidase in Microsporidian Parasites

    PubMed Central

    Williams, Bryony A. P.; Elliot, Catherine; Burri, Lena; Kido, Yasutoshi; Kita, Kiyoshi; Moore, Anthony L.; Keeling, Patrick J.


    Microsporidia are a group of obligate intracellular parasitic eukaryotes that were considered to be amitochondriate until the recent discovery of highly reduced mitochondrial organelles called mitosomes. Analysis of the complete genome of Encephalitozoon cuniculi revealed a highly reduced set of proteins in the organelle, mostly related to the assembly of iron-sulphur clusters. Oxidative phosphorylation and the Krebs cycle proteins were absent, in keeping with the notion that the microsporidia and their mitosomes are anaerobic, as is the case for other mitosome bearing eukaryotes, such as Giardia. Here we provide evidence opening the possibility that mitosomes in a number of microsporidian lineages are not completely anaerobic. Specifically, we have identified and characterized a gene encoding the alternative oxidase (AOX), a typically mitochondrial terminal oxidase in eukaryotes, in the genomes of several distantly related microsporidian species, even though this gene is absent from the complete genome of E. cuniculi. In order to confirm that these genes encode functional proteins, AOX genes from both A. locustae and T. hominis were over-expressed in E. coli and AOX activity measured spectrophotometrically using ubiquinol-1 (UQ-1) as substrate. Both A. locustae and T. hominis AOX proteins reduced UQ-1 in a cyanide and antimycin-resistant manner that was sensitive to ascofuranone, a potent inhibitor of the trypanosomal AOX. The physiological role of AOX microsporidia may be to reoxidise reducing equivalents produced by glycolysis, in a manner comparable to that observed in trypanosomes. PMID:20169184

  6. Modification of plasma membrane NADPH oxidase activity in cucumber seedling roots in response to cadmium stress.


    Jakubowska, Dagmara; Janicka-Russak, Małgorzata; Kabała, Katarzyna; Migocka, Magdalena; Reda, Małgorzata


    The aim of this study was to investigate the effect of cadmium on plasma membrane (PM) NADPH oxidase activity in cucumber roots. Plants were treated with cadmium for 1, 3 or 6 days. Some of the plants after 3-day exposure to cadmium were transferred to a medium without the heavy metal for the next 3 days. Treatment of plants with cadmium for 6 days stimulated the activity of NADPH oxidase. The highest stimulation of O2(•-) production by NADPH oxidase was observed in post-stressed plants, which was correlated with the stimulation of activity of PM H(+)-ATPase in the same conditions. In order to examine the effects of cadmium stresses on the expression level of genes encoding NADPH oxidase, putative cucumber homologs encoding RBOH proteins were selected and a real-time PCR assay was performed. NADPH is a substrate for oxidase; thus alterations in the activity of glucose-6-phosphate dehydrogenase, 6-phosphogluconate dehydrogenase, NADP-isocitrate dehydrogenase and NADP-malic enzyme under cadmium stress were studied. The activity of NADPH dehydrogenases was increased under cadmium stress. The results indicate that PM NADPH oxidase could be involved in plants' response to cadmium stress by affecting the activity of PM H(+)-ATPase, and NADPH-generating enzymes could play important roles in this process.

  7. New insight into the structure and function of the alternative oxidase.


    Berthold, D A; Andersson, M E; Nordlund, P


    The alternative oxidase is a ubiquinol oxidase found in plant mitochondria, as well as in the mitochondria of some fungi and protists. It catalyzes a cyanide-resistant reduction of oxygen to water without translocation of protons across the inner mitochondrial membrane, and thus functions as a non-energy-conserving member of the respiratory electron transfer chain. The active site of the alternative oxidase has been modelled as a diiron center within a four-helix bundle by Siedow et al. (FEBS Lett. 362 (1995) 10-14) and more recently by Andersson and Nordlund (FEBS Lett. 449 (1999) 17-22). The cloning of the Arabidopsis thaliana IMMUTANS (Im) gene, which encodes a plastid enzyme distantly related to the mitochondrial alternative oxidases (Wu et al. Plant Cell 11 (1999) 43-55; Carol et al. Plant Cell 11 (1999) 57-68), has now narrowed the range of possible ligands to the diiron center of the alternative oxidase. The Im protein sequence suggests a minor modification to the recent model of the active site of the alternative oxidase. This change moves an invariant tyrosine into a conserved hydrophobic pocket in the vicinity of the active site, in a position analogous to the long-lived tyrosine radical at the diiron center of ribonucleotide reductase, and similar to the tyrosines near the diiron center of bacterioferritin and rubrerythrin. The Im sequence and modified structural model yield a compelling picture of the alternative oxidase as a diiron carboxylate protein. The current status of the relationship of structure to function in the alternative oxidase is reviewed.

  8. Human lysyl oxidase-like 2.


    Moon, Hee-Jung; Finney, Joel; Ronnebaum, Trey; Mure, Minae


    Lysyl oxidase like-2 (LOXL2) belongs to the lysyl oxidase (LOX) family, which comprises Cu(2+)- and lysine tyrosylquinone (LTQ)-dependent amine oxidases. LOXL2 is proposed to function similarly to LOX in the extracellular matrix (ECM) by promoting crosslinking of collagen and elastin. LOXL2 has also been proposed to regulate extracellular and intracellular cell signaling pathways. Dysregulation of LOXL2 has been linked to many diseases, including cancer, pro-oncogenic angiogenesis, fibrosis and heart diseases. In this review, we will give an overview of the current understandings and hypotheses regarding the molecular functions of LOXL2.

  9. Monoamine oxidase and agitation in psychiatric patients.


    Nikolac Perkovic, Matea; Svob Strac, Dubravka; Nedic Erjavec, Gordana; Uzun, Suzana; Podobnik, Josip; Kozumplik, Oliver; Vlatkovic, Suzana; Pivac, Nela


    Subjects with schizophrenia or conduct disorder display a lifelong pattern of antisocial, aggressive and violent behavior and agitation. Monoamine oxidase (MAO) is an enzyme involved in the degradation of various monoamine neurotransmitters and neuromodulators and therefore has a role in various psychiatric and neurodegenerative disorders and pathological behaviors. Platelet MAO-B activity has been associated with psychopathy- and aggression-related personality traits, while variants of the MAOA and MAOB genes have been associated with diverse clinical phenotypes, including aggressiveness, antisocial problems and violent delinquency. The aim of the study was to evaluate the association of platelet MAO-B activity, MAOB rs1799836 polymorphism and MAOA uVNTR polymorphism with severe agitation in 363 subjects with schizophrenia and conduct disorder. The results demonstrated significant association of severe agitation and smoking, but not diagnosis or age, with platelet MAO-B activity. Higher platelet MAO-B activity was found in subjects with severe agitation compared to non-agitated subjects. Platelet MAO-B activity was not associated with MAOB rs1799836 polymorphism. These results suggested the association between increased platelet MAO-B activity and severe agitation. No significant association was found between severe agitation and MAOA uVNTR or MAOB rs1799836 polymorphism, revealing that these individual polymorphisms in MAO genes are not related to severe agitation in subjects with schizophrenia and conduct disorder. As our study included 363 homogenous Caucasian male subjects, our data showing this negative genetic association will be a useful addition to future meta-analyses. PMID:26851573

  10. An alternative oxidase monoclonal antibody recognises a highly conserved sequence among alternative oxidase subunits.


    Finnegan, P M; Wooding, A R; Day, D A


    The alternative oxidase is found in the inner mitochondrial membranes of plants and some fungi and protists. A monoclonal antibody raised against the alternative oxidase from the aroid lily Sauromatum guttatum has been used extensively to detect the enzyme in these organisms. Using an immunoblotting strategy, the antibody binding site has been localised to the sequence RADEAHHRDVNH within the soybean alternative oxidase 2 protein. Examination of sequence variants showed that A2 and residues C-terminal to H7 are required for recognition by the monoclonal antibody raised against the alternative oxidase. The recognition sequence is highly conserved among all alternative oxidase proteins and is absolutely conserved in 12 of 14 higher plant sequences, suggesting that this antibody will continue to be extremely useful in studying the expression and synthesis of the alternative oxidase.

  11. Alternative oxidase in animals: unique characteristics and taxonomic distribution.


    McDonald, Allison E; Vanlerberghe, Greg C; Staples, James F


    Alternative oxidase (AOX), a ubiquinol oxidase, introduces a branch point into the respiratory electron transport chain, bypassing complexes III and IV and resulting in cyanide-resistant respiration. Previously, AOX was thought to be limited to plants and some fungi and protists but recent work has demonstrated the presence of AOX in most kingdoms of life, including animals. In the present study we identified AOX in 28 animal species representing nine phyla. This expands the known taxonomic distribution of AOX in animals by 10 species and two phyla. Using bioinformatics we found AOX gene sequences in members of the animal phyla Porifera, Placozoa, Cnidaria, Mollusca, Annelida, Nematoda, Echinodermata, Hemichordata and Chordata. Using reverse-transcriptase polymerase chain reaction (RT-PCR) with degenerate primers designed to recognize conserved regions of animal AOX, we demonstrated that AOX genes are transcribed in several animals from different phyla. An analysis of full-length AOX sequences revealed an amino acid motif in the C-terminal region of the protein that is unique to animal AOXs. Animal AOX also lacks an N-terminal cysteine residue that is known to be important for AOX enzyme regulation in plants. We conclude that the presence of AOX is the ancestral state in animals and hypothesize that its absence in some lineages, including vertebrates, is due to gene loss events. PMID:19648408

  12. Alternative oxidase in animals: unique characteristics and taxonomic distribution.


    McDonald, Allison E; Vanlerberghe, Greg C; Staples, James F


    Alternative oxidase (AOX), a ubiquinol oxidase, introduces a branch point into the respiratory electron transport chain, bypassing complexes III and IV and resulting in cyanide-resistant respiration. Previously, AOX was thought to be limited to plants and some fungi and protists but recent work has demonstrated the presence of AOX in most kingdoms of life, including animals. In the present study we identified AOX in 28 animal species representing nine phyla. This expands the known taxonomic distribution of AOX in animals by 10 species and two phyla. Using bioinformatics we found AOX gene sequences in members of the animal phyla Porifera, Placozoa, Cnidaria, Mollusca, Annelida, Nematoda, Echinodermata, Hemichordata and Chordata. Using reverse-transcriptase polymerase chain reaction (RT-PCR) with degenerate primers designed to recognize conserved regions of animal AOX, we demonstrated that AOX genes are transcribed in several animals from different phyla. An analysis of full-length AOX sequences revealed an amino acid motif in the C-terminal region of the protein that is unique to animal AOXs. Animal AOX also lacks an N-terminal cysteine residue that is known to be important for AOX enzyme regulation in plants. We conclude that the presence of AOX is the ancestral state in animals and hypothesize that its absence in some lineages, including vertebrates, is due to gene loss events.

  13. The C-terminal region controls correct folding of genus Trametes pyranose 2-oxidases.


    Maresová, Helena; Palyzová, Andrea; Kyslík, Pavel


    The pyranose 2-oxidases from Trametes ochracea and Trametes pubescens share markedly similar amino acid sequences with identity of 93.4%. When expressed from the recombinant plasmids based on the same vector in the Escherichia coli host strain BL21(DE3) at higher growth temperatures, they differ strikingly in the formation of the inclusion bodies. Upon overexpression in the cultures performed at 28 degrees C, the specific activity of pyranose 2-oxidase from T. pubescens was eight times higher than that from T. ochracea: 93% of pyranose 2-oxidase from T. ochracea and only 15% of that from T. pubescens was present in the form of inclusion bodies. To ascertain the cause of this difference, both cloned genes were shuffled. Site-directed recombination of p2o cDNAs revealed that DNA constructs ending with 3' end of p2o cDNA from T. pubescens code for proteins that are folded into an active form to the greater extent, regardless of the gene expression level. "In silicio" analysis of physico-chemical properties of the protein sequences of pyranose 2-oxidases revealed that the sequence of amino acid residues 368-430, constituting the small, head domain of pyranose 2-oxidase from T. pubescens, affects positively the enzyme folding at higher cultivation temperatures. The domain differs in six amino acid residues from that of T. ochracea.

  14. 1-Aminocyclopropane-1-Carboxylate Oxidase Activity Limits Ethylene Biosynthesis in Rumex palustris during Submergence

    PubMed Central

    Vriezen, Wim H.; Hulzink, Raymond; Mariani, Celestina; Voesenek, Laurentius A.C.J.


