Sample records for multiple bone metastasis

  1. Tumor-targeting Salmonella typhimurium A1-R inhibits human prostate cancer experimental bone metastasis in mouse models.

    PubMed

    Toneri, Makoto; Miwa, Shinji; Zhang, Yong; Hu, Cameron; Yano, Shuya; Matsumoto, Yasunori; Bouvet, Michael; Nakanishi, Hayao; Hoffman, Robert M; Zhao, Ming

    2015-10-13

    Bone metastasis is a frequent occurrence in prostate cancer patients and often is lethal. Zoledronic acid (ZOL) is often used for bone metastasis with limited efficacy. More effective models and treatment methods are required to improve the outcome of prostate cancer patients. In the present study, the effects of tumor-targeting Salmonella typhimurium A1-R were analyzed in vitro and in vivo on prostate cancer cells and experimental bone metastasis. Both ZOL and S. typhimurium A1-R inhibited the growth of PC-3 cells expressing red fluorescent protien in vitro. To investigate the efficacy of S. typhimurium A1-R on prostate cancer experimental bone metastasis, we established models of both early and advanced stage bone metastasis. The mice were treated with ZOL, S. typhimurium A1-R, and combination therapy of both ZOL and S. typhimurium A1-R. ZOL and S. typhimurium A1-R inhibited the growth of solitary bone metastases. S. typhimurium A1-R treatment significantly decreased bone metastasis and delayed the appearance of PC-3 bone metastases of multiple mouse models. Additionally, S. typhimurium A1-R treatment significantly improved the overall survival of the mice with multiple bone metastases. The results of the present study indicate that S. typhimurium A1-R is useful to prevent and inhibit prostate cancer bone metastasis and has potential for future clinical use in the adjuvant setting.

  2. Increased expression of a set of genes enriched in oxygen binding function discloses a predisposition of breast cancer bone metastases to generate metastasis spread in multiple organs.

    PubMed

    Capulli, Mattia; Angelucci, Adriano; Driouch, Keltouma; Garcia, Teresa; Clement-Lacroix, Philippe; Martella, Francesco; Ventura, Luca; Bologna, Mauro; Flamini, Stefano; Moreschini, Oreste; Lidereau, Rosette; Ricevuto, Enrico; Muraca, Maurizio; Teti, Anna; Rucci, Nadia

    2012-11-01

    Bone is the preferential site of distant metastasis in breast carcinoma (BrCa). Patients with metastasis restricted to bone (BO) usually show a longer overall survival compared to patients who rapidly develop multiple metastases also involving liver and lung. Hence, molecular predisposition to generate bone and visceral metastases (BV) represents a clear indication of poor clinical outcome. We performed microarray analysis with two different chip platforms, Affymetrix and Agilent, on bone metastasis samples from BO and BV patients. The unsupervised hierarchical clustering of the resulting transcriptomes correlated with the clinical progression, segregating the BO from the BV profiles. Matching the twofold significantly regulated genes from Affymetrix and Agilent chips resulted in a 15-gene signature with 13 upregulated and two downregulated genes in BV versus BO bone metastasis samples. In order to validate the resulting signature, we isolated different MDA-MB-231 clonal subpopulations that metastasize only in the bone (MDA-BO) or in bone and visceral tissues (MDA-BV). Six of the signature genes were also significantly upregulated in MDA-BV compared to MDA-BO clones. A group of upregulated genes, including Hemoglobin B (HBB), were involved in oxygen metabolism, and in vitro functional analysis of HBB revealed that its expression in the MDA subpopulations was associated with a reduced production of hydrogen peroxide. Expression of HBB was detected in primary BrCa tissue but not in normal breast epithelial cells. Metastatic lymph nodes were frequently more positive for HBB compared to the corresponding primary tumors, whereas BO metastases had a lower expression than BV metastases, suggesting a positive correlation between HBB and ability of bone metastasis to rapidly spread to other organs. We propose that HBB, along with other genes involved in oxygen metabolism, confers a more aggressive metastatic phenotype in BrCa cells disseminated to bone. Copyright © 2012 American Society for Bone and Mineral Research.

  3. The effect of down regulation of calcineurin Aα by lentiviral vector-mediated RNAi on the biological behavior of small-cell lung cancer and its bone metastasis.

    PubMed

    Ma, Ning-Qiang; Liu, Li-Li; Min, Jie; Wang, Jun-Wei; Jiang, Wei-Feng; Liu, Yan; Feng, Yan-Guo; Su, Hai-Chuan; Feng, Ying-Ming; Zhang, He-Long

    2011-12-01

    Bone is the third most common site of cancer metastasis. Over 30 to 40% of lung cancers can develop skeletal metastasis and no effective curative therapy exists in clinic cases. Previously we screened the different expression of proteins between SBC-5 cells and SBC-3 cells by proteomic study methods (MALDI-TOF/TOF-MS) and found that calcineurin (hereafter referred as Cn) overexpresses in SBC-5 which has special priority in metastasis to bone in a multiple-organ metastasis mice model. However the roles of Cn in osteotropism of SCLC remain to be elucidated. At present study, we decrease CnAα expression in SBC-5 by lentiviral vector-mediated RNAi and found that down regulation of CnAα gene expression can decrease the proliferation and colony formation rate, impede the cell cycle progression, reduce the cell migration and invasion, and inhibit cells adhering to bone matrix, but not change the apoptosis rate of SBC-5 in vitro. In vivo down or up regulation of CnAα gene expression can only decrease or increase the bone metastasis rate, but not affect the metastasis rate to the visceral organs. Our research reveals that CnAα is closely related to the osteotropism metastasis of SCLC and a candidate tumor promotor gene for developing bone metastases.

  4. Prolonged Hypocalcemia Following a Single Dose of Denosumab for Diffuse Bone Metastasis of Gastric Cancer after Total Gastrectomy.

    PubMed

    Iizumi, Sakura; Shimoi, Tatsunori; Nishikawa, Tadaaki; Kitano, Atsuko; Sasada, Shinsuke; Shimomura, Akihiko; Noguchi, Emi; Yunokawa, Mayu; Yonemori, Kan; Shimizu, Chikako; Fujiwara, Yasuhiro; Tamura, Kenji

    2017-11-01

    Hypocalcemia is a significant adverse effect of denosumab. We herein report a case of prolonged hypocalcemia in a patient with multiple risk factors for hypocalcemia, including gastrectomy, increased bone turnover, and a poor performance status. Hypocalcemia developed after denosumab treatment for diffuse bone metastasis of gastric cancer, despite oral supplementation with vitamin D and calcium. To avoid serious prolonged hypocalcemia, a thorough assessment of the bone calcium metabolism is required before initiating denosumab treatment.

  5. Prolonged Hypocalcemia Following a Single Dose of Denosumab for Diffuse Bone Metastasis of Gastric Cancer after Total Gastrectomy

    PubMed Central

    Iizumi, Sakura; Shimoi, Tatsunori; Nishikawa, Tadaaki; Kitano, Atsuko; Sasada, Shinsuke; Shimomura, Akihiko; Noguchi, Emi; Yunokawa, Mayu; Yonemori, Kan; Shimizu, Chikako; Fujiwara, Yasuhiro; Tamura, Kenji

    2017-01-01

    Hypocalcemia is a significant adverse effect of denosumab. We herein report a case of prolonged hypocalcemia in a patient with multiple risk factors for hypocalcemia, including gastrectomy, increased bone turnover, and a poor performance status. Hypocalcemia developed after denosumab treatment for diffuse bone metastasis of gastric cancer, despite oral supplementation with vitamin D and calcium. To avoid serious prolonged hypocalcemia, a thorough assessment of the bone calcium metabolism is required before initiating denosumab treatment. PMID:28943574

  6. Bone sialoprotein and osteopontin in bone metastasis of osteotropic cancers.

    PubMed

    Kruger, Thomas E; Miller, Andrew H; Godwin, Andrew K; Wang, Jinxi

    2014-02-01

    The mechanisms underlying malignant cell metastasis to secondary sites such as bone are complex and no doubt multifactorial. Members of the small integrin-binding ligand N-linked glycoproteins (SIBLINGs) family, particularly bone sialoprotein (BSP) and osteopontin (OPN), exhibit multiple activities known to promote malignant cell proliferation, detachment, invasion, and metastasis of several osteotropic cancers. The expression level of BSP and OPN is elevated in a variety of human cancers, particularly those that metastasize preferentially to the skeleton. Recent studies suggest that the "osteomimicry" of malignant cells is not only conferred by transmembrane receptors bound by BSP and OPN, but includes the "switch" in gene expression repertoire typically expressed in cells of skeletal lineage. Understanding the role of BSP and OPN in tumor progression, altered pathophysiology of bone microenvironment, and tumor metastasis to bone will likely result in development of better diagnostic approaches and therapeutic regimens for osteotropic malignant diseases. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  7. Animal Models of Bone Metastasis

    PubMed Central

    Simmons, J. K.; Hildreth, B. E.; Supsavhad, W.; Elshafae, S. M.; Hassan, B. B.; Dirksen, W. P.; Toribio, R. E.; Rosol, T. J.

    2015-01-01

    Bone is one of the most common sites of cancer metastasis in humans and is a significant source of morbidity and mortality. Bone metastases are considered incurable and result in pain, pathologic fracture, and decreased quality of life. Animal models of skeletal metastases are essential to improve the understanding of the molecular pathways of cancer metastasis and growth in bone and to develop new therapies to inhibit and prevent bone metastases. The ideal animal model should be clinically relevant, reproducible, and representative of human disease. Currently, an ideal model does not exist; however, understanding the strengths and weaknesses of the available models will lead to proper study design and successful cancer research. This review provides an overview of the current in vivo animal models used in the study of skeletal metastases or local tumor invasion into bone and focuses on mammary and prostate cancer, lymphoma, multiple myeloma, head and neck squamous cell carcinoma, and miscellaneous tumors that metastasize to bone. PMID:26021553

  8. Prognostic effect of liver metastasis in lung cancer patients with distant metastasis.

    PubMed

    Ren, Yijiu; Dai, Chenyang; Zheng, Hui; Zhou, Fangyu; She, Yunlang; Jiang, Gening; Fei, Ke; Yang, Ping; Xie, Dong; Chen, Chang

    2016-08-16

    Because the need of clinical prognostic evaluation by specific metastatic organ, we aim to analyze the prognostic factors in lung cancer patients with M1b disease with Surveillance Epidemiology and End-Results database (SEER). This retrospective study evaluated lung cancer patients of adenocarcinoma (AD), squamous cell carcinoma (SQCC), and small cell lung cancer (SCLC) selected from SEER. We provided the prognostic correlates of overall survival (OS) and lung cancer-specific survival (LCSS) in this population. 23,679 eligible patients were included. Bone was the most common metastatic site in AD (63.1%) and SQCC (61.1%), while liver was the most prevalent site (61.9%) in SCLC. Single site metastasis was significantly associated with better outcome compared to multiple sites metastases in all patients. Among patients with single site metastasis, OS and LCSS were longer for AD and SCLC if involving brain or bone, with median survival time of 5 to 7 months, comparing to 3 months if invloving liver (all p-values < 0.001). Similarly, among patients with multiple metastases, better outcomes were observed in AD patients (4 vs 3 months; OS and LCSS, p < 0.001) and SCLC patients (6 vs 4 months; OS, p = 0.017; LCSS, p = 0.023) without liver metastasis compared to those with liver metastasis. In conclusion, we estimated multiple survival outcomes by histology of primary tumor and sites of metastasis. Liver metastasis is found to be the worst prognostic factor for AD and SCLC patients with distant metastasis. More in-depth research is warranted to identify patients who are prone to develop distance metastasis, especially to liver.

  9. The Effect of a Histone Deacetylase Inhibitor (AR-42) on Canine Prostate Cancer Growth and Metastasis.

    PubMed

    Elshafae, Said M; Kohart, Nicole A; Altstadt, Lucas A; Dirksen, Wessel P; Rosol, Thomas J

    2017-05-01

    Canine prostate cancer (PCa) is an excellent preclinical model for human PCa. AR-42 is a histone deacetylase inhibitor (HDACi) developed at The Ohio State University that inhibits the proliferation of several cancers, including multiple myeloma, lung, and hepatocellular cancer. In this study, we investigated whether AR-42 would prevent or decrease. The growth and metastasis of a canine PCa (Ace-1 cells) to bone in vitro and in vivo. Proliferation, cell viability, invasion, and metastasis of a canine prostate cancer cell line (Ace-1) were measured following treatment with AR-42. Expression of anoikis resistance, epithelial-to-mesenchymal transition (EMT), and stem cell-related markers were also evaluated. To assess the efficacy of AR-42 on prevention of PCa metastasis to bone, Ace-1 cells were injected in the left cardiac ventricle of nude mice, mice were treated with AR-42, and the incidence and growth of bone metastasis were measured. Bioluminescence was performed to monitor the bone metastases in nude mice. AR-42 inhibited the in vitro proliferation of Ace-1 cells in a time- and dose-dependent manner. The IC 50 concentration of AR-42 for Ace-1 cells was 0.42 μM after 24 hr of treatment. AR-42 induced apoptosis, decreased cell migration, and increased the stem cell properties of Ace-1 cells in vitro. AR-42 downregulated E-cadherin, N-cadherin, TWIST, MYOF, anoikis resistance, and osteomimicry genes, while it upregulated SNAIL, PTEN, FAK, and ZEB1 gene expression in Ace-1 cells. Importantly, AR-42 decreased the bioluminescence and incidence of bone metastasis in nude mice. In addition, AR-42 induced apoptosis and altered the tumor cell morphology to an irregular cell phenotype with condensed chromatin in the bone metastases. AR-42 decreased PCa growth and bone metastasis, induced apoptosis, and downregulated osteomimicry genes in PCa cells in the bone microenvironment. Prostate 77:776-793, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  10. Advances in diagnosis and treatment of metastatic cervical cancer

    PubMed Central

    2016-01-01

    Cervical cancer is one of the most common cancers in women worldwide. The outcome of patients with metastatic cervical cancer is poor. We reviewed the relevant literature concerning the treatment and diagnosis of metastatic cervical cancer. There are two types of metastasis related to different treatments and survival rates: hematogenous metastasis and lymphatic metastasis. Patients with hematogenous metastasis have a higher risk of death than those with lymphatic metastasis. In terms of diagnosis, fluoro-2-deoxy-D-glucose positron emission tomography (FDG-PET) and PET-computed tomography are effective tools for the evaluation of distant metastasis. Concurrent chemoradiotherapy and subsequent chemotherapy are well-tolerated and efficient for lymphatic metastasis. As for lung metastasis, chemotherapy and/or surgery are valuable treatments for resistant, recurrent metastatic cervical cancer and chemoradiotherapy may be the optimal choice for stage IVB cervical cancer. Chemotherapy and bone irradiation are promising for bone metastasis. A better survival is achieved with multimodal therapy. Craniotomy or stereotactic radiosurgery is an optimal choice combined with radiotherapy for solitary brain metastases. Chemotherapy and palliative brain radiation may be considered for multiple brain metastases and other organ metastases. PMID:27171673

  11. Advances in diagnosis and treatment of metastatic cervical cancer.

    PubMed

    Li, Haoran; Wu, Xiaohua; Cheng, Xi

    2016-07-01

    Cervical cancer is one of the most common cancers in women worldwide. The outcome of patients with metastatic cervical cancer is poor. We reviewed the relevant literature concerning the treatment and diagnosis of metastatic cervical cancer. There are two types of metastasis related to different treatments and survival rates: hematogenous metastasis and lymphatic metastasis. Patients with hematogenous metastasis have a higher risk of death than those with lymphatic metastasis. In terms of diagnosis, fluoro-2-deoxy-D-glucose positron emission tomography (FDG-PET) and PET-computed tomography are effective tools for the evaluation of distant metastasis. Concurrent chemoradiotherapy and subsequent chemotherapy are well-tolerated and efficient for lymphatic metastasis. As for lung metastasis, chemotherapy and/or surgery are valuable treatments for resistant, recurrent metastatic cervical cancer and chemoradiotherapy may be the optimal choice for stage IVB cervical cancer. Chemotherapy and bone irradiation are promising for bone metastasis. A better survival is achieved with multimodal therapy. Craniotomy or stereotactic radiosurgery is an optimal choice combined with radiotherapy for solitary brain metastases. Chemotherapy and palliative brain radiation may be considered for multiple brain metastases and other organ metastases.

  12. Bone metastasis target redox-responsive micell for the treatment of lung cancer bone metastasis and anti-bone resorption.

    PubMed

    Ye, Wei-Liang; Zhao, Yi-Pu; Cheng, Ying; Liu, Dao-Zhou; Cui, Han; Liu, Miao; Zhang, Bang-Le; Mei, Qi-Bing; Zhou, Si-Yuan

    2018-01-16

    In order to inhibit the growth of lung cancer bone metastasis and reduce the bone resorption at bone metastasis sites, a bone metastasis target micelle DOX@DBMs-ALN was prepared. The size and the zeta potential of DOX@DBNs-ALN were about 60 nm and -15 mV, respectively. DOX@DBMs-ALN exhibited high binding affinity with hydroxyapatite and released DOX in redox-responsive manner. DOX@DBMs-ALN was effectively up taken by A549 cells and delivered DOX to the nucleus of A549 cells, which resulted in strong cytotoxicity on A549 cells. The in vivo experimental results indicated that DOX@DBMs-ALN specifically delivered DOX to bone metastasis site and obviously prolonged the retention time of DOX in bone metastasis site. Moreover, DOX@DBMs-ALN not only significantly inhibited the growth of bone metastasis tumour but also obviously reduced the bone resorption at bone metastasis sites without causing marked systemic toxicity. Thus, DOX@DBMs-ALN has great potential in the treatment of lung cancer bone metastasis.

  13. Durable clinical remission of a skull metastasis under intralesional Viscum album extract therapy: Case report.

    PubMed

    Werthmann, Paul Georg; Huber, Roman; Kienle, Gunver Sophia

    2018-06-09

    Skull metastases are rare, they can eventually cause pain, and can invade the brain. Viscum album extracts (VAEs) are used as an adjuvant treatment in cancer. A 68-year-old patient with rectal cancer presented with lung metastases, and metastases to multiple bone sites, the chest wall, and the liver were later identified. Histological examination of one of the bone lesions revealed an additional thyroid carcinoma. An osteolytic parietal bone lesion progressed to a painful metastasis of the skull despite radiotherapy and chemotherapy. The VAEs were applied weekly into the metastasis, followed by pain relief and softening of the lesion. The lesion partially regressed (>50%) after 8 months of continued VAE treatment and remained stable for 2 years. This case shows a durable clinical remission of a skull metastasis under VAE. Further investigations of intratumoral VAE treatment seem worthwhile-especially in symptomatic skull metastases not responding to radiotherapy or systemic therapies. © 2018 The Authors Head & Neck Published by Wiley Periodicals, Inc.

  14. 1α,25-Dihydroxyvitamin D Inhibits the Metastatic Capability of MCF10CA1a and MDA-MB-231 Cells in an In Vitro Model of Breast to Bone Metastasis.

    PubMed

    Wilmanski, Tomasz; Barnard, Alle; Parikh, Mukti R; Kirshner, Julia; Buhman, Kimberly; Burgess, John; Teegarden, Dorothy

    2016-10-01

    Breast cancer metastasis to the bone continues to be a major health problem, with approximately 80% of advanced breast cancer patients expected to develop bone metastasis. Although the problem of bone metastasis persists, current treatment options for metastatic cancer patients are limited. In this study, we investigated the preventive role of the active vitamin D metabolite, 1α,25-dihydroxyvitamin D (1,25(OH)2D), against the metastatic potential of breast cancer cells using a novel three-dimensional model (rMET) recapitulating multiple steps of the bone metastatic process. Treatment of MCF10CA1a and MDA-MB-231 cells inhibited metastasis in the rMET model by 70% (±5.7%) and 21% (±6%), respectively. In addition, 1,25(OH)2D treatment decreased invasiveness (20 ± 11% of vehicle) and decreased the capability of MCF10CA1a cells to survive in the reconstructed bone environment after successful invasion through the basement membrane (69 ± 5% of vehicle). An essential step in metastasis is epithelial-mesenchymal transition (EMT). Treatment of MCF10CA1a cells with 1,25(OH)2D increased gene (2.04 ± 0.28-fold increase) and protein (1.87 ± 0.20-fold increase) expression of E-cadherin. Additionally, 1,25(OH)2D treatment decreased N-cadherin gene expression (42 ± 8% decrease), a marker for EMT. Collectively, the present study suggests that 1,25(OH)2D inhibits breast cancer cell metastatic capability as well as inhibits EMT, an essential step in the metastatic process.

  15. Patterns of Intraosseous Recurrence After Stereotactic Body Radiation Therapy for Coxal Bone Metastasis.

    PubMed

    Ito, Kei; Shimizuguchi, Takuya; Nihei, Keiji; Furuya, Tomohisa; Ogawa, Hiroaki; Tanaka, Hiroshi; Sasai, Keisuke; Karasawa, Katsuyuki

    2018-01-01

    To analyze the detailed pattern of intraosseous failure after stereotactic body radiation therapy (SBRT) for coxal bone metastasis. Patients treated with SBRT to coxal bone metastasis were identified by retrospective chart review. The SBRT doses were 30 Gy or 35 Gy in 5 fractions. A margin of 5 to 10 mm was added to the gross tumor volume to create the clinical target volume. We evaluated the presence or absence of intraosseous recurrence using magnetic resonance imaging. Intraosseous recurrences were assessed as "in-field" or "marginal/out-of-field." In addition, we measured the distance between the center of the recurrent tumor and the nearest edge of the initial bone metastasis in cases of marginal/out-of-field recurrence. Seventeen patients treated for 17 coxal bone metastases were included. Median age was 64 years (range, 48-79 years). Coxal lesions involved the ilium in 14 cases, pubis in 3, and ischium in 4 (3 lesions crossed over multiple regions). Patients most commonly had renal cell carcinoma (29.4%), followed by lung, hepatic cell, and colorectal cancers (23.5%, 11.8%, and 11.8%, respectively). Median follow-up after SBRT was 13 months (range, 2-44 months). Among all 17 cases, 7 cases developed 8 intraosseous recurrences, including in-field recurrence in 1 case and marginal/out-of-field recurrences in 7 cases. Median time to intraosseous recurrence was 10 months (range, 2-35 months). Among 7 cases with marginal/out-of-field recurrence, mean distance to the center of the recurrent tumor from the nearest edge of the initial bone metastasis was 34 mm (range, 15-55 mm). Most recurrences were observed out-of-field in the same coxal bone. These results suggest that defining the optimal clinical target volume in SBRT for coxal bone metastasis to obtain sufficient local tumor control is difficult. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Bone metastasis from ovarian cancer. Clinical analysis of 26 cases.

    PubMed

    Zhang, Min; Sun, Jimei

    2013-12-01

    To study the clinical characteristics of bone metastasis from ovarian cancer, and facilitate physicians to develop treatment strategies. This retrospective study was carried out in the Provincial Hospital Affiliated to Shandong University, Shandong, China. Twenty-six cases of bone metastasis from ovarian cancer treated between January 2002 and May 2008 were reviewed, and the clinical data were collected. In the current study, the incidence of bone metastasis is 0.82%. Twelve cases of bone metastasis occurred in the cervical vertebra, 10 in the lumbar vertebra, 8 in the pelvis, 7 in the thoracic vertebra, 5 in the limbs, one in the ribs, and 2 in the sternum. Lung metastasis occurred concomitantly in 9 cases, liver metastasis in 5 cases, brain metastasis in 4 cases, splenic metastasis in 3 cases, adrenal metastasis in 2 cases, and lymphatic metastasis in 12 cases. Twenty-three cases (88.5%) of bone metastasis were detected in stage III-IV, and 3 (11.5%) in stage II (p=0.000). The survival time in cases treated using comprehensive therapy was longer than those using radiotherapy or chemotherapy alone (p=0.047). Bone metastasis from ovarian cancer is rare, however, the increasing pathological stage of ovarian cancer may add to the risk of bone metastasis, especially in the cases with lung or lymphatic metastasis. The pelvis and vertebral bone are the most common location of bone metastasis, and comprehensive treatment may improve the survival time of patients.

  17. Bone Metastasis in Prostate Cancer: Recurring Mitochondrial DNA Mutation Reveals Selective Pressure Exerted by the Bone Microenvironment

    PubMed Central

    Arnold, Rebecca S.; Fedewa, Stacey A.; Goodman, Michael; Osunkoya, Adeboye O.; Kissick, Haydn T.; Morrissey, Colm; True, Lawrence D.; Petros, John A.

    2015-01-01

    Background Cancer progression and metastasis occurs such that cells with acquired mutations enhancing growth and survival (or inhibiting cell death) increase in number, a concept that has been recognized as analogous to Darwinian evolution of species since Peter C. Nowell’s description in 1976. Selective forces include those intrinsic to the host (including metastatic site) as well as those resulting from anti-cancer therapies. By examining the mutational status of multiple tumor sites within an individual patient some insight may be gained into those genetic variants that enhance site-specific metastasis. By comparing these data across multiple individuals, recurrent patterns may identify alterations that are fundamental to successful site-specific metastasis. Methods We sequenced the mitochondrial genome in 10 prostate cancer patients with bone metastases enrolled in a rapid autopsy program. Patients had late stage disease and received androgen ablation and frequently other systemic therapies. For each of 9 patients, 4 separate tissues were sequenced: the primary prostate cancer, a soft tissue metastasis, a bone metastasis and an uninvolved normal tissue that served as the non-cancerous control. An additional (10th) patient had no primary prostate available for sequencing but had both metastatic sites (and control DNA) sequenced. We then examined the number and location of somatically acquired mitochondrial DNA (mtDNA) mutations in the primary and two metastatic sites in each individual patient. Finally, we compared patients with each other to determine any common patterns of somatic mutation. Results Somatic mutations were significantly more numerous in bone compared to either the primary tumor or soft tissue metastases. A missense mutation at nucleotide position (np) 10398 (A10398G; Thr114Ala) in the respiratory complex I gene ND3 was the most common (7 of 10 patients) and was detected only in bone. Other notable somatic mutations that occurred in more than one patient include a tRNA Arg mutation at np 10436 and a tRNA Thr mutation at np 15928. The tRNA Arg mutation was restricted to bone metastases and occurred in three of 10 patients (30%). Somatic mutation at 15928 was not restricted to bone and also occurred in three patients. Conclusions Mitochondrial genomic variation was greater in metastatic sites than the primary tumor and bone metastases had statistically significantly greater numbers of somatic mutations than either the primary or the soft tissue metastases. The genome was not mutated randomly. At least one mutational “hot-spot” was identified at the individual base level (nucleotide position 10398 in bone metastases) indicating a pervasive selective pressure for bone metastatic cells that had acquired the 10398 mtDNA mutation. Two additional recurrent mutations (tRNA Arg and tRNA Thr) support the concept of bone site-specific “survival of the fittest” as revealed by variation in the mitochondrial genome and selective pressure exerted by the metastatic site. PMID:25952970

  18. Bone metastasis in prostate cancer: Recurring mitochondrial DNA mutation reveals selective pressure exerted by the bone microenvironment.

    PubMed

    Arnold, Rebecca S; Fedewa, Stacey A; Goodman, Michael; Osunkoya, Adeboye O; Kissick, Haydn T; Morrissey, Colm; True, Lawrence D; Petros, John A

    2015-09-01

    Cancer progression and metastasis occur such that cells with acquired mutations enhancing growth and survival (or inhibiting cell death) increase in number, a concept that has been recognized as analogous to Darwinian evolution of species since Peter C. Nowell's description in 1976. Selective forces include those intrinsic to the host (including metastatic site) as well as those resulting from anti-cancer therapies. By examining the mutational status of multiple tumor sites within an individual patient some insight may be gained into those genetic variants that enhance site-specific metastasis. By comparing these data across multiple individuals, recurrent patterns may identify alterations that are fundamental to successful site-specific metastasis. We sequenced the mitochondrial genome in 10 prostate cancer patients with bone metastases enrolled in a rapid autopsy program. Patients had late stage disease and received androgen ablation and frequently other systemic therapies. For each of 9 patients, 4 separate tissues were sequenced: the primary prostate cancer, a soft tissue metastasis, a bone metastasis and an uninvolved normal tissue that served as the non-cancerous control. An additional (10th) patient had no primary prostate available for sequencing but had both metastatic sites (and control DNA) sequenced. We then examined the number and location of somatically acquired mitochondrial DNA (mtDNA) mutations in the primary tumor and two metastatic sites in each individual patient. Finally, we compared patients with each other to determine any common patterns of somatic mutation. Somatic mutations were significantly more numerous in the bone compared to either the primary tumor or soft tissue metastases. A missense mutation at nucleotide position (n.p.) 10398 (A10398G; Thr114Ala) in the respiratory complex I gene ND3 was the most common (7 of 10 patients) and was detected only in the bone. Other notable somatic mutations that occurred in more than one patient include a tRNA Arg mutation at n.p. 10436 and a tRNA Thr mutation at n.p. 15928. The tRNA Arg mutation was restricted to bone metastases and occurred in three of 10 patients (30%). Somatic mutation at 15928 was not restricted to the bone and also occurred in three patients. Mitochondrial genomic variation was greater in metastatic sites than in the primary tumor and bone metastases had statistically significantly greater numbers of somatic mutations than either the primary or the soft tissue metastases. The genome was not mutated randomly. At least one mutational "hot-spot" was identified at the individual base level (nucleotide position 10398 in bone metastases) indicating a pervasive selective pressure for bone metastatic cells that had acquired the 10398 mtDNA mutation. Two additional recurrent mutations (tRNA Arg and tRNA Thr) support the concept of bone site-specific "survival of the fittest" as revealed by variation in the mitochondrial genome and selective pressure exerted by the metastatic site. Published by Elsevier Inc.

  19. Concomitant endometrial and gallbladder metastasis in advanced multiple metastatic invasive lobular carcinoma of the breast: A rare case report.

    PubMed

    Bezpalko, Kseniya; Mohamed, Mohamed A; Mercer, Leo; McCann, Michael; Elghawy, Karim; Wilson, Kenneth

    2015-01-01

    At time of presentation, fewer than 10% of patients have metastatic breast cancer. The most common sites of metastasis in order of frequency are bone, lung, pleura, soft tissue, and liver. Breast cancer metastasis to the uterus or gallbladder is rare and has infrequently been reported in the English literature. A 47 year old female with a recent history of thrombocytopenia presented with abnormal vaginal bleeding. Pelvic ultrasound revealed multiple uterine fibroids and endometrial curettings revealed cells consistent with lobular carcinoma of the breast. Breast examination revealed edema and induration of the lower half of the right breast. Biopsy of the right breast revealed invasive lobular carcinoma. Bone marrow aspiration obtained at a previous outpatient visit revealed extensive involvement by metastatic breast carcinoma. Shortly after discharge, the patient presented with acute cholecystitis and underwent cholecystectomy. Microscopic examination of the gallbladder revealed metastatic infiltrating lobular carcinoma. The final diagnosis was invasive lobular carcinoma of the right breast with metastasis to the bone marrow, endometrium, gallbladder, regional lymph nodes, and peritoneum. The growth pattern of invasive lobular carcinoma of the breast is unique and poses a challenge in diagnosing the cancer at an early stage. Unlike other types of breast cancer, it tends to metastasize more to the peritoneum, ovary, and gastrointestinal tract. Metastasis to the endometrium or gallbladder is rare. Metastatic spread should be considered in the differential diagnosis of patients with invasive lobular breast carcinoma presenting with abnormal vaginal bleeding or acute cholecystitis. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. DLC1-dependent parathyroid hormone-like hormone inhibition suppresses breast cancer bone metastasis.

    PubMed

    Wang, Yufeng; Lei, Rong; Zhuang, Xueqian; Zhang, Ning; Pan, Hong; Li, Gang; Hu, Jing; Pan, Xiaoqi; Tao, Qian; Fu, Da; Xiao, Jianru; Chin, Y Eugene; Kang, Yibin; Yang, Qifeng; Hu, Guohong

    2014-04-01

    Bone metastasis is a frequent complication of breast cancer that is often accelerated by TGF-β signaling; however, little is known about how the TGF-β pathway is regulated during bone metastasis. Here we report that deleted in liver cancer 1 (DLC1) is an important regulator of TGF-β responses and osteolytic metastasis of breast cancer cells. In murine models, breast cancer cells lacking DLC1 expression exhibited enhanced capabilities of bone metastasis. Knockdown of DLC1 in cancer cells promoted bone metastasis, leading to manifested osteolysis and accelerated death in mice, while DLC1 overexpression suppressed bone metastasis. Activation of Rho-ROCK signaling in the absence of DLC1 mediated SMAD3 linker region phosphorylation and TGF-β-induced expression of parathyroid hormone-like hormone (PTHLH), leading to osteoclast maturation for osteolytic colonization. Furthermore, pharmacological inhibition of Rho-ROCK effectively reduced PTHLH production and breast cancer bone metastasis in vitro and in vivo. Evaluation of clinical breast tumor samples revealed that reduced DLC1 expression was linked to elevated PTHLH expression and organ-specific metastasis to bone. Overall, our findings define a stroma-dependent paradigm of Rho signaling in cancer and implicate Rho-TGF-β crosstalk in osteolytic bone metastasis.

  1. Synchronous occurrence of prostate carcinoma and multiple myeloma: a case report.

    PubMed

    Sehgal, Tushar; Sharma, Sudha; Naseem, Shano; Varma, Neelam; Das, Ashim; Sharma, S C

    2014-09-01

    We describe a rare case of metastatic prostate cancer to bone marrow and synchronous multiple myeloma as the second malignant disease. Various diagnostic procedures, including cytomorphology and immunohistochemistry analyses together contributed to the detection of metastasis of prostate cancer and synchronous plasma cell proliferation in the bone marrow. The association between these two disorders is poorly understood however, some studies show that bone marrow microenvironment may play a crucial role. The need for further research in this regard is required to unfold this fascinating association.

  2. DLC1-dependent parathyroid hormone–like hormone inhibition suppresses breast cancer bone metastasis

    PubMed Central

    Wang, Yufeng; Lei, Rong; Zhuang, Xueqian; Zhang, Ning; Pan, Hong; Li, Gang; Hu, Jing; Pan, Xiaoqi; Tao, Qian; Fu, Da; Xiao, Jianru; Chin, Y. Eugene; Kang, Yibin; Yang, Qifeng; Hu, Guohong

    2014-01-01

    Bone metastasis is a frequent complication of breast cancer that is often accelerated by TGF-β signaling; however, little is known about how the TGF-β pathway is regulated during bone metastasis. Here we report that deleted in liver cancer 1 (DLC1) is an important regulator of TGF-β responses and osteolytic metastasis of breast cancer cells. In murine models, breast cancer cells lacking DLC1 expression exhibited enhanced capabilities of bone metastasis. Knockdown of DLC1 in cancer cells promoted bone metastasis, leading to manifested osteolysis and accelerated death in mice, while DLC1 overexpression suppressed bone metastasis. Activation of Rho-ROCK signaling in the absence of DLC1 mediated SMAD3 linker region phosphorylation and TGF-β–induced expression of parathyroid hormone–like hormone (PTHLH), leading to osteoclast maturation for osteolytic colonization. Furthermore, pharmacological inhibition of Rho-ROCK effectively reduced PTHLH production and breast cancer bone metastasis in vitro and in vivo. Evaluation of clinical breast tumor samples revealed that reduced DLC1 expression was linked to elevated PTHLH expression and organ-specific metastasis to bone. Overall, our findings define a stroma-dependent paradigm of Rho signaling in cancer and implicate Rho–TGF-β crosstalk in osteolytic bone metastasis. PMID:24590291

  3. Disruption of collagen/apatite alignment impairs bone mechanical function in osteoblastic metastasis induced by prostate cancer.

    PubMed

    Sekita, Aiko; Matsugaki, Aira; Nakano, Takayoshi

    2017-04-01

    Prostate cancer (PCa) frequently metastasizes to the bone, generally inducing osteoblastic alterations that increase bone brittleness. Although there is growing interest in the management of the physical capability of patients with bone metastasis, the mechanism underlying the impairment of bone mechanical function remains unclear. The alignment of both collagen fibrils and biological apatite (BAp) c-axis, together with bone mineral density, is one of the strongest contributors to bone mechanical function. In this study, we analyzed the bone microstructure of the mouse femurs with and without PCa cell inoculation. Histological assessment revealed that the bone-forming pattern in the PCa-bearing bone was non-directional, resulting in a spongious structure, whereas that in the control bone was unidirectional and layer-by-layer, resulting in a compact lamellar structure. The degree of preferential alignment of collagen fibrils and BAp, which was evaluated by quantitative polarized microscopy and microbeam X-ray diffraction, respectively, were significantly lower in the PCa-bearing bone than in the control bone. Material parameters including Young's modulus and toughness, measured by the three-point bending test, were simultaneously decreased in the PCa-bearing bone. Specifically, there was a significant positive correlation between the degree of BAp c-axis orientation and Young's modulus. In conclusion, the impairment of mechanical function in the PCa-bearing bone is attributable to disruption of the anisotropic microstructure of bone in multiple phases. This is the first report demonstrating that cancer bone metastasis induces disruption of the collagen/BAp alignment in long bones, thereby impairing their mechanical function. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Bone morphogenetic protein and bone metastasis, implication and therapeutic potential.

    PubMed

    Ye, Lin; Mason, Malcolm D; Jiang, Wen G

    2011-01-01

    Bone metastasis is one of the most common and severe complications in advanced malignancies, particularly in the three leading cancers; breast cancer, prostate cancer and lung cancer. It is currently incurable and causes severe morbidities, including bone pain, hypercalcemia, pathological fracture, spinal cord compression and consequent paralysis. However, the mechanisms underlying the development of bone metastasis remain largely unknown. Bone morphogenetic proteins (BMPs) belong to the TGF-beta superfamily and are pluripotent factors involved in the regulation of embryonic development and postnatal homeostasis of various organs and tissues, by controlling cellular differentiation, proliferation and apoptosis. Since they are potent regulators for bone formation, there is an increasing interest to investigate BMPs and their roles in bone metastasis. BMPs have been implicated in various neoplasms, at both primary and secondary tumors, particularly skeletal metastasis. Recently studies have also suggested that BMP signaling and their antagonists play pivotal roles in bone metastasis. In this review, we discuss the current knowledge of aberrations of BMPs which have been indicated in tumor progression, and particularly in the development of bone metastasis.

  5. [Analysis of risk factors for bone metastasis after radical resection of colorectal cancer within 5 years].

    PubMed

    Li, Ang; Tan, Zhen; Fu, Chuangang; Wang, Hao; Yuan, Jie

    2017-01-25

    To investigate the risk factors of metachronous bone metastasis after radical resection of colorectal cancer within 5 years. Clinical data of 1 749 patients with colorectal cancer, of whom 50(2.8%) patients developed metastasis to bone after operation, in the Department of Colorectal Surgery, Changhai Hospital of The Second Military Medical University from January 2001 to December 2010 were analyzed retrospectively. Univariate and multivariate analysis were performed to find the risk factors of metachronous bone metastasis from colorectal cancer using Chi square test and Logistic regression, respectively. Of 50 colorectal cancer cases with bone metastasis, 29 were male and 21 were female. The age was ≥ 60 years old in 28 cases. Tumors of 36 cases were located in the rectum and of 14 cases located in the colon. Pathology examination showed 43 cases were adenocarcinomas, 7 cases were mucinous adenocarcinoma. Forty-two cases had T3-4 stage lesions, 30 cases had lymph node metastasis, 14 cases had pulmonary metastasis, and 5 cases had liver metastasis. Univariate Chi square test indicated that factors associated with the metachronous bone metastasis of colorectal cancer within 5 years were tumor site (χ 2 =4.932, P=0.026), preoperative carbohydrate antigen 199 (CA199) level (χ 2 =4.266, P=0.039), lymph node metastasis (χ 2 =13.054, P=0.000) and pulmonary metastasis(χ 2 =35.524, P=0.000). The incidence of bone metastasis in patients with rectal cancer (3.6%, 36/991) was higher compared to those with colon cancer (1.8%, 14/758). The incidence of bone metastasis in patients with higher(> 37 kU/L) preoperative serum CA199 level (4.9%, 12/245) was higher compared to those with lower serum CA199 level (2.5%, 38/1504). The incidence of bone metastasis in patients with lymph node metastasis(4.8%,30/627) and pulmonary metastasis (11.6%, 14/121) was significantly higher compared to those without lymph node metastasis (1.8%, 20/1122) and pulmonary metastasis(2.2%, 36/1628), respectively. Logistic multivariate analysis showed that rectal cancer(OR:0.508, 95%CI:0.268 to 0.963, P=0.038), lymph node metastasis (OR:2.291, 95%CI:1.273 to 4.122, P=0.006) and metachronous pulmonary metastasis(OR:4.796, 95%CI:2.473 to 9.301, P=0.000) were the independent risk factors of metachronous bone metastasis of colorectal cancer within 5 years. Patients with rectal cancer, lymph node metastasis and metachronous pulmonary metastasis are high risk groups of metachronous bone metastasis after radical resection of colorectal cancer within 5 years.

  6. [Evaluation and classification of drug therapy for breast cancer with bone-only metastasis].

    PubMed

    Meng, X Y; Song, S T

    2017-03-23

    Skeleton is one of the most common metastatic organs for breast cancer, which has a better prognosis than visceral metastases. Bone-only metastasis was defined"non-measurable" in the RECIST (Response Evaluation Criteria in Solid Tumors) criteria, and was excluded by clinical trials. However, patients with bone-only metastasis are also in need of effective treatment to prolong survival. Endocrine therapy is the most important treatment for bone metastatic patients. Tumor response of bone metastases can be determined objectively by bone-window CT. Effective treatment should be continued if the symptoms are relieved or osteogenesis is observed. Osteoblastic change in bone-window CT is a sign of improvement after treatment. Endocrine therapy is proper for ER-positive patients. The patients with initial osteoblastic metastasis should not be treated with salvage chemotherapy or anti-HER2 treatment, only if osteolytic metastasis or visceral metastasis is observed. Bishosphonates are just auxiliary drugs in bone metastasis, which should not be abused.

  7. Autocrine inhibition of the c-fms proto-oncogene reduces breast cancer bone metastasis assessed with in vivo dual-modality imaging.

    PubMed

    Jeffery, Justin J; Lux, Katie; Vogel, John S; Herrera, Wynetta D; Greco, Stephen; Woo, Ho-Hyung; AbuShahin, Nisreen; Pagel, Mark D; Chambers, Setsuko K

    2014-04-01

    Breast cancer cells preferentially home to the bone microenvironment, which provides a unique niche with a network of multiple bidirectional communications between host and tumor, promoting survival and growth of bone metastases. In the bone microenvironment, the c-fms proto-oncogene that encodes for the CSF-1 receptor, along with CSF-1, serves as one critical cytokine/receptor pair, functioning in paracrine and autocrine fashion. Previous studies concentrated on the effect of inhibition of host (mouse) c-fms on bone metastasis, with resulting decrease in osteolysis and bone metastases as a paracrine effect. In this report, we assessed the role of c-fms inhibition within the tumor cells (autocrine effect) in the early establishment of breast cancer cells in bone and the effects of this early c-fms inhibition on subsequent bone metastases and destruction. This study exploited a multidisciplinary approach by employing two non-invasive, in vivo imaging methods to assess the progression of bone metastases and bone destruction, in addition to ex vivo analyses using RT-PCR and histopathology. Using a mouse model of bone homing human breast cancer cells, we showed that an early one-time application of anti-human c-fms antibody delayed growth of bone metastases and bone destruction for at least 31 days as quantitatively measured by bioluminescence imaging and computed tomography, compared to controls. Thus, neutralizing human c-fms in the breast cancer cell alone decreases extent of subsequent bone metastasis formation and osteolysis. Furthermore, we are the first to show that anti-c-fms antibodies can impact early establishment of breast cancer cells in bone.

  8. What Is Breast in the Bone?

    PubMed

    Shemanko, Carrie S; Cong, Yingying; Forsyth, Amanda

    2016-10-22

    The normal developmental program that prolactin generates in the mammary gland is usurped in the cancerous process and can be used out of its normal cellular context at a site of secondary metastasis. Prolactin is a pleiotropic peptide hormone and cytokine that is secreted from the pituitary gland, as well as from normal and cancerous breast cells. Experimental and epidemiologic data suggest that prolactin is associated with mammary gland development, and also the increased risk of breast tumors and metastatic disease in postmenopausal women. Breast cancer spreads to the bone in approximately 70% of cases with advanced breast cancer. Despite treatment, new bone metastases will still occur in 30%-50% of patients. Only 20% of patients with bone metastases survive five years after the diagnosis of bone metastasis. The breast cancer cells in the bone microenvironment release soluble factors that engage osteoclasts and/or osteoblasts and result in bone breakdown. The breakdown of the bone matrix, in turn, enhances the proliferation of the cancer cells, creating a vicious cycle. Recently, it was shown that prolactin accelerated the breast cancer cell-mediated osteoclast differentiation and bone breakdown by the regulation of breast cancer-secreted proteins. Interestingly, prolactin has the potential to affect multiple proteins that are involved in both breast development and likely bone metastasis, as well. Prolactin has normal bone homeostatic roles and, combined with the natural "recycling" of proteins in different tissues that can be used for breast development and function, or in bone function, increases the impact of prolactin signaling in breast cancer bone metastases. Thus, this review will focus on the role of prolactin in breast development, bone homeostasis and in breast cancer to bone metastases, covering the molecular aspects of the vicious cycle.

  9. Genomic Copy Number Imbalances Associated with Bone and Non-bone Metastasis of Early-Stage Breast Cancer

    PubMed Central

    Liu, Yanhong; Zhou, Renke; Baumbusch, Lars O.; Tsavachidis, Spyros; Brewster, Abenaa M.; Do, Kim-Anh; Sahin, Aysegul; Hortobagyi, Gabriel N.; Taube, Joseph H.; Mani, Sendurai A.; Aarøe, Jørgen; Wärnberg, Fredrik; Børresen-Dale, Anne-Lise; Mills, Gordon B.; Thompson, Patricia A.; Bondy, Melissa L.

    2014-01-01

    Purpose To identify and validate copy number aberrations in early-stage primary breast tumors associated with bone or non-bone metastasis. Patients and Methods Whole-genome molecular inversion probe arrays were used to evaluate copy number imbalances (CNIs) in breast tumors from 960 early-stage patients with information about site of metastasis. The CoxBoost algorithm was used to select metastasis site-related CNIs and to fit a Cox proportional hazards model. Results Gains at 1q41 and 1q42.12 and losses at 1p13.3, 8p22, and Xp11.3 were significantly associated with bone metastasis. Gains at 2p11.2, 3q21.3–22.2, 3q27.1, 10q23.1, and 14q13.2–3 and loss at 7q21.11 were associated with non-bone metastasis. To examine the joint effect of CNIs and clinical predictors, patients were stratified into three risk groups (low, intermediate, and high) based on the sum of predicted linear hazard ratios (HRs). For bone metastasis, the hazard (95% confidence interval) for the low-risk group was 0.32 (0.11–0.92) compared to the intermediate-risk group and 2.99 (1.74–5.11) for the high-risk group. For non-bone metastasis, the hazard for the low-risk group was 0.34 (0.17–0.66) and 2.33 (1.59–3.43) for the high-risk group. The prognostic value of loss at 8p22 for bone metastasis and gains at 10q23.1 for non-bone metastasis, and gain at 11q13.5 for both bone and non-bone metastases were externally validated in 335 breast tumors pooled from four independent cohorts. Conclusions Distinct CNIs are independently associated with bone and non-bone metastasis for early-stage breast cancer patients across cohorts. These data warrant consideration for tailoring surveillance and management of metastasis risk. PMID:24305980

  10. [Encounter of cancer cells with bone. Histological examination of bone metastasis].

    PubMed

    Kanda, Hiroaki

    2011-03-01

    Management of the cancer bone metastasis is important clinical problem. The mechanism (s) of bone metastasis has been studied mainly by animal models and in vitro system. There might be discrepancy between model systems and in vivo human clinical materials. But there is surprisingly rare study of histological examination of human skeletal metastasis, since it is hard to obtain human materials without modification by chemotherapy or irradiation. There are many surgical materials suitable for this examination in our hospital and we have been examined histological features of them. Stromal cells between metastatic cancer cells and OCs (osteoclasts) and÷or OBs (osteoblasts) might play a role in bone metastasis, since these cells are frequently accompanied with OCs÷OBs. We called these stromal cells as "fibroblast-like cells" and examined their nature and roles in bone metastasis. We hope these fibroblast-like cells might become the target of anti bone metastasis therapy, same as osteoclasts targeted by bisphosphonates.

  11. Biomechanical forces in the skeleton and their relevance to bone metastasis: biology and engineering considerations

    PubMed Central

    Lynch, Maureen; Fischbach, Claudia

    2014-01-01

    Bone metastasis represents the leading cause of breast cancer related-deaths. However, the effect of skeleton-associated biomechanical signals on the initiation, progression, and therapy response of breast cancer bone metastasis is largely unknown. This review seeks to highlight possible functional connections between skeletal mechanical signals and breast cancer bone metastasis and their contribution to clinical outcome. It provides an introduction to the physical and biological signals underlying bone functional adaptation and discusses the modulatory roles of mechanical loading and breast cancer metastasis in this process. Following a definition of biophysical design criteria, in vitro and in vivo approaches from the fields of bone biomechanics and tissue engineering will be reviewed that may be suitable to investigate breast cancer bone metastasis as a function of varied mechano-signaling. Finally, an outlook of future opportunities and challenges associated with this newly emerging field will be provided. PMID:25174311

  12. Regenerative Stem Cell Therapy for Breast Cancer Bone Metastasis

    DTIC Science & Technology

    2014-09-01

    13. SUPPLEMENTARY NOTES 14. ABSTRACT Bone is the most common site of metastasis for human breast cancer (BCa), which results in significant...to all major bones as in human patients. 15. SUBJECT TERMS Bone metastasis; osteolysis; osteoprotegerin 16. SECURITY CLASSIFICATION OF: 17...metastasis for human breast cancer (BCa), which results in significant morbidity and mortality in patients with advanced disease. A vicious cycle

  13. Hematogenous Renal Cell Carcinoma Metastasis in the Postoperative Temporal Bone

    PubMed Central

    Konishi, Masaya; Suzuki, Kensuke; Iwai, Hiroshi

    2017-01-01

    Metastatic renal cell carcinoma (RCC) involving the temporal bone is a rare entity. It is usually asymptomatic and misdiagnosis as acute otitis media, mastoiditis, and Ramsay-Hunt syndrome in early onset is not uncommon. We report a case of RCC metastasis to the postoperative temporal bone in the middle of molecular targeted therapy. A 60-year-old man presented left facial palsy with severe retro-auricular pain and he also underwent left middle ear surgery for cholesteatoma more than 30 years before and had been aware of discontinuous otorrhea; therefore, initially we speculated that facial palsy was derived from recurrent cholesteatoma or Ramsay-Hunt syndrome. Exploratory tympanotomy revealed RCC metastasis and postoperative MR indicated hematogenous metastasis. To the best of our knowledge, no report was obtained on temporal bone metastasis in the middle of chemotherapy or hematogenous metastasis in the postoperative middle ear. Metastasis in the temporal bone is still a possible pathological condition despite the development of present cancer therapy. Besides, this case indicates that hematogenous metastasis can occur in the postoperative state of the temporal bone. PMID:28611633

  14. A case of rectal carcinoma with skin and bone marrow metastasis with concurrent extensive visceral involvement; unusual and dismal co-incidence.

    PubMed

    Arslan, Cagatay; Sen, Cenk Ahmet; Ortac, Ragip

    2015-06-01

    Novel systemic therapies and modern surgical and ablative approaches have improved the survival rates for the patients with metastatic colorectal cancer. However, there are still patients with poor prognosis and underlying mechanisms that could not be defined clearly. Metastatic colorectal cancer patients with skin metastasis have a poor prognosis. A 45-year-old man, who presented with large bowel obstruction, was diagnosed with metastatic rectal adenocarcinoma. Unresectable liver metastases were found at diagnosis. FOLFOX plus bevacizumab treatment was started, but the patient developed bowel obstruction after the third cycle. Therefore, ileostomy was performed. Multiple skin, lung, liver and bone metastases appeared during that time. Bone marrow biopsy demonstrated diffuse infiltration by adenocarcinoma cells. Even though partial remission was achieved after 4 cycles of FOLFIRI-cetuximab, the disease progressed after the 8th cycle. The patient lost his life due to disease progression 8 months after the diagnosis. Bone marrow and skin are unusual sites of metastasis for colorectal carcinoma. Metastases in bone marrow and skin develop at later stages of metastatic disease. This patient lived only 4 months after the development of skin and bone marrow metastases. Skin and bone marrow metastases may be the harbingers of short survival. Biopsy of metastatic sites is crucial for diagnosis and detailed molecular analysis. Molecular pathway alterations underlying worse disease course may be found, and hence probable targets for drug improvement may be indicated.

  15. Biomechanical forces in the skeleton and their relevance to bone metastasis: biology and engineering considerations.

    PubMed

    Lynch, Maureen E; Fischbach, Claudia

    2014-12-15

    Bone metastasis represents the leading cause of breast cancer related-deaths. However, the effect of skeleton-associated biomechanical signals on the initiation, progression, and therapy response of breast cancer bone metastasis is largely unknown. This review seeks to highlight possible functional connections between skeletal mechanical signals and breast cancer bone metastasis and their contribution to clinical outcome. It provides an introduction to the physical and biological signals underlying bone functional adaptation and discusses the modulatory roles of mechanical loading and breast cancer metastasis in this process. Following a definition of biophysical design criteria, in vitro and in vivo approaches from the fields of bone biomechanics and tissue engineering that may be suitable to investigate breast cancer bone metastasis as a function of varied mechano-signaling will be reviewed. Finally, an outlook of future opportunities and challenges associated with this newly emerging field will be provided. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Steps in Prostate Cancer Progression that lead to Bone Metastasis

    PubMed Central

    Jin, Jung-Kang; Dayyani, Farshid; Gallick, Gary E.

    2011-01-01

    Prostate cancer is a complex disease in which metastasis to the bone is the main cause of death. Initial stages of metastasis are generally similar to those for most solid tumors; however, the mechanisms that underlie the homing of prostate tumor cells to the bone remain incompletely understood. Prostate cancer bone metastasis is also a microenvironment-driven disease, involving bi-directional interactions between the tumor and the bone microenvironment. In this review, we discuss the current understanding of the biologic processes and regulatory factors involved in the metastasis of prostate cancer cells, and their specific properties that promote growth in bone. Although many of these processes still need to be fully elucidated, a better understanding of the complex tumor/microenvironment interplay is slowly leading to more effective therapies for patients with prostate cancer bone metastases. PMID:21365645

  17. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cellsmore » and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.« less

  18. An open cohort study of bone metastasis incidence following surgery in breast cancer patients.

    PubMed

    Koizumi, Mitsuru; Yoshimoto, Masataka; Kasumi, Fujio; Iwase, Takuji

    2010-07-21

    To help design clinical trials of adjuvant bisphosphonate therapy for breast cancer, the temporal incidence of bone metastasis was investigated in a cohort of patients. We have tried to draw the criteria to use adjuvant bisphosphonate. Consecutive breast cancer patients undergoing surgery between 1988 and 1998 (5459 patients) were followed up regarding bone metastasis until December 2006. Patients' characteristics at the time of surgery were analyzed by Cox's method, with bone metastasis as events. Patient groups were assigned according to Cox's analysis, and were judged either to require the adjuvant bisphosphonate or not, using the tentative criteria: high risk (>3% person-year), medium risk (1-3%), and low risk (<1%). Bone metastasis incidence was constant between 1.0 and 2.8% per person-year more than 10 years. Non-invasive cancer was associated with a very low incidence of bone metastasis (1/436). Multivariate Cox's analysis indicated important factors for bone metastasis were tumor grade (T), nodal grade (pN), and histology. Because T and pN were important factors for bone metastasis prediction, subgroups were made by pTNM stage. Patients at stages IIIA, IIIB and IV had an incidence of >3% per person-year, patients with stage I <1% per person-year, and those with stages II were between 1 and 3%. Further analysis with histology in stage II patients showed that stage IIB with high risk histology also had a high incidence (3% person year), whereas stage IIA with medium risk histology were <1%. Bone metastasis incidence remained constant for many years. Using pN, T, and histopathology, patients could be classified into high, medium, and low risk groups.

  19. Metabolic Bone Disease in the Context of Metastatic Neuroendocrine Tumor: Differentiation from Skeletal Metastasis, the Molecular PET-CT Imaging Features, and Exploring the Possible Etiopathologies Including Parathyroid Adenoma (MEN1) and Paraneoplastic Humoral Hypercalcemia of Malignancy Due to PTHrP Hypersecretion.

    PubMed

    Ranade, Rohit; Basu, Sandip

    2017-01-01

    Three cases of metabolic bone disease in the setting of metastatic neuroendocrine tumor (NET) are illustrated with associated etiopathologies.  One of these cases harbored mixed lesions in the form of vertebral metastasis (biopsy proven) while the other skeletal lesions were caused due to metabolic bone disease related to multiple parathyroid adenomas. While the metastatic lesion was positive on 68Ga-DOTATATE positron emission tomography-computed tomography (PET-CT), the lesions of metabolic bone disease were negative and the 18F-fluoride PET-CT demonstrated the features of metabolic bone scan. Similar picture of metabolic bone disease [18-sodium fluoride (18NaF)/68Ga-DOTATATE mismatch] was documented in the other two patients, while fluorodeoxyglucose (FDG)-PET-CT was variably positive, primarily showing tracer uptake in the metabolic skeletal lesions of the patient with hypersecretion of parathyroid hormone-related protein (PTHrP) by the underlying tumor. Discordance between 18NaF PET-CT and 68Ga-DOTATATE PET-CT serves as a good marker for identification of metabolic bone disease and diagnosing such a clinical entity. In a patient of NET with metabolic bone disease and hypercalcemia, thus, two causes need to be considered: (i) Coexisting parathyroid adenoma in multiple endocrine neoplasia type I (MEN-I) syndrome and (ii) humoral hypercalcemia of malignancy (HHM) related to hypersecretion of PTHrP by the tumor. The correct diagnosis of metabolic bone disease in metastatic NET can alter the management substantially. Interestingly, peptide receptor radionuclide therapy (PRRT) can emerge as a very promising treatment modality in patients of metabolic bone disease caused by HHM in the setting of NET.

  20. Estrogen Receptors in Breast and Bone: from Virtue of Remodeling to Vileness of Metastasis

    PubMed Central

    Bado, Igor; Gugala, Zbigniew; Fuqua, Suzanne A. W.; Zhang, Xiang H.-F.

    2017-01-01

    Bone metastasis is a prominent cause of morbidity and mortality in cancer. High rates of bone colonization in breast cancer, especially in the subtype expressing estrogen receptors (ERs), suggests tissue-specific proclivities for metastatic tumor formation. The mechanisms behind this subtype-specific organ-tropism remains largely elusive. Interestingly, as the major driver of ER+ breast cancer, ERs also play important roles in bone development and homeostasis. Thus, any agents targeting ER will also inevitably affect the microenvironment, i.e., the osteoblasts and osteoclasts. Yet, how such microenvironmental effects are integrated with direct therapeutic responses of cancer cells remain poorly understood. Recent findings on ER mutations, especially their enrichment in bone metastasis, raised even more provocative questions on the role of ER in cancer-bone interaction. In this review, we evaluate the importance of estrogen receptors (ERs) in bone metastasis and discuss new avenues of investigation for bone metastasis treatment based on current knowledge. PMID:28368409

  1. Transcriptional Network Analysis Identifies BACH1 as a Master Regulator of Breast Cancer Bone Metastasis

    PubMed Central

    Liang, Yajun; Wu, Heng; Lei, Rong; Chong, Robert A.; Wei, Yong; Lu, Xin; Tagkopoulos, Ilias; Kung, Sun-Yuan; Yang, Qifeng; Hu, Guohong; Kang, Yibin

    2012-01-01

    The application of functional genomic analysis of breast cancer metastasis has led to the identification of a growing number of organ-specific metastasis genes, which often function in concert to facilitate different steps of the metastatic cascade. However, the gene regulatory network that controls the expression of these metastasis genes remains largely unknown. Here, we demonstrate a computational approach for the deconvolution of transcriptional networks to discover master regulators of breast cancer bone metastasis. Several known regulators of breast cancer bone metastasis such as Smad4 and HIF1 were identified in our analysis. Experimental validation of the networks revealed BACH1, a basic leucine zipper transcription factor, as the common regulator of several functional metastasis genes, including MMP1 and CXCR4. Ectopic expression of BACH1 enhanced the malignance of breast cancer cells, and conversely, BACH1 knockdown significantly reduced bone metastasis. The expression of BACH1 and its target genes was linked to the higher risk of breast cancer recurrence in patients. This study established BACH1 as the master regulator of breast cancer bone metastasis and provided a paradigm to identify molecular determinants in complex pathological processes. PMID:22875853

  2. Novel immunohistochemistry-based signatures to predict metastatic site of triple-negative breast cancers.

    PubMed

    Klimov, Sergey; Rida, Padmashree Cg; Aleskandarany, Mohammed A; Green, Andrew R; Ellis, Ian O; Janssen, Emiel Am; Rakha, Emad A; Aneja, Ritu

    2017-09-05

    Although distant metastasis (DM) in breast cancer (BC) is the most lethal form of recurrence and the most common underlying cause of cancer related deaths, the outcome following the development of DM is related to the site of metastasis. Triple negative BC (TNBC) is an aggressive form of BC characterised by early recurrences and high mortality. Athough multiple variables can be used to predict the risk of metastasis, few markers can predict the specific site of metastasis. This study aimed at identifying a biomarker signature to predict particular sites of DM in TNBC. A clinically annotated series of 322 TNBC were immunohistochemically stained with 133 biomarkers relevant to BC, to develop multibiomarker models for predicting metastasis to the bone, liver, lung and brain. Patients who experienced metastasis to each site were compared with those who did not, by gradually filtering the biomarker set via a two-tailed t-test and Cox univariate analyses. Biomarker combinations were finally ranked based on statistical significance, and evaluated in multivariable analyses. Our final models were able to stratify TNBC patients into high risk groups that showed over 5, 6, 7 and 8 times higher risk of developing metastasis to the bone, liver, lung and brain, respectively, than low-risk subgroups. These models for predicting site-specific metastasis retained significance following adjustment for tumour size, patient age and chemotherapy status. Our novel IHC-based biomarkers signatures, when assessed in primary TNBC tumours, enable prediction of specific sites of metastasis, and potentially unravel biomarkers previously unknown in site tropism.

  3. Macrophage Efferocytosis and Prostate Cancer Bone Metastasis

    DTIC Science & Technology

    2015-10-01

    prostate cancer bone metastasis through the phagocytosis of apoptotic tumor cells (efferocytosis). Specific Aims: 1. To identify the phagocytic ...2: To identify the phagocytic /efferocytic macrophage population in the tumor microenvironment of prostate bone metastases and determine its ability...preparation for Cancer Research. We obtained an array of prostate cancer tissue including bone metastasis (N=72) and stained the tissue for the phagocytic

  4. Induction of experimental bone metastasis in mice by transfection of integrin alpha 4 beta 1 into tumor cells.

    PubMed Central

    Matsuura, N.; Puzon-McLaughlin, W.; Irie, A.; Morikawa, Y.; Kakudo, K.; Takada, Y.

    1996-01-01

    Cell adhesion receptors (eg, integrins and CD44) play an important role in invasion and metastasis during tumor progression. The increase in integrin alpha 4 beta 1 expression on primary melanomas has been reported to significantly correlate with the development of metastases. alpha 4 beta 1 is a cell surface heterodimer that mediates cell-cell and cell-extracellular matrix interactions through adhesion to vascular cell adhesion molecule (VCAM)-1 and to the IIICS region of fibronectin. To test the effects of alpha 4 beta 1 expression on tumor cell metastasis, Chinese hamster ovary cells were transfected with human alpha 4 cDNA. Whereas alpha 4-negative Chinese hamster ovary cells developed only pulmonary metastasis, alpha 4-positive Chinese hamster ovary cells developed bone and pulmonary metastasis in 3 to 4 weeks when injected intravenously into nude mice. Bone metastasis was inhibited by antibody against alpha 4 or VCAM-1. Expression of alpha 3 beta 1, alpha 6 beta 1, or alpha V beta 1 did not induce bone metastasis. Expression of alpha 4 beta 1 also induced bone metastasis in K562 human erythroleukemia cells injected into SCID mice. These results demonstrate that alpha 4 beta 1 can induce tumor cell trafficking to bone, probably via interaction with VCAM-1 that is constitutively expressed on bone marrow stromal cells. Images Figure 1 Figure 3 PMID:8546226

  5. The Multiple Roles of Exosomes in Metastasis

    PubMed Central

    WEIDLE, H. ULRICH; BIRZELE, FABIAN; KOLLMORGEN, GWEN; RÜGER, RÜDIGER

    2016-01-01

    Exosomes are important contributors to cell−cell communication and their role as diagnostic markers for cancer and the pathogenesis for cancer is under intensive investigation. Here, we focus on their role in metastasis-related processes. We discuss their impact regarding promotion of invasion and migration of tumor cells, conditioning of lymph nodes, generation of premetastatic niches and organotropism of metastasis. Furthermore, we highlight interactions of exosomes with bone marrow and stromal components such as fibroblasts, endothelial cells, myeloid- and other immune-related cells in the context of metastases. For all processes as described above, we outline molecular and cellular components for therapeutic intervention with metastatic processes. PMID:28031234

  6. ABL kinases promote breast cancer osteolytic metastasis by modulating tumor-bone interactions through TAZ and STAT5 signaling

    PubMed Central

    Wang, Jun; Rouse, Clay; Jasper, Jeff S.; Pendergast, Ann Marie

    2016-01-01

    Bone metastases occur in up to 70% of advanced breast cancer. For most patients with breast cancer, bone metastases are predominantly osteolytic. Interactions between tumor cells and stromal cells in the bone microenvironment drive osteolytic bone metastasis, a process that requires the activation of osteoclasts, cells that break down bone. Here, we report that ABL kinases promoted metastasis of breast cancer cells to bone by regulating the crosstalk between tumor and the bone microenvironment. ABL kinases protected tumor cells from apoptosis induced by TRAIL (TNF-related apoptosis-inducing ligand), activated the transcription factor STAT5, and promoted osteolysis through the STAT5-dependent expression of genes encoding the osteoclast activating factors interleukin 6 (IL6) and matrix metalloproteinase-1 (MMP1). Furthermore, ABL kinases increased the abundance of the Hippo pathway mediator TAZ and the expression of TAZ-dependent target genes that promote bone metastasis. Knockdown of ABL kinases or treatment with ABL-specific allosteric inhibitor impaired osteolytic metastasis of breast cancer cells in mice. These findings revealed a role for ABL kinases in regulating tumor-bone interactions and provide a rationale for targeting both tumor and the bone microenvironment with ABL-specific inhibitors. PMID:26838548

  7. Gastric cancer presenting with solitary gigantic pelvic metastasis.

    PubMed

    Zheng, Qi; Nan, Kejun; Yao, Yu

    2012-07-01

    Bone metastasis of gastric cancer is relatively uncommon in clinical practice. Moreover, it is all the more unusual for the primary presentation of gastric malignancy to be bone metastasis. Here, we describe a male patient who complained of pain and edema in his right lower extremity. Further assessment by computed tomography and positron emission tomography revealed an abnormally thickened gastric cardia and a giant neoplasm in the right pelvis with bone damage. Consequently, the finding of adenocarcinoma cells in pelvic and cardia biopsy specimens contributed to the diagnosis of pelvic metastasis from gastric cancer. This case report illustrates that stomach cancer has the potential, although far less than breast, prostate and lung cancers, to metastasize to bone. In addition, it highlights the peculiarity of this bone metastasis which is pelvic, solitary and huge.

  8. Lipid Osteoclastokines Regulate Breast Cancer Bone Metastasis

    PubMed Central

    Krzeszinski, Jing Y.; Schwaid, Adam G.; Cheng, Wing Yin; Jin, Zixue; Gallegos, Zachary R.; Saghatelian, Alan

    2017-01-01

    Bone metastasis is a deadly consequence of cancers, in which osteoclast forms a vicious cycle with tumor cells. Bone metastasis attenuation by clinical usage of osteoclast inhibitors and in our osteopetrotic mouse genetic models with β-catenin constitutive activation or peroxisome proliferator-activated receptor γ deficiency fully support the important role of osteoclast in driving the bone metastatic niche. However, the mechanisms for this “partnership in crime” are underexplored. Here we show that osteoclasts reprogram their lipid secretion to support cancer cells. Metabolomic profiling reveals elevated prometastatic arachidonic acid (AA) but reduced antimetastatic lysophosphatidylcholines (LPCs). This shift in lipid osteoclastokines synergistically stimulates tumor cell proliferation, migration, survival, and expression of prometastatic genes. Pharmacologically, combined treatment with LPCs and BW-755C, an inhibitor of AA signaling via blocking lipoxygenase and cyclooxygenase, impedes breast cancer bone metastasis. Our findings elucidate key paracrine mechanisms for the osteoclast-cancer vicious cycle and uncover important therapeutic targets for bone metastasis. PMID:27967239

  9. New Experiences of Treatment in Multiple Tumors with HIFU Ablation and Whole Body Hyperthermia

    NASA Astrophysics Data System (ADS)

    Takeuchi, Akira; Gondo, Hideki; Iijima, Norio; Xia, Yuantian; Takeuchi, Takashi

    2007-05-01

    We have performed some 5000 whole body hyperthermia (WBH) treatments using far-infrared equipment (RHD 7500: Enthermics medical systems, USA) in 1000 cancer patients since 1991 at Luke Hospital & Clinic (Nakano, Japan). Hyperthermia is a natural treatment whereby patients are heated within the fever temperature range of 41-42 C. However, this therapy alone is poorly suited to advanced cancer patients, where regional tumor control is needed. The potential of HIFU therapy for theses cases deserves further investigation. We have treated 20 times in 12 advanced cancer patients, since importing a new HIFU device (Sonic CZ901: Mianyang some electronic Ltd: China) last December and are able to report some interesting results of combination treatment with HIFU and WBH. Our first experience was a 20-year old female pharyngeal cancer patient with lung and multiple liver metastases. Her lung tumor reduced following WBH (given weekly, 4 times in total) and her liver tumor clearly reduced following HIFU treatment. Our second experience of combinative treatment was in a 65-year old male suffering from a neck tumor with bone metastasis. He received WBH after HIFU treatment into 7th lib bone metastasis. After 10 days, his neck tumor grew with evidence of internal necrosis, and finally ruptured. CT images showed necrotic changes in the focus of the neck tumor and also lib bone metastasis. We believe that this new thermal combinative therapy shows great promise.

  10. Esophageal squamous cell carcinoma with dural and bone marrow metastases.

    PubMed

    Chen, Yen-Hao; Huang, Cheng-Hua

    2014-09-21

    Patients with esophageal squamous cell carcinoma generally present at an advanced stage at the time of diagnosis. The most common sites of visceral metastasis are the lung, liver and bone, but brain and bone marrow involvement is exceedingly rare. Herein, we report a 62-year-old man with a 4-wk history of progressive low back pain with radiation to bilateral lower legs, dysphagia and body weight loss. Esophageal squamous cell carcinoma with regional lymph node, liver and bone metastases was diagnosed. He underwent concurrent chemoradiotherapy and got a partial response. Four months later, he complained of headache, diplopia and severe hearing impairment in the left ear. There was no evidence for bacterial, fungal, tuberculous infection or neoplastic infiltration. Magnetic resonance imaging of the brain demonstrated thickening and enhancement of bilateral pachymeninges and multiple enhancing masses in bilateral skull. Dural metastasis was diagnosed and he received whole brain irradiation. In addition, laboratory examination revealed severe thrombocytopenia and leucopenia, and bone marrow study confirmed the diagnosis of metastatic squamous cell carcinoma. This is the first described case of esophageal squamous cell carcinoma with dural and bone marrow metastases. We also discuss the pathogenesis of unusual metastatic diseases and differential diagnosis of pachymeningeal thickening.

  11. Osthole inhibits bone metastasis of breast cancer

    PubMed Central

    Guo, Baofeng; Ye, Yiyi; Han, Xianghui; Qin, Yuenong; Liu, Sheng

    2017-01-01

    Bone is one of the most common sites for breast cancer metastasis, which greatly contributes to patient morbidity and mortality. Osthole, a major extract from Cnidium monnieri (L.), exhibits many biological and pharmacological activities, however, its potential as a therapeutic agent in the treatment of breast cancer bone metastases remain poorly understood. In this study, we set out to investigate whether osthole could inhibit breast cancer metastasis to bone in mice and clarified the potential mechanism of this inhibition. In the murine model of breast cancer osseous metastasis, mice that received osthole developed significantly less bone metastases and displayed decreased tumor burden when compared with mice in the control group. Osthole inhibited breast cancer cell growth, migration, and invasion, and induced apoptosis of breast cancer cells. Additionally, it also regulated OPG/RANKL signals in the interactions between bone cells (osteoblasts and osteoclasts) and cancer cells. Besides, it also inhibited TGF-β/Smads signaling in breast cancer metastasis to bone in MDA-231BO cells. The results of this study suggest that osthole has real potential as a therapeutic candidate in the treatment of breast cancer patients with bone metastases. PMID:28938572

  12. Age at diagnosis and distant metastasis in breast cancer--a surprising inverse relationship.

    PubMed

    Purushotham, A; Shamil, E; Cariati, M; Agbaje, O; Muhidin, A; Gillett, C; Mera, A; Sivanadiyan, K; Harries, M; Sullivan, R; Pinder, S E; Garmo, H; Holmberg, L

    2014-07-01

    Predictors for site of distant metastasis and impact on survival in breast cancer are incompletely understood. Clinico-pathological risk factors for site of distant metastasis and survival were analysed in patients with invasive breast cancer treated between 1986 and 2006. Of 3553 patients, with median follow-up 6.32years, 825 (23%) developed distant metastasis. The site of metastasis was bone in 196/825 (24%), viscera in 540/825 (65%) and unknown in 89 (11%). Larger primary invasive tumour size, higher tumour grade and axillary nodal positivity increased risk of metastasis to all sites. Lobular carcinoma was more likely to first metastasise to bone compared to invasive ductal carcinoma (NST). Oestrogen receptor (ER) negative, progesterone receptor (PgR) negative and/or Human epidermal growth factor (HER2) positive tumours were more likely to metastasise to viscera. A striking relationship between increasing age at diagnosis and a reduction in risk of distant metastasis to bone and viscera was observed. Median time to death from onset of metastatic disease was 1.52 (Interquartile range (IQR) 0.7-2.9)years for patients with bone metastasis and 0.7 (IQR 0.2-1.5)years for visceral metastasis. On multivariate analysis, despite the decrease in risk of distant metastasis with increasing age, there was an elevated hazard for death in patients >50years at diagnosis of metastasis if they developed bone metastasis, with a similar trend observed in the >70years age group if they developed visceral metastasis. These findings indicate that there are biological mechanisms underlying the impact of age on the development of distant metastasis and subsequent death. This may have important implications in the treatment of breast cancer. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Murine models of breast cancer bone metastasis

    PubMed Central

    Wright, Laura E; Ottewell, Penelope D; Rucci, Nadia; Peyruchaud, Olivier; Pagnotti, Gabriel M; Chiechi, Antonella; Buijs, Jeroen T; Sterling, Julie A

    2016-01-01

    Bone metastases cause significant morbidity and mortality in late-stage breast cancer patients and are currently considered incurable. Investigators rely on translational models to better understand the pathogenesis of skeletal complications of malignancy in order to identify therapeutic targets that may ultimately prevent and treat solid tumor metastasis to bone. Many experimental models of breast cancer bone metastases are in use today, each with its own caveats. In this methods review, we characterize the bone phenotype of commonly utilized human- and murine-derived breast cell lines that elicit osteoblastic and/or osteolytic destruction of bone in mice and report methods for optimizing tumor-take in murine models of bone metastasis. We then provide protocols for four of the most common xenograft and syngeneic inoculation routes for modeling breast cancer metastasis to the skeleton in mice, including the intra-cardiac, intra-arterial, orthotopic and intra-tibial methods of tumor cell injection. Recommendations for in vivo and ex vivo assessment of tumor progression and bone destruction are provided, followed by discussion of the strengths and limitations of the available tools and translational models that aid investigators in the study of breast cancer metastasis to bone. PMID:27867497

  14. Searching early bone metastasis on plain radiography by using digital imaging processing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaramillo-Nunez, A.; Perez-Meza, M.; Universidad de la Sierra Sur, C. P. 70800, Miahuatlan, Oax.

    2012-10-23

    Some authors mention that it is not possible to detect early bone metastasis on plain radiography. In this work we use digital imaging processing to analyze three radiographs taken from a patient with bone metastasis discomfort on the right shoulder. The time period among the first and second radiography was approximately one month and between the first and the third one year. This procedure is a first approach in order to know if in this particular case it was possible to detect an early bone metastasis. The obtained results suggest that by carrying out a digital processing is possible tomore » detect the metastasis since the radiography contains the information although visually it is not possible to observe it.« less

  15. The Italian cross-sectional survey of the management of bone metastasis: ZeTa study

    PubMed Central

    Santini, Daniele; Bertoldo, Francesco; Dell'Aquila, Emanuela; Cecchini, Isabella; Fregosi, Stefania; Bortolussi, Paolo

    2012-01-01

    Background Several studies have emphasized the importance of the maintenance of bone health in a comprehensive cancer care. However, no survey about approach to bone metastasis care is currently available. The ZeTa study provides a picture of the Italian oncologists' therapeutics habits in this area, in a real clinical-practice scenario. Design This study was based on online questionnaire-based interviews to Italian oncologists that included 145 questions. The aim was to collect information on the treatment of bone metastasis, the current use of bisphosphonates, the awareness of guidelines and the concerns about ONJ, the use of vitamin D supplementation. Results 445 oncologists were contacted, 283 agreed to participate. The results show that the current management of bone metastasis is still sub-optimal, as the recommendations from current clinical guidelines are not completely followed by all specialists. Conclusions This survey highlights the urgent need to improve management of bone metastasis in cancer patients. PMID:26909253

  16. An Atypical Metastasis of Follicular-Type Adenocarcinoma of the Thyroid Gland to Thumb

    PubMed Central

    Huri, Gazi

    2011-01-01

    Bone metastasis in the hand is rare. The etiology of metastatic hand cancers is different from other bones. Bronchogenic carcinoma is the most common primary tumor metastasis to hand. In this paper a rare case of thumb metastasis from “follicular-type carcinoma” of the thyroid is presented. PMID:23198224

  17. The Biology of Bone Metastasis.

    PubMed

    Esposito, Mark; Guise, Theresa; Kang, Yibin

    2018-06-01

    Bone metastasis, or the development of secondary tumors within the bone of cancer patients, is a debilitating and incurable disease. Despite its morbidity, the biology of bone metastasis represents one of the most complex and intriguing of all oncogenic processes. This complexity derives from the intricately organized bone microenvironment in which the various stages of hematopoiesis, osteogenesis, and osteolysis are jointly regulated but spatially restricted. Disseminated tumor cells (DTCs) from various common malignancies such as breast, prostate, lung, and kidney cancers or myeloma are uniquely primed to subvert these endogenous bone stromal elements to grow into pathological osteolytic or osteoblastic lesions. This colonization process can be separated into three key steps: seeding, dormancy, and outgrowth. Targeting the processes of dormancy and initial outgrowth offers the most therapeutic promise. Here, we discuss the concepts of the bone metastasis niche, from controlling tumor-cell survival to growth into clinically detectable disease. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

  18. Study on 41Ca-AMS for diagnosis and assessment of cancer bone metastasis in rats

    NASA Astrophysics Data System (ADS)

    Shen, Hongtao; Pang, Fangfang; Jiang, Shan; He, Ming; Dong, Kejun; Dou, Liang; Pang, Yijun; Yang, Xianlin; Ruan, Xiangdong; Liu, Manjun; Xia, Chunbo

    2015-10-01

    The annual incidence of new cancer patients in China is about 2 million, 30-40% of which will end up with bone metastasis. Profound study on the preclinical model and early diagnosis of cancer bone metastasis in rats are very significant for the drug development, better understanding and treatment of bone metastases. In order to monitor the process of bone metabolism and early detection of bone metastasis of cancer cells, a technique of 41Ca isotope tracer combined with AMS has been developed and applied in the study on the bone metastasis of cancer cells by rat model. In this work, 3-month-old female Sprague-Dawley (SD) rats were randomly divided into different groups, and tumor cells injected respectively into the tail vein, femoral artery, femoral cavity and the thigh muscle to establish the rat models for bone metastases. The most appropriate model, i.e., the thigh muscle group, was finally adopted in our real metastases experiment. Each rat in this group was intramuscularly (i.m.) injected with 250 μl CaCl2 solution (containing 1.4 mg Ca and 5nCi 41Ca). About 40 days later, the rat mammary gland carcinoma cells (Walker 256) were injected into these rats following the established protocol. After bone metastasis, medicine interventions were performed. The sequential urine and blood samples were collected and analyzed for 41Ca (by AMS) and N-terminal telopeptide (Ntx), respectively. Bone Mineral Density (BMD) values in the femur and the tibia were measured by CT scan. The results of 41Ca/Ca in longitudinal urinary samples can sensitively reveal the skeletal perturbations caused by bone metastasis of rats, suggests that 41Ca might be similarly developed for human use and improve clinical management through the assessment of the curative effect and non-invasive detection of the earliest stages of cancer growth in bone.

  19. Inhibitory Effects of Megakaryocytes in Prostate Cancer Bone Metastasis

    DTIC Science & Technology

    2010-04-01

    meeting, Feb. 2010, Seattle, WA) 3. Inhibitory effects of megakaryocytes in prostate cancer bone metastasis. (Oral presentation and Young ...cancer bone metastasis. (Oral presentation and ASBMR-Harold M. Frost Young Investigator Award, Aug. 2009, Sun Valley, ID) 5. Career development...valuable new scientific information and also provided critical career development support for an a spiring young scientist. References Please refer

  20. Preventing Prostate Cancer Metastasis by Targeting Exosome Secretion

    DTIC Science & Technology

    2015-12-01

    extensive and painful metastasis of the bone. We proposed compare the impact of exosomes derived from advanced stage prostate cancer on bone stromal cells...The revised report including additional figures, tables, and text, is attached below. 1. INTRODUCTION Bone metastasis is a painful and often lethal...UT) supplemented with 10% fetal bovine serum (Atlanta Biologicals, Lawrenceville, GA) plus penicillin/streptomycin (Gibco, Gaithersburg, MD

  1. Study the Influence of Arthritis on Breast Cancer-Associated Bone Metastasis

    DTIC Science & Technology

    2008-10-01

    Arthritis Lopamudra Das Roy, Latha B. Pathangey, Teresa L. Tinder , and Pinku Mukherjee* Department of Biology, University of North Carolina at... relationship to angiogenic factors in multiple myeloma. European Journal of Internal Medicine. 17:412–416. 40. K. Leitzel, Ettenberg.S, Walsh.R, Abraham.J

  2. [Establishment of a novel chinese human lung adenocarcinoma cell line CPA-Yang3 and its real bone metastasis clone CPA-Yang3BM in immunodeficient mice].

    PubMed

    Yang, Shunfang; Shi, Meiping; Cao, Jie; Su, Jianzhong; Zhao, Lanxiang; Lei, Bei; Chang, Cheng; Lu, Jianying; Ye, Jianding; Xie, Wenhui

    2011-02-01

    The recurrence and metastasis of lung cancer is a tough problem worldwide. The aim of this study is to establish a novel Chinese lung adenocarcinoma cell line and its real bone-seeking clone sub-line for exploring the molecular mechanism of lung cancer metastasis. The cells came from the pleural effusion of a sixty-five years old female patient with lung adenocarcinoma and supraclavicular lymph node metastases. The gene expression was detected by real-time quantitative PCR. Intracardiac injection of the cells into nude mice was performed and in vivo imaging was obtained by bone scintigraphy and conventional radiography. Bone metastases were determined on bone scintigraphy and then the lesions were resected under deep anesthesia for bone metastasis cancer cell culture. The process was repeated for four cycles to obtain a real bone-seeking clone. The tumorigenesis rate started at 4th passage in immunodeficient mice via subcutaneously and as well as later passages. Approximately 1×10⁶ cancer cells were injected into left cardiac ventricle of immunodeficient mice resulted bone metastasis sites were successfully revealed by bone scintigraphy and pathological diagnosis, the mandible (100%), scapula (33%), humerus (50%), vertebral column (50%), femur (66.7%) and accompanied invasion with other organs, the adrenal gland (17%), pulmonary (33%), liver (50%), submaxillary gland (33%) in the mice after inoculation two-three weeks. The chromosome karyotype analysis of the cells was subdiploid. Quantitative real-time PCR was used to examined and compared with SPC-A-1 lung adenocarcinoma, ESM1, VEGF-C, IL-6, IL-8, AR, SVIL, FN1 genes were overexpress. The novel cell was named CPA-Yang3. The femur metastasis cell was repeated in vivo-in vitro-in vivo with three cycles and harvested a real bone metastasis clone. It was named CPA-Yang3BM. Tne characteristics of novel strain CPAYang3 is a highly metastasis cell line of Chinese lung adenocarcinoma and CPA-Yang3BM is a real bone-seeking clone.

  3. Prevalence and Survival Patterns of Patients with Bone Metastasis from Common Cancers in Thailand.

    PubMed

    Phanphaisarn, Areerak; Patumanond, Jayantorn; Settakorn, Jongkolnee; Chaiyawat, Parunya; Klangjorhor, Jeerawan; Pruksakorn, Dumnoensun

    2016-01-01

    Bone metastasis is a single condition but presents with various patterns and severities. Skeletal- related events (SREs) deteriorate overall performance status and reduce quality of life. However, guidelines for early detection and management are limited. This study includes a survey of the prevalence of bone metastasis in cases with common cancers in Thailand as well as a focus on survival patterns and SREs. A retrospective cohort analysis was conducted using a database of the Chiang Mai Cancer Registry and the Musculoskeletal Tumor Registry of the OLARN Center, Chiang Mai University. The prevalence of bone metastasis from each type of primary cancer was noted and time-to-event analysis was performed to estimate cancer survival rates after bone metastasis. There were 29,447 cases of the ten most common cancers in Thailand, accounting for 82.2% of the entire cancer registry entries during the study period. Among those cases, there were 2,263 with bone metastases, accounting for 7.68% of entries. Bone metastasis from lung, liver, breast, cervix and prostate are common in the Thai population, accounting for 83.4% of all positive cases. The median survival time of all was 6 months. Of the bone metastases, 48.9% required therapeutic intervention, including treatment of spinal cord and nerve root compression, pathological fractures, and bone pain. The frequency of the top five types of bone metastasis in Thailand were different from the frequencies in other countries, but corresponded to the relative prevalence of the cancers in Thailand and osteophilic properties of each cancer. The results of this study support the establishment of country specific guidelines for primary cancer identification with skeletal lesions of unknown origin. In addition, further clinical studies of the top five bone metastases should be performed to develop guidelines for optimal patient management during palliative care.

  4. Excess TGF-β mediates muscle weakness associated with bone metastases in mice

    PubMed Central

    Reiken, Steven; Xie, Wenjun; Andersson, Daniel C.; John, Sutha; Chiechi, Antonella; Wright, Laura E.; Umanskaya, Alisa; Niewolna, Maria; Trivedi, Trupti; Charkhzarrin, Sahba; Khatiwada, Pooja; Wronska, Anetta; Haynes, Ashley; Benassi, Maria Serena; Witzmann, Frank A.; Zhen, Gehua; Wang, Xiao; Cao, Xu; Roodman, G. David; Marks, Andrew R.; Guise, Theresa A.

    2015-01-01

    Cancer-associated muscle weakness is poorly understood and there is no effective treatment. Here, we find that seven different mouse models of human osteolytic bone metastases, representing breast, lung and prostate cancers, as well as multiple myeloma exhibited impaired muscle function, implicating a role for the tumor-bone microenvironment in cancer-associated muscle weakness. We found that TGF-β, released from the bone surface as a result of metastasis-induced bone destruction upregulated NADPH oxidase 4 (Nox4), resulting in elevated oxidization of skeletal muscle proteins, including the ryanodine receptor/calcium (Ca2+) release channel (RyR1). The oxidized RyR1 channels leaked Ca2+, resulting in lower intracellular signaling required for proper muscle contraction. We found that inhibiting RyR1 leak, TGF-β signaling, TGF-β release from bone or Nox4 all improved muscle function in mice with MDA-MB-231 bone metastases. Humans with breast cancer- or lung cancer-associated bone metastases also had oxidized skeletal muscle RyR1 that is not seen in normal muscle. Similarly, skeletal muscle weakness, higher levels of Nox4 protein and Nox4 binding to RyR1, and oxidation of RyR1 were present in a mouse model of Camurati-Engelmann disease, a non-malignant metabolic bone disorder associated with increased TGF-β activity. Thus, metastasis-induced TGF-β release from bone contributes to muscle weakness by decreasing Ca2+-induced muscle force production. PMID:26457758

  5. Pre-osteoblastic MC3T3-E1 promote breast cancer cell growth in bone in a murine xenograft model

    USDA-ARS?s Scientific Manuscript database

    The bones are the most common sites of breast cancer metastasis. Upon arrival within the bone microenvironment, breast cancer cells coordinate the activities of stromal cells, resulting in an increase in osteoclast activity and bone matrix degradation. In late stages of bone metastasis, breast cance...

  6. 78 FR 16270 - Agency Information Collection Activities: Submission for OMB Review; Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-14

    ... Emission Tomography (PET) to Identify Bone Metastasis in Cancer; Use: In Decision Memorandum CAG-00065R... bone metastasis in cancer is reasonable and necessary only when the provider is participating in and..., location and quantification of bone metastases in beneficiaries in whom bone metastases are strongly...

  7. Massive trapezial metastasis from gastric adenocarcinoma resected and reconstructed with a vascularized scapular bone graft

    PubMed Central

    Okamoto, Masanori; Yamazaki, Hiroshi; Yoshimura, Yasuo; Aoki, Kaoru; Tanaka, Atsushi; Kato, Hiroyuki

    2017-01-01

    Abstract Rationale: Isolated metastasis to the hand bones is very rare. Only seven cases of metastasis to the trapezium have been reported. To the best of our knowledge, this is the first report of a single metastasis to the trapezium from a gastric adenocarcinoma. Patient concerns: A 62-year-old man presented with pain and massive swelling in the right carpometacarpal joint of the thumb. Diagnoses: The patient was diagnosed with trapezial metastasis of advanced gastric adenocarcinoma. Interventions: The patient underwent systemic chemotherapy with cisplatin and S-1, radiotherapy to the metastatic bone, and treatment with denosumab. One year later, the huge metastatic tumor was resected, and the hand was reconstructed using vascularized scapular bone. Outcomes: Eighteen months postoperatively, the patient was satisfied with the appearance of the reconstructed hand and was able to use his right thumb in activities of daily living. Lessons: Although rare, metastasis to the trapezium should be considered in patients with persistent and progressive thumb CMC joint pain. PMID:29390390

  8. Endothelial-to-Osteoblast Conversion Generates Osteoblastic Metastasis of Prostate Cancer.

    PubMed

    Lin, Song-Chang; Lee, Yu-Chen; Yu, Guoyu; Cheng, Chien-Jui; Zhou, Xin; Chu, Khoi; Murshed, Monzur; Le, Nhat-Tu; Baseler, Laura; Abe, Jun-Ichi; Fujiwara, Keigi; deCrombrugghe, Benoit; Logothetis, Christopher J; Gallick, Gary E; Yu-Lee, Li-Yuan; Maity, Sankar N; Lin, Sue-Hwa

    2017-06-05

    Prostate cancer (PCa) bone metastasis is frequently associated with bone-forming lesions, but the source of the osteoblastic lesions remains unclear. We show that the tumor-induced bone derives partly from tumor-associated endothelial cells that have undergone endothelial-to-osteoblast (EC-to-OSB) conversion. The tumor-associated osteoblasts in PCa bone metastasis specimens and patient-derived xenografts (PDXs) were found to co-express endothelial marker Tie-2. BMP4, identified in PDX-conditioned medium, promoted EC-to-OSB conversion of 2H11 endothelial cells. BMP4 overexpression in non-osteogenic C4-2b PCa cells led to ectopic bone formation under subcutaneous implantation. Tumor-induced bone was reduced in trigenic mice (Tie2 cre /Osx f/f /SCID) with endothelial-specific deletion of osteoblast cell-fate determinant OSX compared with bigenic mice (Osx f/f /SCID). Thus, tumor-induced EC-to-OSB conversion is one mechanism that leads to osteoblastic bone metastasis of PCa. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Natural History of Malignant Bone Disease in Gastric Cancer: Final Results of a Multicenter Bone Metastasis Survey

    PubMed Central

    Silvestris, Nicola; Pantano, Francesco; Ibrahim, Toni; Gamucci, Teresa; De Vita, Fernando; Di Palma, Teresa; Pedrazzoli, Paolo; Barni, Sandro; Bernardo, Antonio; Febbraro, Antonio; Satolli, Maria Antonietta; Bertocchi, Paola; Catalano, Vincenzo; Giommoni, Elisa; Comandone, Alessandro; Maiello, Evaristo; Riccardi, Ferdinando; Ferrara, Raimondo; Trogu, Antonio; Berardi, Rossana; Leo, Silvana; Bertolini, Alessandro; Angelini, Francesco; Cinieri, Saverio; Russo, Antonio; Pisconti, Salvatore; Brunetti, Anna Elisabetta; Azzariti, Amalia; Santini, Daniele

    2013-01-01

    Background Bone metastasis represents an increasing clinical problem in advanced gastric cancer (GC) as disease-related survival improves. In literature, few data on the natural history of bone disease in GC are available. Patients and Methods Data on clinicopathology, skeletal outcomes, skeletal-related events (SREs), and bone-directed therapies for 208 deceased GC patients with evidence of bone metastasis were statistically analyzed. Results Median time to bone metastasis was 8 months (CI 95%, 6.125–9.875 months) considering all included patients. Median number of SREs/patient was one. Less than half of the patients (31%) experienced at least one and only 4 and 2% experienced at least two and three events, respectively. Median times to first and second SRE were 2 and 4 months, respectively. Median survival was 6 months after bone metastasis diagnosis and 3 months after first SRE. Median survival in patients who did not experience SREs was 5 months. Among patients who received zoledronic acid before the first SRE, the median time to appearance of first SRE was significantly prolonged compared to control (7 months vs 4 months for control; P: 0.0005). Conclusions To our knowledge, this retrospective analysis is the largest multicenter study to demonstrate that bone metastases from GC are not so rare, are commonly aggressive and result in relatively early onset of SREs in the majority of patients. Indeed, our large study, which included 90 patients treated with ZOL, showed, for the first time in literature, a significant extension of time to first SRE and increase in the median survival time after diagnosis of bone metastasis. Taken together, these data may support the beneficial effects of ZOL in GC patients. PMID:24204569

  10. Disseminated Skeletal Muscle and Cardiac Metastasis from Squamous Cell Carcinoma of the Lung Detected with FDG and FLT PET/CT.

    PubMed

    Jain, Tarun Kumar; Rayamajhi, Sampanna Jung; Basher, Rajender Kumar; Gupta, Dheeraj; Maturu, Venkata Nagarjuna; Mittal, Bhagwant Rai

    2016-09-01

    Lung cancer is one of the leading cancers all over the world. Positron emission tomography (PET) using 18F fluorodeoxyglucose (18F FDG) is useful for staging of the disease and decide the appropriate management. 3'-deoxy-3'-18 F-fluorothymidine (18F FLT) is a tracer being extensively evaluated currently and is said to represent tumor proliferation. Common sites of metastases from lung cancer include adrenal glands, bone, and brain. Muscle metastasis and cardiac metastasis are uncommon findings. We report a case of squamous cell carcinoma of the lung with metastases to multiple skeletal muscles and myocardium detected with both FDG and FLT PET/computed tomography (CT).

  11. Disseminated Skeletal Muscle and Cardiac Metastasis from Squamous Cell Carcinoma of the Lung Detected with FDG and FLT PET/CT

    PubMed Central

    Jain, Tarun Kumar; Rayamajhi, Sampanna Jung; Basher, Rajender Kumar; Gupta, Dheeraj; Maturu, Venkata Nagarjuna; Mittal, Bhagwant Rai

    2016-01-01

    Lung cancer is one of the leading cancers all over the world. Positron emission tomography (PET) using 18F fluorodeoxyglucose (18F FDG) is useful for staging of the disease and decide the appropriate management. 3’-deoxy-3’-18 F-fluorothymidine (18F FLT) is a tracer being extensively evaluated currently and is said to represent tumor proliferation. Common sites of metastases from lung cancer include adrenal glands, bone, and brain. Muscle metastasis and cardiac metastasis are uncommon findings. We report a case of squamous cell carcinoma of the lung with metastases to multiple skeletal muscles and myocardium detected with both FDG and FLT PET/computed tomography (CT). PMID:27651747

  12. A tissue-engineered humanized xenograft model of human breast cancer metastasis to bone

    PubMed Central

    Thibaudeau, Laure; Taubenberger, Anna V.; Holzapfel, Boris M.; Quent, Verena M.; Fuehrmann, Tobias; Hesami, Parisa; Brown, Toby D.; Dalton, Paul D.; Power, Carl A.; Hollier, Brett G.; Hutmacher, Dietmar W.

    2014-01-01

    ABSTRACT The skeleton is a preferred homing site for breast cancer metastasis. To date, treatment options for patients with bone metastases are mostly palliative and the disease is still incurable. Indeed, key mechanisms involved in breast cancer osteotropism are still only partially understood due to the lack of suitable animal models to mimic metastasis of human tumor cells to a human bone microenvironment. In the presented study, we investigate the use of a human tissue-engineered bone construct to develop a humanized xenograft model of breast cancer-induced bone metastasis in a murine host. Primary human osteoblastic cell-seeded melt electrospun scaffolds in combination with recombinant human bone morphogenetic protein 7 were implanted subcutaneously in non-obese diabetic/severe combined immunodeficient mice. The tissue-engineered constructs led to the formation of a morphologically intact ‘organ’ bone incorporating a high amount of mineralized tissue, live osteocytes and bone marrow spaces. The newly formed bone was largely humanized, as indicated by the incorporation of human bone cells and human-derived matrix proteins. After intracardiac injection, the dissemination of luciferase-expressing human breast cancer cell lines to the humanized bone ossicles was detected by bioluminescent imaging. Histological analysis revealed the presence of metastases with clear osteolysis in the newly formed bone. Thus, human tissue-engineered bone constructs can be applied efficiently as a target tissue for human breast cancer cells injected into the blood circulation and replicate the osteolytic phenotype associated with breast cancer-induced bone lesions. In conclusion, we have developed an appropriate model for investigation of species-specific mechanisms of human breast cancer-related bone metastasis in vivo. PMID:24713276

  13. Surgery of primary tumour has survival benefit in metastatic breast cancer with single-organ metastasis, especially bone.

    PubMed

    Rhu, Jinsoo; Lee, Se Kyung; Kil, Won Ho; Lee, Jeong Eon; Nam, Seok Jin

    2015-04-01

    Surgery for the primary breast tumour is usually not recommended in metastatic breast cancer (MBC); however, some reports have suggested a benefit of locoregional treatment. We designed this study to evaluate the efficacy of locoregional surgery in MBC. Data for patients diagnosed with MBC at Samsung Medical Center between 1995 and 2011 were retrospectively collected. We compared the survival benefit of all treatment modalities using Cox regression analysis. Subgroup analyses based on number of metastases were performed to delineate the indication for each treatment. Among 262 patients, 40 (15.3%) underwent surgery. Other treatments included chemotherapy (n = 213, 81.3%), radiotherapy (n = 138, 52.7%), hormone therapy (n = 118, 45.0%) and HER2/neu receptor (HER2)-targeted therapy (n = 37, 14.1%). Cox regression analysis showed that surgery (hazard ratios (HR) = 0.51, P < 0.01), hormone therapy (HR = 0.31, P < 0.01) and HER2-targeted therapy (HR = 0.33, P < 0.01) were associated with improved survival, whereas presence of three or more metastatic organs (HR = 1.62, P = 0.03) was associated with poor survival. In patients with metastasis to a single organ, surgery (HR = 0.43, P < 0.01), chemotherapy (HR = 0.62, P = 0.05), hormone therapy (HR = 0.39, P < 0.01) and HER2-targeted therapy (HR = 0.39, P = 0.02) had a survival benefit. Furthermore, for patients with bone-only metastasis, surgery (HR = 0.37, P = 0.02), chemotherapy (HR = 0.42, P < 0.01), hormone therapy (HR = 0.22, P < 0.01) and HER2-targeted therapy (HR = 0.09, P = 0.02) showed a survival benefit. However, only hormone therapy and HER2-targeted therapy had a survival benefit in MBC with metastasis to multiple organs. Surgical control of the primary breast tumour should be considered as a locoregional therapy in combination with systemic therapy in MBC with metastasis to a single organ, especially bone-only metastasis.

  14. Microangiopathic hemolytic anemia associated with metastatic breast cancer: case report and literature review.

    PubMed

    Takabatake, Daisuke; Oishi, Kazuyuki

    2016-01-01

    Microangiopathic hemolytic anemia (MAHA) is a mechanical hemolytic anemia characterized by the emergence of fragmented red cells in peripheral blood. Here, we report a case of breast cancer associated with cancer-related (CR)-MAHA along with a literature review. The patient was a 54-year-old woman who made an emergency visit to our hospital because of low back pain, shoulder pain, visual impairment, and anemia. She was diagnosed with stage IV, ER-positive, PgR-positive, HER2-negative left breast cancer (invasive lobular carcinoma), with left axillary adenopathy, metastasis to the soft tissue of the orbital region, multiple bone metastases, pleural dissemination, and metastasis to the stomach and para-aortic lymph nodes. Chemotherapy was initiated successfully; tumor marker levels normalized and the visceral metastases almost disappeared. Hormone therapy was administered for maintenance. Two and a half years later, rapid elevation in tumor marker levels and severe anemia were noted, and fragmented red cells and poikilocytes emerged in the peripheral blood. Positron emission tomography-computed tomography and bone scintigraphy revealed multiple bone metastases, but no evidence of visceral metastasis. CR-MAHA associated with multiple bone metastases was diagnosed, and Paclitaxel chemotherapy was initiated with frequent blood transfusions. Her anemia gradually improved, with a decrease in tumor marker levels and the number of blood transfusions. Three months later, tumor marker levels increased again. Because the anemia was also exacerbated, chemotherapy was changed to eribulin. Tumor marker levels temporally decreased, and the anemia tended to improve, but 3 months later, the levels were elevated again and the anemia was exacerbated. A switch to another regimen was planned, but best supportive care was chosen instead because of rapid deterioration of liver function. The patient died a month later. CR-MAHA is thought to have a different pathologic mechanism from TTP or HUS. Although CR-MAHA is a clinical condition associated with a very poor prognosis, we consider it controllable for long period by rapid introduction of chemotherapy in many cases. CR-MAHA is a nearly oncologic emergency that medical oncologists need to be able to recognize even though it rarely occurs in breast cancer.

  15. [Breast cancer metastasis in distal phalanx of the big toe. Case report].

    PubMed

    Carlesimo, B; Tempesta, M; Fioramonti, P; Bistoni, G; Ruggiero, M; Marchetti, F

    2009-01-01

    Breast cancer represents the most prevalent malignancies in women and bone is the first site of metastasis in 26-50% of cases. Usually metastasis involve limbs in 16%. We present a rare case of 47-year-old woman, who underwent to monolateral mastectomy for lobular cancer. After 8 years from surgery, she presented pain, swelling and functional limitations, gradually increasing, to the left big toe. X-rays and MRI showed a lucent area of bone destruction on the shaft of the distal phalanx of the left big toe. Surgical biopsy on the excised bone assessed for breast cancer metastasis.

  16. Progress in the research on the mechanism of bone metastasis in lung cancer

    PubMed Central

    Luo, Qinqin; Xu, Zhenye; Wang, Lifang; Ruan, Mingyu; Jin, Guiyu

    2016-01-01

    Lung cancer is still the predominant cause of cancer-associated mortality worldwide. The bone metastasis of lung cancer brings great suffering to the patient. Previous advances have provided insights into the mechanism of bone metastasis. Previous research has investigated lung cancer stem cells and three steps were determined for the lung cancer cells to metastasize to the bone: i) Escaping from the primary tumor; ii) moving in the circulation; iii) colonizing in the bone. Key molecules are involved in each of these process. Although there is a close association and similarity, dynamic microenvironments affect these processes. The receptor activator of nuclear factor-κB (RANK)/RANKL axis serves a vital role in the regulation of the generation and activation of osteoclasts during the osteolytic lesion. However, the specific molecules for the lung cancer cells to metastasize to the bone require further research and exploration. The present study aimed to investigate the relative molecular mechanisms of bone metastasis in lung cancer in recent years, providing a general understanding about the features of lung cancer preferences to bone, and discussing other things that require investigation. PMID:27446555

  17. Raman spectroscopy of bone metastasis

    NASA Astrophysics Data System (ADS)

    Esmonde-White, Karen A.; Sottnik, Joseph; Morris, Michael; Keller, Evan

    2012-02-01

    Raman spectroscopy of bone has been used to characterize chemical changes occurring in diseases such as osteoporosis, osteoarthritis and osteomyelitis. Metastasis of cancer into bone causes changes to bone quality that are similar to those observed in osteoporosis, such as decreased bone strength, but with an accelerated timeframe. In particular, osteolytic (bone degrading) lesions in bone metastasis have a marked effect on patient quality of life because of increased risk of fractures, pain, and hypercalcemia. We use Raman spectroscopy to examine bone from two different mouse models of osteolytic bone metastasis. Raman spectroscopy measures physicochemical information which cannot be obtained through standard biochemical and histological measurements. This study was reviewed and approved by the University of Michigan University Committee on the Care and Use of Animals. Two mouse models of prostate cancer bone metastasis, RM1 (n=3) and PC3-luc (n=4) were examined. Tibiae were injected with RM1 or PC3-luc cancer cells, while the contralateral tibiae received a placebo injection for use as controls. After 2 weeks of incubation, the mice were sacrificed and the tibiae were examined by Raman microspectroscopy (λ=785 nm). Spectroscopic markers corresponding to mineral stoichiometry, bone mineralization, and mineral crystallinity were compared in spectra from the cancerous and control tibiae. X-ray imaging of the tibia confirmed extensive osteolysis in the RM1 mice, with tumor invasion into adjoining soft tissue and moderate osteolysis in the PC3-luc mice. Raman spectroscopic markers indicate that osteolytic lesions are less mineralized than normal bone tissue, with an altered mineral stoichiometry and crystallinity.

  18. The incidence of bone metastasis after early-stage breast cancer in Canada.

    PubMed

    Liede, Alexander; Jerzak, Katarzyna J; Hernandez, Rohini K; Wade, Sally W; Sun, Ping; Narod, Steven A

    2016-04-01

    Current information on the incidence and prevalence of bone metastases in women with breast cancer is scarce. This study examined the occurrence and predictors of bone metastases, as well as post-metastasis survival in a prospective cohort of Canadian women with breast cancer. We included women treated for early-stage (stage I, II, or III) breast cancer at the Henrietta Banting Breast Centre (HBBC) in Toronto, Canada between 1987 and 2000. Data were abstracted from medical records and pathology reports in the HBBC database; follow-up extended to end of data availability or August 31, 2015. Actuarial survival analyses provided cumulative incidence of bone metastases at 5, 10, and 15 years after breast cancer diagnosis. Kaplan-Meier curves describe breast cancer mortality. Regression models assessed patient, tumor, and treatment characteristics as predictors of bone metastases with all-cause mortality as a competing risk. Among 2097 women studied, the 5-, 10-, and 15-year probability of bone metastasis was 6.5, 10.3, and 11.3 % for the first recurrence, and 8.4, 12.5, and 13.6 % for any bone recurrence. At median follow-up (12.5 years), 13.2 % of patients had bone metastases. Median survival was 1.6 years following bone metastasis, and shorter if both bone and visceral metastases occurred. Advanced age and adjuvant treatment with tamoxifen were protective against bone metastasis. In this representative cohort of women diagnosed with early-stage breast cancer in Ontario, Canada, with long follow-up, the incidence of bone metastases was consistent with longitudinal studies from the United Kingdom, Denmark, and the US.

  19. Notch Signaling in Prostate Cancer Cells Promotes Osteoblastic Metastasis

    DTIC Science & Technology

    2017-06-01

    in the tumor- bone microenvironment. Conversely, inhibition of Notch3 in PC3, 22rv1 and C42B cells with shRNA, promoted prostate cancer–induced...metastasis and thus may be a therapeutic target for such metastatic lesions. 15. SUBJECT TERMS Prostate Cancer; Notch3; MMP3; Bone -Tumor microenvironment...9 4 1. Introduction: To address the clinical problem of disease progression in prostate cancer- induced bone metastasis, the

  20. Engineering a biomimetic three-dimensional nanostructured bone model for breast cancer bone metastasis study.

    PubMed

    Zhu, Wei; Wang, Mian; Fu, Yebo; Castro, Nathan J; Fu, Sidney W; Zhang, Lijie Grace

    2015-03-01

    Traditional breast cancer (BrCa) bone metastasis models contain many limitations with regards to controllability, reproducibility and flexibility of design. In this study, a novel biomimetic bone microenvironment was created by integrating hydroxyapatite (HA) and native bioactive factors deposited by osteogenic induction of human bone marrow mesenchymal stem cells (MSCs) within a cytocompatible chitosan hydrogel. It was found that a 10% nanocrystalline HA (nHA) chitosan scaffold exhibited the highest BrCa adhesion and proliferation when compared to chitosan scaffolds with 20% nHA, 10% and 20% microcrystalline HA as well as amorphous HA. This 3-D tunable bone scaffold can provide a biologically relevant environment, increase cell-cell and cell-matrix interactions as found in native bone, and retain the behavior of BrCa cells with different metastasis potential (i.e. highly metastatic MDA-MB-231, less metastatic MCF-7 and transfected MDA-MB-231). The co-culture of MSCs and MDA-MB-231 in this bone model illustrated that MSCs have the capacity to upregulate the expression of the well-known metastasis-associated gene metadherin within BrCa cells. In summary, this study illustrates the ability of our 3-D bone model to create a biomimetic environment conducive to recapitulating the behavior of metastatic BrCa cells, making it a promising tool for in vitro BrCa cell bone metastasis study and for the discovery of potential therapeutics. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  1. A New In Vitro Model of Breast Cancer Metastasis to Bone

    DTIC Science & Technology

    2009-04-01

    videomicroscopy [11, 12] have revealed that early stage, pre-angiogenic interactions between the cancer cells and the bone environment are crucial regulators of...1995) Steps in tumor metastasis: new concepts from intravital videomicroscopy . Cancer Metastasis Rev 14:279–301. doi:10.1007/BF00690599 12. Chambers AF

  2. Testicular choriocarcinoma with cutaneous metastasis in a 19-year-old man.

    PubMed

    Toberer, Ferdinand; Enk, Alexander; Hartschuh, Wolfgang; Grüllich, Carsten

    2018-07-01

    A 19-year-old man suffering from testicular choriocarcinoma presented to the dermatology department with a cutaneous metastasis on his head. This metastasis was the first sign of disease that led to medical consultation. Histopathology revealed cytotrophoblasts and syncytiotrophoblasts, the later expressing human chorionic gonadotropin antigen. Whole body computed tomography showed multiple metastases of the brain, lung, liver, bone, paraaortic lymph nodes and left uvea; the primary was found in the left testicle. Despite neurosurgical intervention and chemotherapy the patient died 9 days after the biopsy of the cutaneous metastasis. Cutaneous metastases of testicular choriocarcinoma are exceptionally rare, with fewer than a dozen cases reported in the English-language literature. The present case highlights that testicular choriocarcinoma metastatic to the skin should be included in the differential of cutaneous scalp tumors. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. False-Positive Cases of Fluorodeoxyglucose-Positron Emission Tomography/Computed Tomographic Scans in Metastasis of Esophageal Cancer

    PubMed Central

    Yamatsuji, Tomoki; Ishida, Naomasa; Takaoka, Munenori; Hayashi, Jiro; Yoshida, Kazuhiro; Shigemitsu, Kaori; Urakami, Atsushi; Haisa, Minoru; Naomoto, Yoshio

    2017-01-01

    Of 129 esophagectomies at our institute from June 2010 to March 2015, we experienced three preoperative positron emission tomography-computed tomographic (PET/CT) false positives. Bone metastasis was originally suspected in 2 cases, but they were later found to be bone metastasis negative after a preoperative bone biopsy and clinical course observation. The other cases suspected of mediastinal lymph node metastasis were diagnosed as inflammatory lymphadenopathy by a pathological examination of the removed lymph nodes. Conducting a PET/CT is useful when diagnosing esophageal cancer metastasis, but we need to be aware of the possibility of false positives. Therapeutic decisions should be made based on appropriate and accurate diagnoses, with pathological diagnosis actively introduced if necessary. PMID:28469502

  4. Inhibition effects of total flavonoids from Scutellaria barbata D. Don on human breast carcinoma bone metastasis via downregulating PTHrP pathway

    PubMed Central

    Liu, Huihui; Guo, Shanyu

    2018-01-01

    It is abundantly clear that tumor-derived parathyroid hormone-related protein (PTHrP), receptor activator of nuclear factor-κB ligand (RANKL) and osteoprotegerin (OPG) are central contributors in promoting osteolytic process of breast carcinoma bone metastasis. Forcusing on this molecular basis, the study was undertaken to explore the inhibition effects of total flavonoids from Scutellaria barbata D. Don (TF-SB) on human breast carcinoma bone metastasis. MDA-MB-231 cells and nude mouse models of breast cancer bone metastasis were given TF-SB in different concentrations. The proliferation, migration and invasion potentials of MDA-MB-231 cells were respectively tested. The effects of TF-SB on tumor weights and bone destruction were investigated. The mRNA and protein expression of PTHrP, OPG and RANKL were assessed by qPCR and western blot analysis. In vitro, TF-SB inhibited the proliferation, migration and invasion of MDA-MB-231 cells in a dose-dependent manner. In vivo, TF-SB prevented bone metastasis of breast cancer by decreasing the number of osteoclast cells per field in a dose-dependent manner, but not affecting tumor growth or mouse survival. Molecular analysis revealed that TF-SB controled the secretion of osteolysis-related factors PTHrP and its downstream RANKL/OPG. Together, by controlling the expression of PTHrP and its downstream OPG/RANKL, TF-SB has significant inhibition effects on breast cancer bone metastasis, which indicates a new therapeutic method. PMID:29512770

  5. Clinical Features and Risk Factors of Skeletal-Related Events in Genitourinary Cancer Patients with Bone Metastasis: A Retrospective Analysis of Prostate Cancer, Renal Cell Carcinoma, and Urothelial Carcinoma.

    PubMed

    Owari, Takuya; Miyake, Makito; Nakai, Yasushi; Morizawa, Yosuke; Itami, Yoshitaka; Hori, Shunta; Anai, Satoshi; Tanaka, Nobumichi; Fujimoto, Kiyohide

    2018-06-06

    The objective of the present study was to report the incidence of skeletal-related events (SREs) and identify risk factors for SREs in patients with genitourinary cancer with newly diagnosed bone metastasis. This retrospective study included 180 patients with bone metastasis from prostate cancer (PCa; n = 111), renal cell carcinoma (RCC; n = 43), and urothelial carcinoma (UC; n = 26). Clinical factors at the time of diagnosis of bone metastasis were evaluated with Cox proportional hazards regression analysis to identify independent risk factors for SREs. During follow-up, 29 (26%) patients with PCa, 30 (70%) with RCC, and 15 (58%) with UC developed SREs. Treatment with bone-modifying agents (BMAs) before the development of SREs and within 6 months from the diagnosis of bone metastasis significantly delayed the time to first SRE as compared to nonuse of BMAs. Multivariate analysis identified type of primary cancer (PCa vs. RCC, PCa vs. UC), performance status, and bone pain as significant independent predictive risk factors for SREs. Treatment with BMAs significantly delayed the development of first SREs. The identified predictors of SREs might be useful to select patients who would benefit most from early treatment with BMAs. © 2018 S. Karger AG, Basel.

  6. ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling

    PubMed Central

    Masuda, Tetsuro; Endo, Motoyoshi; Yamamoto, Yutaka; Odagiri, Haruki; Kadomatsu, Tsuyoshi; Nakamura, Takayuki; Tanoue, Hironori; Ito, Hitoshi; Yugami, Masaki; Miyata, Keishi; Morinaga, Jun; Horiguchi, Haruki; Motokawa, Ikuyo; Terada, Kazutoyo; Morioka, Masaki Suimye; Manabe, Ichiro; Iwase, Hirotaka; Mizuta, Hiroshi; Oike, Yuichi

    2015-01-01

    Bone metastasis of breast cancer cells is a major concern, as it causes increased morbidity and mortality in patients. Bone tissue-derived CXCL12 preferentially recruits breast cancer cells expressing CXCR4 to bone metastatic sites. Thus, understanding how CXCR4 expression is regulated in breast cancer cells could suggest approaches to decrease bone metastasis of breast tumor cells. Here, we show that tumor cell-derived angiopoietin-like protein 2 (ANGPTL2) increases responsiveness of breast cancer cells to CXCL12 by promoting up-regulation of CXCR4 in those cells. In addition, we used a xenograft mouse model established by intracardiac injection of tumor cells to show that ANGPTL2 knockdown in breast cancer cells attenuates tumor cell responsiveness to CXCL12 by decreasing CXCR4 expression in those cells, thereby decreasing bone metastasis. Finally, we found that ANGPTL2 and CXCR4 expression levels within primary tumor tissues from breast cancer patients are positively correlated. We conclude that tumor cell-derived ANGPTL2 may increase bone metastasis by enhancing breast tumor cell responsiveness to CXCL12 signaling through up-regulation of tumor cell CXCR4 expression. These findings may suggest novel therapeutic approaches to treat metastatic breast cancer. PMID:25773070

  7. Intraocular extramedullary plasmacytoma in a cat.

    PubMed

    Michau, Tammy Miller; Proulx, David R; Rushton, Steven D; Olivry, Thierry; Dunston, Stanley M; Gilger, Brian C; Davidson, Michael G

    2003-06-01

    An 8-year-old, castrated male Domestic Short-haired cat was referred for evaluation of a possible intraocular neoplasm following previous ocular trauma. The eye was blind, and uveitis and an iridal mass were noted on examination. An enucleation was performed and the mandibular lymph node excised. Histopathologic examination revealed neoplastic proliferation of plasma cells in the iris and lymph node. No other evidence of disseminated disease was detected. This is the first case reported of an intraocular extramedullary plasmacytoma in the cat. The variation in clinical manifestations and potential association with multiple myeloma are not known at this time. Disseminated metastasis from a primary plasmacytoma of the uveal tract could also involve the bone marrow and be indistinguishable from multiple myeloma. Early enucleation, as in trauma-associated sarcomas, may be indicated to prevent metastasis. Periodic systemic evaluation for evidence of multiple myeloma should be performed.

  8. Massive trapezial metastasis from gastric adenocarcinoma resected and reconstructed with a vascularized scapular bone graft: A case report.

    PubMed

    Okamoto, Masanori; Yamazaki, Hiroshi; Yoshimura, Yasuo; Aoki, Kaoru; Tanaka, Atsushi; Kato, Hiroyuki

    2017-12-01

    Isolated metastasis to the hand bones is very rare. Only seven cases of metastasis to the trapezium have been reported. To the best of our knowledge, this is the first report of a single metastasis to the trapezium from a gastric adenocarcinoma. A 62-year-old man presented with pain and massive swelling in the right carpometacarpal joint of the thumb. The patient was diagnosed with trapezial metastasis of advanced gastric adenocarcinoma. The patient underwent systemic chemotherapy with cisplatin and S-1, radiotherapy to the metastatic bone, and treatment with denosumab. One year later, the huge metastatic tumor was resected, and the hand was reconstructed using vascularized scapular bone. Eighteen months postoperatively, the patient was satisfied with the appearance of the reconstructed hand and was able to use his right thumb in activities of daily living. Although rare, metastasis to the trapezium should be considered in patients with persistent and progressive thumb CMC joint pain. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  9. XCR1 promotes cell growth and migration and is correlated with bone metastasis in non-small cell lung cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Ting; Han, Shuai; Wu, Zhipeng

    Bone metastasis occurs in approximately 30–40% patients with advanced non-small cell lung cancer (NSCLC), but the mechanism underlying this bone metastasis remains poorly understood. The chemokine super family is believed to play an important role in tumor metastasis in lung cancer. The chemokine receptor XCR1 has been identified to promote cell proliferation and migration in oral cancer and ovarian carcinoma, but the role of XCR1 in lung cancer has not been reported. In this study, we demonstrated for the first time that XCR1 was overexpressed in lung cancer bone metastasis as compared with that in patients with primary lung cancer.more » In addition, the XCR1 ligand XCL1 promoted the proliferation and migration of lung cancer cells markedly, and knockdown of XCR1 by siRNA abolished the effect of XCL1 in cell proliferation and migration. Furthermore, we identified JAK2/STAT3 as a novel downstream pathway of XCR1, while XCL1/XCR1 increased the mRNA level of the downstream of JAK2/STAT3 including PIM1, JunB, TTP, MMP2 and MMP9. These results indicate that XCR1 is a new potential therapeutic target for the treatment of lung cancer bone metastasis. - Highlights: • XCR1 is overexpressed in bone metastasis compared with primary NSCLC. • XCR1 activation by XCL1 promotes lung cancer cell proliferation and migration. • JAK2/STAT3 is a novel potential downstream pathway of XCR1.« less

  10. An in vitro 3D bone metastasis model by using a human bone tissue culture and human sex-related cancer cells.

    PubMed

    Salamanna, Francesca; Borsari, Veronica; Brogini, Silvia; Giavaresi, Gianluca; Parrilli, Annapaola; Cepollaro, Simona; Cadossi, Matteo; Martini, Lucia; Mazzotti, Antonio; Fini, Milena

    2016-11-22

    One of the main limitations, when studying cancer-bone metastasis, is the complex nature of the native bone environment and the lack of reliable, simple, inexpensive models that closely mimic the biological processes occurring in patients and allowing the correct translation of results. To enhance the understanding of the mechanisms underlying human bone metastases and in order to find new therapies, we developed an in vitro three-dimensional (3D) cancer-bone metastasis model by culturing human breast or prostate cancer cells with human bone tissue isolated from female and male patients, respectively. Bone tissue discarded from total hip replacement surgery was cultured in a rolling apparatus system in a normoxic or hypoxic environment. Gene expression profile, protein levels, histological, immunohistochemical and four-dimensional (4D) micro-CT analyses showed a noticeable specificity of breast and prostate cancer cells for bone colonization and ingrowth, thus highlighting the species-specific and sex-specific osteotropism and the need to widen the current knowledge on cancer-bone metastasis spread in human bone tissues. The results of this study support the application of this model in preclinical studies on bone metastases and also follow the 3R principles, the guiding principles, aimed at replacing/reducing/refining (3R) animal use and their suffering for scientific purposes.

  11. An in vitro 3D bone metastasis model by using a human bone tissue culture and human sex-related cancer cells

    PubMed Central

    Salamanna, Francesca; Borsari, Veronica; Brogini, Silvia; Giavaresi, Gianluca; Parrilli, Annapaola; Cepollaro, Simona; Cadossi, Matteo; Martini, Lucia; Mazzotti, Antonio; Fini, Milena

    2016-01-01

    One of the main limitations, when studying cancer-bone metastasis, is the complex nature of the native bone environment and the lack of reliable, simple, inexpensive models that closely mimic the biological processes occurring in patients and allowing the correct translation of results. To enhance the understanding of the mechanisms underlying human bone metastases and in order to find new therapies, we developed an in vitro three-dimensional (3D) cancer-bone metastasis model by culturing human breast or prostate cancer cells with human bone tissue isolated from female and male patients, respectively. Bone tissue discarded from total hip replacement surgery was cultured in a rolling apparatus system in a normoxic or hypoxic environment. Gene expression profile, protein levels, histological, immunohistochemical and four-dimensional (4D) micro-CT analyses showed a noticeable specificity of breast and prostate cancer cells for bone colonization and ingrowth, thus highlighting the species-specific and sex-specific osteotropism and the need to widen the current knowledge on cancer-bone metastasis spread in human bone tissues. The results of this study support the application of this model in preclinical studies on bone metastases and also follow the 3R principles, the guiding principles, aimed at replacing/reducing/refining (3R) animal use and their suffering for scientific purposes. PMID:27765913

  12. A 3D printed nano bone matrix for characterization of breast cancer cell and osteoblast interactions

    NASA Astrophysics Data System (ADS)

    Zhu, Wei; Castro, Nathan J.; Cui, Haitao; Zhou, Xuan; Boualam, Benchaa; McGrane, Robert; Glazer, Robert I.; Zhang, Lijie Grace

    2016-08-01

    Bone metastasis is one of the most prevalent complications of late-stage breast cancer, in which the native bone matrix components, including osteoblasts, are intimately involved in tumor progression. The development of a successful in vitro model would greatly facilitate understanding the underlying mechanism of breast cancer bone invasion as well as provide a tool for effective discovery of novel therapeutic strategies. In the current study, we fabricated a series of in vitro bone matrices composed of a polyethylene glycol hydrogel and nanocrystalline hydroxyapatite of varying concentrations to mimic the native bone microenvironment for the investigation of breast cancer bone metastasis. A stereolithography-based three-dimensional (3D) printer was used to fabricate the bone matrices with precisely controlled architecture. The interaction between breast cancer cells and osteoblasts was investigated in the optimized bone matrix. Using a Transwell® system to separate the two cell lines, breast cancer cells inhibited osteoblast proliferation, while osteoblasts stimulated breast cancer cell growth, whereas, both cell lines increased IL-8 secretion. Breast cancer cells co-cultured with osteoblasts within the 3D bone matrix formed multi-cellular spheroids in comparison to two-dimensional monolayers. These findings validate the use of our 3D printed bone matrices as an in vitro metastasis model, and highlights their potential for investigating breast cancer bone metastasis.

  13. Painful bone metastasis in elderly treated with radiation therapy: Single- or multiple-fraction regimen? A multicentre retrospective observational analysis.

    PubMed

    Falivene, S; Pezzulla, D; Di Franco, R; Giugliano, F M; Esposito, E; Scoglio, C; Amato, B; Borzillo, V; D'Aiuto, M; Muto, P

    2017-02-01

    Bone metastases are a frequent complication of advanced oncologic disease. Pain associated to bone metastasis is a major cause of morbidity in cancer patients, especially in elderly. The aim of this multicentric retrospective observational study is to evaluate the efficacy of different schedules of radiation therapy in elderly patients in terms of pain relief. 206 patients over the age of 60 were enrolled in 1 year time for a multicentre retrospective observational study. Patients were treated with palliative purposes for painful bone metastases. Pain intensity difference (PID) was found in 72% of patients. Reported PID was statistically significant for p < 0.01. Pain intensity measured by a point numeric rating scale was statistically significant reduced for p < 0.05 by one-fraction regimen compared to other two regimens. In recent years, numerous studies have evaluated the most appropriate regimen of fractionation in individual cases, despite this, a consensus about the best schedule is still debated. On our analysis, single-fractionation scheme (8 Gy) confirmed to be statistical significant effective in providing pain reduction due to bone metastases. Radiation therapy provides significant pain relief of symptomatic bone metastases, but appropriate radiotherapy scheduled is needed in order to get significant response to treatment. Multidisciplinary approach is warranted to value the balance between the therapeutic objectives and the patient quality of life.

  14. Protocadherin-7 induces bone metastasis of breast cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Ai-Min; Tian, Ai-Xian; Zhang, Rui-Xue

    2013-07-05

    Highlights: •PCDH7 is overexpression in high bone metastatic MDA-MB-231 cells. •PCDH7 is up-regulation in bone metastatic breast cancer tissues. •Suppression of PCDH7 inhibits cell proliferation, migration, and invasion in vitro. •PCDH7 induces breast cancer bone metastasis in vivo. -- Abstract: Breast cancer had a propensity to metastasize to bone, resulting in serious skeletal complications associated with poor outcome. Previous study showed that Protocadherin-7 (PCDH7) play an important role in brain metastatic breast cancer, however, the role of PCDH7 in bone metastatic breast cancer has never been explored. In the present study, we found that PCDH7 expression was up-regulation in bonemore » metastatic breast cancer tissues by real-time PCR and immunohistochemistry assays. Furthermore, suppression of PCDH7 inhibits breast cancer cell proliferation, migration, and invasion in vitro by MTT, scratch, and transwell assays. Most importantly, overexpression of PCDH7 promotes breast cancer cell proliferation and invasion in vitro, and formation of bone metastasis in vivo. These data provide an important insight into the role of PCDH7 in bone metastasis of breast cancer.« less

  15. The type 1 lysophosphatidic acid receptor is a target for therapy in bone metastases

    PubMed Central

    Boucharaba, Ahmed; Serre, Claire-Marie; Guglielmi, Julien; Bordet, Jean-Claude; Clézardin, Philippe; Peyruchaud, Olivier

    2006-01-01

    Platelet-derived lysophosphatidic acid (LPA) supports the progression of breast and ovarian cancer metastasis to bone. The mechanisms through which LPA promotes bone metastasis formation are, however, unknown. Here we report that silencing of the type 1 LPA receptor (LPA1) in cancer cells blocks the production of tumor-derived cytokines that are potent activators of osteoclast-mediated bone destruction and significantly reduces the progression of osteolytic bone metastases. Moreover, functional blockade of LPA action on its cognate receptor LPA1 using a pharmacological antagonist mimics the effects of silencing LPA1 in tumor cells in vitro and substantially reduces bone metastasis progression in animals. Overall, these results suggest that inhibition of platelet-derived LPA action on LPA1 expressed by tumor cells may be a promising therapeutic target for patients with bone metastases. PMID:16769891

  16. 77 FR 47852 - Agency Information Collection Activities: Proposed Collection; Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-10

    ... Beneficiaries Receiving NaF-18 Positron Emission Tomography (PET) to Identify Bone Metastasis in Cancer; Use: In... NaF-18 PET scan to identify bone metastasis in cancer is reasonable and necessary only when the... strategy by the identification, location and quantification of bone [[Page 47853

  17. 75 FR 63484 - Agency Information Collection Activities: Proposed Collection; Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-15

    ... Bone Metastasis in Cancer; Use: In Decision Memorandum CAG-00065R, issued on February 26, 2010, the... that for Medicare beneficiaries receiving NaF-18 PET scan to identify bone metastasis in cancer is... or to guide subsequent treatment strategy by the identification, location and quantification of bone...

  18. Association of CA 15-3 and CEA with clinicopathological parameters in patients with metastatic breast cancer.

    PubMed

    Geng, Biao; Liang, Man-Man; Ye, Xiao-Bing; Zhao, Wen-Ying

    2015-01-01

    The objective of this study was to investigate the association of serum cancer antigen 15-3 (CA 15-3) and carcinoembryonic antigen (CEA) levels with clinicopathological parameters in patients diagnosed with metastatic breast cancer (MBC). We retrospectively evaluated the medical records of 284 patients diagnosed with MBC between January, 2007 and December, 2012 who fulfilled the specified criteria and the association between the levels of the two tumor marker and clinicopathological parameters was analyzed. Of the 284 patients, elevated CA 15-3 and CEA levels at initial diagnosis of recurrence were identified in 163 (57.4%) and 97 (34.2%) patients, respectively. Elevated CA 15-3 and CEA levels were significantly associated with breast cancer molecular subtypes (P<0.001 and P=0.032, respectively). Cases with luminal subtypes exhibited a higher percentage of elevated CA 15-3 and CEA levels compared to non-luminal subtypes. Elevated CA 15-3 level was correlated with bone metastasis (P=0.017). However, elevation of CEA was observed regardless of the site of metastasis. Elevation of CA 15-3 was significantly more common in MBC with multiple metastatic sites compared to MBC with a single metastasis (P=0.001). However, the incidence of elevated CEA levels did not differ between patients with a single and those with multiple metastatic sites. In conclusion, elevated CA 15-3 and CEA levels at initial diagnosis of recurrence were found to be associated with breast cancer molecular subtypes, whereas an elevated CA 15-3 level was significantly correlated with bone metastasis and an elevated CEA level was observed regardless of metastatic site. The proportion of MBC cases with elevated CA 15-3 levels differed according to the number of metastatic sites.

  19. In vivo imaging models of bone and brain metastases and pleural carcinomatosis with a novel human EML4-ALK lung cancer cell line

    PubMed Central

    Nanjo, Shigeki; Nakagawa, Takayuki; Takeuchi, Shinji; Kita, Kenji; Fukuda, Koji; Nakada, Mitsutoshi; Uehara, Hisanori; Nishihara, Hiroshi; Hara, Eiji; Uramoto, Hidetaka; Tanaka, Fumihiro; Yano, Seiji

    2015-01-01

    EML4-ALK lung cancer accounts for approximately 3–7% of non-small-cell lung cancer cases. To investigate the molecular mechanism underlying tumor progression and targeted drug sensitivity/resistance in EML4-ALK lung cancer, clinically relevant animal models are indispensable. In this study, we found that the lung adenocarcinoma cell line A925L expresses an EML4-ALK gene fusion (variant 5a, E2:A20) and is sensitive to the ALK inhibitors crizotinib and alectinib. We further established highly tumorigenic A925LPE3 cells, which also have the EML4-ALK gene fusion (variant 5a) and are sensitive to ALK inhibitors. By using A925LPE3 cells with luciferase gene transfection, we established in vivo imaging models for pleural carcinomatosis, bone metastasis, and brain metastasis, all of which are significant clinical concerns of advanced EML4-ALK lung cancer. Interestingly, crizotinib caused tumors to shrink in the pleural carcinomatosis model, but not in bone and brain metastasis models, whereas alectinib showed remarkable efficacy in all three models, indicative of the clinical efficacy of these ALK inhibitors. Our in vivo imaging models of multiple organ sites may provide useful resources to analyze further the pathogenesis of EML4-ALK lung cancer and its response and resistance to ALK inhibitors in various organ microenvironments. PMID:25581823

  20. The innate immune receptor Dectin-2 mediates the phagocytosis of cancer cells by Kupffer cells for the suppression of liver metastasis.

    PubMed

    Kimura, Yoshitaka; Inoue, Asuka; Hangai, Sho; Saijo, Shinobu; Negishi, Hideo; Nishio, Junko; Yamasaki, Sho; Iwakura, Yoichiro; Yanai, Hideyuki; Taniguchi, Tadatsugu

    2016-12-06

    Tumor metastasis is the cause of most cancer deaths. Although metastases can form in multiple end organs, the liver is recognized as a highly permissive organ. Nevertheless, there is evidence for immune cell-mediated mechanisms that function to suppress liver metastasis by certain tumors, although the underlying mechanisms for the suppression of metastasis remain elusive. Here, we show that Dectin-2, a C-type lectin receptor (CLR) family of innate receptors, is critical for the suppression of liver metastasis of cancer cells. We provide evidence that Dectin-2 functions in resident macrophages in the liver, known as Kupffer cells, to mediate the uptake and clearance of cancer cells. Interestingly, Kupffer cells are selectively endowed with Dectin-2-dependent phagocytotic activity, with neither bone marrow-derived macrophages nor alveolar macrophages showing this potential. Concordantly, subcutaneous primary tumor growth and lung metastasis are not affected by the absence of Dectin-2. In addition, macrophage C-type lectin, a CLR known to be complex with Dectin-2, also contributes to the suppression of liver metastasis. Collectively, these results highlight the hitherto poorly understood mechanism of Kupffer cell-mediated control of metastasis that is mediated by the CLR innate receptor family, with implications for the development of anticancer therapy targeting CLRs.

  1. Bone marrow necrosis secondary to imatinib usage, mimicking spinal metastasis on magnetic resonance imaging and FDG-PET/CT.

    PubMed

    Aras, Yavuz; Akcakaya, Mehmet Osman; Unal, Seher N; Bilgic, Bilge; Unal, Omer Faruk

    2012-01-01

    Imatinib mesylate has become the treatment of choice for gastrointestinal stromal tumors (GISTs) and has made a revolutionary impact on survival rates. Bone marrow necrosis is a very rare adverse event in malignant GIST. Bone metastases are also rarely encountered in the setting of this disease. The authors report on a patient with malignant GIST who developed a bone lesion, mimicking spinal metastasis on both MR imaging and FDG-PET/CT. Corpectomy and anterior fusion was performed, but the pathology report was consistent with bone marrow necrosis. Radiological and clinical similarities made the distinction between metastasis and bone marrow necrosis challenging for the treating physicians. Instead of radical surgical excision, more conservative methods such as percutaneous or endoscopic bone biopsies may be more useful for pathological confirmation, even though investigations such as MR imaging and FDG-PET/CT indicate metastatic disease.

  2. Solitary fibular metastasis from nonsmall cell lung carcinoma

    PubMed Central

    Akram, Mohammad; Zaheer, Samreen; Hussain, Asif; Siddiqui, Shahid A; Afrose, Ruquiya; Khalid, Saifullah

    2017-01-01

    Solitary bone metastasis to fibula in patients of lung carcinoma is a rare entity, with only four cases reported in literature. We, hereby, present a case of a 50 year-old-male who was given three cycles of chemotherapy for lung carcinoma with no distant metastasis but presented 2 months later with a fusiform, painful swelling around the knee that was clinically suspected to be inflammatory in nature but proved to be fibular metastasis on cytology. There was no evidence of skeletal metastasis on initial bone scan. He was given palliative radiotherapy for this with symptomatic relief. PMID:28469322

  3. Solitary fibular metastasis from nonsmall cell lung carcinoma.

    PubMed

    Akram, Mohammad; Zaheer, Samreen; Hussain, Asif; Siddiqui, Shahid A; Afrose, Ruquiya; Khalid, Saifullah

    2017-01-01

    Solitary bone metastasis to fibula in patients of lung carcinoma is a rare entity, with only four cases reported in literature. We, hereby, present a case of a 50 year-old-male who was given three cycles of chemotherapy for lung carcinoma with no distant metastasis but presented 2 months later with a fusiform, painful swelling around the knee that was clinically suspected to be inflammatory in nature but proved to be fibular metastasis on cytology. There was no evidence of skeletal metastasis on initial bone scan. He was given palliative radiotherapy for this with symptomatic relief.

  4. Hypoxia induced E-cadherin involving regulators of Hippo pathway due to HIF-1α stabilization/nuclear translocation in bone metastasis from breast carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maroni, Paola; Matteucci, Emanuela; Drago, Lorenzo

    The present study deals with the molecular mechanisms involved in the regulation of E-cadherin expression under hypoxia, because the adjustment of the amount of E-cadherin due to physical stimuli of the microenvironment might influence the colonization of metastasis to skeleton. We analyzed the effect of 1% oxygen tension, that is similar to that encountered in the bone marrow by metastatic cells spreading from breast carcinoma. The purpose was to evaluate the hypoxia-orchestrated control of E-cadherin transactivation via hypoxia inducible factor-1 (HIF-1) and peroxisome proliferator activated receptor-γ (PPARγ), and the involvement of Hippo pathway members, as regulators of transcription factors. Tomore » give a translational significance to the study, we took into consideration human pair-matched ductal breast carcinoma and bone metastasis: E-cadherin and Wwox were expressed in bone metastasis but not in breast carcinoma, while HIF-1α and TAZ seemed localized principally in nuclei of metastasis and were found in all cell compartments of breast carcinoma. A close examination of the regulatory mechanisms underlying E-cadherin expression in bone metastasis was done in 1833 clone derived from MDA-MB231 cells. Hypoxia induced E-cadherin only in 1833 clone, but not in parental cells, through HIF-1 and PPARγ activities, while Wwox decreased. Since Wwox was highly expressed in bone metastasis, the effect of ectopic Wwox was evaluated, and we showed E-cadherin transactivation and enhanced invasiveness in WWOX transfected 1833 cells. Also, hypoxia was additive with ectopic Wwox remarkably enhancing HIF-1α nuclear shuttle and accumulation due to the lengthening of the half-life of HIF-1α protein; under this experimental condition HIF-1α appeared as a slower migrated band compared with control, in agreement with the phosphorylation state. The in vitro data strongly supported the almost exclusive presence of HIF-1α in nuclei of human-bone metastasis. Thus, we identified Wwox as a novel molecule in the HIF-1α-HDM2 regulatory loop, necessary for the dynamic regulation of the HIF-1α amount, and we suggested that the reduction of endogenous Wwox free pool under hypoxia might also be due to the interaction with HDM2, sequestering the E3 ubiquitin ligase. We highlighted the importance of nuclear HIF-1α in the biology of metastasis for the mesenchymal-epithelial transition: this phenotype was regulated by Wwox plus hypoxia through E-cadherin target gene, playing a pivotal role in bone metastasis colonization. - Highlights: • E-cadherin accumulates in hypoxic bone metastasis opposite to primary carcinoma. • HIF-1 and PPARγ cooperate in inducing E-cadherin under hypoxia in metastatic cells. • Wwox regulates HIF-1α phosphorylation and nuclear translocation. • Hypoxia plus Wwox prevent HIF-1α degradation via HDM2 forming a regulatory loop.« less

  5. Breast cancer lung metastasis: Molecular biology and therapeutic implications.

    PubMed

    Jin, Liting; Han, Bingchen; Siegel, Emily; Cui, Yukun; Giuliano, Armando; Cui, Xiaojiang

    2018-03-26

    Distant metastasis accounts for the vast majority of deaths in patients with cancer. Breast cancer exhibits a distinct metastatic pattern commonly involving bone, liver, lung, and brain. Breast cancer can be divided into different subtypes based on gene expression profiles, and different breast cancer subtypes show preference to distinct organ sites of metastasis. Luminal breast tumors tend to metastasize to bone while basal-like breast cancer (BLBC) displays a lung tropism of metastasis. However, the mechanisms underlying this organ-specific pattern of metastasis still remain to be elucidated. In this review, we will summarize the recent advances regarding the molecular signaling pathways as well as the therapeutic strategies for treating breast cancer lung metastasis.

  6. Denosumab and bone metastasis-free survival in men with nonmetastatic castration-resistant prostate cancer: exploratory analyses by baseline prostate-specific antigen doubling time.

    PubMed

    Smith, Matthew R; Saad, Fred; Oudard, Stephane; Shore, Neal; Fizazi, Karim; Sieber, Paul; Tombal, Bertrand; Damiao, Ronaldo; Marx, Gavin; Miller, Kurt; Van Veldhuizen, Peter; Morote, Juan; Ye, Zhishen; Dansey, Roger; Goessl, Carsten

    2013-10-20

    Denosumab, an anti-RANK ligand monoclonal antibody, significantly increases bone metastasis-free survival (BMFS; hazard ratio [HR], 0.85; P = .028) and delays time to first bone metastasis in men with nonmetastatic castration-resistant prostate cancer (CRPC) and baseline prostate-specific antigen (PSA) ≥ 8.0 ng/mL and/or PSA doubling time (PSADT) ≤ 10.0 months. To identify men at greatest risk for bone metastasis or death, we evaluated relationships between PSA and PSADT with BMFS in the placebo group and the efficacy and safety of denosumab in men with PSADT ≤ 10, ≤ 6, and ≤ 4 months. A total of 1,432 men with nonmetastatic CRPC were randomly assigned 1:1 to monthly subcutaneous denosumab 120 mg or placebo. Enrollment began February 2006; primary analysis cutoff was July 2010, when approximately 660 men were anticipated to have developed bone metastases or died. In the placebo group, shorter BMFS was observed as PSADT decreased below 8 months. In analyses by shorter baseline PSADT, denosumab consistently increased BMFS by a median of 6.0, 7.2, and 7.5 months among men with PSADT ≤ 10 (HR, 0.84; P = .042), ≤ 6 (HR, 0.77; P = .006), and ≤ 4 months (HR, 0.71; P = .004), respectively. Denosumab also consistently increased time to bone metastasis by PSADT subset. No difference in survival was observed between treatment groups for the overall study population or PSADT subsets. Patients with shorter PSADT are at greater risk for bone metastasis or death. Denosumab consistently improves BMFS in men with shorter PSADT and seems to have the greatest treatment effects in men at high risk for progression.

  7. Clinical characteristics and outcome of bone-only metastasis in inflammatory and noninflammatory breast cancers.

    PubMed

    Kai, Megumi; Kogawa, Takahiro; Liu, Diane D; Fouad, Tamer M; Kai, Kazuharu; Niikura, Naoki; Hsu, Limin; Willey, Jie S; Theriault, Richard L; Valero, Vicente; Ueno, Naoto T

    2015-02-01

    Inflammatory breast cancer is a rare and aggressive presentation of breast cancer. Bone is a common metastatic site in breast cancer, and bone-only metastatic disease is clinically considered to have a better prognosis than visceral metastasis. However, bone-only metastasis in IBC (bone-only IBC) has not been compared with bone-only metastasis in non-IBC (bone-only non-IBC) in terms of clinical features and outcome. Because of the intrinsically aggressive nature of IBC, we hypothesized that bone-only IBC has a poorer prognosis than does bone-only non-IBC. We retrospectively identified patients with stage III primary diagnosed breast cancer who, between January 1997 and December 2012, had a first recurrence located only in the bone. Among the 197 patients that we defined as a study cohort, 50 patients had IBC and 147 patients had non-IBC. Progression-free survival (PFS) and overall survival (OS) from the date of recurrence were estimated using the Kaplan-Meier method, and patient characteristic groups were compared using the log-rank test. OS did not differ significantly between the 2 groups (P = .2467), but a shorter PFS was seen in patients with bone-only IBC than in patients with bone-only non-IBC (P = .0357). Among patients with estrogen receptor (ER)-positive disease, a much shorter PFS was seen in bone-only IBC than in bone-only non-IBC (P = .0159). Bone-only IBC has a poorer prognosis than does bone-only non-IBC, particularly in those with ER-positive tumors. We might need to consider more aggressive intervention (e.g., chemotherapy) for IBC patients with ER-positive bone-only metastatic disease. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. High-fat diet enhances and monocyte chemoattractant protein-1 deficiency reduces bone loss in mice with pulmonary metastases of Lewis lung carcinoma

    USDA-ARS?s Scientific Manuscript database

    Bone is adversely affected by metastasis and metastasis-associated complications. Obesity is a risk factor for both bone and cancer. Adipose tissue is an endocrine organ that produces pro-inflammatory adipokines, such as monocyte chemotactic protein-1 (MCP-1), that contribute to obesity and obesit...

  9. A systematic review on in vitro 3D bone metastases models: A new horizon to recapitulate the native clinical scenario?

    PubMed

    Salamanna, Francesca; Contartese, Deyanira; Maglio, Melania; Fini, Milena

    2016-07-12

    While the skeleton is not the only organ where metastasis can occur, it is one of the preferred sites, with a significant impact in patients' quality of life. With the aim of delineating the cellular and molecular mechanisms of bone metastasis, numerous studies have been employed to identify any contributing factors that trigger cancer progression. One of the major limitations of studying cancer-bone metastasis is the multifaceted nature of the native bone environment and the lack of reliable, simple, and not expensive models that strictly mimic the biological processes occurring in vivo allowing a correct translation of results. Currently, with the growing acceptance of in vitro models as effective tools for studying cancer biology, three-dimensional (3D) models have emerged as a compromise between two-dimensional cultures of isolated cancer cells and the complexity of human cancer xenografts in immunocompromised animal hosts. This descriptive systematic literature review summarizes the current status of advanced and alternative 3D in vitro bone metastases models. We have also reviewed the strategies employed by researchers to set-up these models with special reference to recent promising developments trying to better replicate the complexity and heterogeneity of a human metastasis in situ, with an outlook at their use in medicine. All these aspects will greatly contribute to the existing knowledge on bone metastases, providing a specific link to clinical scenarios and thus making 3D in vitro bone metastasis models an attractive tool for multidisciplinary experts.

  10. Oral metastasis from primary transitional cell carcinoma of the renal pelvis: report of a case.

    PubMed

    Zhang, Y; Gu, Z-Y; Tian, Z; Yang, C; Cai, X-Y

    2010-07-01

    Transitional cell carcinoma of the renal pelvis is initially a slow growing tumor arising from the transitional epithelium of the mucous membrane of the renal pelvis. Recurrences occur in two forms: superficial bladder cancer and distant metastases. The common metastasis is in the lung, liver, brain and bone. Oral metastasis is seldom reported. The authors report an unusual case of transitional cell carcinoma of the renal pelvis metastasized to the oral cavity and lung simultaneously in a 74-year-old man, which occurred 1 year after a left nephroureterectomy. The patient underwent six courses of chemotherapy (gemcitabine, oxaliplatin, fluorouracil and nedaplatin), and received radiotherapy for the oral lesion. The symptoms were alleviated, but the tumor recurred in the oral cavity 2 years later. Brain and liver metastases were confirmed by CT. Repeated radiotherapy for oral metastasis was performed, but the patient died 4 years after the initial nephroureterectomy due to multiple metastases. Copyright 2010 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  11. Skeletal metastasis: treatments, mouse models, and the Wnt signaling

    PubMed Central

    Valkenburg, Kenneth C.; Steensma, Matthew R.; Williams, Bart O.; Zhong, Zhendong

    2013-01-01

    Skeletal metastases result in significant morbidity and mortality. This is particularly true of cancers with a strong predilection for the bone, such as breast, prostate, and lung cancers. There is currently no reliable cure for skeletal metastasis, and palliative therapy options are limited. The Wnt signaling pathway has been found to play an integral role in the process of skeletal metastasis and may be an important clinical target. Several experimental models of skeletal metastasis have been used to find new biomarkers and test new treatments. In this review, we discuss pathologic process of bone metastasis, the roles of the Wnt signaling, and the available experimental models and treatments. PMID:23327798

  12. A novel microfluidic model can mimic organ-specific metastasis of circulating tumor cells.

    PubMed

    Kong, Jing; Luo, Yong; Jin, Dong; An, Fan; Zhang, Wenyuan; Liu, Lilu; Li, Jiao; Fang, Shimeng; Li, Xiaojie; Yang, Xuesong; Lin, Bingcheng; Liu, Tingjiao

    2016-11-29

    A biomimetic microsystem might compensate costly and time-consuming animal metastatic models. Herein we developed a biomimetic microfluidic model to study cancer metastasis. Primary cells isolated from different organs were cultured on the microlfuidic model to represent individual organs. Breast and salivary gland cancer cells were driven to flow over primary cell culture chambers, mimicking dynamic adhesion of circulating tumor cells (CTCs) to endothelium in vivo. These flowing artificial CTCs showed different metastatic potentials to lung on the microfluidic model. The traditional nude mouse model of lung metastasis was performed to investigate the physiological similarity of the microfluidic model to animal models. It was found that the metastatic potential of different cancer cells assessed by the microfluidic model was in agreement with that assessed by the nude mouse model. Furthermore, it was demonstrated that the metastatic inhibitor AMD3100 inhibited lung metastasis effectively in both the microfluidic model and the nude mouse model. Then the microfluidic model was used to mimick liver and bone metastasis of CTCs and confirm the potential for research of multiple-organ metastasis. Thus, the metastasis of CTCs to different organs was reconstituted on the microfluidic model. It may expand the capabilities of traditional cell culture models, providing a low-cost, time-saving, and rapid alternative to animal models.

  13. Epigenetic regulation of HGF/Met receptor axis is critical for the outgrowth of bone metastasis from breast carcinoma.

    PubMed

    Bendinelli, Paola; Maroni, Paola; Matteucci, Emanuela; Desiderio, Maria Alfonsina

    2017-02-02

    Our translational research deals with the influence of microenvironment on the phenotype and colonization of bone metastases from breast carcinoma, and on pre-metastatic niche formation. The aim of the present study was to clarify the origin of hepatocyte growth factor (HGF), ligand of Met receptor, the control of the axis HGF/Met by DNA methylation, and its importance for the nexus supportive cells-metastatic cells and for metastasis outgrowth. In bone metastasis of the 1833-xenograft model, DNA methyltransferase blockade using the chemotherapic drug 5-aza-2'-deoxycytidine (decitabine) strongly reduced the expression of HGF/Met receptor axis and of E-cadherin, with decrease of metastasis wideness and osteolysis, prolonging mice survival. Thus, DNA methylation events acted as commanders of breast carcinoma cells metastatizing to bone influencing the epithelial phenotype. HGF emerged as a bone-marrow stimulus, and the exosomes seemed to furnish HGF to metastatic cells. In fact, decitabine treatment similarly affected some markers of these microvesicles and HGF, indicating that its supply to recipient cells was prevented. Notably, in bone metastasis the hypomethylation of HGF, Met and E-cadherin promoters did not appear responsible for their elevated expression, but we suggest the involvement of hypermethylated regulators and of Wwox oncosuppressor, the latter being affected by decitabine. Wwox expression increased under decitabine strongly localizing in nuclei of bone metastases. We hypothesize a role of Wwox in Met activity since in vitro Wwox overexpression downregulated the level of nuclear-Met protein fragment and Met stability, also under long exposure of 1833 cells to decitabine. HGF enhanced phosphoMet and the activity in nuclei, an effect partially prevented by decitabine. Altogether, the data indicated the importance to target the tumor microenvironment by blocking epigenetic mechanisms, which control critical events for colonization such as HGF/Met axis and Wwox, as therapy of bone metastasis.

  14. Stimulation of host bone marrow stromal cells by sympathetic nerves promotes breast cancer bone metastasis in mice.

    PubMed

    Campbell, J Preston; Karolak, Matthew R; Ma, Yun; Perrien, Daniel S; Masood-Campbell, S Kathryn; Penner, Niki L; Munoz, Steve A; Zijlstra, Andries; Yang, Xiangli; Sterling, Julie A; Elefteriou, Florent

    2012-07-01

    Bone and lung metastases are responsible for the majority of deaths in patients with breast cancer. Following treatment of the primary cancer, emotional and psychosocial factors within this population precipitate time to recurrence and death, however the underlying mechanism(s) remain unclear. Using a mouse model of bone metastasis, we provide experimental evidence that activation of the sympathetic nervous system, which is one of many pathophysiological consequences of severe stress and depression, promotes MDA-231 breast cancer cell colonization of bone via a neurohormonal effect on the host bone marrow stroma. We demonstrate that induction of RANKL expression in bone marrow osteoblasts, following β2AR stimulation, increases the migration of metastatic MDA-231 cells in vitro, independently of SDF1-CXCR4 signaling. We also show that the stimulatory effect of endogenous (chronic stress) or pharmacologic sympathetic activation on breast cancer bone metastasis in vivo can be blocked with the β-blocker propranolol, and by knockdown of RANK expression in MDA-231 cells. These findings indicate that RANKL promotes breast cancer cell metastasis to bone via its pro-migratory effect on breast cancer cells, independently of its effect on bone turnover. The emerging clinical implication, supported by recent epidemiological studies, is that βAR-blockers and drugs interfering with RANKL signaling, such as Denosumab, could increase patient survival if used as adjuvant therapy to inhibit both the early colonization of bone by metastatic breast cancer cells and the initiation of the "vicious cycle" of bone destruction induced by these cells.

  15. [A single metastasis in the carpal bones as the first clinical manifestation of a hepatocellular carcinoma].

    PubMed

    Corrales Pinzón, R; Alonso Sánchez, J M; de la Mano González, S; El Karzazi Tarazona, K

    2014-01-01

    Hepatocellular carcinoma is the most common primary tumor of the liver. Spreading outside the liver usually takes place in advanced stages of the disease, and bone is the third most common site of metastases. We present a case of hepatocellular carcinoma in which the first clinical manifestation was a single metastasis to the carpal bones. The interest of this case lies in the way this hepatocellular carcinoma manifested as well as in the unusual site of the metastasis. Copyright © 2012 SERAM. Published by Elsevier Espana. All rights reserved.

  16. DHA is a more potent inhibitor of breast cancer metastasis to bone and related osteolysis than EPA

    PubMed Central

    Rahman, M.; Veigas, Maria; Williams, Paul J.; Fernandes, Gabriel

    2013-01-01

    Breast cancer patients often develop bone metastasis evidenced by osteolytic lesions, leading to severe pain and bone fracture. Attenuation of breast cancer metastasis to bone and associated osteolysis by fish oil (FO), rich in EPA and DHA, has been demonstrated previously. However, it was not known whether EPA and DHA differentially or similarly affect breast cancer bone metastasis and associated osteolysis. In vitro culture of parental and luciferase gene encoded MDA-MB-231 human breast cancer cell lines treated with EPA and DHA revealed that DHA inhibits proliferation and invasion of breast cancer cells more potently than EPA. Intra-cardiac injection of parental and luciferase gene encoded MDA-MB-231 cells to athymic NCr nu/nu mice demonstrated that DHA treated mice had significantly less breast cancer cell burden in bone, and also significantly less osteolytic lesions than EPA treated mice. In vivo cell migration assay as measured by luciferase intensity revealed that DHA attenuated cell migration specifically to the bone. Moreover, the DHA treated group showed reduced levels of CD44 and TRAP positive area in bone compared to EPA treated group. Breast cancer cell burden and osteolytic lesions were also examined in intra-tibially breast cancer cell injected mice and found less breast cancer cell growth and associated osteolysis in DHA treated mice as compared to EPA treated mice. Finally, doxorubicin resistant MCF-7 (MCF-7dox) human breast cancer cell line was used to examine if DHA can improve sensitization of MCF-7dox cells to doxorubicin. DHA improved the inhibitory effect of doxorubicin on proliferation and invasion of MCF-7dox cells. Interestingly, drug resistance gene P-gp was also down-regulated in DHA plus doxorubicin treated cells. In conclusion, DHA attenuates breast cancer bone metastasis and associated osteolysis more potently than EPA, possibly by inhibiting migration of breast cancer cell to the bone as well as by inhibiting osteoclastic bone resorption. PMID:24062211

  17. Mint3 in bone marrow-derived cells promotes lung metastasis in breast cancer model mice.

    PubMed

    Hara, Toshiro; Murakami, Yoshinori; Seiki, Motoharu; Sakamoto, Takeharu

    2017-08-26

    Breast cancer is one of the most common cancers in women in the world. Although breast cancer is well treatable at the early stage, patients with distant metastases show a poor prognosis. Data from recent studies using transplantation models indicate that Mint3/APBA3 might promote breast cancer malignancy. However, whether Mint3 indeed contributes to tumor development, progression, or metastasis in vivo remains unclear. To address this, here we examined whether Mint3 depletion affects tumor malignancy in MMTV-PyMT breast cancer model mice. In MMTV-PyMT mice, Mint3 depletion did not affect tumor onset and tumor growth, but attenuated lung metastases. Experimental lung metastasis of breast cancer Met-1 cells derived from MMTV-PyMT mice also decreased in Mint3-depleted mice, indicating that host Mint3 expression affected lung metastasis of MMTV-PyMT-derived breast cancer cells. Further bone marrow transplant experiments revealed that Mint3 in bone marrow-derived cells promoted lung metastasis in MMTV-PyMT mice. Thus, targeting Mint3 in bone marrow-derived cells might be a good strategy for preventing metastasis and improving the prognosis of breast cancer patients. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. In vivo imaging models of bone and brain metastases and pleural carcinomatosis with a novel human EML4-ALK lung cancer cell line.

    PubMed

    Nanjo, Shigeki; Nakagawa, Takayuki; Takeuchi, Shinji; Kita, Kenji; Fukuda, Koji; Nakada, Mitsutoshi; Uehara, Hisanori; Nishihara, Hiroshi; Hara, Eiji; Uramoto, Hidetaka; Tanaka, Fumihiro; Yano, Seiji

    2015-03-01

    EML4-ALK lung cancer accounts for approximately 3-7% of non-small-cell lung cancer cases. To investigate the molecular mechanism underlying tumor progression and targeted drug sensitivity/resistance in EML4-ALK lung cancer, clinically relevant animal models are indispensable. In this study, we found that the lung adenocarcinoma cell line A925L expresses an EML4-ALK gene fusion (variant 5a, E2:A20) and is sensitive to the ALK inhibitors crizotinib and alectinib. We further established highly tumorigenic A925LPE3 cells, which also have the EML4-ALK gene fusion (variant 5a) and are sensitive to ALK inhibitors. By using A925LPE3 cells with luciferase gene transfection, we established in vivo imaging models for pleural carcinomatosis, bone metastasis, and brain metastasis, all of which are significant clinical concerns of advanced EML4-ALK lung cancer. Interestingly, crizotinib caused tumors to shrink in the pleural carcinomatosis model, but not in bone and brain metastasis models, whereas alectinib showed remarkable efficacy in all three models, indicative of the clinical efficacy of these ALK inhibitors. Our in vivo imaging models of multiple organ sites may provide useful resources to analyze further the pathogenesis of EML4-ALK lung cancer and its response and resistance to ALK inhibitors in various organ microenvironments. © 2015 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.

  19. Bilateral primary xanthoma of the humeri with pathologic fractures: A case report

    PubMed Central

    Ali, Sayed; Fedenko, Alex; Syed, Ali B; Matcuk, George; Patel, Dakshesh; Gottsegen, Chris; White, Eric

    2013-01-01

    Xanthomas are rare bone tumors that occur more often in the appendicular skeleton and typically appear radiographically benign, with a narrow zone of transition and a sclerotic rim. We report the case of a 57-year-old woman with hyperlipidemia presenting with bilateral shoulder pain after minor trauma. Radiographic and histopathologic investigation demonstrated intraosseous xanthoma with atypical features, including multifocality, a wide zone of transition and pathologic fractures-characteristics more commonly associated with aggressive lesions such as multiple myeloma or metastasis. The diagnosis, imaging, and histological appearance of xanthoma of bone are reviewed. PMID:24198913

  20. Circulating Bone-related Markers and YKL-40 Versus HER2 and TOPO2a in Bone Metastatic and Nonmetastatic Breast Cancer: Diagnostic Implications.