    Submergence strongly stimulates petiole elongation in Rumex palustris, and ethylene accumulation initiates and maintains this response in submerged tissues. cDNAs from R. palustris corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene (RP-ACO1) were isolated from elongating petioles and used to study the expression of the corresponding gene. An increase in RP-ACO1 messenger was observed in the petioles and lamina of elongating leaves 2 h after the start of submergence. ACC oxidase enzyme activity was measured in homogenates of R. palustris shoots, and a relevant increase was observed within 12 h under water with a maximum after 24 h. We have shown previously that the ethylene production rate of submerged shoots does not increase significantly during the first 24 h of submergence (L.A.C.J. Voesenek, M. Banga, R.H. Thier, C.M. Mudde, F.M. Harren, G.W.M. Barendse, C.W.P.M. Blom [1993] Plant Physiol 103: 783–791), suggesting that under these conditions ACC oxidase activity is inhibited in vivo. We found evidence that this inhibition is caused by a reduction of oxygen levels. We hypothesize that an increased ACC oxidase enzyme concentration counterbalances the reduced enzyme activity caused by low oxygen concentration during submergence, thus sustaining ethylene production under these conditions. Therefore, ethylene biosynthesis seems to be limited at the level of ACC oxidase activity rather than by ACC synthase in R. palustris during submergence. PMID:10482674

  15. Regulation of NADPH oxidases in skeletal muscle.


    Ferreira, Leonardo F; Laitano, Orlando


    The only known function of NAD(P)H oxidases is to produce reactive oxygen species (ROS). Skeletal muscles express three isoforms of NAD(P)H oxidases (Nox1, Nox2, and Nox4) that have been identified as critical modulators of redox homeostasis. Nox2 acts as the main source of skeletal muscle ROS during contractions, participates in insulin signaling and glucose transport, and mediates the myocyte response to osmotic stress. Nox2 and Nox4 contribute to skeletal muscle abnormalities elicited by angiotensin II, muscular dystrophy, heart failure, and high fat diet. Our review addresses the expression and regulation of NAD(P)H oxidases with emphasis on aspects that are relevant to skeletal muscle. We also summarize: i) the most widely used NAD(P)H oxidases activity assays and inhibitors, and ii) studies that have defined Nox enzymes as protagonists of skeletal muscle redox homeostasis in a variety of health and disease conditions. PMID:27184955

  16. Activation of polyphenol oxidase of chloroplasts.


    Tolbert, N E


    Polyphenol oxidase of leaves is located mainly in chloroplasts isolated by differential or sucrose density gradient centrifugation. This activity is part of the lamellar structure that is not lost on repeated washing of the plastids. The oxidase activity was stable during prolonged storage of the particles at 4 C or -18 C. The Km (dihydroxyphenylalanine) for spinach leaf polyphenol oxidase was 7 mm by a spectrophotometric assay and 2 mm by the manometric assay. Polyphenol oxidase activity in the leaf peroxisomal fraction, after isopycnic centrifugation on a linear sucrose gradient, did not coincide with the peroxisomal enzymes but was attributed to proplastids at nearly the same specific density.Plants were grouped by the latency properties for polyphenol oxidase in their isolated chloroplasts. In a group including spinach, Swiss chard, and beet leaves the plastids immediately after preparation from fresh leaves required a small amount of light for maximal rates of oxidation of dihydroxyphenylalanine. Polyphenol oxidase activity in the dark or light increased many fold during aging of these chloroplasts for 1 to 5 days. Soluble polyphenol oxidase of the cytoplasm was not so stimulated. Chloroplasts prepared from stored leaves were also much more active than from fresh leaves. Maximum rates of dihydroxyphenylalanine oxidation were 2 to 6 mmoles x mg(-1) chlorophyll x hr(-1). Equal stimulation of latent polyphenol oxidase in fresh or aged chloroplasts in this group was obtained by either light, an aged trypsin digest, 3-(4-chlorophenyl)-1, 1-dimethylurea, or antimycin A. A variety of other treatments did not activate or had little effect on the oxidase, including various peptides, salts, detergents, and other proteolytic enzymes.Activation of latent polyphenol oxidase in spinach chloroplasts by trypsin amounted to as much as 30-fold. The trypsin activation occurred even after the trypsin had been treated with 10% trichloroacetic acid, 1.0 n HCl or boiled for 30

  17. Azide inhibition of urate oxidase

    PubMed Central

    Gabison, Laure; Colloc’h, Nathalie; Prangé, Thierry


    The inhibition of urate oxidase (UOX) by azide was investigated by X-ray diffraction techniques and compared with cyanide inhibition. Two well characterized sites for reagents are present in the enzyme: the dioxygen site and the substrate-binding site. To examine the selectivity of these sites towards azide inhibition, several crystallization conditions were developed. UOX was co-crystallized with azide (N3) in the presence or absence of either uric acid (UA, the natural substrate) or 8-azaxanthine (8AZA, a competitive inhibitor). In a second set of experiments, previously grown orthorhombic crystals of the UOX–UA or UOX–8AZA complexes were soaked in sodium azide solutions. In a third set of experiments, orthorhombic crystals of UOX with the exchangeable ligand 8-nitroxanthine (8NXN) were soaked in a solution containing uric acid and azide simultaneously (competitive soaking). In all assays, the soaking periods were either short (a few hours) or long (one or two months). These different experimental conditions showed that one or other of the sites, or the two sites together, could be inhibited. This also demonstrated that azide not only competes with dioxygen as cyanide does but also competes with the substrate for its enzymatic site. A model in agreement with experimental data would be an azide in equilibrium between two sites, kinetically in favour of the dioxygen site and thermodynamically in favour of the substrate-binding site. PMID:25005084

  18. Heme/copper terminal oxidases

    SciTech Connect

    Ferguson-Miller, S.; Babcock, G.T.


    Spatially well-organized electron-transfer reactions in a series of membrane-bound redox proteins form the basis for energy conservation in both photosynthesis and respiration. The membrane-bound nature of the electron-transfer processes is critical, as the free energy made available in exergonic redox chemistry is used to generate transmembrane proton concentration and electrostatic potential gradients. These gradients are subsequently used to drive ATP formation, which provides the immediate energy source for constructive cellular processes. The terminal heme/copper oxidases in respiratory electron-transfer chains illustrate a number of the thermodynamic and structural principles that have driven the development of respiration. This class of enzyme reduces dioxygen to water, thus clearing the respiratory system of low-energy electrons so that sustained electron transfer and free-energy transduction can occur. By using dioxygen as the oxidizing substrate, free-energy production per electron through the chain is substantial, owing to the high reduction potential of O{sub 2} (0.815 V at pH 7). 122 refs.

  19. Identification and biochemical characterization of polyamine oxidases in amphioxus: Implications for emergence of vertebrate-specific spermine and acetylpolyamine oxidases.


    Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui


    Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed.

  20. Identification and biochemical characterization of polyamine oxidases in amphioxus: Implications for emergence of vertebrate-specific spermine and acetylpolyamine oxidases.


    Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui


    Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. PMID:26367330

  1. Alternative oxidase in the branched mitochondrial respiratory network: an overview on structure, function, regulation, and role.


    Sluse, F E; Jarmuszkiewicz, W


    Plants and some other organisms including protists possess a complex branched respiratory network in their mitochondria. Some pathways of this network are not energy-conserving and allow sites of energy conservation to be bypassed, leading to a decrease of the energy yield in the cells. It is a challenge to understand the regulation of the partitioning of electrons between the various energy-dissipating and -conserving pathways. This review is focused on the oxidase side of the respiratory chain that presents a cyanide-resistant energy-dissipating alternative oxidase (AOX) besides the cytochrome pathway. The known structural properties of AOX are described including transmembrane topology, dimerization, and active sites. Regulation of the alternative oxidase activity is presented in detail because of its complexity. The alternative oxidase activity is dependent on substrate availability: total ubiquinone concentration and its redox state in the membrane and O2 concentration in the cell. The alternative oxidase activity can be long-term regulated (gene expression) or short-term (post-translational modification, allosteric activation) regulated. Electron distribution (partitioning) between the alternative and cytochrome pathways during steady-state respiration is a crucial measurement to quantitatively analyze the effects of the various levels of regulation of the alternative oxidase. Three approaches are described with their specific domain of application and limitations: kinetic approach, oxygen isotope differential discrimination, and ADP/O method (thermokinetic approach). Lastly, the role of the alternative oxidase in non-thermogenic tissues is discussed in relation to the energy metabolism balance of the cell (supply in reducing equivalents/demand in energy and carbon) and with harmful reactive oxygen species formation.

  2. Purification and characterization of methylamine oxidase induced in Aspergillus niger AKU 3302.


    Frébort, I; Matsushita, K; Toyama, H; Lemr, K; Yamada, M; Adachi, O


    Crude extract of Aspergillus niger AKU 3302 mycelia incubated with methylamine showed a single amine oxidase activity band in a developed polyacrylamide gel that weakly cross-reacted with the antibody against a copper/topa quinone-containing amine oxidase (AO-II) from the same strain induced by n-butylamine. Since the organism cannot grow on methylamine and the already known quinoprotein amine oxidases of the organism cannot catalyze oxidation of methylamine, the organism was forced to produce another enzyme that could oxidize methylamine when the mycelia were incubated with methylamine. The enzyme was separated and purified from the already known two quinoprotein amine oxidases formed in the same mycelia. The purified enzyme showed a sharp symmetric sedimentation peak in analytical ultracentrifugation showing S20,w0 of 6.5s. The molecular mass of 133 kDa estimated by gel chromatography and 66.6 kDa found by SDS-PAGE confirmed the dimeric structure of the enzyme. The purified enzyme was pink in color with an absorption maximum at 494 nm. The enzyme readily oxidized methylamine, n-hexylamine, and n-butylamine, but not benzylamine, histamine, or tyramine, favorite substrates for the already known two quinoprotein amine oxidases. Inactivation by carbonyl reagents and copper chelators suggested the presence of a copper/topa quinone cofactor. Spectrophotometric titration by p-nitrophenylhydrazine showed one reactive carbonyl group per subunit and redox-cyclic quinone staining confirmed the presence of a quinone cofactor. pH-dependent shift of the absorption spectrum of the enzyme-p-nitrophenylhydrazone (469 nm at neutral to 577 nm at alkaline pH) supported the identity of the cofactor with topaquinone. Nothern blot analysis indicated that the methylamine oxidase encoding gene is largely different from the already known amine oxidase in the organism.

  3. Rat pristanoyl-CoA oxidase. cDNA cloning and recognition of its C-terminal (SQL) by the peroxisomal-targeting signal 1 receptor.


    Vanhooren, J C; Fransen, M; de Béthune, B; Baumgart, E; Baes, M; Torrekens, S; Van Leuven, F; Mannaerts, G P; Van Veldhoven, P P


    The composite pristanoyl-CoA oxidase cDNA sequence, derived from two overlapping clones from a rat liver cDNA library and a 5'-RACE (rapid amplification of cDNA ends) PCR fragment, consisted of 2600 bases and contained an open reading frame of 2100 bases, encoding a protein of 700 amino acids with a calculated molecular mass of 78445 Da. This value is somewhat larger than the reported molecular mass of 70 kDa as determined earlier by SDS-gel electrophoresis. The amino acid identity with rat palmitoyl-CoA oxidase was rather low (28%) and barely higher than that with the yeast acyl-CoA oxidases (20%), suggesting that the palmitoyl-CoA oxidase/pristanoyl-CoA oxidase duplication occurred early in evolution. The carboxy-terminal tripeptide of pristanoyl-CoA oxidase was SQL. In vitro studies with the bacterially expressed human peroxisomal-targeting signal-1 import receptor indicated that SQL functions as a peroxisome-targeting signal. Northern analysis of tissues from control and clofibrate treated rats demonstrated that the pristanoyl-CoA oxidase gene is transcribed in liver and extrahepatic tissues and that transcription is not enhanced by treatment of rats with peroxisome proliferators. No mRNA could be detected by northern analysis of human tissues, suggesting that the human pristanoyl-CoA oxidase gene, if present, is only poorly or not transcribed.

  4. Deletion of glucose oxidase changes the pattern of organic acid production in Aspergillus carbonarius.


    Yang, Lei; Lübeck, Mette; Lübeck, Peter S


    Aspergillus carbonarius has potential as a cell factory for the production of different organic acids. At pH 5.5, A.carbonarius accumulates high amounts of gluconic acid when it grows on glucose based medium whereas at low pH, it produces citric acid. The conversion of glucose to gluconic acid is carried out by secretion of the enzyme, glucose oxidase. In this work, the gene encoding glucose oxidase was identified and deleted from A. carbonarius with the aim of changing the carbon flux towards other organic acids. The effect of genetic engineering was examined by testing glucose oxidase deficient (Δgox) mutants for the production of different organic acids in a defined production medium. The results obtained showed that the gluconic acid accumulation was completely inhibited and increased amounts of citric acid, oxalic acid and malic acid were observed in the Δgox mutants.

  5. Plant and animal glycolate oxidases have a common eukaryotic ancestor and convergently duplicated to evolve long-chain 2-hydroxy acid oxidases.


    Esser, Christian; Kuhn, Anke; Groth, Georg; Lercher, Martin J; Maurino, Veronica G


    Glycolate oxidase (GOX) is a crucial enzyme of plant photorespiration. The encoding gene is thought to have originated from endosymbiotic gene transfer between the eukaryotic host and the cyanobacterial endosymbiont at the base of plantae. However, animals also possess GOX activities. Plant and animal GOX belong to the gene family of (L)-2-hydroxyacid-oxidases ((L)-2-HAOX). We find that all (L)-2-HAOX proteins in animals and archaeplastida go back to one ancestral eukaryotic sequence; the sole exceptions are green algae of the chlorophyta lineage. Chlorophyta replaced the ancestral eukaryotic (L)-2-HAOX with a bacterial ortholog, a lactate oxidase that may have been obtained through the primary endosymbiosis at the base of plantae; independent losses of this gene may explain its absence in other algal lineages (glaucophyta, rhodophyta, and charophyta). We also show that in addition to GOX, plants possess (L)-2-HAOX proteins with different specificities for medium- and long-chain hydroxyacids (lHAOX), likely involved in fatty acid and protein catabolism. Vertebrates possess lHAOX proteins acting on similar substrates as plant lHAOX; however, the existence of GOX and lHAOX subfamilies in both plants and animals is not due to shared ancestry but is the result of convergent evolution in the two most complex eukaryotic lineages. On the basis of targeting sequences and predicted substrate specificities, we conclude that the biological role of plantae (L)-2-HAOX in photorespiration evolved by co-opting an existing peroxisomal protein. PMID:24408912

  6. Plant and animal glycolate oxidases have a common eukaryotic ancestor and convergently duplicated to evolve long-chain 2-hydroxy acid oxidases.