    PubMed

    Shaker, Olfat Gamil; Helmy, Hebatullah Samy

    2018-06-01

    The bone represents one of the most common sites of metastases in breast cancer. The aim of the current study was to evaluate the diagnostic potential of several circulating markers to detect metastasis to bones in patients with breast cancer. Receptor activator of Nuclear Factor-kappa β (NF-Kβ) ligand (RANKL), osteoprotegrin (OPG), vitamin D (VIT D), Chitinase-3-like protein 1; also known as YKL-40, topoisomerase IIα (TOPO2a), and human epidermal growth factor receptor 2 (HER2) were measured in blood samples obtained from 122 patients with breast cancer and 25 healthy controls. All biomarkers were significantly elevated in patients with breast cancer with bone metastasis compared with nonmetastatic patients except YKL-40. RANKL had the highest diagnostic performance for bone metastasis detection with an area under the curve of 97.3, a sensitivity of 85%, and a specificity of 98.6%. Furthermore, logistic regression analysis resulted in a model of RANKL combined with HER2 that had even higher discriminatory power of metastasis to bones than that of RANKL alone. Overall correct classification of the model was 98.9%. We recommend that measuring RANKL together with HER2 can be routinely applied to allow early detection of bone metastases in patients with breast cancer. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Role of periostin and its antagonist PNDA-3 in gastric cancer metastasis.

    PubMed

    Liu, Guo-Xiao; Xi, Hong-Qing; Sun, Xiao-Yan; Wei, Bo

    2015-03-07

    The extracellular matrix component periostin is a secreted protein that functions as both a cell attachment protein and an autocrine or paracrine factor that signals through the cell adhesion molecule integrins αvβ3 and αvβ5. Periostin participates in normal physiological activities such as cardiac development, but is also involved in pathophysiological processes in vascular diseases, wound repair, bone formation, and tumor development. It is of increasing interest in tumor biology because it is frequently overexpressed in a variety of epithelial carcinomas and is functionally involved in multiple steps of metastasis progression. These include the maintenance of stemness, niche formation, EMT, the survival of tumor cells, and angiogenesis, all of which are indispensable for gastric cancer metastasis. Periostin has been reported to activate the PI-3K/AKT, Wnt, and FAK-mediated signaling pathways to promote metastasis. Therefore, periostin represents a potentially promising candidate for the inhibition of metastasis. In this review article, we summarize recent advances in knowledge concerning periostin, its antagonist PNDA-3, and their influence on such key processes in cancer metastasis as maintenance of stemness, niche formation, epithelial-to-mesenchymal transition, tumor cell survival, and angiogenesis. In particular, we focus our attention on the role of periostin in gastric cancer metastasis, speculate as to the usefulness of periostin as a therapeutic and diagnostic target for gastric cancer metastasis, and consider potential avenues for future research.

  2. PKCε Is an Essential Mediator of Prostate Cancer Bone Metastasis.

    PubMed

    Gutierrez-Uzquiza, Alvaro; Lopez-Haber, Cynthia; Jernigan, Danielle L; Fatatis, Alessandro; Kazanietz, Marcelo G

    2015-09-01

    The bone is a preferred site for metastatic homing of prostate cancer cells. Once prostate cancer patients develop skeletal metastases, they eventually succumb to the disease; therefore, it is imperative to identify key molecular drivers of this process. This study examines the involvement of protein kinase C epsilon (PKCε), an oncogenic protein that is abnormally overexpressed in human tumor specimens and cell lines, on prostate cancer cell bone metastasis. PC3-ML cells, a highly invasive prostate cancer PC3 derivative with bone metastatic colonization properties, failed to induce skeletal metastatic foci upon inoculation into nude mice when PKCε expression was silenced using shRNA. Interestingly, while PKCε depletion had only marginal effects on the proliferative, adhesive, and migratory capacities of PC3-ML cells in vitro or in the growth of xenografts upon s.c. inoculation, it caused a significant reduction in cell invasiveness. Notably, PKCε was required for transendothelial cell migration (TEM) as well as for the growth of PC3-ML cells in a bone biomimetic environment. At a mechanistic level, PKCε depletion abrogates the expression of IL1β, a cytokine implicated in skeletal metastasis. Taken together, PKCε is a key factor for driving the formation of bone metastasis by prostate cancer cells and is a potential therapeutic target for advanced stages of the disease. This study uncovers an important new function of PKCε in the dissemination of cancer cells to the bone; thus, highlighting the promising potential of this oncogenic kinase as a therapeutic target for skeletal metastasis. ©2015 American Association for Cancer Research.

  3. Clinicopathological features of gastric metastasis from breast cancer in three cases.

    PubMed

    Koike, Kenta; Kitahara, Kenji; Higaki, Mayumi; Urata, Masako; Yamazaki, Fumio; Noshiro, Hirokazu

    2014-09-01

    The common sites for metastases from breast cancer are lymph nodes, bone, lung, liver, and brain. Gastrointestinal (GI) metastasis is rarely found or diagnosed in patients with breast cancer. This report presents three cases of gastric metastasis from breast cancer. Case 1 was a 42-year-old female diagnosed with gastric metastasis after mastectomy with axillary lymph node dissection for invasive lobular carcinoma of the left breast. Case 2 was a 54-year-old female who was diagnosed to have invasive lobular carcinoma of the left breast with systemic bone and gastric metastasis. Case 3 was a 54-year-old female who was diagnosed to have bilateral invasive ductal carcinoma of the breast with simultaneous bone and gastric metastasis. The immunohistochemical statuses for estrogen receptor, progesterone receptor, mammaglobin, and gross cystic disease fluid protein-15 (GCDFP-15) between the primary and gastric metastatic lesions were all well matched. All three cases were treated with systemic chemotherapy, hormone therapy or both, without surgical intervention for gastric lesions. Two patients with disseminated disease died 27 and 58 months after diagnosis of gastric metastasis, while one patient without organ metastasis is still alive at 56 months after diagnosis. It is important to make a correct diagnosis by distinguishing gastric metastasis from breast cancer in order to select the optimal initial treatment for systemic disease of breast cancer.

  4. Diagnostic performance of 18F-FDG PET/CT and whole-body diffusion-weighted imaging with background body suppression (DWIBS) in detection of lymph node and bone metastases from pediatric neuroblastoma.

    PubMed

    Ishiguchi, Hiroaki; Ito, Shinji; Kato, Katsuhiko; Sakurai, Yusuke; Kawai, Hisashi; Fujita, Naotoshi; Abe, Shinji; Narita, Atsushi; Nishio, Nobuhiro; Muramatsu, Hideki; Takahashi, Yoshiyuki; Naganawa, Shinji

    2018-06-01

    Recent many studies have shown that whole body "diffusion-weighted imaging with background body signal suppression" (DWIBS) seems a beneficial tool having higher tumor detection sensitivity without ionizing radiation exposure for pediatric tumors. In this study, we evaluated the diagnostic performance of whole body DWIBS and 18 F-FDG PET/CT for detecting lymph node and bone metastases in pediatric patients with neuroblastoma. Subjects in this retrospective study comprised 13 consecutive pediatric patients with neuroblastoma (7 males, 6 females; mean age, 2.9 ± 2.0 years old) who underwent both 18 F-FDG PET/CT and whole-body DWIBS. All patients were diagnosed as neuroblastoma on the basis of pathological findings. Eight regions of lymph nodes and 17 segments of skeletons in all patients were evaluated. The images of 123 I-MIBG scintigraphy/SPECT-CT, bone scintigraphy/SPECT, and CT were used to confirm the presence of lymph node and bone metastases. Two radiologists trained in nuclear medicine evaluated independently the uptake of lesions in 18 F-FDG PET/CT and the signal-intensity of lesions in whole-body DWIBS visually. Interobserver difference was overcome through discussion to reach a consensus. The sensitivities, specificities, and overall accuracies of 18 F-FDG PET/CT and whole-body DWIBS were compared using McNemer's test. Positive predictive values (PPVs) and negative predictive values (NPVs) of both modalities were compared using Fisher's exact test. The total numbers of lymph node regions and bone segments which were confirmed to have metastasis in the total 13 patients were 19 and 75, respectively. The sensitivity, specificity, overall accuracy, PPV, and NPV of 18 F-FDG PET/CT for detecting lymph node metastasis from pediatric neuroblastoma were 100, 98.7, 98.9, 95.0, and 100%, respectively, and those for detecting bone metastasis were 90.7, 73.1, 80.3, 70.1, and 91.9%, respectively. In contrast, the sensitivity, specificity, overall accuracy, PPV, and NPV of whole-body DWIBS for detecting bone metastasis from pediatric neuroblastoma were 94.7, 24.0, 53.0, 46.4 and 86.7%, respectively, whereas those for detecting lymph node metastasis were 94.7, 85.3, 87.2, 62.1, and 98.5%, respectively. The low specificity, overall accuracy, and PPV of whole-body DWIBS for detecting bone metastasis were due to a high incidence of false-positive findings (82/108, 75.9%). The specificity, overall accuracy, and PPV of whole-body DWIBS for detecting lymph node metastasis were also significantly lower than those of 18 F-FDG PET/CT for detecting lymph node metastasis, although the difference between these 2 modalities was less than that for detecting bone metastasis. The specificity, overall accuracy, and PPV of whole-body DWIBS are significantly lower than those of 18 F-FDG PET/CT because of a high incidence of false-positive findings particularly for detecting bone metastasis, whereas whole-body DWIBS shows a similar level of sensitivities for detecting lymph node and bone metastases to those of 18 F-FDG PET/CT. DWIBS should be carefully used for cancer staging in children because of its high incidence of false-positive findings in skeletons.

  5. The role of internal fixation for long bone metastasis prior to impending fracture: an experimental model.

    PubMed

    Ibrahim, Mohammad; Terai, Hidetomi; Yamada, Kentaro; Suzuki, Akinobu; Toyoda, Hiromitsu; Nakamura, Hiroaki

    2013-07-01

    Patients with long bone metastasis have many therapeutic options, including surgery. However, the appropriate time for surgical intervention and the use of internal fixation prior to impending fracture remains controversial. The purpose of this study was to establish a long bone metastatic model with internal fixation, and to determine whether prophylactic internal fixation for long bone metastasis prior to impending fracture would affect bone destruction, tumor progression, and mortality. We implanted VX2 tumor cells into the tibiae of 45 rabbits divided equally into three groups: internal fixation, control, and sham groups. Rabbits were monitored by X-ray and computed tomography, and blood serum levels were examined every 2 weeks. Computed tomography data revealed significantly higher bone destruction in rabbit tibiae in the sham and control groups compared with those in the fixation group; there were volumetric bone losses of 0.2, 0.4, and 2.3% in the fixation, sham, and control groups, respectively, at 3 weeks, which increased to 1.2, 2.5, and 6.1% at 5 weeks. Rabbits in the fixation group showed significantly prolonged survival (64.5 ± 13.5 days) in comparison with rabbits in the sham group (50.3 ± 11.6 days) and control group (38.2 ± 4.9 days). Our results suggest that prophylactic internal fixation may hinder bone destruction and tumor progression, thus extending the survival period for patients with long bone metastasis.

  6. The secreted factors responsible for pre-metastatic niche formation: old sayings and new thoughts.

    PubMed

    Peinado, Héctor; Lavotshkin, Simon; Lyden, David

    2011-04-01

    Metastasis is a multistep process that requires acquisition of malignant cell phenotypes which allow tumor cells to escape from the primary tumor site. Each of the steps during metastatic progression involves co-evolution of the tumor and its microenvironment. Although tumor cells are the driving force of metastasis, new findings suggest that the host cells within the tumor microenvironment play a key role in influencing metastatic behavior. Many of these contributing cells are derived from the bone marrow; in particular, recruited bone marrow progenitor cells generate the "pre-metastatic niche" to which the tumor cells metastasize. Analysis of the molecular mechanisms involved in pre-metastatic niche formation has revealed that secreted soluble factors are key players in bone marrow cell mobilization during metastasis. In addition, membrane vesicles derived from both tumor and host cells have recently been recognized as new candidates with important roles in the promotion of tumor growth and metastasis. This review describes old ideas and presents new insights into the role of tumor and bone marrow-derived microvesicles and exosomes in pre-metastatic niche formation and metastasis. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Evaluation of the pain and local tenderness in bone metastasis treated with magnetic resonance-guided focused ultrasound surgery (MRgFUS)

    NASA Astrophysics Data System (ADS)

    Namba, Hirofumi; Kawasaki, Motohiro; Kato, Tomonari; Tani, Toshikazu; Ushida, Takahiro; Koizumi, Norihiro

    2017-03-01

    It has been reported that MRgFUS has pain palliative effects on the local pain in patients with bone metastasis. In general, a severity of pain has been evaluated using only subjective method with numerical rating scale (NRS) or visual analogue scale (VAS). It is important to evaluate local pain-palliative effects of MRgFUS treatment with objective and quantitative method. The aim of this study is to investigate changes in the severity of local pain of bone metastasis before and after MRgFUS treatments, measuring pressure pain threshold (PPT) using pressure algometer, and pain intensity using electrical stimulation device (the Pain Vision system) at most painful site of bone metastasis. We have conducted MRgFUS for pain palliation of bone metastasis for 8 patients, and evaluated the local tenderness quantitatively for 8 patients, and evaluated local pain intensity for 7 patients. Before the treatments, PPTs were 106.3kPa [40.0-431.5] at metastatic site and 344.8 kPa [206.0-667.0] at normal control site, which showed a significant difference. The PPTs at metastatic site shows a significant increase from 106.3 kPa [40.0-431.5] at the baseline to 270.5 kPa [93.5-533.5] at 3 months after the treatment. The NRS score shows a significant decrease from 6.0 [4-8] at baseline to 1 [0-3] at 3 months after the treatment. Similarly, the pain intensity shows a significant decrease 245 [96.3-888.7] at baseline to 55.9 [2.8-292] at 3 months after the treatment. The results of our study illustrate the pain-relieving effects of MRgFUS for the treatment of painful bone metastasis. PPT might be a useful parameter not only for assessing a treatment's effect, but also for the decision of the painful area to treat with MRgFUS. Pain Vision seems to be useful for quantitative and objective evaluation of local pain of painful bone metastasis.

  8. Integrins in bone metastasis formation and potential therapeutic implications.

    PubMed

    Clëzardin, P

    2009-11-01

    Integrins constitute a family of cell surface receptors that are heterodimers composed of noncovalently associated alpha and beta subunits. Integrins bind to extracellular matrix proteins and immunogobulin superfamily molecules. They exert a stringent control on cell migration, survival and proliferation. However, their expression and functions are often deregulated in cancer, and many lines of evidence implicate them as key regulators during progression from primary tumor growth to metastasis. Here, we review the role of integrins in bone metastasis formation and present evidence that the use of integrin-targeted therapeutic agents may be an efficient strategy to block tumor metastasis.

  9. Choroidal metastasis from primary bone leiomyosarcoma.

    PubMed

    Cristina, Nieto Gómez; Francisco, Escudero Domínguez; Vanesa, Rivero Gutiérrez; Fernando, Cruz González; Luis, Cacharro Moras; Emiliano, Hernández Galilea

    2015-10-01

    Choroidal metastases, the most common form of intraocular malignancies, are principally caused by primary tumors from breast, lung, and gastrointestinal tract. These lesions are mostly symptomatic and rarely detected incidentally in the extension study of a previously diagnosed tumor. Leiomyosarcoma is a neoplasm of mesenchymal cells with smooth muscle differentiation and represents the most prevalent soft-tissue sarcoma. Leiomyosarcoma is a notably rare tumor in ophthalmic region. We report a case of primary bone leiomyosarcoma metastatic to the choroid that was treated with chemotherapy and surgery. Although three cases of choroidal metastasis from leiomyosarcomas have been already reported, to our knowledge this is the first case of choroidal metastasis from primary bone leiomyosarcoma.

  10. Analgesic efficacy of zoledronic acid and its effect on functional status of prostate cancer patients with metastasis

    PubMed Central

    Gálvez, Rafael; Ribera, Victoria; González-Escalada, José Ramón; Souto, Alicia; Cánovas, María Luz; Castro, Andrés; Herrero, Begoña; de los Ángeles Maqueda, María; Castilforte, Matilde; Marco-Martínez, José Javier; Pérez, Concepción; Vicente-Fatela, Lorenza; MD, Consuelo Nieto; Orduña, Maria José; Padrol, Anna; Reig, Enrique; Carballido, Joaquín; Cózar, José Manuel

    2008-01-01

    Objectives A multi-centered observational study evaluated the efficacy of zoledronic acid for improving pain and mobility, and preventing skeletal-related events (SRE) (fracture, spinal compression, pain-relieving radiotherapy), in patients with prostate cancer and bone metastasis. Materials and Methods Males (n = 218) with prostate cancer and bone metastasis undergoing oncologic therapy received zoledronic acid (4 mg iv/month) for 6 months. Parameters evaluated were: 1) pain and movement after 2 consecutive doses; 2) quality of life; 3) SRE incidence and time-to-appearance. Medication tolerance and treatment satisfaction were assessed using a questionnaire. Results A total of 170 that matched all the inclusion criteria (78%) out of 218 were evaluable for efficacy. There was a measurable statistically significant reduction in pain at rest and on movement as well as an improvement in the quality of life compared with baseline. Best results were obtained with early treatment. Overall incidence of bone events was 11.2%. Of the 212 patients (97.2%) evaluable for safety, 16% suffered adverse events and 66% expressed satisfaction with the treatment Discussion Zoledronic acid is effective for reducing pain, improving mobility, and increasing the quality of life in patients with prostate cancer with bone metastasis. Its easy administration and good tolerability make zoledronic acid one of the principal therapeutic tools in the management of patients with pain associated with bone metastasis from prostate cancer. PMID:19920966

  11. Human bone marrow-derived MSCs can home to orthotopic breast cancer tumors and promote bone metastasis

    PubMed Central

    Goldstein, Robert H; Reagan, Michaela R; Anderson, Kristen; Kaplan, David L; Rosenblatt, Michael

    2010-01-01

    American women have a nearly 25% lifetime risk of developing breast cancer, with 20–40% of these patients developing life-threatening metastases. Over 70% of patients presenting with metastases have skeletal involvement, which signals progression to an incurable stage. Tumor-stroma cell interactions are only superficially understood, specifically regarding the ability of stromal cells to affect metastasis. In vivo models show that exogenously supplied hBMSCs (human bone-marrow derived stem cells) migrate to breast cancer tumors, but no reports have shown endogenous hBMSC migration from the bone to primary tumors. Here we present a model of in vivo hBMSC migration from a physiologic human bone environment to human breast tumors. Further, hBMSCs alter tumor growth and bone metastasis frequency. hBMSCs may home to certain breast tumors based on tumor-derived TGF-β1. Moreover, at the primary tumor IL-17B/IL-17BR signaling may mediate interactions between hBMSCs and breast cancer cells (BCCs). PMID:21159629

  12. Breast cancer-associated metastasis is significantly increased in a model of autoimmune arthritis

    PubMed Central

    Das Roy, Lopamudra; Pathangey, Latha B; Tinder, Teresa L; Schettini, Jorge L; Gruber, Helen E; Mukherjee, Pinku

    2009-01-01

    Introduction Sites of chronic inflammation are often associated with the establishment and growth of various malignancies including breast cancer. A common inflammatory condition in humans is autoimmune arthritis (AA) that causes inflammation and deformity of the joints. Other systemic effects associated with arthritis include increased cellular infiltration and inflammation of the lungs. Several studies have reported statistically significant risk ratios between AA and breast cancer. Despite this knowledge, available for a decade, it has never been questioned if the site of chronic inflammation linked to AA creates a milieu that attracts tumor cells to home and grow in the inflamed bones and lungs which are frequent sites of breast cancer metastasis. Methods To determine if chronic inflammation induced by autoimmune arthritis contributes to increased breast cancer-associated metastasis, we generated mammary gland tumors in SKG mice that were genetically prone to develop AA. Two breast cancer cell lines, one highly metastatic (4T1) and the other non-metastatic (TUBO) were used to generate the tumors in the mammary fat pad. Lung and bone metastasis and the associated inflammatory milieu were evaluated in the arthritic versus the non-arthritic mice. Results We report a three-fold increase in lung metastasis and a significant increase in the incidence of bone metastasis in the pro-arthritic and arthritic mice compared to non-arthritic control mice. We also report that the metastatic breast cancer cells augment the severity of arthritis resulting in a vicious cycle that increases both bone destruction and metastasis. Enhanced neutrophilic and granulocytic infiltration in lungs and bone of the pro-arthritic and arthritic mice and subsequent increase in circulating levels of proinflammatory cytokines, such as macrophage colony stimulating factor (M-CSF), interleukin-17 (IL-17), interleukin-6 (IL-6), vascular endothelial growth factor (VEGF), and tumor necrosis factor-alpha (TNF-alpha) may contribute to the increased metastasis. Treatment with anti-IL17 + celecoxib, an anti-inflammatory drug completely abrogated the development of metastasis and significantly reduced the primary tumor burden. Conclusions The data clearly has important clinical implications for patients diagnosed with metastatic breast cancer, especially with regards to the prognosis and treatment options. PMID:19643025

  13. Breast-cancer-associated metastasis is significantly increased in a model of autoimmune arthritis.

    PubMed

    Das Roy, Lopamudra; Pathangey, Latha B; Tinder, Teresa L; Schettini, Jorge L; Gruber, Helen E; Mukherjee, Pinku

    2009-01-01

    Sites of chronic inflammation are often associated with the establishment and growth of various malignancies including breast cancer. A common inflammatory condition in humans is autoimmune arthritis (AA) that causes inflammation and deformity of the joints. Other systemic effects associated with arthritis include increased cellular infiltration and inflammation of the lungs. Several studies have reported statistically significant risk ratios between AA and breast cancer. Despite this knowledge, available for a decade, it has never been questioned if the site of chronic inflammation linked to AA creates a milieu that attracts tumor cells to home and grow in the inflamed bones and lungs which are frequent sites of breast cancer metastasis. To determine if chronic inflammation induced by autoimmune arthritis contributes to increased breast cancer-associated metastasis, we generated mammary gland tumors in SKG mice that were genetically prone to develop AA. Two breast cancer cell lines, one highly metastatic (4T1) and the other non-metastatic (TUBO) were used to generate the tumors in the mammary fat pad. Lung and bone metastasis and the associated inflammatory milieu were evaluated in the arthritic versus the non-arthritic mice. We report a three-fold increase in lung metastasis and a significant increase in the incidence of bone metastasis in the pro-arthritic and arthritic mice compared to non-arthritic control mice. We also report that the metastatic breast cancer cells augment the severity of arthritis resulting in a vicious cycle that increases both bone destruction and metastasis. Enhanced neutrophilic and granulocytic infiltration in lungs and bone of the pro-arthritic and arthritic mice and subsequent increase in circulating levels of proinflammatory cytokines, such as macrophage colony stimulating factor (M-CSF), interleukin-17 (IL-17), interleukin-6 (IL-6), vascular endothelial growth factor (VEGF), and tumor necrosis factor-alpha (TNF-alpha) may contribute to the increased metastasis. Treatment with anti-IL17 + celecoxib, an anti-inflammatory drug completely abrogated the development of metastasis and significantly reduced the primary tumor burden. The data clearly has important clinical implications for patients diagnosed with metastatic breast cancer, especially with regards to the prognosis and treatment options.

  14. Characterizing the inorganic/organic interface in cancer bone metastasis

    NASA Astrophysics Data System (ADS)

    Wu, Fei

    Bone metastasis frequently occurs in patients with advanced breast cancer and remains a major source of mortality. At the molecular level, bone is a nanocomposite composed of inorganic bone mineral deposited within an organic extracellular matrix (ECM). Although the exact mechanisms of bone metastasis remain unclear, the nanoscale materials properties of bone mineral have been implicated in this process. Bone apatite is closely related to synthetic hydroxyapatite (HAP, Ca10(PO4)6(OH)2) in terms of structural and mechanical properties. Additionally, although the primary protein content of bone is collagen I, the glycoprotein fibronectin (Fn) is essential in maintaining the overall integrity of the bone matrix. Importantly, in vivo, neither breast cancer cells nor normal bone cells interact directly with the bone mineral but rather with the protein film adsorbed onto the mineral surface. Therefore, we hypothesized that breast cancer cell functions were regulated by differential fibronectin adsorption onto hydroxyapatite, which led to pathological remodeling of the bone matrix and sustained bone metastasis. Three model systems containing HAP and Fn were developed for this thesis. In model system I, a library of synthetic HAP nanoparticles were utilized to investigate the effect of mineral size, shape, and crystallinity on Fn conformation, using Forster resonance energy transfer (FRET) spectroscopy. In model system II, Fn-functionalized large geologic HAP crystals were used instead of HAP nanoparticles to avoid cellular uptake when investigating subsequent cell functions. Overall our FRET analysis (models I and II) revealed that Fn conformation depended on size, surface chemistry, and roughness of underlying HAP. When breast cancer cells were seeded on the Fn-coated HAP crystal facets (model II), our data indicated high secretion levels of proangiogenic and proinflammatory factors associated with the presence of unfolded Fn conformations, likely caused by differential engagement of cell receptors integrins with the underlying Fn. Finally, in model system III, Fn fibrillar structures (mimicking the bone matrix) were fabricated and characterized in presence of HAP nanoparticles, suggesting that the presence of microcalcifications found in tumorous/inflammed tissues affects both the structural and mechanical properties of the surrounding ECM. Collectively, our study of cellular behavior regulated by mineral/ECM interactions provides insights into the pathogenesis of breast cancer bone metastasis as well as other HAP-related inflammation.

  15. The SK-N-AS human neuroblastoma cell line develops osteolytic bone metastases with increased angiogenesis and COX-2 expression

    PubMed Central

    Tsutsumimoto, Takahiro; Williams, Paul; Yoneda, Toshiyuki

    2014-01-01

    Neuroblastoma (NB), which arises from embryonic neural crest cells, is the most common extra-cranial solid tumor of childhood. Approximately half of NB patients manifest bone metastasis accompanied with bone pain, fractures and bone marrow failure, leading to disturbed quality of life and poor survival. To study the mechanism of bone metastasis of NB, we established an animal model in which intracardiac inoculation of the SK-N-AS human NB cells in nude mice developed osteolytic bone metastases with increased osteoclastogenesis. SK-N-AS cells induced the expression of receptor activator of NF-κB ligand and osteoclastogenesis in mouse bone marrow cells in the co-culture. SK-N-AS cells expressed COX-2 mRNA and produced substantial amounts of prostaglandin E2 (PGE2). In contrast, the SK-N-DZ and SK-N-FI human NB cells failed to develop bone metastases, induce osteoclastogenesis, express COX-2 mRNA and produce PGE2. Immunohistochemical examination of SK-N-AS bone metastasis and subcutaneous tumor showed strong expression of COX-2. The selective COX-2 inhibitor NS-398 inhibited PGE2 production and suppressed bone metastases with reduced osteoclastogenesis. NS-398 also inhibited subcutaneous SK-N-AS tumor development with decreased angiogenesis and vascular endothelial growth factor-A expression. Of interest, metastasis to the adrenal gland, a preferential site for NB development, was also diminished by NS-398. Our results suggest that COX2/PGE2 axis plays a critical role in the pathophysiology of osteolytic bone metastases and tumor development of the SK-NS-AS human NB. Inhibition of angiogenesis by suppressing COX-2/PGE2 may be an effective therapeutic approach for children with NB. PMID:26909300

  16. A New In Vitro Model of Breast Cancer Metastasis to Bone

    DTIC Science & Technology

    2008-04-01

    intravital videomicroscopy [11, 12] have revealed that early stage, pre-angiogenic interactions between the cancer cells and the bone environment are...Chambers AF, MacDonald IC, Schmidt EE, et al. (1995) Steps in tumor metastasis: New concepts from intravital videomicroscopy . 279 - 301 13. Steeg PS

  17. The prognosis analysis of different metastasis pattern in patients with different breast cancer subtypes: a SEER based study.

    PubMed

    Wang, Haiyong; Zhang, Chenyue; Zhang, Jingze; Kong, Li; Zhu, Hui; Yu, Jinming

    2017-04-18

    Studies on prognosis of different metastasis patterns in patients with different breast cancer subtypes (BCS) are limited. Therefore, we identified 7862 breast cancer patients with distant metastasis from 2010 to 2013 using Surveillance, Epidemiology, wand End Results (SEER) population-based data. The results showed that bone was the most common metastatic site and brain was the least common metastatic site, and the patients with HR+/HER2- occupied the highest metastasis proportion, the lowest metastasis proportion were found in HR-/HER2+ patients. Univariate and multivariate logistic regression analysis were used to analyze the association, and it was found that there were significant differences of distant metastasis patterns in patients with different BCS(different P value). Importantly, univariate and multivariate Cox regression analysis were used to analyze the prognosis. It was proven that only bone metastasis was not a prognostic factor in the HR+/HER2-, HR+/HER2+ and HR-/HER2+ subgroup (all, P > 0.05), and patients with brain metastasis had the worst cancer specific survival (CSS) in all the subgroups of BCS (all, P<0.01). Interestingly, for patients with two metastatic sites, those with bone and lung metastasis had best CSS in the HR+/HER2- (P<0.001) and HR+/HER2+ subgroups (P=0.009) However, for patients with three and four metastatic sites, there was no statistical difference in their CSS (all, P>0.05).

  18. The prognosis analysis of different metastasis pattern in patients with different breast cancer subtypes: a SEER based study

    PubMed Central

    Wang, Haiyong; Zhang, Chenyue; Zhang, Jingze; Kong, Li; Zhu, Hui; Yu, Jinming

    2017-01-01

    Studies on prognosis of different metastasis patterns in patients with different breast cancer subtypes (BCS) are limited. Therefore, we identified 7862 breast cancer patients with distant metastasis from 2010 to 2013 using Surveillance, Epidemiology, wand End Results (SEER) population-based data. The results showed that bone was the most common metastatic site and brain was the least common metastatic site, and the patients with HR+/HER2− occupied the highest metastasis proportion, the lowest metastasis proportion were found in HR-/HER2+ patients. Univariate and multivariate logistic regression analysis were used to analyze the association, and it was found that there were significant differences of distant metastasis patterns in patients with different BCS(different P value). Importantly, univariate and multivariate Cox regression analysis were used to analyze the prognosis. It was proven that only bone metastasis was not a prognostic factor in the HR+/HER2-, HR+/HER2+ and HR-/HER2+ subgroup (all, P > 0.05), and patients with brain metastasis had the worst cancer specific survival (CSS) in all the subgroups of BCS (all, P<0.01). Interestingly, for patients with two metastatic sites, those with bone and lung metastasis had best CSS in the HR+/HER2- (P<0.001) and HR+/HER2+ subgroups (P=0.009) However, for patients with three and four metastatic sites, there was no statistical difference in their CSS (all, P>0.05). PMID:28038448

  19. A Spontaneous 3D Bone-On-a-Chip for Bone Metastasis Study of Breast Cancer Cells.

    PubMed

    Hao, Sijie; Ha, Laura; Cheng, Gong; Wan, Yuan; Xia, Yiqiu; Sosnoski, Donna M; Mastro, Andrea M; Zheng, Si-Yang

    2018-03-01

    Bone metastasis occurs at ≈70% frequency in metastatic breast cancer. The mechanisms used by tumors to hijack the skeleton, promote bone metastases, and confer therapeutic resistance are poorly understood. This has led to the development of various bone models to investigate the interactions between cancer cells and host bone marrow cells and related physiological changes. However, it is challenging to perform bone studies due to the difficulty in periodic sampling. Herein, a bone-on-a-chip (BC) is reported for spontaneous growth of a 3D, mineralized, collagenous bone tissue. Mature osteoblastic tissue of up to 85 µm thickness containing heavily mineralized collagen fibers naturally formed in 720 h without the aid of differentiation agents. Moreover, co-culture of metastatic breast cancer cells is examined with osteoblastic tissues. The new bone-on-a-chip design not only increases experimental throughput by miniaturization, but also maximizes the chances of cancer cell interaction with bone matrix of a concentrated surface area and facilitates easy, frequent observation. As a result, unique hallmarks of breast cancer bone colonization, previously confirmed only in vivo, are observed. The spontaneous 3D BC keeps the promise as a physiologically relevant model for the in vitro study of breast cancer bone metastasis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Clinical outcome for patients of solitary bone only metastasis.

    PubMed

    Hosaka, Seiichi; Katagiri, Hirohisa; Honda, Yosuke; Wasa, Junji; Murata, Hideki; Takahashi, Mitsuru

    2016-03-01

    Solitary bone only metastasis (SBOM) is a rare condition in which metastasis is limited to a single skeletal lesion originating from a previously treated or controllable primary lesion. The study objective was to evaluate the clinical features and survival regarding this rare condition and to clarify its treatment strategy. A total of 1453 patients with bone metastasis registered in our hospital database were enrolled. To assess the primary and/or metastatic lesion we used plain X-ray images, CT, MRI and FDG-PET scans as well as bone scans. Among the patients, only 27 (1.8%) had SBOM. The primary cancers responsible for SBOM were lung in seven patients, breast in five, kidney in four, prostate in two, uterus in two and other types in seven. Treatment of SBOM involved resection in four patients, radiotherapy only in 17, radiotherapy in combination with zoledronate in six and chemotherapy with zoledronate in one. Local recurrence did not develop in the four cases treated with resection. However, in-field recurrence was found in 4 of 22 (18%) patients who underwent radiotherapy. All three patients who received >40 Gy did not develop in-field recurrence. The overall and event free survival rates at 5 years were 63% and 41%, respectively. Solitary bone only metastasis should be treated with wide resection or long-course radiotherapy at doses 40-50 Gy to achieve long lasting local tumor control. Copyright © 2015 The Japanese Orthopaedic Association. Published by Elsevier B.V. All rights reserved.

  1. Multiscale characterization of the mineral phase at skeletal sites of breast cancer metastasis.

    PubMed

    He, Frank; Chiou, Aaron E; Loh, Hyun Chae; Lynch, Maureen; Seo, Bo Ri; Song, Young Hye; Lee, Min Joon; Hoerth, Rebecca; Bortel, Emely L; Willie, Bettina M; Duda, Georg N; Estroff, Lara A; Masic, Admir; Wagermaier, Wolfgang; Fratzl, Peter; Fischbach, Claudia

    2017-10-03

    Skeletal metastases, the leading cause of death in advanced breast cancer patients, depend on tumor cell interactions with the mineralized bone extracellular matrix. Bone mineral is largely composed of hydroxyapatite (HA) nanocrystals with physicochemical properties that vary significantly by anatomical location, age, and pathology. However, it remains unclear whether bone regions typically targeted by metastatic breast cancer feature distinct HA materials properties. Here we combined high-resolution X-ray scattering analysis with large-area Raman imaging, backscattered electron microscopy, histopathology, and microcomputed tomography to characterize HA in mouse models of advanced breast cancer in relevant skeletal locations. The proximal tibial metaphysis served as a common metastatic site in our studies; we identified that in disease-free bones this skeletal region contained smaller and less-oriented HA nanocrystals relative to ones that constitute the diaphysis. We further observed that osteolytic bone metastasis led to a decrease in HA nanocrystal size and perfection in remnant metaphyseal trabecular bone. Interestingly, in a model of localized breast cancer, metaphyseal HA nanocrystals were also smaller and less perfect than in corresponding bone in disease-free controls. Collectively, these results suggest that skeletal sites prone to tumor cell dissemination contain less-mature HA (i.e., smaller, less-perfect, and less-oriented crystals) and that primary tumors can further increase HA immaturity even before secondary tumor formation, mimicking alterations present during tibial metastasis. Engineered tumor models recapitulating these spatiotemporal dynamics will permit assessing the functional relevance of the detected changes to the progression and treatment of breast cancer bone metastasis.

  2. Multiscale characterization of the mineral phase at skeletal sites of breast cancer metastasis

    PubMed Central

    Chiou, Aaron E.; Loh, Hyun Chae; Lynch, Maureen; Seo, Bo Ri; Song, Young Hye; Hoerth, Rebecca; Bortel, Emely L.; Willie, Bettina M.; Duda, Georg N.; Masic, Admir; Wagermaier, Wolfgang; Fratzl, Peter; Fischbach, Claudia

    2017-01-01

    Skeletal metastases, the leading cause of death in advanced breast cancer patients, depend on tumor cell interactions with the mineralized bone extracellular matrix. Bone mineral is largely composed of hydroxyapatite (HA) nanocrystals with physicochemical properties that vary significantly by anatomical location, age, and pathology. However, it remains unclear whether bone regions typically targeted by metastatic breast cancer feature distinct HA materials properties. Here we combined high-resolution X-ray scattering analysis with large-area Raman imaging, backscattered electron microscopy, histopathology, and microcomputed tomography to characterize HA in mouse models of advanced breast cancer in relevant skeletal locations. The proximal tibial metaphysis served as a common metastatic site in our studies; we identified that in disease-free bones this skeletal region contained smaller and less-oriented HA nanocrystals relative to ones that constitute the diaphysis. We further observed that osteolytic bone metastasis led to a decrease in HA nanocrystal size and perfection in remnant metaphyseal trabecular bone. Interestingly, in a model of localized breast cancer, metaphyseal HA nanocrystals were also smaller and less perfect than in corresponding bone in disease-free controls. Collectively, these results suggest that skeletal sites prone to tumor cell dissemination contain less-mature HA (i.e., smaller, less-perfect, and less-oriented crystals) and that primary tumors can further increase HA immaturity even before secondary tumor formation, mimicking alterations present during tibial metastasis. Engineered tumor models recapitulating these spatiotemporal dynamics will permit assessing the functional relevance of the detected changes to the progression and treatment of breast cancer bone metastasis. PMID:28923958

  3. Uncarboxylated Osteocalcin and Gprc6a Axis Produce Intratumoral Androgens in Castration-Resistant Prostate Cancer

    DTIC Science & Technology

    2016-05-01

    multiple pathways, despite castrate levels of testosterone . One such adaptive mechanism is the “intracrine” production of androgens in the primary...despite castrate levels of testosterone . One such adaptive mechanism is the “intracrine” production of androgens in the primary tumor and/or at... testosterone . Thus, just as the skeleton regulates fertility in an endocrine fashion, and it may also promote bone metastasis via an “intracrine” mechanism

  4. [The related factors of head and neck mocosal melanoma with lymph node metastasis].

    PubMed

    Yin, G F; Guo, W; Chen, X H; Huang, Z G

    2017-12-05

    Objective: To investigate the related factors of mucosal melanoma of head and neck with lymph node metastasis for early diagnosis and further treatments. Method: A retrospective analysis of 117 cases of head and neck mucosal malignant melanoma patients which received surgical treatment was performed. Eleven cases of patients with pathologically confirmed lymph node metastasis and 33 cases without lymph node metastasis (1∶3) were randomly selected to analyze. The related factors of lymph node metastasis of head and neck mucosal melanoma patients including age, gender, whether the existence of recurrence, bone invasion, lesion location were analyzed. The single factor and logistic regression analysis were performed, P <0.05 difference was statistically significant. Result: The lymph node metastasis rate of head and neck mucosal melanoma was 9.40%(11/117), the single factor analysis showed that there were 3 factors to be associated with lymph node metastasis, which was recurrence ( P =0.0000), bone invasion ( P =0.001), primary position ( P =0.007). Recurrence ( P =0.021) was a risk factor for lymph node metastasis according to the Logistic regression analysis, and the impact of bone invasion ( P =0.487) and primary location ( P =0.367) remained to be further explored. Conclusion: The patients of head and neck mucosal melanoma with the presence of recurrent usually accompanied by a further progression of the disease, such as lymph node metastasis, so for recurrent patients should pay special attention to the situation of lymph node and choose the reasonable treatment. Copyright© by the Editorial Department of Journal of Clinical Otorhinolaryngology Head and Neck Surgery.

  5. Differential proteomic analysis of a human breast tumor and its matched bone metastasis identifies cell membrane and extracellular proteins associated with bone metastasis.

    PubMed

    Dumont, Bruno; Castronovo, Vincent; Peulen, Olivier; Blétard, Noëlla; Clézardin, Philippe; Delvenne, Philippe; De Pauw, Edwin A; Turtoi, Andrei; Bellahcène, Akeila

    2012-04-06

    The classical fate of metastasizing breast cancer cells is to seed and form secondary colonies in bones. The molecules closely associated with these processes are predominantly present at the cell surface and in the extracellular space, establishing the first contacts with the target tissue. In this study, we had the rare opportunity to analyze a bone metastatic lesion and its corresponding breast primary tumor obtained simultaneously from the same patient. Using mass spectrometry, we undertook a proteomic study on cell surface and extracellular protein-enriched material. We provide a repertoire of significantly modulated proteins, some with yet unknown roles in the bone metastatic process as well as proteins notably involved in cancer cell invasiveness and in bone metabolism. The comparison of these clinical data with those previously obtained using a human osteotropic breast cancer cell line highlighted an overlapping group of proteins. Certain differentially expressed proteins are validated in the present study using immunohistochemistry on a retrospective collection of breast tumors and matched bone metastases. Our exclusive set of selected proteins supports the setup of further investigations on both clinical samples and experimental bone metastasis models that will help to reveal the finely coordinated expression of proteins that favor the development of metastases in the bone microenvironment.

  6. Site of metastasis and breast cancer mortality: a Danish nationwide registry-based cohort study.

    PubMed

    Ording, Anne Gulbech; Heide-Jørgensen, Uffe; Christiansen, Christian Fynbo; Nørgaard, Mette; Acquavella, John; Sørensen, Henrik Toft

    2017-01-01

    Survival among patients with metastatic breast cancer may vary according to the site of metastasis and receptor status. We used Danish nationwide medical registries to establish a cohort of patients with metastatic breast cancer (870 with de novo metastatic disease and 3518 with recurrent disease with distant metastasis) diagnosed during 1997-2011. We examined 1-year and >1 to 5-year mortality associated with first site of metastasis and receptor expression status of the primary tumor. Cox proportional regression was used to compute confounder-adjusted mortality rate ratios (MRRs) associated with site of metastasis, stratified by receptor status. Overall 1-year and >1 to 5-year mortality risks were 36 and 69 %, respectively. Risk of death within 1 year was highest for brain-only (62 %) and liver-only (43 %) involvement and nearly the same for patients with lung-only (32 %), bone-only (32 %) involvement, and other/combination of sites (34 %). Using bone-only metastasis as reference, women with brain-only metastasis had more than two-fold increased risk of dying. The adjusted MRR for women with liver-only metastasis also was increased, though less pronounced. Patients with lung-only [adjusted MRR 0.9 (95 % confidence interval (CI) 0.8, 1.1)] or other metastases [adjusted MRR 1.0 (95 % CI 0.9, 1.2)] had similar mortality as patients with bone-only metastasis. Positive hormonal receptor status was a favorable prognostic factor. Metastatic breast cancer has a serious prognosis. Patients with brain-only metastasis had the highest mortality. Positive hormonal receptor status on the primary tumor was a favorable prognostic factor for all metastatic sites.

  7. Prostate cancer involving bilateral seminal vesicles along with bone and testicular metastases: a case report.

    PubMed

    Gao, Qingqiang; Chen, Jianhuai; Dai, Yutian

    2018-03-09

    In the past 20 years, the incidence of prostate cancer has risen rapidly. It has been ranked as the third most common malignant tumor of the male genitourinary system. Testicular metastasis is uncommon in prostate cancer. Most cases are incidentally found in the treatment of prostate cancer with orchiectomy. Therefore, we believed it was necessary to report the case of our patient with this disease. We present a case of a 69-year-old Han Chinese man with a high total prostate-specific antigen level. A transrectal ultrasound-guided prostate biopsy was performed. A pathology report showed prostate cancer tissue with a Gleason score of 4 + 4 = 8/10. Imaging findings suggested that the prostate cancer tissue involved bilateral seminal vesicles and multiple bones. Next, radioactive seed implantation was carried out, and endocrine therapy was continued after the operation. Then enlargement of the left scrotum was found along with a total prostate-specific antigen level of 19.21 ng/ml. Computed tomography of the middle abdomen and pelvic cavity revealed 2.0 × 1.3-cm lesions of the left testis. The patient underwent a left testicular high resection and right orchiectomy. The postoperative pathology report showed metastatic prostate cancer cells in the left testis. Testicular metastasis of prostate cancer is rare. Therefore, a testicular physical examination is necessary for patients without relapse to avoid a missed diagnosis. Testicular metastasis should be treated according to the principle of treatment for advanced prostate adenocarcinoma if testicular metastasis of prostate adenocarcinoma is detected.

  8. Role of Katanin in Prostate Cancer Bone Metastasis

    DTIC Science & Technology

    2008-01-01

    AD_________________ Award Number: W81XWH-07-1-0055 TITLE: Role of Katanin in Prostate Cancer...Distribution Unlimited The views, opinions and/or findings contained in this report are those of the...DATES COVERED 18 DEC 2006 - 17 DEC 2007 4. TITLE AND SUBTITLE Role of Katanin in Prostate Cancer Bone Metastasis 5a. CONTRACT NUMBER 5b

  9. Interaction between tumor cell surface receptor RAGE and proteinase 3 mediates prostate cancer metastasis to bone

    PubMed Central

    Kolonin, Mikhail G.; Sergeeva, Anna; Staquicini, Daniela I.; Smith, Tracey L.; Tarleton, Christy A.; Molldrem, Jeffrey J.; Sidman, Richard L.; Marchiò, Serena; Pasqualini, Renata; Arap, Wadih

    2017-01-01

    Human prostate cancer often metastasizes to bone, but the biological basis for such site-specific tropism remains largely unresolved. Recent work led us to hypothesize that this tropism may reflect pathogenic interactions between RAGE, a cell surface receptor expressed on malignant cells in advanced prostate cancer, and proteinase 3 (PR3), a serine protease present in inflammatory neutrophils and hematopoietic cells within the bone marrow microenvironment. In this study, we establish that RAGE-PR3 interaction mediates homing of prostate cancer cells to the bone marrow. PR3 bound to RAGE on the surface of prostate cancer cells in vitro, inducing tumor cell motility through a non-proteolytic signal transduction cascade involving activation and phosphorylation of ERK1/2 and JNK1. In preclinical models of experimental metastasis, ectopic expression of RAGE on human prostate cancer cells was sufficient to promote bone marrow homing within a short time frame. Our findings demonstrate how RAGE-PR3 interactions between human prostate cancer cells and the bone marrow microenvironment mediate bone metastasis during prostate cancer progression, with potential implications for prognosis and therapeutic intervention. PMID:28428279

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Masala, Salvatore; Roselli, Mario; Manenti, Guglielmo

    A 70-year-old man with a painful vertebral metastasis was treated with combined percutaneous cryoablation and vertebroplasty therapy (CVT) in one session. The patient was suffering from diffuse visceral metastasized cholangiocarcinoma. After several weeks of back pain, magnetic resonance imaging documented a single L2 bone metastasis. In consultation with the oncologists, palliative combined CVT was administered with the aim of obtaining pain relief and bone stabilization. In our experience this combined treatment is safe and effective for immediate pain relief in painful bone metastases when other standard palliative treatments have failed.

  11. Developing a novel therapeutic strategy targeting Kallikrein-4 to inhibit prostate cancer growth and metastasis

    DTIC Science & Technology

    Kallikrein-related peptidase 4 (KLK4) is a rational therapeutic target for prostate cancer (PCa) as it is up-regulated in both localised and bone ...in PCa homing to bone . We therefore hypothesize that blockade of KLK4 activity will inhibit PCa growth and prevent metastasis to secondary sites like... bone . This project aims to develop a novel therapeutic strategy targeting KLK4 specifically in PCa. KLK4 siRNA is incorporated into a novel polymeric

  12. The Role of Hedgehog Signaling in Tumor Induced Bone Disease

    PubMed Central

    Cannonier, Shellese A.; Sterling, Julie A.

    2015-01-01

    Despite significant progress in cancer treatments, tumor induced bone disease continues to cause significant morbidities. While tumors show distinct mutations and clinical characteristics, they behave similarly once they establish in bone. Tumors can metastasize to bone from distant sites (breast, prostate, lung), directly invade into bone (head and neck) or originate from the bone (melanoma, chondrosarcoma) where they cause pain, fractures, hypercalcemia, and ultimately, poor prognoses and outcomes. Tumors in bone secrete factors (interleukins and parathyroid hormone-related protein) that induce RANKL expression from osteoblasts, causing an increase in osteoclast mediated bone resorption. While the mechanisms involved varies slightly between tumor types, many tumors display an increase in Hedgehog signaling components that lead to increased tumor growth, therapy failure, and metastasis. The work of multiple laboratories has detailed Hh signaling in several tumor types and revealed that tumor establishment in bone can be controlled by both canonical and non-canonical Hh signaling in a cell type specific manner. This review will explore the role of Hh signaling in the modulation of tumor induced bone disease, and will shed insight into possible therapeutic interventions for blocking Hh signaling in these tumors. PMID:26343726

  13. Partial resection and reconstruction of the sternum for treatment of metachronous sternal metastasis of thyroid carcinoma: A case report.

    PubMed

    Lan, Hong-Jing; Wu, Zhi-Qiang; Gong, Dong-Ge; Zheng, Wang-Yong; Jin, Yun

    2017-11-01

    Metachronous sternal metastasis of thyroid carcinoma was a rare disease. There was no consensus in the treatment for bone metastasis after the initial thyroid carcinoma surgery. A 53-year-old female patient was hospitalized due to recurrent dull chest pains, with a history of radical right side thyroid carcinoma 4 years ago. On examination, there was an irregular mass on the lower left half of the sternum. Computerized tomography scan showed sternal bone destruction with a soft tissue mass. Metachronous sternal metastasis of thyroid carcinoma. Partial resection of the sternum and reconstruction with a titanium alloy mesh were performed. After a 3-year follow-up, the patient had no recurrence. Surgical resection may be a sufficient treatment for metachronous sternal metastasis of thyroid carcinoma. Biosynthesis material mesh is preferred to be used.

  14. Complementary roles of tumour specific PET tracer ¹⁸F-FAMT to ¹⁸F-FDG PET/CT for the assessment of bone metastasis.

    PubMed

    Morita, Motoho; Higuchi, Tetsuya; Achmad, Arifudin; Tokue, Azusa; Arisaka, Yukiko; Tsushima, Yoshito

    2013-10-01

    The usefulness of (18)F-FDG PET/CT for bone metastasis evaluation has already been established. The amino acid PET tracer [(18)F]-3-fluoro-alpha-methyl tyrosine ((18)F-FAMT) has been reported to be highly specific for malignancy. We evaluated the additional value of (18)F-FAMT PET/CT to complement (18)F-FDG PET/CT in the evaluation of bone metastasis. This retrospective study included 21 patients with bone metastases of various cancers who had undergone both (18)F-FDG and (18)F-FAMT PET/CT within 1 month of each other. (18)F-FDG-avid bone lesions suspicious for malignancy were carefully selected based on the cut-off value for malignancy, and the SUVmax of the (18)F-FAMT in the corresponding lesions were evaluated. A total of 72 (18)F-FDG-positive bone lesions suspected to be metastases in the 21 patients were used as the reference standard. (18)F-FAMT uptake was found in 87.5 % of the lesions. In the lesions of lung cancer origin, the uptake of the two tracers showed a good correlation (40 lesions, r = 0.68, P < 0.01). Bone metastatic lesions of oesophageal cancer showed the highest average of (18)F-FAMT uptake. Bone metastatic lesions of squamous cell carcinoma showed higher (18)F-FAMT uptake than those of adenocarcinoma. No significant difference in (18)F-FAMT uptake was seen between osteoblastic and osteolytic bone metastatic lesions. The usefulness of (18)F-FAMT PET/CT for bone metastasis detection regardless of the lesion phenotype was demonstrated. The fact that (18)F-FAMT uptake was confirmed by (18)F-FDG uptake suggests that (18)F-FAMT PET/CT has the potential to complement (18)F-FDG PET/CT for the detection of bone metastases.

  15. Kinin and Purine Signaling Contributes to Neuroblastoma Metastasis.

    PubMed

    Ulrich, Henning; Ratajczak, Mariusz Z; Schneider, Gabriela; Adinolfi, Elena; Orioli, Elisa; Ferrazoli, Enéas G; Glaser, Talita; Corrêa-Velloso, Juliana; Martins, Poliana C M; Coutinho, Fernanda; Santos, Ana P J; Pillat, Micheli M; Sack, Ulrich; Lameu, Claudiana

    2018-01-01

    Bone marrow metastasis occurs in approximately 350,000 patients that annually die in the U.S. alone. In view of the importance of tumor cell migration into the bone marrow, we have here investigated effects of various concentrations of stromal cell-derived factor-1 (SDF-1), bradykinin- and ATP on bone marrow metastasis. We show for first time that bradykinin augmented chemotactic responsiveness of neuroblastoma cells to SDF-1 and ATP concentrations, encountered under physiological conditions. Bradykinin upregulated VEGF expression, increased metalloproteinase activity and induced adhesion of neuroblastoma cells. Bradykinin augmented SDF-1-induced intracellular Ca 2+ mobilization as well as resensitization and expression of ATP-sensing P2X7 receptors. Bradykinin treatment resulted in higher gene expression levels of the truncated P2X7B receptor compared to those of the P2X7A full-length isoform. Bradykinin as pro-metastatic factor induced tumor proliferation that was significantly decreased by P2X7 receptor antagonists; however, the peptide did not enhance cell death nor P2X7A receptor-related pore activity, promoting neuroblastoma growth. Furthermore, immunodeficient nude/nude mice transplanted with bradykinin-pretreated neuroblastoma cells revealed significantly higher metastasis rates compared to animals injected with untreated cells. In contrast, animals receiving Brilliant Blue G, a P2X7 receptor antagonist, did not show any specific dissemination of neuroblastoma cells to the bone marrow and liver, and metastasis rates were drastically reduced. Our data suggests correlated actions of kinins and purines in neuroblastoma dissemination, providing novel avenues for clinic research in preventing metastasis.

  16. Ectonucleotide pyrophosphatase/phosphodiesterase (E-NPP) and adenosine deaminase (ADA) activities in prostate cancer patients: influence of Gleason score, treatment and bone metastasis.

    PubMed

    Battisti, Vanessa; Maders, Liési D K; Bagatini, Margarete D; Battisti, Iara E; Bellé, Luziane P; Santos, Karen F; Maldonado, Paula A; Thomé, Gustavo R; Schetinger, Maria R C; Morsch, Vera M

    2013-04-01

    The relation between adenine nucleotides and cancer has already been described in literature. Considering that the enzymes ectonucleotide pyrophosphatase/phosphodiesterase (E-NPP) and adenosine deaminase (ADA) act together to control nucleotide levels, we aimed to investigate the role of these enzymes in prostate cancer (PCa). E-NPP and ADA activities were determined in serum and platelets of PCa patients and controls. We also verified the influence of the Gleason score, bone metastasis and treatment in the enzyme activities. Platelets and serum E-NPP activity increased, whereas ADA activity in serum decreased in PCa patients. In addition, Gleason score, metastasis and treatment influenced E-NPP and ADA activities. We may propose that E-NPP and ADA are involved in the development of PCa. Moreover, E-NPP and ADA activities are modified in PCa patients with distinct Gleason score, with bone metastasis, as well as in patients under treatment. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  17. Phosphoproteomic Assessment of Therapeutic Kinases for Personalized Therapy in Castration-Resistant Prostate Cancer

    DTIC Science & Technology

    2016-10-01

    Huang J , Witte ON (2016) Functional Screen Identifies Kinases Driving Prostate Cancer Visceral and Bone Metastasis. PNAS. 113(2):E172-E181. PMCID...Faltermeier CM, Carlin DE, Flemming DT, Wong CK, Newton Y, Sudha S, Vashisht AA, Huang J , Wohlschlegel JA, Graeber TG, Witte ON#, Stuart JM# (2016...Pitteri S, Huang J , Witte ON (2016) Activation of Notch1 Synergizes with Multiple Pathways in Promoting Castration Resistant Prostate Cancer. PNAS. In

  18. Dual targeting c-met and VEGFR2 in osteoblasts suppresses growth and osteolysis of prostate cancer bone metastasis.

    PubMed

    Lee, Changki; Whang, Young Mi; Campbell, Preston; Mulcrone, Patrick L; Elefteriou, Florent; Cho, Sun Wook; Park, Serk In

    2018-02-01

    Prostate cancer characteristically induces osteoblastic bone metastasis, for which no therapies are available. A dual kinase inhibitor of c-Met and VEGFR-2 (cabozantinib) was shown to reduce prostate cancer growth in bone, with evidence for suppressing osteoblastic activity. However, c-Met and VEGFR2 signaling in osteoblasts in the context of bone metastasis remain unclear. Here we show using cultured osteoblasts that hepatocyte growth factor (HGF) and VEGF-A increased receptor activator of NFκB ligand (RANKL) and M-CSF, two essential factors for osteoclastogenesis. Insulin-like growth factor-1 (IGF1) also increased RANKL and M-CSF via c-Met transactivation. The conditioned media from IGF1-, HGF-, or VEGFA-treated osteoblasts promoted osteoclastogenesis that was reversed by inhibiting c-Met and/or VEGFR2 in osteoblasts. In vivo experiments used cabozantinib-resistant prostate cancer cells (PC-3 and C4-2B) to test the effects of c-Met/VEGFR2 inhibition specifically in osteoblasts. Cabozantinib (60 mg/kg, 3 weeks) suppressed tumor growth in bone and reduced expression of RANKL and M-CSF and subsequent tumor-induced osteolysis. Collectively, inhibition of c-Met and VEGFR2 in osteoblasts reduced RANKL and M-CSF expression, and associated with reduction of tumor-induced osteolysis, suggesting that c-Met and VEGFR2 are promising therapeutic targets in bone metastasis. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Role of Adrenomedullin in Breast Cancer Bone Metastasis and Chemoresistance

    DTIC Science & Technology

    2008-05-01

    osteoblast proliferation but does not induce bone matrix protein (bone sialoprotein , type I collagen, osteocalcin, and osteopontin) mRNA expression...are incompletely understood. AM treatment stimulates osteoblast proliferation but does not induce bone matrix protein (bone sialoprotein , type I

  20. A squamous cell lung carcinoma with abscess-like distant metastasis.

    PubMed

    Dursunoğlu, Neşe; Başer, Sevin; Evyapan, Fatma; Kiter, Göksel; Ozkurt, Sibel; Polat, Bahattin; Karabulut, Nevzat

    2007-01-01

    This is a metastatic spread of squamous cell lung carcinoma to lungs, liver, lymph node, bone and subcutanous region as multiple abscess-like lesions. A fifty-five years old man admitted to the out-patient clinic with fever, cough, hemopthysis, night sweats, chest pain, abdominal pain and weight loss. In a short period of time abcess like lesions developed in his lungs, liver, lymph node, bone and subcutanous region. Though the clinical presentation is suggestive for an infectious condition, no success to antimicrobial treatment and negative results of microbiological studies have arised a need to further investigations. Histopathological studies of the abscess wall ultimately gave the definitive diagnosis as metastatic squamous cell carcinoma. We believe that case report is interesting because of the uncommon metastatic lesions masquerading the abscesses and also wide-spread multiple distant invasions of a squamous cell lung carcinoma in a short time period.

  1. Brain metastasis from ovarian cancer: a systematic review.

    PubMed

    Pakneshan, Shabnam; Safarpour, Damoun; Tavassoli, Fattaneh; Jabbari, Bahman

    2014-08-01

    To review the existing literature on brain metastasis (BM) from ovarian cancer and to assess the frequency, anatomical, clinical and paraclinical information and factors associated with prognosis. Ovarian cancer is a rare cause of brain metastasis with a recently reported increasing prevalence. Progressive neurologic disability and poor prognosis is common. A comprehensive review on this subject has not been published previously. This systematic literature search used the Pubmed and Yale library. A total of 66 publications were found, 57 of which were used representing 591 patients with BM from ovarian cancer. The median age of the patients was 54.3 years (range 20-81). A majority of patients (57.3 %) had multiple brain lesions. The location of the lesion was cerebellar (30 %), frontal (20 %), parietal (18 %) and occipital (11 %). Extracranial metastasis was present in 49.8 % of cases involving liver (20.7 %), lung (20.4 %), lymph nodes (12.6 %), bones (6.6 %) and pelvic organs (4.3 %). The most common symptoms were weakness (16 %), seizures (11 %), altered mentality (11 %) visual disturbances (9 %) and dizziness (8 %). The interval from diagnosis of breast cancer to BM ranged from 0 to 133 months (median 24 months) and median survival was 8.2 months. Local radiation, surgical resection, stereotactic radiosurgery and medical therapy were used. Factors that significantly increased the survival were younger age at the time of ovarian cancer diagnosis and brain metastasis diagnosis, lower grade of the primary tumor, higher KPS score and multimodality treatment for the brain metastases. Ovarian cancer is a rare cause of brain metastasis. Development of brain metastasis among older patients and lower KPS score correlate with less favorable prognosis. The more prolonged survival after using multimodality treatment for brain metastasis is important due to potential impact on management of brain metastasis in future.

  2. [Diagnostic values of serum type III procollagen N-terminal peptide in type IV gastric cancer].

    PubMed

    Akazawa, S; Fujiki, T; Kanda, Y; Kumai, R; Yoshida, S

    1985-04-01

    Since increased synthesis of collagen has been demonstrated in tissue of type IV gastric cancer, we attempted to distinguish type IV gastric cancer from other cancers by measuring serum levels of type III procollagen N-terminal peptide (type III-N-peptide). Mean serum levels in type IV gastric cancer patients without metastasis were found to be elevated above normal values and developed a tendency to be higher than those in types I, II and III gastric cancer patients without metastasis. Highly positive ratios were found in patients with liver diseases including hepatoma and colon cancer, biliary tract cancer, and esophageal cancer patients with liver, lung or bone metastasis, but only 2 out of 14 of these cancer patients without such metastasis showed positive serum levels of type III-N-peptide. Positive cases in patients with type IV gastric cancer were obtained not only in the group with clinical stage IV but also in the groups with clinical stages II and III. In addition, high serum levels of type III-N-peptide in patients with type IV gastric cancer were seen not only in the cases with liver, lung or bone metastasis but also in cases with disseminated peritoneal metastasis alone. These results suggest that if the serum level of type III-N-peptide is elevated above normal values, type IV gastric cancer should be suspected after ruling out liver diseases, myelofibrosis and liver, lung or bone metastasis.

  3. Psoralen inhibits bone metastasis of breast cancer in mice.

    PubMed

    Wu, Chunyu; Sun, Zhenping; Ye, Yiyi; Han, Xianghui; Song, Xiaoyun; Liu, Sheng

    2013-12-01

    Breast cancer is the most common female malignancy and it frequently metastasizes to bone. Metastatic breast cancer continues to be the primary cause of death for women in East and Southeast Asia. Psoralen is a furocoumarin that can be isolated from the seeds of Psoralea corylifolia L. Psoralen exhibits a wide range of biological properties and has been demonstrated as an antioxidant, antidepressant, anticancer, antibacterial, and antiviral agent. Additionally, it is involved in the formation and regulation of bone. This study investigated whether psoralen can inhibit metastasis of breast cancer to bone in vivo. Histological, molecular biological, and imaging analyses revealed that psoralen inhibits bone metastases in mice. Psoralen may function to inhibit breast cancer cell growth in the bone microenvironment and regulate the function of osteoblasts and osteoclasts in tumor-bearing mice. The results of this study suggest that psoralen is a bone-modifying agent and a potential therapeutic to treat patients with bone metastases. © 2013.

  4. Percutaneous cryoablation and vertebroplasty: a case report.

    PubMed

    Masala, Salvatore; Roselli, Mario; Manenti, Guglielmo; Mammucari, Matteo; Bartolucci, Dario Alberto; Simonetti, Giovanni

    2008-01-01

    A 70-year-old man with a painful vertebral metastasis was treated with combined percutaneous cryoablation and vertebroplasty therapy (CVT) in one session. The patient was suffering from diffuse visceral metastasized cholangiocarcinoma. After several weeks of back pain, magnetic resonance imaging documented a single L2 bone metastasis. In consultation with the oncologists, palliative combined CVT was administered with the aim of obtaining pain relief and bone stabilization. In our experience this combined treatment is safe and effective for immediate pain relief in painful bone metastases when other standard palliative treatments have failed.

  5. Anatomic Site Variability in Rat Skeletal Uptake and Desorption Of Fluorescently Labeled Bisphosphonate

    PubMed Central

    Wen, D.; Qing, L.; Harrison, G.; Golub, E.; Akintoye, S.O.

    2010-01-01

    Objectives Bisphosphonates commonly used to treat osteoporosis, Paget’s disease, multiple myeloma, hypercalcemia of malignancy and osteolytic lesions of cancer metastasis have been associated with bisphosphonate-associated jaw osteonecrosis (BJON). The underlying pathogenesis of BJON is unclear, but disproportionate bisphosphonate concentration in the jaw has been proposed as one potential etiological factor. This study tested the hypothesis that skeletal biodistribution of intravenous bisphosphonate is anatomic site-dependent in a rat model system. Materials and Methods Fluorescently labeled pamidronate was injected intravenously in athymic rats of equal weights followed by in vivo whole body fluorimetry, ex vivo optical imaging of oral, axial and appendicular bones and ethylenediaminetetraacetic acid bone decalcification to assess hydroxyapatite-bound bisphosphonate. Results Bisphosphonate uptake and bisphosphonate released per unit calcium were similar in oral and appendicular bones but lower than those in axial bones. Hydroxyapatite-bound bisphosphonate liberated by sequential acid decalcification was highest in oral relative to axial and appendicular bones (p < 0.05). Conclusions This study demonstrates regional differences in uptake and release of bisphosphonate from oral, axial and appendicular bones of immune deficient rats. PMID:21122034

  6. Clinicopathological factors associated with survival in patients with breast cancer brain metastasis.

    PubMed

    Li, Rong; Zhang, Kui; Siegal, Gene P; Wei, Shi

    2017-06-01

    Brain metastasis from breast cancer generally represents a catastrophic event yet demonstrates substantial biological heterogeneity. There have been limited studies solely focusing on the prognosis of patients with such metastasis. In this study, we carried out a comprehensive analysis in 108 consecutive patients with breast cancer brain metastases between 1997 and 2012 to further define clinicopathological factors associated with early onset of brain metastasis and survival outcomes after development of them. We found that lobular carcinoma, higher clinical stages at diagnosis, and lack of coexisting bone metastasis were significantly associated with a worse brain relapse-free survival when compared with brain-only metastasis. High histologic grade, triple-negative breast cancer, and absence of visceral involvement were unfavorable prognostic factors after brain metastasis. Furthermore, high histologic grade, advanced tumor stages, and lack of coexisting bone involvement indicated a worse overall survival. Thus, the previously established prognostic factors in early stage or advanced breast cancers may not entirely apply to patients with brain metastases. Furthermore, the prognostic significance of the clinicopathological factors differed before and after a patient develops brain metastasis. This knowledge might help in establishing an algorithm to further stratify patients with breast cancer into prognostically significant categories for optimal prevention, screening, and treatment of their brain metastasis. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Suppression of asparaginyl endopeptidase attenuates breast cancer-induced bone pain through inhibition of neurotrophin receptors.

    PubMed

    Yao, Peng; Ding, Yuanyuan; Han, Zhenkai; Mu, Ying; Hong, Tao; Zhu, Yongqiang; Li, Hongxi

    2017-01-01

    Objective Cancer-induced bone pain is a common clinical problem in breast cancer patients with bone metastasis. However, the mechanisms driving cancer-induced bone pain are poorly known. Recent studies show that a novel protease, asparaginyl endopeptidase (AEP) plays crucial roles in breast cancer metastasis and progression. We aim to determine the functions and targeted suppress of AEP in a mouse model of breast cancer-induced bone pain. Methods Breast cancer cells with AEP knocked-down or overexpression were constructed and implanted into the intramedullary space of the femur to induce pain-like behavior in mice. AEP-specific inhibitors or purified AEP proteins were further used in animal model. The histological characters of femur and pain ethological changes were measured. The expressions of AEP and neurotrophin receptors (p75NTR and TrkA) in dorsal root ganglion and spinal cord were examined. Results Femur radiographs and histological analysis revealed that cells with AEP knocked-down reduced bone destruction and pain behaviors. However, cells with AEP overexpression elevated bone damage and pain behaviors. Further, Western blot results found that the expressions of p75NTR and TrkA in dorsal root ganglions and spinal cords were reduced in mice inoculated with AEP knocked-down cells. Targeted suppression of AEP with specific small compounds significantly reduced the bone pain while purified recombinant AEP proteins increased bone pain. Conclusions AEP aggravate the development of breast cancer bone metastasis and bone pain by increasing the expression of neurotrophin receptors. AEP might be an effective target for treatment of breast cancerinduced bone pain.

  8. Collagen induced arthritis increases secondary metastasis in MMTV-PyV MT mouse model of mammary cancer.

    PubMed

    Roy, Lopamudra Das; Ghosh, Sriparna; Pathangey, Latha B; Tinder, Teresa L; Gruber, Helen E; Mukherjee, Pinku

    2011-08-22

    Several studies have demonstrated that sites of chronic inflammation are often associated with the establishment and growth of various malignancies. A common inflammatory condition in humans is autoimmune arthritis (AA). Although AA and cancer are different diseases, many of the underlying processes that contribute to the disorders of the joints and connective tissue that characterize AA also affect cancer progression and metastasis. Systemically, AA can lead to cellular infiltration and inflammation of the lungs. Several studies have reported statistically significant risk ratios between AA and breast cancer. Despite this knowledge being available, there has been minimal research linking breast cancer, arthritis, and metastasis associated with breast cancer. Notably both diseases are extremely prevalent in older post-menopausal women. To establish the novel link between arthritis induced inflammation and secondary metastasis associated with breast cancer, PyV MT mice that spontaneously develop mammary gland carcinoma were injected with Type II collagen (CII) to induce arthritis at 9 and 18 weeks of age for pre-metastatic and metastatic condition. The sites of secondary metastasis and the associated inflammatory microenvironment were evaluated. A significant increase in breast cancer-associated secondary metastasis to the lungs and bones was observed in the arthritic versus the non-arthritic PyV MT mice along with an increase in primary tumor burden. We report significant increases in the levels of interstitial cellular infiltrates and pro-inflammatory cytokines such as interleukin-17 (IL-17), interleukin-6 (IL-6), Pro- Matrix metallopeptidase 9 (Pro-MMP9), insulin like growth factor-II (GF-II) and macrophage colony stimulating factor (M-CSF) in the arthritic lung and bone milieu as well as in the circulation. These pro-inflammatory cytokines along with the inflammatory microenvironment may be the underlying factors facilitating tumor progression and metastasis in arthritic PyV MT mice. This was further substantiated by treatment with celecoxib, an anti-inflammatory drug + αIL-17 antibody that significantly reduced the secondary metastasis to lung and bone. The data generated not only reveal the underlying mechanism of high susceptibility to bone and lung metastasis in an arthritic condition but our combination therapies may lead to treatment modalities that will be capable of reducing tumor burden, and preventing relapse and metastasis in arthritic patients with breast cancer.

  9. Collagen induced arthritis increases secondary metastasis in MMTV-PyV MT mouse model of mammary cancer

    PubMed Central

    2011-01-01

    Background Several studies have demonstrated that sites of chronic inflammation are often associated with the establishment and growth of various malignancies. A common inflammatory condition in humans is autoimmune arthritis (AA). Although AA and cancer are different diseases, many of the underlying processes that contribute to the disorders of the joints and connective tissue that characterize AA also affect cancer progression and metastasis. Systemically, AA can lead to cellular infiltration and inflammation of the lungs. Several studies have reported statistically significant risk ratios between AA and breast cancer. Despite this knowledge being available, there has been minimal research linking breast cancer, arthritis, and metastasis associated with breast cancer. Notably both diseases are extremely prevalent in older post-menopausal women. Methods To establish the novel link between arthritis induced inflammation and secondary metastasis associated with breast cancer, PyV MT mice that spontaneously develop mammary gland carcinoma were injected with Type II collagen (CII) to induce arthritis at 9 and 18 weeks of age for pre-metastatic and metastatic condition. The sites of secondary metastasis and the associated inflammatory microenvironment were evaluated. Results A significant increase in breast cancer-associated secondary metastasis to the lungs and bones was observed in the arthritic versus the non-arthritic PyV MT mice along with an increase in primary tumor burden. We report significant increases in the levels of interstitial cellular infiltrates and pro-inflammatory cytokines such as interleukin-17 (IL-17), interleukin-6 (IL-6), Pro- Matrix metallopeptidase 9 (Pro-MMP9), insulin like growth factor-II (GF-II) and macrophage colony stimulating factor (M-CSF) in the arthritic lung and bone milieu as well as in the circulation. These pro-inflammatory cytokines along with the inflammatory microenvironment may be the underlying factors facilitating tumor progression and metastasis in arthritic PyV MT mice. This was further substantiated by treatment with celecoxib, an anti-inflammatory drug + αIL-17 antibody that significantly reduced the secondary metastasis to lung and bone. Conclusions The data generated not only reveal the underlying mechanism of high susceptibility to bone and lung metastasis in an arthritic condition but our combination therapies may lead to treatment modalities that will be capable of reducing tumor burden, and preventing relapse and metastasis in arthritic patients with breast cancer. PMID:21859454

  10. Emerging paradigms and questions on pro-angiogenic bone marrow-derived myelomonocytic cells.

    PubMed

    Laurent, Julien; Touvrey, Cédric; Botta, Francesca; Kuonen, François; Ruegg, Curzio

    2011-01-01

    Cancer-related inflammation has emerged in recent years as a major event contributing to tumor angiogenesis, tumor progression and metastasis formation. Bone marrow-derived and inflammatory cells promote tumor angiogenesis by providing endothelial progenitor cells that differentiate into mature endothelial cells, and by secreting pro-angiogenic factors and remodeling the extracellular matrix to stimulate angiogenesis though paracrine mechanisms. Several bone marrow-derived myelonomocytic cells, including monocytes and macrophages, have been identified and characterized by several laboratories in recent years. While the central role of these cells in promoting tumor angiogenesis, tumor progression and metastasis is nowadays well established, many questions remain open and new ones are emerging. These include the relationship between their phenotype and function, the mechanisms of pro-angiogenic programming, their contribution to resistance to anti-angiogenic treatments and to metastasis and their potential clinical use as biomarkers of angiogenesis and anti-angiogenic therapies. Here, we will review phenotypical and functional aspects of bone marrow-derived myelonomocytic cells and discuss some of the current outstanding questions.

  11. Coordinate regulation of microenvironmental stimuli and role of methylation in bone metastasis from breast carcinoma.

    PubMed

    Matteucci, Emanuela; Maroni, Paola; Disanza, Andrea; Bendinelli, Paola; Desiderio, Maria Alfonsina

    2016-01-01

    The pathogenesis of bone metastasis is unclear, and much focus in metastatic biology and therapy relays on epigenetic alterations. Since DNA-methyltransferase blockade with 5-aza-2'-deoxycytidine (dAza) counteracts tumour growth, here we utilized dAza to clarify whether molecular events undergoing epigenetic control were critical for bone metastatization. In particular, we investigated the patterns of secreted-protein acidic and rich in cysteine (SPARC) and of Endothelin 1, affected by DNA methyltransferases in tumours, with the hypothesis that in bone metastasis a coordinate function of SPARC and Endothelin 1, if any occurs, was orchestrated by DNA methylation. To this purpose, we prepared a xenograft model with the clone 1833, derived from human-MDA-MB231 cells, and dAza administration slowed-down metastasis outgrowth. This seemed consequent to the reductions of SPARC and Endothelin 1 at invasive front and in the bone marrow, mostly due to loss of Twist. In the metastasis bulk Snail, partly reduced by dAza, might sustain Endothelin 1-SPARC cooperativity. Both SPARC and Endothelin 1 underwent post-translational control by miRNAs, a molecular mechanism that might explain the in vivo data. Ectopic miR29a reduced SPARC expression also under long-term dAza exposure, while Endothelin 1 down-regulation occurred in the presence of endogenous-miR98 expression. Notably, dAza effects differed depending on in vivo and in vitro conditions. In 1833 cells exposed to 30-days dAza, SPARC-protein level was practically unaffected, while Endothelin 1 induction depended on the 3'-UTR functionality. The blockade of methyltransferases leading to SPARC reduction in vivo, might represent a promising strategy to hamper early steps of the metastatic process affecting the osteogenic niche. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Associations Between Serum Bone Biomarkers in Early Breast Cancer and Development of Bone Metastasis: Results From the AZURE (BIG01/04) Trial.

    PubMed

    Brown, Janet; Rathbone, Emma; Hinsley, Samantha; Gregory, Walter; Gossiel, Fatma; Marshall, Helen; Burkinshaw, Roger; Shulver, Helen; Thandar, Hasina; Bertelli, Gianfilippo; Maccon, Keane; Bowman, Angela; Hanby, Andrew; Bell, Richard; Cameron, David; Coleman, Robert

    2018-02-07

    Adjuvant therapies can prevent/delay bone metastasis development in breast cancer. We investigated whether serum bone turnover markers in early disease have clinical utility in identifying patients with a high risk of developing bone metastasis. Markers of bone formation (N-terminal propeptide of type-1 collagen [P1NP]) and bone resorption (C-telopeptide of type-1 collagen [CTX], pyridinoline cross-linked carboxy-terminal telopeptide of type-1 collagen [1-CTP]) were measured in baseline (pretreatment blood samples from 872 patients from a large randomized trial of adjuvant zoledronic acid (AZURE-ISRCTN79831382) in early breast cancer. Cox proportional hazards regression and cumulative incidence functions (adjusted for factors having a statistically significant effect on outcome) were used to investigate prognostic and predictive associations between recurrence events, bone marker levels, and clinical variables. All statistical tests were two-sided. When considered as continuous variables (log transformed), P1NP, CTX, and 1-CTP were each prognostic for future bone recurrence at any time (P = .006, P = .009, P = .008, respectively). Harrell's c-indices were a P1NP of 0.57 (95% confidence interval [CI] = 0.51 to 0.63), CTX of 0.57 (95% CI = 0.51 to 0.62), and 1-CTP of 0.57 (95% CI = 0.52 to 0.63). In categorical analyses based on the normal range, high baseline P1NP (>70 ng/mL) and CTX (>0.299 ng/mL), but not 1-CTP (>4.2 ng/mL), were also prognostic for future bone recurrence (P = .03, P = .03, P = .10, respectively). None of the markers were prognostic for overall distant recurrence; that is, they were bone metastasis specific, and none of the markers were predictive of treatment benefit from zoledronic acid. Serum P1NP, CTX, and 1-CTP are clinically useful, easily measured markers that show good prognostic ability (though low-to-moderate discrimination) for bone-specific recurrence and are worthy of further study. © The Author(s) 2018. Published by Oxford University Press.

  13. Denosumab and Bone Metastasis–Free Survival in Men With Nonmetastatic Castration-Resistant Prostate Cancer: Exploratory Analyses by Baseline Prostate-Specific Antigen Doubling Time

    PubMed Central

    Smith, Matthew R.; Saad, Fred; Oudard, Stephane; Shore, Neal; Fizazi, Karim; Sieber, Paul; Tombal, Bertrand; Damiao, Ronaldo; Marx, Gavin; Miller, Kurt; Van Veldhuizen, Peter; Morote, Juan; Ye, Zhishen; Dansey, Roger; Goessl, Carsten

    2013-01-01

    Purpose Denosumab, an anti–RANK ligand monoclonal antibody, significantly increases bone metastasis–free survival (BMFS; hazard ratio [HR], 0.85; P = .028) and delays time to first bone metastasis in men with nonmetastatic castration-resistant prostate cancer (CRPC) and baseline prostate-specific antigen (PSA) ≥ 8.0 ng/mL and/or PSA doubling time (PSADT) ≤ 10.0 months. To identify men at greatest risk for bone metastasis or death, we evaluated relationships between PSA and PSADT with BMFS in the placebo group and the efficacy and safety of denosumab in men with PSADT ≤ 10, ≤ 6, and ≤ 4 months. Patients and Methods A total of 1,432 men with nonmetastatic CRPC were randomly assigned 1:1 to monthly subcutaneous denosumab 120 mg or placebo. Enrollment began February 2006; primary analysis cutoff was July 2010, when approximately 660 men were anticipated to have developed bone metastases or died. Results In the placebo group, shorter BMFS was observed as PSADT decreased below 8 months. In analyses by shorter baseline PSADT, denosumab consistently increased BMFS by a median of 6.0, 7.2, and 7.5 months among men with PSADT ≤ 10 (HR, 0.84; P = .042), ≤ 6 (HR, 0.77; P = .006), and ≤ 4 months (HR, 0.71; P = .004), respectively. Denosumab also consistently increased time to bone metastasis by PSADT subset. No difference in survival was observed between treatment groups for the overall study population or PSADT subsets. Conclusion Patients with shorter PSADT are at greater risk for bone metastasis or death. Denosumab consistently improves BMFS in men with shorter PSADT and seems to have the greatest treatment effects in men at high risk for progression. PMID:24043751

  14. CXXL 14 Blockade of CXCL12/CXCR4 Signaling in Prostate Cancer Bone Metastasis

    DTIC Science & Technology

    2016-10-01

    is a common and unfortunate complication of advanced prostate cancer resulting in significant pain and fractures . The most devastating consequence...metastasis often experience bone pain and pathological fractures . Metastatic spread accounts for the majority of cancer mortalities, highlighting the...These data suggest a mechanism of increased migration and invasion is due to EMT. Regulation of Kinase Signaling by CXCL14 CXCL12 activates

  15. Interactions between human osteoblasts and prostate cancer cells in a novel 3D in vitro model

    PubMed Central

    Sieh, Shirly; Lubik, Amy A; Clements, Judith A; Nelson, Colleen C

    2010-01-01

    Cell-cell and cell-matrix interactions play a major role in tumor morphogenesis and cancer metastasis. Therefore, it is crucial to create a model with a biomimetic microenvironment that allows such interactions to fully represent the pathophysiology of a disease for an in vitro study. This is achievable by using three-dimensional (3D) models instead of conventional two-dimensional (2D) cultures with the aid of tissue engineering technology. We are now able to better address the complex intercellular interactions underlying prostate cancer (CaP) bone metastasis through such models. In this study, we assessed the interaction of CaP cells and human osteoblasts (hOBs) within a tissue engineered bone (TEB) construct. Consistent with other in vivo studies, our findings show that intercellular and CaP cell-bone matrix interactions lead to elevated levels of matrix metalloproteinases, steroidogenic enzymes and the CaP biomarker, prostate specific antigen (PSA); all associated with CaP metastasis. Hence, it highlights the physiological relevance of this model. We believe that this model will provide new insights for understanding of the previously poorly understood molecular mechanisms of bone metastasis, which will foster further translational studies, and ultimately offer a potential tool for drug screening. PMID:21197221

  16. The role of whole-body bone scanning and clinical factors in detecting bone metastases in patients with non-small cell lung cancer.

    PubMed

    Erturan, Serdar; Yaman, Mustafa; Aydin, Günay; Uzel, Isil; Müsellim, Benan; Kaynak, Kamil

    2005-02-01

    Correct detection of bone metastases in patients with non-small cell lung cancer (NSCLC) is crucial for prognosis and selection of an appropriate treatment regimen. The aim of this study was to investigate the role of whole-body bone scanning (WBBS) and clinical factors in detecting bone metastases in NSCLC. One hundred twenty-five patients with a diagnosis made between 1998 and 2002 were recruited (squamous cell carcinoma, 54.4%; adenocarcinoma, 32.8%; non-small cell carcinoma, 8.8%; large cell carcinoma, 4%). Clinical factors suggesting bone metastasis (skeletal pain, elevated alkaline phosphatase, hypercalcemia) were evaluated. WBBS was performed in all patients, and additional MRI was ordered in 10 patients because of discordance between clinical factors and WBBS findings. Bone metastases were detected in 53% (n = 21) of 39 clinical factor-positive patients, 5.8% (n = 5) of 86 clinical factor-negative patients, and 20.8% of total patients. The existence of bone-specific clinical factors as indicators of metastasis presented 53.8% positive predictive value (PPV), 94.2% negative predictive value (NPV), and 81.6% accuracy. However, the findings of WBBS showed 73.5% PPV, 97.8% NPV, and 91.2% accuracy. Adenocarcinoma was the most common cell type found in patients with bone metastasis (39%). The routine bone scanning prevented two futile thoracotomies (8%) in 25 patients with apparently operable lung cancer. In spite of the high NPV of the bone-specific clinical factors and the high value obtained in the false-positive findings in the bone scan, the present study indicates that in patients for whom surgical therapy is an option, preoperative staging using WBBS can be helpful to avoid misstaging due to asymptomatic bone metastases.

  17. Phase I clinical study of personalized peptide vaccination combined with radiotherapy for advanced hepatocellular carcinoma

    PubMed Central

    Shen, Jie; Wang, Li-Feng; Zou, Zheng-Yun; Kong, Wei-Wei; Yan, Jing; Meng, Fan-Yan; Chen, Fang-Jun; Du, Juan; Shao, Jie; Xu, Qiu-Ping; Ren, Hao-Zhen; Li, Ru-Tian; Wei, Jia; Qian, Xiao-Ping; Liu, Bao-Rui

    2017-01-01

    AIM To assess the efficacy and safety of a new treatment modality, cellular immune therapy based on personalized peptide vaccination (PPV-DC-CTL) combined with radiotherapy, for treating advanced hepatocellular carcinoma (HCC). METHODS A total of nine patients with advanced HCC were enrolled. Multidisciplinary consultation confirmed that all the patients definitely had no opportunity of surgery, because four patients had multiple liver metastases (the number of liver lesions > 3), one patient had liver metastases and portal vein tumor thrombosis, one patient had lung and bone metastases, two patients had liver and lung metastases and one patient had liver metastasis and peritoneal metastasis. Patients with metastasis were treated with precise radiotherapy combined with PPV-DC-CTL. RESULTS Following radiotherapy and one to three cycles of PPV-DC-CTL treatment, AFP levels were significantly decreased in six patients and imaging assessment of the lesions showed a partial response (PR) in three patients and stable disease in the other three patients. The response rate was 33% and disease control rate was 66%. This regimen was found to be safe and well tolerated. None of the patients developed liver or kidney side effects. Only one patient developed grade II bone marrow suppression and the remaining patients had no significant hematological side effects. CONCLUSION Radiotherapy combined with PPV-DC-CTL provides a new therapeutic strategy for patients with advanced HCC, which is well tolerated, safe, feasible and effective. PMID:28839440

  18. BMP9 inhibits the bone metastasis of breast cancer cells by downregulating CCN2 (connective tissue growth factor, CTGF) expression.

    PubMed

    Ren, Wei; Sun, Xiaoxiao; Wang, Ke; Feng, Honglei; Liu, Yuehong; Fei, Chang; Wan, Shaoheng; Wang, Wei; Luo, Jinyong; Shi, Qiong; Tang, Min; Zuo, Guowei; Weng, Yaguang; He, Tongchuan; Zhang, Yan

    2014-03-01

    Bone morphogenetic proteins (BMPs), which belong to the transforming growth factor-β superfamily, regulate a wide range of cellular responses including cell proliferation, differentiation, adhesion, migration, and apoptosis. BMP9, the latest BMP to be discovered, is reportedly expressed in a variety of human carcinoma cell lines, but the role of BMP9 in breast cancer has not been fully clarified. In a previous study, BMP9 was found to inhibit the growth, migration, and invasiveness of MDA-MB-231 breast cancer cells. In the current study, the effect of BMP9 on the bone metastasis of breast cancer cells was investigated. After absent or low expression of BMP9 was detected in the MDA-MB-231 breast cancer cells and breast non-tumor adjacent tissues using Western blot and immunohistochemistry, In our previous study, BMP9 could inhibit the proliferation and invasiveness of breast cancer cells MDA-MB-231 in vitro and in vivo. This paper shows that BMP9 inhibit the bone metastasis of breast cancer cells by activating the BMP/Smad signaling pathway and downregulating connective tissue growth factor (CTGF); however, when CTGF expression was maintained, the inhibitory effect of BMP9 on the MDA-MB-231 cells was abolished. Together, these observations indicate that BMP9 is an important mediator of breast cancer bone metastasis and a potential therapeutic target for treating this deadly disease.

  19. Effect of zoledronic acid and amputation on bone invasion and lung metastasis of canine osteosarcoma in nude mice

    PubMed Central

    Wolfe, Tobie D.; Somanathan Pillai, Smitha Pankajavally; Hildreth, Blake Eason; Lanigan, Lisa G.; Martin, Chelsea K.; Werbeck, Jillian L.

    2014-01-01

    Osteosarcoma (OSA) is an aggressive, highly metastatic and lytic primary bone neoplasm commonly affecting the appendicular skeleton of dogs and children. Current treatment options include amputation of the afflicted limb, limb-sparing procedures, or palliative radiation with or without adjunct chemotherapy. Therapies that inhibit bone resorption, such as the bisphosphonates, may be an effective palliative therapy by limiting the local progression of OSA in those patients that are not viable candidates for amputation. We have developed a mouse model of canine skeletal OSA following intratibial inoculation of OSCA40 cells that spontaneously metastasized to the lungs. We demonstrated that therapy with a nitrogen-containing bisphosphonate, zoledronic acid (Zol), reduced OSA-induced bone lysis; however, Zol monotherapy or in combination with amputation was not effective at inhibiting pulmonary metastasis. While not reaching statistical significance, amputation of the tumor-bearing limb reduced the average incidence of lung metastases; however, this effect was nullified when Zol was added to the treatment protocol. In untreated mice, the magnitude of proximal tibial lysis was significantly correlated with the incidence of metastasis. The data support amputation alone for the management of appendicular OSA rather than combining amputation with Zol. However, in patients that are not viable candidates for amputation, Zol may be a useful palliative therapy for OSA by reducing the magnitude of lysis and therefore bone pain, despite the risk of increased pulmonary metastasis. PMID:21374084

  20. Bone marrow-derived Gr1+ cells can generate a metastasis-resistant microenvironment via induced secretion of thrombospondin-1

    PubMed Central

    Catena, Raúl; Bhattacharya, Nandita; Rayes, Tina El; Wang, Suming; Choi, Hyejin; Gao, Dingcheng; Ryu, Seongho; Joshi, Natasha; Bielenberg, Diane; Lee, Sharrell B.; Haukaas, Svein A.; Gravdal, Karsten; Halvorsen, Ole J.; Akslen, Lars A.; Watnick, Randolph S.; Mittal, Vivek

    2013-01-01

    Metastatic tumors have been shown to establish permissive microenvironments for metastases via recruitment of bone marrow (BM)- derived cells. Here, we show that metastasis-incompetent tumors are also capable of generating such microenvironments. However, in these situations the otherwise pro-metastatic Gr1+ myeloid cells create a metastasis-refractory microenvironment via the induction of thrombospondin-1 (Tsp-1) by tumor-secreted prosaposin. (BM)-specific genetic deletion of Tsp-1 abolished the inhibition of metastasis, which was restored by BM transplant from Tsp-1+ donors. We also developed a 5-amino acid peptide from prosaposin as a pharmacological inducer of Tsp-1 in Gr1+ BM cells, which dramatically suppresses metastasis. These results provide mechanistic insights into why certain tumors are deficient in metastatic potential and implicate recruited Gr1+ myeloid cells as the main source of Tsp-1. The results underscore the plasticity of Gr1+ cells, which, depending on the context, promote or inhibit metastasis, and suggest that the peptide could be a potential therapeutic agent against metastatic cancer. PMID:23633432

  1. The Difficult Task of Diagnosing Prostate Cancer Metastases on Dry Bone.

    PubMed

    Castoldi, Elisa; Cappella, Annalisa; Gibelli, Daniele; Sforza, Chiarella; Cattaneo, Cristina

    2018-05-01

    The interpretation of pathology on skeletal remains is mandatory for implementing the biological profile and for disease recognition. Prostate cancer is one of the most common tumors, with a high preference for the skeleton as a primary site of metastasis. Its diagnosis on bone is however still ambiguous, due to its "osteoblastic" and resorptive manifestation. This study investigates distribution and appearance of prostate cancer metastases on dry bone on six known cases (selected from the Milano Cemetery Skeletal Collection) and one healthy individual. A macroscopic inspection was performed highlighting the abnormalities observed, describing location, shape, dimension, and aspect. A great amount of proliferative and mixed lesions was noticed, but also cases of pure lytic lesions were displayed. The multiple appearances of the manifestations observed display the difficulty in correctly identifying such a pathology, but also the potential and advantages provided by investigating a study sample with known antemortem history. © 2017 American Academy of Forensic Sciences.

  2. Evaluation of antitumor activity and cardiac toxicity of a bone-targeted ph-sensitive liposomal formulation in a bone metastasis tumor model in mice.

    PubMed

    Dos Santos Ferreira, Diego; Jesus de Oliveira Pinto, Bruno Luís; Kumar, Vidhya; Cardoso, Valbert Nascimento; Fernandes, Simone Odília; Souza, Cristina Maria; Cassali, Geovanni Dantas; Moore, Anna; Sosnovik, David E; Farrar, Christian T; Leite, Elaine Amaral; Alves, Ricardo José; de Oliveira, Mônica Cristina; Guimarães, Alexander Ramos; Caravan, Peter

    2017-07-01

    Chemotherapy for bone tumors is a major challenge because of the inability of therapeutics to penetrate dense bone mineral. We hypothesize that a nanostructured formulation with high affinity for bone could deliver drug to the tumor while minimizing off-target toxicity. Here, we evaluated the efficacy and toxicity of a novel bone-targeted, pH-sensitive liposomal formulation containing doxorubicin in an animal model of bone metastasis. Biodistribution studies with the liposome showed good uptake in tumor, but low accumulation of doxorubicin in the heart. Mice treated with the bone-targeted liposome formulation showed a 70% reduction in tumor volume, compared to 35% reduction for free doxorubicin at the same dose. Both cardiac toxicity and overall mortality were significantly lower for animals treated with the bone-targeted liposomes compared to free drug. Bone-targeted, pH-sensitive, doxorubicin containing liposomes represent a promising approach to selectively delivering doxorubicin to bone tumors while minimizing cardiac toxicity. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Mixed spine metastasis detection through positron emission tomography/computed tomography synthesis and multiclassifier

    PubMed Central

    Yao, Jianhua; Burns, Joseph E.; Sanoria, Vic; Summers, Ronald M.

    2017-01-01

    Abstract. Bone metastases are a frequent occurrence with cancer, and early detection can guide the patient’s treatment regimen. Metastatic bone disease can present in density extremes as sclerotic (high density) and lytic (low density) or in a continuum with an admixture of both sclerotic and lytic components. We design a framework to detect and characterize the varying spectrum of presentation of spine metastasis on positron emission tomography/computed tomography (PET/CT) data. A technique is proposed to synthesize CT and PET images to enhance the lesion appearance for computer detection. A combination of watershed, graph cut, and level set algorithms is first run to obtain the initial detections. Detections are then sent to multiple classifiers for sclerotic, lytic, and mixed lesions. The system was tested on 44 cases with 225 sclerotic, 139 lytic, and 92 mixed lesions. The results showed that sensitivity (false positive per patient) was 0.81 (2.1), 0.81 (1.3), and 0.76 (2.1) for sclerotic, lytic, and mixed lesions, respectively. It also demonstrates that using PET/CT data significantly improves the computer aided detection performance over using CT alone. PMID:28612036

  4. Muscle metastasis from non-small cell lung cancer: two cases and literature review.

    PubMed

    Tezcan, Y; Koc, M

    2014-08-01

    Non-small cell lung cancers (NSCLC) is the most commonly observed group among lung cancers. Adenocancers are histopathologically more common. Males are more affected than females, an effect which is directly related to smoking. They generally cause distant haematogenous and lymphatic metastasis. Distant haematogenous metastases are often seen in contralateral lung, brain, bone, adrenals, and liver. Muscle metastases from NSCLC are quite rare and male cases are more frequently affected compared to female cases. NSCLC cases with muscle metastasis are at the same time accompanied by distant organ metastases such as bone, brain, and liver. All treatment approaches are considered to be palliative in these cases, which are symptomatologically quite severe. In the present study, we presented the rarely observed cases of two male patients with muscle metastasis from NSCLC together with the related literature.

  5. [Giant-cell tumor of the patella with lung metastases: a case report].

    PubMed

    Bahri, I; Ben Yahia, N; Boudawara, T; Makni, S; Fakhfakh, B; Kechaou, S; Keskes, H; Jlidi, R

    2003-06-01

    Giant-cell tumors are an infrequent clinical, radiological, and pathological entity observed in 5% of primary bone tumors. They generally occur at the epiphysis of long bones, particularly in the knee area but patellar localization seems very rare. Despite their perfectly benign histological aspect, giant-cell tumors may be aggressive, leading to local recurrence or even distant metastasis to the lung. We report a case of benign giant-cell tumor of the patella with lung metastasis observed in a 23-year-old woman. The aggressive radiological image was suggestive of chondrosarcoma. Histologically the differential diagnosis with chondroblastoma was difficult. The tumor and lung metastasis were treated by surgical resection. Four years later there has been no recurrence. We present the anatomic and clinical aspects of giant-cell tumor of the bone together with the diagnostic approach and the clinical course.

  6. Cancer patients use hospital-based care until death: a further analysis of the Dutch Bone Metastasis Study.

    PubMed

    Meeuse, Jan J; van der Linden, Yvette M; Post, Wendy J; Wanders, Rinus; Gans, Rijk O B; Leer, Jan Willem H; Reyners, Anna K L

    2011-10-01

    To describe health care utilization (HCU) at the end of life in cancer patients. These data are relevant to plan palliative care services, and to develop training programs for involved health care professionals. The Dutch Bone Metastasis Study (DBMS) was a nationwide study proving equal effectiveness of single fraction palliative radiotherapy compared with multiple fractions for painful bone metastases in 1157 patients. The 860 (74%) patients who died during follow-up were included in the current analysis. The main outcome was the frequency of hospital-based (outpatient contact or admission) and/or general practitioner (GP) contact during the last 12 weeks of life. Changes in HCU towards death were related to data on quality of life and pain intensity using a multilevel regression model. Hospital-based HCU was reported in 1801 (63%) returned questionnaires, whereas GP contact was stated in 1246 (43%). In 573 (20%) questionnaires, both types of HCU were reported. In multilevel regression analyses, the frequency of outpatient contacts remained constant during the weeks towards death, whereas the frequency of GP contacts increased. Lower valuation of quality of life was related to both GP- and hospital-based HCU. There was a high consumption of hospital-based HCU in the last 12 weeks of life of cancer patients with bone metastases. Hospital-based HCU did not decrease during the weeks towards death, despite an increase in GP contacts. Future planning of palliative care and training programs should encompass close collaboration between medical specialists and GPs to optimize end-of-life care.

  7. Postradiation atrophy of mature bone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Erguen, H.; Howland, W.J.

    1980-01-01

    The growing number of oncological patients subjected to radiotherapy require the diagnostic radiologist to be aware of expected bone changes following irradiation and the differentiation of this entity from metastasis. The primary event of radiation damage to bone is atrophy and true necrosis of bone is uncommon. The postradiation atrophic changes of bone are the result of combined cellular and vascular damage, the former being more important. The damage to the osteoblast resulting in decreased matrix production is apparently the primary histopathologic event. Radiation damaged bone is susceptible to superimposed complications of fracture, infection, necrosis, and sarcoma. The primary radiographicmore » evidence of atrophy, localized osteopenia, is late in appearing, mainly because of the relative insensitivity of radiographs in detecting demineralization. Contrary to former views, the mature bone is quite radiosensitive and reacts quickly to even small doses of radiation. In vivo midrodensitometric analysis and radionuclide bone and bone marrow scans can reveal early changes following irradiation. The differentiation of postirradiation atrophy and metastasis may be difficult. Biopsy should be the last resort because of the possibility of causing true necrosis in atrophic bone by trauma and infection.« less

  8. Postradiation atrophy of mature bone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ergun, H.; Howland, W.J.

    1980-01-01

    The growing number of oncological patients subjected to radiotherapy require the diagnostic radiologist to be aware of expected bone changes following irradiation and the differentiation of this entity from metastasis. The primary event of radiation damage to bone is atrophy and true necrosis of bone is uncommon. The postradiation atrophic changes of bone are the result of combined cellular and vascular damage, the former being more important. The damage to the osteoblast resulting in decreased matrix production is apparently the primary histopathologic event. Radiation damaged bone is susceptible to superimposed complications of fracture, infection, necrosis, and sarcoma. The primary radiographicmore » evidence of atrophy, localized osteopenia, is late in appearing, mainly because of the relative insensitivity of radiographs in detecing demineralization. Contrary to former views, the mature bone is quite radiosensitive and reacts quickly to even small doses of radiation. In vivo midrodensitometric analysis and radionuclide bone and bone marrow scans can reveal early changes following irradiation. The differentiation of postirradiation atrophy and metastasis may be difficult. Biopsy should be the last resort because of the possibility of causing true necrosis in atrophic bone by trauma and infection.« less

  9. DKK1 and Kremen Expression Predicts the Osteoblastic Response to Bone Metastasis.

    PubMed

    Clines, Katrina L; Clines, Gregory A

    2018-05-14

    Bone metastasis is a complication of advanced breast and prostate cancer. Tumor-secreted Dickkopf homolog 1 (DKK1), an inhibitor of canonical Wnt signaling and osteoblast differentiation, was proposed to regulate the osteoblastic response to metastatic cancer in bone. The objectives of this study were to compare DKK1 expression with the in vivo osteoblastic response in a panel of breast and prostate cancer cell lines, and to discover mechanisms that regulate cancer DKK1 expression. DKK1 expression was highest in MDA-MB-231 and PC3 cells that produce osteolytic lesions, and hence a suppressed osteoblastic response, in animal models of bone metastasis. LnCaP, C4-2B, LuCaP23.1, T47D, ZR-75-1, MCF-7, ARCaP and ARCaP M cancer cells that generate osteoblastic, mixed or no bone lesions had the lowest DKK1 expression. The cell lines with negligible expression, LnCaP, C4-2B and T47D, exhibited methylation of the DKK1 promoter. Canonical Wnt signaling activity was then determined and found in all cell lines tested, even in the MDA-MB-231 and PC3 cell lines despite sizeable amounts of DKK1 protein expression expected to block canonical Wnt signaling. A mechanism of DKK1 resistance in the osteolytic cell lines was investigated and determined to be at least partially due to down-regulation of the DKK1 receptors Kremen1 and Kremen2 in the MDA-MB-231 and PC3 cell lines. Combined DKK1 and Kremen expression in cancer cells may serve as predictive markers of the osteoblastic response of breast and prostate cancer bone metastasis. Published by Elsevier Inc.

  10. Design and Construction of a Multi-Organ Microfluidic Chip Mimicking the in vivo Microenvironment of Lung Cancer Metastasis.

    PubMed

    Xu, Zhiyun; Li, Encheng; Guo, Zhe; Yu, Ruofei; Hao, Hualong; Xu, Yitong; Sun, Zhao; Li, Xiancheng; Lyu, Jianxin; Wang, Qi

    2016-10-05

    Metastasis is a complex pathophysiological process. As the main cause of cancer mortality in humans it represents a serious challenge to both basic researchers and clinicians. Here we report the design and construction of a multi-organ microfluidic chip that closely mimics the in vivo microenvironment of lung cancer metastasis. This multi-organs-on-a-chip includes an upstream "lung" and three downstream "distant organs", with three polydimethylsiloxane (PDMS) layers and two thin PDMS microporous membranes bonded to form three parallel microchannels. Bronchial epithelial, lung cancer, microvascular endothelial, mononuclear, and fibroblast cells were grown separated by the biomembrane in upstream "lung", while astrocytes, osteocytes, and hepatocytes were grown in distant chambers, to mimic lung cancer cell metastasis to the brain, bone, and liver. After culture in this system, lung cancer cells formed a "tumor mass", showed epithelial-mesenchymal transition (with altered expression of E-cadherin, N-cadherin, Snail1, and Snail2) and invasive capacity. A549 cells co-cultured with astrocytes overexpressed CXCR4 protein, indicating damage of astrocytes after cancer cell metastasis to the brain. Osteocytes overexpressed RANKL protein indicates damage of osteocytes after cancer cell metastasis to the bone, and hepatocytes overexpressed AFP protein indicates damage to hepatocytes after cancer cell metastasis to the liver. Finally, in vivo imaging of cancer growth and metastasis in a nude mice model validated the performance of metastasis in the organs-on-chip system. This system provides a useful tool to mimic the in vivo microenvironment of cancer metastasis and to investigate cell-cell interactions during metastasis.

  11. Primary non-Hodgkin lymphoma of the right femur and subsequent metastasis to the left femur: A case report and literature review.

    PubMed

    Hu, Jing-Yu; Yu, Dan; Wu, Yao-Hui

    2018-04-01

    Non-Hodgkin lymphoma of the bone is rare and typically causes an extensive bone lesion. The present study describes a case of diffuse large B-cell primary non-Hodgkin lymphoma of the bone, which occurred in the right femur, and was initially treated with surgery and chemotherapy. Following a 7-year period of complete remission, a new, similar lesion was identified in the left femur. With both lesions, there was no accompanying destruction of any other bones or organ involvement. Metastasis of PLB to the contralateral side is extremely rare and, to the best of our knowledge, this is the first report of this particular presentation in China or worldwide. We hypothesized that the present situation arose due to mechanisms involving the tumor microenvironment, circulating tumor cells, lymphocyte homing and self-seeding. The present report describes the case in detail, and discusses the possible underlying mechanisms and their potential contribution to the treatment of non-Hodgkin lymphoma, as well as the prevention of metastasis and recurrence, which may be of considerable clinical significance.

  12. [Cranial metastasis of thyroid follicular carcinoma. Report of a case].

    PubMed

    Calderón-Garcidueñas, A L; González-Schaffinni, M A; Farías-García, R; Rey-Laborde, R

    2001-01-01

    Thyroid follicular carcinoma is able to produce metastatic lesions before the vanishing of the primary lesion. We present a case of a woman with a lytic, solitary, asymptomatic parietal bone lesion of 2 years of evolution. Autopsy revealed a thyroid gland with two small cystic areas and renal metastasis. Thyroid carcinoma should be included in the differential diagnosis in cases of lytic bone lesions with long evolution in patients 60 years of age or older.

  13. 68Ga-PSMA PET-CT Imaging of Metastatic Adenoid Cystic Carcinoma.

    PubMed

    de Keizer, Bart; Krijger, Gerard C; Ververs, F Tessa; van Es, Robert J J; de Bree, Remco; Willems, Stefan

    2017-12-01

    A patient with a history of adenoid cystic carcinoma of the nasal cavity presented himself with bone pain and an elevated PSA level. On suspicion of metastatic prostate cancer a 68 Ga-PSMA PET-CT was performed. The PET-CT showed numerous lung and non-sclerotic bone metastasis. Biopsy of a bone metastasis was performed and pathology showed adenoid cystic carcinoma instead of prostate cancer. Immunohistochemical PSMA staining of the primary tumour showed intense PSMA expression in adenoid cystic carcinoma tumour cells. Because of the high PSMA expression of adenoid cystic carcinoma, 68 Ga-PSMA PET-CT might be a promising imaging modality for this malignancy.

  14. Instrumentation Failure after Partial Corpectomy with Instrumentation of a Metastatic Spine

    PubMed Central

    Park, Sung Bae; Kim, Ki Jeong; Han, Sanghyun; Oh, Sohee; Kim, Chi Heon; Chung, Chun Kee

    2018-01-01

    Objective To identify the perioperative factors associated with instrument failure in patients undergoing a partial corpectomy with instrumentation (PCI) for spinal metastasis. Methods We assessed the one hundred twenty-four patients with who underwent PCI for a metastatic spine from 1987 to 2011. Outcome measure was the risk factor related to implantation failure. The preoperative factors analyzed were age, sex, ambulation, American Spinal Injury Association grade, bone mineral density, use of steroid, primary tumor site, number of vertebrae with metastasis, extra-bone metastasis, preoperative adjuvant chemotherapy, and preoperative spinal radiotherapy. The intraoperative factors were the number of fixed vertebrae, fixation in osteolytic vertebrae, bone grafting, and type of surgical approach. The postoperative factors included postoperative adjuvant chemotherapy and spinal radiotherapy. This study was supported by the National Research Foundation grant funded by government. There were no study-specific biases related to conflicts of interest. Results There were 15 instrumentation failures (15/124, 12.1%). Preoperative ambulatory status and primary tumor site were not significantly related to the development of implant failure. There were no significant associations between insertion of a bone graft into the partial corpectomy site and instrumentation failure. The preoperative and operative factors analyzed were not significantly related to instrumentation failure. In univariable and multivariable analyses, postoperative spinal radiotherapy was the only significant variable related to instrumentation failure (p=0.049 and 0.050, respectively). Conclusion When performing PCI in patients with spinal metastasis followed by postoperative spinal radiotherapy, the surgeon may consider the possibility of instrumentation failure and find other strategies for augmentation than the use of a bone graft for fusion. PMID:29631384

  15. Instrumentation Failure after Partial Corpectomy with Instrumentation of a Metastatic Spine.

    PubMed

    Park, Sung Bae; Kim, Ki Jeong; Han, Sanghyun; Oh, Sohee; Kim, Chi Heon; Chung, Chun Kee

    2018-05-01

    To identify the perioperative factors associated with instrument failure in patients undergoing a partial corpectomy with instrumentation (PCI) for spinal metastasis. We assessed the one hundred twenty-four patients with who underwent PCI for a metastatic spine from 1987 to 2011. Outcome measure was the risk factor related to implantation failure. The preoperative factors analyzed were age, sex, ambulation, American Spinal Injury Association grade, bone mineral density, use of steroid, primary tumor site, number of vertebrae with metastasis, extra-bone metastasis, preoperative adjuvant chemotherapy, and preoperative spinal radiotherapy. The intraoperative factors were the number of fixed vertebrae, fixation in osteolytic vertebrae, bone grafting, and type of surgical approach. The postoperative factors included postoperative adjuvant chemotherapy and spinal radiotherapy. This study was supported by the National Research Foundation grant funded by government. There were no study-specific biases related to conflicts of interest. There were 15 instrumentation failures (15/124, 12.1%). Preoperative ambulatory status and primary tumor site were not significantly related to the development of implant failure. There were no significant associations between insertion of a bone graft into the partial corpectomy site and instrumentation failure. The preoperative and operative factors analyzed were not significantly related to instrumentation failure. In univariable and multivariable analyses, postoperative spinal radiotherapy was the only significant variable related to instrumentation failure ( p =0.049 and 0.050, respectively). When performing PCI in patients with spinal metastasis followed by postoperative spinal radiotherapy, the surgeon may consider the possibility of instrumentation failure and find other strategies for augmentation than the use of a bone graft for fusion.

  16. Use of Bone Scan During Initial Prostate Cancer Workup, Downstream Procedures, and Associated Medicare Costs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Falchook, Aaron D.; Salloum, Ramzi G.; Hendrix, Laura H.

    Purpose: For patients with a high likelihood of having metastatic disease (high-risk prostate cancer), bone scan is the standard, guideline-recommended test to look for bony metastasis. We quantified the use of bone scans and downstream procedures, along with associated costs, in patients with high-risk prostate cancer, and their use in low- and intermediate-risk patients for whom these tests are not recommended. Methods and Materials: Patients in the Surveillance, Epidemiology, and End Results (SEER)-Medicare database diagnosed with prostate cancer from 2004 to 2007 were included. Prostate specific antigen (PSA), Gleason score, and clinical T stage were used to define D'Amico riskmore » categories. We report use of bone scans from the date of diagnosis to the earlier of treatment or 6 months. In patients who underwent bone scans, we report use of bone-specific x-ray, computed tomography (CT), and magnetic resonance imaging (MRI) scans, and bone biopsy within 3 months after bone scan. Costs were estimated using 2012 Medicare reimbursement rates. Results: In all, 31% and 48% of patients with apparent low- and intermediate-risk prostate cancer underwent a bone scan; of these patients, 21% underwent subsequent x-rays, 7% CT, and 3% MRI scans. Bone biopsies were uncommon. Overall, <1% of low- and intermediate-risk patients were found to have metastatic disease. The annual estimated Medicare cost for bone scans and downstream procedures was $11,300,000 for low- and intermediate-risk patients. For patients with apparent high-risk disease, only 62% received a bone scan, of whom 14% were found to have metastasis. Conclusions: There is overuse of bone scans in patients with low- and intermediate-risk prostate cancers, which is unlikely to yield clinically actionable information and results in a potential Medicare waste. However, there is underuse of bone scans in high-risk patients for whom metastasis is likely.« less

  17. Inhibition of bone loss with surface-modulated, drug-loaded nanoparticles in an intraosseous model of prostate cancer.

    PubMed

    Adjei, Isaac M; Sharma, Blanka; Peetla, Chiranjeevi; Labhasetwar, Vinod

    2016-06-28

    Advanced-stage prostate cancer usually metastasizes to bone and is untreatable due to poor biodistribution of intravenously administered anticancer drugs to bone. In this study, we modulated the surface charge/composition of biodegradable nanoparticles (NPs) to sustain their blood circulation time and made them small enough to extravasate through the openings of the bone's sinusoidal capillaries and thus localize into marrow. NPs with a neutral surface charge, achieved by modulating the NP surface-associated emulsifier composition, were more effective at localizing to bone marrow than NPs with a cationic or anionic surface charge. These small neutral NPs (~150nm vs. the more usual ~320nm) were also ~7-fold more effective in localizing in bone marrow than large NPs. We hypothesized that NPs that effectively localize to marrow could improve NP-mediated anticancer drug delivery to sites of bone metastasis, thereby inhibiting cancer progression and preventing bone loss. In a PC-3M-luc cell-induced osteolytic intraosseous model of prostate cancer, these small neutral NPs demonstrated greater accumulation in bone within metastatic sites than in normal contralateral bone as well as co-localization with the tumor mass in marrow. Significantly, a single-dose intravenous administration of these small neutral NPs loaded with paclitaxel (PTX-NPs), but not anionic PTX-NPs, slowed the progression of bone metastasis. In addition, neutral PTX-NPs prevented bone loss, whereas animals treated with the rapid-release drug formulation Cremophor EL (PTX-CrEL) or saline (control) showed >50% bone loss. Neutral PTX-NPs did not cause acute toxicity, whereas animals treated with PTX-CrEL experienced weight loss. These results indicate that NPs with appropriate physical and sustained drug-release characteristics could be explored to treat bone metastasis, a significant clinical issue in prostate and other cancers. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. From Breast to Bone: Tracking Gene Expression Changes Responsible for Breast Cancer Metastasis in a Humanized Mouse Model with Molecular Imaging

    DTIC Science & Technology

    2015-11-01

    strategies to predict and prevent metastasis. 15. SUBJECT TERMS triple-negative breast cancer, metastasis, p53, BTG2, PDX Models 16. SECURITY CLASSIFICATION...membrane and into the circulation, survival in the circulation, extravasation into distant organs, tumor dormancy, and finally tumor growth in the...sequencing analysis are novel targets for metastasis prevention or are more effective at destroying metastatic cells while minimizing the risk of

  19. Incidence and clinical characteristics of symptomatic choroidal metastasis from lung cancer.

    PubMed

    Kreusel, Klaus-Martin; Bechrakis, Nikolaos E; Wiegel, Thomas; Krause, Lothar; Foerster, Michael H

    2008-08-01

    To determine the clinical characteristics of symptomatic choroidal metastasis (CM) resulting from metastatic lung cancer. Twenty-two consecutive patients with symptomatic CM resulting from lung cancer were retrospectively reviewed for ocular findings, medical history and systemic disease. All patients underwent a complete screening for further organ metastasis by computed tomography (CT) and bone scintigraphy. Annual frequency of CM was determined and compared with the incidence predicted from ocular screening studies. In eight of 22 (36%; 95% confidence interval [CI] 17-59) patients, lung cancer had been diagnosed before occurrence of CM, with a median interval of 13 months. In 14 patients lung cancer was detected after diagnosis of CM, with a median interval of 1 month. Choroidal metastasis was unilateral, solitary and located close to or at the posterior pole in the majority of patients. Further organ metastasis with a median number of three affected organ systems was present in 19 (86%; 95% CI 65-97) patients. Median survival after diagnosis of symptomatic CM was 13 months, by contrast with 2 months in lung cancer patients with CM identified in an ocular screening study. The mean number of patients in Berlin diagnosed with symptomatic CM was 1.4 per year, which was two orders of magnitude less than predicted from screening studies. Symptomatic choroidal lung cancer metastasis in the majority of patients presents as a solitary tumour before diagnosis of lung cancer in patients with multiple organ systems affected by metastatic disease. Contrary to predictions from ocular screening studies, it is a rare clinical entity.

  20. Gene expression markers in circulating tumor cells may predict bone metastasis and response to hormonal treatment in breast cancer

    PubMed Central

    WANG, HAIYING; MOLINA, JULIAN; JIANG, JOHN; FERBER, MATTHEW; PRUTHI, SANDHYA; JATKOE, TIMOTHY; DERECHO, CARLO; RAJPUROHIT, YASHODA; ZHENG, JIAN; WANG, YIXIN

    2013-01-01

    Circulating tumor cells (CTCs) have recently attracted attention due to their potential as prognostic and predictive markers for the clinical management of metastatic breast cancer patients. The isolation of CTCs from patients may enable the molecular characterization of these cells, which may help establish a minimally invasive assay for the prediction of metastasis and further optimization of treatment. Molecular markers of proven clinical value may therefore be useful in predicting disease aggressiveness and response to treatment. In our earlier study, we identified a gene signature in breast cancer that appears to be significantly associated with bone metastasis. Among the genes that constitute this signature, trefoil factor 1 (TFF1) was identified as the most differentially expressed gene associated with bone metastasis. In this study, we investigated 25 candidate gene markers in the CTCs of metastatic breast cancer patients with different metastatic sites. The panel of the 25 markers was investigated in 80 baseline samples (first blood draw of CTCs) and 30 follow-up samples. In addition, 40 healthy blood donors (HBDs) were analyzed as controls. The assay was performed using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) with RNA extracted from CTCs captured by the CellSearch system. Our study indicated that 12 of the genes were uniquely expressed in CTCs and 10 were highly expressed in the CTCs obtained from patients compared to those obtained from HBDs. Among these genes, the expression of keratin 19 was highly correlated with the CTC count. The TFF1 expression in CTCs was a strong predictor of bone metastasis and the patients with a high expression of estrogen receptor β in CTCs exhibited a better response to hormonal treatment. Molecular characterization of these genes in CTCs may provide a better understanding of the mechanism underlying tumor metastasis and identify gene markers in CTCs for predicting disease progression and response to treatment. PMID:24649289

  1. Gene expression markers in circulating tumor cells may predict bone metastasis and response to hormonal treatment in breast cancer.

    PubMed

    Wang, Haiying; Molina, Julian; Jiang, John; Ferber, Matthew; Pruthi, Sandhya; Jatkoe, Timothy; Derecho, Carlo; Rajpurohit, Yashoda; Zheng, Jian; Wang, Yixin

    2013-11-01

    Circulating tumor cells (CTCs) have recently attracted attention due to their potential as prognostic and predictive markers for the clinical management of metastatic breast cancer patients. The isolation of CTCs from patients may enable the molecular characterization of these cells, which may help establish a minimally invasive assay for the prediction of metastasis and further optimization of treatment. Molecular markers of proven clinical value may therefore be useful in predicting disease aggressiveness and response to treatment. In our earlier study, we identified a gene signature in breast cancer that appears to be significantly associated with bone metastasis. Among the genes that constitute this signature, trefoil factor 1 (TFF1) was identified as the most differentially expressed gene associated with bone metastasis. In this study, we investigated 25 candidate gene markers in the CTCs of metastatic breast cancer patients with different metastatic sites. The panel of the 25 markers was investigated in 80 baseline samples (first blood draw of CTCs) and 30 follow-up samples. In addition, 40 healthy blood donors (HBDs) were analyzed as controls. The assay was performed using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) with RNA extracted from CTCs captured by the CellSearch system. Our study indicated that 12 of the genes were uniquely expressed in CTCs and 10 were highly expressed in the CTCs obtained from patients compared to those obtained from HBDs. Among these genes, the expression of keratin 19 was highly correlated with the CTC count. The TFF1 expression in CTCs was a strong predictor of bone metastasis and the patients with a high expression of estrogen receptor β in CTCs exhibited a better response to hormonal treatment. Molecular characterization of these genes in CTCs may provide a better understanding of the mechanism underlying tumor metastasis and identify gene markers in CTCs for predicting disease progression and response to treatment.

  2. A herpes simplex virus type 2-encoded microRNA promotes tumor cell metastasis by targeting suppressor of cytokine signaling 2 in lung cancer.

    PubMed

    Wang, Xudong; Liu, Shupeng; Zhou, Zhenhua; Yan, Hongli; Xiao, Jianru

    2017-05-01

    Certain viruses use microRNAs to regulate the expression of their own genes, host genes, or both. A number of microRNAs expressed by herpes simplex virus type 2 have been confirmed by previous studies. However, whether these microRNAs play a role in the metastasis of lung cancers and how these viral microRNAs precisely regulated the tumor biological process in lung cancer bone metastasis remain obscure. We recently identified the high expression of an acutely and latently expressed viral microRNA, Hsv2-miR-H9-5p, encoded by herpes simplex virus type 2 latency-associated transcript through microarray and quantitative polymerase chain reaction analyses which compared the expression of microRNAs in bone metastasis from lung cancer with primary lung cancers. We now reported that Hsv2-miR-H9-5p was highly expressed in bone metastasis and closely associated with pathological and metastatic processes of lung cancers. The functions of Hsv2-miR-H9-5p were determined by overexpression which results in an increase in survival, migration, and invasion of lung cancer cells in vitro. We determined that Hsv2-miR-H9-5p directly targeted SOCS2 mechanistically by dual-luciferase reporter assay. Then, we investigated the functions of SOCS2 in the progress of lung cancers. Reduction of SOCS2 dosage by hsv2-miR-H9-5p induced increased migration and invasion of lung cancer cells. Overexpression of SOCS2 inverted these phenotypes generated by hsv2-miR-H9-5p, indicating the potential roles of SOCS2 in Hsv2-miR-H9-5p-driven metastasis in lung cancers. The results highlighted that Hsv2-miR-H9-5p regulated and contributed to bone metastasis of lung cancers. We proposed that Hsv2-miR-H9-5p could be used as a potential target in lung cancer therapy.

  3. Organtropic Metastatic Secretomes and Exosomes in Breast Cancer

    DTIC Science & Technology

    2014-10-01

    An understanding of secreted metastasis regulators (extracellular proteins, cell-free nucleic acids and small vesicles – exosomes -) has tremendous...and exosomal proteins and miRNAs to promote organotropic metastasis. Therapeutic disruptions of these communication pathways may significantly increase...secreted and exosomal proteins and miRNAs that are regulators of bone and lung metastasis, to characterize their function in mediating tumor-stroma

  4. Loss of TGF-β signaling in osteoblasts increases basic-FGF and promotes prostate cancer bone metastasis.

    PubMed

    Meng, Xiangqi; Vander Ark, Alexandra; Daft, Paul; Woodford, Erica; Wang, Jie; Madaj, Zachary; Li, Xiaohong

    2018-04-01

    TGF-β plays a central role in prostate cancer (PCa) bone metastasis, and it is crucial to understand the bone cell-specific role of TGF-β signaling in this process. Thus, we used knockout (KO) mouse models having deletion of the Tgfbr2 gene specifically in osteoblasts (Tgfbr2 Col1CreERT KO) or in osteoclasts (Tgfbr2 LysMCre KO). We found that PCa-induced bone lesion development was promoted in the Tgfbr2 Col1CreERT KO mice, but was inhibited in the Tgfbr2 LysMCre KO mice, relative to their respective control Tgfbr2 FloxE2 littermates. Since metastatic PCa cells attach to osteoblasts when colonized in the bone microenvironment, we focused on the mechanistic studies using the Tgfbr2 Col1CreERT KO mouse model. We found that bFGF was upregulated in osteoblasts from PC3-injected tibiae of Tgfbr2 Col1CreERT KO mice and correlated with increased tumor cell proliferation, angiogenesis, amounts of cancer-associated fibroblasts and osteoclasts. In vitro studies showed that osteoblastogenesis was inhibited, osteoclastogenesis was stimulated, but PC3 viability was not affected, by bFGF treatments. Lastly, the increased PC3-induced bone lesions in Tgfbr2 Col1CreERT KO mice were significantly attenuated by blocking bFGF using neutralizing antibody, suggesting bFGF is a promising target inhibiting bone metastasis. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Role of Adrenomedullin in Breast Cancer Bone Metastasis and Chemoresistance

    DTIC Science & Technology

    2007-05-01

    the body: the seed and soil hypothesis, which states : “when a plant goes to seed, its seeds are carried in all directions; but they can only grow if...complete and complex model of breast cancer bone metastasis. Solid black lines indicate established interactions within the vicious cycle. Dotted gray...967–971. 21. Leonard, J. T., & Roy, K. (2006). The HIV entry inhibitors revisited. Current Medicinal Chemistry , 13, 911–934. 22. Harms, J. F., Welch, D

  6. Exceptional bone metastasis of basal cell carcinoma in Gorlin-Goltz syndrome.

    PubMed

    Lamon, Tatiana; Gerard, Stephane; Meyer, Nicolas; Losfeld, Benjamin; Abellan van Kan, Gabor; Balardy, Laurent; Vellas, Bruno

    2010-01-01

    Basal cell carcinoma (BCC), the most prevalent form of cancer worldwide, is a malignant skin neoplasm. It is locally invasive, with an exceptional incidence of reported metastasis. It can also be part of the Gorlin-Goltz syndrome, an autosomal dominant genetic disorder with high penetrance and variable expressivity, which is principally characterized by cutaneous BCC, odontogenic keratocysts, palmar and/or plantar pits, and falx cerebri calcification. We report the exceptional clinical observation of a 54-year-old man presenting bone metastasis from BCC in Gorlin-Goltz syndrome. Less than 300 cases of metastatic BCC have been reported in the literature. The present case is the second associated with Gorlin-Goltz syndrome. Copyright 2009 S. Karger AG, Basel.

  7. Cancer and the metastatic substrate

    PubMed Central

    Arvelo, Francisco; Sojo, Felipe; Cotte, Carlos

    2016-01-01

    Seventy percent of cancer patients have detectable metastases when they receive a diagnosis and 90% of cancer deaths result from metastases. These two facts emphasise the urgency for research to study the mechanisms and processes that enable metastasis. We need to develop a greater understanding of the cellular and molecular mechanisms that cause metastasis and also we need to do more. We must also consider the micro- and macro-environmental factors that influence this disease. Studying this environmental context has led us to update the ‘seed and soil’ hypothesis which dates back to the 19th century. This theory describes cancerous cells as seeds and the substrate as the soil in target organs though this may seem antiquated. Nonetheless, the tissue specificity that researchers have recently observed in metastatic colonisation supports the validity of the seed and soil theory. We now know that the metastatic potential of a tumour cell depends on multiple, reciprocal interactions between the primary tumour and distant sites. These interactions determine tumour progression. Studies of metastasis have allowed us to develop treatments that focus on therapeutic effectiveness. These new treatments account for the frequent metastasis of some tumours to target organs such as bones, lungs, brain, and liver. The purpose of this review is first to describe interactions between the cellular and molecular entities and the target organ tumour environment that enables metastasis. A second aim is to describe the complex mechanisms that mediate these interactions. PMID:28105072

  8. FROM ANEURYSMAL BONE CYST TO TELANGIECTATIC OSTEOSARCOMA WITH METASTASIS IN INGUINAL LYMPH NODES - CASE REPORT.

    PubMed

    Janevska, Vesna; Spasevska, Liljana; Samardziski, Milan; Nikodinovskai, Violeta; Zhivadinovik, Julija; Trajkovskai, Elizabeta

    2015-01-01

    Aneurysmal bone cyst is a benign bone lesion composed of blood filled cystic cavities lined by fibrous septa. Its malignant transformation of is a rare event. We report a case of a lesion in the second metatarsal bone in a 29-year-old male, presented as a slight swelling of the right foot. After the curettage had been done, the diagnosis of aneurysmal bone cyst was made but the recurrence occurred 4 years later. The biopsy of the recurrent tumor showed compact neoplastic tissue consistent with diagnosis of giant cell tumor with malignancy. The malignant component was recognized as a high grade sarcoma with osteoid production. A tumor mass with the whole II metatarsal bone was extirpated and a resected part of fibula was transplanted. A year later, another recurrence occurred, an amputation was performed and a teleangiectatic osteosarcoma with ingvinal lymph nodes metastases was diagnosed. No other tumor mass was confirmed, either clinically or by imaging techniques at the time of his third operation. He died 4 months later with multiple pulmonary metastases. We emphasize the importance of team work in order to achieve the accurate diagnosis, highlighting careful radiological examinations, good sampling and awareness of unusual cases in bone tumor pathology.

  9. Primary Ewing's Sarcoma of the temporal bone in an infant.

    PubMed

    Goudarzipour, Kourosh; Shamsian, Shahin; Alavi, Samin; Nourbakhsh, Kazem; Aghakhani, Roxana; Eydian, Zahra; Arzanian, Mohammad Taghi

    2015-04-01

    Introduction : Ewing's sarcoma is the second most common primary malignant tumor of bone found in children after Osteosarcoma. It accounts for 4-9% of primary malignant bone tumors and it affects bones of the skull or face in only 1-4% of cases. Hence it rarely affects the head and neck. Subject and Method : In this case report, we describe a case of primary Ewing's sarcoma occurring in the temporal bone. The tumor was surgically excised, and the patient underwent chemotherapy for ten months. Results : Neither recurrence nor distant metastasis was noted in these 10 months after surgery but about 18 months after surgery our patient was expired. Conclusion : Although the prognosis of Ewing's sarcoma is generally poor because of early metastasis to the lungs and to other bones, a review of the article suggested that Ewing's sarcoma occurring in the skull can often be successfully managed by intensive therapy with radical excision and chemotherapy. This result was supported by the case reported here.

  10. Severe hypocalcaemia as a cause of seemingly idiopathic bilateral lower limb oedema.

    PubMed

    Hung, Aaron Karnell Dachuan

    2014-01-10

    The existing scientific literature has not drawn a link between severe hypocalcaemia and its role in recalcitrant peripheral oedema. This phenomenon is particularly relevant in oncological and geriatric medicine as bone strengthening but serum calcium-lowering agents such as bisphosphonates and denosumab are used for osteoporosis and/or bone metastasis. This case report, through metastatic prostate cancer in a 66-year-old man with bone metastasis being treated with a monoclonal antibody denosumab, proposes the mechanism of hypocalcaemic oedema as being akin to calcium deprivation such as those induced by calcium channel antagonism. It demonstrates the importance of calcium supplementation as a concurrent treatment while patients are on these osteoclast inhibiting agents.

  11. Organ Preference of Cancer Metastasis and Metastasis-Related Cell Adhesion Molecules Including Carbohydrates.

    PubMed

    Kawaguchi, Takanori

    2016-01-01

    This review starts on one of our special interests, the organ preference of metastasis. We examined data on 1,117 autopsy cases and found that the organ distribution of metastasis of cancers of the lung, pancreas, stomach, colon, rectum, uterine cervix, liver, bile duct, and esophagus involved the lung, liver, adrenal gland, bone/bone marrow, lymph node, and pleura/peritoneum. Cancers of the kidney, thyroid, ovary, choriocarcinoma, and breast, however, manifested different metastatic patterns. The distribution of leukemia and lymphoma metastases was quite different from that of epithelial cancers. On the basis of experimental studies, we believe that the anatomical-mechanical hypothesis should be replaced by the microinjury hypothesis, which suggests that tissue microinjury induced by temporal tumor cell embolization is crucial for successful metastasis. This hypothesis may actually reflect the so-called inflammatory oncotaxis concept. To clarify the mechanisms underlying metastasis, we developed an experimental model system of a rat hepatoma AH7974 that embraced substrate adhesiveness. This model did not prove a relationship between substrate-adhesion potential and metastatic lung-colonizing potential of tumor cells, but metastatic potential was correlated with the expression of the laminin carbohydrate that was recognized by Griffonia (Bandeiraea) simplicifolia isolectin G4. Therefore, we investigated the relationship between carbohydrate expression profiles and metastasis and prognosis. We indeed found an intimate relationship between the carbohydrate expression of cancer cells and the progression of malignant tumors, organ preference of metastasis, metastatic potential of tumor cells, and prognosis of patients.

  12. Color-Coded Imaging of Syngeneic Orthotopic Malignant Lymphoma Interacting with Host Stromal Cells During Metastasis.

    PubMed

    Matsumoto, Takuro; Suetsugu, Atsushi; Hasegawa, Kosuke; Nakamura, Miki; Aoki, Hitomi; Kunisada, Takahiro; Tsurumi, Hisashi; Shimizu, Masahito; Hoffman, Robert M

    2016-04-01

    The EL4 cell line was previously derived from a lymphoma induced in a C57/BL6 mouse by 9,10-dimethyl-1,2-benzanthracene. In a previous study, EL4 lymphoma cells expressing red fluorescent protein (EL4-RFP) were established and injected into the tail vein of C57/BL6 green fluorescent protein (GFP) transgenic mice. Metastasis was observed at multiple sites which were also enriched with host GFP-expressing stromal cells. In the present study, our aim was to establish an orthotopic model of EL4-RFP. In the present study, EL4-RFP lymphoma cells were injected in the spleen of C57/BL6 GFP transgenic mice as an orthotopic model of lymphoma. Resultant primary tumor and metastases were imaged with the Olympus FV1000 scanning laser confocal microscope. EL4-RFP metastasis was observed 21 days later. EL4-RFP tumors in the spleen (primary injection site), liver, supra-mediastinum lymph nodes, abdominal lymph nodes, bone marrow, and lung were visualized by color-coded imaging. EL4-RFP metastases in the liver, lymph nodes, and bone marrow in C57/BL6 GFP mice were rich in GFP stromal cells such as macrophages, fibroblasts, dendritic cells, and normal lymphocytes derived from the host animal. Small tumors were observed in the spleen, which were rich in host stromal cells. In the lung, no mass formation of lymphoma cells occurred, but lymphoma cells circulated in lung peripheral blood vessels. Phagocytosis of EL4-RFP lymphoma cells by macrophages, as well as dendritic cells and fibroblasts, were observed in culture. Color-coded imaging of the lymphoma microenvironment suggests an important role of stromal cells in lymphoma progression and metastasis. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  13. Prevalence of Prostate Cancer Metastases after Intravenous Inoculation Provides Clues into the Molecular Basis of Dormancy in the Bone Marrow Microenvironment1

    PubMed Central

    Jung, Younghun; Shiozawa, Yusuke; Wang, Jingcheng; McGregor, Natalie; Dai, Jinlu; Park, Serk In; Berry, Janice E; Havens, Aaron M; Joseph, Jeena; Kim, Jin Koo; Patel, Lalit; Carmeliet, Peter; Daignault, Stephanie; Keller, Evan T; McCauley, Laurie K; Pienta, Kenneth J; Taichman, Russell S

    2012-01-01

    Bone is the preferred metastasis site of advanced prostate cancer (PCa). Using an in vivo murine model of human PCa cell metastasis to bone, we noted that the majority of animals that develop skeletal metastasis have either spinal lesions or lesions in the bones of the hindlimb. Much less frequently, lesions develop in the bones of the forelimb. We therefore speculated whether the environment of the forelimb bones is not permissive for the growth of PCa. Consequently, data on tumor prevalence were normalized to account for the number of PCa cells arriving after intravascular injection, marrow cellularity, and number of hematopoietic stem cell niches. None of these factors were able to account for the observed differences in tumor prevalence. An analysis of differential gene and protein levels identified that growth arrest specific-6 (GAS6) levels were significantly greater in the forelimb versus hindlimb bone marrow. When murine RM1 cells were implanted into subcutaneous spaces in immune competent animals, tumor growth in the GAS6-/- animals was greater than in GAS6+/+ wild-type animals. In an osseous environment, the human PC3 cell line grew significantly better in vertebral body transplants (vossicles) derived from GAS6-/- animals than in vossicles derived from GAS6+/+ animals. Together, these data suggest that the differences in tumor prevalence after intravascular inoculation are a useful model to study the molecular basis of tumor dormancy. Importantly, these data suggest that therapeutic manipulation of GAS6 levels may prove useful as a therapy for metastatic disease. PMID:22745589

  14. Label-free Raman spectroscopy provides early determination and precise localization of breast cancer-colonized bone alterations.

    PubMed

    Zhang, Chi; Winnard, Paul T; Dasari, Sidarth; Kominsky, Scott L; Doucet, Michele; Jayaraman, Swaathi; Raman, Venu; Barman, Ishan

    2018-01-21

    Breast neoplasms frequently colonize bone and induce development of osteolytic bone lesions by disrupting the homeostasis of the bone microenvironment. This degenerative process can lead to bone pain and pathological bone fracture, a major cause of cancer morbidity and diminished quality of life, which is exacerbated by our limited ability to monitor early metastatic disease in bone and assess fracture risk. Spurred by its label-free, real-time nature and its exquisite molecular specificity, we employed spontaneous Raman spectroscopy to assess and quantify early metastasis driven biochemical alterations to bone composition. As early as two weeks after intracardiac inoculations of MDA-MB-435 breast cancer cells in NOD-SCID mice, Raman spectroscopic measurements in the femur and spine revealed consistent changes in carbonate substitution, overall mineralization as well as crystallinity increase in tumor-bearing bones when compared with their normal counterparts. Our observations reveal the possibility of early stage detection of biochemical changes in the tumor-bearing bones - significantly before morphological variations are captured through radiographic diagnosis. This study paves the way for a better molecular understanding of altered bone remodeling in such metastatic niches, and for further clinical studies with the goal of establishing a non-invasive tool for early metastasis detection and prediction of pathological fracture risk in breast cancer.

  15. Role of TGF-β in breast cancer bone metastases

    PubMed Central

    Chiechi, Antonella; Waning, David L.; Stayrook, Keith R.; Buijs, Jeroen T.; Guise, Theresa A.; Mohammad, Khalid S.

    2014-01-01

    Breast cancer is the most prevalent cancer among females worldwide leading to approximately 350,000 deaths each year. It has long been known that cancers preferentially metastasize to particular organs, and bone metastases occur in ~70% of patients with advanced breast cancer. Breast cancer bone metastases are predominantly osteolytic and accompanied by increased fracture risk, pain, nerve compression and hypercalcemia, causing severe morbidity. In the bone matrix, transforming growth factor-β (TGF-β) is one of the most abundant growth factors, which is released in active form upon tumor-induced osteoclastic bone resorption. TGF-β, in turn, stimulates bone metastatic tumor cells to secrete factors that further drive osteolytic bone destruction adjacent to the tumor. Thus, TGF-β is a crucial factor responsible for driving the feed-forward vicious cycle of cancer growth in bone. Moreover, TGF-β activates epithelial-to-mesenchymal transition, increases tumor cell invasiveness and angiogenesis and induces immunosuppression. Blocking the TGF-β signaling pathway to interrupt this vicious cycle between breast cancer and bone offers a promising target for therapeutic intervention to decrease skeletal metastasis. This review will describe the role of TGF-β in breast cancer and bone metastasis, and pre-clinical and clinical data will be evaluated for the potential use of TGF-β inhibitors in clinical practice to treat breast cancer bone metastases. PMID:24558636

  16. Intrathoracic stomach mimicking bone metastasis from thyroid cancer in whole-body iodine-131 scan diagnosed by SPECT/CT.

    PubMed

    García-Gómez, Francisco Javier; la Riva-Pérez, Pablo Antonio de; Calvo-Morón, Cinta; Buján-Lloret, Cristina; Cambil-Molina, Teresa; Castro-Montaño, Juan

    2017-01-01

    The whole-body iodine-131 scintigraphy is an imaging technique in monitoring patients with a history of thyroid cancer. Although the rate of false positives is negligible, it is not nonexistent. We report the case of an intervened and treated patient for thyroid cancer with good clinical and biochemical response. Scintigraphic findings were consistent with unsuspected bone metastasis. Fused SPECT/CT data allowed accurate diagnosis of giant diaphragmatic hernia associated with intrathoracic stomach, a very rare pathology that can lead to false positive results.

  17. [10]-gingerol induces apoptosis and inhibits metastatic dissemination of triple negative breast cancer in vivo.

    PubMed

    Martin, Ana Carolina B M; Fuzer, Angelina M; Becceneri, Amanda B; da Silva, James Almada; Tomasin, Rebeka; Denoyer, Delphine; Kim, Soo-Hyun; McIntyre, Katherine A; Pearson, Helen B; Yeo, Belinda; Nagpal, Aadya; Ling, Xiawei; Selistre-de-Araújo, Heloisa S; Vieira, Paulo Cézar; Cominetti, Marcia R; Pouliot, Normand

    2017-09-22

    There is increasing interest in the use of non-toxic natural products for the treatment of various pathologies, including cancer. In particular, biologically active constituents of the ginger oleoresin ( Zingiber officinale Roscoe) have been shown to mediate anti-tumour activity and to contribute to the anti-inflammatory, antioxidant, antimicrobial, and antiemetic properties of ginger. Here we report on the inhibitory properties of [10]-gingerol against metastatic triple negative breast cancer (TNBC) in vitro and in vivo . We show that [10]-gingerol concentration-dependently induces apoptotic death in mouse and human TNBC cell lines in vitro . In addition, [10]-gingerol is well tolerated in vivo , induces a marked increase in caspase-3 activation and inhibits orthotopic tumour growth in a syngeneic mouse model of spontaneous breast cancer metastasis. Importantly, using both spontaneous and experimental metastasis assays, we show for the first time that [10]-gingerol significantly inhibits metastasis to multiple organs including lung, bone and brain. Remarkably, inhibition of brain metastasis was observed even when treatment was initiated after surgical removal of the primary tumour. Taken together, these results indicate that [10]-gingerol may be a safe and useful complementary therapy for the treatment of metastatic breast cancer and warrant further investigation of its efficacy, either alone or in combination with standard systemic therapies, in pre-clinical models of metastatic breast cancer and in patients.

  18. [10]-gingerol induces apoptosis and inhibits metastatic dissemination of triple negative breast cancer in vivo

    PubMed Central

    Becceneri, Amanda B.; da Silva, James Almada; Tomasin, Rebeka; Denoyer, Delphine; Kim, Soo-Hyun; McIntyre, Katherine A.; Pearson, Helen B.; Yeo, Belinda; Nagpal, Aadya; Ling, Xiawei; Selistre-de-Araújo, Heloisa S.; Vieira, Paulo Cézar

    2017-01-01

    There is increasing interest in the use of non-toxic natural products for the treatment of various pathologies, including cancer. In particular, biologically active constituents of the ginger oleoresin (Zingiber officinale Roscoe) have been shown to mediate anti-tumour activity and to contribute to the anti-inflammatory, antioxidant, antimicrobial, and antiemetic properties of ginger. Here we report on the inhibitory properties of [10]-gingerol against metastatic triple negative breast cancer (TNBC) in vitro and in vivo. We show that [10]-gingerol concentration-dependently induces apoptotic death in mouse and human TNBC cell lines in vitro. In addition, [10]-gingerol is well tolerated in vivo, induces a marked increase in caspase-3 activation and inhibits orthotopic tumour growth in a syngeneic mouse model of spontaneous breast cancer metastasis. Importantly, using both spontaneous and experimental metastasis assays, we show for the first time that [10]-gingerol significantly inhibits metastasis to multiple organs including lung, bone and brain. Remarkably, inhibition of brain metastasis was observed even when treatment was initiated after surgical removal of the primary tumour. Taken together, these results indicate that [10]-gingerol may be a safe and useful complementary therapy for the treatment of metastatic breast cancer and warrant further investigation of its efficacy, either alone or in combination with standard systemic therapies, in pre-clinical models of metastatic breast cancer and in patients. PMID:29069785

  19. [Hyperthyroidism by autonomous metastasis of thyroid carcinoma (author's transl)].

    PubMed

    Mornex, R; Pousset, G; Briere, J; Daumont, M; Paffoy, J C

    1976-01-01

    Nine years after surgical ablation of a trabeculo-vesicular carcinoma of the tyroid, a patient developped bone and liver metastasis. She had clinical signs of thyrotoxicosis, clear increase of blood T3 and sligh increase of T4. The TSH secretion was blocked. Exogenous TSH increased iodine uptake in the thyroid and not in the metastasis. After 2 doses of 120 mCi of 131I, she became hypothyroid, the liver was normal and the scan revealed the disappearance of uptake in thyroid and in metastasis. Such a clinical course was previously found in only 10 cases despite the frequent funcitonal differenciation of the metastasis of thyroid carcinomas.

  20. Modifying the osteoblastic niche with zoledronic acid in vivo—Potential implications for breast cancer bone metastasis

    PubMed Central

    Haider, Marie-Therese; Holen, Ingunn; Dear, T. Neil; Hunter, Keith; Brown, Hannah K.

    2014-01-01

    Introduction Bone metastasis is the most common complication of advanced breast cancer. The associated cancer-induced bone disease is treated with bone-sparing agents like zoledronic acid. Clinical trials have shown that zoledronic acid also reduces breast cancer recurrence in bone; potentially by modifying the bone microenvironment surrounding disseminated tumour cells. We have characterised the early effects of zoledronic acid on key cell types of the metastatic niche in vivo, and investigated how these modify the location of breast tumour cells homing to bone. Methods Female mice were treated with a single, clinically achievable dose of zoledronic acid (100 μg/kg) or PBS. Bone integrity, osteoclast and osteoblast activity and number/mm trabecular bone on 1, 3, 5 and 10 days after treatment were assessed using μCT, ELISA (TRAP, PINP) and bone histomorphometry, respectively. The effect of zoledronic acid on osteoblasts was validated in genetically engineered mice with GFP-positive osteoblastic cells. The effects on growth plate cartilage were visualised by toluidine blue staining. For tumour studies, mice were injected i.c. with DID-labelled MDA-MB-231-NW1-luc2 breast cancer cells 5 days after zoledronic acid treatment, followed by assessment of tumour cell homing to bone and soft tissues by multiphoton microscopy, flow cytometry and ex vivo cultures. Results As early as 3 days after treatment, animals receiving zoledronic acid had significantly increased trabecular bone volume vs. control. This rapid bone effect was reflected in a significant reduction in osteoclast and osteoblast number/mm trabecular bone and reduced bone marker serum levels (day 3–5). These results were confirmed in mice expressing GFP in osteoblastic linage cells. Pre-treatment with zoledronic acid caused accumulation of an extra-cellular matrix in the growth plate associated with a trend towards preferential [1] homing of tumour cells to osteoblast-rich areas of bone, but without affecting the total number of tumour cells. The number of circulating tumour cells was reduced in ZOL treated animals. Conclusion A single dose of zoledronic acid caused significant changes in the bone area suggested to contain the metastatic niche. Tumour cells arriving in this modified bone microenvironment appeared to preferentially locate to osteoblast-rich areas, supporting that osteoblasts may be key components of the bone metastasis niche and therefore a potential therapeutic target in breast cancer. PMID:24971713

  1. Modelling the temperature evolution of bone under high intensity focused ultrasound

    NASA Astrophysics Data System (ADS)

    ten Eikelder, H. M. M.; Bošnački, D.; Elevelt, A.; Donato, K.; Di Tullio, A.; Breuer, B. J. T.; van Wijk, J. H.; van Dijk, E. V. M.; Modena, D.; Yeo, S. Y.; Grüll, H.

    2016-02-01

    Magnetic resonance-guided high intensity focused ultrasound (MR-HIFU) has been clinically shown to be effective for palliative pain management in patients suffering from skeletal metastasis. The underlying mechanism is supposed to be periosteal denervation caused by ablative temperatures reached through ultrasound heating of the cortex. The challenge is exact temperature control during sonication as MR-based thermometry approaches for bone tissue are currently not available. Thus, in contrast to the MR-HIFU ablation of soft tissue, a thermometry feedback to the HIFU is lacking, and the treatment of bone metastasis is entirely based on temperature information acquired in the soft tissue adjacent to the bone surface. However, heating of the adjacent tissue depends on the exact sonication protocol and requires extensive modelling to estimate the actual temperature of the cortex. Here we develop a computational model to calculate the spatial temperature evolution in bone and the adjacent tissue during sonication. First, a ray-tracing technique is used to compute the heat production in each spatial point serving as a source term for the second part, where the actual temperature is calculated as a function of space and time by solving the Pennes bio-heat equation. Importantly, our model includes shear waves that arise at the bone interface as well as all geometrical considerations of transducer and bone geometry. The model was compared with a theoretical approach based on the far field approximation and an MR-HIFU experiment using a bone phantom. Furthermore, we investigated the contribution of shear waves to the heat production and resulting temperatures in bone. The temperature evolution predicted by our model was in accordance with the far field approximation and agreed well with the experimental data obtained in phantoms. Our model allows the simulation of the HIFU treatments of bone metastasis in patients and can be extended to a planning tool prior to MR-HIFU treatments.

  2. PSA Converts Parathyroid Hormone-Related Protein (THrP) from an Osteolytic to an Osteoblastic Factor: Role in Bone Metastasis

    DTIC Science & Technology

    2004-12-01

    bone density associated with DLX3 mutation in the tricho-dento-osseous syndrome . Bone. 35:988-997. Hassan MQ, Javed A, Morasso MI, Karlin J, Montecino M...putative role in hydrolysis of osteogenic peptides. J Bone Miner Res. 15:1266-1274. Ryan CW, Vogelzang NJ, Vokes EE, Kindler HL, Undevia SD, Humerickhouse

  3. C-C motif ligand 5 promotes migration of prostate cancer cells in the prostate cancer bone metastasis microenvironment.

    PubMed

    Urata, Satoko; Izumi, Kouji; Hiratsuka, Kaoru; Maolake, Aerken; Natsagdorj, Ariunbold; Shigehara, Kazuyoshi; Iwamoto, Hiroaki; Kadomoto, Suguru; Makino, Tomoyuki; Naito, Renato; Kadono, Yoshifumi; Lin, Wen-Jye; Wufuer, Guzailinuer; Narimoto, Kazutaka; Mizokami, Atsushi

    2018-03-01

    Chemokines and their receptors have key roles in cancer progression. The present study investigated chemokine activity in the prostate cancer bone metastasis microenvironment. Growth and migration of human prostate cancer cells were assayed in cocultures with bone stromal cells. The migration of LNCaP cells significantly increased when co-cultured with bone stromal cells isolated from prostate cancer bone metastases. Cytokine array analysis of conditioned medium from bone stromal cell cultures identified CCL5 as a concentration-dependent promoter of LNCaP cell migration. The migration of LNCaP cells was suppressed when C-C motif ligand 5 (CCL5) neutralizing antibody was added to cocultures with bone stromal cells. Knockdown of androgen receptor with small interfering RNA increased the migration of LNCaP cells compared with control cells, and CCL5 did not promote the migration of androgen receptor knockdown LNCaP. Elevated CCL5 secretion in bone stromal cells from metastatic lesions induced prostate cancer cell migration by a mechanism consistent with CCL5 activity upstream of androgen receptor signaling. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  4. CD13-positive bone marrow-derived myeloid cells promote angiogenesis, tumor growth, and metastasis.

    PubMed

    Dondossola, Eleonora; Rangel, Roberto; Guzman-Rojas, Liliana; Barbu, Elena M; Hosoya, Hitomi; St John, Lisa S; Molldrem, Jeffrey J; Corti, Angelo; Sidman, Richard L; Arap, Wadih; Pasqualini, Renata

    2013-12-17

    Angiogenesis is fundamental to tumorigenesis and an attractive target for therapeutic intervention against cancer. We have recently demonstrated that CD13 (aminopeptidase N) expressed by nonmalignant host cells of unspecified types regulate tumor blood vessel development. Here, we compare CD13 wild-type and null bone marrow-transplanted tumor-bearing mice to show that host CD13(+) bone marrow-derived cells promote cancer progression via their effect on angiogenesis. Furthermore, we have identified CD11b(+)CD13(+) myeloid cells as the immune subpopulation directly regulating tumor blood vessel development. Finally, we show that these cells are specifically localized within the tumor microenvironment and produce proangiogenic soluble factors. Thus, CD11b(+)CD13(+) myeloid cells constitute a population of bone marrow-derived cells that promote tumor progression and metastasis and are potential candidates for the development of targeted antiangiogenic drugs.

  5. MFAP5 promotes tumor progression and bone metastasis by regulating ERK/MMP signaling pathways in breast cancer.

    PubMed

    Wu, Zhiqiang; Wang, Ting; Fang, Meng; Huang, Wending; Sun, Zhengwang; Xiao, Jianru; Yan, Wangjun

    2018-04-06

    Breast cancer accounts for about 30% of all cancers in women, while approximately 70% breast cancer patients developed bone metastases throughout the course of their disease, highlighting the importance of exploring new therapeutic targets. Microfibrillar-associated protein 5 (MFAP5) is a component of extracellular elastic microfibril which has been confirmed to function in tissue development and cancer progression. But the role of MFAP5 in breast cancer remains unclear. The present study demonstrated that MFAP5 was up-regulated in breast cancers compared with that in normal breast tissues, and further increased in breast cancer bone metastasis. Functionally, MFAP5 overexpression accelerated breast cancer cell proliferation and migration, while an opposite effect was observed when MFAP5 was knocked down. In addition, up-regulation of MFAP5 increased the expression of MMP2 and MMP9 and activated the ERK signaling pathway. Conversely, inhibition of MFAP5 suppressed the expression of MMP2, MMP9, p-FAK, p-Erk1/2 and p-cJun. These findings may provide a better understanding about the mechanism of breast cancer and suggest that MFAP5 may be a potential prognostic biomarker and therapeutic target for breast cancer, especially for bone metastasis of breast cancer. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. The Effect of Acupressure on Pain in Cancer Patients With Bone Metastasis: A Nonrandomized Controlled Trial.

    PubMed

    Serçe, Sibel; Ovayolu, Özlem; Pirbudak, Lütfiye; Ovayolu, Nimet

    2018-04-01

    Pain is a serious and common problem in bone metastases. For this purpose, complementary and supportive practices are also applied along with medical treatment. This study was conducted for the purpose of evaluating the effect of acupressure on pain in cancer patients with bone metastasis. The study was conducted in a nonrandomized controlled trial with patients who applied to the radiotherapy unit of an oncology hospital. The data of the study were collected by using a questionnaire and the Visual Analog Scale. A total of 8 acupressure sessions, which lasted for approximately 10 minutes each (with warming and acupressure periods), was applied to the intervention group. The data were analyzed by using χ 2 test, paired t test, and Pearson's correlation coefficient. It was determined that the pain mean score of the intervention group was 7.6 ± 1.9 before the acupressure and decreased to 6.8 ± 1.9 after the acupressure and this result was statistically significant. On the other hand, no significant difference was determined in the pain mean score of the control group. Acupressure is applicable for cancer patients with bone metastasis by nursing staff after receiving brief training and may make a difference in relieving pain of the patients. Further well-designed trials should be conducted.

  7. Preparing the “Soil”: The Premetastatic Niche

    PubMed Central

    Kaplan, Rosandra N.; Rafii, Shahin; Lyden, David

    2010-01-01

    Current focus on cancer metastasis has centered on the intrinsic factors regulating the cell autonomous homing of the tumor cells to the metastatic site. Specific up-regulation of fibronectin and clustering of bone marrow–derived cellular infiltrates coexpressing matrix metalloproteinases in distant tissue sites before tumor cell arrival are proving to be indispensable for the initial stages of metastasis. These bone marrow–derived hematopoietic progenitors that express vascular endothelial growth factor receptor 1 mobilize in response to the unique array of growth factors produced by the primary tumor. Their arrival in distant sites represents early changes in the local microenvironment, termed the “premetastatic niche,” which dictate the pattern of metastatic spread. Focus on the early cellular and molecular events in cancer dissemination and selectivity will likely lead to new approaches to detect and prevent metastasis at its earliest inception. PMID:17145848

  8. The Risk of Misdiagnosing the Primary Site Responsible for Bone Metastases in Patients With Chronic Lymphocytic Leukemia and a Second Primary Carcinoma

    PubMed Central

    Hatoum, Georges; Meshkin, Cyrus; Alkhunaizi, Sufana; Levene, Richard; Formoso-Onofrio, Julie

    2015-01-01

    Chronic lymphocytic leukemia (CLL) is a common malignancy which may coexist with other primary cancers. CLL is rarely the cause of solitary bone lesions; such lesions in the context of CLL are believed to result from either Richter’s transformation or metastasis from another primary malignancy. Renal cell carcinoma (RCC), on the other hand, is a malignancy which frequently metastasizes to bone and may cause an osteolytic solitary bone lesion. The origin of a solitary bone lesion in a patient with multiple potential primary malignancies has prognostic implications and affects treatment protocol, and as such must be diagnosed accurately. We describe a patient with CLL and a history of RCC who is found to have an incidental solitary bone lesion of the T11 vertebra. After two separate CT-guided biopsies revealed various lymphoid cell predominance and no evidence of RCC, treatment with low dose external beam radiation therapy (EBRT) was employed. Post-therapy MRI showed further propagation of the lesion. Surgical corpectomy was subsequently performed and postoperative pathology of the lesion was consistent with RCC. The patient was treated with bisphosphonates and a higher dose of EBRT. Our case illustrates the importance of surgical excisional biopsy for accurately diagnosing the primary source metastatic to the bone in a patient with CLL and another potential primary cancer. PMID:29147427

  9. Roles of Osteonectin in Breast Cancer Metastasis to Bone

    DTIC Science & Technology

    2005-05-01

    directed cell motility. Some 18 of these other factors within the mineralized matrix of bone could be bone sialoprotein and thrombospondin. Bone... sialoprotein has been shown to increase MDA-MB-231 cell migration in an RGD-dependent manner [14]. Another study has demonstrated the chemoattraction of MDA... sialoproteins I and II, and osteonectin from the mineral compartment of developing human bone. J Biol Chem, 1987. 262(20): p. 9702-8. 7. Dayhoff, M.O

  10. A c-fms tyrosine kinase inhibitor, Ki20227, suppresses osteoclast differentiation and osteolytic bone destruction in a bone metastasis model.

    PubMed

    Ohno, Hiroaki; Kubo, Kazuo; Murooka, Hideko; Kobayashi, Yoshiko; Nishitoba, Tsuyoshi; Shibuya, Masabumi; Yoneda, Toshiyuki; Isoe, Toshiyuki

    2006-11-01

    In bone metastatic lesions, osteoclasts play a key role in the development of osteolysis. Previous studies have shown that macrophage colony-stimulating factor (M-CSF) is important for the differentiation of osteoclasts. In this study, we investigated whether an inhibitor of M-CSF receptor (c-Fms) suppresses osteoclast-dependent osteolysis in bone metastatic lesions. We developed small molecule inhibitors against ligand-dependent phosphorylation of c-Fms and examined the effects of these compounds on osteolytic bone destruction in a bone metastasis model. We discovered a novel quinoline-urea derivative, Ki20227 (N-{4-[(6,7-dimethoxy-4-quinolyl)oxy]-2-methoxyphenyl}-N'-[1-(1,3-thiazole-2-yl)ethyl]urea), which is a c-Fms tyrosine kinase inhibitor. The IC(50)s of Ki20227 to inhibit c-Fms, vascular endothelial growth factor receptor-2 (KDR), stem cell factor receptor (c-Kit), and platelet-derived growth factor receptor beta were found to be 2, 12, 451, and 217 nmol/L, respectively. Ki20227 did not inhibit other kinases tested, such as fms-like tyrosine kinase-3, epidermal growth factor receptor, or c-Src (c-src proto-oncogene product). Ki20227 was also found to inhibit the M-CSF-dependent growth of M-NFS-60 cells but not the M-CSF-independent growth of A375 human melanoma cells in vitro. Furthermore, in an osteoclast-like cell formation assay using mouse bone marrow cells, Ki20227 inhibited the development of tartrate-resistant acid phosphatase-positive osteoclast-like cells in a dose-dependent manner. In in vivo studies, oral administration of Ki20227 suppressed osteoclast-like cell accumulation and bone resorption induced by metastatic tumor cells in nude rats following intracardiac injection of A375 cells. Moreover, Ki20227 decreased the number of tartrate-resistant acid phosphatase-positive osteoclast-like cells on bone surfaces in ovariectomized (ovx) rats. These findings suggest that Ki20227 inhibits osteolytic bone destruction through the suppression of M-CSF-induced osteoclast accumulation in vivo. Therefore, Ki20227 may be a useful therapeutic agent for osteolytic disease associated with bone metastasis and other bone diseases.

  11. Choroidal metastasis from early rectal cancer: Case report and literature review

    PubMed Central

    Tei, Mitsuyoshi; Wakasugi, Masaki; Akamatsu, Hiroki

    2014-01-01

    INTRODUCTION Choroidal metastasis from colorectal cancer is rare, and there have been no reported cases of such metastasis from early colorectal cancer. We report a case of choroidal metastasis from early rectal cancer. PRESENTATION OF CASE A 61 year-old-man experienced myodesopsia in the left eye 2 years and 6 months after primary rectal surgery for early cancer, and was diagnosed with left choroidal metastasis and multiple lung metastases. Radiotherapy was initiated for the left eye and systemic chemotherapy is initiated for the multiple lung metastases. The patient is living 2 years and 3 months after the diagnosis of choroidal metastasis without signs of recurrence in the left eye, and continues to receive systemic chemotherapy for multiple lung metastases. DISCUSSION Current literatures have few recommendations regarding the appropriate treatment of choroidal metastasis from colorectal cancer, but an aggressive multi-disciplinary approach may be effective in local regression. CONCLUSION This is the first report of choroidal metastasis from early rectal cancer. We consider it important to enforce systemic chemotherapy in addition to radiotherapy for choroidal metastasis from colorectal cancer. PMID:25460493

  12. Choroidal metastasis from early rectal cancer: Case report and literature review.

    PubMed

    Tei, Mitsuyoshi; Wakasugi, Masaki; Akamatsu, Hiroki

    2014-01-01

    Choroidal metastasis from colorectal cancer is rare, and there have been no reported cases of such metastasis from early colorectal cancer. We report a case of choroidal metastasis from early rectal cancer. A 61 year-old-man experienced myodesopsia in the left eye 2 years and 6 months after primary rectal surgery for early cancer, and was diagnosed with left choroidal metastasis and multiple lung metastases. Radiotherapy was initiated for the left eye and systemic chemotherapy is initiated for the multiple lung metastases. The patient is living 2 years and 3 months after the diagnosis of choroidal metastasis without signs of recurrence in the left eye, and continues to receive systemic chemotherapy for multiple lung metastases. Current literatures have few recommendations regarding the appropriate treatment of choroidal metastasis from colorectal cancer, but an aggressive multi-disciplinary approach may be effective in local regression. This is the first report of choroidal metastasis from early rectal cancer. We consider it important to enforce systemic chemotherapy in addition to radiotherapy for choroidal metastasis from colorectal cancer. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Label-free Raman spectroscopy provides early determination and precise localization of breast cancer-colonized bone alterations† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc02905e

    PubMed Central

    Zhang, Chi; Winnard Jr, Paul T.; Dasari, Sidarth; Kominsky, Scott L.; Doucet, Michele; Jayaraman, Swaathi

    2017-01-01

    Breast neoplasms frequently colonize bone and induce development of osteolytic bone lesions by disrupting the homeostasis of the bone microenvironment. This degenerative process can lead to bone pain and pathological bone fracture, a major cause of cancer morbidity and diminished quality of life, which is exacerbated by our limited ability to monitor early metastatic disease in bone and assess fracture risk. Spurred by its label-free, real-time nature and its exquisite molecular specificity, we employed spontaneous Raman spectroscopy to assess and quantify early metastasis driven biochemical alterations to bone composition. As early as two weeks after intracardiac inoculations of MDA-MB-435 breast cancer cells in NOD-SCID mice, Raman spectroscopic measurements in the femur and spine revealed consistent changes in carbonate substitution, overall mineralization as well as crystallinity increase in tumor-bearing bones when compared with their normal counterparts. Our observations reveal the possibility of early stage detection of biochemical changes in the tumor-bearing bones – significantly before morphological variations are captured through radiographic diagnosis. This study paves the way for a better molecular understanding of altered bone remodeling in such metastatic niches, and for further clinical studies with the goal of establishing a non-invasive tool for early metastasis detection and prediction of pathological fracture risk in breast cancer. PMID:29629144

  14. Isolated Hepatic Metastasis from Prostate Carcinoma.

    PubMed

    Wang, Stephani C; McCarthy, Lezah P; Mehdi, Syed

    2017-01-01

    Worldwide, prostate cancer is considered the second most common cancer in men. Most common sites for metastatic disease are lymph nodes and bones. However, isolated liver metastasis from prostate cancer is rare. We present a 75 year-old male with prostate adenocarcinoma diagnosed 7 years ago. With rising PSA, he underwent imaging and found to have isolated hepatic metastasis. After left hepatic lobectomy, his PSA dramatically decreased to < 0.01. Physicians should be aware of isolated hepatic metastasis in patients with prostate cancer. Metastasectomy should be considered in such case, and combined medical and surgical approach may prolong the overall survival.