    Esser, Christian; Kuhn, Anke; Groth, Georg; Lercher, Martin J; Maurino, Veronica G


    Glycolate oxidase (GOX) is a crucial enzyme of plant photorespiration. The encoding gene is thought to have originated from endosymbiotic gene transfer between the eukaryotic host and the cyanobacterial endosymbiont at the base of plantae. However, animals also possess GOX activities. Plant and animal GOX belong to the gene family of (L)-2-hydroxyacid-oxidases ((L)-2-HAOX). We find that all (L)-2-HAOX proteins in animals and archaeplastida go back to one ancestral eukaryotic sequence; the sole exceptions are green algae of the chlorophyta lineage. Chlorophyta replaced the ancestral eukaryotic (L)-2-HAOX with a bacterial ortholog, a lactate oxidase that may have been obtained through the primary endosymbiosis at the base of plantae; independent losses of this gene may explain its absence in other algal lineages (glaucophyta, rhodophyta, and charophyta). We also show that in addition to GOX, plants possess (L)-2-HAOX proteins with different specificities for medium- and long-chain hydroxyacids (lHAOX), likely involved in fatty acid and protein catabolism. Vertebrates possess lHAOX proteins acting on similar substrates as plant lHAOX; however, the existence of GOX and lHAOX subfamilies in both plants and animals is not due to shared ancestry but is the result of convergent evolution in the two most complex eukaryotic lineages. On the basis of targeting sequences and predicted substrate specificities, we conclude that the biological role of plantae (L)-2-HAOX in photorespiration evolved by co-opting an existing peroxisomal protein.

  7. NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys

    PubMed Central

    Peck, Ammon B.; Khan, Saeed R.


    A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917

  8. NADPH Oxidase Biology and the Regulation of Tyrosine Kinase Receptor Signaling and Cancer Drug Cytotoxicity

    PubMed Central

    Paletta-Silva, Rafael; Rocco-Machado, Nathália; Meyer-Fernandes, José Roberto


    The outdated idea that reactive oxygen species (ROS) are only dangerous products of cellular metabolism, causing toxic and mutagenic effects on cellular components, is being replaced by the view that ROS have several important functions in cell signaling. In aerobic organisms, ROS can be generated from different sources, including the mitochondrial electron transport chain, xanthine oxidase, myeloperoxidase, and lipoxygenase, but the only enzyme family that produces ROS as its main product is the NADPH oxidase family (NOX enzymes). These transfer electrons from NADPH (converting it to NADP−) to oxygen to make O2•−. Due to their stability, the products of NADPH oxidase, hydrogen peroxide, and superoxide are considered the most favorable ROS to act as signaling molecules. Transcription factors that regulate gene expression involved in carcinogenesis are modulated by NADPH oxidase, and it has emerged as a promising target for cancer therapies. The present review discusses the mechanisms by which NADPH oxidase regulates signal transduction pathways in view of tyrosine kinase receptors, which are pivotal to regulating the hallmarks of cancer, and how ROS mediate the cytotoxicity of several cancer drugs employed in clinical practice. PMID:23434665

  9. Novel deletion in a patient with an isolated peroxisoml acyl-CoA oxidase deficiency

    SciTech Connect

    Poll-The, B.T.; Fournier, B.; Clevers, H.; Wanders, R.J.A.


    Disorders with defective peroxisome assembly are associated with multiple peroxisomal enzymatic abnormalities. Besides these diseases patients have been described suspected of having a single enzyme defect in the peroxisomal {beta}-oxidation pathway. Laboratory findings for these patients include elevated plasma very long chain fatty acids (VLCFA) and impaired VLCFA oxidation in fibroblasts. Complementation analysis between these patients and those with a proven single enzyme deficiency, using peroxisomal {beta}-oxidation of VLCFA as the criterion for complementation, has been used to show whether the patients are deficient in acyl-CoA oxidase, peroxisomal trifunctional protein or thiolase activity. Fibroblasts from a patient showing the clinical and biochemical abnormalities of isolated acyl-CoA oxidase deficiency (using cell complementation) were analyzed at the molecular level. Isolation of RNA from patient`s fibroblasts was followed by random reverse transcription of RNA and PCR amplification. PCR products were blotted and hybridized with the human acyl-CoA oxidase cDNA. A fragment 150 bp shorter than normal was found. Upon sequencing, exon 7 was found to be deleted leading to a frameshift in the acyl-CoA oxidase mRNA. Southern blot analysis of the patient`s DNA did not reveal any deletion in contrast to two siblings previously reported as having a deletion of at least 17 kb in the acyl-CoA oxidase gene.

  10. Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases

    PubMed Central

    Giacomelli, Lisa


    Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

  11. Expression studies on the ba3 quinol oxidase from Paracoccus denitrificans. A bb3 variant is enzymatically inactive.


    Zickermann, I; Tautu, O S; Link, T A; Korn, M; Ludwig, B; Richter, O M


    Expression of the quinol oxidase from Paracoccus denitrificans has been examined using a polyclonal antibody directed against subunit II and a promoter probe vector carrying the promoter region of the qox operon. Under aerobic conditions nitrate and nitrite act as specific inducers of the expression. To obtain an enzymatically competent quinol oxidase complex, an intact ctaB gene is required, which constitutes part of the cta operon coding for the aa3 cytochrome c oxidase of P. denitrificans. Deletion of ctaB leads to a change in heme composition of the quinol oxidase with heme b replacing the high-spin heme a of the binuclear center, causing loss of electron transport activity. PMID:9219517

  12. NADPH oxidases: new actors in thyroid cancer?


    Ameziane-El-Hassani, Rabii; Schlumberger, Martin; Dupuy, Corinne


    Hydrogen peroxide (H2O2) is a crucial substrate for thyroid peroxidase, a key enzyme involved in thyroid hormone synthesis. However, as a potent oxidant, H2O2 might also be responsible for the high level of oxidative DNA damage observed in thyroid tissues, such as DNA base lesions and strand breakages, which promote chromosomal instability and contribute to the development of tumours. Although the role of H2O2 in thyroid hormone synthesis is well established, its precise mechanisms of action in pathological processes are still under investigation. The NADPH oxidase/dual oxidase family are the only oxidoreductases whose primary function is to produce reactive oxygen species. As such, the function and expression of these enzymes are tightly regulated. Thyrocytes express dual oxidase 2, which produces most of the H2O2 for thyroid hormone synthesis. Thyrocytes also express dual oxidase 1 and NADPH oxidase 4, but the roles of these enzymes are still unknown. Here, we review the structure, expression, localization and function of these enzymes. We focus on their potential role in thyroid cancer, which is characterized by increased expression of these enzymes. PMID:27174022

  13. Xanthine oxidase inhibitory activity of alkyl gallates.


    Masuoka, Noriyoshi; Nihei, Ken-ichi; Kubo, Isao


    A series (C1-C12) of alkyl gallates was examined for their effects on the activity of xanthine oxidase. Octyl (C8), decyl (C10), and dodecyl (C12) gallates competitively inhibited uric acid formation generated by xanthine oxidase, and the inhibition increased upon increasing the alkyl chain length. Interestingly, neither menthyl nor bornyl gallates inhibited uric acid formation. These data indicate that the hydrophobic alkyl portion is associated with the xanthine-binding site in the Mo-binding domain. It is likely that the linear alkyl portion interacts with the hydrophobic domain close to the binding site, and the hydrophobic interaction is crucial to inhibit the xanthine oxidase reaction. On the other hand, all of gallic acid and its esters equally suppress superoxide anion generation catalyzed by xanthine oxidase at low concentration. The suppression is not due to scavenging activity of these gallates but due to reduction of xanthine oxidase by these gallates. The reduced enzyme catalyzes the reaction to generate hydrogen peroxide and uric acid.

  14. Mitochondrial targeting of human protoporphyrinogen oxidase.


    Davids, Lester M; Corrigall, Anne V; Meissner, Peter N


    Variegate porphyria is an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. This study examined the effect of three South African VP-causing mutations (H20P, R59W, R168C) on mitochondrial targeting. Only H20P did not target, and of eight protoporphyrinogen oxidase-GFP chimeric fusion proteins created, N-terminal residues 1-17 were found to be the minimal protoporphyrinogen oxidase sequence required for efficient mitochondrial targeting. Removal of this N-terminal sequence displayed mitochondrial localization, suggesting internal mitochondrial targeting signals. In addition, six constructs were engineered to assess the effect of charge and helicity on mitochondrial targeting of the protein. Of those engineered, only the PPOX20/H20P-GFP construct abolished mitochondrial targeting, presumably through disruption of the protoporphyrinogen oxidase alpha-helix. Based on our results we propose a mechanism for protoporphyrinogen oxidase targeting to the mitochondrion.

  15. Immunoblot analyses of the elicited Sanguinaria canadensis enzyme, dihydrobenzophenanthridine oxidase: evidence for resolution from a polyphenol oxidase isozyme.


    Ignatov, A; Neuman, M C; Barg, R; Krueger, R J; Coscia, C J


    In our initial purification of dihydrobenzophenanthridine oxidase from Sanguinaria canadensis plant cell cultures, we reported that our most purified preparations contained a major band at 77 kDa and minor lower Mr bands. Here we present evidence on highly purified dihydrobenzophenanthridine oxidase from elicited S. canadensis cultures to indicate that this enzyme is the 77-kDa protein and that lower Mr bands include an isozyme(s) of the polyphenol oxidase family that copurifies with it. An antibody raised against the 77-kDa protein and an anti-polyphenol oxidase antibody that recognizes a 70-kDa band were used to monitor chromatographic fractions by immunoblot analysis of the oxidases. Oxidase-containing eluates from DEAE-Sephadex, CM, and HiTrap blue were compared to corresponding flow-through fractions. Bands at 77 and 88 kDa were detected with anti-dihydrobenzophenanthridine oxidase antibody in eluates displaying high dihydrobenzophenanthridine oxidase activity. Polyphenol oxidase specific activity and immunoreactivity partitioned both in flow-through and eluate fractions of the CM and HiTrap columns. Estimation of the dihydrobenzophenanthridine oxidase and polyphenol oxidase specific activities for each step showed increasing enrichment of alkaloidal enzyme accompanied by variable dihydrobenzophenanthridine oxidase/polyphenol oxidase activity ratios. Taken together these observations indicate that the dihydrobenzophenanthridine and polyphenol oxidases have Mr values of 77 and 70 kDa, respectively, and the two enzymes are different entities.

  16. Alternative oxidase: distribution, induction, properties, structure, regulation, and functions.


    Rogov, A G; Sukhanova, E I; Uralskaya, L A; Aliverdieva, D A; Zvyagilskaya, R A


    The respiratory chain in the majority of organisms with aerobic type metabolism features the concomitant existence of the phosphorylating cytochrome pathway and the cyanide- and antimycin A-insensitive oxidative route comprising a so-called alternative oxidase (AOX) as a terminal oxidase. In this review, the history of AOX discovery is described. Considerable evidence is presented that AOX occurs widely in organisms at various levels of organization and is not confined to the plant kingdom. This enzyme has not been found only in Archaea, mammals, some yeasts and protists. Bioinformatics research revealed the sequences characteristic of AOX in representatives of various taxonomic groups. Based on multiple alignments of these sequences, a phylogenetic tree was constructed to infer their possible evolution. The ways of AOX activation, as well as regulatory interactions between AOX and the main respiratory chain are described. Data are summarized concerning the properties of AOX and the AOX-encoding genes whose expression is either constitutive or induced by various factors. Information is presented on the structure of AOX, its active center, and the ubiquinone-binding site. The principal functions of AOX are analyzed, including the cases of cell survival, optimization of respiratory metabolism, protection against excess of reactive oxygen species, and adaptation to variable nutrition sources and to biotic and abiotic stress factors. It is emphasized that different AOX functions complement each other in many instances and are not mutually exclusive. Examples are given to demonstrate that AOX is an important tool to overcome the adverse aftereffects of restricted activity of the main respiratory chain in cells and whole animals. This is the first comprehensive review on alternative oxidases of various organisms ranging from yeasts and protists to vascular plants.

  17. Xanthine oxidase inhibitors from Brandisia hancei.


    Kong, L D; Wolfender, J L; Cheng, C H; Hostettmann, K; Tan, R X


    Xanthine oxidase is a key enzyme associated with the incidence of hyperuricemia-related disorders. Repeated chromatography of the enzyme inhibitory part of the water extract of the twigs and leaves of Brandisia hancei (Scrophulariaceae) gave a flavone luteolin, an iridoid glycoside mussaenoside, two beta-sitosterol glycosides daucosterol and beta-sitosterol gentiobioside, and five phenylethanoids arenarioside, brandioside, acteoside, 2'-O-acetylacteoside and isoacteoside. Luteolin and isoacteoside inhibited the xanthine oxidase (XO, EC with the IC50 values at 7.83 and 45.48 microM, respectively. Isoacteoside was found to be the first phenylethanoid that decreased substantially the formation of uric acid by inhibiting competitively xanthine oxidase (Ki value: 10.08 microM). Furthermore, the study suggested that the caffeoylation of the 6'-hydroxyl group of the phenylethanoids was essential for the enzyme inhibitory action.