  15. 3D SPECT/CT fusion using image data projection of bone SPECT onto 3D volume-rendered CT images: feasibility and clinical impact in the diagnosis of bone metastasis.

    PubMed

    Ogata, Yuji; Nakahara, Tadaki; Ode, Kenichi; Matsusaka, Yohji; Katagiri, Mari; Iwabuchi, Yu; Itoh, Kazunari; Ichimura, Akira; Jinzaki, Masahiro

    2017-05-01

    We developed a method of image data projection of bone SPECT into 3D volume-rendered CT images for 3D SPECT/CT fusion. The aims of our study were to evaluate its feasibility and clinical usefulness. Whole-body bone scintigraphy (WB) and SPECT/CT scans were performed in 318 cancer patients using a dedicated SPECT/CT systems. Volume data of bone SPECT and CT were fused to obtain 2D SPECT/CT images. To generate our 3D SPECT/CT images, colored voxel data of bone SPECT were projected onto the corresponding location of the volume-rendered CT data after a semi-automatic bone extraction. Then, the resultant 3D images were blended with conventional volume-rendered CT images, allowing to grasp the three-dimensional relationship between bone metabolism and anatomy. WB and SPECT (WB + SPECT), 2D SPECT/CT fusion, and 3D SPECT/CT fusion were evaluated by two independent reviewers in the diagnosis of bone metastasis. The inter-observer variability and diagnostic accuracy in these three image sets were investigated using a four-point diagnostic scale. Increased bone metabolism was found in 744 metastatic sites and 1002 benign changes. On a per-lesion basis, inter-observer agreements in the diagnosis of bone metastasis were 0.72 for WB + SPECT, 0.90 for 2D SPECT/CT, and 0.89 for 3D SPECT/CT. Receiver operating characteristic analyses for the diagnostic accuracy of bone metastasis showed that WB + SPECT, 2D SPECT/CT, and 3D SPECT/CT had an area under the curve of 0.800, 0.983, and 0.983 for reader 1, 0.865, 0.992, and 0.993 for reader 2, respectively (WB + SPECT vs. 2D or 3D SPECT/CT, p < 0.001; 2D vs. 3D SPECT/CT, n.s.). The durations of interpretation of WB + SPECT, 2D SPECT/CT, and 3D SPECT/CT images were 241 ± 75, 225 ± 73, and 182 ± 71 s for reader 1 and 207 ± 72, 190 ± 73, and 179 ± 73 s for reader 2, respectively. As a result, it took shorter time to read 3D SPECT/CT images than 2D SPECT/CT (p < 0.0001) or WB + SPECT images (p < 0.0001). 3D SPECT/CT fusion offers comparable diagnostic accuracy to 2D SPECT/CT fusion. The visual effect of 3D SPECT/CT fusion facilitates reduction of reading time compared to 2D SPECT/CT fusion.

  16. Beta 2-Microglobulin: A Novel Therapeutic Target for the Treatment of Human Prostate Cancer Bone Metastasis

    DTIC Science & Technology

    2009-03-14

    H, Sodek J, Zhau HE, Chung LW. Human osteocalcin and bone sialoprotein mediating osteomimicry of prostate cancer cells: role of cAMP-dependent...with mesenchymal phenotype b2-m b2-Microglobulin BSP Bone sialoprotein C4-2 Lineage derivative cells from LNCaP C4-2B C4-2 cells metastasized to bone...OPN) and bone sialoprotein (BSP), and RANKL, collectively allow- ing cancer cells to survive and thrive in the bone microenvironment [7–9]. Previous

  17. Bone microenvironment-mediated resistance of cancer cells to bisphosphonates and impact on bone osteocytes/stem cells.

    PubMed

    Alasmari, Abeer; Lin, Shih-Chun; Dibart, Serge; Salih, Erdjan

    2016-08-01

    Anti-resorptive bisphosphonates (BPs) have been clinically used to prevent cancer-bone metastasis and cancer-induced bone pathologies despite the fact that the phenotypic response of the cancer-bone interactions to BP exposure is "uncharted territory". This study offers unique insights into the interplay between cancer stem cells and osteocytes/osteoblasts and mesenchymal stem cells using a three-dimensional (3D) live cancer-bone interactive model. We provide extraordinary cryptic details of the biological events that occur as a result of alendronate (ALN) treatment using 3D live cancer-bone model systems under specific bone remodeling stages. While cancer cells are susceptible to BP treatment in the absence of bone, they are totally unaffected in the presence of bone. Cancer cells colonize live bone irrespective of whether the bone is committed to bone resorption or formation and hence, cancer-bone metastasis/interactions are though to be "independent of bone remodeling stages". In our 3D live bone model systems, ALN inhibited bone resorption at the osteoclast differentiation level through effects of mineral-bound ALN on osteocytes and osteoblasts. The mineral-bound ALN rendered bone incapable of osteoblast differentiation, while cancer cells colonize the bone with striking morphological adaptations which led to a conclusion that a direct anti-cancer effect of BPs in a "live or in vivo" bone microenvironment is implausible. The above studies were complemented with mass spectrometric analysis of the media from cancer-bone organ cultures in the absence and presence of ALN. The mineral-bound ALN impacts the bone organs by limiting transformation of mesenchymal stem cells to osteoblasts and leads to diminished endosteal cell population and degenerated osteocytes within the mineralized bone matrix.

  18. Analysis of tumor- and stroma-supplied proteolytic networks reveals a brain metastasis-promoting role for cathepsin S

    PubMed Central

    Sevenich, Lisa; Bowman, Robert L.; Mason, Steven D.; Quail, Daniela F.; Rapaport, Franck; Elie, Benelita T.; Brogi, Edi; Brastianos, Priscilla K.; Hahn, William C.; Holsinger, Leslie J.; Massagué, Joan; Leslie, Christina S.; Joyce, Johanna A.

    2014-01-01

    Metastasis remains the most common cause of death in most cancers, with limited therapies for combating disseminated disease. While the primary tumor microenvironment is an important regulator of cancer progression, it is less well understood how different tissue environments influence metastasis. We analyzed tumor-stroma interactions that modulate organ tropism of brain, bone and lung metastasis in xenograft models. We identified a number of potential modulators of site-specific metastasis, including cathepsin S as a regulator of breast-to-brain metastasis. High cathepsin S expression at the primary site correlated with decreased brain metastasis-free survival in breast cancer patients. Both macrophages and tumor cells produce cathepsin S, and only the combined depletion significantly reduced brain metastasis in vivo. Cathepsin S specifically mediates blood-brain barrier transmigration via proteolytic processing of the junctional adhesion molecule (JAM)-B. Pharmacological inhibition of cathepsin S significantly reduced experimental brain metastasis, supporting its consideration as a therapeutic target for this disease. PMID:25086747

  19. Measurement bias detection with Kronecker product restricted models for multivariate longitudinal data: an illustration with health-related quality of life data from thirteen measurement occasions

    PubMed Central

    Verdam, Mathilde G. E.; Oort, Frans J.

    2014-01-01

    Highlights Application of Kronecker product to construct parsimonious structural equation models for multivariate longitudinal data. A method for the investigation of measurement bias with Kronecker product restricted models. Application of these methods to health-related quality of life data from bone metastasis patients, collected at 13 consecutive measurement occasions. The use of curves to facilitate substantive interpretation of apparent measurement bias. Assessment of change in common factor means, after accounting for apparent measurement bias. Longitudinal measurement invariance is usually investigated with a longitudinal factor model (LFM). However, with multiple measurement occasions, the number of parameters to be estimated increases with a multiple of the number of measurement occasions. To guard against too low ratios of numbers of subjects and numbers of parameters, we can use Kronecker product restrictions to model the multivariate longitudinal structure of the data. These restrictions can be imposed on all parameter matrices, including measurement invariance restrictions on factor loadings and intercepts. The resulting models are parsimonious and have attractive interpretation, but require different methods for the investigation of measurement bias. Specifically, additional parameter matrices are introduced to accommodate possible violations of measurement invariance. These additional matrices consist of measurement bias parameters that are either fixed at zero or free to be estimated. In cases of measurement bias, it is also possible to model the bias over time, e.g., with linear or non-linear curves. Measurement bias detection with Kronecker product restricted models will be illustrated with multivariate longitudinal data from 682 bone metastasis patients whose health-related quality of life (HRQL) was measured at 13 consecutive weeks. PMID:25295016

  20. Measurement bias detection with Kronecker product restricted models for multivariate longitudinal data: an illustration with health-related quality of life data from thirteen measurement occasions.

    PubMed

    Verdam, Mathilde G E; Oort, Frans J

    2014-01-01

    Application of Kronecker product to construct parsimonious structural equation models for multivariate longitudinal data.A method for the investigation of measurement bias with Kronecker product restricted models.Application of these methods to health-related quality of life data from bone metastasis patients, collected at 13 consecutive measurement occasions.The use of curves to facilitate substantive interpretation of apparent measurement bias.Assessment of change in common factor means, after accounting for apparent measurement bias.Longitudinal measurement invariance is usually investigated with a longitudinal factor model (LFM). However, with multiple measurement occasions, the number of parameters to be estimated increases with a multiple of the number of measurement occasions. To guard against too low ratios of numbers of subjects and numbers of parameters, we can use Kronecker product restrictions to model the multivariate longitudinal structure of the data. These restrictions can be imposed on all parameter matrices, including measurement invariance restrictions on factor loadings and intercepts. The resulting models are parsimonious and have attractive interpretation, but require different methods for the investigation of measurement bias. Specifically, additional parameter matrices are introduced to accommodate possible violations of measurement invariance. These additional matrices consist of measurement bias parameters that are either fixed at zero or free to be estimated. In cases of measurement bias, it is also possible to model the bias over time, e.g., with linear or non-linear curves. Measurement bias detection with Kronecker product restricted models will be illustrated with multivariate longitudinal data from 682 bone metastasis patients whose health-related quality of life (HRQL) was measured at 13 consecutive weeks.

  1. Urothelial bladder cancer with cavitary lung metastases

    PubMed Central

    Kurian, Anil; Lee, Jason; Born, Abraham

    2011-01-01

    Transitional cell carcinoma (TCC) of the bladder tends to remain superficial; however, in 5% to 20% of cases, it progresses to muscle invasion and, more rarely, can metastasize. TCC of the bladder primarily spreads via regional lymphatics. The most common sites of distant metastases of TCC are the liver, lung, mediastinum and bone. Long-term survival of patients with metastatic bladder cancer is rare. Patterns of pulmonary metastasis include multiple nodules, a solitary mass or interstitial micronodule. When multiple nodules are present, they are round and well-circumscribed, without calcification or cavitation. An unusual case of rapidly metastatic TCC to the lung causing large cavitary masses and nodules is presented. Imaging performed after the patient began chemotherapy revealed widespread necrosis of the metastatic cavitary masses causing moderate volume hemoptysis. PMID:21766082

  2. In vivo and in vitro anti-tumor and anti-metastasis effects of Coriolus versicolor aqueous extract on mouse mammary 4T1 carcinoma.

    PubMed

    Luo, Ke-Wang; Yue, Grace Gar-Lee; Ko, Chun-Hay; Lee, Julia Kin-Ming; Gao, Si; Li, Long-Fei; Li, Gang; Fung, Kwok-Pui; Leung, Ping-Chung; Lau, Clara Bik-San

    2014-01-01

    Coriolus versicolor (CV), a medicinal mushroom widely consumed in Asian countries, has been demonstrated to be effective in stimulation of immune system and inhibition of tumor growth. The present study aimed to investigate the anti-tumor and anti-metastasis effects of CV aqueous extract in mouse mammary carcinoma 4T1 cells and in 4T1-tumor bearing mouse model. Our results showed that CV aqueous extract (0.125-2 mg/ml) did not inhibit 4T1 cell proliferation while the non-cytotoxic dose of CV extract (1-2 mg/ml) significantly inhibited cell migration and invasion (p<0.05). Besides, the enzyme activities and protein levels of MMP-9 were suppressed by CV extract significantly. Animal studies showed that CV aqueous extract (1 g/kg, orally-fed daily for 4 weeks) was effective in decreasing the tumor weight by 36%, and decreased the lung metastasis by 70.8% against untreated control. Besides, micro-CT analysis of the tumor-bearing mice tibias indicated that CV extract was effective in bone protection against breast cancer-induced bone destruction as the bone volume was significantly increased. On the other hand, CV aqueous extract treatments resulted in remarkable immunomodulatory effects, which was reflected by the augmentation of IL-2, 6, 12, TNF-α and IFN-γ productions from the spleen lymphocytes of CV-treated tumor-bearing mice. In conclusion, our results demonstrated for the first time that the CV aqueous extract exhibited anti-tumor, anti-metastasis and immunomodulation effects in metastatic breast cancer mouse model, and could protect the bone from breast cancer-induced bone destruction. These findings provided scientific evidences for the clinical application of CV aqueous extract in breast cancer patients. Copyright © 2014 Elsevier GmbH. All rights reserved.

  3. Invasiveness is associated with metastasis and decreased survival in hemangiopericytoma of the central nervous system.

    PubMed

    Kinslow, Connor J; Rajpara, Raj S; Wu, Cheng-Chia; Bruce, Samuel S; Canoll, Peter D; Wang, Shih-Hsiu; Sonabend, Adam M; Sheth, Sameer A; McKhann, Guy M; Sisti, Michael B; Bruce, Jeffrey N; Wang, Tony J C

    2017-06-01

    Meningeal hemangiopericytoma (m-HPC) is a rare tumor of the central nervous system (CNS), which is distinguished clinically from meningioma by its tendency to recur and metastasize. The histological classification and grading scheme for m-HPC is still evolving and few studies have identified tumor features that are associated with metastasis. All patients at our institution with m-HPC were assessed for patient, tumor, and treatment characteristics associated with survival, recurrence, and metastasis. New findings were validated using the SEER database. Twenty-seven patients were identified in our institutional records with m-HPC with a median follow-up time of 85 months. Invasiveness was the strongest predictor of decreased overall survival (OS) and decreased metastasis-free survival (MFS) (p = 0.004 and 0.001). On subgroup analysis, bone invasion trended towards decreased OS (p = 0.056). Bone invasion and soft tissue invasion were significantly associated with decreased MFS (p = 0.001 and 0.012). An additional 315 patients with m-HPC were identified in the SEER database that had information on tumor invasion and 263 with information on distant metastasis. Invasion was significantly associated with decreased survival (HR = 5.769, p = 0.007) and metastasis (OR 134, p = 0.000) in the SEER data. In this study, the authors identified a previously unreported tumor characteristic, invasiveness, as the strongest factor associated with decreased survival and metastasis. The association of invasion with decreased survival and metastasis was confirmed in a separate, larger, publicly available database. Invasion may be a useful parameter in the histological grading and clinical management of hemangiopericytoma of the CNS.

  4. HER2 and EGFR overexpression support metastatic progression of prostate cancer to bone

    PubMed Central

    Day, Kathleen C.; Hiles, Guadalupe Lorenzatti; Kozminsky, Molly; Dawsey, Scott J.; Paul, Alyssa; Broses, Luke J.; Shah, Rajal; Kunja, Lakshmi P.; Hall, Christopher; Palanisamy, Nallasivam; Daignault-Newton, Stephanie; El-Sawy, Layla; Wilson, Steven James; Chou, Andrew; Ignatoski, Kathleen Woods; Keller, Evan; Thomas, Dafydd; Nagrath, Sunitha; Morgan, Todd; Day, Mark L.

    2016-01-01

    Activation of the epidermal growth factor receptors EGFR (ErbB1) and HER2 (ErbB2) drive the progression of multiple cancer types through complex mechanisms that are still not fully understood. In this study, we report that HER2 expression is elevated in bone metastases of prostate cancer independently of gene amplification. An examination of HER2 and NF-κB receptor (RANK) coexpression revealed increased levels of both proteins in aggressive prostate tumors and metastatic deposits. Inhibiting HER2 expression in bone tumor xenografts reduced proliferation and RANK expression while maintaining EGFR expression. In examining the role of EGFR in tumor-initiating cells (TIC), we found that EGFR expression was required for primary and secondary sphere formation of prostate cancer cells. EGFR expression was also observed in circulating tumor cells (CTC) during prostate cancer metastasis. Dual inhibition of HER2 and EGFR resulted in significant inhibition of tumor xenograft growth, further supporting the significance of these receptors in prostate cancer progression. Overall, our results indicate that EGFR promotes survival of prostate TIC and CTC that metastasize to bone, whereas HER2 supports the growth of prostate cancer cells once they are established at metastatic sites. PMID:27793843

  5. A rare presentation of metastasis of prostate adenocarcinoma to the stomach and rectum.

    PubMed

    Soe, Aye Min; Bordia, Sonal; Xiao, Philip Q; Lopez-Morra, Hernan; Tejada, Juan; Atluri, Sreedevi; Krishnaiah, Mahesh

    2014-12-01

    Prostate cancer is the second most common cause of cancer death in men in the United States. The most common sites of metastasis include the bone, lymph nodes, lung, liver, pleura, and adrenal glands, whereas metastatic prostate cancer involving the gastrointestinal tract has been rarely reported. A 64-year-old African-American man with a history of prostate cancer presented with anemia. He reported the passing of dark colored stools but denied hematemesis or hematochezia. Colonoscopy revealed circumferential nodularity, and histology demonstrated metastatic carcinoma of the prostate. Esophagogastroduodenoscopy showed hypertrophic folds in the gastric fundus, and microscopic examination revealed tumor cells positive for prostate-specific antigen. Bone scanning and computed tomography of the abdomen and pelvis did not show metastasis. It is crucial to distinguish primary gastrointestinal cancer from metastatic lesions, especially in patients with a history of cancer at another site, for appropriate management.

  6. A Rare Presentation of Metastasis of Prostate Adenocarcinoma to the Stomach and Rectum

    PubMed Central

    Bordia, Sonal; Xiao, Philip Q; Lopez-Morra, Hernan; Tejada, Juan; Atluri, Sreedevi; Krishnaiah, Mahesh

    2014-01-01

    Prostate cancer is the second most common cause of cancer death in men in the United States. The most common sites of metastasis include the bone, lymph nodes, lung, liver, pleura, and adrenal glands, whereas metastatic prostate cancer involving the gastrointestinal tract has been rarely reported. A 64-year-old African-American man with a history of prostate cancer presented with anemia. He reported the passing of dark colored stools but denied hematemesis or hematochezia. Colonoscopy revealed circumferential nodularity, and histology demonstrated metastatic carcinoma of the prostate. Esophagogastroduodenoscopy showed hypertrophic folds in the gastric fundus, and microscopic examination revealed tumor cells positive for prostate-specific antigen. Bone scanning and computed tomography of the abdomen and pelvis did not show metastasis. It is crucial to distinguish primary gastrointestinal cancer from metastatic lesions, especially in patients with a history of cancer at another site, for appropriate management. PMID:25580360

  7. EMMPRIN regulates tumor growth and metastasis by recruiting bone marrow-derived cells through paracrine signaling of SDF-1 and VEGF.

    PubMed

    Chen, Yanke; Gou, Xingchun; Kong, Derek Kai; Wang, Xiaofei; Wang, Jianhui; Chen, Zeming; Huang, Chen; Zhou, Jiangbing

    2015-10-20

    EMMPRIN, a cell adhesion molecule highly expressed in a variety of tumors, is associated with poor prognosis in cancer patients. Mechanistically, EMMPRIN has been characterized to contribute to tumor development and progression by controlling the expression of MMPs and VEGF. In the present study, by using fluorescently labeled bone marrow-derived cells (BMDCs), we found that the down-regulation of EMMPRIN expression in cancer cells reduces tumor growth and metastasis, and is associated with the reduced recruitment of BMDCs. Further protein profiling studies suggest that EMMPRIN controls BMDC recruitment through regulating the secretion of soluble factors, notably, VEGF and SDF-1. We demonstrate that the expression and secretion of SDF-1 in tumor cells are regulated by EMMPRIN. This study reveals a novel mechanism by which EMMPRIN promotes tumor growth and metastasis by recruitment of BMDCs through controlling secretion and paracrine signaling of SDF-1 and VEGF.

  8. An Unusual Clinical Presentation of Gastrointestinal Metastasis From Invasive Lobular Carcinoma of Breast.

    PubMed

    Balakrishnan, Bathmapriya; Shaik, Sufiya; Burman-Solovyeva, Irina

    2016-01-01

    Introduction. We present an unusual case of metastatic lobular breast carcinoma. Typical areas of metastasis include bone, gynecological organs, peritoneum, retroperitoneum, and gastrointestinal (GI) tract, in order of frequency. With regard to GI metastasis, extrahepatic represents a rare site. Case. Two years after being diagnosed with invasive lobular breast carcinoma, a 61-year-old female complained of 3 months of nonspecific abdominal pain and diarrhea. A colonoscopy revealed 5 tubular adenomatous polyps in the ascending and transverse colon. Contrast computed tomography (CT) of the abdomen and pelvis was done 7 months after the colonoscopy to further evaluate persistent diarrhea. The CT results were consistent with infectious or inflammatory enterocolitis. Despite conservative management, symptoms failed to improve and a repeat diagnostic colonoscopy was obtained. Random colonic biopsies revealed metastatic high-grade adenocarcinoma of the colon. Discussion. Metastatic lobular breast carcinoma to the GI tract can distort initial interpretation of endoscopic evaluation with lesions mimicking inflammation. The interval between discovery of GI metastasis and diagnosis of lobular breast cancer can vary widely from synchronous to 30 years; however, progression is most often much sooner. Nonspecific symptoms and subtle appearance of metastatic lesions may confound the diagnosis. A high index of suspicion is needed for possible metastatic spread to the GI tract in patients with a history of invasive lobular breast carcinoma. Perhaps, patients with nonspecific GI symptoms should have an endoscopic examination with multiple random biopsies as invasive lobular carcinoma typically mimics macroscopic changes consistent with colitis.

  9. Diagnostic performance of a computer-assisted diagnosis system for bone scintigraphy of newly developed skeletal metastasis in prostate cancer patients: search for low-sensitivity subgroups.

    PubMed

    Koizumi, Mitsuru; Motegi, Kazuki; Koyama, Masamichi; Terauchi, Takashi; Yuasa, Takeshi; Yonese, Junji

    2017-08-01

    The computer-assisted diagnostic system for bone scintigraphy (BS) BONENAVI is used to evaluate skeletal metastasis. We investigated its diagnostic performance in prostate cancer patients with and without skeletal metastasis and searched for the problems. An artificial neural network (ANN) value was calculated in 226 prostate cancer patients (124 with skeletal metastasis and 101 without) using BS. Receiver operating characteristic curve analysis was performed and the sensitivity and specificity determined (cutoff ANN = 0.5). Patient's situation at the time of diagnosis of skeletal metastasis, computed tomography (CT) type, extent of disease (EOD), and BS uptake grade were analyzed. False-negative and false-positive results were recorded. BONENAVI showed 82% (102/124) of sensitivity and 83% (84/101) specificity for metastasis detection. There were no significant differences among CT types, although low EOD and faint BS uptake were associated with low ANN values and low sensitivity. Patients showed lower sensitivity during the follow-up period than staging work-up. False-negative lesions were often located in the pelvis or adjacent to it. They comprised not only solitary, faint BS lesions but also overlaying to urinary excretion. BONENAVI with BS has good sensitivity and specificity for detecting prostate cancer's osseous metastasis. Low EOD and faint BS uptake are associated with low sensitivity but not the CT type. Prostate cancer patients likely to have false-negative results during the follow-up period had a solitary lesion in the pelvis with faint BS uptake or lesions overlaying to urinary excretion.

  10. Whole-Body and Microenvironmental Localization of Radium-223 in Naïve and Mouse Models of Prostate Cancer Metastasis

    PubMed Central

    Abou, Diane S.; Ulmert, David; Doucet, Michele; Hobbs, Robert F.; Riddle, Ryan C.

    2016-01-01

    Background: Bone-metastatic, castration-resistant prostate cancer (bmCRPC) represents a lethal stage of the most common noncutaneous cancer in men. The recent introduction of Radium-223 dichloride, a bone-seeking alpha particle (α)–emitting radiopharmaceutical, demonstrates statistically significant survival benefit and palliative effect for bmCRPC patients. Clinical results have established safety and efficacy, yet questions remain regarding pharmacodynamics and dosing for optimized patient benefit. Methods: We elucidated the biodistribution of 223Ra as well as interaction with the bone and tumor compartments in skeletally mature mice (C57Bl/6 and CD-1, n = 3–6) and metastasis models (LNCaP and PC3, n = 4). Differences in uptake were evaluated by µCT and histological investigation. Novel techniques were leveraged on whole-mount undecalcified cryosections to determine microdistribution of Radium-223. All statistical tests were two-sided. Results: 223Ra uptake in the bones (>30% injected activity per gram) at 24 hours was also accompanied by non-negligible remnant activity in the kidney (2.33% ± 0.36%), intestines (5.73% ± 2.04%), and spleen (10.5% ± 5.9%) Skeletal accumulation across strains did not correspond with bone volume or surface area but instead to local blood vessel density (P = .04). Microdistribution analysis by autoradiography and α camera revealed targeting of the ossifying surfaces adjacent to the epiphyseal growth plate. In models of PCa metastasis, radioactivity does not localize directly within tumors but instead at the apposite bone surface. Osteoblastic and lytic lesions display similar intensity, which is comparable with uptake at sites of normal bone remodeling. Conclusions: Profiling the macro- and microdistribution of 223Ra in healthy and diseased models has important implications to guide precision application of this emerging α-therapy approach for bmCRPC and other bone metastastic diseases. PMID:26683407

  11. RAS mutations affect pattern of metastatic spread and increase propensity for brain metastasis in colorectal cancer.

    PubMed

    Yaeger, Rona; Cowell, Elizabeth; Chou, Joanne F; Gewirtz, Alexandra N; Borsu, Laetitia; Vakiani, Efsevia; Solit, David B; Rosen, Neal; Capanu, Marinela; Ladanyi, Marc; Kemeny, Nancy

    2015-04-15

    RAS and PIK3CA mutations in metastatic colorectal cancer (mCRC) have been associated with worse survival. We sought to evaluate the impact of RAS and PIK3CA mutations on cumulative incidence of metastasis to potentially curable sites of liver and lung and other sites such as bone and brain. We performed a computerized search of the electronic medical record of our institution for mCRC cases genotyped for RAS or PIK3CA mutations from 2008 to 2012. Cases were reviewed for patient characteristics, survival, and site-specific metastasis. Among the 918 patients identified, 477 cases were RAS wild type, and 441 cases had a RAS mutation (394 at KRAS exon 2, 29 at KRAS exon 3 or 4, and 18 in NRAS). RAS mutation was significantly associated with shorter median overall survival (OS) and on multivariate analysis independently predicted worse OS (HR, 1.6; P < .01). RAS mutant mCRC exhibited a significantly higher cumulative incidence of lung, bone, and brain metastasis and on multivariate analysis was an independent predictor of involvement of these sites (HR, 1.5, 1.6, and 3.7, respectively). PIK3CA mutations occurred in 10% of the 786 cases genotyped, did not predict for worse survival, and did not exhibit a site-specific pattern of metastatic spread. The metastatic potential of CRC varies with the presence of RAS mutation. RAS mutation is associated with worse OS and increased incidence of lung, bone, and brain metastasis. An understanding of this site-specific pattern of spread may help to inform physicians' assessment of symptoms in patients with mCRC. © 2014 American Cancer Society.

  12. Anal metastasis as the sentinel and isolated presentation of invasive ductal breast carcinoma.

    PubMed

    Rengifo, C; Titi, S; Walls, J

    2016-05-01

    Breast cancer currently affects 1 in 8 women in the UK during their lifetime. Common sites for breast cancer metastasis include the axillary lymph nodes, bones, lung, liver, brain, soft tissue and adrenal glands. There is well documented evidence detailing breast metastasis to the gastrointestinal tract but anal metastasis is exceptionally rare. We present the case of a 78-year-old woman with an anal metastasis as the sentinel and isolated presentation of an invasive ductal breast carcinoma. As advances in the treatment of breast cancer improve, and with an ageing and expanding population, there will be an increasing number of cancer survivors, and more of these unusual presentations may be encountered in the future.

  13. Identifying osteosarcoma metastasis associated genes by weighted gene co-expression network analysis (WGCNA).

    PubMed

    Tian, Honglai; Guan, Donghui; Li, Jianmin

    2018-06-01

    Osteosarcoma (OS), the most common malignant bone tumor, accounts for the heavy healthy threat in the period of children and adolescents. OS occurrence usually correlates with early metastasis and high death rate. This study aimed to better understand the mechanism of OS metastasis.Based on Gene Expression Omnibus (GEO) database, we downloaded 4 expression profile data sets associated with OS metastasis, and selected differential expressed genes. Weighted gene co-expression network analysis (WGCNA) approach allowed us to investigate the most OS metastasis-correlated module. Gene Ontology functional and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were used to give annotation of selected OS metastasis-associated genes.We select 897 differential expressed genes from OS metastasis and OS non-metastasis groups. Based on these selected genes, WGCNA further explored 142 genes included in the most OS metastasis-correlated module. Gene Ontology functional and KEGG pathway enrichment analyses showed that significantly OS metastasis-associated genes were involved in pathway correlated with insulin-like growth factor binding.Our research figured out several potential molecules participating in metastasis process and factors acting as biomarker. With this study, we could better explore the mechanism of OS metastasis and further discover more therapy targets.

  14. Neoplastic pleural effusion and intrathoracic metastasis of a scapular osteosarcoma in a dog: a multidisciplinary integrated diagnostic approach.

    PubMed

    Mesquita, Luis; Mortier, Jeremy; Ressel, Lorenzo; Finotello, Riccardo; Silvestrini, Paolo; Piviani, Martina

    2017-06-01

    A 10-year-old, female spayed mixed-breed or cross-bred dog was referred to the Small Animal Teaching Hospital of the University of Liverpool due to tachypnea, dyspnea, and pleural effusion not responding to diuretics and antibiotics. The chest was drained and cytology of the pleural fluid was consistent with a modified transudate with presence of atypical cells initially attributed to mesothelial hyperplasia and dysplasia. Computed tomography detected, in addition to the bilateral pleural effusion, diffuse pleural thickening, multiple pleural and pulmonary nodules, and a mineralized and lytic mass in the left scapula. Imaging findings were suggestive of a primary bone tumor with intrathoracic metastasis. Cytology of the left scapular and pleural masses revealed a malignant neoplasm highly suggestive of osteosarcoma. The diagnosis was confirmed by demonstration of a positive cytochemical reaction for alkaline phosphatase on prestained cytology slides. This finding prompted review of the initial interpretation of the pleural effusion cytology. The presence of neoplastic osteoblasts in the thoracic fluid was identified by a combination of cytochemistry, cell pellet immunohistochemistry, and transmission electron microscopy findings. In this report, a multidisciplinary integrated diagnostic approach was used to diagnose and confirm a neoplastic pleural effusion due to osteosarcoma metastasis in a dog. © 2017 American Society for Veterinary Clinical Pathology.

  15. Complete response of a recurrent-metastatic liposarcoma with dedifferentiated histological features following the administration of trabectedin and review of literature.

    PubMed

    Kus, Tulay; Aktas, Gokmen; Kalender, Mehmet Emin; Tutar, Ediz; Ulker, Esra; Camci, Celaletdin

    2015-01-01

    The present case report defines a rare case of a liposarcoma with bone metastasis resulting in a complete remission (CR) following trabectedin treatment. The patient was referred with abdominal swelling and pain. A retroperitoneal mass was detected and described as dedifferentiated liposarcoma (DDLS). The mass was surgically removed and consequently adjuvant chemotherapy was administered. Three months after the completion of chemotherapy, patient presented with bone metastasis in thoracic and lumbar vertebrae. Vertebroplasty and radiotherapy (RT) was performed. After these therapies, bone pain persisted and bone scintigraphy showed increased activity in L4, T11, and T12 vertebrae. Zoledronic acid was added to trabectedin treatment. CR has been detected on bone scintigraphy and positron emission tomography-computed tomography (PET-CT) after 18 weeks. Previous cases about liposarcoma treated with trabectedin were mostly about the myxoid/round cell type (former name, currently known as myxoid liposarcoma (MLS)) and mostly reported partial responses. In this study, trabectedin was used for the treatment of a metastatic retroperitoneal DDLS and a CR was achieved.

  16. Diagnostic role of (99)Tc(m)-MDP SPECT/CT combined SPECT/MRI Multi modality imaging for early and atypical bone metastases.

    PubMed

    Chen, Xiao-Liang; Li, Qian; Cao, Lin; Jiang, Shi-Xi

    2014-01-01

    The bone metastasis appeared early before the bone imaging for most of the above patients. (99)Tc(m)-MDP ((99)Tc(m) marked methylene diphosphonate) bone imaging could diagnosis the bone metastasis with highly sensitivity, but with lower specificity. The aim of this study is to explore the diagnostic value of (99)Tc(m)-MDP SPECT/CT combined SPECT/MRI Multi modality imaging for the early period atypical bone metastases. 15 to 30 mCi (99)Tc(m)-MDP was intravenously injected to the 34 malignant patients diagnosed as doubtful early bone metastases. SPECT, CT and SPECT/CT images were captured and analyzed consequently. For the patients diagnosed as early period atypical bone metastases by SPECT/CT, combining the SPECT/CT and MRI together as the SPECT/MRI integrated image. The obtained SPECT/MRI image was analyzed and compared with the pathogenic results of patients. The results indicated that 34 early period doubtful metastatic focus, including 34 SPECT positive focus, 17 focus without special changes by using CT method, 11 bone metastases focus by using SPECT/CT method, 23 doubtful bone metastases focus, 8 doubtful bone metastases focus, 14 doubtful bone metastases focus and 2 focus without clear image. Totally, SPECT/CT combined with SPECT/MRI method diagnosed 30 bone metastatic focus and 4 doubtfully metastatic focus. In conclusion, (99)Tc(m)-MDP SPECT/CT combined SPECT/MRI Multi modality imaging shows a higher diagnostic value for the early period bone metastases, which also enhances the diagnostic accuracy rate.

  17. Paget's disease of bone resembling bone metastasis from gastric cancer.

    PubMed

    Shimoyama, Yasuyuki; Kusano, Motoyasu; Shimoda, Yoko; Ishihara, Shingo; Toyomasu, Yoshitaka; Ohno, Tetsuro; Mochiki, Erito; Sano, Takaaki; Hirato, Junko; Mori, Masatomo

    2011-08-01

    A 74-year-old man had an endoscopic type 0'-IIc tumor in the upper gastric body on the greater curvature and biopsy showed the tumor to be a well-differentiated adenocarcinoma (Group 5). He was referred to us for endoscopic submucosal dissection (ESD). Endoscopy revealed fold convergency, fold swelling, and fusion of the fold, indicating tumor invasion into the submucosa, which was outside the indications for ESD. In addition, there was an increase of serum bone-type alkaline phosphatase (ALP-III and ALP-IV) and urinary cross-linked N-terminal telopeptide of type I collagen (a bone metabolism marker), while (18)F-fluorodeoxyglucose positron emission tomography showed increased uptake in the left pelvis and Th10, suggesting bone metastases. We first diagnosed gastric cancer with bone metastases; however, the symptoms suggested pathological bone fracture and no bone pain. Therefore, a computed tomography-guided aspiration bone biopsy was performed to exclude the possibility of Paget's disease of bone. Biopsy specimens revealed no tumor and a mosaic pattern. No increased uptake of (18)F-FAMT (L-[3-(18)F] α-methyltyrosine) supported a diagnosis of no bone metastases from gastric cancer. We finally diagnosed gastric cancer accompanied by Paget's disease of bone and performed a laparoscopy-assisted proximal gastrectomy. The pathological diagnosis was U less 0-IIb, and U post 0-IIc ypT1a (M) N0H0P0M0 yp stage IA. In gastric cancer patients with suspected bone metastasis, we also need to consider Paget's disease of bone.

  18. Role of Bruton's tyrosine kinase (BTK) in growth and metastasis of INA6 myeloma cells

    PubMed Central

    Bam, R; Venkateshaiah, S U; Khan, S; Ling, W; Randal, S S; Li, X; Zhang, Q; van Rhee, F; Barlogie, B; Epstein, J; Yaccoby, S

    2014-01-01

    Bruton's tyrosine kinase (BTK) and the chemokine receptor CXCR4 are linked in various hematologic malignancies. The aim of the study was to understand the role of BTK in myeloma cell growth and metastasis using the stably BTK knockdown luciferase-expressing INA6 myeloma line. BTK knockdown had reduced adhesion to stroma and migration of myeloma cells toward stromal cell-derived factor-1. BTK knockdown had no effect on short-term in vitro growth of myeloma cells, although clonogenicity was inhibited and myeloma cell growth was promoted in coculture with osteoclasts. In severe combined immunodeficient-rab mice with contralaterally implanted pieces of bones, BTK knockdown in myeloma cells promoted their proliferation and growth in the primary bone but suppressed metastasis to the contralateral bone. BTK knockdown myeloma cells had altered the expression of genes associated with adhesion and proliferation and increased mammalian target of rapamycin signaling. In 176 paired clinical samples, BTK and CXCR4 expression was lower in myeloma cells purified from a focal lesion than from a random site. BTK expression in random-site samples was correlated with proportions of myeloma cells expressing cell surface CXCR4. Our findings highlight intratumoral heterogeneity of myeloma cells in the bone marrow microenvironment and suggest that BTK is involved in determining proliferative, quiescent or metastatic phenotypes of myeloma cells. PMID:25083818

  19. The Influence of Primary Microenvironment on Prostate Cancer Osteoblastic Bone Lesion Development

    DTIC Science & Technology

    2015-09-01

    for inhibiting PCa bone lesion development: 3a. Basic fibroblast growth factor (bFGF) in PC3 bone metastasis: bFGF was identified by cytokine...II receptor (TβRII) knockout (Tgfbr2 KO) mouse models. Col1creERT/Tgfbr2 KO (Col/Tgfbr2 KO), which have TGF-β signaling specific KO in fibroblasts ... fibroblasts and osteoblasts in the bone by Colcre/Tgfbr2 KO, or in the myeloid lineage cells, including osteoclasts in the bone by LysMcre/Tgfbr2 KO

  20. A Prospective Study of Bone Tumor Response Assessment in Metastatic Breast Cancer

    PubMed Central

    Hayashi, Naoki; Costelloe, Colleen M.; Hamaoka, Tsuyoshi; Wei, Caimiao; Niikura, Naoki; Theriault, Richard L.; Hortobagyi, Gabriel N.; Madewell, John E.; Ueno, Naoto T.

    2013-01-01

    In this pilot study, we prospectively compared the response of bone metastasis assessed by our MD Anderson (MDA) bone tumor response criteria (computed tomography [CT], plain radiography [XR], and skeletal scintigraphy [SS]) with the response assessed by the World Health Organization (WHO) criteria (XR and SS). Both MDA and WHO criteria predicted progression-free survival (PFS) of patients at 6 months but not at an earlier time point. Background In our previous study, new MD Anderson (MDA) bone tumor response criteria (based on computed tomography [CT], plain radiography [XR], and skeletal scintigraphy [SS]) predicted progression-free survival (PFS) better than did World Health Organization (WHO) bone tumor response criteria (plain radiography [XR] and SS) among patients with breast cancer and bone-only metastases. In this pilot study, we tested whether MDA criteria could reveal bone metastasis response earlier than WHO criteria in patients with newly diagnosed breast cancer with osseous and measurable nonosseous metastases. Methods We prospectively analyzed bone metastasis response using each imaging modality and set of bone response criteria to distinguish progressive disease (PD) from non-PD and their association with PFS and overall survival (OS). We also compared the response of osseous metastases assessed by both criteria with the response of nonosseous measurable lesions. Results The median follow-up period was 26.7 months (range, 6.1–53.3 months) in 29 patients. PFS rates differed at 6 months based on the classification of PD or non-PD using either set of criteria (MDA, P = .002; WHO, P = .014), but these rates, as well as OS, did not differ at 3 months. Response in osseous metastases by either set of criteria did not correlate with the response in nonosseous metastases. Conclusion MDA and WHO criteria predicted PFS of patients with osseous metastases at 6 months but not at an earlier time point. We plan a well-powered study to determine the role of MDA criteria in predicting bone tumor response by incorporating 18-fluorodeoxyglucose (18F) positron emission tomography (FDG-PET)/CT to see if findings using this modality are earlier than those with WHO criteria. PMID:23098575

  1. CD73-deficient mice have increased antitumor immunity and are resistant to experimental metastasis.

    PubMed

    Stagg, John; Divisekera, Upulie; Duret, Helene; Sparwasser, Tim; Teng, Michele W L; Darcy, Phillip K; Smyth, Mark J

    2011-04-15

    CD73 is a cell-surface enzyme that suppresses immune responses by producing extracellular adenosine. In this study, we employed CD73 gene-targeted mice to investigate the role of host-derived CD73 on antitumor immunity and tumor cell metastasis. We found that CD73 ablation significantly suppressed the growth of ovalbumin-expressing MC38 colon cancer, EG7 lymphoma, AT-3 mammary tumors, and B16F10 melanoma. The protective effect of CD73 deficiency on primary tumors was dependent on CD8(+) T cells and associated with an increased frequency of antigen-specific CD8(+) T cells in peripheral blood and tumors and increased antigen-specific IFN-γ production. Replicate studies in bone marrow chimeras established that both hematopoietic and nonhematopoietic expression of CD73 was important to promote tumor immune escape. Using adoptive reconstitution of T regulatory cell (Treg)-depleted DEREG (depletion of regulatory T cells) mice, we demonstrated that part of the protumorigenic effect of Tregs was dependent on their expression of CD73. CD73-deficient mice were also protected against pulmonary metastasis of B16F10 melanoma cells after intravenous injection. Unexpectedly, we found that the prometastatic effect of host-derived CD73 was dependent on CD73 expression on nonhematopoietic cells. CD73 expression on nonhematopoietic cells, most likely endothelial cells, was critical for promoting lung metastasis in a manner independent from immunosuppressive effects. Notably, in vivo blockade of CD73 with a selective inhibitor or anti-CD73 monoclonal antibody significantly reduced tumor growth and metastasis of CD73-negative tumors. Taken together, our findings indicate that CD73 may be targeted at multiple levels to induce anticancer effects including at the level of tumor cells, Tregs, and nonhematopoietic cells. ©2011 AACR.

  2. Malignant transformation of a unicameral bone cyst in a cat.

    PubMed

    Berger, Björn; Brühschwein, Andreas; Eddicks, Lina; Meyer-Lindenberg, Andrea

    2016-04-01

    A unicameral bone cyst in the proximal humerus of a 3-year-old Norwegian forest cat was diagnosed by dynamic contrast-enhanced magnetic resonance imaging, surgical exploration, and histopathology. Surgical curettage and incorporation of bone cement led to full recovery. An osteosarcoma developed at the surgical site 17 months later. Thoracic radiographs showed pulmonary lesions consistent with metastasis.

  3. Malignant transformation of a unicameral bone cyst in a cat

    PubMed Central

    Berger, Björn; Brühschwein, Andreas; Eddicks, Lina; Meyer-Lindenberg, Andrea

    2016-01-01

    A unicameral bone cyst in the proximal humerus of a 3-year-old Norwegian forest cat was diagnosed by dynamic contrast-enhanced magnetic resonance imaging, surgical exploration, and histopathology. Surgical curettage and incorporation of bone cement led to full recovery. An osteosarcoma developed at the surgical site 17 months later. Thoracic radiographs showed pulmonary lesions consistent with metastasis. PMID:27041754

  4. Keratin 13 expression reprograms bone and brain metastases of human prostate cancer cells.

    PubMed

    Li, Qinlong; Yin, Lijuan; Jones, Lawrence W; Chu, Gina C-Y; Wu, Jason B-Y; Huang, Jen-Ming; Li, Quanlin; You, Sungyong; Kim, Jayoung; Lu, Yi-Tsung; Mrdenovic, Stefan; Wang, Ruoxiang; Freeman, Michael R; Garraway, Isla; Lewis, Michael S; Chung, Leland W K; Zhau, Haiyen E

    2016-12-20

    Lethal progression of prostate cancer metastasis can be improved by developing animal models that recapitulate the clinical conditions. We report here that cytokeratin 13 (KRT13), an intermediate filament protein, plays a directive role in prostate cancer bone, brain, and soft tissue metastases. KRT13 expression was elevated in bone, brain, and soft tissue metastatic prostate cancer cell lines and in primary and metastatic clinical prostate, lung, and breast cancer specimens. When KRT13 expression was determined at a single cell level in primary tumor tissues of 44 prostate cancer cases, KRT13 level predicted bone metastasis and the overall survival of prostate cancer patients. Genetically enforced KRT13 expression in human prostate cancer cell lines drove metastases toward mouse bone, brain and soft tissues through a RANKL-independent mechanism, as KRT13 altered the expression of genes associated with EMT, stemness, neuroendocrine/neuromimicry, osteomimicry, development, and extracellular matrices, but not receptor activator NF-κB ligand (RANKL) signaling networks in prostate cancer cells. Our results suggest new inhibitors targeting RANKL-independent pathways should be developed for the treatment of prostate cancer bone and soft tissue metastases.

  5. Spine metastasis imaging: review of the literature.

    PubMed

    Guillevin, R; Vallee, J-N; Lafitte, F; Menuel, C; Duverneuil, N-M; Chiras, J

    2007-12-01

    Any malignant neoplasm possesses the capacity to metastasize to the musculoskeletal system. Because the spine is the most frequent site of bone metastasis, imaging must be discussed in cases of cancer. Bone marrow is the main interest in imaging the metastatic process by magnetic resonance, while X-rays allow the study of cortical involvement. This article presents our experience, and a review of the literature, in an overview of the different imaging techniques-X-rays and magnetic resonance-with emphasis on the many difficulties that can be encountered in the diagnosis and monitoring of spinal metastases, allowing a management strategy for diagnosis and follow-up.

  6. The Effect of Gabapentin and Tramadol in Cancer Pain Induced by Glioma Cell in Rat Femur.

    PubMed

    Corona-Ramos, Janette Nallely; Déciga-Campos, Myrna; Romero-Piña, Mario; Medina, Luis A; Martínez-Racine, Issac; Jaramillo-Morales, Osmar A; García-López, Patricia; López-Muñoz, Francisco Javier

    2017-08-01

    Preclinical Research The presence of pain as part of the cancer process is variable. Glioblastoma multiform (GBM) can produce bone metastasis, a condition that involves other pathological phenotypes including neuropathic and inflammatory pain. Tramadol and gabapentin are drugs used in the treatment of neuropathic pain. However, there are no studies evaluating their analgesic effects in bone metastasis. We produced a pain model induced by the inoculation of glioma cells (10 5 ) into the rat femur, by perforating the intercodiloid fossa. Painful behavior was evaluated by measuring mechanical allodynia using the Von Frey test while thermal hyperalgesia was assessed in the plantar test. Histopathological features were evaluated and antinociceptive responses were compared using tramadol and gabapentin. The inoculation of cells inside the right femur produced nociceptive behaviors. Tramadol and gabapentin produced an anti-allodynic effect in this condition, but tramadol did not produce an anti-hyperalgesic response. The development of this model will allow us to perform tests to elucidate the pathology of bone metastasis, cancer pain, and in particular the pain produced by glioma. Drug Dev Res 78 : 173-183, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  7. Bone pulsating metastasis due to renal cell carcinoma.

    PubMed

    Cınar, Murat; Derincek, Alihan; Karan, Belgin; Akpınar, Sercan; Tuncay, Cengiz

    2010-11-01

    Pulsation on the bone cortex surface is a rare condition. Pulsative palpation of the superficial-located bone tumors can be misperceived as an aneurysm. Fifty-eight-year-old man is presented with pulsating bone mass in his proximal tibia. During angiographic examination, hypervascular masses were diagnosed both at right kidney and at right proximal tibia. Renal cell carcinoma was diagnosed after abdominal CT scan. Proximal tibia biopsy was complicated with projectile bleeding.

  8. Gut metastasis from breast carcinoma.

    PubMed

    Al-Qahtani, Mohammed S

    2007-10-01

    Breast cancer is the second most common malignancy in women. Common sites of metastases include the liver, lung, bone, and the brain. Metastases to the gastrointestinal tract are rare with patients presenting with small-bowel perforation, intestinal obstruction, and gastrointestinal bleeding. Here we report a case of a Saudi female presenting with invasive lobular carcinoma and ileo-cecal junction metastasis.

  9. Functional Genomics for Epithelial-Mesenchymal Transition in Breast Cancer

    DTIC Science & Technology

    2011-10-01

    9780521887212) CONFERENCES PRESENTATIONS (Podium) International International Bone & Mineral Society – Cancer and Bone Society meeting, Chicago , IL...bladder. Clin Exp Metastasis. 22: 115– 125. 62. Yates CC, Shepard CR, Stolz DB, Wells A (2007) Co- culturing human prostate carcinoma cells with hepato

  10. Pigment epithelium-derived factor upregulates collagen I and downregulates matrix metalloproteinase 2 in osteosarcoma cells, and colocalises to collagen I and heat shock protein 47 in fetal and adult bone.

    PubMed

    Alcantara, Marice B; Nemazannikova, Natalie; Elahy, Mina; Dass, Crispin R

    2014-11-01

    Pigment epithelium-derived factor (PEDF) has proven anti-osteosarcoma activity. However, the mechanism(s) underpinning its ability to reduce primary bone tumour (osteosarcoma) metastasis is unknown. Adult and fetal murine bone were immunostained for PEDF, collagen I (major protein in bone) and its processing proteins, heat shock protein 47 (HSP47, a chaperone protein for collagen I), membrane type I matrix metalloproteinase (MT1-MMP, a collagenase), and matrix metalloproteinase 2 (MMP-2, which is activated by MT1-MMP). Immunoblotting and immunocytochemistry were used to observe levels of the above biomarkers when human osteosarcoma cells were treated with PEDF. Immunohistochemical staining in adult and fetal bone mirrors collagen I. PEDF localised to ridges of trabecular bone in tibial cortex and to megakaryocytes within bone marrow. Second, we observed that PEDF upregulates collagen I, HSP47 and MT1-MMP, while downregulating MMP-2 in osteosarcoma cells in vitro. PEDF is a promising antagonist to osteosarcoma cell metastasis via downregulation of MMP-2, and can induce tumour cells to further adopt differentiative properties, thereby possibly reducing their aggressive growth in vitro and in vivo. © 2014 Royal Pharmaceutical Society.

  11. HTLV-1 Tax transgenic mice develop spontaneous osteolytic bone metastases prevented by osteoclast inhibition

    PubMed Central

    Gao, Ling; Deng, Hongju; Zhao, Haibo; Hirbe, Angela; Harding, John; Ratner, Lee; Weilbaecher, Katherine

    2005-01-01

    One in 20 carriers of human T-cell leukemia virus type 1 (HTLV-1) will develop adult T-cell leukemia/lymphoma (ATL), a disease frequently associated with hypercalcemia, bone destruction, and a fatal course refractory to current therapies. Overexpression of the HTLV-1–encoded Tax oncoprotein under the human granzyme B promoter causes large granular lymphocytic leukemia/lymphomas in mice. We found that Tax+ mice spontaneously developed hypercalcemia, high-frequency osteolytic bone metastases, and enhanced osteoclast activity. We evaluated Tax tumors for the production of osteoclast-activating factors. Purification of Tax+ tumor cells and nonmalignant tumor-infiltrating lymphocytes demonstrated that each of these populations expressed transcripts for distinct osteoclast-activating factors. We then evaluated the effect of osteoclast inhibition on tumor formation. Mice doubly transgenic for Tax and the osteoclast inhibitory factor, osteoprotegerin, were protected from osteolytic bone disease and developed fewer soft-tissue tumors. Likewise, osteoclast inhibition with bone-targeted zoledronic acid protected Tax+ mice from bone and soft-tissue tumors and prolonged survival. Tax+ mice represent the first animal model of high-penetrance spontaneous osteolytic bone metastasis and underscore the critical role of nonmalignant host cells recruited by tumor cells in the process of cancer progression and metastasis. PMID:16118323

  12. Three-Dimensional Mechanical Loading Modulates the Osteogenic Response of Mesenchymal Stem Cells to Tumor-Derived Soluble Signals.

    PubMed

    Lynch, Maureen E; Chiou, Aaron E; Lee, Min Joon; Marcott, Stephen C; Polamraju, Praveen V; Lee, Yeonkyung; Fischbach, Claudia

    2016-08-01

    Dynamic mechanical loading is a strong anabolic signal in the skeleton, increasing osteogenic differentiation of bone marrow-derived mesenchymal stem cells (BM-MSCs) and increasing the bone-forming activity of osteoblasts, but its role in bone metastatic cancer is relatively unknown. In this study, we integrated a hydroxyapatite-containing three-dimensional (3D) scaffold platform with controlled mechanical stimulation to investigate the effects of cyclic compression on the interplay between breast cancer cells and BM-MSCs as it pertains to bone metastasis. BM-MSCs cultured within mineral-containing 3D poly(lactide-co-glycolide) (PLG) scaffolds differentiated into mature osteoblasts, and exposure to tumor-derived soluble factors promoted this process. When BM-MSCs undergoing osteogenic differentiation were exposed to conditioned media collected from mechanically loaded breast cancer cells, their gene expression of osteopontin was increased. This was further enhanced when mechanical compression was simultaneously applied to BM-MSCs, leading to more uniformly deposited osteopontin within scaffold pores. These results suggest that mechanical loading of 3D scaffold-based culture models may be utilized to evaluate the role of physiologically relevant physical cues on bone metastatic breast cancer. Furthermore, our data imply that cyclic mechanical stimuli within the bone microenvironment modulate interactions between tumor cells and BM-MSCs that are relevant to bone metastasis.

  13. The portrayal of bone tumours in the press.

    PubMed

    Al-Nammari, Shafic Said; Danesh, Arash; Mussa, Mohamed; Al-Hadithy, Nawfal

    2013-04-01

    The media are pivotal in educating and informing the general public. The stories they cover and how they cover them has a powerful influence on public perceptions. There have been no previous reports of the portrayal of bone tumours in the press. LexisNexis™ Professional search engine used to retrieve articles from all United Kingdom National Newspapers over one year containing terms "bone tumour/bone tumour" and 46 other named bone and joint tumours from May 2009 to May 2010. A total of 253 relevant articles were found. Seven per cent solely bone tumour related, 41% main theme and 52% mentioned in passing. 52% mentioned tumour type. These were 51% multiple myeloma, 15% Ewing's sarcoma, 9% sarcoma unspecified, 6% clear cell sarcoma, 4.5% epithelial sarcoma, 4% synovial sarcoma, 3% osteosarcoma, 3% bony metastasis and 1.5% chondrosarcoma. Benign bone tumours not mentioned. Article focus: chemotherapy 17%, surgeon/doctor 7% and new surgical technique 2%. The overall attitudinal tone of the articles were 52% negative, 32% neutral and 16% positive. Only 13% quoted an oncologist, and 1% an orthopaedic surgeon. Quality of medical information provided was limited with 90% providing no meaningful medical information and this medical information being correct only 68% of the time. Articles with quotes from a doctor were significantly more likely to contain meaningful medical information than those without-33 versus 4%, respectively (p < 0.001 Chi-squared test)-and there was a trend for them to be more factually correct overall-68 versus 50% (p = 0.192 Fisher's exact Test).

  14. Preparation and evaluation of rhenium-188-pamidronate as a palliative treatment in bone metastasis.

    PubMed

    Erfani, Mostafa; Rahmani, Nasim; Doroudi, Alireza; Shafiei, Mohammad

    2017-06-01

    Rhenium-188-hydroxyethylidene diphosphonate ( 188 Re-HEDP) as a first generation bisphosphonate has been widely used for bone seeking radiopharmaceutical in cases of metastatic bone disease. No study has been yet reported on preparing a complex of 188 Re with pamidronate (3-aminohydroxypropylidene-1,1-bisphosphonic acid) (PMA) as a second generation bisphosphonate. Based on this fact, it was hypothesized that a bone-seeking 188 Re-PMA radiopharmaceutical could be developed as an agent for palliative radiotherapy of bone pain due to skeletal metastases. Pamidronate was labeled with 188 ReO 4 - eluted from the alumina based 188 W/ 188 Re generator. Labeling was optimized, and radiochemical analysis was performed by thin layer chromatography (TLC) and high performance liquid chromatography (HPLC). Biodistribution of this radioconjugate was evaluated and verified further in mice. 188 Re-PMA was prepared successfully in a high labeling yield (˃95%) corresponding to a specific activity of 124MBq/μmol and good in vitro stability, but it is likely to consist of multiple species. In biodistribution studies selective uptake and retention of activity in the skeletal system (0.81±0.25% ID/g and 0.57±0.16 at 4 and 48h in bone post injection respectively) followed by clearance in the soft tissues were observed. These results show that due to its biological capabilities it would be advantageous to use 188 Re-PMA for bone pain palliation therapy. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Elevated circulating level of osteopontin is associated with advanced disease state of non-small cell lung cancer.

    PubMed

    Chang, Yoon Soo; Kim, Hyung Jung; Chang, Joon; Ahn, Chul Min; Kim, Sung Kyu; Kim, Se Kyu

    2007-09-01

    Osteopontin (OPN) plays important roles in tumor progression and metastasis through binding to OPN receptors such as alpha(v)beta(beta) integrin and CD44, and its overexpression in tumor is associated poor clinical outcome of NSCLC patients. Circulating OPN levels, measured by ELISA in 130 NSCLC cases that had not been treated for cancer at the time of sampling, were analyzed according to clinical, pathologic parameters and single nucleotide polymorphisms (SNPs) in the OPN gene promoter. Advanced disease states had higher circulating levels of OPN (T4 versus T1-3, N3 versus N0-2, and M1 versus M0, P=.029, .001, and .001, respectively, Kruskal-Wallis H-test), reflected by higher level of OPN in stage IV than stage I-III (P=.029, Kruskal-Wallis H-test). Among the clinical and pathological parameters including age, gender, smoking status, histologic subtypes and grade of differentiation, smoking status influences circulating OPN level showing higher level of OPN in ex-smokers than current and non-smokers (P=.038, Kruskal-Wallis H-test). Variation at nucleotide (nt) -443 of the OPN gene promoter had no influence on circulating OPN levels, however, patients with G/G at nt -156 showed higher concentrations of OPN than those with G/GG or GG/GG (P=.003, Kruskal-Wallis H-test). A patient with G/G at nt -156 was more frequently diagnosed with advanced stage (IIIB-IV) than with early stage (I-IIIA) NSCLC (P=.048, Mantel-Haenszel-test). In multivariate analysis, stage is the only independent factor influencing circulating level of OPN. Although circulating level of OPN in the patients with bone metastasis was higher than in those without bone metastasis (P=.028, Mann-Whitney U-test), there was no difference in the OPN levels between bone metastasis group and non-bone metastasis group. Given that the elevated levels of OPN is associated with advanced stages of NSCLC, elucidating OPN regulatory mechanisms may contribute to the development of a new therapeutic modality for NSCLC.

  16. Mechanism of immunomodulatory drugs' action in the treatment of multiple myeloma

    PubMed Central

    Chang, Xiubao; Zhu, Yuanxiao; Shi, Changxin; Stewart, A. Keith

    2014-01-01

    Although immunomodulatory drugs (IMiDs), such as thalidomide, lenalidomide, and pomalidomide, are widely used in the treatment of multiple myeloma (MM), the molecular mechanism of IMiDs' action is largely unknown. In this review, we will summarize recent advances in the application of IMiDs in MM cancer treatment as well as their effects on immunomodulatory activities, anti-angiogenic activities, intervention of cell surface adhesion molecules between myeloma cells and bone marrow stromal cells, anti-inflammatory activities, anti-proliferation, pro-apoptotic effects, cell cycle arrest, and inhibition of cell migration and metastasis. In addition, the potential IMiDs' target protein, IMiDs' target protein's functional role, and the potential molecular mechanisms of IMiDs resistance will be discussed. We wish, by presentation of our naive discussion, that this review article will facilitate further investigation in these fields. PMID:24374776

  17. Targeting G-Protein Signaling for the Therapeutics of Prostate Tumor Bone Metastases and the Associated Chronic Bone Pain

    DTIC Science & Technology

    2015-09-01

    results in increased activity/expression of key pain-sensing receptor channels, such as TRPV1 , such that the channels are constitutively activated...Keywords: Prostate Cancer Bone Metastasis, Bone Cancer Pain, Heterotrimeric G protein betagamma subunits, G protein coupled receptors (GPCRs), TRPV1 ...vitro, as well as mediating GPCR-regulated TRPV1 channel function in cultured mouse sensory neurons (Aim 1) Major Goal/Objective 1: Determine the

  18. Targeting G-Protein Signaling for the Therapeutics of Prostate Tumor Bone Metastases and the Associated Chronic Bone Pain

    DTIC Science & Technology

    2013-07-01

    results in increased activity/expression of key pain-sensing receptor channels, such as TRPV1 , such that the channels are constitutively activated...Keywords: Prostate Cancer Bone Metastasis, Bone Cancer Pain, Heterotrimeric G protein betagamma subunits, G protein coupled receptors (GPCRs), TRPV1 ...cell growth, migration and invasion in vitro, as well as mediating GPCR-regulated TRPV1 channel function in cultured mouse sensory neurons (Aim 1

  19. Pathological Fracture of the Femur by Metastatic Carcinoma Penis-a Rare Presentation.

    PubMed

    Hussain, Shabbir; Solanki, Fanindra Singh; Sharma, Deepti B; Sharma, Dhananjay

    2016-04-01

    We report herein a clinical case of a patient with femur fracture due to metastasis from penile squamous cell carcinoma. A young man, who was treated for carcinoma penis, presented with pathological fracture of femur and lung metastasis from metastatic carcinoma penis after 18 months. Long bone metastasis from penile cancer is extremely rare, to the best of our knowledge; this is the first report of a patient with penile cancer spread to the femur from primary squamous cell carcinoma of the penis.

  20. Fusion of bone marrow-derived cells with cancer cells: metastasis as a secondary disease in cancer

    PubMed Central

    Pawelek, John M.

    2014-01-01

    This perspective article highlights the leukocyte-cancer cell hybrid theory as a mechanism for cancer metastasis. Beginning from the first proposal of the theory more than a century ago and continuing today with the first proof for this theory in a human cancer, the hybrid theory offers a unifying explanation for metastasis. In this scenario, leukocyte fusion with a cancer cell is a secondary disease superimposed upon the early tumor, giving birth to a new, malignant cell with a leukocyte-cancer cell hybrid epigenome. PMID:24589183

  1. Accelerated Tumor Cell Death by Angiogenic Modifiers

    DTIC Science & Technology

    2004-08-01

    factors; extracellular matrix; 3-D cell culture; cancer metastasis Running title: Tumor-Stroma Interaction Abbreviations: BSP, bone sialoprotein ; ECM...such as osteocalcin (OC), bone sialoprotein (BSP), osteopontin (OPN), osteonectin (ON or SPARC), 18 osteoprotegerin (OPG), PTHrP, M-CSF, RANK and...Waltregny, D., Bellahcene, A., Van Riet, I., Fisher, L. W., Young, M., Fernandez, P. and et al. Prognostic value of bone sialoprotein expression in

  2. Monocyte chemotactic protein-1 attenuates and high-fat diet exacerbates bone loss in mice with pulmonary metastasis of Lewis lung carcinoma

    USDA-ARS?s Scientific Manuscript database

    Bone can be adversely affected by obesity and cancer-associated complications including wasting. The objective of this study was to determine whether a high-fat diet and a deficiency in monocyte chemotactic protein-1 (MCP-1) altered bone structural defects found in male C57BL/6 mice with Lewis lung...

  3. Amino-terminal enhancer of split gene AES encodes a tumor and metastasis suppressor of prostate cancer.

    PubMed

    Okada, Yoshiyuki; Sonoshita, Masahiro; Kakizaki, Fumihiko; Aoyama, Naoki; Itatani, Yoshiro; Uegaki, Masayuki; Sakamoto, Hiromasa; Kobayashi, Takashi; Inoue, Takahiro; Kamba, Tomomi; Suzuki, Akira; Ogawa, Osamu; Taketo, M Mark

    2017-04-01

    A major cause of cancer death is its metastasis to the vital organs. Few effective therapies are available for metastatic castration-resistant prostate cancer (PCa), and progressive metastatic lesions such as lymph nodes and bones cause mortality. We recently identified AES as a metastasis suppressor for colon cancer. Here, we have studied the roles of AES in PCa progression. We analyzed the relationship between AES expression and PCa stages of progression by immunohistochemistry of human needle biopsy samples. We then performed overexpression and knockdown of AES in human PCa cell lines LNCaP, DU145 and PC3, and determined the effects on proliferation, invasion and metastasis in culture and in a xenograft model. We also compared the PCa phenotypes of Aes/Pten compound knockout mice with those of Pten simple knockout mice. Expression levels of AES were inversely correlated with clinical stages of human PCa. Exogenous expression of AES suppressed the growth of LNCaP cells, whereas the AES knockdown promoted it. We also found that AES suppressed transcriptional activities of androgen receptor and Notch signaling. Notably, AES overexpression in AR-defective DU145 and PC3 cells reduced invasion and metastasis to lymph nodes and bones without affecting proliferation in culture. Consistently, prostate epithelium-specific inactivation of Aes in Pten flox/flox mice increased expression of Snail and MMP9, and accelerated growth, invasion and lymph node metastasis of the mouse prostate tumor. These results suggest that AES plays an important role in controlling tumor growth and metastasis of PCa by regulating both AR and Notch signaling pathways. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  4. Orbital Metastasis Is Associated With Decreased Survival in Stage M Neuroblastoma.

    PubMed

    Harreld, Julie H; Bratton, Emily M; Federico, Sara M; Li, Xingyu; Grover, William; Li, Yimei; Kerr, Natalie C; Wilson, Matthew W; Hoehn, Mary E

    2016-04-01

    Approximately 30% of patients with metastatic (stage M) neuroblastoma present with periorbital ecchymosis from orbital osseous disease. Though locoregional disease is staged by imaging, the prognostic significance of metastatic site in stage M disease is unknown. We hypothesize that, compared to nonorbital metastasis, orbital metastasis is associated with decreased survival in patients with stage M neuroblastoma, and that periorbital ecchymosis reflects location and extent of orbital disease. Medical records and imaging from 222 patients with stage M neuroblastoma seen at St. Jude Children's Research Hospital between January 1995 and May 2009 were reviewed. Thirty-seven patients were <18 months of age at diagnosis and 185 were ≥18 months of age. Overall survival (OS) and 5-year survival (5YS) were compared for patients with and without orbital, calvarial and nonorbital osseous metastasis, and with and without periorbital ecchymosis (log-rank test). Associations of periorbital ecchymosis with orbital metastasis location/extent were explored (Fisher's exact test, t-test). In patients ≥18 months of age, only orbital metastasis was associated with decreased 5YS (P = 0.0323) and OS (P = 0.0288). In patients <18 months of age, neither orbital, calvarial, or nonorbital bone metastasis was associated with OS or 5YS. Periorbital ecchymosis was associated with higher number of involved orbital bones (P = 0.0135), but not location or survival. In patients ≥ 18 months of age with stage M neuroblastoma, orbital metastatic disease is associated with decreased 5YS and OS. In future clinical trials, orbital disease may be useful as an imaging-based risk factor for substratification of stage M neuroblastoma. © 2015 Wiley Periodicals, Inc.

  5. Molecular Imaging With Quantum Dots Probing EMT and Prostate Cancer Metastasis in Live Animals

    DTIC Science & Technology

    2007-10-01

    of humanprostate cancer metastasis to human bone. Cancer Res 1999;59(8): 1987 – 1993. 14. Navone NM, Olive M, Ozen M, Davis R, Troncoso P, Tu SM...changing the particle size. J. Am. Chem. Soc. 125, 7100–7106. 27. Kim, S., Fisher, B., Eisler , H. J., and Bawendi, M. (2003) Type-II quantum dots

  6. A genome-wide scan identifies variants in NFIB associated with metastasis in patients with osteosarcoma

    PubMed Central

    Mirabello, Lisa; Koster, Roelof; Moriarity, Branden S.; Spector, Logan G.; Meltzer, Paul S.; Gary, Joy; Machiela, Mitchell J.; Pankratz, Nathan; Panagiotou, Orestis A.; Largaespada, David; Wang, Zhaoming; Gastier-Foster, Julie M.; Gorlick, Richard; Khanna, Chand; de Toledo, Silvia Regina Caminada; Petrilli, Antonio S.; Patiño-Garcia, Ana; Sierrasesúmaga, Luis; Lecanda, Fernando; Andrulis, Irene L.; Wunder, Jay S.; Gokgoz, Nalan; Serra, Massimo; Hattinger, Claudia; Picci, Piero; Scotlandi, Katia; Flanagan, Adrienne M.; Tirabosco, Roberto; Amary, Maria Fernanda; Halai, Dina; Ballinger, Mandy L.; Thomas, David M.; Davis, Sean; Barkauskas, Donald A.; Marina, Neyssa; Helman, Lee; Otto, George M.; Becklin, Kelsie L.; Wolf, Natalie K.; Weg, Madison T.; Tucker, Margaret; Wacholder, Sholom; Fraumeni, Joseph F.; Caporaso, Neil E.; Boland, Joseph F.; Hicks, Belynda D.; Vogt, Aurelie; Burdett, Laurie; Yeager, Meredith; Hoover, Robert N.; Chanock, Stephen J.; Savage, Sharon A.

    2015-01-01

    Metastasis is the leading cause of death in osteosarcoma patients, the most common pediatric bone malignancy. We conducted a multi-stage genome-wide association study of osteosarcoma metastasis at diagnosis in 935 osteosarcoma patients to determine whether germline genetic variation contributes to risk of metastasis. We identified a SNP, rs7034162, in NFIB significantly associated with metastasis in European osteosarcoma cases, as well as in cases of African and Brazilian ancestry (meta-analysis of all cases: P=1.2×10−9, OR 2.43, 95% CI 1.83–3.24). The risk allele was significantly associated with lowered NFIB expression, which led to increased osteosarcoma cell migration, proliferation, and colony formation. Additionally, a transposon screen in mice identified a significant proportion of osteosarcomas harboring inactivating insertions in Nfib, and had lowered Nfib expression. These data suggest that germline genetic variation at rs7034162 is important in osteosarcoma metastasis, and that NFIB is an osteosarcoma metastasis susceptibility gene. PMID:26084801

  7. NSG Mice Provide a Better Spontaneous Model of Breast Cancer Metastasis than Athymic (Nude) Mice

    PubMed Central

    Puchalapalli, Madhavi; Zeng, Xianke; Mu, Liang; Anderson, Aubree; Hix Glickman, Laura; Zhang, Ming; Sayyad, Megan R.; Mosticone Wangensteen, Sierra; Clevenger, Charles V.; Koblinski, Jennifer E.

    2016-01-01

    Metastasis is the most common cause of mortality in breast cancer patients worldwide. To identify improved mouse models for breast cancer growth and spontaneous metastasis, we examined growth and metastasis of both estrogen receptor positive (T47D) and negative (MDA-MB-231, SUM1315, and CN34BrM) human breast cancer cells in nude and NSG mice. Both primary tumor growth and spontaneous metastases were increased in NSG mice compared to nude mice. In addition, a pattern of metastasis similar to that observed in human breast cancer patients (metastases to the lungs, liver, bones, brain, and lymph nodes) was found in NSG mice. Furthermore, there was an increase in the metastatic burden in NSG compared to nude mice that were injected with MDA-MB-231 breast cancer cells in an intracardiac experimental metastasis model. This data demonstrates that NSG mice provide a better model for studying human breast cancer metastasis compared to the current nude mouse model. PMID:27662655

  8. The role of versican G3 domain in regulating breast cancer cell motility including effects on osteoblast cell growth and differentiation in vitro – evaluation towards understanding breast cancer cell bone metastasis

    PubMed Central

    2012-01-01

    Background Versican is detected in the interstitial tissues at the invasive margins of breast carcinoma, is predictive of relapse, and negatively impacts overall survival rates. The versican G3 domain is important in breast cancer cell growth, migration and bone metastasis. However, mechanistic studies evaluating versican G3 enhanced breast cancer bone metastasis are limited. Methods A versican G3 construct was exogenously expressed in the 66c14 and the MC3T3-E1 cell line. Cells were observed through light microscopy and viability analyzed by Coulter Counter or determined with colorimetric proliferation assays. The Annexin V-FITC apoptosis detection kit was used to detect apoptotic activity. Modified Chemotactic Boyden chamber migration invasion assays were applied to observe tumor migration and invasion to bone stromal cells and MC3T3-E1 cells. Alkaline phosphatase (ALP) staining and ALP ELISA assays were performed to observe ALP activity in MC3T3-E1 cells. Results In the four mouse breast cancer cell lines 67NR, 66c14, 4T07, and 4T1, 4T1 cells expressed higher levels of versican, and showed higher migration and invasion ability to MC3T3-E1 cells and primary bone stromal cells. 4T1 conditioned medium (CM) inhibited MC3T3-E1 cell growth, and even lead to apoptosis. Only 4T1 CM prevented MC3T3-E1 cell differentiation, noted by inhibition of alkaline phosphatase (ALP) activity. We exogenously expressed a versican G3 construct in a cell line that expresses low versican levels (66c14), and observed that the G3-expressing 66c14 cells showed enhanced cell migration and invasion to bone stromal and MC3T3-E1 cells. This observation was prevented by selective EGFR inhibitor AG1478, selective MEK inhibitor PD 98059, and selective AKT inhibitor Triciribine, but not by selective JNK inhibitor SP 600125. Versican G3 enhanced breast cancer cell invasion to bone stromal cells or osteoblast cells appears to occur through enhancing EGFR/ERK or AKT signaling. G3 expressing MC3T3-E1 cells showed inhibited cell growth and cell differentiation when cultured with TGF-β1 (1 ng/ml), and expressed enhanced cell apoptosis when cultured with TNF-α (2 ng/ml). Enhanced EGFR/JNK signaling appears to be responsible for G3 enhanced osteoblast apoptosis and inhibited osteoblast differentiation. Whereas repressed expression of GSK-3β (S9P) contributes to G3 inhibited osteoblast growth. Versican G3 functionality was dependent on its EGF-like motifs. Without the structure of EGF-like repeats, the G3 domain would not confer enhancement of tumor cell migration and invasion to bone with concordant inhibition of osteoblast differentiation and promotion of osteoblast apoptosis. Conclusions Versican enhances breast cancer bone metastasis not only through enhancing tumor cell mobility, invasion, and survival in bone tissues, but also by inhibiting pre-osteoblast cell growth, differentiation, which supply favorable microenvironments for tumor metastasis. PMID:22862967

  9. Distant metastasis of intraosseous dentinogenic ghost cell tumour to the donor site of a bone graft

    PubMed Central

    Park, H-R; Min, J-H; Huh, K-H; Yi, W-J; Heo, M-S; Lee, S-S; Cho, Y-A

    2013-01-01

    A dentinogenic ghost cell tumour (DGCT) is an extremely rare odontogenic tumour which is considered as a solid, neoplastic variant of calcifying odontogenic cyst. Intraosseous DGCTs are more aggressive than extraosseous DGCTs and have a high propensity for local recurrence. This report describes a case of a diagnosis of recurrent DGCT at the primary site and a distant donor site. A 25-year-old female patient visited a dental hospital for a complaint of facial swelling for the previous month. Incisional biopsy was performed and the specimen was diagnosed as DGCT. Partial mandibulectomy for tumour resection and iliac bone graft was performed. 2 years later, the tumour recurred on the mandible and iliac bone. The recurrent lesion on the donor site was diagnosed as metastasized DGCT. This report highlights the possibility of distant metastasis occurring at a graft donor site. PMID:23420853

  10. 18F-fluorodeoxyglucose imaging of primary malignant pericardial mesothelioma with concurrent pericardial and pleural effusions and bone metastasis: A case report.

    PubMed

    Li, Xiaohui; Lu, Rugang; Zhao, Youcai; Wang, Feng; Shao, Guoqiang

    2018-06-01

    Primary malignant pericardial mesothelioma (PMPM) is an aggressive tumor that originates from the mesothelial cells of the pericardium. PMPM with extensive atrial infiltration and bone metastasis is extremely rare. The diagnosis and staging of PMPM based on anatomical imaging may be difficult when concurrent pericardial and pleural effusions are present. A 28-year-old man presented with progressive chest pain. Concurrent pericardial and pleural effusions were identified on computed tomography. On echocardiography, mild thickening and adhesions of the pericardium with the right ventricle and atrium were observed. 18 F-fluorodeoxyglucose (FDG) metabolism imaging revealed increased accumulation in the pericardium and adjacent right atrium. Ring-shaped radioactivity aggregation and bone destruction in the sacrum were demonstrated on 18 F-FDG and 99m Tc-methyl diphosphonate imaging. The diagnosis of PMPM was subsequently confirmed by pathology. The patient survived for >1.5 years with comprehensive treatment.

  11. Advances in cancer pain from bone metastasis.

    PubMed

    Zhu, Xiao-Cui; Zhang, Jia-Li; Ge, Chen-Tao; Yu, Yuan-Yang; Wang, Pan; Yuan, Ti-Fei; Fu, Cai-Yun

    2015-01-01

    With the technological advances in cancer diagnosis and treatment, the survival rates for patients with cancer are prolonged. The issue of figuring out how to improve the life quality of patients with cancer has become increasingly prominent. Pain, especially bone pain, is the most common symptom in malignancy patients, which seriously affects the life quality of patients with cancer. The research of cancer pain has a breakthrough due to the development of the animal models of cancer pain in recent years, such as the animal models of mouse femur, humerus, calcaneus, and rat tibia. The establishment of several kinds of animal models related to cancer pain provides a new platform in vivo to investigate the molecular mechanisms of cancer pain. In this review, we focus on the advances of cancer pain from bone metastasis, the mechanisms involved in cancer pain, and the drug treatment of cancer pain in the animal models.

  12. Monocyte chemotactic protein-1 deficiency attenuates and high-fat diet exacerbates bone loss in mice with Lewis lung carcinoma.

    PubMed

    Yan, Lin; Nielsen, Forrest H; Sundaram, Sneha; Cao, Jay

    2017-04-04

    Bone loss occurs in obesity and cancer-associated complications including wasting. This study determined whether a high-fat diet and a deficiency in monocyte chemotactic protein-1 (MCP-1) altered bone structural defects in male C57BL/6 mice with Lewis lung carcinoma (LLC) metastases in lungs. Compared to non-tumor-bearing mice, LLC reduced bone volume fraction, connectivity density, trabecular number, trabecular thickness and bone mineral density and increased trabecular separation in femurs. Similar changes occurred in vertebrae. The high-fat diet compared to the AIN93G diet exacerbated LLC-induced detrimental structural changes; the exacerbation was greater in femurs than in vertebrae. Mice deficient in MCP-1 compared to wild-type mice exhibited increases in bone volume fraction, connectivity density, trabecular number and decreases in trabecular separation in both femurs and vertebrae, and increases in trabecular thickness and bone mineral density and a decrease in structure model index in vertebrae. Lewis lung carcinoma significantly decreased osteocalcin but increased tartrate-resistant acid phosphatase 5b (TRAP 5b) in plasma. In LLC-bearing mice, the high-fat diet increased and MCP-1 deficiency decreased plasma TRAP 5b; neither the high-fat diet nor MCP-1 deficiency resulted in significant changes in plasma concentration of osteocalcin. In conclusion, pulmonary metastasis of LLC is accompanied by detrimental bone structural changes; MCP-1 deficiency attenuates and high-fat diet exacerbates the metastasis-associated bone wasting.

  13. Does Radiotherapy for the Primary Tumor Benefit Prostate Cancer Patients with Distant Metastasis at Initial Diagnosis?

    PubMed Central

    Cho, Yeona; Chang, Jee Suk; Rha, Koon Ho; Hong, Sung Joon; Choi, Young Deuk; Ham, Won Sik; Kim, Jun Won; Cho, Jaeho

    2016-01-01

    Purpose/Objectives Treatment of the primary tumor reportedly improves survival in several types of metastatic cancer. We herein evaluated the efficacy and toxicity of radiotherapy for the primary tumor in prostate cancer with metastasis. Materials/Methods The study cohort included 140 men with metastatic prostate cancer at initial diagnosis. Metastatic sites were divided into 4 groups as follows: solitary bone, 2–4 bones, ≥5 bones, and visceral organs. Patient, tumor, and treatment characteristics, and clinical outcomes were compared between patients treated with (prostate radiotherapy [PRT] group) or without radiotherapy to the primary tumor. Results Patients in PRT group presented with a statistically significantly younger age (p = .02), whereas other characteristics showed no significant difference. Overall survival (OS) and biochemical failure-free survival (BCFFS) were improved in PRT patients (3-year OS: 69% vs. 43%, p = 0.004; 3-year BCFFS: 52% vs. 16%, p = 0.002). Multivariate analysis identified PRT as a significant predictor of both OS (hazard ratio [HR] = 0.43, p = 0.015). None of the 38 PRT patients experienced severe (grade ≥3) genitourinary or gastrointestinal toxicity. Conclusions Our data suggest that radiotherapy to the primary tumor was associated with improved OS and BCFFS in metastatic prostate cancer. The results of this study warrant prospective controlled clinical trials of this approach in stage IV prostate cancer patients with limited extent of bone metastasis and good performance status. PMID:26807740

  14. EMMPRIN regulates tumor growth and metastasis by recruiting bone marrow-derived cells through paracrine signaling of SDF-1 and VEGF

    PubMed Central

    Chen, Yanke; Gou, Xingchun; Kong, Derek Kai; Wang, Xiaofei; Wang, Jianhui; Chen, Zeming; Huang, Chen; Zhou, Jiangbing

    2015-01-01

    EMMPRIN, a cell adhesion molecule highly expressed in a variety of tumors, is associated with poor prognosis in cancer patients. Mechanistically, EMMPRIN has been characterized to contribute to tumor development and progression by controlling the expression of MMPs and VEGF. In the present study, by using fluorescently labeled bone marrow-derived cells (BMDCs), we found that the down-regulation of EMMPRIN expression in cancer cells reduces tumor growth and metastasis, and is associated with the reduced recruitment of BMDCs. Further protein profiling studies suggest that EMMPRIN controls BMDC recruitment through regulating the secretion of soluble factors, notably, VEGF and SDF-1. We demonstrate that the expression and secretion of SDF-1 in tumor cells are regulated by EMMPRIN. This study reveals a novel mechanism by which EMMPRIN promotes tumor growth and metastasis by recruitment of BMDCs through controlling secretion and paracrine signaling of SDF-1 and VEGF. PMID:26416452

  15. Skull infarction in a patient with malignant fibrous histiocytoma.

    PubMed

    Nagle, C E; Morayati, S J; LeDuc, M A

    1987-09-01

    The authors describe a case of a skull infarction initially suspected to be an isolated, remote metastasis in a patient diagnosed with soft tissue malignant fibrous histiocytoma. Osseous malignant fibrous histiocytoma has been reported to occur within a bone infarction but the presence of a benign bone infarction remote from a soft tissue malignant fibrous histiocytoma has not been reported previously. Bone infarctions and malignant fibrous histiocytomas are briefly reviewed.

  16. 68Ga-PSMA-11 PET/CT for prostate cancer staging and risk stratification in Chinese patients.

    PubMed

    Zang, Shiming; Shao, Guoqiang; Cui, Can; Li, Tian-Nv; Huang, Yue; Yao, Xiaochen; Fan, Qiu; Chen, Zejun; Du, Jin; Jia, Ruipeng; Sun, Hongbin; Hua, Zichun; Tang, Jun; Wang, Feng

    2017-02-14

    We evaluated the clinical utility of 68Ga-PSMA-11 PET/CT for staging and risk stratification of treatment-naïve prostate cancer (PCa) and metastatic castrate-resistant prostate cancer (mCRPC). Twenty-two consecutive patients with treatment-naïve PCa and 18 with mCRPC were enrolled. 68Ga-PSMA-11 PET/CT and magnetic resonance imaging (MRI) were performed for the evaluation of primary prostatic lesions, and bone scans were used for evaluation bone metastasis. Among the 40 patients, 37 (92.5% [22 treatment-naïve PCa, 15 mCRPC]) showed PSMA-avid lesions on 68Ga-PSMA-11 images. Only 3 patients with stable mCRPC after chemotherapy were negative for PSMA. The sensitivity, specificity and accuracy of 68Ga-PSMA-11 imaging were 97.3%, 100.0% and 97.5%, respectively. The maximum standardized uptake (SUVmax) of prostatic lesions was 17.09 ± 11.08 and 13.33 ± 12.31 in treatment-naïve PCa and mCRPC, respectively. 68Ga-PSMA-11 revealed 105 metastatic lymph nodes in 15 patients; the SUVmax was 16.85 ± 9.70 and 7.54 ± 5.20 in treatment-naïve PCa and mCRPC, respectively. 68Ga-PSMA-11 PET/CT also newly detected visceral metastasis in 9 patients (22.5%) and bone metastasis in 29 patients (72.5%). 68Ga-PSMA-11 PET/CT exhibits potential for staging and risk stratification in naïve PCa, as well as improved sensitivity for detection of lymph node and remote metastasis.

  17. Zoledronic acid inhibits macrophage/microglia-assisted breast cancer cell invasion

    PubMed Central

    Rietkötter, Eva; Menck, Kerstin; Bleckmann, Annalen; Farhat, Katja; Schaffrinski, Meike; Schulz, Matthias; Hanisch, Uwe-Karsten; Binder, Claudia; Pukrop, Tobias

    2013-01-01

    The bisphosphonate zoledronic acid (ZA) significantly reduces complications of bone metastasis by inhibiting resident macrophages, the osteoclasts. Recent clinical trials indicate additional anti-metastatic effects of ZA outside the bone. However, which step of metastasis is influenced and whether this is due to direct toxicity on cancer cells or inhibition of the tumor promoting microenvironment, is unknown. In particular, tumor-associated and resident macrophages support each step of organ metastasis and could be a crucial target of ZA. Thus, we comparatively investigate the ZA effects on: i) different types of macrophages, ii) on breast cancer cells but also iii) on macrophage-induced invasion. We demonstrate that ZA concentrations reflecting the plasma level affected viability of human macrophages, murine bone marrow-derived macrophages as well as their resident brain equivalents, the microglia, while it did not influence the tested cancer cells. However, the effects on the macrophages subsequently reduced the macrophage/microglia-induced invasiveness of the cancer cells. In line with this, manipulation of microglia by ZA in organotypic brain slice cocultures reduced the tissue invasion by carcinoma cells. The characterization of human macrophages after ZA treatment revealed a phenotype/response shift, in particular after external stimulation. In conclusion, we show that therapeutic concentrations of ZA affect all types of macrophages but not the cancer cells. Thus, anti-metastatic effects of ZA are predominantly caused by modulating the microenvironment. Most importantly, our findings demonstrate that ZA reduced microglia-assisted invasion of cancer cells to the brain tissue, indicating a potential therapeutic role in the prevention of cerebral metastasis. PMID:24036536

  18. 68Ga-PSMA-11 PET/CT for prostate cancer staging and risk stratification in Chinese patients

    PubMed Central

    Cui, Can; Li, Tian-Nv; Huang, Yue; Yao, Xiaochen; Fan, Qiu; Chen, Zejun; Du, Jin; Jia, Ruipeng; Sun, Hongbin; Hua, Zichun; Tang, Jun; Wang, Feng

    2017-01-01

    We evaluated the clinical utility of 68Ga-PSMA-11 PET/CT for staging and risk stratification of treatment-naïve prostate cancer (PCa) and metastatic castrate-resistant prostate cancer (mCRPC). Twenty-two consecutive patients with treatment-naïve PCa and 18 with mCRPC were enrolled. 68Ga-PSMA-11 PET/CT and magnetic resonance imaging (MRI) were performed for the evaluation of primary prostatic lesions, and bone scans were used for evaluation bone metastasis. Among the 40 patients, 37 (92.5% [22 treatment-naïve PCa, 15 mCRPC]) showed PSMA-avid lesions on 68Ga-PSMA-11 images. Only 3 patients with stable mCRPC after chemotherapy were negative for PSMA. The sensitivity, specificity and accuracy of 68Ga-PSMA-11 imaging were 97.3%, 100.0% and 97.5%, respectively. The maximum standardized uptake (SUVmax) of prostatic lesions was 17.09 ± 11.08 and 13.33 ± 12.31 in treatment-naïve PCa and mCRPC, respectively. 68Ga-PSMA-11 revealed 105 metastatic lymph nodes in 15 patients; the SUVmax was 16.85 ± 9.70 and 7.54 ± 5.20 in treatment-naïve PCa and mCRPC, respectively. 68Ga-PSMA-11 PET/CT also newly detected visceral metastasis in 9 patients (22.5%) and bone metastasis in 29 patients (72.5%). 68Ga-PSMA-11 PET/CT exhibits potential for staging and risk stratification in naïve PCa, as well as improved sensitivity for detection of lymph node and remote metastasis. PMID:28103574

  19. Replacing zoledronic acid with denosumab is a risk factor for developing osteonecrosis of the jaw.

    PubMed

    Higuchi, Tomoko; Soga, Yoshihiko; Muro, Misato; Kajizono, Makoto; Kitamura, Yoshihisa; Sendo, Toshiaki; Sasaki, Akira

    2018-06-01

    Intravenous zoledronic acid (ZA) is often replaced with subcutaneous denosumab in patients with bone metastatic cancer. Despite their different pharmacologic mechanisms of action, both denosumab and ZA are effective in bone metastasis but cause osteonecrosis of the jaw (ONJ) as a side effect. ZA persists in the body almost indefinitely, whereas denosumab does not persist for long periods. This study evaluated the risks of developing ONJ when replacing ZA with denosumab. In total, 161 Japanese patients administered ZA for bone metastatic cancer were enrolled in this single-center, retrospective, observational study. The risk of developing ONJ was evaluated by logistic regression analysis using the following factors: age, gender, cancer type, angiogenesis inhibitors, steroids, and replacement of ZA with denosumab. Seventeen patients (10.6%) developed ONJ. Multiple regression analysis indicated a significant difference in rate of ONJ associated with replacement of ZA with denosumab (odds ratio = 3.81; 95% confidence interval 1.04-13.97; P = .043). Replacing ZA with denosumab is a risk factor for the development of ONJ. Both binding of bisphosphonate to bone and receptor activator of nuclear factor-κ B ligand inhibition could additively increase the risk of ONJ. We bring the replacement of ZA with denosumab to the attention of clinical oncologists. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Sustained delivery and efficacy of polymeric nanoparticles containing osteopontin and bone sialoprotein antisenses in rats with breast cancer bone metastasis.

    PubMed

    Elazar, Victoria; Adwan, Hassan; Bäuerle, Tobias; Rohekar, Keren; Golomb, Gershon; Berger, Martin R

    2010-04-01

    Poor prognosis in mammary carcinoma is associated with a certain expression profile of a defined set of genes including osteopontin and bone sialoprotein. Efficient and specific delivery of antisenses (AS) and a protection of the sequences from degradation are the crucial conditions for AS therapeutic efficiency. We hypothesized that effective and safe AS delivery direceted against these genes could be achieved by polymeric nanoparticles (NP) fabricated from a biocompatible polymer. Due to their nano-size range and small negative charge, AS-NP can overcome the absorption barrier offering increased resistance to nuclease degradation, sustained duration of AS administration, and consequently, prolonged antisense action. The ASs designed against OPN and BSP-II were successfully encapsulated in NP composed of the biodegradable and biocompatible polylactide-co-glycolide polymer (PLGA), exhibiting sustained release and stability of the ASs. The therapeutic efficacy of the AS-NP delivery system was examined in vitro, and in a breast cancer bone metastasis animal model of MDA-MB-231 human breast cancer cells in nude rats. Treatment with OPN-AS or BSP-AS loaded NP in comparison with osmotic mini-pumps (locoregional injection and SC implants, respectively) resulted in a significant decrease in both, tumor bone metastasis incidence and in the size of the lesions in rats with metastases. Despite its smaller dose, AS-NP exhibited a better therapeutic efficacy than osmotic mini-pumps in terms of lesion ratio at later time periods (8-12 weeks). It may be concluded that AS delivery by NP is a promising therapeutic modality providing stability of the encapsulated AS and a sustained release.

  1. Effects of letrozole on breast cancer micro-metastatic tumor growth in bone and lung in mice inoculated with murine 4T1 cells.

    PubMed

    Wang, Wendan; Belosay, Aashvini; Yang, Xujuan; Hartman, James A; Song, Huaxin; Iwaniec, Urszula T; Turner, Russell T; Churchwell, Mona I; Doerge, Daniel R; Helferich, William G

    2016-06-01

    Breast cancer (BC) is the leading cancer in women worldwide. Metastasis occurs in stage IV BC with bone and lung being common metastatic sites. Here we evaluate the effects of the aromatase inhibitor letrozole on BC micro-metastatic tumor growth in bone and lung metastasis in intact and ovariectomized (OVX) mice with murine estrogen receptor negative (ER-) BC cells inoculated in tibia. Forty-eight BALB/c mice were randomly assigned to one of four groups: OVX, OVX + Letrozole, Intact, and Intact + Letrozole, and injected with 4T1 cells intra-tibially. Letrozole was subcutaneously injected daily for 23 days at a dose of 1.75 µg/g body weight. Tumor progression was monitored by bioluminescence imaging (BLI). Following necropsy, inoculated tibiae were scanned via µCT and bone response to tumor was scored from 0 (no ectopic mineralization/osteolysis) to 5 (extensive ectopic mineralization/osteolysis). OVX mice had higher tibial pathology scores indicative of more extensive bone destruction than intact mice, irrespective of letrozole treatment. Letrozole decreased serum estradiol levels and reduced lung surface tumor numbers in intact animals. Furthermore, mice receiving letrozole had significantly fewer tumor colonies and fewer proliferative cells in the lung than OVX and intact controls based on H&E and Ki-67 staining, respectively. In conclusion, BC-inoculated OVX animals had higher tibia pathology scores than BC-inoculated intact animals and letrozole reduced BC metastases to lungs. These findings suggest that, by lowering systemic estrogen level and/or by interacting with the host organ, the aromatase inhibitor letrozole has the potential to reduce ER- BC metastasis to lung.

  2. Evaluation of the combined use of metronomic zoledronic acid and Coriolus versicolor in intratibial breast cancer mouse model.

    PubMed

    Ko, Chun-Hay; Yue, Grace Gar-Lee; Gao, Si; Luo, Ke-Wang; Siu, Wing-Sum; Shum, Wai-Ting; Shiu, Hoi-Ting; Lee, Julia Kin-Ming; Li, Gang; Leung, Ping-Chung; Evdokiou, Andreas; Lau, Clara Bik-San

    2017-05-23

    Coriolus versicolor (CV) is a mushroom traditionally used for strengthening the immune system and nowadays used as immunomodulatory adjuvant in anticancer therapy. Breast cancer usually metastasizes to the skeleton, interrupts the normal bone remodeling process and causes osteolytic bone lesions. The aims of the present study were to evaluate its herb-drug interaction with metronomic zoledronate in preventing cancer propagation, metastasis and bone destruction. Mice inoculated with human breast cancer cells tagged with a luciferase (MDA-MB-231-TXSA) in tibia were treated with CV aqueous extract, mZOL, or the combination of both for 4 weeks. Alteration of the luciferase signals in tibia, liver and lung were quantified using the IVIS imaging system. The skeletal response was evaluated using micro-computed tomography (micro-CT). In vitro experiments were carried out to confirm the in vivo findings. Results showed that combination of CV and mZOL diminished tumor growth without increasing the incidence of lung and liver metastasis in intratibial breast tumor model. The combination therapy also reserved the integrity of bones. In vitro studies demonstrated that combined use of CV and mZOL inhibited cancer cell proliferation and osteoclastogenesis. These findings suggested that combination treatment of CV and mZOL attenuated breast tumor propagation, protected against osteolytic bone lesion without significant metastases. This study provides scientific evidences on the beneficial outcome of using CV together with mZOL in the management of breast cancer and metastasis, which may lead to the development of CV as adjuvant health supplement for the control of breast cancer. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  3. Inhibition of bone resorption by Tanshinone VI isolated from Salvia miltiorrhiza Bunge.

    PubMed

    Nicolin, V; Dal Piaz, F; Nori, S L; Narducci, P; De Tommasi, N

    2010-05-10

    During the last decade, a more detailed knowledge of molecular mechanisms involved in osteoclastogenesis has driven research efforts in the development and screening of compound libraries of several small molecules that specifically inhibit the pathway involved in the commitment of the osteoclast precursor cells. Natural compounds that suppress osteoclast differentiation may have therapeutic value in treating osteoporosis and other bone erosive diseases such as rheumatoid arthritis or metastasis associated with bone loss. In ongoing investigation into anti-osteoporotic compounds from natural products we have analyzed the effect of Tanshinone VI on osteoclasts differentiation, using a physiologic three-dimensional osteoblast/bone marrow model of cell co-culture. Tanshinone VI is an abietane diterpene extracted from the root of Salvia miltiorrhiza Bunge (Labiatae), a Chinese traditional crude drug, "Tan-Shen". Tashinone has been widely used in clinical practice for the prevention of cardiac diseases, arthritis and other inflammation-related disorders based on its pharmacological actions in multiple tissues. Although Tanshinone VI A has been used as a medicinal agent in the treatment of many diseases, its role in osteoclast-related bone diseases remains unknown. We showed previously that Tanshinone VI greatly inhibits osteoclast differentiation and suppresses bone resorption through disruption of the actin ring; subsequently, we intended to examine the precise inhibitory mechanism of Tanshinone VI on osteoclast differentiating factor. This study shows, for the first time, that Tanshinone VI prevents osteoclast differentiation by inhibiting RANKL expression and NFkB induction.

  4. Three-Dimensional Mechanical Loading Modulates the Osteogenic Response of Mesenchymal Stem Cells to Tumor-Derived Soluble Signals

    PubMed Central

    Lynch, Maureen E.; Chiou, Aaron E.; Lee, Min Joon; Marcott, Stephen C.; Polamraju, Praveen V.; Lee, Yeonkyung

    2016-01-01

    Dynamic mechanical loading is a strong anabolic signal in the skeleton, increasing osteogenic differentiation of bone marrow-derived mesenchymal stem cells (BM-MSCs) and increasing the bone-forming activity of osteoblasts, but its role in bone metastatic cancer is relatively unknown. In this study, we integrated a hydroxyapatite-containing three-dimensional (3D) scaffold platform with controlled mechanical stimulation to investigate the effects of cyclic compression on the interplay between breast cancer cells and BM-MSCs as it pertains to bone metastasis. BM-MSCs cultured within mineral-containing 3D poly(lactide-co-glycolide) (PLG) scaffolds differentiated into mature osteoblasts, and exposure to tumor-derived soluble factors promoted this process. When BM-MSCs undergoing osteogenic differentiation were exposed to conditioned media collected from mechanically loaded breast cancer cells, their gene expression of osteopontin was increased. This was further enhanced when mechanical compression was simultaneously applied to BM-MSCs, leading to more uniformly deposited osteopontin within scaffold pores. These results suggest that mechanical loading of 3D scaffold-based culture models may be utilized to evaluate the role of physiologically relevant physical cues on bone metastatic breast cancer. Furthermore, our data imply that cyclic mechanical stimuli within the bone microenvironment modulate interactions between tumor cells and BM-MSCs that are relevant to bone metastasis. PMID:27401765

  5. Breast cancer cells obtain an osteomimetic feature via epithelial-mesenchymal transition that have undergone BMP2/RUNX2 signaling pathway induction.

    PubMed

    Tan, Cong-Cong; Li, Gui-Xi; Tan, Li-Duan; Du, Xin; Li, Xiao-Qing; He, Rui; Wang, Qing-Shan; Feng, Yu-Mei

    2016-11-29

    Bone is one of the most common organs of breast cancer metastasis. Cancer cells that mimic osteoblasts by expressing bone matrix proteins and factors have a higher likelihood of metastasizing to bone. However, the molecular mechanisms of osteomimicry formation of cancer cells remain undefined. Herein, we identified a set of bone-related genes (BRGs) that are ectopically co-expressed in primary breast cancer tissues and determined that osteomimetic feature is obtained due to the osteoblast-like transformation of epithelial breast cancer cells that have undergone epithelial-mesenchymal transition (EMT) followed by bone morphogenetic protein-2 (BMP2) stimulation. Furthermore, we demonstrated that breast cancer cells that transformed into osteoblast-like cells with high expression of BRGs showed enhanced chemotaxis, adhesion, proliferation and multidrug resistance in an osteoblast-mimic bone microenvironment in vitro. During these processes, runt-related transcription factor 2 (RUNX2) functioned as a master mediator by suppressing or activating the transcription of BRGs that underlie the dynamic antagonism between the TGF-β/SMAD and BMP/SMAD signaling pathways in breast cancer cells. Our findings suggest a novel mechanism of osteomimicry formation that arises in primary breast tumors, which may explain the propensity of breast cancer to metastasize to the skeleton and contribute to potential strategies for predicting and targeting breast cancer bone metastasis and multidrug resistance.

  6. Bone stroma-derived cells change coregulators recruitment to androgen receptor and decrease cell proliferation in androgen-sensitive and castration-resistant prostate cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Villagran, Marcelo A.; Gutierrez-Castro, Francisco A.; Pantoja, Diego F.

    Prostate cancer (CaP) bone metastasis is an early event that remains inactive until later-stage progression. Reduced levels of circulating androgens, due to andropause or androgen deprivation therapies, alter androgen receptor (AR) coactivator expression. Coactivators shift the balance towards enhanced AR-mediated gene transcription that promotes progression to androgen-resistance. Disruptions in coregulators may represent a molecular switch that reactivates latent bone metastasis. Changes in AR-mediated transcription in androgen-sensitive LNCaP and androgen-resistant C4-2 cells were analyzed for AR coregulator recruitment in co-culture with Saos-2 and THP-1. The Saos-2 cell line derived from human osteosarcoma and THP-1 cell line representing human monocytes were usedmore » to display osteoblast and osteoclast activity. Increased AR activity in androgen-resistant C4-2 was due to increased AR expression and SRC1/TIF2 recruitment and decreased SMRT/NCoR expression. AR activity in both cell types was decreased over 90% when co-cultured with Saos-2 or THP-1 due to dissociation of AR from the SRC1/TIF2 and SMRT/NCoR coregulators complex, in a ligand-dependent and cell-type specific manner. In the absence of androgens, Saos-2 decreased while THP-1 increased proliferation of LNCaP cells. In contrast, both Saos-2 and THP-1 decreased proliferation of C4-2 in absence and presence of androgens. Global changes in gene expression from both CaP cell lines identified potential cell cycle and androgen regulated genes as mechanisms for changes in cell proliferation and AR-mediated transactivation in the context of bone marrow stroma cells. - Highlights: • Decreased corepressor expression change AR in androgen-resistance prostate cancer. • Bone stroma-derived cells change AR coregulator recruitment in prostate cancer. • Bone stroma cells change cell proliferation in androgen-resistant cancer cells. • Global gene expression in CaP cells is modified by bone stroma cells in co-cultures. • Potential new multi-subunit coactivator complexes for AR in CaP bone metastasis.« less

  7. Comparison of 68Ga-labelled PSMA-11 and 11C-choline in the detection of prostate cancer metastases by PET/CT.

    PubMed

    Schwenck, Johannes; Rempp, Hansjoerg; Reischl, Gerald; Kruck, Stephan; Stenzl, Arnulf; Nikolaou, Konstantin; Pfannenberg, Christina; la Fougère, Christian

    2017-01-01

    Prostate-specific membrane antigen (PSMA) is expressed ubiquitously on the membrane of most prostate tumors and its metastasis. While PET/CT using 11 C-choline was considered as the gold standard in the staging of prostate cancer, PET with radiolabelled PSMA ligands was introduced into the clinic in recent years. Our aim was to compare the PSMA ligand 68 Ga-PSMA-11 with 11 C-choline in patients with primary and recurrent prostate cancer. 123 patients underwent a whole-body PET/CT examination using 68 Ga-PSMA-11 and 11 C-choline. Suspicious lesions were evaluated visually and semiquantitatively (SUVavg). Out of these, 103 suffered from a confirmed biochemical relapse after prostatectomy and/or radiotherapy (mean PSA level of 4.5 ng/ml), while 20 patients underwent primary staging. In 67 patients with biochemical relapse, we detected 458 lymph nodes suspicious for metastasis. PET using 68 Ga-PSMA-11 showed a significantly higher uptake and detection rate than 11 C-choline PET. Also 68 Ga-PSMA-11 PET identified significantly more patients with suspicious lymph nodes as well as affected lymph nodes regions especially at low PSA levels. Bone lesions suspicious for prostate cancer metastasis were revealed in 36 patients' biochemical relapse. Significantly more bone lesions were detected by 68 Ga-PSMA-11, but only 3 patients had only PSMA-positive bone lesions. Nevertheless, we detected also 29 suspicious lymph nodes and 8 bone lesions, which were only positive as per 11 C-choline PET. These findings led to crucial differences in the TNM classification and the identification of oligometastatic patients. In the patients who underwent initial staging, all primary tumors showed uptake of both tracers. Although significantly more suspicious lymph nodes and bone lesions were identified, only 2 patients presented with bone lesions only detected by 68 Ga-PSMA-11 PET. Thus, PET using 68 Ga-PSMA-11 showed a higher detection rate than 11 C-choline PET for lymph nodes as well as bone lesions. However, we found lymph nodes and bone lesions which were not concordant applying both tracers.

  8. Curcumin deteriorates trabecular and cortical bone in mice bearing metastatic Lewis lung carcinoma

    USDA-ARS?s Scientific Manuscript database

    Bone is a major target of metastasis for many malignancies; curcumin has been studied for its role in cancer prevention including early phase clinical trials for its efficacy and safe use with cancer patients. The present study investigated the effects of dietary supplementation with curcumin (2% a...

  9. Postmenopausal Osteoporosis: The Role of Immune System Cells

    PubMed Central

    Faienza, Maria Felicia; Ventura, Annamaria; Marzano, Flaviana; Cavallo, Luciano

    2013-01-01

    In the last years, new evidences of the relationship between immune system and bone have been accumulated both in animal models and in humans affected by bone disease, such as rheumatoid arthritis, bone metastasis, periodontitis, and osteoporosis. Osteoporosis is characterized by low bone mass and microarchitectural deterioration of bone tissue with a subsequent increase in bone fragility and susceptibility to fractures. The combined effects of estrogen deprivation and raising of FSH production occurring in menopause cause a marked stimulation of bone resorption and a rapid bone loss which is central for the onset of postmenopausal osteoporosis. This review focuses on the role of immune system in postmenopausal osteoporosis and on therapeutic strategies targeting osteoimmunology pathways. PMID:23762093

  10. The Usefulness of Bone Biomarkers for Monitoring Treatment Disease: A Comparative Study in Osteolytic and Osteosclerotic Bone Metastasis Models.

    PubMed

    Martín-Fernández, Marta; Valencia, Karmele; Zandueta, Carolina; Ormazábal, Cristina; Martínez-Canarias, Susana; Lecanda, Fernando; de la Piedra, Concepción

    2017-04-01

    The skeleton is the most common site of colonization by metastatic cancers. Zoledronic acid (ZA) has been shown to be effective for the treatment of bone metastases regardless of whether the bone lesions are osteolytic or osteoblastic. Biochemical markers of bone turnover may be useful tools to quantify the degree of bone remodeling in the presence of bone metastases. The aim of this work was to establish the correlation between tumor dispersion (bioluminescence) and biochemical markers of bone turnover in two osteolytic and osteoblastic metastasis models in mice. The A549M1 cell line that produces osteolytic metastases and the LADOB cell line extracted from a patient with a lung carcinoma and osteoblastic metastases cells were retrovirally transduced with a luciferase reporter gene for in vivo image analysis. Forty-four-week-old mice were inoculated in the left cardiac ventricle with A549M1 or LADOB cells. Twenty mouse of each group were treated with a single dose of ZA (70 μg/kg) 5 days after i.c. Ten animals of each group were sacrificed at 21 and 28 days postinoculation in A549M1 and 60 and 75 days in the LADOB assay. Bioluminescence analysis was quantified 7, 14, 21 ,and 28 days postinoculation in A549M1 mice and 33, 45, 60, and 75 days after inoculation in LADOB mice. Osteocalcin (BGP), aminoterminal propeptide of procollagen I (PINP), carboxiterminal telopeptide of type I collagen (CTX), and 5b isoenzyme of tartrate-resistant acid phosphatase were measured by ELISA (IDS, UK). Bioluminescence imaging revealed a significant increase of tumor burden on time in both osteolytic and osteoblastic mice models. ZA administration resulted in a significant decrease in tumor burden at 21 and 28 days in the A549M1 animals and 60 and 70 days postinoculation in the LADOB line. Biomarkers levels were significantly increased in the untreated group at every point in the osteolytic model. In the osteoblastic model, 2 months after inoculation, all biomarkers were significantly increased. However, 2.5 months postinoculation, only PINP and CTX were significantly increased. Serum bone remodeling markers decreased in ZA-treated mice as compared with tumor groups in both models. With respect to the correlation between bone turnover markers and tumor burden, in the osteolytic model, PINP and BGP demonstrate a strong correlation with bioluminescence in both tumoral and ZA animals, and only CTX was significantly associated with bioluminescence in the group of animals that were not treated with ZA. We found that the best biomarkers for the diagnosis of both osteolytic and osteoblastic metastasis are formation markers, especially BGP. Moreover, these markers can be useful in the follow-up of the treatment with ZA in both types of metastasis. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Adenoid cystic carcinoma of the submandibular gland with rare metastasis to the sternum in a 52-year-old male.

    PubMed

    Alshammari, Abdullah; Eldeib, Omar Jamal; Eldeib, Ahmed Jamal; Saleh, Waleed

    2016-01-01

    Adenoid cystic carcinoma (ACC) is a rare tumor, described as being one of the most biologically destructive tumors of the head and neck. It is the most common malignancy that affects the minor salivary glands. Lung and bones are the most common regions of ACC distant metastasis. To the best of our knowledge, herein, we report the first ever case of latent isolated sternal metastasis from ACC in a 52-year-old gentleman, who was diagnosed to have ACC of the submandibular gland, excised 10 years ago.

  12. Cancer metastasis: enactment of the script for human reproductive drama.

    PubMed

    Sun, Xichun; Liu, Xiwu

    2017-01-01

    Based on compelling evidence from many biological disciplines, we put forth a hypothesis for cancer metastasis. In the hypothesis, the metastatic cascade is depicted as human reproduction in miniature. Illustrated in a reproductive light, the staggering resemblance of cancer metastasis to human reproduction becomes evident despite some ostensible dis-similarities. In parallel to the appearance of primordial germ cells during early embryogenesis, the cancer reproductive saga starts with the separation of metastasis initiating cells (MICs) from cancer initiating cells when the primary cancer is still in its infancy. Prime MICs embark on a journey to the host bone marrow where they undergo further development and regulation. Migrating MICs are guided by the same CXCR4/CYCL12 axis as used in the migration of primordial germ cells to the genital ridge. Like the ovary, the host bone marrow features immune privileges, coolness, hypoxia and acidity which are essential for stemness maintenance and regulation. Opportune activation of the MICs via fusion with bone marrow stem cells triggers a frenzy of cellular proliferation and sets them on the move again. This scenario is akin to oocyte fertilization in the Fallopian tube and its subsequent journey towards the decidum. Just as the human reproductive process is plagued with undesirable outcomes so is the cancer metastasis highly inefficient. The climax of the cancer metastatic drama (colonization) is reached when proliferating MIC clusters attempt to settle down on decidum-like premetastatic sites. Successfully colonized clusters blossom into overt macrometastases only after the execution of sophisticated immunomodulation, angiogenesis and vascular remodeling. Similarly, the implanted blastomere needs to orchestrate these feats before flourishing into a new life. What is more, the cancer reproductive drama seems to be directed by a primordial hypothalamus-pituitary-gonad axis. Pursuing this reproductive trail could lead to new frontiers and breakthroughs in cancer research and therapeutics.

  13. Metastasis genetics, epigenetics, and the tumor microenvironment

    USDA-ARS?s Scientific Manuscript database

    KISS1 is a member of a family of genes known as metastasis suppressors, defined by their ability to block metastasis without blocking primary tumor development and growth. KISS1 re-expression in multiple metastatic cell lines of diverse cellular origin suppresses metastasis; yet, still allows comple...

  14. CD147 deficiency blocks IL-8 secretion and inhibits lung cancer-induced osteoclastogenesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Hongkai; Zhuo, Yunyun; Hu, Xu

    2015-03-06

    Bone is a frequent target of lung cancer metastasis, which is associated with significant morbidity and poor prognosis; however, the molecular basis of this process is still unknown. This study investigated the role of extracellular matrix metalloproteinase inducer (also known as cluster of differentiation (CD)147) in osteoclastogenesis resulting from bone metastasis, based on the enrichment of this glycoprotein on the surface of many malignant bone tumors. RNA interference was used to silence CD147 expression in A549 human lung cancer cells. Compared with conditioned medium (CM) from control cells (A549-CM), CM from CD147-deficient cells (A549-si-CM) suppressed receptor activator of nuclear factormore » κB ligand-stimulated osteoclastogenesis in RAW 264.7 cells and bone marrow-derived macrophages. The mRNA levels of osteoclast-specific genes such as tartrate-resistant acid phosphatase, calcitonin receptor, and cathepsin K were also reduced in the presence of A549-si-CM. CD147 knockdown in A549 cells decreased interleukin (IL)-8mRNA and protein expression. IL-8 is present in large amounts in A549-CM and mimicked its inductive effect on osteoclastogenesis; this was reversed by depletion of IL-8 from the medium. Taken together, these results indicate that CD147 promotes lung cancer-induced osteoclastogenesis by modulating IL-8 secretion, and suggest that CD147 is a potential therapeutic target for cancer-associated bone resorption in lung cancer patients. - Highlights: • Bone loss frequently results from lung cancer metastasis. • Cluster of differentiation (CD)147 was depleted in A549 lung adenocarcinoma cells. • RAW 264.7 cell osteoclastogenesis was blocked by medium from CD147-deficient cells. • Interleukin (IL)-8 level was reduced in the conditioned medium. • Osteoclastogenesis induced by lung tumor cells requires CD147-mediated IL-8 release.« less

  15. Selenite-Releasing Bone Mineral Nanoparticles Retard Bone Tumor Growth and Improve Healthy Tissue Functions In Vivo.

    PubMed

    Wang, Yanhua; Hao, Hang; Liu, Haoming; Wang, Yifan; Li, Yan; Yang, Gaojie; Ma, Jun; Mao, Chuanbin; Zhang, Shengmin

    2015-08-26

    Selenite-doped bone mineral nanoparticles can retard the growth of osteosarcoma in a nude mice model, through sustained release of selenite ions. The selenite ions released from the nanoparticles through a degradation-mediated fashion inhibit tumor metastasis. Blood routine analysis indicates that selenite ions can also improve the functions of liver, kidney, and heart. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. MMP-8, A Breast Cancer Bone Metastasis Suppressor Gene

    DTIC Science & Technology

    2006-08-01

    new protein synthesis. This event is particularly important in situations such as tissue repair following injury . PTH and TGF-b1 stimulated LTBP-1...osteoclastogenesis inhi- bitory factor in the stimulation of osteoclast formation by parathyroid hormone in mouse bone cells. Eur J Endo - crinol 142:661–664...done to determine cross-sectional area, bone volume, and perios - teal perimeter (Ps.Pm). The endocortical sur- face was outlined, and the analysis

  17. Regulation of Prostate Cancer Bone Metastasis by DKK1

    DTIC Science & Technology

    2012-09-01

    information is estimated to average 1 hour per response , including the time for reviewing instructions, searching existing data sources, gathering and...ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a. REPORT U b. ABSTRACT U c. THIS PAGE U UU 13 19b. TELEPHONE NUMBER...cells into bone irrevocably alters the bone microenvironment and initiates a skeletal response that is dependent on the type of tumor (1). Breast

  18. CXCR4 Protein Epitope Mimetic Antagonist POL5551 Disrupts Metastasis and Enhances Chemotherapy Effect in Triple-Negative Breast Cancer.

    PubMed

    Xiang, Jingyu; Hurchla, Michelle A; Fontana, Francesca; Su, Xinming; Amend, Sarah R; Esser, Alison K; Douglas, Garry J; Mudalagiriyappa, Chidananda; Luker, Kathryn E; Pluard, Timothy; Ademuyiwa, Foluso O; Romagnoli, Barbara; Tuffin, Gérald; Chevalier, Eric; Luker, Gary D; Bauer, Michael; Zimmermann, Johann; Aft, Rebecca L; Dembowsky, Klaus; Weilbaecher, Katherine N

    2015-11-01

    The SDF-1 receptor CXCR4 has been associated with early metastasis and poorer prognosis in breast cancers, especially the most aggressive triple-negative subtype. In line with previous reports, we found that tumoral CXCR4 expression in patients with locally advanced breast cancer was associated with increased metastases and rapid tumor progression. Moreover, high CXCR4 expression identified a group of bone marrow-disseminated tumor cells (DTC)-negative patients at high risk for metastasis and death. The protein epitope mimetic (PEM) POL5551, a novel CXCR4 antagonist, inhibited binding of SDF-1 to CXCR4, had no direct effects on tumor cell viability, but reduced migration of breast cancer cells in vitro. In two orthotopic models of triple-negative breast cancer, POL5551 had little inhibitory effect on primary tumor growth, but significantly reduced distant metastasis. When combined with eribulin, a chemotherapeutic microtubule inhibitor, POL5551 additively reduced metastasis and prolonged survival in mice after resection of the primary tumor compared with single-agent eribulin. Hypothesizing that POL5551 may mobilize tumor cells from their microenvironment and sensitize them to chemotherapy, we used a "chemotherapy framing" dosing strategy. When administered shortly before and after eribulin treatment, three doses of POL5551 with eribulin reduced bone and liver tumor burden more effectively than chemotherapy alone. These data suggest that sequenced administration of CXCR4 antagonists with cytotoxic chemotherapy synergize to reduce distant metastases. ©2015 American Association for Cancer Research.

  19. Early versus late distant metastasis and adjuvant chemotherapy alone versus both radiotherapy and chemotherapy in molecular apocrine breast cancer

    PubMed Central

    Liu, Xiaozhen; Yang, Yang; Feng, Xiaolong; Shen, Honghong; Liu, Jian; Liu, Xia; Niu, Yun

    2016-01-01

    As a new subtype of breast cancer, molecular apocrine breast cancer (MABC) is estrogen receptor (ER) and progesterone receptor (PR) negative expression, but androgen receptor (AR) positive expression. The prognostic significance and clinical biological behavior of MABC have remained unclear up to now. This study aimed to analysis the distant metastasis behavior and response to adjuvant radiotherapy and chemotherapy of MABC subgroup. The report showed that there were significant differences between early and late distant metastasizing tumors with respect to Ki67, epidermal growth factor receptor 2 (HER2) and vascular endothelial growth factor (VEGF) expressions by a retrospective analysis consisting of 410 invasive breast cancer patients, which included 205 MABC and 205 nonMABC cases. MABC subgroup metastasized earlier than nonMABC subgroup, and MABC showed a tendency for a higher metastasis rate in lung, liver and brain, but lower in bone. HER2-positive or VEGF-positive tumors were more inclined to develop bone metastasis within MABC subgroup. The survival rate was superior for patients undergone both adjuvant radiotherapy and chemotherapy than those undergone chemotherapy alone in nonMABC subgroup, but there was no significant difference in MABC subgroup. Our data suggested that MABC subgroup seemed to develop distant metastasis earlier than nonMABC subgroup, and patients with MABC indicated poor prognosis. This study might also provide a foundation for helping patients receive reasonable treatments according to molecular subtype. PMID:27340922

  20. Early versus late distant metastasis and adjuvant chemotherapy alone versus both radiotherapy and chemotherapy in molecular apocrine breast cancer.

    PubMed

    Liu, Xiaozhen; Yang, Yang; Feng, Xiaolong; Shen, Honghong; Liu, Jian; Liu, Xia; Niu, Yun

    2016-08-02

    As a new subtype of breast cancer, molecular apocrine breast cancer (MABC) is estrogen receptor (ER) and progesterone receptor (PR) negative expression, but androgen receptor (AR) positive expression. The prognostic significance and clinical biological behavior of MABC have remained unclear up to now. This study aimed to analysis the distant metastasis behavior and response to adjuvant radiotherapy and chemotherapy of MABC subgroup. The report showed that there were significant differences between early and late distant metastasizing tumors with respect to Ki67, epidermal growth factor receptor 2 (HER2) and vascular endothelial growth factor (VEGF) expressions by a retrospective analysis consisting of 410 invasive breast cancer patients, which included 205 MABC and 205 nonMABC cases. MABC subgroup metastasized earlier than nonMABC subgroup, and MABC showed a tendency for a higher metastasis rate in lung, liver and brain, but lower in bone. HER2-positive or VEGF-positive tumors were more inclined to develop bone metastasis within MABC subgroup. The survival rate was superior for patients undergone both adjuvant radiotherapy and chemotherapy than those undergone chemotherapy alone in nonMABC subgroup, but there was no significant difference in MABC subgroup. Our data suggested that MABC subgroup seemed to develop distant metastasis earlier than nonMABC subgroup, and patients with MABC indicated poor prognosis. This study might also provide a foundation for helping patients receive reasonable treatments according to molecular subtype.

  1. Bone Metastasis

    MedlinePlus

    ... of Privacy Practices Notice of Nondiscrimination Manage Cookies Advertising Mayo Clinic is a not-for-profit organization and proceeds from Web advertising help support our mission. Mayo Clinic does not ...

  2. Costal chondrosarcoma requiring differential diagnosis from metastatic tumor.

    PubMed

    Matsuoka, Katsunari; Ueda, Mitsuhiro; Miyamoto, Yoshihiro

    2017-02-01

    Although chondrosarcoma is a common malignant bone tumor, cases arising in the rib are relatively rare. We experienced a case of chondrosarcoma arising in the right 10th rib during follow-up after lung cancer surgery. Although the finding of an osteolytic mass suggested a metastatic bone tumor, 18F-fluorodeoxyglucose positron-emission tomography demonstrated low fluorodeoxyglucose uptake, and a primary bone tumor was suspected. The bone tumor was resected and diagnosed as chondrosarcoma. Four years after resection, there has been no recurrence or metastasis. Positron-emission tomography was useful for differential diagnosis between a chondrosarcoma and a metastatic bone tumor.

  3. [The biological role of exosomes in bone remodeling and bone diseases.

    PubMed

    Urabe, Fumihiko; Yoshioka, Yusuke; Ochiya, Takahiro

    Exosomes are about 100nm membrane vesicles, and released from almost all cell types. They carry and transfer a wide variety of molecules, such as mRNAs, microRNAs, proteins, and lipids, as modulators of intercellular communication. Various studies have shown that this exosome-mediated intercellular communication lead to proliferation, invasion and metastasis of cancer cells. In addition to that, emerging data suggest that exosomes are also involved in physiological processes of bone remodeling and bone diseases. Increasing understanding of the working mechanism of exosomes will provide us with new therapeutic and diagnostic opportunities. Here we summarize the current research on exosomes in bone remodeling and bone diseases.

  4. [Therapy of malignant melanoma at the stage of distant metastasis].

    PubMed

    Garbe, C; Eigentler, T K

    2004-02-01

    Treatment of melanoma in the stage of distant metastasis aims on palliation and achievement of durable tumor remission with prolongation of survival. As long as metastasis is confined to one organ system and is removable, surgery remains the treatment of first choice. In limited metastasis radiotherapy may likewise be indicated, particularly in bone and brain metastasis. More extensive metastasis should be treated by chemotherapy or chemoimmunotherapy. Monochemotherapy with dacarbazine, temozolomide, fotemustine and vindesine or its combinations with interferon-alpha are currently preferred. Polychemotherapy or its combinations with interferon-alpha and interleukin-2 are suitable to produce higher response rates but failed to prolong survival. As these treatments are associated with substantially higher toxicity they have been widely abandoned. Combined treatment with dacarbazine and interferon-alpha obtain tumor responses or stable disease in 40-50% and objective tumor remissions in 15-20% of patients. Effective cancer vaccination strategies and blockade of melanoma specific target molecules are currently developed as new treatment options.

  5. Osteoblast-Derived PTHRP and Breast Cancer Bone Metastasis

    DTIC Science & Technology

    2004-11-01

    short arm of chromosome 11 using aniridia - Wilms ’ tumor -associated deletions. Hum Genet 75:180-187 28. Yasuda T, Banville D, Hendy GN, Goltzman D...survival. It is, however, still unknown whether PTHrP overexpression is simply a consequence of tumor progression, or whether it is mechanistically...mammary epithelial cells and determined the consequences of this ablation on tumor initiation, growth and metastasis ( 1) (Appendix 1) . Toward this

  6. The metastasis suppressor RARRES3 as an endogenous inhibitor of the immunoproteasome expression in breast cancer cells

    NASA Astrophysics Data System (ADS)

    Anderson, Alison M.; Kalimutho, Murugan; Harten, Sarah; Nanayakkara, Devathri M.; Khanna, Kum Kum; Ragan, Mark A.

    2017-01-01

    In breast cancer metastasis, the dynamic continuum involving pro- and anti-inflammatory regulators can become compromised. Over 600 genes have been implicated in metastasis to bone, lung or brain but how these genes might contribute to perturbation of immune function is poorly understood. To gain insight, we adopted a gene co-expression network approach that draws on the functional parallels between naturally occurring bone marrow-derived mesenchymal stem cells (BM-MSCs) and cancer stem cells (CSCs). Our network analyses indicate a key role for metastasis suppressor RARRES3, including potential to regulate the immunoproteasome (IP), a specialized proteasome induced under inflammatory conditions. Knockdown of RARRES3 in near-normal mammary epithelial and breast cancer cell lines increases overall transcript and protein levels of the IP subunits, but not of their constitutively expressed counterparts. RARRES3 mRNA expression is controlled by interferon regulatory factor IRF1, an inducer of the IP, and is sensitive to depletion of the retinoid-related receptor RORA that regulates various physiological processes including immunity through modulation of gene expression. Collectively, these findings identify a novel regulatory role for RARRES3 as an endogenous inhibitor of IP expression, and contribute to our evolving understanding of potential pathways underlying breast cancer driven immune modulation.

  7. Genetic Recombination Between Stromal and Cancer Cells Results in Highly Malignant Cells Identified by Color-Coded Imaging in a Mouse Lymphoma Model.

    PubMed

    Nakamura, Miki; Suetsugu, Atsushi; Hasegawa, Kousuke; Matsumoto, Takuro; Aoki, Hitomi; Kunisada, Takahiro; Shimizu, Masahito; Saji, Shigetoyo; Moriwaki, Hisataka; Hoffman, Robert M

    2017-12-01

    The tumor microenvironment (TME) promotes tumor growth and metastasis. We previously established the color-coded EL4 lymphoma TME model with red fluorescent protein (RFP) expressing EL4 implanted in transgenic C57BL/6 green fluorescent protein (GFP) mice. Color-coded imaging of the lymphoma TME suggested an important role of stromal cells in lymphoma progression and metastasis. In the present study, we used color-coded imaging of RFP-lymphoma cells and GFP stromal cells to identify yellow-fluorescent genetically recombinant cells appearing only during metastasis. The EL4-RFP lymphoma cells were injected subcutaneously in C57BL/6-GFP transgenic mice and formed subcutaneous tumors 14 days after cell transplantation. The subcutaneous tumors were harvested and transplanted to the abdominal cavity of nude mice. Metastases to the liver, perigastric lymph node, ascites, bone marrow, and primary tumor were imaged. In addition to EL4-RFP cells and GFP-host cells, genetically recombinant yellow-fluorescent cells, were observed only in the ascites and bone marrow. These results indicate genetic exchange between the stromal and cancer cells. Possible mechanisms of genetic exchange are discussed as well as its ramifications for metastasis. J. Cell. Biochem. 118: 4216-4221, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  8. The role of radiation therapy in the treatment of solitary plasmacytomas.

    PubMed

    Mayr, N A; Wen, B C; Hussey, D H; Burns, C P; Staples, J J; Doornbos, J F; Vigliotti, A P

    1990-04-01

    Between 1960 and 1985, 30 patients with solitary plasmacytomas were treated with radiotherapy at the University of Iowa: 13 patients with extramedullary plasmacytomas (EMP) and 17 with solitary plasmacytomas of bone (SPB). The local control rates were 92% for patients with EMP and 88% for those with SPB. Two of nine patients (22%) with EMP treated to the primary tumor only developed regional lymph node metastasis, indicating the need for elective irradiation of this area. The most common pattern of failure in both groups was progression to multiple myeloma. This occurred in 23% of the patients with EMP and 53% of those with SPB. The time course of progression to multiple myeloma differed for the two groups. All of those who progressed to multiple myeloma in the EMP group did so within 2 years, whereas a significant number of those in the SPB group progressed more than 5 years after initial therapy. None of five patients who received adjuvant chemotherapy in the SPB group progressed to multiple myeloma, compared to 75% (9/12) of the patients who did not receive chemotherapy.

  9. Competitive Stem Cell Recruitment by Multiple Cytotactic Cues

    PubMed Central

    Mendelson, Avital; Cheung, Yukkee; Paluch, Kamila; Chen, Mo; Kong, Kimi; Tan, Jiali; Dong, Ziming; Sia, Samuel K.; Mao, Jeremy J.

    2014-01-01

    A multitude of cytotactic cues direct cell migration in development, cancer metastasis and wound healing. However, our understanding of cell motility remains fragmented partially because current migration devices only allow the study of independent factors. We developed a cell motility assay that allows competitive recruitment of a given cell population simultaneously by gradients of multiple cytotactic cues, observable under real-time imaging. Well-defined uniform gradients of cytotactic cues can be independently generated and sustained in each channel. As a case study, bone marrow mesenchymal stem/stromal cells (MSCs) were exposed to 15 cytokines that are commonly present in arthritis. Cytokines that induced robust recruitment of MSCs in multiple groups were selected to ‘compete’ in a final round to yield the most chemotactic factor(s) based on cell migration numbers, distances, migration indices and motility over time. The potency of a given cytokine in competition frequently differed from its individual action, substantiating the need to test multiple cytokines concurrently due to synergistic or antagonistic effects. This new device has the rare capacity to screen molecules that induce cell migration in cancer therapy, drug development and tissue regeneration. PMID:23364311

  10. Assessment of National Practice for Palliative Radiation Therapy for Bone Metastases Suggests Marked Underutilization of Single-Fraction Regimens in the United States

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rutter, Charles E., E-mail: charles.rutter@yale.edu; Yale Cancer Center, New Haven, Connecticut; Yu, James B.

    2015-03-01

    Purpose: To characterize temporal trends in the application of various bone metastasis fractionations within the United States during the past decade, using the National Cancer Data Base; the primary aim was to determine whether clinical practice in the United States has changed over time to reflect the published randomized evidence and the growing movement for value-based treatment decisions. Patients and Methods: The National Cancer Data Base was used to identify patients treated to osseous metastases from breast, prostate, and lung cancer. Utilization of single-fraction versus multiple-fraction radiation therapy was compared according to demographic, disease-related, and health care system details. Results: Wemore » included 24,992 patients treated during the period 2005-2011 for bone metastases. Among patients treated to non-spinal/vertebral sites (n=9011), 4.7% received 8 Gy in 1 fraction, whereas 95.3% received multiple-fraction treatment. Over time the proportion of patients receiving a single fraction of 8 Gy increased (from 3.4% in 2005 to 7.5% in 2011). Numerous independent predictors of single-fraction treatment were identified, including older age, farther travel distance for treatment, academic treatment facility, and non-private health insurance (P<.05). Conclusions: Single-fraction palliative radiation therapy regimens are significantly underutilized in current practice in the United States. Further efforts are needed to address this issue, such that evidence-based and cost-conscious care becomes more commonplace.« less

  11. Solitary small bowel metastasis from breast cancer.

    PubMed

    Choi, Jung Eun; Park, Shin Young; Jeon, Myung Hoon; Kang, Su Hwan; Lee, Soo Jung; Bae, Young Kyung; Kim, Min Kyoung

    2011-03-01

    The common sites of metastasis of breast cancer are bone, lung, and liver, but gastrointestinal metastasis from breast cancer is rare. We experienced a case of solitary ileal metastasis from breast cancer. A 45-years-old woman presented with melena for several weeks. She showed no other abdominal symptoms. Colonoscopy findings showed an ulcerative mucosal lesion in the terminal ileum, and biopsy was performed. Pathologic examination revealed metastatic carcinoma, originated from breast. The tumor cells were positive for estrogen receptor and negative for Cdx-2. She had had a previous medical history of bilateral breast cancer and undergone breast conserving surgery with sentinel lymph node biopsy for both breasts. The torso positron emission tomography scan at 19 months after surgery showed mildly increased uptake in the terminal ileum which was considered as inflammation. Finally, she was diagnosed with solitary ileal metastasis from breast cancer at 22 months after surgery.

  12. Tumor suppressor miR-1 inhibits tumor growth and metastasis by simultaneously targeting multiple genes

    PubMed Central

    Liu, Cuilian; Zhang, Song; Wang, Qizhi; Zhang, Xiaobo

    2017-01-01

    Cancer progression depends on tumor growth and metastasis, which are activated or suppressed by multiple genes. An individual microRNA may target multiple genes, suggesting that a miRNA may suppress tumor growth and metastasis via simultaneously targeting different genes. However, thus far, this issue has not been explored. In the present study, the findings showed that miR-1 could simultaneously inhibit tumor growth and metastasis of gastric and breast cancers by targeting multiple genes. The results indicated that miR-1 was significantly downregulated in cancer tissues compared with normal tissues. The miR-1 overexpression led to cell cycle arrest in the G1 phase in gastric and breast cancer cells but not in normal cells. Furthermore, the miR-1 overexpression significantly inhibited the metastasis of gastric and breast cancer cells. An analysis of the underlying mechanism revealed that the simultaneous inhibition of tumor growth and metastasis mediated by miR-1 was due to the synchronous targeting of 6 miR-1 target genes encoding cyclin dependent kinase 4, twinfilin actin binding protein 1, calponin 3, coronin 1C, WAS protein family member 2 and thymosin beta 4, X-linked. In vivo assays demonstrated that miR-1 efficiently inhibited tumor growth and metastasis of gastric and breast cancers in nude mice. Therefore, our study contributed novel insights into the miR-1′s roles in tumorigenesis of gastric and breast cancers. PMID:28159933

  13. Tumor suppressor miR-1 inhibits tumor growth and metastasis by simultaneously targeting multiple genes.

    PubMed

    Liu, Cuilian; Zhang, Song; Wang, Qizhi; Zhang, Xiaobo

    2017-06-27

    Cancer progression depends on tumor growth and metastasis, which are activated or suppressed by multiple genes. An individual microRNA may target multiple genes, suggesting that a miRNA may suppress tumor growth and metastasis via simultaneously targeting different genes. However, thus far, this issue has not been explored. In the present study, the findings showed that miR-1 could simultaneously inhibit tumor growth and metastasis of gastric and breast cancers by targeting multiple genes. The results indicated that miR-1 was significantly downregulated in cancer tissues compared with normal tissues. The miR-1 overexpression led to cell cycle arrest in the G1 phase in gastric and breast cancer cells but not in normal cells. Furthermore, the miR-1 overexpression significantly inhibited the metastasis of gastric and breast cancer cells. An analysis of the underlying mechanism revealed that the simultaneous inhibition of tumor growth and metastasis mediated by miR-1 was due to the synchronous targeting of 6 miR-1 target genes encoding cyclin dependent kinase 4, twinfilin actin binding protein 1, calponin 3, coronin 1C, WAS protein family member 2 and thymosin beta 4, X-linked. In vivo assays demonstrated that miR-1 efficiently inhibited tumor growth and metastasis of gastric and breast cancers in nude mice. Therefore, our study contributed novel insights into the miR-1's roles in tumorigenesis of gastric and breast cancers.

  14. Biocompatible, Biodegradable, and Enzymatic-Cleavable MRI Contrast Agents for Early Detection of Bone Metastatic Breast cancer

    DTIC Science & Technology

    2013-04-01

    metastasis from breast cancer. The proposed imaging agent is consist of bone targeting moiety of Asp8 and MRI imaging moiety of DOTA (Gd) with a cathepsin K...the Gd chelator of DOTA . Asp8 has a high affinity for bone mineral and has been used as bone-targeting moiety in molecular therapeutics.(1-6) The use...findings in literature.(4, 7, 17) To obtain imaging agents for MRI studies, the above mentioned peptides were allowed to react with DOTA -NHS

  15. Signaling Interplay between Bone Marrow Adipose Tissue and Multiple Myeloma cells.

    PubMed

    Falank, Carolyne; Fairfield, Heather; Reagan, Michaela R

    2016-01-01

    In the year 2000, Hanahan and Weinberg (1) defined the six Hallmarks of Cancer as: self-sufficiency in growth signals, evasion of apoptosis, insensitivity to antigrowth mechanisms, tissue invasion and metastasis, limitless replicative potential, and sustained angiogenesis. Eleven years later, two new Hallmarks were added to the list (avoiding immune destruction and reprograming energy metabolism) and two new tumor characteristics (tumor-promoting inflammation and genome instability and mutation) (2). In multiple myeloma (MM), a destructive cancer of the plasma cell that grows predominantly in the bone marrow (BM), it is clear that all these hallmarks and characteristics are in play, contributing to tumor initiation, drug resistance, disease progression, and relapse. Bone marrow adipose tissue (BMAT) is a newly recognized contributor to MM oncogenesis and disease progression, potentially affecting MM cell metabolism, immune action, inflammation, and influences on angiogenesis. In this review, we discuss the confirmed and hypothetical contributions of BMAT to MM development and disease progression. BMAT has been understudied due to technical challenges and a previous lack of appreciation for the endocrine function of this tissue. In this review, we define the dynamic, responsive, metabolically active BM adipocyte. We then describe how BMAT influences MM in terms of: lipids/metabolism, hypoxia/angiogenesis, paracrine or endocrine signaling, and bone disease. We then discuss the connection between BMAT and systemic inflammation and potential treatments to inhibit the feedback loops between BM adipocytes and MM cells that support MM progression. We aim for researchers to use this review to guide and help prioritize their experiments to develop better treatments or a cure for cancers, such as MM, that associate with and may depend on BMAT.

  16. Signaling Interplay between Bone Marrow Adipose Tissue and Multiple Myeloma cells

    PubMed Central

    Falank, Carolyne; Fairfield, Heather; Reagan, Michaela R.

    2016-01-01

    In the year 2000, Hanahan and Weinberg (1) defined the six Hallmarks of Cancer as: self-sufficiency in growth signals, evasion of apoptosis, insensitivity to antigrowth mechanisms, tissue invasion and metastasis, limitless replicative potential, and sustained angiogenesis. Eleven years later, two new Hallmarks were added to the list (avoiding immune destruction and reprograming energy metabolism) and two new tumor characteristics (tumor-promoting inflammation and genome instability and mutation) (2). In multiple myeloma (MM), a destructive cancer of the plasma cell that grows predominantly in the bone marrow (BM), it is clear that all these hallmarks and characteristics are in play, contributing to tumor initiation, drug resistance, disease progression, and relapse. Bone marrow adipose tissue (BMAT) is a newly recognized contributor to MM oncogenesis and disease progression, potentially affecting MM cell metabolism, immune action, inflammation, and influences on angiogenesis. In this review, we discuss the confirmed and hypothetical contributions of BMAT to MM development and disease progression. BMAT has been understudied due to technical challenges and a previous lack of appreciation for the endocrine function of this tissue. In this review, we define the dynamic, responsive, metabolically active BM adipocyte. We then describe how BMAT influences MM in terms of: lipids/metabolism, hypoxia/angiogenesis, paracrine or endocrine signaling, and bone disease. We then discuss the connection between BMAT and systemic inflammation and potential treatments to inhibit the feedback loops between BM adipocytes and MM cells that support MM progression. We aim for researchers to use this review to guide and help prioritize their experiments to develop better treatments or a cure for cancers, such as MM, that associate with and may depend on BMAT. PMID:27379019

  17. Biocompatible, Biodegradable, and Enzymatic-Cleavable MRI Contrast Agents for Early Detection of Bone Metastatic Breast Cancer

    DTIC Science & Technology

    2012-04-01

    detection of bone metastasis from breast cancer. The proposed imaging agent is consist of bone targeting moiety of Asp8 and MRI imaging moiety of DOTA ...peptide onto DOTA followed by Gd complexation was performed to achieve the proposed imaging agent. Non-targeting and CTSK-insensitive controls were...synthesis (SPPS) strategy, and purified by preparative HPLC. The chemical structures of peptides were shown below. Peptides reacted with DOTA -NHS

  18. Single inhalation exposure to 90SrCl2 in the beagle dog: late biological effects.

    PubMed

    Gillett, N A; Muggenburg, B A; Boecker, B B; Griffith, W C; Hahn, F F; McClellan, R O

    1987-08-01

    Late-occurring biologic effects were studied in beagle dogs that were given graded levels of 90SrCl2 via single brief inhalation exposures and were subsequently observed for their life-span. Due to the soluble chemical form of the aerosol, 90Sr was rapidly translocated from lung and deposited in bone where it was subsequently retained for a long period of time. Radiation-induced lesions were confined to the bone, bone marrow, and adjacent soft tissue. Forty-five primary bone tumors occurred in 31 of 66 exposed dogs. Metastasis occurred from 21 tumors, with the lung being the most frequent site of metastasis (76%). Twenty-seven tumors were classified as different subtypes of osteosarcoma, 14 as hemangiosarcomas, 3 as fibrosarcomas, and 1 as a myxosarcoma. Four carcinomas arising from soft tissues adjacent to bone were also considered to be 90Sr induced. In contrast to bone tumors arising in beagles chronically exposed to 90Sr through ingestion, histologic lesions of radiation osteodystrophy were minimal in this study, indicating that these lesions are not a necessary precursor of osteosarcoma development. The incidences of hemangiosarcomas (31%) and telangiectatic osteosarcomas (11%) in addition to osteosarcomas suggest that the cell of origin for all of these neoplasms is a multipotent mesenchymal cell with the potential for various morphologic expressions dependent on local environmental factors.

  19. Hepatectomy As A First Choice Treatment For Liver Metastasis From Gastric Cancer: A Single Center Experience.

    PubMed

    Sakamoto, Hirohiko; Amikura, Katsumi; Tanaka, Yoichi; Kawashima, Yoshiyuki

    2014-05-01

    Indication of hepatectomy for liver metastases from gastric cancer (LMGC) is still controversial despite many papers favoring surgery. The aim of this study is to claim that we should accept hepatectomy as first choice treatment for LMGC. It is important to have a consensus on this matter for surgeons to treat LMGC properly. Fifty three patients undergoing hepatectomy for LMGC from 1990 through 2010 were retrospectively analysed for survival and prognostic factors. Analyses were made on size, multiplicity, synchronicity and positive surgical margin as liver metastasis factors. Serosal invasion, node metastasis, histological differentiation and UICC stage were analysed as primary site factors. Multivariate analysis was performed for those positive for univariate analysis. Cumulative 5 year survival rate was 27%. Multiplicity, positive margin and node metastasis (N > 2) yielded significant difference on univariate analysis. On multivariate analysis multiplicity and node metastasis (N > 2) were significant. Hepatectomy for LMGC is potentially curative and should be regarded as first choice. Solitary and N < 3 are good prognostic factors.

  20. Diagnosis and treatment of bone metastasis: comprehensive guideline of the Japanese Society of Medical Oncology, Japanese Orthopedic Association, Japanese Urological Association, and Japanese Society for Radiation Oncology.

    PubMed

    Shibata, H; Kato, S; Sekine, I; Abe, K; Araki, N; Iguchi, H; Izumi, T; Inaba, Y; Osaka, I; Kato, S; Kawai, A; Kinuya, S; Kodaira, M; Kobayashi, E; Kobayashi, T; Sato, J; Shinohara, N; Takahashi, S; Takamatsu, Y; Takayama, K; Takayama, K; Tateishi, U; Nagakura, H; Hosaka, M; Morioka, H; Moriya, T; Yuasa, T; Yurikusa, T; Yomiya, K; Yoshida, M

    2016-01-01

    Diagnosis and treatment of bone metastasis requires various types of measures, specialists and caregivers. To provide better diagnosis and treatment, a multidisciplinary team approach is required. The members of this multidisciplinary team include doctors of primary cancers, radiologists, pathologists, orthopaedists, radiotherapists, clinical oncologists, palliative caregivers, rehabilitation doctors, dentists, nurses, pharmacists, physical therapists, occupational therapists, medical social workers, etc. Medical evidence was extracted from published articles describing meta-analyses or randomised controlled trials concerning patients with bone metastases mainly from 2003 to 2013, and a guideline was developed according to the Medical Information Network Distribution Service Handbook for Clinical Practice Guideline Development 2014. Multidisciplinary team meetings are helpful in diagnosis and treatment. Clinical benefits such as physical or psychological palliation obtained using the multidisciplinary team approaches are apparent. We established a guideline describing each specialty field, to improve understanding of the different fields among the specialists, who can further provide appropriate treatment, and to improve patients' outcomes.

  1. An unusual subcutaneous breast cancer metastasis in a 86-year-old woman.

    PubMed

    Metere, A; Di Cosimo, C; Chiesa, C; Esposito, A; Giacomelli, L; Redler, A

    2012-04-01

    The most common metastasis site of breast cancer are the local and distant lymph nodes, bone, lungs, liver and brain. We report a 86-year-old woman with an unusual abdominal subcutaneous metastasis of breast cancer. The patient was diagnosed with invasive lobular breast cancer and had been treated six months earlier with modified radical mastectomy. Later she presented a painless mass on the middle upper abdominal wall. She was subsequently admitted to the hospital to perform a whole body CT scan, confirming the presence of the abdominal mass in epigastric region, causing a partial compression of the stomach. Histopathological studies confirmed that the abdominal mass was a rare subcutaneous metastatic lesion of breast origin. The patient underwent a surgical intervention to remove the metastasis and she recovered fully.

  2. Unusual metastasis of left colon cancer: considerations on two cases.

    PubMed

    Gubitosi, Adelmo; Moccia, Giancarlo; Malinconico, Francesca Antonella; Gilio, Francesco; Iside, Giovanni; Califano, Umberto G A; Foroni, Fabrizio; Ruggiero, Roberto; Docimo, Giovanni; Parmeggiani, Domenico; Agresti, Massimo

    2009-04-01

    Usually, left colon cancer metastasis concerns liver, abdominal lymph nodes and lungs. Other localizations are quite rare occurrences. In spite of this, some uncommon metastasis sites are reported in literature, such as: peritoneum, ovaries, uterus, kidney testis, bones, thyroid, oral cavity and central nervous system. We report two cases of unusual localizations of left colon cancer metastasis localization, one into the retroperitoneal space and the other at the left axillary lynphnodes and between liver and pancreas. In the first reported case the diffusion pathway may have been the lymphatic mesocolic vessels, partially left in place from the previous surgery. In the second case the alleged metastatic lane may have been through the periumbilical lymph nodes to the parasternal lymph nodes and then to the internal mammary ones, finally reaching the axillary limph nodes.

  3. Occurrence of metastases in beagles with skeletal malignancies induced by internal irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lloyd, R.D.; Angus, W.; Taylor, G.N.

    1994-03-01

    Metastases from malignant bone tumors often are responsible for the fatal effects of these cancers. Characteristics of primary skeletal malignancies in beagles injected with bone-seeking radionuclides were studied by Thurman (1971) and summarized by Thurman et al. (1971). There were 212 tumors in 186 of these dogs for which we subsequently received information on bone tumor metastases. Evaluation of bone and soft tissue slides from these animals allowed us to compare parameters reported previously with the occurrence of grossly apparent bone tumor metastases. Data included growth-rate of the primary tumor, volume of the primary tumor at death, sex of themore » animal, growth period of the primary tumor, degree of calcification of the primary tumor, skeletal location of the primary tumor, cumulative radiation dose to the skeleton, dose equivalent to the skeleton, and year of death. For most of the comparisons, no significant differences could be established between dogs with and without metastases. However, tumor volume at death appeared to be correlated with probability of metastasis (p < 0.05), with the larger tumors being associated with higher rates of metastasis. Comparisons of dogs with and without metastases as a function of tumor growth-rate did not, for the most part, yield significantly different results between groups. 10 refs., 11 tabs.« less

  4. Anal metastasis from breast cancer: a case report and review of the literature.

    PubMed

    Bochicchio, Annamaria; Tartarone, Alfredo; Ignomirelli, Orazio; Latorre, Giuseppe; Cangiano, Rodolfo; Gallucci, Giuseppina; Coccaro, Mariarosa; Feudale, Elisa; Aieta, Michele

    2012-03-01

    Breast cancer usually metastasizes towards the lymph nodes, lung, bone, liver or brain; metastatic gastrointestinal involvement is rare and anal metastases are extremely rare. Necroscopic studies report a 6-18% incidence of extra-hepatic gastrointestinal metastases, and the most frequent sites of the GI tract involved are the stomach and the small intestine. We report a case with anal metastasis from breast cancer and a review of the associated literature.

  5. Mesorectum localization as a special kind of rectal metastasis from breast cancer.

    PubMed

    Xue, Fan; Liu, Zhong-Lin; Zhang, Qing; Kong, Xiang-Nan; Liu, Wen-Zhi

    2015-04-14

    Breast cancer can metastasize to other organs following initial treatment. Bones, liver, and the lung are the most common sites of breast cancer metastases. The digestive tract, on the other hand, is rarely involved. The incidence of mesorectal metastasis (a special category of rectal metastases) from breast cancer has not been described before. The case reported herein concerns a 68-year-old woman who underwent mastectomy. A pelvic mass with no symptoms was subsequently identified by computed tomography in the patient. We ultimately confirmed that this mass was a metastasis from breast cancer located in the mesorectum using surgical exploration and pathology results.

  6. Autologous Bone Marrow Stromal Cells Genetically Engineered to Secrete an IGF-I Receptor Decoy Prevent the Growth of Liver Metastases

    PubMed Central

    Wang, Ni; Fallavollita, Lucia; Nguyen, Long; Burnier, Julia; Rafei, Moutih; Galipeau, Jacques; Yakar, Shoshana; Brodt, Pnina

    2009-01-01

    Liver metastases respond poorly to current therapy and remain a frequent cause of cancer-related mortality. We reported previously that tumor cells expressing a soluble form of the insulin-like growth factor-I receptor (sIGFIR) lost the ability to metastasize to the liver. Here, we sought to develop a novel therapeutic approach for prevention of hepatic metastasis based on sustained in vivo delivery of the soluble receptor by genetically engineered autologous bone marrow stromal cells. We found that when implanted into mice, these cells secreted high plasma levels of sIGFIR and inhibited experimental hepatic metastases of colon and lung carcinoma cells. In hepatic micrometastases, a reduction in intralesional angiogenesis and increased tumor cell apoptosis were observed. The results show that the soluble receptor acted as a decoy to abort insulin-like growth factor-I receptor (IGF-IR) functions during the early stages of metastasis and identify sustained sIGFIR delivery by cell-based vehicles as a potential approach for prevention of hepatic metastasis. PMID:19367255

  7. Unusual presentation of a metastatic uveal melanoma in a cat.

    PubMed

    Planellas, Marta; Pastor, Josep; Torres, Ma Dolores; Peña, Teresa; Leiva, Marta

    2010-11-01

    A 10 year-old, spayed female Domestic Short-Haired (DSH) cat was diagnosed with a large primary uveal melanoma and exenteration was recommended. Thoracic radiographs, abdominal ultrasonography, and complete blood count and serum biochemistry panel did not reveal any abnormality compatible with metastatic disease and surgery was performed. Histopathologic study of the eye confirmed a diffuse iris melanoma. Five months later, the cat presented with a lameness of the right anterior extremity. On physical exam the right elbow was swollen and painful. Radiographs showed a severe osteolysis of the radial head and proximal diaphysis. Fine needle aspiration of the radius head identified a round cell neoplasm with scattered cells containing intracytoplasmatic pigmented granules, compatible with metastatic melanoma. The owners decided not to treat the patient with chemotherapy and declined a biopsy. Two months later, the cat died and necropsy was performed confirming bone metastasis of the uveal melanoma. A diagnosis of generalized metastasis from primary diffuse iris melanoma was made. This report describes, for the first time, long bone metastasis from an uveal melanoma in a cat. © 2010 American College of Veterinary Ophthalmologists.

  8. Gastrodin inhibits osteoclastogenesis via down-regulating the NFATc1 signaling pathway and stimulates osseointegration in vitro

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Feng; Shen, Yi; Liu, Bo

    Bone is a rigid yet dynamic organ, and this dynamism is mediated by the delicate balance between osteoclastic bone resorption and osteoblastic bone formation. However, excessive activation of osteoclasts is responsible for many bone diseases such as osteoporosis, Paget disease, and tumor bone metastasis. Agents that could inhibit osteoclast formation or function are regarded as promising alternatives to treat osteoclast-related diseases. Recently, traditional Chinese medicine has attracted attention because of its multiple activities in bone metabolism. Among them, gastrodin has been reported as an anti-osteoporosis agent that reduces reactive oxygen species. However, the direct action of gastrodin on osteoclast differentiationmore » and bone resorption, and its underlying molecular mechanism, remain unknown. In this study, we investigated the effects of gastrodin on receptor activator NF-κB ligand (RANKL)-activated osteoclasts formation and bone resorption. Our results showed that gastrodin retarded RANKL-induced osteoclast differentiation efficiently by downregulating transcriptional and translational expression of nuclear factor of activated T cells cl (NFATc1), a major factor in RANKL-mediated osteoclastogenesis. Meanwhile, gastrodin prevented osteoclast maturation and migration by inhibiting the gene expression of dendrocyte expressed seven transmembrane protein (DC-STAMP), an osteoclastic-specific gene that controls cells fusion and movement. And gastrodin prevented RANKL-induced osteoclastic bone erosion in vitro. In addition, gastrodin also stimulated bone mesenchymal stem cell (BMSC) spreading and osseointegration in titanium plate. In summary, gastrodin could prevent osteoclasts formation and bone resorption via blockage of NFATc1 activity, and stimulate osseointegration in vitro. Gastrodin could be developed as a potent phytochemical candidate to treat osteolytic diseases. - Highlights: • Gastrodin suppresses osteoclasts formation and function in vitro. • Gastrodin impairs NFATc1 activation. • Gastrodin stimulates osseointegration in vitro. • Gastrodin may be used for treating osteoclast related diseases.« less

  9. Crude Fucoidan Extracts Impair Angiogenesis in Models Relevant for Bone Regeneration and Osteosarcoma via Reduction of VEGF and SDF-1.

    PubMed

    Wang, Fanlu; Schmidt, Harald; Pavleska, Dijana; Wermann, Thees; Seekamp, Andreas; Fuchs, Sabine

    2017-06-20

    The marine origin polysaccharide fucoidan combines multiple biological activities. As demonstrated by various studies in vitro and in vivo, fucoidans show anti-viral, anti-tumor, anti-oxidant, anti-inflammatory and anti-coagulant properties, although the detailed molecular action remains to be elucidated. The aim of the present study is to assess the impact of crude fucoidan extracts, on the formation of vascular structures in co-culture models relevant for bone vascularization during bone repair and for vascularization processes in osteosarcoma. The co-cultures consisted of bone marrow derived mesenchymal stem cells, respectively the osteosarcoma cell line MG63, and human blood derived outgrowth endothelial cells (OEC). The concentration dependent effects on the metabolic activity on endothelial cells and osteoblast cells were first assessed using monocultures of OEC, MSC and MG63 suggesting a concentration of 100 µg/mL as a suitable concentration for further experiments. In co-cultures fucoidan significantly reduced angiogenesis in MSC/OEC but also in MG63/OEC co-cultures suggesting a potential application of fucoidan to lower the vascularization in bone tumors such as osteosarcoma. This was associated with a decrease in VEGF (vascular endothelial growth factor) and SDF-1 (stromal derived factor-1) on the protein level, both related to the control of angiogenesis and furthermore discussed as crucial factors in osteosarcoma progression and metastasis. In terms of bone formation, fucoidan slightly lowered on the calcification process in MSC monocultures and MSC/OEC co-cultures. In summary, these data suggest the suitability of lower fucoidan doses to limit angiogenesis for instance in osteosarcoma.

  10. Breast Cancer Metastases to the Gastrointestinal Tract Presenting with Anemia and Intra-abdominal Bleed.

    PubMed

    Khan, Idrees; Malik, Rehan; Khan, Amina; Assad, Salman; Zahid, Mehr; Sohail, Muhammad Saad; Yasin, Faizan; Qavi, Ahmed H

    2017-07-06

    Signet ring adenocarcinoma of the breast with synchronous metastasis to the gastrointestinal (GI) tract is a rare occurrence, typically presenting with abdominal pain, dyspepsia, or GI bleed. We report a case of metastatic breast cancer presenting with a complaint of anemia. A further diagnostic evaluation revealed generalized lymphadenopathy, nodular thickening of the urinary bladder wall, bone lesions, and enlarged pancreas. Biopsies from the lymph nodes, pancreatic biopsy, and bladder nodule all revealed a signet cell carcinoma. An upper and lower GI endoscopy revealed multiple ulcerated gastric mucosal nodules and polypoid folds in the cecum and proximal ascending colon; the biopsies from these lesions were also positive for signet ring cell adenocarcinoma.

  11. The Emerging Roles of Forkhead Box (FOX) Proteins in Osteosarcoma

    PubMed Central

    Zhang, Wentao; Duan, Ning; Song, Tao; Li, Zhong; Zhang, Caiguo; Chen, Xun

    2017-01-01

    Osteosarcoma is the most common bone cancer primarily occurring in children and young adults. Over the past few years, the deregulation of a superfamily transcription factors, known as forkhead box (FOX) proteins, has been demonstrated to contribute to the pathogenesis of osteosarcoma. Molecular mechanism studies have demonstrated that FOX family proteins participate in a variety of signaling pathways and that their expression can be regulated by multiple factors. The dysfunction of FOX genes can alter osteosarcoma cell differentiation, metastasis and progression. In this review, we summarized the evidence that FOX genes play direct or indirect roles in the development and progression of osteosarcoma, and evaluated the emerging role of FOX proteins as targets for therapeutic intervention. PMID:28775781

  12. The Role of Osteoblast-Derived Inflammatory Cytokines in Bone Metastatic Breast Cancer

    DTIC Science & Technology

    2008-03-01

    Cancer Res. Treat. 59 (2000) 271–278. [2] R.D. Rubens , G.R. Mundy, Cancer and the skeleton, Martin Dunitz, London, 2000. [3] R.D. Rubens , Bone...NIHM01RR10732) for technical advice regarding ELISAs. References 1. Rubens , R. D., & Mundy, G. R. (2000). Cancer and the skeleton. London: Martin...58. Mundy, G. R., & Guise, T. A. (2000). Pathophysiology of bone metastasis. In R. D. Rubens , & G. R. Mundy (Eds.) Cancer and the skeleton (pp. 43–64

  13. Detection of bone metastases in breast cancer patients in the PET/CT era: Do we still need the bone scan?

    PubMed

    Caglar, M; Kupik, O; Karabulut, E; Høilund-Carlsen, P F

    2016-01-01

    To examine the value of 18F-fluorodeoxyglucose positron emission tomography/computed tomography (FDG-PET/CT) for the detection of bone metastasis in breast cancer patients and assess whether whole body bone scan (BS) with (99m)Tc-methylene diphosphonate provides any additional information. Study group comprised 150 patients, mean age 52 years (range 27-85) with breast cancer, suspected of having bone metastases. All patients had undergone both FDG-PET/CT and BS with or without single photon emission tomography/computed tomography (SPECT/CT) within a period of 6 weeks. The final diagnosis of bone metastasis was established by histopathological findings, additional imaging, or clinical follow-up longer than 10 months. Cancer antigen 15-3 (CA15-3) and carcinoembryogenic antigen (CEA) were measured in all patients. Histologically 83%, 7% and 10% had infiltrating ductal, lobular and mixed carcinoma respectively. Confirmed bone metastases were present in 86 patients (57.3%) and absent in 64 (42.7%). Mean CA15-3 and CEA values in patients with bone metastases were 74.6ng/mL and 60.4U/mL respectively, compared to 21.3ng/mL and 3.2U/mL without metastases (p<0.001). The sensitivity of FDG-PET/CT for the detection of bone metastases was 97.6% compared to 89.5% with SPECT/CT. In 57 patients, FDG-PET/CT correctly identified additional pulmonary, hepatic, nodal and other soft tissue metastases, not detected by BS. Our findings suggest that FDG-PET/CT is superior to BS with or without SPECT/CT. Copyright © 2015 Elsevier España, S.L.U. and SEMNIM. All rights reserved.