  18. Evidence for Interplay between Genes and Parenting on Infant Temperament in the First Year of Life: Monoamine Oxidase a Polymorphism Moderates Effects of Maternal Sensitivity on Infant Anger Proneness

    ERIC Educational Resources Information Center

    Pickles, Andrew; Hill, Jonathan; Breen, Gerome; Quinn, John; Abbott, Kate; Jones, Helen; Sharp, Helen


    Background: The low expression polymorphism of the MAOA gene in interaction with adverse environments (G × E) is associated with antisocial behaviour disorders. These have their origins in early life, but it is not known whether MAOA G × E occurs in infants. We therefore examined whether MAOA G × E predicts infant anger proneness, a temperamental…

  19. Differential Expression and Internal Feedback Regulation of 1-Aminocyclopropane-1-Carboxylate Synthase, 1-Aminocyclopropane-1-Carboxylate Oxidase, and Ethylene Receptor Genes in Tomato Fruit during Development and Ripening1

    PubMed Central

    Nakatsuka, Akira; Murachi, Shiho; Okunishi, Hironori; Shiomi, Shinjiro; Nakano, Ryohei; Kubo, Yasutaka; Inaba, Akitsugu


    We investigated the feedback regulation of ethylene biosynthesis in tomato (Lycopersicon esculentum) fruit with respect to the transition from system 1 to system 2 ethylene production. The abundance of LE-ACS2, LE-ACS4, and NR mRNAs increased in the ripening fruit concomitant with a burst in ethylene production. These increases in mRNAs with ripening were prevented to a large extent by treatment with 1-methylcyclopropene (MCP), an ethylene action inhibitor. Transcripts for the LE-ACS6 gene, which accumulated in preclimacteric fruit but not in untreated ripening fruit, did accumulate in ripening fruit treated with MCP. Treatment of young fruit with propylene prevented the accumulation of transcripts for this gene. LE-ACS1A, LE-ACS3, and TAE1 genes were expressed constitutively in the fruit throughout development and ripening irrespective of whether the fruit was treated with MCP or propylene. The transcripts for LE-ACO1 and LE-ACO4 genes already existed in preclimacteric fruit and increased greatly when ripening commenced. These increases in LE-ACO mRNA with ripening were also prevented by treatment with MCP. The results suggest that in tomato fruit the preclimacteric system 1 ethylene is possibly mediated via constitutively expressed LE-ACS1A and LE-ACS3 and negatively feedback-regulated LE-ACS6 genes with preexisting LE-ACO1 and LE-ACO4 mRNAs. At the onset of the climacteric stage, it shifts to system 2 ethylene, with a large accumulation of LE-ACS2, LE-ACS4, LE-ACO1, and LE-ACO4 mRNAs as a result of a positive feedback regulation. This transition from system 1 to system 2 ethylene production might be related to the accumulated level of NR mRNA. PMID:9847103

  20. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

    SciTech Connect

    Xu, Yun-Ling; Li, Li; Wu, Keqiang


    The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.

  1. Identification and characterization of Sclerotinia sclerotiorum NADPH oxidases.


    Kim, Hyo-jin; Chen, Changbin; Kabbage, Mehdi; Dickman, Martin B


    Numerous studies have shown both the detrimental and beneficial effects of reactive oxygen species (ROS) in animals, plants, and fungi. These organisms utilize controlled generation of ROS for signaling, pathogenicity, and development. Here, we show that ROS are essential for the pathogenic development of Sclerotinia sclerotiorum, an economically important fungal pathogen with a broad host range. Based on the organism's completed genome sequence, we identified two S. sclerotiorum NADPH oxidases (SsNox1 and SsNox2), which presumably are involved in ROS generation. RNA interference (RNAi) was used to examine the function of SsNox1 and SsNox2. Silencing of SsNox1 expression indicated a central role for this enzyme in both virulence and pathogenic (sclerotial) development, while inactivation of the SsNox2 gene resulted in limited sclerotial development, but the organism remained fully pathogenic. ΔSsnox1 strains had reduced ROS levels, were unable to develop sclerotia, and unexpectedly correlated with significantly reduced oxalate production. These results are in accordance with previous observations indicating that fungal NADPH oxidases are required for pathogenic development and are consistent with the importance of ROS regulation in the successful pathogenesis of S. sclerotiorum. PMID:21890677

  2. Complete genome sequence of the melanogenic marine bacterium Marinomonas mediterranea type strain (MMB-1T)

    SciTech Connect

    Lucas-Elio, Patricia; Goodwin, Lynne A.; Woyke, Tanja; Pitluck, Sam; Nolan, Matt; Kyrpides, Nikos C; Detter, J C; Copeland, A; Teshima, Hazuki; Bruce, David; Detter, J. Chris; Tapia, Roxanne; Han, Cliff; Land, Miriam L; Ivanova, N; Mikhailova, Natalia; Johnston, Andrew W. B.; Sanchez-Amat, Antonio


    Marinomonas mediterranea MMB-1 T Solano & Sanchez-Amat 1999 belongs to the family Oceanospirillaceae within the phylum Proteobacteria. This species is of interest because it is the only species described in the genus Marinomonas to date that can synthesize melanin pigments, which is mediated by the activity of a tyrosinase. M. mediterranea expresses other oxidases of biotechnological interest, such as a multicopper oxidase with laccase activity and a novel L-lysine-epsilon-oxidase. The 4,684,316 bp long genome harbors 4,228 proteincoding genes and 98 RNA genes and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  3. Spatiotemporal Localization of d-Amino Acid Oxidase and d-Aspartate Oxidases during Development in Caenorhabditis elegans

    PubMed Central

    Saitoh, Yasuaki; Katane, Masumi; Kawata, Tomonori; Maeda, Kazuhiro; Sekine, Masae; Furuchi, Takemitsu; Kobuna, Hiroyuki; Sakamoto, Taro; Inoue, Takao; Arai, Hiroyuki; Nakagawa, Yasuhito


    Recent investigations have shown that a variety of d-amino acids are present in living organisms and that they possibly play important roles in physiological functions in the body. d-Amino acid oxidase (DAO) and d-aspartate oxidase (DDO) are degradative enzymes stereospecific for d-amino acids. They have been identified in various organisms, including mammals and the nematode Caenorhabditis elegans, although the significance of these enzymes and the relevant functions of d-amino acids remain to be elucidated. In this study, we investigated the spatiotemporal localization of C. elegans DAO and DDOs (DDO-1, DDO-2, and DDO-3) and measured the levels of several d- and l-amino acids in wild-type C. elegans and four mutants in which each gene for DAO and the DDOs was partially deleted and thereby inactivated. Furthermore, several phenotypes of these mutant strains were characterized. The results reported in this study indicate that C. elegans DAO and DDOs are involved in egg-laying events and the early development of C. elegans. In particular, DDOs appear to play important roles in the development and maturation of germ cells. This work provides novel and useful insights into the physiological functions of these enzymes and d-amino acids in multicellular organisms. PMID:22393259

  4. Relationship of cytochrome caa sub 3 from Thermus thermophilus to other heme- and copper-containing terminal oxidases

    SciTech Connect

    Mather, M.W.; Springer, P.; Fee, J.A.


    Cytochrome oxidases are a key component of the energy metabolism of most aerobic organisms from mammals to bacteria. They are the final enzyme of the membrane associated respiratory chain responsible for converting the chemical energy of reduced substrates to a transmembrane electrochemical potential, which issused by the cell for a wide variety of energy-requiring processes. The most widely studied oxidase is the cytochrome c oxidase of the mammalian mitochondrion. This complex, integral membrane protein contains 13 subunits and four canonical metal centers: heme center a and a{sub 3}; copper centers CU{sub A} and CU{sub B}. It is responsible for electron transfer from reduced chytochrome c to dioxygen with the concomitant reduction of dioxygen to water and the coupled vectorial transfer of protons across the mitochondrial membrane. In this communication we will describe preliminary results of DNA sequencing experiments with the cytochrome caa{sub 3} oxidase, initially undertaken to determine the nature of the subunits of this oxidase and shed light on the distribution of the metal centers. We will speculate on oxidase gene and protein structures and evolutionary relationships in the light of these results and recent sequencing results from other groups. 47 refs., 4 figs., 1 tab.

  5. Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

    PubMed Central

    Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry


    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  6. A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio.


    Hernández-Romero, Diana; Sanchez-Amat, Antonio; Solano, Francisco


    The sequencing of the genome of Ralstonia solanacearum[Salanoubat M, Genin S, Artiguenave F, et al. (2002) Nature 415, 497-502] revealed several genes that putatively code for polyphenol oxidases (PPOs). This soil-borne pathogenic bacterium withers a wide range of plants. We detected the expression of two PPO genes (accession numbers NP_518458 and NP_519622) with high similarity to tyrosinases, both containing the six conserved histidines required to bind the pair of type-3 copper ions at the active site. Generation of null mutants in those genes by homologous recombination mutagenesis and protein purification allowed us to correlate each gene with its enzymatic activity. In contrast with all tyrosinases so far studied, the enzyme NP_518458 shows higher monophenolase than o-diphenolase activity and its initial activity does not depend on the presence of l-dopa cofactor. On the other hand, protein NP_519622 is an enzyme with a clear preference to oxidize o-diphenols and only residual monophenolase activity, behaving as a catechol oxidase. These catalytic characteristics are discussed in relation to two other characteristics apart from the six conserved histidines. One is the putative presence of a seventh histidine which interacts with the carboxy group on the substrate and controls the preference for carboxylated and decarboxylated substrates. The second is the size of the residue isosteric with the aromatic F261 reported in sweet potato catechol oxidase which acts as a gate to control accessibility to CuA at the active site. PMID:16403014

  7. Extracellular oxidases of the lignin-degrading fungus Panus tigrinus.


    Cadimaliev, D A; Revin, V V; Atykyan, N A; Samuilov, V D


    Two extracellular oxidases (laccases) were isolated from the extracellular fluid of the fungus Panus (Lentinus) tigrinus cultivated in low-nitrogen medium supplemented with birch sawdust. The enzymes were purified by successive chromatography on columns with TEAE-cellulose and DEAE-Toyopearl 650M. Both oxidases catalyze oxidation of pyrocatechol and ABTS. Moreover, oxidase 1 also catalyzes oxidation of guaiacol, o-phenylenediamine, and syringaldazine. The enzymes have identical pH (7.0) and temperature (60-65 degrees C) optimums. Absorption spectra of the oxidases differ from the spectra of typical "blue" laccases and are similar to the spectrum of yellow oxidase. PMID:16038613

  8. Copper Starvation-inducible Protein for Cytochrome Oxidase Biogenesis in Bradyrhizobium japonicum*

    PubMed Central

    Serventi, Fabio; Youard, Zeb Andrew; Murset, Valérie; Huwiler, Simona; Bühler, Doris; Richter, Miriam; Luchsinger, Ronny; Fischer, Hans-Martin; Brogioli, Robert; Niederer, Martina; Hennecke, Hauke


    Microarray analysis of Bradyrhizobium japonicum grown under copper limitation uncovered five genes named pcuABCDE, which are co-transcribed and co-regulated as an operon. The predicted gene products are periplasmic proteins (PcuA, PcuC, and PcuD), a TonB-dependent outer membrane receptor (PcuB), and a cytoplasmic membrane-integral protein (PcuE). Homologs of PcuC and PcuE had been discovered in other bacteria, namely PCuAC and YcnJ, where they play a role in cytochrome oxidase biogenesis and copper transport, respectively. Deletion of the pcuABCDE operon led to a pleiotropic phenotype, including defects in the aa3-type cytochrome oxidase, symbiotic nitrogen fixation, and anoxic nitrate respiration. Complementation analyses revealed that, under our assay conditions, the tested functions depended only on the pcuC gene and not on pcuA, pcuB, pcuD, or pcuE. The B. japonicum genome harbors a second pcuC-like gene (blr7088), which, however, did not functionally replace the mutated pcuC. The PcuC protein was overexpressed in Escherichia coli, purified to homogeneity, and shown to bind Cu(I) with high affinity in a 1:1 stoichiometry. The replacement of His79, Met90, His113, and Met115 by alanine perturbed copper binding. This corroborates the previously purported role of this protein as a periplasmic copper chaperone for the formation of the CuA center on the aa3-type cytochrome oxidase. In addition, we provide evidence that PcuC and the copper chaperone ScoI are important for the symbiotically essential, CuA-free cbb3-type cytochrome oxidase specifically in endosymbiotic bacteroids of soybean root nodules, which could explain the symbiosis-defective phenotype of the pcuC and scoI mutants. PMID:23012364

  9. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.


    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R


    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  10. Lysyl oxidase isoforms in gastric cancer.


    Añazco, Carolina; Delgado-López, Fernando; Araya, Paulina; González, Ileana; Morales, Erik; Pérez-Castro, Ramón; Romero, Jacqueline; Rojas, Armando


    Gastric cancer (GC) is the fifth most frequent cancer in the world and shows the highest incidence in Latin America and Asia. An increasing amount of evidence demonstrates that lysyl oxidase isoforms, a group of extracellular matrix crosslinking enzymes, should be considered as potential biomarkers and therapeutic targets in GC. In this review, we focus on the expression levels of lysyl oxidase isoforms, its functions and the clinical implications in GC. Finding novel proteins related to the processing of these extracellular matrix enzymes might be helpful in the design of new therapies, which, in combination with classic pharmacology, could be used to delay the progress of this aggressive cancer and offer a wider temporal window for clinical intervention. PMID:27564724

  11. Imaging Monoamine Oxidase in the Human Brain

    SciTech Connect

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean


    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.