  14. Bone metastases from breast cancer at the time or radical mastectomy as detected by bone scan. Eight-year follow-up.

    PubMed

    Sklaroff, R B; Sklaroff, D M

    1976-07-01

    Sixty-four women with Stage II breast cancer who had Sr85 bone scans at the time of radical mastectomy were followed for 8 years in a prospective study. Those women with positive scans had a slight, but statistically significant, increased incidence of metastic disease, particularly for metastases to bone.However, 40% of those women with positive bone scans and negative roentgenograms survived 8 years without evidence of any metastatic disease. Therefore, it has not been shown at this time that bone scans should be obtained in order to exclude bone metastasis before regional therapy for breast cancer is instituted. Also, a significant percentage of women with negative bone scans developed both bone and soft tissue metastases. As many as 30% of asymptomatic women with a history of breast cancer and positive bone scans and negative bone roentgenograms may still harbor disease in bone after 8 years.

  15. Microfluidic co-culture platform for investigating osteocyte-osteoclast signalling during fluid shear stress mechanostimulation.

    PubMed

    Middleton, K; Al-Dujaili, S; Mei, X; Günther, A; You, L

    2017-07-05

    Bone cells exist in a complex environment where they are constantly exposed to numerous dynamic biochemical and mechanical stimuli. These stimuli regulate bone cells that are involved in various bone disorders, such as osteoporosis. Knowledge of how these stimuli affect bone cells have been utilised to develop various treatments, such as pharmaceuticals, hormone therapy, and exercise. To investigate the role that bone loading has on these disorders in vitro, bone cell mechanotransduction studies are typically performed using parallel plate flow chambers (PPFC). However, these chambers do not allow for dynamic cellular interactions among different cell populations to be investigated. We present a microfluidic approach that exposes different cell populations, which are located at physiologically relevant distances within adjacent channels, to different levels of fluid shear stress, and promotes cell-cell communication between the different channels. We employed this microfluidic system to assess mechanically regulated osteocyte-osteoclast communication. Osteoclast precursors (RAW264.7 cells) responded to cytokine gradients (e.g., RANKL, OPG, PGE-2) developed by both mechanically stimulated (fOCY) and unstimulated (nOCY) osteocyte-like MLO-Y4 cells simultaneously. Specifically, we observed increased osteoclast precursor cell densities and osteoclast differentiation towards nOCY. We also used this system to show an increased mechanoresponse of osteocytes when in co-culture with osteoclasts. We envision broad applicability of the presented approach for microfluidic perfusion co-culture of multiple cell types in the presence of fluid flow stimulation, and as a tool to investigate osteocyte mechanotransduction, as well as bone metastasis extravasation. This system could also be applied to any multi-cell population cross-talk studies that are typically performed using PPFCs (e.g. endothelial cells, smooth muscle cells, and fibroblasts). Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Genomics screens for metastasis genes

    PubMed Central

    Yan, Jinchun; Huang, Qihong

    2014-01-01

    Metastasis is responsible for most cancer mortality. The process of metastasis is complex, requiring the coordinated expression and fine regulation of many genes in multiple pathways in both the tumor and host tissues. Identification and characterization of the genetic programs that regulate metastasis is critical to understanding the metastatic process and discovering molecular targets for the prevention and treatment of metastasis. Genomic approaches and functional genomic analyses can systemically discover metastasis genes. In this review, we summarize the genetic tools and methods that have been used to identify and characterize the genes that play critical roles in metastasis. PMID:22684367

  17. Pain Palliation by Percutaneous Acetabular Osteoplasty for Metastatic Hepatocellular Carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hokotate, Hirofumi; Baba, Yasutaka; Churei, Hisahiko

    2001-09-15

    A 68-year-old man with hepatocellular carcinoma and known skeletal metastasis developed right hip pain and gait disturbance due to an osteolytic metastasis in the right acetabulum. This was treated initially with chemoembolization and radiation therapy. When these procedures proved unsuccessful percutaneous injection of acrylic bone cement into the acetabulum was undertaken. Immediately after this procedure, he obtained sufficient pain relief and improved walking ability, which continued for 3 months until he died of hepatic insufficiency.

  18. Sustained conditional knockdown reveals intracellular bone sialoprotein as essential for breast cancer skeletal metastasis.

    PubMed

    Kovacheva, Marineta; Zepp, Michael; Berger, Stefan M; Berger, Martin R

    2014-07-30

    Increased bone sialoprotein (BSP) serum levels are related to breast cancer skeletal metastasis, but their relevance is unknown. We elucidated novel intracellular BSP functions by a conditional knockdown of BSP. Conditional MDA-MB-231 subclones were equipped with a novel gene expression cassette containing a tet-reg-ulated miRNA providing knockdown of BSP production. These clones were used to assess the effect of BSP on morphology, proliferation, migration, colony formation and gene expression in vitro, and on soft tissue and osteolytic le-sions in a xenograft model by three imaging methods. BSP knockdown caused significant anti-proliferative, anti-migratory and anti-clonogenic effects in vitro (p<0.001). In vivo, significant de-creases of soft tissue and osteolytic lesions (p<0.03) were recorded after 3 weeks of miRNA treatment, leading to complete remission within 6 weeks. Microarray data revealed that 0.3% of genes were modulated in response to BSP knockdown. Upregulated genes included the endoplasmic reticulum stress genes ATF3 and DDIT3, the tumor suppressor gene EGR1, ID2 (related to breast epithelial differentiation), c-FOS and SERPINB2, whereas the metastasis associated genes CD44 and IL11 were downregulated. Also, activation of apoptotic pathways was demonstrated. These results implicate that intracellular BSP is essential for breast cancer skeletal metastasis and a target for treating these lesions.

  19. Sustained conditional knockdown reveals intracellular bone sialoprotein as essential for breast cancer skeletal metastasis

    PubMed Central

    Kovacheva, Marineta; Zepp, Michael; Berger, Stefan M.; Berger, Martin R.

    2014-01-01

    Increased bone sialoprotein (BSP) serum levels are related to breast cancer skeletal metastasis, but their relevance is unknown. We elucidated novel intracellular BSP functions by a conditional knockdown of BSP. Conditional MDA-MB-231 subclones were equipped with a novel gene expression cassette containing a tet-regulated miRNA providing knockdown of BSP production. These clones were used to assess the effect of BSP on morphology, proliferation, migration, colony formation and gene expression in vitro, and on soft tissue and osteolytic lesions in a xenograft model by three imaging methods. BSP knockdown caused significant anti-proliferative, anti-migratory and anti-clonogenic effects in vitro (p<0.001). In vivo, significant decreases of soft tissue and osteolytic lesions (p<0.03) were recorded after 3 weeks of miRNA treatment, leading to complete remission within 6 weeks. Microarray data revealed that 0.3% of genes were modulated in response to BSP knockdown. Upregulated genes included the endoplasmic reticulum stress genes ATF3 and DDIT3, the tumor suppressor gene EGR1, ID2 (related to breast epithelial differentiation), c-FOS and SERPINB2, whereas the metastasis associated genes CD44 and IL11 were downregulated. Also, activation of apoptotic pathways was demonstrated. These results implicate that intracellular BSP is essential for breast cancer skeletal metastasis and a target for treating these lesions. PMID:24980816

  20. Tumour exosome integrins determine organotropic metastasis

    PubMed Central

    Hoshino, Ayuko; Costa-Silva, Bruno; Shen, Tang-Long; Rodrigues, Goncalo; Hashimoto, Ayako; Mark, Milica Tesic; Molina, Henrik; Kohsaka, Shinji; Di Giannatale, Angela; Ceder, Sophia; Singh, Swarnima; Williams, Caitlin; Soplop, Nadine; Uryu, Kunihiro; Pharmer, Lindsay; King, Tari; Bojmar, Linda; Davies, Alexander E.; Ararso, Yonathan; Zhang, Tuo; Zhang, Haiying; Hernandez, Jonathan; Weiss, Joshua M.; Dumont-Cole, Vanessa D.; Kramer, Kimberly; Wexler, Leonard H.; Narendran, Aru; Schwartz, Gary K.; Healey, John H.; Sandstrom, Per; Labori, Knut Jørgen; Kure, Elin H.; Grandgenett, Paul M.; Hollingsworth, Michael A.; de Sousa, Maria; Kaur, Sukhwinder; Jain, Maneesh; Mallya, Kavita; Batra, Surinder K.; Jarnagin, William R.; Brady, Mary S.; Fodstad, Oystein; Muller, Volkmar; Pantel, Klaus; Minn, Andy J.; Bissell, Mina J.; Garcia, Benjamin A.; Kang, Yibin; Rajasekhar, Vinagolu K.; Ghajar, Cyrus M.; Matei, Irina; Peinado, Hector; Bromberg, Jacqueline; Lyden, David

    2015-01-01

    Ever since Stephen Paget’s 1889 hypothesis, metastatic organotropism has remained one of cancer’s greatest mysteries. Here we demonstrate that exosomes from mouse and human lung-, liver- and brain-tropic tumour cells fuse preferentially with resident cells at their predicted destination, namely lung fibroblasts and epithelial cells, liver Kupffer cells and brain endothelial cells. We show that tumour-derived exosomes uptaken by organ-specific cells prepare the pre-metastatic niche. Treatment with exosomes from lung-tropic models redirected the metastasis of bone-tropic tumour cells. Exosome proteomics revealed distinct integrin expression patterns, in which the exosomal integrins α6β4 and α6β1 were associated with lung metastasis, while exosomal integrin αvβ5 was linked to liver metastasis. Targeting the integrins α6β4 and αvβ5 decreased exosome uptake, as well as lung and liver metastasis, respectively. We demonstrate that exosome integrin uptake by resident cells activates Src phosphorylation and pro-inflammatory S100 gene expression. Finally, our clinical data indicate that exosomal integrins could be used to predict organ-specific metastasis. PMID:26524530

  1. Tumour exosome integrins determine organotropic metastasis

    DOE PAGES

    Hoshino, Ayuko; Costa-Silva, Bruno; Shen, Tang-Long; ...

    2015-10-28

    Ever since Stephen Paget’s 1889 hypothesis, metastatic organotropism has remained one of cancer’s greatest mysteries. In this paper, we demonstrate that exosomes from mouse and human lung-, liver- and brain-tropic tumour cells fuse preferentially with resident cells at their predicted destination, namely lung fibroblasts and epithelial cells, liver Kupffer cells and brain endothelial cells. We show that tumour-derived exosomes uptaken by organ-specific cells prepare the pre-metastatic niche. Treatment with exosomes from lung-tropic models redirected the metastasis of bone-tropic tumour cells. Exosome proteomics revealed distinct integrin expression patterns, in which the exosomal integrins α 6β 4 and α 6β 1 weremore » associated with lung metastasis, while exosomal integrin α vβ 5 was linked to liver metastasis. Targeting the integrins α 6β 4 and α vβ 5 decreased exosome uptake, as well as lung and liver metastasis, respectively. We demonstrate that exosome integrin uptake by resident cells activates Src phosphorylation and pro-inflammatory S100 gene expression. In conclusion, our clinical data indicate that exosomal integrins could be used to predict organ-specific metastasis.« less

  2. Tumour exosome integrins determine organotropic metastasis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoshino, Ayuko; Costa-Silva, Bruno; Shen, Tang-Long

    Ever since Stephen Paget’s 1889 hypothesis, metastatic organotropism has remained one of cancer’s greatest mysteries. In this paper, we demonstrate that exosomes from mouse and human lung-, liver- and brain-tropic tumour cells fuse preferentially with resident cells at their predicted destination, namely lung fibroblasts and epithelial cells, liver Kupffer cells and brain endothelial cells. We show that tumour-derived exosomes uptaken by organ-specific cells prepare the pre-metastatic niche. Treatment with exosomes from lung-tropic models redirected the metastasis of bone-tropic tumour cells. Exosome proteomics revealed distinct integrin expression patterns, in which the exosomal integrins α 6β 4 and α 6β 1 weremore » associated with lung metastasis, while exosomal integrin α vβ 5 was linked to liver metastasis. Targeting the integrins α 6β 4 and α vβ 5 decreased exosome uptake, as well as lung and liver metastasis, respectively. We demonstrate that exosome integrin uptake by resident cells activates Src phosphorylation and pro-inflammatory S100 gene expression. In conclusion, our clinical data indicate that exosomal integrins could be used to predict organ-specific metastasis.« less

  3. Tumour exosome integrins determine organotropic metastasis.

    PubMed

    Hoshino, Ayuko; Costa-Silva, Bruno; Shen, Tang-Long; Rodrigues, Goncalo; Hashimoto, Ayako; Tesic Mark, Milica; Molina, Henrik; Kohsaka, Shinji; Di Giannatale, Angela; Ceder, Sophia; Singh, Swarnima; Williams, Caitlin; Soplop, Nadine; Uryu, Kunihiro; Pharmer, Lindsay; King, Tari; Bojmar, Linda; Davies, Alexander E; Ararso, Yonathan; Zhang, Tuo; Zhang, Haiying; Hernandez, Jonathan; Weiss, Joshua M; Dumont-Cole, Vanessa D; Kramer, Kimberly; Wexler, Leonard H; Narendran, Aru; Schwartz, Gary K; Healey, John H; Sandstrom, Per; Labori, Knut Jørgen; Kure, Elin H; Grandgenett, Paul M; Hollingsworth, Michael A; de Sousa, Maria; Kaur, Sukhwinder; Jain, Maneesh; Mallya, Kavita; Batra, Surinder K; Jarnagin, William R; Brady, Mary S; Fodstad, Oystein; Muller, Volkmar; Pantel, Klaus; Minn, Andy J; Bissell, Mina J; Garcia, Benjamin A; Kang, Yibin; Rajasekhar, Vinagolu K; Ghajar, Cyrus M; Matei, Irina; Peinado, Hector; Bromberg, Jacqueline; Lyden, David

    2015-11-19

    Ever since Stephen Paget's 1889 hypothesis, metastatic organotropism has remained one of cancer's greatest mysteries. Here we demonstrate that exosomes from mouse and human lung-, liver- and brain-tropic tumour cells fuse preferentially with resident cells at their predicted destination, namely lung fibroblasts and epithelial cells, liver Kupffer cells and brain endothelial cells. We show that tumour-derived exosomes uptaken by organ-specific cells prepare the pre-metastatic niche. Treatment with exosomes from lung-tropic models redirected the metastasis of bone-tropic tumour cells. Exosome proteomics revealed distinct integrin expression patterns, in which the exosomal integrins α6β4 and α6β1 were associated with lung metastasis, while exosomal integrin αvβ5 was linked to liver metastasis. Targeting the integrins α6β4 and αvβ5 decreased exosome uptake, as well as lung and liver metastasis, respectively. We demonstrate that exosome integrin uptake by resident cells activates Src phosphorylation and pro-inflammatory S100 gene expression. Finally, our clinical data indicate that exosomal integrins could be used to predict organ-specific metastasis.

  4. TU-A-12A-08: Computing Longitudinal Material Changes in Bone Metastases Using Dual Energy Computed Tomography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schmidtlein, CR; Hwang, S; Veeraraghavan, H

    Purpose: This study demonstrates a methodology for tracking changes in metastatic bone disease using trajectories in material basis space in serial dual energy computed tomography (DECT) studies. Methods: This study includes patients with bone metastases from breast cancer that had clinical surveillance CT scans using a General Electric CT750HD in dual energy mode. A radiologist defined regions-of-interested (ROI) for bone metastasis, normal bone, and marrow across the serial DECT scans. Our approach employs a Radon transform to forward-projection the basis images, namely, water and iodine, into sinogram space. This data is then repartitioned into fat/bone and effective density/Z image pairsmore » using assumed energy spectrums for the x-ray energies. This approach both helps remove negative material densities and avoids adding spectrum-hardening artifacts. These new basis data sets were then reconstructed via filtered back-projection to create new material basis pair images. The trajectories of these pairs were then plotted in the new basis space providing a means to both visualize and quantitatively measure changes in the material properties of the tumors. Results: ROI containing radiologist defined metastatic bone disease showed well-defined trajectories in both fat/bone and effective density/Z space. ROI that contained radiologist defined normal bone and marrow did not exhibit any discernible trajectories and were stable from scan to scan. Conclusions: The preliminary results show that changes in material composition and effective density/Z image pairs were seen primarily in metastasis and not in normal tissue. This study indicates that by using routine clinical DECT it may be possible to monitor therapy response of bone metastases because healing or worsening bone metastases change material composition of bone. Additional studies are needed to further validate these results and to test for their correlation with outcome.« less

  5. Bone Metastasis in Advanced Breast Cancer: Analysis of Gene Expression Microarray.

    PubMed

    Cosphiadi, Irawan; Atmakusumah, Tubagus D; Siregar, Nurjati C; Muthalib, Abdul; Harahap, Alida; Mansyur, Muchtarruddin

    2018-03-08

    Approximately 30% to 40% of breast cancer recurrences involve bone metastasis (BM). Certain genes have been linked to BM; however, none have been able to predict bone involvement. In this study, we analyzed gene expression profiles in advanced breast cancer patients to elucidate genes that can be used to predict BM. A total of 92 advanced breast cancer patients, including 46 patients with BM and 46 patients without BM, were identified for this study. Immunohistochemistry and gene expression analysis was performed on 81 formalin-fixed paraffin-embedded samples. Data were collected through medical records, and gene expression of 200 selected genes compiled from 6 previous studies was performed using NanoString nCounter. Genetic expression profiles showed that 22 genes were significantly differentially expressed between breast cancer patients with metastasis in bone and other organs (BM+) and non-BM, whereas subjects with only BM showed 17 significantly differentially expressed genes. The following genes were associated with an increasing incidence of BM in the BM+ group: estrogen receptor 1 (ESR1), GATA binding protein 3 (GATA3), and melanophilin with an area under the curve (AUC) of 0.804. In the BM group, the following genes were associated with an increasing incidence of BM: ESR1, progesterone receptor, B-cell lymphoma 2, Rab escort protein, N-acetyltransferase 1, GATA3, annexin A9, and chromosome 9 open reading frame 116. ESR1 and GATA3 showed an increased strength of association with an AUC of 0.928. A combination of the identified 3 genes in BM+ and 8 genes in BM showed better prediction than did each individual gene, and this combination can be used as a training set. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Squamous cell lung carcinoma presenting as melena: a case report and review of the literature.

    PubMed

    Azar, Ibrahim; Koutroumpakis, Efstratios; Patel, Raina; Mehdi, Syed

    2017-10-03

    Lung cancer has a predilection to widely metastasize to the liver, bone, brain and adrenal glands. Metastasis of primary lung tumors to the stomach is infrequent, with only sporadic cases reported. Most cases are asymptomatic and diagnosed post-mortem on autopsy. The incidence of symptomatic gastrointestinal metastases is extremely rare. Herein, we describe a case of gastric metastasis by squamous cell lung carcinoma, presenting as melena and diagnosed by esophagogastroduodenoscopy. To the best of our knowledge, only twenty other cases in the English literature have reported symptomatic gastric metastasis of lung cancer diagnosed by endoscopic biopsy. A brief review of the literature shows gastric metastasis of lung cancer to have a predilection to occur most frequently in male smokers with the most common type of tumor likely to be squamous cell carcinoma.

  7. Systemic Delivery of Oncolytic Adenoviruses Targeting Transforming Growth Factor-β Inhibits Established Bone Metastasis in a Prostate Cancer Mouse Model

    PubMed Central

    Hu, Zebin; Gupta, Janhavi; Zhang, Zhenwei; Gerseny, Helen; Berg, Arthur; Chen, Yun Ju; Zhang, Zhiling; Du, Hongyan; Brendler, Charles B.; Xiao, Xianghui; Pienta, Kenneth J.; Guise, Theresa; Lee, Chung; Stern, Paula H.; Stock, Stuart

    2012-01-01

    Abstract We have examined whether Ad.sTβRFc and TAd.sTβRFc, two oncolytic viruses expressing soluble transforming growth factor-β receptor II fused with human Fc (sTGFβRIIFc), can be developed to treat bone metastasis of prostate cancer. Incubation of PC-3 and DU-145 prostate tumor cells with Ad.sTβRFc and TAd.sTβRFc produced sTGFβRIIFc and viral replication; sTGFβRIIFc caused inhibition of TGF-β-mediated SMAD2 and SMAD3 phosphorylation. Ad(E1-).sTβRFc, an E1– adenovirus, produced sTGFβRIIFc but failed to replicate in tumor cells. To examine the antitumor response of adenoviral vectors, PC-3-luc cells were injected into the left heart ventricle of nude mice. On day 9, mice were subjected to whole-body bioluminescence imaging (BLI). Mice bearing hind-limb tumors were administered viral vectors via the tail vein on days 10, 13, and 17 (2.5×1010 viral particles per injection per mouse, each injection in a 0.1-ml volume), and subjected to BLI and X-ray radiography weekly until day 53. Ad.sTβRFc, TAd.sTβRFc, and Ad(E1-).sTβRFc caused significant inhibition of tumor growth; however, Ad.sTβRFc was the most effective among all the vectors. Only Ad.sTβRFc and TAd.sTβRFc inhibited tumor-induced hypercalcemia. Histomorphometric and synchrotron micro-computed tomographic analysis of isolated bones indicated that Ad.sTβRFc induced significant reduction in tumor burden, osteoclast number, and trabecular and cortical bone destruction. These studies suggest that Ad.sTβRFc and TAd.sTβRFc can be developed as potential new therapies for prostate cancer bone metastasis. PMID:22551458

  8. A novel long non-coding RNA linc-ZNF469-3 promotes lung metastasis through miR-574-5p-ZEB1 axis in triple negative breast cancer.

    PubMed

    Wang, Po-Shun; Chou, Cheng-Han; Lin, Cheng-Han; Yao, Yun-Chin; Cheng, Hui-Chuan; Li, Hao-Yi; Chuang, Yu-Chung; Yang, Chia-Ning; Ger, Luo-Ping; Chen, Yu-Chia; Lin, Forn-Chia; Shen, Tang-Long; Hsiao, Michael; Lu, Pei-Jung

    2018-05-14

    Triple-negative breast cancer (TNBC) patients usually lead to poor prognosis and survival because of metastasis. The major sites for TNBC metastasis include the lungs, brain, liver, and bone. Long non-coding RNAs (lncRNAs) are non-protein-coding transcripts longer than 200 nucleotides and have been reported as important regulators in BC metastasis. However, the underlying mechanisms for lncRNAs regulating TNBC metastasis are not fully understood. Here we found that linc-ZNF469-3 was highly expressed in lung-metastatic LM2-4175 TNBC cells and overexpression of linc-ZNF469-3 enhanced invasion ability and stemness properties in vitro and lung metastasis in vivo. Furthermore, we found linc-ZNF469-3 physically interacted with miR-574-5p and overexpression of miR-574-5p attenuated ZEB1 expression. Importantly, endogenous high expressions of linc-ZNF469-3 and ZEB1 were correlated with tumor recurrence in TNBC patients with lung metastasis. Taken together, our findings suggested that linc-ZNF469-3 promotes lung metastasis of TNBC through miR-574-5p-ZEB1 signaling axis and may be used as potential prognostic marker for TNBC patients.

  9. Rapid modification of the bone microenvironment following short-term treatment with Cabozantinib in vivo.

    PubMed

    Haider, Marie-Therese; Hunter, Keith D; Robinson, Simon P; Graham, Timothy J; Corey, Eva; Dear, T Neil; Hughes, Russell; Brown, Nicola J; Holen, Ingunn

    2015-12-01

    Bone metastasis remains incurable with treatment restricted to palliative care. Cabozantinib (CBZ) is targeted against multiple receptor tyrosine kinases involved in tumour pathobiology, including hepatocyte growth factor receptor (MET) and vascular endothelial growth factor receptor 2 (VEGFR-2). CBZ has demonstrated clinical activity in advanced prostate cancer with resolution of lesions visible on bone scans, implicating a potential role of the bone microenvironment as a mediator of CBZ effects. We characterised the effects of short-term administration of CBZ on bone in a range of in vivo models to determine how CBZ affects bone in the absence of tumour. Studies were performed in a variety of in vivo models including male and female BALB/c nude mice (age 6-17-weeks). Animals received CBZ (30 mg/kg, 5× weekly) or sterile H2O control for 5 or 10 days. Effects on bone integrity (μCT), bone cell activity (PINP, TRAP ELISA), osteoblast and osteoclast number/mm trabecular bone surface, area of epiphyseal growth plate cartilage, megakaryocyte numbers and bone marrow composition were assessed. Effects of longer-term treatment (15-day & 6-week administration) were assessed in male NOD/SCID and beige SCID mice. CBZ treatment had significant effects on the bone microenvironment, including reduced osteoclast and increased osteoblast numbers compared to control. Trabecular bone structure was altered after 8 administrations. A significant elongation of the epiphyseal growth plate, in particular the hypertrophic chondrocyte zone, was observed in all CBZ treated animals irrespective of administration schedule. Both male and female BALB/c nude mice had increased megakaryocyte numbers/mm(2) tissue after 10-day CBZ treatment, in addition to vascular ectasia, reduced bone marrow cellularity and extravasation of red blood cells into the extra-vascular bone marrow. All CBZ-induced effects were transient and rapidly lost following cessation of treatment. Short-term administration of CBZ induces rapid, reversible effects on the bone microenvironment in vivo highlighting a potential role in mediating treatment responses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Tumor-stroma interactions a trademark for metastasis.

    PubMed

    Morales, Monica; Planet, Evarist; Arnal-Estape, Anna; Pavlovic, Milica; Tarragona, Maria; Gomis, Roger R

    2011-10-01

    We aimed to unravel genes that are significantly associated with metastasis in order to identify functions that support disseminated disease. We identify genes associated with metastasis and verify its clinical correlations using publicly available primary tumor expression profile data sets. We used facilities in R and Bioconductor (GSEA). Specific data structures and functions were imported. Our results show that genes associated with metastasis in primary tumor enriched for pathways associated with immune infiltration or cytokine-cytokine receptor interaction. As an example, we focus on the enrichment of TGFBR2 and TGF|X A set of communication tools capital for tumor-stroma interactions that define metastasis to the lung and support bone colonization. We showed that tumor-stroma communication through cytokine-cytokine receptor interaction pathway is selected in primary tumors with high risk of relapse. High levels of these factors support systemic instigation of the far metastatic nest as well as local metastatic-specific functions that provide solid ground for metastatic development. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. The seed and soil hypothesis revisited - the role of tumor-stroma interactions in metastasis to different organs

    PubMed Central

    Langley, Robert R.; Fidler, Isaiah J.

    2011-01-01

    The fact that certain tumors exhibit a predilection for metastasis to specific organs has been recognized for well over a century now. An extensive body of clinical data and experimental research has confirmed Stephen Paget's original “seed and soil” hypothesis that proposed the organ-preference patterns of tumor metastasis are the product of favorable interactions between metastatic tumor cells (the “seed”) and their organ microenvironment (the “soil”). Indeed, many of first-line therapeutic regimens currently in use for the treatment of human cancer are designed to target cancer cells (such as chemotherapy) and also to modulate the tumor microenvironment (such as anti-angiogenic therapy). While some types of tumors are capable of forming metastases in virtually every organ in the body, the most frequent target organs of metastasis are bone, brain, liver, and the lung. In this review, we discuss how tumor-stromal interactions influence metastasis in each of these organs. PMID:21365651

  12. Single inhalation exposure to /sup 90/SrCl/sub 2/ in the beagle dog: late biological effects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gillett, N.A.; Muggenburg, B.A.; Boecker, B.B.

    1987-08-01

    Late-occurring biologic effects were studied in beagle dogs that were given graded levels of /sup 90/SrCl/sub 2/ via single brief inhalation exposures and were subsequently observed for their life-span. Due to the soluble chemical form of the aerosol, /sup 90/Sr was rapidly translocated from lung and deposited in bone where it was subsequently retained for a long period of time. Radiation-induced lesions were confined to the bone, bone marrow, and adjacent soft tissue. Forty-five primary bone tumors occurred in 31 of 66 exposed dogs. Metastasis occurred from 21 tumors, with the lung being the most frequent site of metastasis (76%).more » Twenty-seven tumors were classified as different subtypes of osteosarcoma, 14 as hemangiosarcomas, 3 as fibrosarcomas, and 1 as a myxosarcoma. Four carcinomas arising from soft tissues adjacent to bone were also considered to be /sup 90/Sr induced. In contrast to bone tumors arising in beagles chronically exposed to 90Sr through ingestion, histologic lesions of radiation osteodystrophy were minimal in this study, indicating that these lesions are not a necessary precursor of osteosarcoma development. The incidences of hemangiosarcomas (31%) and telangiectatic osteosarcomas (11%) in addition to osteosarcomas suggest that the cell of origin for all of these neoplasms is a multipotent mesenchymal cell with the potential for various morphologic expressions dependent on local environmental factors.« less

  13. Anti-rheumatic drug iguratimod (T-614) alleviates cancer-induced bone destruction via down-regulating interleukin-6 production in a nuclear factor-κB-dependent manner.

    PubMed

    Sun, Yue; Ye, Da-Wei; Zhang, Peng; Wu, Ying-Xing; Wang, Bang-Yan; Peng, Guang; Yu, Shi-Ying

    2016-10-01

    Cytokines are believed to be involved in a "vicious circle" of progressive interactions in bone metastasis. Iguratimod is a novel anti-rheumatic drug which is reported to have the capability of anti-cytokines. In this study, a rat model was constructed to investigate the effect of iguratimod on bone metastasis and it was found that iguratimod alleviated cancer-induced bone destruction. To further explore whether an anti-tumor activity of iguratimod contributes to the effect of bone resorption suppression, two human breast cancer cell lines MDA-MB-231 and MCF-7 were studied. The effect of iguratimod on tumor proliferation was detected by CCK-8 assay and flow cytometry. The effects of iguratimod on migration and invasion of cancer cells were determined by wound-healing and Transwell assays. Results showed that high dose (30 μg/mL) iguratimod slightly suppressed the proliferation of cancer cells but failed to inhibit their migration and invasion capacity. Interestingly, iguratimod decreased the transcription level of IL-6 in MDA-MB-231 cells in a concentration-dependent manner. Moreover, iguratimod partially impaired NF-κB signaling by suppressing the phosphorylation of NF-κB p65 subunit. Our findings indicated that iguratimod may alleviate bone destruction by partially decreasing the expression of IL-6 in an NF-κB-dependent manner, while it has little effect on the tumor proliferation and invasion.

  14. Lung inflammation promotes metastasis through neutrophil protease-mediated degradation of Tsp-1

    PubMed Central

    El Rayes, Tina; Catena, Raúl; Lee, Sharrell; Stawowczyk, Marcin; Joshi, Natasha; Fischbach, Claudia; Powell, Charles A.; Dannenberg, Andrew J.; Altorki, Nasser K.; Gao, Dingcheng; Mittal, Vivek

    2015-01-01

    Inflammation is inextricably associated with primary tumor progression. However, the contribution of inflammation to tumor outgrowth in metastatic organs has remained underexplored. Here, we show that extrinsic inflammation in the lungs leads to the recruitment of bone marrow-derived neutrophils, which degranulate azurophilic granules to release the Ser proteases, elastase and cathepsin G, resulting in the proteolytic destruction of the antitumorigenic factor thrombospondin-1 (Tsp-1). Genetic ablation of these neutrophil proteases protected Tsp-1 from degradation and suppressed lung metastasis. These results provide mechanistic insights into the contribution of inflammatory neutrophils to metastasis and highlight the unique neutrophil protease–Tsp-1 axis as a potential antimetastatic therapeutic target. PMID:26668367

  15. Colorectal breast carcinoma metastasis diagnosed as an obstructive colonic primary tumor. A case report and review of the literature.

    PubMed

    Théraux, J; Bretagnol, F; Guedj, N; Cazals-Hatem, D; Panis, Y

    2009-12-01

    Common sites of colorectal breast carcinoma metastasis are bones, lungs, the central nervous system and the liver. Metastases in the gastrointestinal (GI) tract are rare and especially involve the stomach rather than the colon. Clinical or radiological features usually cannot differentiate them from a primary colorectal tumor, resulting in inappropriate treatment. In some cases, this lesion suggests multifocal spread of breast cancer with peritoneal carcinomatosis. Colorectal breast cancer metastasis is a rare finding and there is no consensus on the management of these lesions. The present case report describes a 69-year-old female with metastatic breast cancer presenting as an obstructive tumor of the transverse colon.

  16. Extraosseus uptake of F-18 fluoride in the primary malignancy and cerebral metastasis in a case of non-small-cell lung cancer.

    PubMed

    Li, Yuxin; Tafti, Bashir A; Shaba, Wisam; Berenji, Gholam R

    2011-07-01

    A 68-year-old man with history of heavy smoking was admitted for increasing falls during the past 4 weeks. Chest x-ray revealed a right upper lobe mass. Biopsy demonstrated poorly differentiated non-small-cell carcinoma. F-18 fluoride positron emission tomography/computer tomography (PET/CT) was performed to evaluate bone metastasis. Review of the sectional PET images demonstrated extraosseous fluoride uptake in the primary lung mass, as well as ring-shaped fluoride uptake in the cerebral metastatic lesion. Neither of these lesions demonstrated calcifications on CT images. The patient received radiation treatment of the brain metastasis after F-18 fluoride PET/CT study.

  17. Effects of a cloned cell line with NK activity on bone marrow transplants, tumour development and metastasis in vivo

    NASA Astrophysics Data System (ADS)

    Warner, John F.; Dennert, Gunther

    1982-11-01

    Natural killer (NK) cells cloned in vitro have been transferred into NK-deficient hosts. These cells have been shown to have a role in the rejection of allogeneic bone marrow grafts, resistance to both radiation-induced thymic leukaemia and challenge with melanoma tumour cells. It appears that NK cells have an important role in immune surveillance.

  18. Quality of Life After Palliative Radiation Therapy for Patients With Painful Bone Metastases: Results of an International Study Validating the EORTC QLQ-BM22

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zeng Liang; Chow, Edward, E-mail: edward.chow@sunnybrook.ca; Bedard, Gillian

    2012-11-01

    Purpose: Radiation therapy (RT) is an effective method of palliating painful bone metastases and can improve function and reduce analgesic requirements. In advanced cancer patients, quality of life (QOL) is the primary outcome of interest over traditional endpoints such as survival. The purpose of our study was to compare bone metastasis-specific QOL scores among patients who responded differently to palliative RT. Methods and Materials: Patients receiving RT for bone metastases across 6 countries were prospectively enrolled from March 2010-January 2011 in a trial validating the QLQ-BM22 and completed the QLQ-BM22 and the core measure (QLQ-C30) at baseline and after 1more » month. Pain scores and analgesic intake were recorded, and response to RT was determined according to the latest published guidelines. The Kruskal-Wallis nonparametric and Wilcoxon rank sum tests compared changes in QOL among response groups. A Bonferroni-adjusted P<.003 indicated statistical significance. Results: Of 79 patients who received palliative RT, 59 were assessable. Partial response, pain progression, and indeterminate response were observed in 22, 8, and 29 patients, respectively; there were no patients with a complete response. Patients across all groups had similar baseline QOL scores apart from physical functioning (patients who progressed had better initial functioning). One month after RT, patients who responded had significant improvements in 3 of 4 QLQ-BM22 domains (painful site, P<.0001; painful characteristic, P<.0001; and functional interference, P<.0001) and 3 QLQ-C30 domains (physical functioning, P=.0006; role functioning, P=.0026; and pain, P<.0001). Patients with progression in pain had significantly worse functional interference (P=.0007) and pain (P=.0019). Conclusions: Patients who report pain relief after palliative RT also have better QOL with respect to bone metastasis-specific issues. The QLQ-BM22 and QLQ-C30 are able to discriminate among patients with varying responses and are recommended for use in future bone metastasis clinical trials.« less

  19. Significant Prognostic Factors for Completely Resected pN2 Non-small Cell Lung Cancer without Neoadjuvant Therapy

    PubMed Central

    Nakao, Masayuki; Mun, Mingyon; Nakagawa, Ken; Nishio, Makoto; Ishikawa, Yuichi; Okumura, Sakae

    2015-01-01

    Purpose: To identify prognostic factors for pathologic N2 (pN2) non-small cell lung cancer (NSCLC) treated by surgical resection. Methods: Between 1990 and 2009, 287 patients with pN2 NSCLC underwent curative resection at the Cancer Institute Hospital without preoperative treatment. Results: The 5-year overall survival (OS), cancer-specific survival (CSS), and recurrence-free survival (RFS) rates were 46%, 55% and 24%, respectively. The median follow-up time was 80 months. Multivariate analysis identified four independent predictors for poor OS: multiple-zone mediastinal lymph node metastasis (hazard ratio [HR], 1.616; p = 0.003); ipsilateral intrapulmonary metastasis (HR, 1.042; p = 0.002); tumor size >30 mm (HR, 1.013; p = 0.002); and clinical stage N1 or N2 (HR, 1.051; p = 0.030). Multivariate analysis identified three independent predictors for poor RFS: multiple-zone mediastinal lymph node metastasis (HR, 1.457; p = 0.011); ipsilateral intrapulmonary metastasis (HR, 1.040; p = 0.002); and tumor size >30 mm (HR, 1.008; p = 0.032). Conclusion: Multiple-zone mediastinal lymph node metastasis, ipsilateral intrapulmonary metastasis, and tumor size >30 mm were common independent prognostic factors of OS, CSS, and RFS in pN2 NSCLC. PMID:25740454

  20. Applications of transgenics in studies of bone sialoprotein.

    PubMed

    Zhang, Jin; Tu, Qisheng; Chen, Jake

    2009-07-01

    Bone sialoprotein (BSP) is a major non-collagenous protein in mineralizing connective tissues such as dentin, cementum and calcified cartilage tissues. As a member of the Small Integrin-Binding Ligand, N-linked Glycoprotein (SIBLING) gene family of glycoproteins, BSP is involved in regulating hydroxyapatite crystal formation in bones and teeth, and has long been used as a marker gene for osteogenic differentiation. In the most recent decade, new discoveries in BSP gene expression and regulation, bone remodeling, bone metastasis, and bone tissue engineering have been achieved with the help of transgenic mice. In this review, we discuss these new discoveries obtained from the literatures and from our own laboratory, which were derived from the use of transgenic mouse mutants related to BSP gene or its promoter activity.

  1. Biomechanical effects of metastasis in the osteoporotic lumbar spine: A Finite Element Analysis.

    PubMed

    Salvatore, Giuseppe; Berton, Alessandra; Giambini, Hugo; Ciuffreda, Mauro; Florio, Pino; Longo, Umile Giuseppe; Denaro, Vincenzo; Thoreson, Andrew; An, Kai-Nan

    2018-02-05

    Cancer patients are likely to undergo osteoporosis as consequence of hormone manipulation and/or chemotherapy. Little is known about possible increased risk of fracture in this population. The aim of this study was to describe the biomechanical effect of a metastatic lesion in an osteoporotic lumbar spine model. A finite element model of two spinal motion segments (L3-L5) was extracted from a previously developed L3-Sacrum model and used to analyze the effect of metastasis size and bone mineral density (BMD) on Vertebral bulge (VB) and Vertebral height (VH). VB and VH represent respectively radial and axial displacement and they have been correlated to burst fracture. A total of 6 scenarios were evaluated combining three metastasis sizes (no metastasis, 15% and 30% of the vertebral body) and two BMD conditions (normal BMD and osteoporosis). 15% metastasis increased VB and VH by 178% and 248%, respectively in normal BMD model; while VB and VH increased by 134% and 174% in osteoporotic model. 30% metastasis increased VB and VH by 88% and 109%, respectively, when compared to 15% metastasis in normal BMD model; while VB and VH increased by 59% and 74% in osteoporotic model. A metastasis in the osteoporotic lumbar spine always leads to a higher risk of vertebral fracture. This risk increases with the size of the metastasis. Unexpectedly, an increment in metastasis size in the normal BMD spine produces a greater impact on vertebral stability compared to the osteoporotic spine.

  2. Clinicopathologic risk factors for right paraesophageal lymph node metastasis in patients with papillary thyroid carcinoma.

    PubMed

    Yu, Q A; Ma, D K; Liu, K P; Wang, P; Xie, C M; Wu, Y H; Dai, W J; Jiang, H C

    2018-03-17

    To investigate risk factors associated with right paraesophageal lymph node (RPELN) metastasis in patients with papillary thyroid carcinoma (PTC) and to determine the indications for right lymph node dissection. Clinicopathologic data from 829 patients (104 men and 725 women) with PTC, operated on by the same thyroid surgery team at the First Affiliated Hospital of Harbin Medical University from January 2013 to May 2017, were analyzed. Overall, 309 patients underwent total thyroidectomy with bilateral lymph node dissection, 488 underwent right thyroid lobe and isthmic resection with right central compartment lymph node dissection, and 32 underwent near-total thyroidectomy (ipsilateral thyroid lobectomy with contralateral near-total lobectomy) with bilateral lymph node dissection. The overall rate of central compartment lymph node metastasis was 43.5% (361/829), with right central compartment lymph node and RPELN metastasis rates of 35.5% (294/829) and 19.1% (158/829), respectively. Tumor size, number, invasion, and location, lymph node metastasis, right central compartment lymph node metastasis, and right lateral compartment lymph node metastasis were associated with RPELN in the univariate analysis, whereas age and sex were not. Multivariate analysis identified tumors with a diameter ≥ 1 cm, multiple tumors, tumors located in the right lobe, right central compartment lymph node metastasis, and right lateral compartment lymph node metastasis as independent risk factors for RPELN metastasis. Lymph node dissection, including RPELN dissection, should be performed for patients with PTC with a tumor diameter ≥ 1 cm, multiple tumors, right-lobe tumors, right central compartment lymph node metastasis, or suspected lateral compartment lymph node metastasis.

  3. Combining Src inhibitors and aromatase inhibitors: a novel strategy for overcoming endocrine resistance and bone loss.

    PubMed

    Hiscox, Stephen; Barrett-Lee, Peter; Borley, Annabel C; Nicholson, Robert I

    2010-08-01

    Aromatase inhibitors have largely replaced tamoxifen as the first-line treatment for postmenopausal women with metastatic, hormone receptor-positive (HR+) breast cancer. However, many patients develop clinical resistance with prolonged treatment, and oestrogen deprivation following aromatase inhibition can result in loss of bone mineral density. Furthermore, most patients with metastatic breast cancer develop bone metastases, and the resulting adverse skeletal-related events are a significant cause of patient morbidity. Src, a non-receptor tyrosine kinase, is a component of signalling pathways that regulate breast cancer cell proliferation, invasion and metastasis as well as osteoclast-mediated bone turnover. Preclinical evidence also suggests a role for Src in acquired endocrine resistance. As such, Src inhibition represents a logical strategy for the treatment of metastatic breast cancer. In vitro, combination therapy with Src inhibitors and endocrine agents, including aromatase inhibitors, has been shown to inhibit the proliferation and metastasis of both endocrine-responsive and endocrine-resistant breast cancer cell lines more effectively than either of the therapy alone. Src inhibition has also been shown to suppress osteoclast formation and activity. Combination therapy with aromatase inhibitors and Src inhibitors therefore represents a novel approach through which the development of both acquired resistance and bone pathology could be delayed. Data from clinical trials utilising such combinations will reveal if this strategy has the potential to improve patient outcomes. Copyright 2010 Elsevier Ltd. All rights reserved.

  4. Postradiation atrophy of mature bone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ergun, H.; Howland, W.J.

    1980-01-01

    The primary event of radiation damage to bone is atrophy and true necrosis of bone is uncommon. The postradiation atrophic changes of bone are the result of combined cellular and vascular damage, the former being more important. The damage to the osteoblast resulting in decreased matrix production is apparently the primary histopathologic event. Radiation damaged bone is susceptible to superimposed complications of fracture, infection, necrosis, and sarcoma. The primary radiographic evidence of atrophy, localized osteopenia, is late in appearing. Contrary to former views, the mature bone is quite radiosensitive and reacts quickly to even small doses of radiation. The differentiationmore » of postirradiation atrophy and metastasis may be difficult. Biopsy should be the last resort because of the possibility of causing true necrosis in atrophic bone by trauma and infection.« less

  5. Quantification of osteolytic bone lesions in a preclinical rat trial

    NASA Astrophysics Data System (ADS)

    Fränzle, Andrea; Bretschi, Maren; Bäuerle, Tobias; Giske, Kristina; Hillengass, Jens; Bendl, Rolf

    2013-10-01

    In breast cancer, most of the patients who died, have developed bone metastasis as disease progression. Bone metastases in case of breast cancer are mainly bone destructive (osteolytic). To understand pathogenesis and to analyse response to different treatments, animal models, in our case rats, are examined. For assessment of treatment response to bone remodelling therapies exact segmentations of osteolytic lesions are needed. Manual segmentations are not only time-consuming but lack in reproducibility. Computerized segmentation tools are essential. In this paper we present an approach for the computerized quantification of osteolytic lesion volumes using a comparison to a healthy reference model. The presented qualitative and quantitative evaluation of the reconstructed bone volumes show, that the automatically segmented lesion volumes complete missing bone in a reasonable way.

  6. Retrospective analysis of an oral combination of dexamethasone, uracil plus tegafur and cyclophosphamide for hormone-refractory prostate cancer.

    PubMed

    Hatano, Koji; Nonomura, Norio; Nishimura, Kazuo; Kawashima, Atsunari; Mukai, Masatoshi; Nagahara, Akira; Nakai, Yasutomo; Nakayama, Masashi; Takayama, Hitoshi; Tsujimura, Akira; Okuyama, Akihiko

    2011-02-01

    To evaluate the clinical utility of an oral combination of dexamethasone, uracil plus tegafur and cyclophosphamide as a treatment for patients with hormone-refractory prostate cancer. Fifty-seven patients with hormone-refractory prostate cancer were treated with an oral administration of dexamethasone (1.0 mg/day), uracil plus tegafur (400 mg/day) and cyclophosphamide (100 mg/day). The median patient age was 71 years. Sixteen patients had symptomatic bone metastasis, 31 had asymptomatic bone metastasis and 8 showed lymph node metastasis. Eight patients presented with only biochemical progression as evaluated by serum prostate-specific antigen levels. Thirty-six (63%) of 57 patients demonstrated a ≥50% decline in serum prostate-specific antigen levels. The median time to prostate-specific antigen progression was 7.2 months. In patients with a prostate-specific antigen decline of ≥50%, the median time to progression was 13.3 months. With respect to pre-treatment markers, the duration of response to initial hormonal treatment was associated with the time to prostate-specific antigen progression. In 11 of 16 (69%) patients who complained of bone pain, the pain improved and became stable in 5 of those patients (31%). Most adverse events were mild and only three (5%) patients showed neutropenia of Grade 3 or higher. The combination of dexamethasone, uracil plus tegafur and cyclophosphamide is an effective and well tolerated regimen for hormone-refractory prostate cancer. To evaluate the survival benefits, further randomized studies are required.

  7. Dusp3 deletion in mice promotes experimental lung tumour metastasis in a macrophage dependent manner

    PubMed Central

    Vandereyken, Maud; Jacques, Sophie; Van Overmeire, Eva; Amand, Mathieu; Rocks, Natacha; Delierneux, Céline; Singh, Pratibha; Singh, Maneesh; Ghuysen, Camille; Wathieu, Caroline; Zurashvili, Tinatin; Sounni, Nor Eddine; Moutschen, Michel; Gilles, Christine; Oury, Cécile; Cataldo, Didier; Van Ginderachter, Jo A.

    2017-01-01

    Vaccinia-H1 Related (VHR) dual-specificity phosphatase, or DUSP3, plays an important role in cell cycle regulation and its expression is altered in several human cancers. In mouse model, DUSP3 deletion prevents neo-angiogenesis and b-FGF-induced microvessel outgrowth. Considering the importance of angiogenesis in metastasis formation, our study aimed to investigate the role of DUSP3 in tumour cell dissemination. Using a Lewis Lung carcinoma (LLC) experimental metastasis model, we observed that DUSP3-/- mice developed larger lung metastases than littermate controls. DUSP3-/- bone marrow transfer to lethally irradiated DUSP3+/+ mice was sufficient to transfer the phenotype to DUSP3+/+ mice, indicating that hematopoietic cells compartment was involved in the increased tumour cell dissemination to lung tissues. Interestingly, we found a higher percentage of tumour-promoting Ly6Cint macrophages in DUSP3-/- LLC-bearing lung homogenates that was at least partially due to a better recruitment of these cells. This was confirmed by 1) the presence of higher number of the Ly6Bhi macrophages in DUSP3-/- lung homogenates and by 2) the better migration of DUSP3-/- bone marrow sorted monocytes, peritoneal macrophages and bone marrow derived macrophages (BMDMs), compared to DUSP3+/+ monocytes, macrophages and BMDMs, in response to LLC-conditioned medium. Our study demonstrates that DUSP3 phosphatase plays a key role in metastatic growth through a mechanism involving the recruitment of macrophages towards LLC-bearing lungs. PMID:29020102

  8. Molecular Imaging with Quantum Dots Probing EMT and Prostate Cancer Metastasis in Live Animals

    DTIC Science & Technology

    2006-10-01

    Grignon DJ, Cher ML. Severe combined immunodeficient-humodel of humanprostate cancer metastasis to human bone. Cancer Res 1999;59(8): 1987 – 1993. 14... Eisler , H. J., and Bawendi, M. (2003) Type-II quantum dots: CdTe/CdSe(core/shell) and CdSe/ZinTe(core/shell) heterostructures. J. Am. Chem. Soc. 125...S1044. 39. Cunha GR, Donjacour AA, Cooke PS, et al. The endocrinology and developmen- tal biology of the prostate. Endocr Rev 1987 ; 8:338-362. 40

  9. The LOX Invasion: Stopping the Spread of Breast Cancer | Center for Cancer Research

    Cancer.gov

    Metastasis is the primary cause of death in breast cancer patients. In 10% of breast cancer diagnoses, the cancer has already spread to distant organs in the body. Although breast cancer has the potential to spread to almost any region of the body, the most common is the bone, followed by the lung and liver. Understanding the mechanisms for breast cancer invasion and metastasis is therefore vital for designing new therapies to prevent the spread of the disease.

  10. Predictors of metastasis to lymph nodes posterior to the right recurrent laryngeal nerve in differentiated thyroid carcinoma: A prospective study.

    PubMed

    Liu, Ziwen; Sun, Mengqing; Xiao, Yiding; Yang, Jing; Zhang, Taiping; Zhao, Yupei

    2017-07-01

    To study the clinicopathological characteristics and the risk factors of lymph nodes posterior to the right recurrent laryngeal nerve (LN-prRLN) metastasis in differentiated thyroid carcinoma; and to identify the indication for LN-prRLN dissection. We treated 145 patients with differentiated thyroid carcinoma with appropriate surgical intervention. The specimens were examined by the pathologists. The right paratracheal lymph nodes were divided into two groups: anterior or posterior to right recurrent laryngeal nerve (VIa or VIp compartment, respectively). We recorded the clinical characteristics, histopathological features of the primary tumors, and lymph node metastasis of the patients. The results were statistically analyzed. There were 85 patients (58.6%) with central lymph node metastasis, of whom 61 (42.1%) had metastasis in VIa compartment; 16 patients (11.0%) had VIp subdistrict metastasis; and 25 patients had lateral lymph node metastasis. Multiplicity, larger tumor (≥1 cm), and coexistence of central lymph node metastasis, VIa compartment metastasis, and lateral lymph node metastasis were all significantly related with LN-prRLN metastasis, while sex, age, location of the tumor, and extrathyroid extension of the tumor showed no significant relation (p > 0.05). The incidence of LN-prRLN metastasis was lower than other central lymph nodes, as well as lymph nodes anterior to right recurrent laryngeal nerve. When there were multiple foci of tumors, or the tumor was larger than 1 cm, or central or lateral LN metastasis was indicated by preoperative ultrasound or confirmed by intraoperative frozen sections, it is strongly recommended that exploration and dissection of the LN-prRLN should only be performed by experienced surgeons. Copyright © 2016. Published by Elsevier Taiwan.

  11. The role of biochemical of bone turnover markers in osteoporosis and metabolic bone disease: a consensus paper of the Belgian Bone Club.

    PubMed

    Cavalier, E; Bergmann, P; Bruyère, O; Delanaye, P; Durnez, A; Devogelaer, J-P; Ferrari, S L; Gielen, E; Goemaere, S; Kaufman, J-M; Toukap, A Nzeusseu; Reginster, J-Y; Rousseau, A-F; Rozenberg, S; Scheen, A J; Body, J-J

    2016-07-01

    The exact role of biochemical markers of bone turnover in the management of metabolic bone diseases remains a topic of controversy. In this consensus paper, the Belgian Bone Club aimed to provide a state of the art on the use of these biomarkers in different clinical or physiological situations like in postmenopausal women, osteoporosis in men, in elderly patients, in patients suffering from bone metastasis, in patients with chronic renal failure, in pregnant or lactating women, in intensive care patients, and in diabetics. We also gave our considerations on the analytical issues linked to the use of these biomarkers, on potential new emerging biomarkers, and on the use of bone turnover biomarkers in the follow-up of patients treated with new drugs for osteoporosis.

  12. Loss of miR-100 enhances migration, invasion, epithelial-mesenchymal transition and stemness properties in prostate cancer cells through targeting Argonaute 2.

    PubMed

    Wang, Min; Ren, Dong; Guo, Wei; Wang, Zeyu; Huang, Shuai; Du, Hong; Song, Libing; Peng, Xinsheng

    2014-07-01

    Evidence in literature has demonstrated that some microRNAs (miRNAs) play a pivotal role in most solid tumor metastasis. Previous studies have showed that miR-100 is downregulated in human prostate cancer tissue compared to normal prostate and also significantly decreased in bone metastatic prostate cancer samples compared with primary prostate cancer. Argonaute 2 (AGO2) is the core effector protein of the miRNA-induced silencing complex and overexpression of AGO2 might enhance tumor metastasis. However, it is unknown whether and how miR-100 and AGO2 regulates metastasis of prostate cancer. Here, we report that miR-100 negatively regulated migration, invasion, epithelial-mesenchymal transition (EMT), colony formation, spheroid formation and expression of the stemness factors c-Myc, Oct4 and Klf4 in PC-3 and DU145 cells. Furthermore, miR-100 expression was negatively correlated with bone metastasis of prostate cancer patients. Notably, luciferase assay showed that AGO2 was a direct target of miR-100. Downregulation of AGO2 repressed migration, invasion, EMT and stemness of prostate cancer cells, and reversed the effects seen with miR-100 downregulation. Downregulation of AGO2 enhanced expression of miR-34a and miR-125b which can suppress migration, invasion, EMT and stemness of cancer cells. Taken together, our findings indicate that loss of miR-100 promotes the metastatic ability of prostate cancer cells at least partially by upregulating AGO2 expression through modulating migration, invasion, EMT and stemness of cancer cells, and suggest that miR-100/AGO2 may play an important role in regulating the metastasis of prostate cancer and is a potential target of prevention and therapy.

  13. [Small bowel metastasis from breast cancer: a case report].

    PubMed

    Jo, Don Hyoun; Cheung, Dae Young; Kim, Hyung Keun; Son, Dong Kyun; Chung, Ji Sung; Kim, Jin Il; Park, Soo Heon; Han, Joon Yeol; Kim, Jae Kwang; Chung, Kyu Won

    2005-08-01

    Breast cancer is a common malignancy in women and frequently metastasizes to various organs such as liver, lung, brain, bone and so on. But metastasis to gastrointestinal tract is rare. We describe a 73-year-old woman with small intestinal metastasis of breast cancer. She was diagnosed as right breast cancer in stage I, received modified radical mastectomy 6 years ago and had been followed up without any evidence of residual disease. During investigation for lower abdominal pain and weight loss of 9 kg, we found a small bowel mass. The histology of the tissue taken from small bowel mass was adenocarcinoma, poorly differentiated. The immunohistochemical stain of this specimen showed 75% positivity of estrogen receptor and 90% positivity of progesterone receptor. This is a case of small bowel metastasis from breast cancer and we report this case with a review of literatures.

  14. Metastatic bone lesion due to methotrexate and etanercept 24 years after breast cancer treatment

    PubMed Central

    Yano, Shuichi

    2014-01-01

    A 72-year-old woman with rheumatoid arthritis presented with lumbar vertebral bone metastasis 24 years after mammectomy and radiotherapy for breast cancer. She was treated with prednisolone and methotrexate (MTX) for 11 months to which 10 mg of etanercept twice a week was added for a further 8 months. On the basis of this result, the possibility of a metastatic bone lesion appearing many years after cancer treatment should be considered when planning MTX and etanercept therapy. PMID:24729113

  15. Relation between primary tumor FDG avidity and site of first distant metastasis in patients with breast cancer.

    PubMed

    Lim, Chae Hong; Moon, Seung Hwan; Cho, Young Seok; Im, Young-Hyuck; Choe, Yearn Seong; Kim, Byung-Tae; Lee, Kyung-Han

    2016-08-01

    Identification of tumor imaging features associated with metastatic pattern may allow better understanding of cancer dissemination. Here, we investigated how primary tumor F-fluorodeoxyglucose (FDG) avidity influences the first site of breast cancer metastasis.Subjects were 264 patients with advanced breast cancer who underwent positron emission tomography/computed tomography at diagnosis and had metastasis at presentation (n = 193) or metastatic relapse after surgery (n = 71). Primary tumor FDG avidity (maximum SUV [SUVmax] ≥10.1) was compared with histology and first metastatic sites.The most common site of first metastasis was the bone, occurring in 62.7% of patients with metastasis at presentation and 38.0% of those with metastatic relapse. First metastasis to lung occurred in 30.1% and 35.2%, and to liver in 25.4% and 15.2% of respective groups. In patients with metastasis at presentation, primary tumors were FDG avid in 98/193 cases, and this was associated with more frequent first metastasis to lung (37.8% vs 22.1%; P = 0.018). In patients with metastasis relapse, primary tumors were FDG avid in 31/71 cases, and this was associated with more frequent first metastasis to lung (48.4% vs 25.0%; P = 0.041) and liver (29.0% vs 5.0%; P = 0.008). In patients with metastasis relapse, primary tumors that were FDG avid but hormone receptor negative had more first metastasis to lung (57.9% vs 26.9%; P = 0.016).FDG-avid primary breast tumors have favored first spread to the lung and liver, which suggests that tumor cells with heightened glycolytic activity better colonize these organs.

  16. Novel 3D Tissue Engineered Bone Model, Biomimetic Nanomaterials, and Cold Atmospheric Plasma Technique for Biomedical Applications

    NASA Astrophysics Data System (ADS)

    Wang, Mian

    This thesis research is consist of four chapters, including biomimetic three-dimensional tissue engineered nanostructured bone model for breast cancer bone metastasis study (Chapter one), cold atmospheric plasma for selectively ablating metastatic breast cancer (Chapter two), design of biomimetic and bioactive cold plasma modified nanostructured scaffolds for enhanced osteogenic differentiation of bone marrow derived mesenchymal stem cells (Chapter three), and enhanced osteoblast and mesenchymal stem cell functions on titanium with hydrothermally treated nanocrystalline hydroxyapatite/magnetically treated carbon nanotubes for orthopedic applications (Chapter four). All the thesis research is focused on nanomaterials and the use of cold plasma technique for various biomedical applications.

  17. Macrophage Efferocytosis and Prostate Cancer Bone Metastasis

    DTIC Science & Technology

    2016-10-01

    mediator of prostate cancer tumor growth. Specifically, phagocytic macrophages and efferocytosis were found to be upregulated in the blood of...patients with metastatic prostate cancer. Moreover, inhibiting phagocytic macrophages with the chemotherapeutic trabectedin reduced efferocytosis and

  18. Effect of number and location of distant metastases on renal cell carcinoma mortality in candidates for cytoreductive nephrectomy: implications for multimodal therapy.

    PubMed

    Capitanio, Umberto; Abdollah, Firas; Matloob, Rayan; Salonia, Andrea; Suardi, Nazareno; Briganti, Alberto; Carenzi, Cristina; Rigatti, Patrizio; Montorsi, Francesco; Bertini, Roberto

    2013-06-01

    To test whether the combination of number and location of distant metastases affects cancer-specific survival in patients with metastatic renal cell carcinoma. Overall, 242 metastatic renal cell carcinoma patients with synchronous metastases at diagnosis underwent cytoreductive nephrectomy at a single institution. Combinations of number and location of distant metastases were coded as: single metastasis and single organ affected, multiple metastases and single organ affected, single metastasis for each of the multiple organs affected, and multiple metastases for each of the multiple organs affected. Covariates included age, symptoms, performance status, American Society of Anesthesiologists score, hemoglobin, lactate dehydrogenase, tumor size, Fuhrman grade, T stage, lymph node status, necrosis, sarcomatoid features and metastasectomy at the time of nephrectomy. The median survival was 34.7 versus 32.3 versus 29.6 versus 8.5 months for single metastasis and single organ affected, multiple metastases and single organ affected single metastasis for each of the multiple organs affected, and multiple metastases for each of the multiple organs affected patients, respectively. At multivariable analyses, the combination of number and location of distant metastases resulted in one of the most informative and independent predictors of cancer-specific survival in metastatic renal cell carcinoma patients. The lung was the location with the highest rate of single organ affected (50.3% vs 35.1% in other sites; P < 0.001). Considering only patients with a single metastasis, no statistically significantly different cancer-specific survival rates were recorded (P > 0.3) among different metastatic organs. Among metastatic renal cell carcinoma patients undergoing cytoreductive nephrectomy, the combination of the number and location of distant metastases is a major independent predictor of cancer-specific survival. Patients with multiple organs affected by multifocal disease are more likely to have poorer survival. © 2012 The Japanese Urological Association.

  19. Bisphosphonates and osteonecrosis of the jaw.

    PubMed

    Shannon, Jodi; Shannon, John; Modelevsky, Steven; Grippo, Anne A

    2011-12-01

    Bisphosphonates are used worldwide as a successful treatment for people with osteoporosis, which is the major underlying cause of fractures in postmenopausal women and older adults. These agents are successful at increasing bone mass and bone trabecular thickness, decreasing the risk of fracture, and decreasing bone pain, enabling individuals to have better quality of life. Bisphosphonates are also used to treat multiple myeloma, bone metastasis, and Paget's disease; however, bisphosphonate treatment may result in negative side effects, including osteonecrosis of the jaw (ONJ). ONJ involves necrotic, exposed bone in the jaw, pain, possible secondary infection, swelling, painful lesions, and various dysesthesias, although less-severe cases may be asymptomatic. First-generation bisphosphonates, which do not contain nitrogen, are metabolized into a nonfunctional, cytotoxic analogue of adenosine triphosphate and cause osteoclast death by starvation. Second-generation bisphosphonates are nitrogen-containing agents; these inhibit osteoclast vesicular trafficking, membrane ruffling, morphology, and cytoskeletal arrangement by inhibiting farnesyl diphosphate synthase in the mevalonate pathway. Physicians treating older adults with osteoporosis and cancer should work together with dental practitioners, pharmacists, and other clinicians to inform individuals receiving bisphosphonates of their possible side effects and to suggest precautionary steps that may minimize the risk of osteonecrosis, particularly of the jaw. These include practicing good oral hygiene; scheduling regular dental examinations and cleanings; and cautioning people who are scheduling treatment for periodontal disease, oral and maxillofacial therapy, endodontics, implant placement, restorative dentistry, and prosthodontics. Recommendations for management of people with ONJ include an oral rinse, such as chlorhexidine, and antibiotics. © 2011, Copyright the Authors Journal compilation © 2011, The American Geriatrics Society.

  20. A Novel Immune-Intact Mouse Model of Prostate Cancer Bone Metastasis: Mechanisms of Chemotaxis and Bone Colonization

    DTIC Science & Technology

    2017-10-01

    Colonization PRINCIPAL INVESTIGATOR: Srinivas Nandana CONTRACTING ORGANIZATION: Cedars-Sinai Medical Center Los Angeles, CA, 90048 REPORT DATE...8. PERFORMING ORGANIZATION REPORT NUMBER Cedars-Sinai Medical Center, 8700 Beverly Blvd, Los Angeles, CA, 90048 9. SPONSORING / MONITORING...Revised Statement of Work (SOW): PROPOSED START DATE Sep 30, 2016 ACTUAL START DATE – Sep 18, 2017 Site: Uro -Oncology, Dept of Medicine

  1. Primary Occipital Ewing's Sarcoma with Subsequent Spinal Seeding.

    PubMed

    Alqahtani, Ali; Amer, Roaa; Bakhsh, Eman

    2017-01-01

    Ewing's sarcoma is a primary bone cancer that mainly affects the long bones. This malignancy is particularly common in pediatric patients. Primary cranial involvement accounts for 1% of cases, with occipital involvement considered extremely rare. In this case study, primary occipital Ewing's sarcoma with a posterior fossa mass and subsequent relapse resulting in spinal seeding is reported. A 3-year-old patient presented with a 1-year history of left-sided headaches, localized over the occipital bone with progressive torticollis. Computed tomography (CT) imaging showed a mass in the left posterior fossa compressing the brainstem. The patient then underwent surgical excision followed by adjuvant chemoradiation therapy. Two years later, the patient presented with severe lower back pain and urinary incontinence. Whole-spine magnetic resonance imaging (MRI) showed cerebrospinal fluid (CSF) seeding from the L5 to the S4 vertebrae. Primary cranial Ewing's sarcoma is considered in the differential diagnosis of children with extra-axial posterior fossa mass associated with destructive permeative bone lesions. Although primary cranial Ewing's sarcoma typically has good prognosis, our patient developed metastasis in the lower spine. Therefore, with CNS Ewing's sarcoma, screening of the entire neural axis should be taken into consideration for early detection of CSF seeding metastasis in order to decrease the associated morbidity and mortality.

  2. Genetically fluorescent melanoma bone and organ metastasis models.

    PubMed

    Yang, M; Jiang, P; An, Z; Baranov, E; Li, L; Hasegawa, S; Al-Tuwaijri, M; Chishima, T; Shimada, H; Moossa, A R; Hoffman, R M

    1999-11-01

    We report here the establishment and metastatic properties of bright, highly stable, green fluorescent protein (GFP) expression transductants of the B16 mouse malignant melanoma cell line and the LOX human melanoma line. The highly fluorescent malignant melanoma cell lines allowed the visualization of skeletal and multiorgan metastases after i.v. injection of B16 cells in C57BL/6 mice and intradermal injection of LOX cells in nude mice. The melanoma cell lines were transduced with the pLEIN expression retroviral vector containing the GFP and neomycin resistance genes. Stable B16F0 and LOX clones expressing high levels of GFP were selected stepwise in vitro in levels of G418 of up to 800 microg/ml. Extensive bone and bone marrow metastases of B16F0 were visualized by GFP expression when the animals were sacrificed 3 weeks after cell implantation. Metastases for both cell lines were visualized in many organs, including the brain, lung, pleural membrane, liver, kidney, adrenal gland, lymph nodes, skeleton, muscle, and skin by GFP fluorescence. This is the first observation of experimental skeletal metastases of melanoma, which was made possible by GFP expression. These models should facilitate future studies of the mechanism and therapy of bone and multiorgan metastasis of melanoma.

  3. Systemic Ablation of MMP-9 Triggers Invasive Growth and Metastasis of Pancreatic Cancer via Deregulation of IL6 Expression in the Bone Marrow.

    PubMed

    Grünwald, Barbara; Vandooren, Jennifer; Gerg, Michael; Ahomaa, Kaarin; Hunger, Annique; Berchtold, Sonja; Akbareian, Sophia; Schaten, Susanne; Knolle, Percy; Edwards, Dylan R; Opdenakker, Ghislain; Krüger, Achim

    2016-11-01

    Matrix metalloproteinase 9 (MMP-9/Gelatinase B) is overexpressed in pancreatic ductal adenocarcinoma (PDAC) and plays a central role in tumor cell invasion and metastasis. Here we complemented mechanistic insights in the cancer biology of MMP-9 and investigated the effects of specific long-term loss-of-function, by genetic ablation, of MMP-9 on PDAC initiation and progression in the well-established KPC mouse model of spontaneous PDAC. Tumor growth and progression were analyzed by histopathology and IHC. Invasive growth of PDAC cells was analyzed by both in vitro (proliferation, survival, migration, invasion assays) and in vivo (experimental metastasis assays) methods. Retroviral shRNAi was used to knockdown target genes (MMP-9, IL6R). Gene expression was analyzed by qRT-PCR, immunoblot, ELISA, in situ hybridization, and zymography. PDAC tumors from MMP-9-deficient mice were dramatically larger, more invasive, and contained more stroma. Yet, ablation of MMP-9 in PDAC cells did not directly promote invasive growth. Interestingly, systemic ablation of MMP-9 led to increased IL6 levels resulting from abrogation of MMP-9-dependent SCF signaling in the bone marrow. IL6 levels in MMP-9 -/- mice were sufficient to induce invasive growth and STAT3 activation in PDAC cells via IL6 receptor (IL6R). Interference with IL6R blocked the increased invasion and metastasis of PDAC cells in MMP-9-deficient hosts. In conclusion, ablation of systemic MMP-9 initiated fatal communication between maintenance of physiological functions of MMP-9 in the bone marrow and invasive growth of PDAC via the IL6/IL6R/STAT3 axis. Thus, the beneficial effects of host MMP-9 on PDAC are an important caveat for the use of systemic MMP-9 inhibitors in cancer. Mol Cancer Res; 14(11); 1147-58. ©2016 AACR. ©2016 American Association for Cancer Research.

  4. SU-E-T-56: Brain Metastasis Treatment Plans for Contrast-Enhanced Synchrotron Radiation Therapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Obeid, L; Adam, J; Tessier, A

    2014-06-01

    Purpose: Iodine-enhanced radiotherapy is an innovative treatment combining the selective accumulation of an iodinated contrast agent in brain tumors with irradiations using monochromatic medium energy x-rays. The aim of this study is to compare dynamic stereotactic arc-therapy and iodineenhanced SSRT. Methods: Five patients bearing brain metastasis received a standard helical 3D-scan without iodine. A second scan was acquired 13 min after an 80 g iodine infusion. Two SSRT treatment plans (with/without iodine) were performed for each patient using a dedicated Monte Carlo (MC) treatment planning system (TPS) based on the ISOgray TPS. Ten coplanar beams (6×6 cm2, shaped with collimator)more » were simulated. MC statistical error objective was less than 5% in the 50% isodose. The dynamic arc-therapy plan was achieved on the Iplan Brainlab TPS. The treatment plan validation criteria were fixed such that 100% of the prescribed dose is delivered at the beam isocentre and the 70% isodose contains the whole target volume. The comparison elements were the 70% isodose volume, the average and maximum doses delivered to organs at risk (OAR): brainstem, optical nerves, chiasma, eyes, skull bone and healthy brain parenchyma. Results: The stereotactic dynamic arc-therapy remains the best technique in terms of dose conformation. Iodine-enhanced SSRT presents similar performances to dynamic arc-therapy with increased brainstem and brain parenchyma sparing. One disadvantage of SSRT is the high dose to the skull bone. Iodine accumulation in metastasis may increase the dose by 20–30%, allowing a normal tissue sparing effect at constant prescribed dose. Treatment without any iodine enhancement (medium-energy stereotactic radiotherapy) is not relevant with degraded HDVs (brain, parenchyma and skull bone) comparing to stereotactic dynamic arc-therapy. Conclusion: Iodine-enhanced SSRT exhibits a good potential for brain metastasis treatment regarding the dose distribution and OAR criteria.« less

  5. Case report of metastatic invasive breast lobular carcinoma to the urinary bladder.

    PubMed

    Al Ibraheemi, Ahmed A

    2016-01-01

    Breast cancer is the most common cancer in women except skin cancer. The common metastatic sites include lymph node, lung, liver and bone. However, metastasis to the bladder is extremely rare. To our knowledge, this is the first case of breast cancer metastasis to urinary bladder in Jordan which is reported. Nine years after the initial diagnosis of lobular breast carcinoma, the patient suffered from left side leg edema; Ultrasonography and Computed tomography scanning showed thickening of posterior bladder wall and bilateral hydronephrosis. The biopsy of the bladder confirmed metastatic lesion from the breast. In contrast to the primary tumor, bladder metastasis showed negative expression of estrogen (ER) and progesterone (PR) receptors. However, Her2neu test was negative in both. The reported case confirms that bladder metastasis from breast cancer tend to occur late after the diagnosis of the primary tumor. Furthermore, bladder metastasis can be asymptomatic and heterogeneous in ER and PR expression in comparison with the primary tumor. This report supports the need for careful follow-up and early intervention whenever such clinical situation is suspected. This report supports further evaluation of receptor status at time of metastasis.

  6. High-intensity focused ultrasound (HIFU) in patients with solid malignancies: evaluation of feasibility, local tumour response and clinical results.

    PubMed

    Orgera, G; Monfardini, L; Della Vigna, P; Zhang, L; Bonomo, G; Arnone, P; Padrenostro, M; Orsi, F

    2011-08-01

    The purpose of this study was to evaluate the safety and efficacy of ultrasound-guided high-intensity focused ultrasound (USgHIFU) for ablation of solid tumours without damaging the surrounding structures. A specific written informed consent was obtained from every patient before treatment. From September 2008 to April 2009, 22 patients with 29 lesions were treated: nine patients with liver and/or soft-tissue metastases from colorectal carcinoma (CRC), six with pancreatic solid lesions, three with liver and/or bone metastases from breast cancer, one with osteosarcoma, one with muscle metastasis from lung cancer, one with iliac metastasis from multiple myeloma and one with abdominal liposarcoma. The mean diameter of tumours was 4.2 cm. All patients were evaluated 1 day, 1 month and 3 months after HIFU treatment by multidetector computed tomography (MDCT), positron-emission tomography (PET)-CT and clinical evaluation. The treatment time and adverse events were recorded. All patients had one treatment. Average treatment and sonication times were, respectively, 162.7 and 37.4 min. PET-CT or/and MDCT showed complete response in 11/13 liver metastases; all bone, soft-tissue and pancreatic lesions were palliated in symptoms, with complete response to PET-CT, MDCT or magnetic resonance imaging (MRI); the liposarcoma was almost completely ablated at MRI. Local oedema was observed in three patients. No other side effects were observed. All patients were discharged 1-3 days after treatment. According to our preliminary experience in a small number of patients, we conclude that HIFU ablation is a safe and feasible technique for locoregional treatment and is effective in pain control.

  7. Applications of Transgenics in Studies of Bone Sialoprotein

    PubMed Central

    Zhang, Jin; Tu, Qisheng; Chen, Jake

    2010-01-01

    Bone sialoprotein (BSP) is a major non-collagenous protein in mineralizing connective tissues such as dentin, cementum and calcified cartilage tissues. As a member of the SIBLING (Small Integrin-Binding Ligand, N-linked Glycoprotein) gene family of glycoproteins, BSP is involved in regulating hydroxyapatite crystal formation in bones and teeth, and has long been used as a marker gene for osteogenic differentiation. In the most recent decade, new discoveries in BSP gene expression and regulation, bone remodeling, bone metastasis, and bone tissue engineering have been achieved with the help of transgenic mice. In this review, we discuss these new discoveries obtained from the literatures and from our own laboratory, which were derived from the use of transgenic mouse mutants related to BSP gene or its promoter activity. PMID:19326395

  8. Ovarian cancer-related hypophosphatemic osteomalacia--a case report.

    PubMed

    Lin, Hung-An; Shih, Shyang-Rong; Tseng, Yu-Ting; Chen, Chi-Hau; Chiu, Wei-Yih; Hsu, Chih-Yao; Tsai, Keh-Sung

    2014-12-01

    Tumor-induced osteomalacia (TIO) is a rare paraneoplastic syndrome caused primarily by benign mesenchymal tumors. It has been associated with malignancies in rare cases. High serum levels of fibroblast growth factor (FGF) 23 reported in a group of patients with ovarian cancer had normal serum phosphate levels. There had been no ovarian cancer-related hypophosphatemic osteomalacia in a search of the literature. We investigated a 57-year-old woman with progressive low back pain. Clinical, biochemical, and radiological assessments were performed. The patient's serum phosphate and FGF23 levels were evaluated at baseline and after treatment for ovarian cancer. The patient presented with progressive low back pain and weight loss during the previous 6 months. Imaging studies revealed low bone mineral density and multiple suspicious spinal metastatic lesions. Laboratory examination showed hypophosphatemia, hyperphosphaturia, normocalcemia, an elevated serum alkaline phosphatase level, and an elevated serum FGF23 level. Because TIO was suspected, a tumor survey was performed, and ovarian carcinoma with multiple metastasis was detected. After surgery and chemotherapy treatments for ovarian cancer, the serum phosphate and FGF23 levels returned to normal, and the low back pain improved. To our knowledge, this is the first case of ovarian cancer-related hypophosphatemic osteomalacia reported in the literature. TIO should be considered in patients with ovarian cancer presenting with weakness, bone pain, and fractures. Investigation of TIO is appropriate when these patients present hypophosphatemia.

  9. Activation of NF-kappa B Signaling Promotes Growth of Prostate Cancer Cells in Bone

    PubMed Central

    Jin, Renjie; Sterling, Julie A.; Edwards, James R.; DeGraff, David J.; Lee, Changki; Park, Serk In; Matusik, Robert J.

    2013-01-01

    Patients with advanced prostate cancer almost invariably develop osseous metastasis. Although many studies indicate that the activation of NF-κB signaling appears to be correlated with advanced cancer and promotes tumor metastasis by influencing tumor cell migration and angiogenesis, the influence of altered NF-κB signaling in prostate cancer cells within boney metastatic lesions is not clearly understood. While C4-2B and PC3 prostate cancer cells grow well in the bone, LNCaP cells are difficult to grow in murine bone following intraskeletal injection. Our studies show that when compared to LNCaP, NF-κB activity is significantly higher in C4-2B and PC3, and that the activation of NF-κB signaling in prostate cancer cells resulted in the increased expression of the osteoclast inducing genes PTHrP and RANKL. Further, conditioned medium derived from NF-κB activated LNCaP cells induce osteoclast differentiation. In addition, inactivation of NF-κB signaling in prostate cancer cells inhibited tumor formation in the bone, both in the osteolytic PC3 and osteoblastic/osteoclastic mixed C4-2B cells; while the activation of NF-κB signaling in LNCaP cells promoted tumor establishment and proliferation in the bone. The activation of NF-κB in LNCaP cells resulted in the formation of an osteoblastic/osteoclastic mixed tumor with increased osteoclasts surrounding the new formed bone, similar to metastases commonly seen in patients with prostate cancer. These results indicate that osteoclastic reaction is required even in the osteoblastic cancer cells and the activation of NF-κB signaling in prostate cancer cells increases osteoclastogenesis by up-regulating osteoclastogenic genes, thereby contributing to bone metastatic formation. PMID:23577181

  10. 21 CFR 310.503 - Requirements regarding certain radioactive drugs.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Soluble phosphate Treatment of polycythemia vera. Do ......do Treatment of leukemia and bone metastasis.... (e) No exemption from section 505 of the act or from part 312 of this chapter is in effect or has...

  11. Osteoclastic miR-214 targets TRAF3 to contribute to osteolytic bone metastasis of breast cancer

    PubMed Central

    Liu, Jin; Li, Defang; Dang, Lei; Liang, Chao; Guo, Baosheng; Lu, Cheng; He, Xiaojuan; Cheung, Hilda Y. S.; He, Bing; Liu, Biao; Li, Fangfei; Lu, Jun; Wang, Luyao; Shaikh, Atik Badshah; Jiang, Feng; Lu, Changwei; Peng, Songlin; Zhang, Zongkang; Zhang, Bao-Ting; Pan, Xiaohua; Xiao, Lianbo; Lu, Aiping; Zhang, Ge

    2017-01-01

    The role of osteoclastic miRNAs in regulating osteolytic bone metastasis (OBM) of breast cancer is still underexplored. Here, we examined the expression profiles of osteoclastogenic miRNAs in human bone specimens and identified that miR-214-3p was significantly upregulated in breast cancer patients with OBM. Consistently, we found increased miR-214-3p within osteoclasts, which was associated with the elevated bone resorption, during the development of OBM in human breast cancer xenografted nude mice (BCX). Furthermore, genetic ablation of osteoclastic miR-214-3p in nude mice prevent the development of OBM. Conditioned medium from MDA-MB-231 cells dramatically stimulated miR-214-3p expression to promote osteoclast differentiation. Mechanistically, a series of in vitro study showed that miR-214-3p directly targeted Traf3 to promote osteoclast activity and bone-resorbing activity. In addition, osteoclast-specific miR-214-3p knock-in mice showed remarkably increased bone resorption when compared to the littermate controls, which was attenuated after osteoclast-targeted treatment with Traf3 3′UTR-containing plasmid. In BCX nude mice, osteoclast-targeted antagomir-214-3p delivery could recover the TRAF3 protein expression and attenuate the development of OBM, respectively. Collectively, inhibition of osteoclastic miR-214-3p may be a potential therapeutic strategy for breast cancer patients with OBM. Meanwhile, the intraosseous TRAF3 could be a promising biomarker for evaluation of the treatment response of antagomir-214-3p. PMID:28071724

  12. Prostate cancer invasion and metastasis: Insights from mining genomic data

    DOE PAGES

    Hudson, Bryan D.; Kulp, Kristen S.; Loots, Gabriela G.