  12. Monoamine oxidase inhibitors from Gentiana lutea.


    Haraguchi, Hiroyuki; Tanaka, Yasumasa; Kabbash, Amal; Fujioka, Toshihiro; Ishizu, Takashi; Yagi, Akira


    Three monoamine oxidase (MAO) inhibitors were isolated from Gentiana lutea. Their structures were elucidated to be 3-3''linked-(2'-hydroxy-4-O-isoprenylchalcone)-(2'''-hydroxy-4''-O-isoprenyldihydrochalcone) (1), 2-methoxy-3-(1,1'-dimethylallyl)-6a,10a-dihydrobenzo(1,2-c)chroman-6-one and 5-hydroxyflavanone. These compounds, and the hydrolysis product of 1, displayed competitive inhibitory properties against MAO-B which was more effective than MAO-A.

  13. Increased xanthine oxidase in the skin of preeclamptic women.


    Bainbridge, Shannon A; Deng, Jau-Shyong; Roberts, James M


    Xanthine oxioreductase is the holoenzyme responsible for terminal purine catabolism. Under conditions of metabolic stress or heightened proinflammatory cytokine production, this enzyme is preferentially in its oxidized form, xanthine oxidase, with catalytic action that generates uric acid and the free radical superoxide. As preeclampsia is characterized by heightened inflammation, oxidative stress, and hyperuricemia, it has been proposed that xanthine oxidase plays a pivotal role in this hypertensive disorder of pregnancy. We sought to determine whether xanthine oxidase protein content was higher in maternal tissue of preeclamptic mothers, compared to healthy pregnant controls, using immunohistochemical analysis of skin biopsies. We further compared xanthine oxidase immunoreactivity in skin biopsies from preeclamptic women and patients with several inflammatory conditions. In preeclamptic women, intense xanthine oxidase immunoreactivity was present within the epidermis. By contrast, only very faint xanthine oxidase staining was observed in skin biopsies from healthy pregnant controls. Further, a role for inflammation in the increase of xanthine oxidase was suggested by similar findings of heightened xanthine oxidase immunoreactivity in the skin biopsies from nonpregnant individuals diagnosed with conditions of systemic inflammation. The finding of increased xanthine oxidase in maternal tissue, most likely as the result of heightened maternal inflammation, suggests maternal xanthine oxidase as a source of free radical and uric acid generation in preeclampsia.

  14. Brain monoamine oxidase A activity predicts trait aggression.


    Alia-Klein, Nelly; Goldstein, Rita Z; Kriplani, Aarti; Logan, Jean; Tomasi, Dardo; Williams, Benjamin; Telang, Frank; Shumay, Elena; Biegon, Anat; Craig, Ian W; Henn, Fritz; Wang, Gene-Jack; Volkow, Nora D; Fowler, Joanna S


    The genetic deletion of monoamine oxidase A (MAO A), an enzyme that breaks down the monoamine neurotransmitters norepinephrine, serotonin, and dopamine, produces aggressive phenotypes across species. Therefore, a common polymorphism in the MAO A gene (MAOA, Mendelian Inheritance in Men database number 309850, referred to as high or low based on transcription in non-neuronal cells) has been investigated in a number of externalizing behavioral and clinical phenotypes. These studies provide evidence linking the low MAOA genotype and violent behavior but only through interaction with severe environmental stressors during childhood. Here, we hypothesized that in healthy adult males the gene product of MAO A in the brain, rather than the gene per se, would be associated with regulating the concentration of brain amines involved in trait aggression. Brain MAO A activity was measured in vivo in healthy nonsmoking men with positron emission tomography using a radioligand specific for MAO A (clorgyline labeled with carbon 11). Trait aggression was measured with the multidimensional personality questionnaire (MPQ). Here we report for the first time that brain MAO A correlates inversely with the MPQ trait measure of aggression (but not with other personality traits) such that the lower the MAO A activity in cortical and subcortical brain regions, the higher the self-reported aggression (in both MAOA genotype groups) contributing to more than one-third of the variability. Because trait aggression is a measure used to predict antisocial behavior, these results underscore the relevance of MAO A as a neurochemical substrate of aberrant aggression. PMID:18463263

  15. Genetic mapping of polyphenol oxidase in tetraploid wheat.


    Simeone, Rosanna; Pasqualone, Antonella; Clodoveo, Maria Lisa; Blanco, Antonio


    Pasta colour is one of the main factors influencing pasta quality. It is the product of a desirable yellow component, an undesirable brown component and, under some drying conditions, a red component. The brown colour depends on enzymatic and chemical factors. Polyphenol oxidase (PPO; E.C. is one of the enzymatic factors. It is mainly localised in the peripheral part of the wheat kernel, and is involved in the oxidation of endogenous wheat phenolic compounds resulting in the production of highly coloured products. Therefore, a knowledge of the genetic control of PPO activity could enable the developing of better strategies in breeding programs to reduce pasta darkening. The aim of this study was to map the gene(s) affecting PPO activity using a set of recombinant inbred (RI) lines, derived from a cross between Triticum turgidum L. var. durum cultivar Messapia and the accession MG4343 of Triticum turgidum L. var. dicoccoides. After performing linkage analysis, the gene for high PPO activity was mapped on the long arm of the chromosome 2A and its characteristic was found highly associated to the RFLP marker Xutv1427-2A, with a value of LOD equal to 29.84. The identification of molecular markers linked to loci controlling the PPO activity may potentially accelerate wheat breeding since the selection of plants can be carried out by genotype rather than phenotype.

  16. Genetic mapping of polyphenol oxidase in tetraploid wheat.


    Simeone, Rosanna; Pasqualone, Antonella; Clodoveo, Maria Lisa; Blanco, Antonio


    Pasta colour is one of the main factors influencing pasta quality. It is the product of a desirable yellow component, an undesirable brown component and, under some drying conditions, a red component. The brown colour depends on enzymatic and chemical factors. Polyphenol oxidase (PPO; E.C. is one of the enzymatic factors. It is mainly localised in the peripheral part of the wheat kernel, and is involved in the oxidation of endogenous wheat phenolic compounds resulting in the production of highly coloured products. Therefore, a knowledge of the genetic control of PPO activity could enable the developing of better strategies in breeding programs to reduce pasta darkening. The aim of this study was to map the gene(s) affecting PPO activity using a set of recombinant inbred (RI) lines, derived from a cross between Triticum turgidum L. var. durum cultivar Messapia and the accession MG4343 of Triticum turgidum L. var. dicoccoides. After performing linkage analysis, the gene for high PPO activity was mapped on the long arm of the chromosome 2A and its characteristic was found highly associated to the RFLP marker Xutv1427-2A, with a value of LOD equal to 29.84. The identification of molecular markers linked to loci controlling the PPO activity may potentially accelerate wheat breeding since the selection of plants can be carried out by genotype rather than phenotype. PMID:12378236

  17. Comparison of kinetic properties of amine oxidases from sainfoin and lentil and immunochemical characterization of copper/quinoprotein amine oxidases.


    Zajoncová, L; Frébort, I; Luhová, L; Sebela, M; Galuszka, P; Pec, P


    Kinetic properties of novel amine oxidase isolated from sainfoin (Onobrychis viciifolia) were compared to those of typical plant amine oxidase (EC from lentil (Lens culinaris). The amine oxidase from sainfoin was active toward substrates, such as 1,5-diaminopentane (cadaverine) with K(m) of 0.09 mM and 1,4-diaminobutane (putrescine) with K(m) of 0.24 mM. The maximum rate of oxidation for cadaverine at saturating concentration was 2.7 fold higher than that of putrescine. The amine oxidase from lentil had the maximum rate for putrescine comparable to the rate of sainfoin amine oxidase with the same substrate. Both amine oxidases, like other plant Cu-amine oxidases, were inhibited by substrate analogs (1,5-diamino-3-pentanone, 1,4-diamino-2-butanone and aminoguanidine), Cu2+ chelating agents (diethyltriamine, 1,10-phenanthroline, 8-hydroxyquinoline, 2,2'-bipyridyl, imidazole, sodium cyanide and sodium azide), some alkaloids (L-lobeline and cinchonine), some lathyrogens (beta-aminopropionitrile and aminoacetonitrile) and other inhibitors (benzamide oxime, acetone oxime, hydroxylamine and pargyline). Tested by Ouchterlony's double diffusion in agarose gel, polyclonal antibodies against the amine oxidase from sainfoin, pea and grass pea cross-reacted with amine oxidases from several other Fabaceae and from barley (Hordeum vulgare) of Poaceae, while amine oxidase from the filamentous fungus Aspergillus niger did not cross-react at all. However, using Western blotting after SDS-PAGE with rabbit polyclonal antibodies against the amine oxidase from Aspergillus niger, some degree of similarity of plant amine oxidases from sainfoin, pea, field pea, grass pea, fenugreek, common melilot, white sweetclover and Vicia panonica with the A. niger amine oxidase was confirmed. PMID:10092944

  18. ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.


    Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver


    Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. PMID:20630728

  19. CtaM Is Required for Menaquinol Oxidase aa3 Function in Staphylococcus aureus

    PubMed Central

    Schurig-Briccio, Lici A.; Gerdes, Svetlana Y.; Gennis, Robert B.


    ABSTRACT Staphylococcus aureus is the leading cause of skin and soft tissue infections, bacteremia, osteomyelitis, and endocarditis in the developed world. The ability of S. aureus to cause substantial disease in distinct host environments is supported by a flexible metabolism that allows this pathogen to overcome challenges unique to each host organ. One feature of staphylococcal metabolic flexibility is a branched aerobic respiratory chain composed of multiple terminal oxidases. Whereas previous biochemical and spectroscopic studies reported the presence of three different respiratory oxygen reductases (o type, bd type, and aa3 type), the genome contains genes encoding only two respiratory oxygen reductases, cydAB and qoxABCD. Previous investigation showed that cydAB and qoxABCD are required to colonize specific host organs, the murine heart and liver, respectively. This work seeks to clarify the relationship between the genetic studies showing the unique roles of the cydAB and qoxABCD in virulence and the respiratory reductases reported in the literature. We establish that QoxABCD is an aa3-type menaquinol oxidase but that this enzyme is promiscuous in that it can assemble as a bo3-type menaquinol oxidase. However, the bo3 form of QoxABCD restricts the carbon sources that can support the growth of S. aureus. In addition, QoxABCD function is supported by a previously uncharacterized protein, which we have named CtaM, that is conserved in aerobically respiring Firmicutes. In total, these studies establish the heme A biosynthesis pathway in S. aureus, determine that QoxABCD is a type aa3 menaquinol oxidase, and reveal CtaM as a new protein required for type aa3 menaquinol oxidase function in multiple bacterial genera. PMID:27406563

  20. Pathological changes in platelet histamine oxidases in atopic eczema

    PubMed Central

    Ionescu, Gruia


    Increased plasma histamine levels were associated with significantly lowered diamine and type B monoamine oxidase activities in platelet-rich plasma of atopic eczema (AE) patients. The diamine oxidase has almost normal cofactor levels (pyridoxal phosphate and Cu2+) but the cofactor levels for type B monoamine oxidase (flavin adenine dinucleotide and Fe2+) are lowered. The biogenic amines putrescine, cadaverine, spermidine, spermine, tyramine and serotonin in the sera, as well as dopamine and epinephrine in EDTA-plasma were found to be normal. It is unlikely, therefore, that these amines are responsible for the decreased activities of monoamine and diamine oxidase in these patients. The most likely causative factors for the inhibition of the diamine oxidase are nicotine, alcohol, food additives and other environmental chemicals, or perhaps a genetic defect of the diamine oxidase. PMID:18475554

  1. In vitro antimalarial and xanthine oxidase inhibition of 2-Aminoanthraquinone.


    Rauf, Abdur; Khan, Rehan; Khan, Haroon; Jehan, Noor; Akram, Mohammad; Ahmad, Zarka; Muhammad, Naveed; Farooq, Umar; Khan, Ajmal


    In the present research study 2-Aminoanthraquinone were scrutinized for their antimalarial and Xanthine oxidase inhibitor potential. It demonstrated marked concentration dependent antimalarial activity with maximum effect of 89.06% and with IC50 of 34.17 µM. Regarding Xanthine oxidase inhibitor activity, it evoked significant effect with 57.45% activity with IC50 value of 81.57.19 μM. In conclusion, 2-Aminoanthraquinone showed potent antimalarial and xanthine oxidase inhibitory activity. PMID:27087090

  2. Kinetic Results for Mutations of Conserved Residues H304 and R309 of Human Sulfite Oxidase Point to Mechanistic Complexities

    PubMed Central

    Davis, Amanda C.; Johnson-Winters, Kayunta; Arnold, Anna R.; Tollin, Gordon; Enemark, John H.


    Several point mutations in the gene of human sulfite oxidase (hSO) result in isolated sulfite oxidase deficiency, an inherited metabolic disorder. Three conserved residues (H304, R309, K322) are hydrogen bonded to the phosphate group of the molybdenum cofactor, and the R309H and K322R mutations are responsible for isolated sulfite oxidase deficiency. The kinetic effects of the K322R mutation have been previously reported (Rajapakshe et al. 2012, Chem. Biodiversity 9, 1621-1634); here we investigate several mutants of H304 and R309 by steady-state kinetics, laser flash photolysis studies of intramolecular electron transfer (IET), and spectroelectrochemistry. An unexpected result is that all of the mutants show decreased rates of IET but increased steady-state rates of catalysis. However, in all cases the rate of IET is greater than the overall turnover rate, showing that IET is not the rate determining step for any of the mutations. PMID:24968320

  3. Tellurite-mediated damage to the Escherichia coli NDH-dehydrogenases and terminal oxidases in aerobic conditions.


    Díaz-Vásquez, Waldo A; Abarca-Lagunas, María J; Cornejo, Fabián A; Pinto, Camilo A; Arenas, Felipe A; Vásquez, Claudio C


    Escherichia coli exposed to tellurite shows augmented membrane lipid peroxidation and ROS content. Also, reduced thiols, protein carbonylation, [Fe-S] center dismantling, and accumulation of key metabolites occur in these bacteria. In spite of this, not much is known about tellurite effects on the E. coli electron transport chain (ETC). In this work, tellurite-mediated damage to the E. coli ETC's NADH dehydrogenases and terminal oxidases was assessed. Mutant lacking ETC components showed delayed growth, decreased oxygen consumption and increased ROS in the presence of the toxicant. Membranes from tellurite-exposed E. coli exhibited decreased oxygen consumption and dNADH/NADH dehydrogenase activity, showing an impairment of NDH-I but not of NDH-II activity. Regarding terminal oxidases, only the bo oxidase complex was affected by tellurite. When assaying NDH-I and NDH-II activity in the presence of superoxide, the NDH-I complex was preferentially damaged. The activity was partly restored in the presence of reducing agents, sulfide and Fe(2+) under anaerobic conditions, suggesting that damage affects NDH-I [4Fe-4S] centers. Finally, augmented membrane protein oxidation along with reduced oxidase activity was observed in the presence of the toxicant. Also, the increased expression of genes encoding alternative terminal oxidases probably reflects a cell's change towards anaerobic respiration when facing tellurite. PMID:25447814

  4. Characterization of three bioenergetically active respiratory terminal oxidases in the cyanobacterium Synechocystis sp. strain PCC 6803.


    Pils, D; Schmetterer, G


    Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.

  5. The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea.


    Giesbert, Sabine; Schürg, Timo; Scheele, Sandra; Tudzynski, Paul


    The role of reactive oxygen species (ROS) in interactions between phytopathogenic fungi and their hosts is well established. An oxidative burst mainly caused by superoxide formation by membrane-associated NADPH oxidases is an essential element of plant defence reactions. Apart from primary effects, ROS play a major role as a second messenger in host response. Recently, NADPH oxidase (nox)-encoding genes have been identified in filamentous fungi. Functional analyses have shown that these fungal enzymes are involved in sexual differentiation, and there is growing evidence that they also affect developmental programmes involved in fungus-plant interactions. Here we show that in the biotrophic plant pathogen Claviceps purpurea deletion of the cpnox1 gene, probably encoding an NADPH oxidase, has impact on germination of conidia and pathogenicity: Deltacpnox1 mutants can penetrate the host epidermis, but they are impaired in colonization of the plant ovarian tissue. In the few cases where macroscopic signs of infection (honeydew) appear, they are extremely delayed and fully developed sclerotia have never been observed. C. purpurea Nox1 is important for the interaction with its host, probably by directly affecting pathogenic differentiation of the fungus.

  6. NADPH oxidase-mediated generation of reactive oxygen species: A new mechanism for X-ray-induced HeLa cell death

    SciTech Connect

    Liu Qing; He Xiaoqing; Liu Yongsheng; Du Bingbing; Wang Xiaoyan; Zhang Weisheng; Jia Pengfei; Dong Jingmei; Ma Jianxiu; Wang Xiaohu; Li Sha; Zhang Hong


    Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91{sup phox} was dose-dependent. Meanwhile, the cytoplasmic subunit p47{sup phox} was translocated to the cell membrane and localized with p22{sup phox} and gp91{sup phox} to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.

  7. Nanoparticle strategies for cancer therapeutics: Nucleic acids, polyamines, bovine serum amine oxidase and iron oxide nanoparticles (Review).


    Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J


    Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other

  8. Nox NADPH Oxidases and the Endoplasmic Reticulum

    PubMed Central

    Araujo, Thaís L.S.; Abrahão, Thalita B.


    Abstract Significance: Understanding isoform- and context-specific subcellular Nox reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase compartmentalization allows relevant functional inferences. This review addresses the interplay between Nox NADPH oxidases and the endoplasmic reticulum (ER), an increasingly evident player in redox pathophysiology given its role in redox protein folding and stress responses. Recent Advances: Catalytic/regulatory transmembrane subunits are synthesized in the ER and their processing includes folding, N-glycosylation, heme insertion, p22phox heterodimerization, as shown for phagocyte Nox2. Dual oxidase (Duox) maturation also involves the regulation by ER-resident Duoxa2. The ER is the activation site for some isoforms, typically Nox4, but potentially other isoforms. Such location influences redox/Nox-mediated calcium signaling regulation via ER targets, such as sarcoendoplasmic reticulum calcium ATPase (SERCA). Growing evidence suggests that Noxes are integral signaling elements of the unfolded protein response during ER stress, with Nox4 playing a dual prosurvival/proapoptotic role in this setting, whereas Nox2 enhances proapoptotic signaling. ER chaperones such as protein disulfide isomerase (PDI) closely interact with Noxes. PDI supports growth factor-dependent Nox1 activation and mRNA expression, as well as migration in smooth muscle cells, and PDI overexpression induces acute spontaneous Nox activation. Critical Issues: Mechanisms of PDI effects include possible support of complex formation and RhoGTPase activation. In phagocytes, PDI supports phagocytosis, Nox activation, and redox-dependent interactions with p47phox. Together, the results implicate PDI as possible Nox organizer. Future Directions: We propose that convergence between Noxes and ER may have evolutive roots given ER-related functional contexts, which paved Nox evolution, namely calcium signaling and pathogen killing. Overall, the interplay between

  9. Loss of Lysyl Oxidase-like 3 Attenuates Embryonic Lung Development in Mice.


    Zhang, Jian; Liu, Ziyi; Zhang, Tingting; Lin, Zhuchun; Li, Zhenzu; Zhang, Aizhen; Sun, Xiaoyang; Gao, Jiangang


    Lysyl oxidase-like 3 (LOXL3), a human disease gene candidate, is a member of the lysyl oxidase (LOX) family and is indispensable for mouse palatogenesis and vertebral column development. Our previous study showed that the loss of LOXL3 resulted in a severe cleft palate and spinal deformity. In this study, we investigated a possible role for LOXL3 in mouse embryonic lung development. LOXL3-deficient mice displayed reduced lung volumes and weights, diminished saccular spaces, and deformed and smaller thoracic cavities. Excess elastic fibres were detected in LOXL3-deficient lungs, which might be related to the increased LOXL4 expression. Increased transforming growth factor β1 (TGFβ1) expression might be involved in the up-regulation of LOXL4 in LOXL3-deficient lungs. We concluded that the loss of LOXL3 attenuates mouse embryonic lung development. PMID:27645581

  10. Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd


    Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD+. The oxidation of NADH to NAD+ was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. PMID:26930704

  11. Reduced cytochrome oxidase activity in the retrosplenial cortex after lesions to the anterior thalamic nuclei.


    Mendez-Lopez, Magdalena; Arias, Jorge L; Bontempi, Bruno; Wolff, Mathieu


    The anterior thalamic nuclei (ATN) make a critical contribution to hippocampal system functions. Growing experimental work shows that the effects of ATN lesions often resemble those of hippocampal lesions and both markedly reduce the expression of immediate-early gene markers in the retrosplenial cortex, which still appears normal by standard histological means. This study shows that moderate ATN damage was sufficient to produce severe spatial memory impairment as measured in a radial-arm maze. Furthermore, ATN rats exhibited reduced cytochrome oxidase activity in the most superficial cortical layers of the granular retrosplenial cortex, and, to a lesser extent, in the anterior cingulate cortex. By contrast, no change in cytochrome oxidase activity was observed in other limbic cortical regions or in the hippocampal formation. Altogether our results indicate that endogenous long-term brain metabolic capacity within the granular retrosplenial cortex is compromised by even limited ATN damage.

  12. Thermosensitive respiratory deficiency in yeast associated with specific effects on particulate cytochrome oxidase.


    Bex, F; Sels, A A


    A mutant of Saccharomyces cerevisiae, unable to grow at the expense of non fermentable carbon sources at 37 degrees C, has been selected; at 25 degrees C the mutant strain behaves like the parental wild strain. Evaluations of respiration rates during aerobic growth at restrictive temperature on one hand, enzymatic and/or spectral evaluations of the individual components of the respiratory chain on the other hand show that the respiratory deficiency is specifically correlated with a reduced level of cytochrome oxidase. The decrease of enzyme activity is the direct consequence of a lowering of hemoprotein (a,a3) concentration. Temperature-activity relationship of cytochrome oxidase elaborated at the permissive temperature by the mutant strain is modified as far as the particulate enzyme is concerned, but no difference is observed after partial solubilization of the enzyme by non ionic surfactant. Genetic analysis shows that the mutant phenotype results from a nuclear gene mutation.

  13. Loss of Lysyl Oxidase-like 3 Attenuates Embryonic Lung Development in Mice

    PubMed Central

    Zhang, Jian; Liu, Ziyi; Zhang, Tingting; Lin, Zhuchun; Li, Zhenzu; Zhang, Aizhen; Sun, Xiaoyang; Gao, Jiangang


    Lysyl oxidase-like 3 (LOXL3), a human disease gene candidate, is a member of the lysyl oxidase (LOX) family and is indispensable for mouse palatogenesis and vertebral column development. Our previous study showed that the loss of LOXL3 resulted in a severe cleft palate and spinal deformity. In this study, we investigated a possible role for LOXL3 in mouse embryonic lung development. LOXL3-deficient mice displayed reduced lung volumes and weights, diminished saccular spaces, and deformed and smaller thoracic cavities. Excess elastic fibres were detected in LOXL3-deficient lungs, which might be related to the increased LOXL4 expression. Increased transforming growth factor β1 (TGFβ1) expression might be involved in the up-regulation of LOXL4 in LOXL3-deficient lungs. We concluded that the loss of LOXL3 attenuates mouse embryonic lung development. PMID:27645581

  14. NADPH Oxidase Promotes Neutrophil Extracellular Trap Formation in Pulmonary Aspergillosis

    PubMed Central

    Röhm, Marc; Grimm, Melissa J.; D'Auria, Anthony C.; Almyroudis, Nikolaos G.


    NADPH oxidase is a crucial enzyme in antimicrobial host defense and in regulating inflammation. Chronic granulomatous disease (CGD) is an inherited disorder of NADPH oxidase in which phagocytes are defective in generation of reactive oxidant intermediates. Aspergillus species are ubiquitous, filamentous fungi, which can cause invasive aspergillosis, a major cause of morbidity and mortality in CGD, reflecting the critical role for NADPH oxidase in antifungal host defense. Activation of NADPH oxidase in neutrophils can be coupled to the release of proteins and chromatin that comingle in neutrophil extracellular traps (NETs), which can augment extracellular antimicrobial host defense. NETosis can be driven by NADPH oxidase-dependent and -independent pathways. We therefore undertook an analysis of whether NADPH oxidase was required for NETosis in Aspergillus fumigatus pneumonia. Oropharyngeal instillation of live Aspergillus hyphae induced neutrophilic pneumonitis in both wild-type and NADPH oxidase-deficient (p47phox−/−) mice which had resolved in wild-type mice by day 5 but progressed in p47phox−/− mice. NETs, identified by immunostaining, were observed in lungs of wild-type mice but were absent in p47phox−/− mice. Using bona fide NETs and nuclear chromatin decondensation as an early NETosis marker, we found that NETosis required a functional NADPH oxidase in vivo and ex vivo. In addition, NADPH oxidase increased the proportion of apoptotic neutrophils. Together, our results show that NADPH oxidase is required for pulmonary clearance of Aspergillus hyphae and generation of NETs in vivo. We speculate that dual modulation of NETosis and apoptosis by NADPH oxidase enhances antifungal host defense and promotes resolution of inflammation upon infection clearance. PMID:24549323

  15. Mouse aldehyde-oxidase-4 controls diurnal rhythms, fat deposition and locomotor activity

    PubMed Central

    Terao, Mineko; Barzago, Maria Monica; Kurosaki, Mami; Fratelli, Maddalena; Bolis, Marco; Borsotti, Andrea; Bigini, Paolo; Micotti, Edoardo; Carli, Mirjana; Invernizzi, Roberto William; Bagnati, Renzo; Passoni, Alice; Pastorelli, Roberta; Brunelli, Laura; Toschi, Ivan; Cesari, Valentina; Sanoh, Seigo; Garattini, Enrico


    Aldehyde-oxidase-4 (AOX4) is one of the mouse aldehyde oxidase isoenzymes and its physiological function is unknown. The major source of AOX4 is the Harderian-gland, where the enzyme is characterized by daily rhythmic fluctuations. Deletion of the Aox4 gene causes perturbations in the expression of the circadian-rhythms gene pathway, as indicated by transcriptomic analysis. AOX4 inactivation alters the diurnal oscillations in the expression of master clock-genes. Similar effects are observed in other organs devoid of AOX4, such as white adipose tissue, liver and hypothalamus indicating a systemic action. While perturbations of clock-genes is sex-independent in the Harderian-gland and hypothalamus, sex influences this trait in liver and white-adipose-tissue which are characterized by the presence of AOX isoforms other than AOX4. In knock-out animals, perturbations in clock-gene expression are accompanied by reduced locomotor activity, resistance to diet induced obesity and to hepatic steatosis. All these effects are observed in female and male animals. Resistance to obesity is due to diminished fat accumulation resulting from increased energy dissipation, as white-adipocytes undergo trans-differentiation towards brown-adipocytes. Metabolomics and enzymatic data indicate that 5-hydroxyindolacetic acid and tryptophan are novel endogenous AOX4 substrates, potentially involved in AOX4 systemic actions. PMID:27456060

  16. Endothelins and NADPH oxidases in the cardiovascular system.


    Dammanahalli, Karigowda J; Sun, Zhongjie


    1. The endothelin (ET) system and NADPH oxidase play important roles in the regulation of cardiovascular function, as well as in the pathogenesis of hypertension and other cardiovascular diseases. 2. Endothelins activate NADPH oxidases and thereby increase superoxide production, resulting in oxidative stress and cardiovascular dysfunction. Thus, NADPH oxidases may mediate the role of endothelins in some cardiovascular diseases. However, the role of reactive oxygen species (ROS) in mediating ET-induced vasoconstriction and cardiovascular disease remains under debate, as evidenced by conflicting reports from different research teams. Conversely, activation of NADPH oxidase can stimulate ET secretion via ROS generation, which further enhances the cardiovascular effects of NADPH oxidase. However, little is known about how ROS activate the endothelin system. It seems that the relationship between ET-1 and ROS may vary with cardiovascular disorders. 3. Endothelins activate NADPH oxidase via the ET receptor-proline-rich tyrosine kinase-2 (Pyk2)-Rac1 pathway. Rac1 is an important regulator of NADPH oxidase. There is ample evidence supporting direct stimulation by Rac1 of NADPH oxidase activity. In addition, Rac1-induced cardiomyocyte hypertrophy is mediated by the generation of ROS.

  17. Characterization of a flavoprotein oxidase from opium poppy catalyzing the final steps in sanguinarine and papaverine biosynthesis.


    Hagel, Jillian M; Beaudoin, Guillaume A W; Fossati, Elena; Ekins, Andrew; Martin, Vincent J J; Facchini, Peter J


    Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The K(m) values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism.

  18. Evidence for a Key Role of Cytochrome bo3 Oxidase in Respiratory Energy Metabolism of Gluconobacter oxydans

    PubMed Central

    Richhardt, Janine; Luchterhand, Bettina; Büchs, Jochen


    The obligatory aerobic acetic acid bacterium Gluconobacter oxydans oxidizes a variety of substrates in the periplasm by membrane-bound dehydrogenases, which transfer the reducing equivalents to ubiquinone. Two quinol oxidases, cytochrome bo3 and cytochrome bd, then catalyze transfer of the electrons from ubiquinol to molecular oxygen. In this study, mutants lacking either of these terminal oxidases were characterized. Deletion of the cydAB genes for cytochrome bd had no obvious influence on growth, whereas the lack of the cyoBACD genes for cytochrome bo3 severely reduced the growth rate and the cell yield. Using a respiration activity monitoring system and adjusting different levels of oxygen availability, hints of a low-oxygen affinity of cytochrome bd oxidase were obtained, which were supported by measurements of oxygen consumption in a respirometer. The H+/O ratio of the ΔcyoBACD mutant with mannitol as the substrate was 0.56 ± 0.11 and more than 50% lower than that of the reference strain (1.26 ± 0.06) and the ΔcydAB mutant (1.31 ± 0.16), indicating that cytochrome bo3 oxidase is the main component for proton extrusion via the respiratory chain. Plasmid-based overexpression of cyoBACD led to increased growth rates and growth yields, both in the wild type and the ΔcyoBACD mutant, suggesting that cytochrome bo3 might be a rate-limiting factor of the respiratory chain. PMID:23852873

  19. Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis.


    Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun


    Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction.

  20. Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

    PubMed Central

    Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.


    Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

  1. The human lysyl oxidase-like 2 protein functions as an amine oxidase toward collagen and elastin.


    Kim, Young-Mi; Kim, Eun-Cheol; Kim, Youngho


    The lysyl oxidase-like 2 (LOXL2) protein is a human paralogue of lysyl oxidase (LOX) that functions as an amine oxidase for formation of lysine-derived cross-links found in collagen and elastin. In addition to the C-terminal domains characteristic to the LOX family members, LOXL2 contains four scavenger receptor cysteine-rich (SRCR) domains in the N-terminus. In order to assess the amine oxidase activity of LOXL2, we expressed a series of recombinant LOXL2 proteins with deletions in the SRCR domains, using an Escherichia coli expression system. All of the purified recombinant LOXL2 proteins, with or without the SRCR domains in the N-terminus, showed significant amine oxidase activity toward several different types of collagen and elastin in in vitro amine oxidase assays, indicating deletion of the SRCR domains does not interfere with amine oxidase activity of LOXL2. Further, amine oxidase activity of LOXL2 was not susceptible to inhibition by β-aminopropionitrile, an irreversible inhibitor of LOX, suggesting a different enzymatic mechanism between these two paralogues.

  2. Loss of lysyl oxidase-like 3 causes cleft palate and spinal deformity in mice.


    Zhang, Jian; Yang, Rui; Liu, Ziyi; Hou, Congzhe; Zong, Wen; Zhang, Aizhen; Sun, Xiaoyang; Gao, Jiangang


    In mammals, embryonic development are highly regulated morphogenetic processes that are tightly controlled by genetic elements. Failure of any one of these processes can result in embryonic malformation. The lysyl oxidase (LOX) family genes are closely related to human diseases. In this study, we investigated the essential role of lysyl oxidase-like 3 (LOXL3), a member of the LOX family, in embryonic development. Mice lacking LOXL3 exhibited perinatal lethality, and the deletion of the Loxl3 gene led to impaired development of the palate shelves, abnormalities in the cartilage primordia of the thoracic vertebrae and mild alveolar shrinkage. We found that the obvious decrease of collagen cross-links in palate and spine that was induced by the lack of LOXL3 resulted in cleft palate and spinal deformity. Thus, we provide critical in vivo evidence that LOXL3 is indispensable for mouse palatogenesis and vertebral column development. The Loxl3 gene may be a candidate disease gene resulting in cleft palate and spinal deformity.

  3. Loss of lysyl oxidase-like 3 causes cleft palate and spinal deformity in mice

    PubMed Central

    Zhang, Jian; Yang, Rui; Liu, Ziyi; Hou, Congzhe; Zong, Wen; Zhang, Aizhen; Sun, Xiaoyang; Gao, Jiangang


    In mammals, embryonic development are highly regulated morphogenetic processes that are tightly controlled by genetic elements. Failure of any one of these processes can result in embryonic malformation. The lysyl oxidase (LOX) family genes are closely related to human diseases. In this study, we investigated the essential role of lysyl oxidase-like 3 (LOXL3), a member of the LOX family, in embryonic development. Mice lacking LOXL3 exhibited perinatal lethality, and the deletion of the Loxl3 gene led to impaired development of the palate shelves, abnormalities in the cartilage primordia of the thoracic vertebrae and mild alveolar shrinkage. We found that the obvious decrease of collagen cross-links in palate and spine that was induced by the lack of LOXL3 resulted in cleft palate and spinal deformity. Thus, we provide critical in vivo evidence that LOXL3 is indispensable for mouse palatogenesis and vertebral column development. The Loxl3 gene may be a candidate disease gene resulting in cleft palate and spinal deformity. PMID:26307084

  4. Constitutive arsenite oxidase expression detected in arsenic-hypertolerant Pseudomonas xanthomarina S11.


    Koechler, Sandrine; Arsène-Ploetze, Florence; Brochier-Armanet, Céline; Goulhen-Chollet, Florence; Heinrich-Salmeron, Audrey; Jost, Bernard; Lièvremont, Didier; Philipps, Muriel; Plewniak, Frédéric; Bertin, Philippe N; Lett, Marie-Claire


    Pseudomonas xanthomarina S11 is an arsenite-oxidizing bacterium isolated from an arsenic-contaminated former gold mine in Salsigne, France. This bacterium showed high resistance to arsenite and was able to oxidize arsenite to arsenate at concentrations up to 42.72 mM As[III]. The genome of this strain was sequenced and revealed the presence of three ars clusters. One of them is located on a plasmid and is organized as an "arsenic island" harbouring an aio operon and genes involved in phosphorous metabolism, in addition to the ars genes. Neither the aioXRS genes nor a specific sigma-54-dependent promoter located upstream of aioBA genes, both involved in regulation of arsenite oxidase expression in other arsenite-oxidizing bacteria, could be identified in the genome. This observation is in accordance with the fact that no difference was observed in expression of arsenite oxidase in P. xanthomarina S11, whether or not the strain was grown in the presence of As[III].

  5. Apocyanin, a Microglial NADPH Oxidase Inhibitor Prevents Dopaminergic Neuronal Degeneration in Lipopolysaccharide-Induced Parkinson's Disease Model.


    Sharma, Neha; Nehru, Bimla


    Microglia-associated inflammatory processes have been strongly implicated in the development and progression of Parkinson's disease (PD). Specifically, microglia are activated in response to lipopolysaccharide (LPS) and become chronic source of cytokines and reactive oxygen species (ROS) production. Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase complex is responsible for extracellular as well as intracellular production of ROS by microglia and its expression is upregulated in PD. Therefore, targeting NADPH oxidase complex activation using an NADPH oxidase inhibitor, i.e., apocyanin seems to be an effective approach. The aim of present study was to investigate the neuroprotective effects of apocyanin in a LPS-induced PD model. LPS (5 μg) was injected intranigral and apocyanin was administered daily at a dose of 10 mg/kg b.wt (i.p.) during the experiment. LPS when injected into the substantia nigra (SN) reproduced the characteristic hallmark features of PD in rats. It elicited an inflammatory response characterized by glial cell activation (Iba-1, GFAP). Furthermore, LPS upregulated the gene expression of nuclear factor-κB (NFκB), iNOS, and gp91PHOX and resulted in an elevated total ROS production as well as NADPH oxidase activity. Subsequently, this resulted in dopaminergic loss as depicted by decreased tyrosine hydroxylase (TH) expression with substantial loss in neurotransmitter dopamine and its metabolites, whereas treatment with apocyanin significantly reduced the number of glial fibrillary acidic protein (GFAP) and Iba-1-positive cells in LPS-treated animals. It also mitigated microglial activation-induced inflammatory response and elevation in NADPH oxidase activity, thus reducing the extracellular as well as intracellular ROS production. The present study indicated that targeting NADPH oxidase can inhibit microglial activation and reduce a broad spectrum of toxic factors generation (i.e., cytokines, ROS, and reactive nitrogen species [RNS

  6. Cell Wall Amine Oxidases: New Players in Root Xylem Differentiation under Stress Conditions.


    Ghuge, Sandip A; Tisi, Alessandra; Carucci, Andrea; Rodrigues-Pousada, Renato A; Franchi, Stefano; Tavladoraki, Paraskevi; Angelini, Riccardo; Cona, Alessandra


    Polyamines (PAs) are aliphatic polycations present in all living organisms. A growing body of evidence reveals their involvement as regulators in a variety of physiological and pathological events. They are oxidatively deaminated by amine oxidases (AOs), including copper amine oxidases (CuAOs) and flavin adenine dinucleotide (FAD)-dependent polyamine oxidases (PAOs). The biologically-active hydrogen peroxide (H₂O₂) is a shared compound in all of the AO-catalyzed reactions, and it has been reported to play important roles in PA-mediated developmental and stress-induced processes. In particular, the AO-driven H₂O₂ biosynthesis in the cell wall is well known to be involved in plant wound healing and pathogen attack responses by both triggering peroxidase-mediated wall-stiffening events and signaling modulation of defense gene expression. Extensive investigation by a variety of methodological approaches revealed high levels of expression of cell wall-localized AOs in root xylem tissues and vascular parenchyma of different plant species. Here, the recent progresses in understanding the role of cell wall-localized AOs as mediators of root xylem differentiation during development and/or under stress conditions are reviewed. A number of experimental pieces of evidence supports the involvement of apoplastic H₂O₂ derived from PA oxidation in xylem tissue maturation under stress-simulated conditions. PMID:27135338

  7. Crp-dependent cytochrome bd oxidase confers nitrite resistance to Shewanella oneidensis.


    Fu, Huihui; Chen, Haijiang; Wang, Jixuan; Zhou, Guangqi; Zhang, Haiyan; Zhang, Lili; Gao, Haichun


    Shewanella oneidensis is able to respire on a variety of organic and inorganic substrates, including nitrate and nitrite. Conversion of nitrate to nitrite and nitrite to ammonium is catalysed by periplasmic nitrate and nitrite reductases (NAP and NRF) respectively. Global regulator Crp (cyclic AMP receptor protein) is essential for growth of S. oneidensis on both nitrate and nitrite. In this study, we discovered that crp mutants are not only severely deficient in nitrate or nitrite respiration, but are also hypersensitive to nitrite. This hypersusceptibility phenotype is independent of nitrite respiration. Using random transposon mutagenesis, we obtained 73 Δcrp suppressor strains resistant to nitrite. Transposon insertion sites in 24 suppressor strains were exclusively mapped in the region upstream of the cyd operon encoding a cytochrome bd oxidase, resulting in expression of the operon now driven by a Crp-independent promoter. Further investigation indicated that the promoter in suppressor strains comes from the transposon. Mutational analysis of the cydB gene (encoding the essential subunit II of the bd oxidase) confirmed that the cytochrome bd oxidase confers nitrite resistance to S. oneidensis.

  8. Specific and reversible immobilization of NADH oxidase on functionalized carbon nanotubes.


    Wang, Liang; Wei, Li; Chen, Yuan; Jiang, Rongrong


    Nanotechnology-inspired biocatalyst systems have attracted a lot of attention in enzyme immobilization recently. Theoretically, nanomaterials are ideal supporting materials because they can provide the upper limits on enzyme-efficiency-determining factors such as surface area/volume ratio, enzyme loading capacity and mass transfer resistance. However, common immobilization methods have limited the applicability of these biocatalysts owing to enzyme leaching, 3D structure loss, and strong diffusion resistance. Expensive enzyme purification step is also required for these methods before immobilization. In this work, we show an efficient immobilization method based on specific interaction between His-tagged NADH oxidase and functionalized single-walled carbon nanotubes without requiring enzyme purification for immobilization. We cloned the annotated NADH oxidase gene from Bacillus cereus genome and overexpressed with pET30 vector encoding N-terminal 6× His-tag. The His-tagged NADH oxidase was then immobilized onto single-walled carbon nanotubes functionalized with N(α),N(α)-bis(carboxymethyl)-L-lysine hydrate. The resulting nanoscale biocatalyst has overcome the foresaid limitations, and demonstrates good loading capacity and stability while maintaining 92% maximum activity of the native enzyme. We further demonstrate that the immobilization is reversible and can retain ca. 92% activity for a couple of loading cycles. PMID:20630484

  9. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    NASA Technical Reports Server (NTRS)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)


    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  10. Enzymatic polymerization of dihydroquercetin using bilirubin oxidase.


    Khlupova, M E; Vasil'eva, I S; Shumakovich, G P; Morozova, O V; Chertkov, V A; Shestakova, A K; Kisin, A V; Yaropolov, A I


    Dihydroquercetin (or taxifolin) is one of the most famous flavonoids and is abundant in Siberian larch (Larix sibirica). The oxidative polymerization of dihydroquercetin (DHQ) using bilirubin oxidase as a biocatalyst was investigated and some physicochemical properties of the products were studied. DHQ oligomers (oligoDHQ) with molecular mass of 2800 and polydispersity of 8.6 were obtained by enzymatic reaction under optimal conditions. The oligomers appeared to be soluble in dimethylsulfoxide, dimethylformamide, and methanol. UV-visible spectra of oligoDHQ in dimethylsulfoxide indicated the presence of highly conjugated bonds. The synthesized oligoDHQ was also characterized by FTIR and (1)H and (13)C NMR spectroscopy. Comparison of NMR spectra of oligoDHQ with DHQ monomer and the parent flavonoids revealed irregular structure of a polymer formed via the enzymatic oxidation of DHQ followed by nonselective radical polymerization. As compared with the monomer, oligoDHQ demonstrated higher thermal stability and high antioxidant activity.

  11. [NADPH oxidases, Nox: new isoenzymes family].


    Chuong Nguyen, Minh Vu; Lardy, Bernard; Paclet, Marie-Hélène; Rousset, Francis; Berthier, Sylvie; Baillet, Athan; Grange, Laurent; Gaudin, Philippe; Morel, Françoise


    NADPH oxidases, Nox, are a family of isoenzymes, composed of seven members, whose sole function is to produce reactive oxygen species (ROS). Although Nox catalyze the same enzymatic reaction, they acquired from a common ancestor during evolution, specificities related to their tissue expression, subcellular localization, activation mechanisms and regulation. Their functions could vary depending on the pathophysiological state of the tissues. Indeed, ROS are not only bactericidal weapons in phagocytes but also essential cellular signaling molecules and their overproduction is involved in chronic diseases and diseases of aging. The understanding of the mechanisms involved in the function of Nox and the emergence of Nox inhibitors, require a thorough knowledge of their nature and structure. The objectives of this review are to highlight, in a structure/function approach, the main similar and differentiated properties shared by the human Nox isoenzymes.

  12. Degradation of pentachlorophenol by potato polyphenol oxidase.


    Hou, Mei-Fang; Tang, Xiao-Yan; Zhang, Wei-De; Liao, Lin; Wan, Hong-Fu


    In this study, polyphenol oxidase (PPO) was extracted from commercial potatoes. Degradation of pentachlorophenol by potato PPO was investigated. The experimental results show that potato PPO is more active in weak acid than in basic condition and that the optimum pH for the reaction is 5.0. The degradation of pentachlorophenol by potato PPO reaches a maximum at 298 K. After reaction for 1 h, the removal of both pentachlorophenol and total organic carbon is >70% with 6.0 units/mL potato PPO at pH 5.0 and 298 K. Pentachlorophenol can be degraded through dechlorination and ring-opening by potato PPO. The work demonstrates that pentachlorophenol can be effectively eliminated by crude potato PPO. PMID:21967325

  13. Visualization of monoamine oxidase in human brain

    SciTech Connect

    Fowler, J.S.; Volkow, N.D.; Wang, G.J.; Pappas, N.; Shea, C.; MacGregor, R.R.; Logan, J.


    Monoamine oxidase is a flavin enzyme which exists in two subtypes, MAO A and MAO B. In human brain MAO B predominates and is largely compartmentalized in cell bodies of serotonergic neurons and glia. Regional distribution of MAO B was determined by positron computed tomography with volunteers after the administration of deuterium substituted [11C]L-deprenyl. The basal ganglia and thalamus exhibited the greatest concentrations of MAO B with intermediate levels in the frontal cortex and cingulate gyrus while lowest levels were observed in the parietal and temporal cortices and cerebellum. We observed that brain MAO B increases with are in health normal subjects, however the increases were generally smaller than those revealed with post-mortem studies.

  14. NADPH Oxidases in Lung Health and Disease

    PubMed Central

    Bernard, Karen; Hecker, Louise; Luckhardt, Tracy R.; Cheng, Guangjie


    Abstract Significance: The evolution of the lungs and circulatory systems in vertebrates ensured the availability of molecular oxygen (O2; dioxygen) for aerobic cellular metabolism of internal organs in large animals. O2 serves as the physiologic terminal acceptor of mitochondrial electron transfer and of the NADPH oxidase (Nox) family of oxidoreductases to generate primarily water and reactive oxygen species (ROS), respectively. Recent advances: The purposeful generation of ROS by Nox family enzymes suggests important roles in normal physiology and adaptation, most notably in host defense against invading pathogens and in cellular signaling. Critical issues: However, there is emerging evidence that, in the context of chronic stress and/or aging, Nox enzymes contribute to the pathogenesis of a number of lung diseases. Future Directions: Here, we review evolving functions of Nox enzymes in normal lung physiology and emerging pathophysiologic roles in lung disease. Antioxid. Redox Signal. 20, 2838–2853. PMID:24093231

  15. ROS signalling, NADPH oxidases and cancer.


    Landry, William D; Cotter, Thomas G


    ROS (reactive oxygen species) have long been regarded as a series of destructive molecules that have a detrimental effect on cell homoeostasis. In support of this are the myriad antioxidant defence systems nearly all eukaryotic cells have that are designed to keep the levels of ROS in check. However, research data emerging over the last decade have demonstrated that ROS can influence a range of cellular events in a manner similar to that seen for traditional second messenger molecules such as cAMP. Hydrogen peroxide (H2O2) appears to be the main ROS with such signalling properties, and this molecule has been shown to affect a wide range of cellular functions. Its localized synthesis by the Nox (NADPH oxidase) family of enzymes and how these enzymes are regulated is of particular interest to those who work in the field of tumour biology.

  16. Heterologous expression of two FAD-dependent oxidases with (S)-tetrahydroprotoberberine oxidase activity from Arge mone mexicana and Berberis wilsoniae in insect cells.


    Gesell, Andreas; Chávez, Maria Luisa Díaz; Kramell, Robert; Piotrowski, Markus; Macheroux, Peter; Kutchan, Toni M


    Berberine, palmatine and dehydrocoreximine are end products of protoberberine biosynthesis. These quaternary protoberberines are elicitor inducible and, like other phytoalexins, are highly oxidized. The oxidative potential of these compounds is derived from a diverse array of biosynthetic steps involving hydroxylation, intra-molecular C-C coupling, methylenedioxy bridge formation and a dehydrogenation reaction as the final step in the biosynthesis. For the berberine biosynthetic pathway, the identification of the dehydrogenase gene is the last remaining uncharacterized step in the elucidation of the biosynthesis at the gene level. An enzyme able to catalyze these reactions, (S)-tetrahydroprotoberberine oxidase (STOX, EC, was originally purified in the 1980s from suspension cells of Berberis wilsoniae and identified as a flavoprotein (Amann et al. 1984). We report enzymatic activity from recombinant STOX expressed in Spodoptera frugiperda Sf9 insect cells. The coding sequence was derived successively from peptide sequences of purified STOX protein. Furthermore, a recombinant oxidase with protoberberine dehydrogenase activity was obtained from a cDNA library of Argemone mexicana, a traditional medicinal plant that contains protoberberine alkaloids. The relationship of the two enzymes is discussed regarding their enzymatic activity, phylogeny and the alkaloid occurrence in the plants. Potential substrate binding and STOX-specific amino acid residues were identified based on sequence analysis and homology modeling. PMID:21327819

  17. Heterologous expression of two FAD-dependent oxidases with (S)-tetrahydroprotoberberine oxidase activity from Arge mone mexicana and Berberis wilsoniae in insect cells.


    Gesell, Andreas; Chávez, Maria Luisa Díaz; Kramell, Robert; Piotrowski, Markus; Macheroux, Peter; Kutchan, Toni M


    Berberine, palmatine and dehydrocoreximine are end products of protoberberine biosynthesis. These quaternary protoberberines are elicitor inducible and, like other phytoalexins, are highly oxidized. The oxidative potential of these compounds is derived from a diverse array of biosynthetic steps involving hydroxylation, intra-molecular C-C coupling, methylenedioxy bridge formation and a dehydrogenation reaction as the final step in the biosynthesis. For the berberine biosynthetic pathway, the identification of the dehydrogenase gene is the last remaining uncharacterized step in the elucidation of the biosynthesis at the gene level. An enzyme able to catalyze these reactions, (S)-tetrahydroprotoberberine oxidase (STOX, EC, was originally purified in the 1980s from suspension cells of Berberis wilsoniae and identified as a flavoprotein (Amann et al. 1984). We report enzymatic activity from recombinant STOX expressed in Spodoptera frugiperda Sf9 insect cells. The coding sequence was derived successively from peptide sequences of purified STOX protein. Furthermore, a recombinant oxidase with protoberberine dehydrogenase activity was obtained from a cDNA library of Argemone mexicana, a traditional medicinal plant that contains protoberberine alkaloids. The relationship of the two enzymes is discussed regarding their enzymatic activity, phylogeny and the alkaloid occurrence in the plants. Potential substrate binding and STOX-specific amino acid residues were identified based on sequence analysis and homology modeling.

  18. Stability of spermine oxidase to thermal and chemical denaturation: comparison with bovine serum amine oxidase.


    Cervelli, Manuela; Leonetti, Alessia; Cervoni, Laura; Ohkubo, Shinji; Xhani, Marla; Stano, Pasquale; Federico, Rodolfo; Polticelli, Fabio; Mariottini, Paolo; Agostinelli, Enzo


    Spermine oxidase (SMOX) is a flavin-containing enzyme that specifically oxidizes spermine to produce spermidine, 3-aminopropanaldehyde and hydrogen peroxide. While no crystal structure is available for any mammalian SMOX, X-ray crystallography showed that the yeast Fms1 polyamine oxidase has a dimeric structure. Based on this scenario, we have investigated the quaternary structure of the SMOX protein by native gel electrophoresis, which revealed a composite gel band pattern, suggesting the formation of protein complexes. All high-order protein complexes are sensitive to reducing conditions, showing that disulfide bonds were responsible for protein complexes formation. The major gel band other than the SMOX monomer is the covalent SMOX homodimer, which was disassembled by increasing the reducing conditions, while being resistant to other denaturing conditions. Homodimeric and monomeric SMOXs are catalytically active, as revealed after gel staining for enzymatic activity. An engineered SMOX mutant deprived of all but two cysteine residues was prepared and characterized experimentally, resulting in a monomeric species. High-sensitivity differential scanning calorimetry of SMOX was compared with that of bovine serum amine oxidase, to analyse their thermal stability. Furthermore, enzymatic activity assays and fluorescence spectroscopy were used to gain insight into the unfolding process. PMID:27295021

  19. Oxygen dependent pyruvate oxidase expression and production in Streptococcus sanguinis

    PubMed Central

    Zheng, Lan-yan; Itzek, Andreas; Chen, Zhi-yun; Kreth, Jens


    The objective of this study was to characterize the oxygen dependent regulation of pyruvate oxidase (SpxB) gene expression and protein production in Streptococcus sanguinis (S. sanguinis). SpxB is responsible for the generation of growth-inhibiting amounts of hydrogen peroxide (H2O2) able to antagonize cariogenic Streptococcus mutans (S. mutans). Furthermore, the ecological consequence of H2O2 production was investigated in its self-inhibiting ability towards the producing strain. Expression of spxB was determined with quantitative Real-Time RT-PCR and a fluorescent expression reporter strain. Protein abundance was investigated with FLAG epitope engineered in frame on the C-terminal end of SpxB. Self inhibition was tested with an antagonism plate assay. The expression and protein abundance decreased in cells grown under anaerobic conditions. S. sanguinis was resistant against its own produced H2O2, while cariogenic S. mutans was inhibited in its growth. The results suggest that S. sanguinis produces H2O2 as antimicrobial substance to inhibit susceptible niche competing species like S. mutans during initial biofilm formation, when oxygen availability allows for spxB expression and Spx production. PMID:21485312

  20. Upregulation of Mitochondrial Content in Cytochrome c Oxidase