    2013-07-22

    Prostate cancer (PCa) is the second most commonly diagnosed malignancy in men in the Western world and the second leading cause of cancer-related deaths among men worldwide. Although most cancers have the potential to metastasize under appropriate conditions, PCa favors the skeleton as a primary site of metastasis, suggesting that the bone microenvironment is conducive to its growth. PCa metastasis proceeds through a complex series of molecular events that include angiogenesis at the site of the original tumor, local migration within the primary site, intravasation into the blood stream, survival within the circulation, extravasation of the tumor cells to themore » target organ and colonization of those cells within the new site. In turn, each one of these steps involves a complicated chain of events that utilize multiple protein–protein interactions, protein signaling cascades and transcriptional changes. Despite the urgent need to improve current biomarkers for diagnosis, prognosis and drug resistance, advances have been slow. Global gene expression methods such as gene microarrays and RNA sequencing enable the study of thousands of genes simultaneously and allow scientists to examine molecular pathways of cancer pathogenesis. In this review, we summarize the current literature that explored high-throughput transcriptome analysis toward the advancement of biomarker discovery for PCa. Novel biomarkers are strongly needed to enable more accurate detection of PCa, improve prediction of tumor aggressiveness and facilitate the discovery of new therapeutic targets for tailored medicine. Furthermore, promising molecular markers identified from gene expression profiling studies include HPN, CLU1, WT1, WNT5A, AURKA and SPARC.« less

  13. ΔNp63 mediates cellular survival and metastasis in canine osteosarcoma

    PubMed Central

    Roberts, Ryan D.; Fenger, Joelle M.; Guttridge, Denis C.; London, Cheryl A.; Cam, Hakan

    2016-01-01

    p63 is a structural homolog within the 53 family encoding two isoforms, ΔNp63 and TAp63. The oncogenic activity of ΔNp63 has been demonstrated in multiple cancers, however the underlying mechanisms that contribute to tumorigenesis are poorly characterized. Osteosarcoma (OSA) is the most common primary bone tumor in dogs, exhibiting clinical behavior and molecular biology essentially identical to its human counterpart. The purpose of this study was to evaluate the potential contribution of ΔNp63 to the biology of canine OSA. As demonstrated by qRT-PCR, nearly all canine OSA cell lines and tissues overexpressed ΔNp63 relative to normal control osteoblasts. Inhibition of ΔNp63 by RNAi selectively induced apoptosis in the OSA cell lines overexpressing ΔNp63. Knockdown of ΔNp63 upregulated expression of the proapoptotic Bcl-2 family members Puma and Noxa independent of p53. However the effects of ΔNp63 required transactivating isoforms of p73, suggesting that ΔNp63 promotes survival in OSA by repressing p73-dependent apoptosis. In addition, ΔNp63 modulated angiogenesis and invasion through its effects on VEGF-A and IL-8 expression, and STAT3 phosphorylation. Lastly, the capacity of canine OSA cell lines to form pulmonary metastasis was directly related to expression levels of ΔNp63 in a murine model of metastatic OSA. Together, these data demonstrate that ΔNp63 inhibits apoptosis and promotes metastasis, supporting continued evaluation of this oncogene as a therapeutic target in both human and canine OSA. PMID:27391430

  14. Prostate cancer invasion and metastasis: Insights from mining genomic data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hudson, Bryan D.; Kulp, Kristen S.; Loots, Gabriela G.

    Prostate cancer (PCa) is the second most commonly diagnosed malignancy in men in the Western world and the second leading cause of cancer-related deaths among men worldwide. Although most cancers have the potential to metastasize under appropriate conditions, PCa favors the skeleton as a primary site of metastasis, suggesting that the bone microenvironment is conducive to its growth. PCa metastasis proceeds through a complex series of molecular events that include angiogenesis at the site of the original tumor, local migration within the primary site, intravasation into the blood stream, survival within the circulation, extravasation of the tumor cells to themore » target organ and colonization of those cells within the new site. In turn, each one of these steps involves a complicated chain of events that utilize multiple protein–protein interactions, protein signaling cascades and transcriptional changes. Despite the urgent need to improve current biomarkers for diagnosis, prognosis and drug resistance, advances have been slow. Global gene expression methods such as gene microarrays and RNA sequencing enable the study of thousands of genes simultaneously and allow scientists to examine molecular pathways of cancer pathogenesis. In this review, we summarize the current literature that explored high-throughput transcriptome analysis toward the advancement of biomarker discovery for PCa. Novel biomarkers are strongly needed to enable more accurate detection of PCa, improve prediction of tumor aggressiveness and facilitate the discovery of new therapeutic targets for tailored medicine. Furthermore, promising molecular markers identified from gene expression profiling studies include HPN, CLU1, WT1, WNT5A, AURKA and SPARC.« less

  15. ΔNp63 mediates cellular survival and metastasis in canine osteosarcoma.

    PubMed

    Cam, Maren; Gardner, Heather L; Roberts, Ryan D; Fenger, Joelle M; Guttridge, Denis C; London, Cheryl A; Cam, Hakan

    2016-07-26

    p63 is a structural homolog within the 53 family encoding two isoforms, ΔNp63 and TAp63. The oncogenic activity of ΔNp63 has been demonstrated in multiple cancers, however the underlying mechanisms that contribute to tumorigenesis are poorly characterized. Osteosarcoma (OSA) is the most common primary bone tumor in dogs, exhibiting clinical behavior and molecular biology essentially identical to its human counterpart. The purpose of this study was to evaluate the potential contribution of ΔNp63 to the biology of canine OSA. As demonstrated by qRT-PCR, nearly all canine OSA cell lines and tissues overexpressed ΔNp63 relative to normal control osteoblasts. Inhibition of ΔNp63 by RNAi selectively induced apoptosis in the OSA cell lines overexpressing ΔNp63. Knockdown of ΔNp63 upregulated expression of the proapoptotic Bcl-2 family members Puma and Noxa independent of p53. However the effects of ΔNp63 required transactivating isoforms of p73, suggesting that ΔNp63 promotes survival in OSA by repressing p73-dependent apoptosis. In addition, ΔNp63 modulated angiogenesis and invasion through its effects on VEGF-A and IL-8 expression, and STAT3 phosphorylation. Lastly, the capacity of canine OSA cell lines to form pulmonary metastasis was directly related to expression levels of ΔNp63 in a murine model of metastatic OSA. Together, these data demonstrate that ΔNp63 inhibits apoptosis and promotes metastasis, supporting continued evaluation of this oncogene as a therapeutic target in both human and canine OSA.

  16. Therapeutic Targeting of TRPV1 for the Treatment of Chronic Pain Associated with Prostate Cancer Bone Metastasis

    DTIC Science & Technology

    2013-07-30

    1 AD_________________ Award Number: W81XWH-11-1-0333 TITLE: Therapeutic Targeting of TRPV1 for the...TITLE AND SUBTITLE Therapeutic Targeting of TRPV1 for the Treatment of Chronic Pain 5a. CONTRACT NUMBER Associated with Prostate Cancer Bone...specific inflammatory factors, IL-6 and TNF-α, PTHrP and ET-1 on upregulation of TRPV1 channel function/expression, and nociceptor sensitization

  17. The Role of Megakaryocytes in Breast Cancer Metastasis to Bone

    DTIC Science & Technology

    2014-05-01

    marrow. We found that MKs increased in the femurs of mice bearing MDA-MB-231 human cancer. We compared MKs in femurs of nude mice inoculated with cancer...been inoculated with metastastic human breast cancer cells, we observed that megakaryocyte (MK) numbers were significantly increased in the bone...proteolysis [2]. Thromboembolism is one of the most common causes of death in human cancer patients. MKs differentiate in the endosteal niche, the same

  18. Predicting severe hematologic toxicity from extended-field chemoradiation of para-aortic nodal metastases from cervical cancer.

    PubMed

    Yan, Kevin; Ramirez, Ezequiel; Xie, Xian-Jin; Gu, Xuejun; Xi, Yin; Albuquerque, Kevin

    The purpose of this study was to determine factors predictive for severe hematologic toxicity (HT) in cervical cancer patients with para-aortic lymph node metastasis treated with concurrent cisplatin chemoradiation to an extended field (EFCRT). Thirty-eight patients with cervical cancer and para-aortic lymph node metastasis who underwent EFCRT were analyzed. Active bone marrow was defined as the region within irradiated total bone marrow (BM TOT ) with a standard uptake value on 18 F-fluorodeoxyglucose positron emission tomography/computed tomography greater than the mean standard uptake value for BM TOT . Serial weekly blood counts from the beginning to the end of radiation treatment were evaluated for HT using Common Terminology Criteria for Adverse Events, version 4.0. Nineteen patients had grade 3 or higher hematologic toxicity (HT3+), not including lymphocyte toxicity. Obese patients (n = 12) were less likely to get HT3+ (P = .03) despite getting equivalent doses of chemotherapy. Volumes of BM TOT and active bone marrow receiving doses of 20, 30, and 45 Gy and body mass index significantly predicted HT3+. Patients who had HT3+ had prolonged treatment time (62 vs 53 days, P < .001). For patients receiving EFCRT, bone marrow irradiation parameters and patient body mass index were associated with HT3+. A simplified nomogram has been created to predict HT3+ in these patients, allowing the potential to explore bone marrow-sparing delivery techniques. Copyright © 2017 American Society for Radiation Oncology. Published by Elsevier Inc. All rights reserved.

  19. Radium-223 dichloride bone-targeted alpha particle therapy for hormone-refractory breast cancer metastatic to bone

    PubMed Central

    2014-01-01

    Background Hormone-refractory breast cancer metastatic to bone is a clinically challenging disease associated with high morbidity, poor prognosis, and impaired quality of life owing to pain and skeletal-related events. In a preclinical study using a mouse model of breast cancer and bone metastases, Ra-223 dichloride was incorporated into bone matrix and inhibited proliferation of breast cancer cells and differentiation of osteoblasts and osteoclasts (all P values < .001) in vitro. Ra-223 dichloride also induced double-strand DNA breaks in cancer cells in vivo. Methods The US Food and Drug Administration recently approved radium-223 (Ra-223) dichloride (Ra-223; Xofigo injection) alpha-particle therapy for the treatment of symptomatic bone metastases in patients with castration-resistant prostate cancer. On the basis of a strong preclinical rationale, we used Ra-223 dichloride to treat bone metastases in a patient with breast cancer. Results A 44-year-old white woman with metastatic breast cancer who was estrogen receptor–positive, BRCA1-negative, BRCA2-negative, PIK3CA mutation (p.His1047Arg) positive presented with diffuse bony metastases and bone pain. She had hormone refractory and chemotherapy refractory breast cancer. After Ra-223 therapy initiation her bone pain improved, with corresponding decrease in tumor markers and mixed response in 18F-FDG PET/CT and 18F-NaF bone PET/CT. The patient derived clinical benefit from therapy. Conclusion We have shown that Ra-223 dichloride can be safely administered in a patient with hormone-refractory bone metastasis from breast cancer at the US FDA–approved dose for prostate cancer. Furthermore, because the treatment did not cause any drop in hematologic parameters, it has the potential to be combined with other radiosensitizing therapies, which may include chemotherapy or targeted therapies. Given that Ra-223 dichloride is already commercially available, this case report may help future patients and provide a rationale for initiating clinical research in the use of Ra-223 dichloride to treat bone metastasis from breast cancer. A randomized clinical trial is needed to provide evidence of efficacy, safety, and good outcomes. PMID:25243101

  20. Femoral Metastasis from Penile Carcinoma: Report of 2 Cases

    PubMed Central

    Braumann, Laura; Tsagozis, Panagiotis; Wedin, Rikard; Brosjö, Otte

    2015-01-01

    Purpose. Penile cancer rarely gives symptomatic skeletal metastases. Methods. We present 2 patients with squamous carcinoma of the penis who were surgically treated for metastases in the femur. Results. Both patients had pathological fractures and were operated on. In one case, the skeletal metastasis preceded any lymphatic spread of the disease, suggesting early haematogenous dissemination. Conclusions. Endoprosthetic reconstruction resulted in pain relief and restored the ambulatory capacity. Clinicians should be aware of the possibility for symptomatic bone metastases with a risk for pathological fracture in patients with penile cancer. PMID:26579327

  1. Dysphagia: An Unusual Presentation of Metastatic Uterine Cervical Carcinoma.

    PubMed

    Hameed, Anam; Dekovich, Alexander A; Lum, Phillip J; Shafi, Mehnaz A

    2017-03-01

    Worldwide, cervical cancer is the third most common cancer among women and the fourth leading cause of death from cancer. The most common sites of metastasis are the pelvic lymph nodes, vagina, and the pelvic sidewalls. Distant metastases are uncommon but can involve the bone, lung, and liver. Characteristics associated with increased rate of distant metastasis include bulky tumor, endometrial extension, lymph node involvement, and advanced disease. We report the case of a woman with stage II cervical carcinoma, who presented with dysphagia due to cervical cancer metastases to the mediastinum.

  2. Potential Role of CD68 in Breast Cancer Bone Metastasis

    DTIC Science & Technology

    2012-01-01

    research on the risk factors of Salmonella in poultry farms and processing plants. EDUCATIONAL ACTIVITIES Classroom Instruction: English...presentation – Department of Biochemistry, Mississippi State University, April 2007. “Kinetic Studies of Chicken Muscle Lactate Dehydrogenase

  3. Osteoclast-targeting small molecules for the treatment of neoplastic bone metastases.

    PubMed

    Kawatani, Makoto; Osada, Hiroyuki

    2009-11-01

    Osteoclasts are highly specialized cells that resorb bone, and their abnormal activity is implicated in a variety of human bone diseases. In neoplastic bone metastasis, the bone destruction caused by osteoclasts is not only associated with the formation and progression of metastatic lesions, but also could contribute to frequent complications such as severe pain and pathological fractures, which greatly diminish the quality of life of patients. Bisphosphonates, potent antiresorptive drugs, have been shown to have efficacy for treating bone metastases in many types of cancer, and the development of various molecularly targeted agents is currently proceeding. Thus, inhibition of osteoclast function is now established as an important treatment strategy for bony metastases. This review focuses on promising small molecules that disrupt osteoclast function and introduces our chemical/biological approach for identifying osteoclast-targeting small molecular inhibitors.

  4. Development and external validation of nomograms to predict the risk of skeletal metastasis at the time of diagnosis and skeletal metastasis-free survival in nasopharyngeal carcinoma.

    PubMed

    Yang, Lin; Xia, Liangping; Wang, Yan; He, Shasha; Chen, Haiyang; Liang, Shaobo; Peng, Peijian; Hong, Shaodong; Chen, Yong

    2017-09-06

    The skeletal system is the most common site of distant metastasis in nasopharyngeal carcinoma (NPC); various prognostic factors have been reported for skeletal metastasis, though most studies have focused on a single factor. We aimed to establish nomograms to effectively predict skeletal metastasis at initial diagnosis (SMAD) and skeletal metastasis-free survival (SMFS) in NPC. A total of 2685 patients with NPC who received bone scintigraphy (BS) and/or 18F-deoxyglucose positron emission tomography/computed tomography (18F-FDG PET/CT) and 2496 patients without skeletal metastasis were retrospectively assessed to develop individual nomograms for SMAD and SMFS. The models were validated externally using separate cohorts of 1329 and 1231 patients treated at two other institutions. Five independent prognostic factors were included in each nomogram. The SMAD nomogram had a significantly higher c-index than the TNM staging system (training cohort, P = 0.005; validation cohort, P < 0.001). The SMFS nomogram had significantly higher c-index values in the training and validation sets than the TNM staging system (P < 0.001 and P = 0.005, respectively). Three proposed risk stratification groups were created using the nomograms, and enabled significant discrimination of SMFS for each risk group. The prognostic nomograms established in this study enable accurate stratification of distinct risk groups for skeletal metastasis, which may improve counseling and facilitate individualized management of patients with NPC.

  5. Nanoparticle-mediated siRNA delivery assessed in a 3D co-culture model simulating prostate cancer bone metastasis.

    PubMed

    Fitzgerald, Kathleen A; Guo, Jianfeng; Raftery, Rosanne M; Castaño, Irene Mencía; Curtin, Caroline M; Gooding, Matt; Darcy, Raphael; O' Brien, Fergal J; O' Driscoll, Caitriona M

    2016-09-25

    siRNA has emerged as a potential therapeutic for the treatment of prostate cancer but effective delivery remains a major barrier to its clinical application. This study aimed to develop and characterise a 3D in vitro co-culture model to simulate prostate cancer bone metastasis and to assess the ability of the model to investigate nanoparticle-mediated siRNA delivery and gene knockdown. PC3 or LNCaP prostate cancer cells were co-cultured with hFOB 1.19 osteoblast cells in 2D on plastic tissue culture plates and in 3D on collagen scaffolds mimicking the bone microenvironment. To characterise the co-culture model, cell proliferation, enzyme secretion and the utility of two different gene delivery vectors to mediate siRNA uptake and gene knockdown were assessed. Cell proliferation was reduced by∼50% by day 7 in the co-culture system relative to monoculture (PC3 and LNCaP co-cultures, in 2D and 3D) and an enhanced level of MMP9 (a marker of bone metastasis) was secreted into the media (1.2-4-fold increase depending on the co-culture system). A cationic cyclodextrin gene delivery vector proved significantly less toxic in the co-culture system relative to the commercially available vector Lipofectamine 2000(®). In addition, knockdown of both the GAPDH gene (minimum 15%) and RelA subunit of the NF-κB transcription factor (minimum 20%) was achieved in 2D and 3D cell co-cultures. Results indicate that the prostate cancer-osteoblast in vitro co-culture model was more physiologically relevant vs the monoculture. This model has the potential to help improve the design and efficacy of gene delivery formulations, to more accurately predict in vivo performance and, therefore, to reduce the risk of product failure in late-stage clinical development. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Brain Metastasis from Colorectal Cancer: Predictors and Treatment Outcomes.

    PubMed

    Nozawa, Hiroaki; Ishihara, Soichiro; Kawai, Kazushige; Sasaki, Kazuhito; Murono, Koji; Otani, Kensuke; Nishikawa, Takeshi; Tanaka, Toshiaki; Kiyomatsu, Tomomichi; Hata, Keisuke; Watanabe, Toshiaki

    2017-01-01

    Difficulties are associated with the management of brain metastasis (BM), which portends a poor prognosis in the treatment of colorectal cancer (CRC). The aim of the present study was to identify risk factors for BM in CRC and evaluate the outcomes of various treatment modalities. We retrospectively reviewed data on a total of 2,238 patients with primary CRC who underwent surgical resection at our hospital between 1999 and 2014. Predictive factors for BM and prognostic factors after the diagnosis of BM were examined by univariate and multivariate analyses using Cox proportional hazards models. Three patients (0.1%) had BM at the initial diagnosis, and 23 patients (1.2%) developed metachronous BM during the median follow-up period of 44.6 months. Lung and bone metastases were identified as independent predictive factors for BM. Median survival after the diagnosis of BM was 7.4 months. Stereotactic radiosurgery, administered to 41% of the patients with BM, was associated with a better postdiagnostic survival. CRC patients with metastasis to the lung or bone were at a higher risk of BM. Because the survival is still limited, it is crucial to determine the treatment strategy in consideration of the characteristics of each therapy and quality of life in CRC patients with BM. © 2017 S. Karger AG, Basel.

  7. Brain Metastasis in Bone and Soft Tissue Cancers: A Review of Incidence, Interventions, and Outcomes

    PubMed Central

    Shweikeh, Faris; Bukavina, Laura; Saeed, Kashif; Sarkis, Reem; Suneja, Aarushi; Sweiss, Fadi; Drazin, Doniel

    2014-01-01

    Bone and soft tissue malignancies account for a small portion of brain metastases. In this review, we characterize their incidence, treatments, and prognosis. Most of the data in the literature is based on case reports and small case series. Less than 5% of brain metastases are from bone and soft tissue sarcomas, occurring most commonly in Ewing's sarcoma, malignant fibrous tumors, and osteosarcoma. Mean interval from initial cancer diagnosis to brain metastasis is in the range of 20–30 months, with most being detected before 24 months (osteosarcoma, Ewing sarcoma, chordoma, angiosarcoma, and rhabdomyosarcoma), some at 24–36 months (malignant fibrous tumors, malignant peripheral nerve sheath tumors, and alveolar soft part sarcoma), and a few after 36 months (chondrosarcoma and liposarcoma). Overall mean survival ranges between 7 and 16 months, with the majority surviving < 12 months (Ewing's sarcoma, liposarcoma, malignant fibrous tumors, malignant peripheral nerve sheath tumors, angiosarcoma and chordomas). Management is heterogeneous involving surgery, radiosurgery, radiotherapy, and chemotherapy. While a survival advantage may exist for those given aggressive treatment involving surgical resection, such patients tended to have a favorable preoperative performance status and minimal systemic disease. PMID:24757391

  8. Hepatocyte Growth Factor and Interleukin-6 in Prostate Cancer Bone Metastasis

    DTIC Science & Technology

    2006-06-01

    Wif1 Wnt inhibitory factor 1 ## ## ## ## Cxcl4 Chemokine (C-X-C motif) ligand 4 ## ## ## ## Cxcl12 Chemokine (C-X-C motif) ligand 12...CGGCTGAAGAACAACAACAG GGCGTCTGACTCACACCTCT Clu CAGCTGGCTAACCTCACACA AACAGCTTCACCACCACCTC Cxcl4 AGTCCTGAGCTGCTGCTTCT CCCAGAGGAGATGGTCTTCA Col1A1 GAGAGCATGACCGATGGATT

  9. Nanotechnology in the targeted drug delivery for bone diseases and bone regeneration

    PubMed Central

    Gu, Wenyi; Wu, Chengtie; Chen, Jiezhong; Xiao, Yin

    2013-01-01

    Nanotechnology is a vigorous research area and one of its important applications is in biomedical sciences. Among biomedical applications, targeted drug delivery is one of the most extensively studied subjects. Nanostructured particles and scaffolds have been widely studied for increasing treatment efficacy and specificity of present treatment approaches. Similarly, this technique has been used for treating bone diseases including bone regeneration. In this review, we have summarized and highlighted the recent advancement of nanostructured particles and scaffolds for the treatment of cancer bone metastasis, osteosarcoma, bone infections and inflammatory diseases, osteoarthritis, as well as for bone regeneration. Nanoparticles used to deliver deoxyribonucleic acid and ribonucleic acid molecules to specific bone sites for gene therapies are also included. The investigation of the implications of nanoparticles in bone diseases have just begun, and has already shown some promising potential. Further studies have to be conducted, aimed specifically at assessing targeted delivery and bioactive scaffolds to further improve their efficacy before they can be used clinically. PMID:23836972

  10. Nanotechnology in the targeted drug delivery for bone diseases and bone regeneration.

    PubMed

    Gu, Wenyi; Wu, Chengtie; Chen, Jiezhong; Xiao, Yin

    2013-01-01

    Nanotechnology is a vigorous research area and one of its important applications is in biomedical sciences. Among biomedical applications, targeted drug delivery is one of the most extensively studied subjects. Nanostructured particles and scaffolds have been widely studied for increasing treatment efficacy and specificity of present treatment approaches. Similarly, this technique has been used for treating bone diseases including bone regeneration. In this review, we have summarized and highlighted the recent advancement of nanostructured particles and scaffolds for the treatment of cancer bone metastasis, osteosarcoma, bone infections and inflammatory diseases, osteoarthritis, as well as for bone regeneration. Nanoparticles used to deliver deoxyribonucleic acid and ribonucleic acid molecules to specific bone sites for gene therapies are also included. The investigation of the implications of nanoparticles in bone diseases have just begun, and has already shown some promising potential. Further studies have to be conducted, aimed specifically at assessing targeted delivery and bioactive scaffolds to further improve their efficacy before they can be used clinically.

  11. Prostate Cancer and Bone: The Elective Affinities

    PubMed Central

    2014-01-01

    The onset of metastases dramatically changes the prognosis of prostate cancer patients, determining increased morbidity and a drastic fall in survival expectancy. Bone is a common site of metastases in few types of cancer, and it represents the most frequent metastatic site in prostate cancer. Of note, the prevalence of tumor relapse to the bone appears to be increasing over the years, likely due to a longer overall survival of prostate cancer patients. Bone tropism represents an intriguing challenge for researchers also because the preference of prostate cancer cells for the bone is the result of a sequential series of targetable molecular events. Many factors have been associated with the peculiar ability of prostate cancer cells to migrate in bone marrow and to determine mixed osteoblastic/osteolytic lesions. As anticipated by the success of current targeted therapy aimed to block bone resorption, a better understanding of molecular affinity between prostate cancer and bone microenvironment will permit us to cure bone metastasis and to improve prognosis of prostate cancer patients. PMID:24971315

  12. A Color-coded Imageable Syngeneic Mouse Model of Stromal-cell Recruitment by Metastatic Lymphoma.

    PubMed

    Matsumoto, Takuro; Suetsugu, Atsushi; Shibata, Yuhei; Nakamura, Nobuhiko; Aoki, Hitomi; Kunisada, Takahiro; Tsurumi, Hisashi; Shimizu, Masahito; Hoffman, Robert M

    2015-09-01

    A syngeneic color-coded imageable lymphoma model has been developed to visualize recruitment of host stromal cells by malignant lymphoma during metastasis. The EL4 cell line was previously derived from a lymphoma induced in a C57/BL6 mouse by 9,10-dimethyl-1,2-benzanthracene. EL4 lymphoma cells expressing red fluorescent protein (EL4-RFP) were initially established. EL4-RFP cells were subsequently injected into the tail vein of C57/BL6-GFP transgenic mice. EL4-RFP metastasis was observed in the lymph nodes of the upper mediastinum and in the liver 28 days after cell injection. Large EL4-RFP liver metastases in C57/BL6-GFP mice contained GFP-expressing stromal cells derived from the host. In addition, EL4-RFP lymphoma metastasis was formed in peri-gastric lymph nodes, which were also enriched in host GFP-expressing cells. Furthermore, EL4-RFP lymphoma cells were also observed in the peripheral blood and bone marrow of C57/BL6-GFP transgenic mice, where they were associated with GFP-expressing host cells. Lymph node, liver and bone marrow metastases were found approximately 4 weeks after transplantation and all RFP-expressing metastases were highly enriched in GFP-expressing host stromal cells. This model of malignant lymphoma can be used to study early tumor development, metastasis, and the role of the stroma, as well as for discovery and evaluation of novel therapeutics for this treatment-resistant disease. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  13. Expression of anaesthetic and analgesic drug target genes in excised breast tumour tissue: Association with clinical disease recurrence or metastasis.

    PubMed

    Connolly, C; Madden, S F; Buggy, D J; Gallagher, H C

    2017-01-01

    Retrospective analyses suggest anaesthetic-analgesics technique during cancer surgery may affect recurrence/metastasis. This could involve direct effects of anaesthetic-analgesic drugs on cancer cells. While μ-opioid receptor over-expression in lung tumours is associated with greater metastasis, other anaesthetic-analgesic receptor targets in cancer recurrence/metastasis remain unexplored. Therefore, we evaluated the association between genetic expression of anaesthetic-analgesic receptor targets and recurrence/metastasis, using a repository of breast cancer gene expression and matching clinical data. A list of 23 genes encoding for the most prominent anaesthetic-analgesic receptor targets was compiled. This was processed through BreastMark- an algorithm integrating gene expression data from ~17,000 samples and clinical data from >4,500 breast cancer samples. Gene expression data was dichotomized using disease-free survival (survival without recurrence) and distant disease-free survival (survival without metastasis) as end points. Hazard ratios were calculated by Cox-regression analysis. Enrichment for prognostic markers was determined by randomly choosing 23-member gene lists from all available genes, calculating how often >5 significant markers were observed and adjusting p-values for multiple testing. This was repeated 10,000 times and an empirical p-value calculated. Of 23 selected genes, 9 were significantly associated with altered rates of metastasis and 4 with recurrence on univariate analysis. Adjusting for multiple testing, 5 of these 9 genes remained significantly associated with metastasis, non with recurrence. This ratio of genes (5/23) was not significantly enriched for markers of metastasis (p = 0.07). Several anaesthetic-analgesic receptor genes were associated with metastatic spread in breast cancer. Overall there was no significant enrichment in prognostic markers of metastasis, although a trend was observed.

  14. Is there any significance of lung cancer histology to compare the diagnostic accuracies of (18)F-FDG-PET/CT and (99m)Tc-MDP BS for the detection of bone metastases in advanced NSCLC?

    PubMed

    Inal, Ali; Kaplan, Muhammed Ali; Kucukoner, Mehmet; Urakcı, Zuhat; Dostbil, Zeki; Komek, Hail; Onder, Hakan; Tasdemir, Bekir; Isıkdogan, Abdurrahman

    2014-01-01

    Bone scintigraphy (BS) and fluorine-18 deoxyglucose positron emission tomography computed tomography ((18)F-FDG-PET/CT) are widely used for the detection of bone involvement. The optimal imaging modality for the detection of bone metastases in histological subgroups of non-small cell lung cancer (NSCLC) remains ambiguous. The aim of this study was to compare the efficacy of (18)F-FDG-PET/C and 99mTc-methylene diphosphonate ((99m)Tc-MDP) BS in the detection of bone metastases of patients in NSCLC. Specifically, we compared the diagnostic accuracies of these imaging techniques evaluating bone metastasis in histological subgroups of NSCLC. Fifty-three patients with advanced NSCLC, who had undergone both (18)F-FDG-PET/CT and BS and were eventually diagnosed as having bone metastasis, were enrolled in this retrospective study. The sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of (18)F-FDG-PET/CT and BS were 90.4%, 99.4%, 98.1%, 96.6%, 97.0% and 84.6%, 93.1%, 82.5%, 93.2, 90.8%, respectively. The κ statistics were calculated for (18)F-FDG-PET/CT and BS. The κ-value was 0.67 between (18)F-FDG-PET/CT and BS in all patients. On the other hand, the κ-value was 0.65 in adenocarcinoma, and 0.61 in squamous cell carcinoma between (18)F-FDG-PET/CT and BS. The κ-values suggested excellent agreement between all patients and histological subgroups of NSCLC. (18)F-FDG-PET/CT was more favorable than BS in the screening of metastatic bone lesions, but the trend did not reach statistical significance in all patients and histological subgroups of NSCLC. Our results need to be validated in prospective and larger study clinical trials to further clarify this topic.

  15. Extracranial bone metastases from recurrent anaplastic astrocytoma on FDG PET/CT

    PubMed Central

    Li, Zu-Gui; Mu, Hai-Yu

    2017-01-01

    Abstract Objective: Extracranial bone metastases from astrocytoma are rare and frequently detected as part of multiorgan metastases. It is extremely rare for astrocytoma to have extracranial bone metastases alone. The importance of whole-body fluorodeoxyglucose positron emission tomography/computed tomography (FDG PET/CT) imaging in evaluating extracranial metastasis (ECMs) has not been described effectively due to the rarity of this event. The purpose of our case report is to emphasize the role of FDG PET/CT in the assessment of tumor recurrence and extracranial bone metastases from anaplastic astrocytoma. Methods and materials: A 25-year-old woman was firstly admitted with a 4-month history of progressive blurred vision, and 2-month history of intermittent headache. Presurgical MRI imaging revealed a large mass in the left trigone of lateral ventricle. Subsequently, she underwent tumor resection, radiotherapy and chemotherapy. A final pathological diagnosis of anaplastic astrocytoma (WHO III) was made. Nearly 12 months after the surgery, the follow-up brain MR imaging revealed a contrast-enhanced lesion in the site of operative region. Whole-body FDG PET/CT imaging was performed to evaluate the situation. Results: Postoperative brain FDG PET/CT showed an abnormal focal FDG uptake corresponding to the contrast-enhanced lesion in the operative area, suggesting a tumor recurrence. Whole-body FDG PET/CT also showed multiple FDG-avid osteosclerotic lesions in the body. It was highly suggestive of extracranial bone metastases. A subsequent open bone biopsy of FDG-avid lesion in right iliac crest was performed. Histopathological and immunohistochemical findings indicated characteristic of glioma. The patient died 1 month later, nearly 13 months after the initial diagnosis. Conclusions: ECMs from anaplastic astrocytoma are extremely rare but they do occur. Whole-body FDG PET/CT imaging with inclusion of brain was valuable in differentiating tumor recurrence from radiation necrosis and in detecting uncommon extracranial bone metastases from anaplastic astrocytoma, which were closely related to prognosis of this disease. PMID:28591062

  16. IRX1 hypomethylation promotes osteosarcoma metastasis via induction of CXCL14/NF-κB signaling

    PubMed Central

    Lu, Jinchang; Song, Guohui; Tang, Qinglian; Zou, Changye; Han, Feng; Zhao, Zhiqiang; Yong, Bicheng; Yin, Junqiang; Xu, Huaiyuan; Xie, Xianbiao; Kang, Tiebang; Lam, YingLee; Yang, Huiling; Shen, Jingnan; Wang, Jin

    2015-01-01

    Osteosarcoma is a common malignant bone tumor with a propensity to metastasize to the lungs. Epigenetic abnormalities have been demonstrated to underlie osteosarcoma development; however, the epigenetic mechanisms that are involved in metastasis are not yet clear. Here, we analyzed 2 syngeneic primary human osteosarcoma cell lines that exhibit disparate metastatic potential for differences in epigenetic modifications and expression. Using methylated DNA immunoprecipitation (MeDIP) and microarray expression analysis to screen for metastasis-associated genes, we identified Iroquois homeobox 1 (IRX1). In both human osteosarcoma cell lines and clinical osteosarcoma tissues, IRX1 overexpression was strongly associated with hypomethylation of its own promoter. Furthermore, experimental modulation of IRX1 in osteosarcoma cell lines profoundly altered metastatic activity, including migration, invasion, and resistance to anoikis in vitro, and influenced lung metastasis in murine models. These prometastatic effects of IRX1 were mediated by upregulation of CXCL14/NF-κB signaling. In serum from osteosarcoma patients, the presence of IRX1 hypomethylation in circulating tumor DNA reduced lung metastasis–free survival. Together, these results identify IRX1 as a prometastatic gene, implicate IRX1 hypomethylation as a potential molecular marker for lung metastasis, and suggest that epigenetic reversion of IRX1 activation may be beneficial for controlling osteosarcoma metastasis. PMID:25822025

  17. External beam radiotherapy for palliation of painful bone metastases: pooled data bioeffect dose response analysis of dose fractionation

    NASA Astrophysics Data System (ADS)

    Naveen, T.; Supe, Sanjay S.; Ganesh, K. M.; Samuel, Jacob

    2009-01-01

    Bone metastases develop in up to 70% of newly diagnosed cancer patients and result in immobility, anxiety, and depression, severely diminishing the patients quality of life. Radiotherapy is a frequently used modality for bone metastasis and has been shown to be effective in reducing metastatic bone pain and in some instances, causing tumor shrinkage or growth inhibition. There is controversy surrounding the optimal fractionation schedule and total dose of external beam radiotherapy, despite many randomized trials and overviews addressing the issue. This study was undertaken to apply BED to clinical fractionation data of radiotherapeutic management of bone metastases in order to arrive at optimum BED values for acceptable level of response rate. A computerised literature search was conducted to identify all prospective clinical studies that addressed the issue of fractionation for the treatment of bone metastasis. The results of these studies were pooled together to form the database for the analysis. A total of 4111 number of patients received radiation dose ranging from 4 to 40.5 Gy in 1 to 15 fractions with dose per fraction ranging from 2 to 10 Gy. Single fraction treatments were delivered in 2013 patients and the dose varied from 4 to 10 Gy. Multifraction treatments were delivered in 2098 patients and the dose varied from 15 to 40.5 Gy. The biological effective dose (BED) was evaluated for each fractionation schedule using the linear quadratic model and an α/β value of 10 Gy. Response rate increased significantly beyond a BED value of 14.4 Gy (p < 0.01). Based on our analysis and indications from the literature about higher retreatment and fracture rate of single fraction treatments, minimum BED value of 14.4 Gy is recommended.

  18. Follow-up bone scan in breast cancer patients: what is the appropriate interpretation of purely rib uptake?

    PubMed

    Seo, Minjung; Ko, Byung Kyun; Tae, Soon Young; Koh, Su-Jin; Noh, Young Ju; Choi, Hye-Jeong; Bae, Kyungkyg; Bang, Minseo; Jun, Sungmin; Park, Seol Hoon

    2016-12-01

    Although rib uptake is frequently detected in follow-up bone scans of breast cancer patients, few studies have assessed its clinical significance. Among 1208 breast cancer patients who underwent a bone scan between 2011 and 2014, 157 patients presented with newly detected rib uptake at follow-up. Patients who had underlying bone metastases (n=8) or had simultaneous new uptake in sites other than the rib (n=13) were excluded. The patients enrolled finally were those who had purely rib uptakes. The location, intensity, and final diagnosis of the uptake were evaluated by nuclear medicine physicians. A total of 275 new instances of rib uptake were detected in follow-up bone scans of 136 patients. These were more frequently located on the ipsilateral side of the breast cancer (61.1%) and the anterior arc (65.1%), and they presented as moderate to intense (93.1%) uptakes. Among these, 265 lesions in 130 patients turned out to be benign fractures (96.4%), whereas only 10 lesions in six patients were metastases. The proportion of metastases was significantly higher if the uptake was linear or if the patient had recurrence. It was marginally higher if the uptake was located in the posterior arc. The proportion of metastases within the radiation field was significantly lower in patients with a history of irradiation. Newly detected purely rib uptake on a follow-up bone scan in patients who have been treated for breast cancer is mostly because of fractures and rarely signals metastasis. However, if the patient has disease recurrence, metastasis should strongly be suspected, particularly when uptake is linear or located in the posterior arc.

  19. Thoracic skeletal imaging

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Scott, W.W.; Scott, P.D.; Trerotola, S.O.

    1990-01-01

    This book reviews the radiographic presentations of all hard and soft tissue disorders of the thorax. The signposts for diagnosis are described and all imaging modalities are included. Topics include: breast carcinoma metastasis to the bones of the chest, polio, scoliosis, ancylosis spondylitis, lung cancer with rib metastases.

  20. Development of a bone-targeted pH-sensitive liposomal formulation containing doxorubicin: physicochemical characterization, cytotoxicity, and biodistribution evaluation in a mouse model of bone metastasis.

    PubMed

    Ferreira, Diêgo Dos Santos; Faria, Samilla Dornelas; Lopes, Sávia Caldeira de Araújo; Teixeira, Cláudia Salviano; Malachias, Angelo; Magalhães-Paniago, Rogério; de Souza Filho, José Dias; Oliveira, Bruno Luis de Jesus Pinto; Guimarães, Alexander Ramos; Caravan, Peter; Ferreira, Lucas Antônio Miranda; Alves, Ricardo José; Oliveira, Mônica Cristina

    2016-01-01

    Despite recent advances in cancer therapy, the treatment of bone tumors remains a major challenge. A possible underlying hypothesis, limitation, and unmet need may be the inability of therapeutics to penetrate into dense bone mineral, which can lead to poor efficacy and high toxicity, due to drug uptake in healthy organs. The development of nanostructured formulations with high affinity for bone could be an interesting approach to overcome these challenges. To develop a liposomal formulation with high affinity for hydroxyapatite and the ability to release doxorubicin (DOX) in an acidic environment for future application as a tool for treatment of bone metastases. Liposomes were prepared by thin-film lipid hydration, followed by extrusion and the sulfate gradient-encapsulation method. Liposomes were characterized by average diameter, ζ-potential, encapsulation percentage, X-ray diffraction, and differential scanning calorimetry. Release studies in buffer (pH 7.4 or 5), plasma, and serum, as well as hydroxyapatite-affinity in vitro analysis were performed. Cytotoxicity was evaluated by MTT assay against the MDA-MB-231 cell line, and biodistribution was assessed in bone metastasis-bearing animals. Liposomes presented suitable diameter (~170 nm), DOX encapsulation (~2 mg/mL), controlled release, and good plasma and serum stability. The existence of interactions between DOX and the lipid bilayer was proved through differential scanning calorimetry and small-angle X-ray scattering. DOX release was faster when the pH was in the range of a tumor than at physiological pH. The bone-targeted formulation showed a strong affinity for hydroxyapatite. The encapsulation of DOX did not interfere in its intrinsic cytotoxicity against the MDA-MB-231 cell line. Biodistribution studies demonstrated high affinity of this formulation for tumors and reduction of uptake in the heart. These results suggest that bone-targeted pH-sensitive liposomes containing DOX can be an interesting strategy for selectively delivering this drug into bone-tumor sites, increasing its activity, and reducing DOX-related toxicity.

  1. Matrix Metalloproteinases in Bone Resorption, Remodeling, and Repair.

    PubMed

    Paiva, Katiucia B S; Granjeiro, José M

    2017-01-01

    Matrix metalloproteinases (MMPs) are the major protease family responsible for the cleavage of the matrisome (global composition of the extracellular matrix (ECM) proteome) and proteins unrelated to the ECM, generating bioactive molecules. These proteins drive ECM remodeling, in association with tissue-specific and cell-anchored inhibitors (TIMPs and RECK, respectively). In the bone, the ECM mediates cell adhesion, mechanotransduction, nucleation of mineralization, and the immobilization of growth factors to protect them from damage or degradation. Since the first description of an MMP in bone tissue, many other MMPs have been identified, as well as their inhibitors. Numerous functions have been assigned to these proteins, including osteoblast/osteocyte differentiation, bone formation, solubilization of the osteoid during bone resorption, osteoclast recruitment and migration, and as a coupling factor in bone remodeling under physiological conditions. In turn, a number of pathologies, associated with imbalanced bone remodeling, arise mainly from MMP overexpression and abnormalities of the ECM, leading to bone osteolysis or bone formation. In this review, we will discuss the functions of MMPs and their inhibitors in bone cells, during bone remodeling, pathological bone resorption (osteoporosis and bone metastasis), bone repair/regeneration, and emergent roles in bone bioengineering. © 2017 Elsevier Inc. All rights reserved.

  2. M2 polarization of macrophages by Oncostatin M in hypoxic tumor microenvironment is mediated by mTORC2 and promotes tumor growth and metastasis.

    PubMed

    Shrivastava, Richa; Asif, Mohammad; Singh, Varsha; Dubey, Parul; Ahmad Malik, Showkat; Lone, Mehraj-U-Din; Tewari, Brij Nath; Baghel, Khemraj Singh; Pal, Subhashis; Nagar, Geet Kumar; Chattopadhyay, Naibedya; Bhadauria, Smrati

    2018-04-03

    Oncostatin M (OSM), an inflammatory cytokine belonging to the interleukin-6 (IL-6) superfamily, plays a vital role in multitude of physiological and pathological processes. Its role in breast tumor progression and metastasis to distant organs is well documented. Recent reports implicate OSM in macrophage M2 polarization, a key pro-tumoral phenomenon. M2 polarization of macrophages is believed to promote tumor progression by potentiating metastasis and angiogenesis. In the current study, we delineated the mechanism underlying OSM induced macrophage M2 polarization. The findings revealed that OSM skews macrophages towards an M2 polarized phenotype via mTOR signaling complex 2 (mTORC2). mTORC2 relays signals through two effector kinases i.e. PKC-α and Akt. Our results indicated that mTORC2 mediated M2 polarization of macrophages is not dependent on PKC-α and is primarily affected via Akt, particularly Akt1. In vivo studies conducted on 4T1/BALB/c mouse orthotropic model of breast cancer further corroborated these observations wherein i.v. reintroduction of mTORC2 abrogated monocytes into orthotropic mouse model resulted in diminished acquisition of M2 specific attributes by tumor associated macrophages. Metastasis to distant organs like lung, liver and bone was reduced as evident by decrease in formation of focal metastatic lesions in mTORC2 abrogated monocytes mice. Our study pinpoints key role of mTORC2-Akt1 axis in OSM induced macrophage polarization and suggests for possible usage of Oncostatin-M blockade and/or selective mTORC2 inhibition as a potential anti-cancer strategy particularly with reference to metastasis of breast cancer to distant organs such as lung, liver and bone. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Incidence of hypocalcemia in patients receiving denosumab for prevention of skeletal-related events in bone metastasis.

    PubMed

    Yerram, Prakirthi; Kansagra, Shraddha; Abdelghany, Osama

    2017-04-01

    Background Denosumab therapy is commonly used for the prevention of skeletal-related events in patients with bone metastasis. However, a common side effect of denosumab is hypocalcemia. Objective The aim of the study is to determine the incidence of hypocalcemia in patients receiving denosumab for prevention of skeletal-related events in bone metastasis and evaluate risk factors for developing hypocalcemia. Methods This was a retrospective medication use evaluation reviewing the incidence of hypocalcemia in patients receiving outpatient denosumab for prevention of skeletal-related events at Yale-New Haven Hospital. Additionally, various risk factors were reviewed to determine their risk of developing hypocalcemia. Results As per Common Terminology Criteria for Adverse Events v4.03, of the 106 patients included in the study population, 37 (35%) patients had an incidence of hypocalcemia within 30 days of denosumab administration. Fourteen patients (13.2%) had an incidence of grade 1, 13 patients (12.3%) had an incidence of grade 2 hypocalcemia, and 7 patients (6.6%) had an incidence of grade 3 hypocalcemia. Grade 4 hypocalcemia occurred in three (2.8%) patients. Calcium supplementation did not decrease the risk of developing hypocalcemia. Patients who had one or more episodes of acute kidney insufficiency were at a higher risk of developing hypocalcemia (odds ratio = 7.5 (95% confidence interval = 1.8-36.3), p = 0.001). Conclusion This study found that the overall incidence of hypocalcemia and severe hypocalcemia was higher than reported in clinical trials. Additionally, calcium supplementation did not have an effect on incidence of hypocalcemia, while patients who experienced acute kidney insufficiency while on denosumab had a higher likelihood of developing hypocalcemia.

  4. miR-7 suppresses brain metastasis of breast cancer stem-like cells by modulating KLF4

    PubMed Central

    Okuda, Hiroshi; Xing, Fei; Pandey, Puspa R; Sharma, Sambad; Watabe, Misako; Pai, Sudha K.; Mo, Yin-Yuan; Iiizumi-Gairani, Megumi; Hirota, Shigeru; Liu, Yin; Wu, Kerui; Pochampally, Radhika; Watabe, Kounosuke

    2012-01-01

    Despite significant improvement in survival rates of breast cancer patients, prognosis of metastatic disease is still dismal. Cancer stem-like cells (CSCs) are considered to play a role in metastatic progression of breast cancer; however, the exact pathological role of CSCs is yet to be elucidated. In this report, we found that CSCs (CD24−/CD44+/ESA+) isolated from metastatic breast cell lines are significantly more metastatic than non-CSC populations in an organ specific manner. The results of our microRNA profile analysis for these cells revealed that CSCs that are highly metastatic to bone and brain expressed significantly lower level of miR-7 and that this microRNA was capable of modulating one of the essential genes for induced pluripotent stem cell, KLF4. Interestingly, high expression of KLF4 was significantly and inversely correlated to brain- but not bone-metastasis free survival of breast cancer patients, and we indeed found that the expression of miR-7 significantly suppressed the ability of CSCs to metastasize to brain but not to bone in our animal model. We also examined the expression of miR-7 and KLF4 in brain-metastatic lesions and found that these genes were significantly down- or up-regulated, respectively, in the tumor cells in brain. Furthermore, the results of our in vitro experiments indicate that miR-7 attenuates the abilities of invasion and self-renewal of CSCs by modulating KLF4 expression. These results suggest that miR-7 and KLF4 may serve as biomarkers or therapeutic targets for brain metastasis of breast cancer. PMID:23384942

  5. Direct Melanoma Cell Contact Induces Stromal Cell Autocrine Prostaglandin E2-EP4 Receptor Signaling That Drives Tumor Growth, Angiogenesis, and Metastasis.

    PubMed

    Inada, Masaki; Takita, Morichika; Yokoyama, Satoshi; Watanabe, Kenta; Tominari, Tsukasa; Matsumoto, Chiho; Hirata, Michiko; Maru, Yoshiro; Maruyama, Takayuki; Sugimoto, Yukihiko; Narumiya, Shuh; Uematsu, Satoshi; Akira, Shizuo; Murphy, Gillian; Nagase, Hideaki; Miyaura, Chisato

    2015-12-11

    The stromal cells associated with tumors such as melanoma are significant determinants of tumor growth and metastasis. Using membrane-bound prostaglandin E synthase 1 (mPges1(-/-)) mice, we show that prostaglandin E2 (PGE2) production by host tissues is critical for B16 melanoma growth, angiogenesis, and metastasis to both bone and soft tissues. Concomitant studies in vitro showed that PGE2 production by fibroblasts is regulated by direct interaction with B16 cells. Autocrine activity of PGE2 further regulates the production of angiogenic factors by fibroblasts, which are key to the vascularization of both primary and metastatic tumor growth. Similarly, cell-cell interactions between B16 cells and host osteoblasts modulate mPGES-1 activity and PGE2 production by the osteoblasts. PGE2, in turn, acts to stimulate receptor activator of NF-κB ligand expression, leading to osteoclast differentiation and bone erosion. Using eicosanoid receptor antagonists, we show that PGE2 acts on osteoblasts and fibroblasts in the tumor microenvironment through the EP4 receptor. Metastatic tumor growth and vascularization in soft tissues was abrogated by an EP4 receptor antagonist. EP4-null Ptger4(-/-) mice do not support B16 melanoma growth. In vitro, an EP4 receptor antagonist modulated PGE2 effects on fibroblast production of angiogenic factors. Our data show that B16 melanoma cells directly influence host stromal cells to generate PGE2 signals governing neoangiogenesis and metastatic growth in bone via osteoclast erosive activity as well as angiogenesis in soft tissue tumors. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Direct Melanoma Cell Contact Induces Stromal Cell Autocrine Prostaglandin E2-EP4 Receptor Signaling That Drives Tumor Growth, Angiogenesis, and Metastasis*

    PubMed Central

    Inada, Masaki; Takita, Morichika; Yokoyama, Satoshi; Watanabe, Kenta; Tominari, Tsukasa; Matsumoto, Chiho; Hirata, Michiko; Maru, Yoshiro; Maruyama, Takayuki; Sugimoto, Yukihiko; Narumiya, Shuh; Uematsu, Satoshi; Akira, Shizuo; Murphy, Gillian; Nagase, Hideaki; Miyaura, Chisato

    2015-01-01

    The stromal cells associated with tumors such as melanoma are significant determinants of tumor growth and metastasis. Using membrane-bound prostaglandin E synthase 1 (mPges1−/−) mice, we show that prostaglandin E2 (PGE2) production by host tissues is critical for B16 melanoma growth, angiogenesis, and metastasis to both bone and soft tissues. Concomitant studies in vitro showed that PGE2 production by fibroblasts is regulated by direct interaction with B16 cells. Autocrine activity of PGE2 further regulates the production of angiogenic factors by fibroblasts, which are key to the vascularization of both primary and metastatic tumor growth. Similarly, cell-cell interactions between B16 cells and host osteoblasts modulate mPGES-1 activity and PGE2 production by the osteoblasts. PGE2, in turn, acts to stimulate receptor activator of NF-κB ligand expression, leading to osteoclast differentiation and bone erosion. Using eicosanoid receptor antagonists, we show that PGE2 acts on osteoblasts and fibroblasts in the tumor microenvironment through the EP4 receptor. Metastatic tumor growth and vascularization in soft tissues was abrogated by an EP4 receptor antagonist. EP4-null Ptger4−/− mice do not support B16 melanoma growth. In vitro, an EP4 receptor antagonist modulated PGE2 effects on fibroblast production of angiogenic factors. Our data show that B16 melanoma cells directly influence host stromal cells to generate PGE2 signals governing neoangiogenesis and metastatic growth in bone via osteoclast erosive activity as well as angiogenesis in soft tissue tumors. PMID:26475855

  7. Prognostic factors in patients with spinal metastasis: a systematic review and meta-analysis.

    PubMed

    Luksanapruksa, Panya; Buchowski, Jacob M; Hotchkiss, William; Tongsai, Sasima; Wilartratsami, Sirichai; Chotivichit, Areesak

    2017-05-01

    Incidence of symptomatic spinal metastasis has increased owing to improvement in treatment of the disease. One of the key factors that influences decision-making is expected patient survival. To our knowledge, no systematic reviews or meta-analysis have been conducted that review independent prognostic factors in spinal metastases. This study aimed to determine independent prognostic factors that affect outcome in patients with metastatic spine disease. This is a systematic literature review and meta-analysis of publications for prognostic factors in spinal metastatic disease. Pooled patient results from cohort and observational studies. Meta-analysis for poor prognostic factors as determined by hazard ratio (HR) and 95% confidential interval (95% CI). We systematically searched relevant publications in PubMed and Embase. The following search terms were used: ("'spinal metastases'" OR "'vertebral metastases'" OR "spinal metastasis" OR 'vertebral metastases') AND ('"prognostic factors"' OR "'survival'"). Inclusion criteria were prospective and retrospective cohort series that report HR and 95% CI of independent prognostic factors from multivariate analysis. Two reviewers independently assessed all papers. The quality of included papers was assessed by using Newcastle-Ottawa Scale for cohort studies and publication bias was assessed by using funnel plot, Begg test, and Egger test. The prognostic factors that were mentioned in at least three publications were pooled. Meta-analysis was performed using HR and 95% CI as the primary outcomes of interest. Heterogeneity was assessed using the I 2 method. A total of 3,959 abstracts (1,382 from PubMed and 2,577 from Embase) were identified through database search and 40 publications were identified through review of cited publications. The reviewers selected a total of 51 studies for qualitative synthesis and 43 studies for meta-analysis. Seventeen poor prognostic factors were identified. These included presence of a neurologic deficit before surgery, non-ambulatory status before radiotherapy (RT), non-ambulatory status before surgery, presence of bone metastases, presence of multiple bone metastases (>2 sites), presence of multiple spinal metastases (>3 sites), development of motor deficit in <7 days before initiating RT, development of motor deficit in <14 days before initiating RT, time interval from cancer diagnosis to RT <15 months, Karnofsky Performance Score (KPS) 10-40, KPS 50-70, KPS<70, Eastern Cooperative Oncology Group (ECOG) grade 3-4, male gender, presence of visceral metastases, moderate growth tumor on Tomita score (TS) classification, and rapid growth tumor on TS classification. Seventeen independent poor prognostic factors were identified in this study. These can be categorized into cancer-specific and nonspecific prognostic factors. A tumor-based prognostic scoring system that combines all specific and general factors may enhance the accuracy of survival prediction in patients with metastatic spine disease. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Osteoprotegerin expression in triple-negative breast cancer cells promotes metastasis.

    PubMed

    Weichhaus, Michael; Segaran, Prabu; Renaud, Ashleigh; Geerts, Dirk; Connelly, Linda

    2014-10-01

    Osteoprotegerin (OPG) is a secreted member of the tumor necrosis factor (TNF) receptor superfamily that has been well characterized as a negative regulator of bone remodeling. OPG is also expressed in human breast cancer tissues and cell lines. In vitro studies suggest that OPG exerts tumor-promoting effects by binding to TNF-related apoptosis inducing ligand (TRAIL), thereby preventing induction of apoptosis. However, the in vivo effect of OPG expression by primary breast tumors has not been characterized. We knocked down OPG expression in MDA-MB-231 and MDA-MB-436 human breast cancer cells using shRNA and siRNA to investigate impact on metastasis in the chick embryo model. We observed a reduction in metastasis with OPG knockdown cells. We found that lowering OPG expression did not alter sensitivity to TRAIL-induced apoptosis; however, the OPG knockdown cells had a reduced level of invasion. In association with this we observed reduced expression of the proteases Cathepsin D and Matrix Metalloproteinase-2 upon OPG knockdown, indicating that OPG may promote metastasis via modulation of protease expression and invasion. We conclude that OPG has a metastasis-promoting effect in breast cancer cells. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  9. Nonspecific iodine accumulation in surgical suture material mimicking follicular thyroid cancer bone metastasis in (131)I scintigraphy.

    PubMed

    Winkens, Thomas; Nietzsche, Sandor; Gottschaldt, Michael; Freesmeyer, Martin

    2014-02-01

    A 23-year-old man with follicular thyroid carcinoma and cervical lymph node metastases showed a clear I focus on the skull after radioiodine therapy; therefore, an osseous metastasis was suspected. I and MRI fusion suggested the I focus to be adjacent to an epicranial suture from an early childhood trepanation for epidural hematoma. Radio-guided surgery found dark brown material to be the source of the radiation and successfully removed the material. Subsequent electron microscopy revealed a thread within the dark brown material, suggesting suture material as the cause of I accumulation.

  10. Targeting Common but Complex Proteoglycans on Breast Cancer Cells and Stem Cells Using Evolutionary Refined Malaria Proteins

    DTIC Science & Technology

    2017-10-01

    heart of C57BL/6 mice resulted in aggressive bone metastasis with an overall penetrance of 50%–60% 1(Fig. 7J). The bone metastases invaded into...metastases, while all control-treated mice died with metastatic disease (p = 0.0196) 1(Fig. 7L). Indeed, the VAR2CSA drug conjugate-treatment 6...CS- conjugated and 15 have been directly associated with human malignant disease (Table S5). To investigate the inter-tumor diversity in expression

  11. The Role of p53 Mutations in Metastasis of Prostate Cancer to Bone

    DTIC Science & Technology

    2004-12-01

    described in Methods xiii. We have shown that the addition of ascorbic acid to MC3T3-El cultures results in increased matrix mineralization (Appendix...suggested that we inject the mice with calcein at 9 days and 2 days prior to euthanasia: as calcein fluoresces following binding to calcium in the bone... calcium deposits: silver lactate staining increases sensitivity and reduces background. Histochem. J., 25, 446-251 (1993) B. A. Scheven, J. S. Milne and

  12. The Clinicopathological Factors Associated with Disease Progression in Luminal A Breast Cancer and Characteristics of Metastasis: A Retrospective Study from A Single Center in China.

    PubMed

    Ye, Jingming; Wang, Wenjun; Xin, Ling; Owen, Sioned; Xu, Ling; Duan, Xuening; Cheng, Yuanjia; Zhang, Hong; Zhang, Shuang; Li, Ting; Liu, Yinhua

    2017-08-01

    This study investigated the clinicopathological factors associated with outcomes in patients with Luminal A breast cancer. Retrospective analysis of the association of clinicopathological factors and breast cancer outcome in 421 patients with newly-diagnosed Luminal-A breast cancer that were enrolled from January 2008 to December 2014. Clinicopathological data were analyzed to validate the relationship with disease-free survival (DFS) and overall survival (OS). Kaplan-Meier curves and log-rank tests were used to analyze the value of clinicopathological factors (tumor size, node status and lymphovascular invasion), and subsequent Cox regression analysis revealed significant prognostic factors. With a median of 61 months follow-up, the 5-year DFS and 5-year OS rate were 98.3% and 99.3%. Cox multivariate regression analysis showed that clinical anatomic stage, tumor size, status of lymph nodes, lymphovascular invasion and systemic treatment are strong prognostic factors for clinical outcome in patients with Luminal-A breast cancer. Of all 413 patients with stage I-III breast cancer, 14 presented with metastasis (3.4%) during the follow up. Bone (6/14, 42.9%) was the most common site of metastasis followed by liver (5/14, 35.7%) and lung (4/14, 28.6%). The median survival time after metastasis was 20.4 months. Of all the sites of distant metastasis, liver metastasis was the only factor that affected survival time after metastasis (χ 2 =6.263, p=0.012). Patients with Luminal A breast cancer have excellent outcomes. Liver metastasis is an important factor compressing the survival time after distant metastasis presents. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  13. Staging Lung Cancer: Metastasis.

    PubMed

    Shroff, Girish S; Viswanathan, Chitra; Carter, Brett W; Benveniste, Marcelo F; Truong, Mylene T; Sabloff, Bradley S

    2018-05-01

    The updated eighth edition of the tumor, node, metastasis (TNM) classification for lung cancer includes revisions to T and M descriptors. In terms of the M descriptor, the classification of intrathoracic metastatic disease as M1a is unchanged from TNM-7. Extrathoracic metastatic disease, which was classified as M1b in TNM-7, is now subdivided into M1b (single metastasis, single organ) and M1c (multiple metastases in one or multiple organs) descriptors. In this article, the rationale for changes in the M descriptors, the utility of preoperative staging with PET/computed tomography, and the treatment options available for patients with oligometastatic disease are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Amphiregulin enhances intercellular adhesion molecule-1 expression and promotes tumor metastasis in human osteosarcoma

    PubMed Central

    Liu, Ju-Fang; Tsao, Ya-Ting; Hou, Chun-Han

    2015-01-01

    Osteosarcoma is a common, high malignant, and metastatic bone cancer. Amphiregulin (AREG) has been associated with cancer cellular activities. However, the effect of AREG on metastasis activity in human osteosarcoma cells has yet to be determined. We determined that AREG increases the expression of intercellular adhesion molecule-1 (ICAM-1) through PI3K/Akt signaling pathway via its interaction with the epidermal growth factor receptor, thus resulting in the enhanced cell migration of osteosarcoma. Furthermore, AREG stimulation increased the association of NF-κB to ICAM-1 promoter which then up-regulated ICAM-1 expression. Finally, we observed that shRNA silencing of AREG decreased osteosarcoma metastasis in vivo. Our findings revealed a relationship between osteosarcoma metastatic potential and AREG expression and the modulating effect of AREG on ICAM-1 expression. PMID:26503469

  15. Ovarian Cancer-Related Hypophosphatemic Osteomalacia—A Case Report

    PubMed Central

    Lin, Hung-An; Shih, Shyang-Rong; Tseng, Yu-Ting; Chen, Chi-Hau; Chiu, Wei-Yih; Hsu, Chih-Yao

    2014-01-01

    Context: Tumor-induced osteomalacia (TIO) is a rare paraneoplastic syndrome caused primarily by benign mesenchymal tumors. It has been associated with malignancies in rare cases. High serum levels of fibroblast growth factor (FGF) 23 reported in a group of patients with ovarian cancer had normal serum phosphate levels. There had been no ovarian cancer-related hypophosphatemic osteomalacia in a search of the literature. Objective: We investigated a 57-year-old woman with progressive low back pain. Design and Intervention: Clinical, biochemical, and radiological assessments were performed. The patient's serum phosphate and FGF23 levels were evaluated at baseline and after treatment for ovarian cancer. Results: The patient presented with progressive low back pain and weight loss during the previous 6 months. Imaging studies revealed low bone mineral density and multiple suspicious spinal metastatic lesions. Laboratory examination showed hypophosphatemia, hyperphosphaturia, normocalcemia, an elevated serum alkaline phosphatase level, and an elevated serum FGF23 level. Because TIO was suspected, a tumor survey was performed, and ovarian carcinoma with multiple metastasis was detected. After surgery and chemotherapy treatments for ovarian cancer, the serum phosphate and FGF23 levels returned to normal, and the low back pain improved. Conclusions: To our knowledge, this is the first case of ovarian cancer-related hypophosphatemic osteomalacia reported in the literature. TIO should be considered in patients with ovarian cancer presenting with weakness, bone pain, and fractures. Investigation of TIO is appropriate when these patients present hypophosphatemia. PMID:25181387

  16. CTC-Endothelial Cell Interactions during Metastasis

    DTIC Science & Technology

    2013-04-01

    endothelial cells via a variety of E-selectin ligands ( ESL ). These ESLs express a unique carbohydrate motif, sLex, which appears to be required for... ESL binding. The chemokine receptor CXCR4 has also been reported to supporting transendothelial migration of prostate cells through bone marrow

  17. Radiotherapeutic and surgical management for newly diagnosed brain metastasis(es): An American Society for Radiation Oncology evidence-based guideline

    PubMed Central

    Tsao, May N.; Rades, Dirk; Wirth, Andrew; Lo, Simon S.; Danielson, Brita L.; Gaspar, Laurie E.; Sperduto, Paul W.; Vogelbaum, Michael A.; Radawski, Jeffrey D.; Wang, Jian Z.; Gillin, Michael T.; Mohideen, Najeeb; Hahn, Carol A.; Chang, Eric L.

    2012-01-01

    Purpose To systematically review the evidence for the radiotherapeutic and surgical management of patients newly diagnosed with intraparenchymal brain metastases. Methods and Materials Key clinical questions to be addressed in this evidence-based Guideline were identified. Fully published randomized controlled trials dealing with the management of newly diagnosed intraparenchymal brain metastases were searched systematically and reviewed. The U.S. Preventative Services Task Force levels of evidence were used to classify various options of management. Results The choice of management in patients with newly diagnosed single or multiple brain metastases depends on estimated prognosis and the aims of treatment (survival, local treated lesion control, distant brain control, neurocognitive preservation). Single brain metastasis and good prognosis (expected survival 3 months or more): For a single brain metastasis larger than 3 to 4 cm and amenable to safe complete resection, whole brain radiotherapy (WBRT) and surgery (level 1) should be considered. Another alternative is surgery and radiosurgery/radiation boost to the resection cavity (level 3). For single metastasis less than 3 to 4 cm, radiosurgery alone or WBRT and radiosurgery or WBRT and surgery (all based on level 1 evidence) should be considered. Another alternative is surgery and radiosurgery or radiation boost to the resection cavity (level 3). For single brain metastasis (less than 3 to 4 cm) that is not resectable or incompletely resected, WBRT and radiosurgery, or radiosurgery alone should be considered (level 1). For nonresectable single brain metastasis (larger than 3 to 4 cm), WBRT should be considered (level 3). Multiple brain metastases and good prognosis (expected survival 3 months or more): For selected patients with multiple brain metastases (all less than 3 to 4 cm), radiosurgery alone, WBRT and radiosurgery, or WBRT alone should be considered, based on level 1 evidence. Safe resection of a brain metastasis or metastases causing significant mass effect and postoperative WBRT may also be considered (level 3). Patients with poor prognosis (expected survival less than 3 months): Patients with either single or multiple brain metastases with poor prognosis should be considered for palliative care with or without WBRT (level 3). It should be recognized, however, that there are limitations in the ability of physicians to accurately predict patient survival. Prognostic systems such as recursive partitioning analysis, and diagnosis-specific graded prognostic assessment may be helpful. Conclusions Radiotherapeutic intervention (WBRT or radiosurgery) is associated with improved brain control. In selected patients with single brain metastasis, radiosurgery or surgery has been found to improve survival and locally treated metastasis control (compared with WBRT alone). PMID:25925626

  18. Paraganglioma with intracranial metastasis: a case report and review of the literature.

    PubMed

    Cai, Peihao; Mahta, Ali; Kim, Ryan Y; Kesari, Santosh

    2012-10-01

    Paragangliomas are rare neuroendocrine tumors of neural crest origin. They are mostly benign, however; malignant tumors with aggressive behavior and distant metastasis can also occur. Intracranial involvement is extremely rare and has been sporadically reported in the literature. Here we report a case who presented with progressive neurologic deficits due to multiple intracranial lesions found to be metastasis from an occult retroperitoneal malignant paraganglioma.

  19. Race does not predict the development of metastases in men with nonmetastatic castration-resistant prostate cancer.

    PubMed

    Whitney, Colette A; Howard, Lauren E; Amling, Christopher L; Aronson, William J; Cooperberg, Matthew R; Kane, Christopher J; Terris, Martha K; Freedland, Stephen J

    2016-12-15

    Although race is associated with prostate cancer progression in early stage disease, once men have advanced disease, it is unclear whether race continues to predict a poor outcome. The authors hypothesized that, in an equal-access setting among patients with castration-resistant prostate cancer (CRPC) and no known metastases (M0/Mx), black men would receive imaging tests at similar rates as nonblack men (ie, there would be an equal opportunity to detect metastases) but would have a higher risk of metastatic disease. In total, 837 men who were diagnosed with M0/Mx CRPC during 2000 through 2014 from 5 Veterans Affairs hospitals in the SEARCH (Shared Equal Access Regional Cancer Hospital) database were analyzed. Data on all imaging tests after CRPC diagnosis were collected, including date, type, and outcome. Multivariable Cox models were used to test associations between race and the time to first metastasis, first bone metastasis, first bone scan, second bone scan among men who had a negative first bone scan, and overall survival. Black men (n = 306) were equally as likely as nonblack men (n = 531) to receive a first and second bone scan after a diagnosis of CRPC. There were no significant differences in the risk of developing any metastases, bone metastases, time to bone scans, or overall survival between black men and nonblack men (all P > .2). The lack of racial differences in the development of metastases and scanning practices observed in this study suggests that, once men have a diagnosis of M0/Mx CRPC, race may not be a prognostic factor. Efforts to understand prostate cancer racial disparities may derive greater benefit by focusing on the risk of developing prostate cancer and on the outcomes of men who have early stage disease. Cancer 2016;122:3848-3855. © 2016 American Cancer Society. © 2016 American Cancer Society.

  20. Three-Dimensional Characterization of the Vascular Bed in Bone Metastasis of the Rat by Microcomputed Tomography (MicroCT)

    PubMed Central

    Nyangoga, Hervé; Mercier, Philippe; Libouban, Hélène; Baslé, Michel Félix; Chappard, Daniel

    2011-01-01

    Background Angiogenesis contributes to proliferation and metastatic dissemination of cancer cells. Anatomy of blood vessels in tumors has been characterized with 2D techniques (histology or angiography). They are not fully representative of the trajectories of vessels throughout the tissues and are not adapted to analyze changes occurring inside the bone marrow cavities. Methodology/Principal Findings We have characterized the vasculature of bone metastases in 3D at different times of evolution of the disease. Metastases were induced in the femur of Wistar rats by a local injection of Walker 256/B cells. Microfil®, (a silicone-based polymer) was injected at euthanasia in the aorta 12, 19 and 26 days after injection of tumor cells. Undecalcified bones (containing the radio opaque vascular casts) were analyzed by microCT, and a first 3D model was reconstructed. Bones were then decalcified and reanalyzed by microCT; a second model (comprising only the vessels) was obtained and overimposed on the former, thus providing a clear visualization of vessel trajectories in the invaded metaphysic allowing quantitative evaluation of the vascular volume and vessel diameter. Histological analysis of the marrow was possible on the decalcified specimens. Walker 256/B cells induced a marked osteolysis with cortical perforations. The metaphysis of invaded bones became progressively hypervascular. New vessels replaced the major central medullar artery coming from the diaphyseal shaft. They sprouted from the periosteum and extended into the metastatic area. The newly formed vessels were irregular in diameter, tortuous with a disorganized architecture. A quantitative analysis of vascular volume indicated that neoangiogenesis increased with the development of the tumor with the appearance of vessels with a larger diameter. Conclusion This new method evidenced the tumor angiogenesis in 3D at different development times of the metastasis growth. Bone and the vascular bed can be identified by a double reconstruction and allowed a quantitative evaluation of angiogenesis upon time. PMID:21464932

  1. Epigenetic regulator RBP2 is critical for breast cancer progression and metastasis

    PubMed Central

    Cao, Jian; Liu, Zongzhi; Cheung, William K.C.; Zhao, Minghui; Chen, Sophia Y.; Chan, Siew Wee; Booth, Carmen J.; Nguyen, Don X.; Yan, Qin

    2014-01-01

    Summary Metastasis is a major clinical challenge for cancer treatment. Emerging evidence suggests that epigenetic aberrations contribute significantly to tumor formation and progression. However, the drivers and roles of such epigenetic changes in tumor metastasis are still poorly understood. Using bioinformatic analysis of human breast cancer gene expression datasets, we identified histone demethylase RBP2 as a putative mediator of metastatic progression. By using both human breast cancer cells and genetically engineered mice, we demonstrated that RBP2 is critical for breast cancer metastasis to the lung in multiple in vivo models. Mechanistically, RBP2 promotes metastasis as a pleiotropic positive regulator of many metastasis genes. In addition, RBP2 loss suppresses tumor formation in the MMTV-neu transgenic mice. These results suggest that therapeutically targeting RBP2 is a potential strategy to inhibit tumor progression and metastasis. PMID:24582965

  2. Joint-preserving palliative surgery using self-locking screws of intramedullary nail and percutaneous cementoplasty for proximal humeral metastasis in the advanced cancer patients.

    PubMed

    Park, Jong Woong; Kim, Yong-Il; Kang, Hyun Guy; Kim, June Hyuk; Kim, Han Soo

    2018-05-15

    We introduced a palliative joint-preserving surgery using proximal self-locking screws of intramedullary (IM) nail and percutaneous cementoplasty (PC) in patients with proximal humeral metastases, including the head and neck, and evaluated the outcome of the surgical method. Twenty-three patients (mean age = 63.0 ± 11.8 years, M:F = 14:9) had IM nailing with a self-locking screw system and PC for the treatment of humeral head and neck metastases. Usually, three proximal locking screws were inserted after IM nailing, and 20.9 ± 8.0 ml of polymethylmethacrylate (PMMA) bone cement was injected in the perimetal osteolytic area. Regional anesthesia with interscalene block was performed in 87.0% (20/23), and the duration of surgery (from anesthesia to awakening) was approximately 40-55 min. Red blood cell was not transfused intra- and/or postoperatively in 65.2% (15/23). The localized preoperative pain (visual analog scale (VAS), 8.2 ± 3.1) was gradually decreased at postoperative 1 week (VAS, 4.9 ± 2.1) and at 6 weeks (VAS, 2.9 ± 2.1) (P < 0.001). Among nine patients who underwent F-18-FDG PET/CT, the proximal humeral metastasis around PC showed improved, stable, and aggravated states in five (55.6%), three (33.3%), and one patient (11.1%), respectively. Meanwhile, 88.8% (8/9) of patients showed aggravation at the naive bone metastasis area. The selection of the self-locking screw type of the IM nail and PC was helpful in preventing fixation failure for joint-preserving palliative surgery in the proximal humeral metastasis.

  3. Discoidin Domain Receptors: Novel Targets in Breast Cancer Bone Metastasis

    DTIC Science & Technology

    2017-02-01

    BrCa cases with different molecular subtypes, and found a significant inverse association between cytoplasmic DDR1 localization and progesterone...DDR1 antibody, and completed the study of DDR1 expression and association with disease progression with one TMA. We found a significant inverse

  4. Tumor cell-targeted delivery of CRISPR/Cas9 by aptamer-functionalized lipopolymer for therapeutic genome editing of VEGFA in osteosarcoma.

    PubMed

    Liang, Chao; Li, Fangfei; Wang, Luyao; Zhang, Zong-Kang; Wang, Chao; He, Bing; Li, Jie; Chen, Zhihao; Shaikh, Atik Badshah; Liu, Jin; Wu, Xiaohao; Peng, Songlin; Dang, Lei; Guo, Baosheng; He, Xiaojuan; Au, D W T; Lu, Cheng; Zhu, Hailong; Zhang, Bao-Ting; Lu, Aiping; Zhang, Ge

    2017-12-01

    Osteosarcoma (OS) is a highly aggressive pediatric cancer, characterized by frequent lung metastasis and pathologic bone destruction. Vascular endothelial growth factor A (VEGFA), highly expressed in OS, not only contributes to angiogenesis within the tumor microenvironment via paracrine stimulation of vascular endothelial cells, but also acts as an autocrine survival factor for tumor cell themselves, thus making it a promising therapeutic target for OS. CRISPR/Cas9 is a versatile genome editing technology and holds tremendous promise for cancer treatment. However, a major bottleneck to achieve the therapeutic potential of the CRISPR/Cas9 is the lack of in vivo tumor-targeted delivery systems. Here, we screened an OS cell-specific aptamer (LC09) and developed a LC09-functionalized PEG-PEI-Cholesterol (PPC) lipopolymer encapsulating CRISPR/Cas9 plasmids encoding VEGFA gRNA and Cas9. Our results demonstrated that LC09 facilitated selective distribution of CRISPR/Cas9 in both orthotopic OS and lung metastasis, leading to effective VEGFA genome editing in tumor, decreased VEGFA expression and secretion, inhibited orthotopic OS malignancy and lung metastasis, as well as reduced angiogenesis and bone lesion with no detectable toxicity. The delivery system simultaneously restrained autocrine and paracrine VEGFA signaling in tumor cells and could facilitate translating CRISPR-Cas9 into clinical cancer treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Ipsilateral breast metastasis from a pulmonary adenocarcinoma: a case report and a focused review of the literature

    PubMed Central

    Shen, Yan-Wei; Sui, Yan-Xia; Zhang, Xiao-Man; Lv, Meng; Zhang, Xiao; Liu, Pei-Jun; Yang, Jin

    2015-01-01

    Metastases to the breast from extramammary malignancies are extremely rare. Ruling out the diagnosis of primary breast tumor is important in order to decide on clinical management and predict prognosis. We report a case of metastasis to the breast from a pulmonary adenocarcinoma, with extensive micropapillary component, diagnosed concomitantly with the primary tumor. A 52 year-old female patient presented with mammary gland tingling and dyspnea accompanied with fatigued of 4 months duration and a nodular shadows in the front of the upper lobe was found on a chest computed tomography (CT) scan. The original clinical diagnosis was right breast cancer with lung and bone metastasis, or breast and lung double primary cancers. In addition,on physical examination a poorly defined mass was noted in the upper outer quadrant of the right breast. The patient underwent thoracocentesis and breast biopsy. By imageology, cytology, histology and immunohistochemistry, we diagnosed primary lung cancer with metastases to the right breast and bone. The metastatic anatomic sites demonstrated histologically extensive micropapillary component, which is recently recognized as an important prognostic factor. The patient was administered 4 cycles of cisplatin and docetaxel, although no clinical response was seen, the patient is still alive 9 months after diagnosis. The result of immunohistochemistry is a useful supplement in differential diagnosis. PMID:26464732

  6. The systemic delivery of an oncolytic adenovirus expressing decorin inhibits bone metastasis in a mouse model of human prostate cancer

    DOE PAGES

    Xu, Weidong; Neill, Thomas; Yang, Yuefeng; ...

    2014-12-11

    In an effort to develop a new therapy for prostate cancer bone metastases, we have created Ad.dcn, a recombinant oncolytic adenovirus carrying the human decorin gene. Infection of PC-3 and DU-145, the human prostate tumor cells, with Ad.dcn or a non-replicating adenovirus Ad(E1-).dcn resulted in decorin expression; Ad.dcn produced high viral titers and cytotoxicity in human prostate tumor cells. Adenoviral-mediated decorin expression inhibited Met, the Wnt/β- catenin signaling axis, vascular endothelial growth factor A, reduced mitochondrial DNA levels, and inhibited tumor cell migration. To examine the anti-tumor response of Ad.dcn, PC-3-luc cells were inoculated in the left heart ventricle tomore » establish bone metastases in nude mice. Ad.dcn, in conjunction with control replicating and non-replicating vectors were injected via tail vein. The real-time monitoring of mice, once a week, by bioluminescence imaging and X-ray radiography showed that Ad.dcn produced significant inhibition of skeletal metastases. Analyses of the mice at the terminal time point indicated a significant reduction in the tumor burden, osteoclast number, serum TRACP 5b levels, osteocalcin levels, hypercalcemia, inhibition of cancer cachexia, and an increase in the animal survival. Finally, based on these studies, we believe that Ad.dcn can be developed as a potential new therapy for prostate cancer bone metastasis.« less

  7. Stroma-induced Jagged1 expression drives PC3 prostate cancer cell migration; disparate effects of RIP-generated proteolytic fragments on cell behaviour and Notch signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Delury, Craig, E-mail: c.delury@lancaster.ac.uk; Hart, Claire, E-mail: claire.hart@manchester.ac.uk; Brown, Mick, E-mail: michael.brown@ics.manchester.ac.uk

    The Notch ligand Jagged1 is subject to regulated intramembrane proteolysis (RIP) which yields a soluble ectodomain (sJag) and a soluble Jagged1 intracellular domain (JICD). The full-length Jagged1 protein enhances prostate cancer (PCa) cell proliferation and is highly expressed in metastatic cells. However, little is known regarding the mechanisms by which Jagged1 or its RIP-generated fragments might promote PCa bone metastasis. In the current study we show that bone marrow stroma (BMS) induces Jagged1 expression in bone metastatic prostate cancer PC3 cells and that this enhanced expression is mechanistically linked to the promotion of cell migration. We also show that RIP-generatedmore » Jagged1 fragments exert disparate effects on PC3 cell behaviour and Notch signaling. In conclusion, the expression of both the full-length ligand and its RIP-generated fragments must be considered in tandem when attempting to regulate Jagged1 as a possible PCa therapy. - Highlights: • Bone marrow stroma induces Jagged1 expression in prostate cancer (PCa) PC3 cells. • This enhanced expression of full-length Jagged1 is required for PC3 cell migration. • Proteolytic fragments of Jagged1 exert disparate effects on PC3 cell behaviour. • Effects of fragments on cell behaviour do not correlate with Notch signaling. • Effects of Jagged1 and its fragments on PCa metastasis likely to be complex.« less

  8. Are serial bone scans useful for the follow-up of clinically localized, low to intermediate grade prostate cancer managed with watchful observation alone?

    PubMed

    Yap, B K; Choo, R; Deboer, G; Klotz, L; Danjoux, C; Morton, G

    2003-05-01

    To assess the predictive value of serial bone scans as a surveillance tool for bone metastasis in men with clinically localized prostate cancer and managed with watchful observation. A prospective single-arm study was conducted to assess the feasibility of a watchful observation protocol with selective delayed intervention for patients with clinically localized prostate cancer, i.e. T1b-T2bN0M0, a Gleason score of 15 ng/mL the patient underwent bone scintigraphy every year. In all, 244 eligible patients were enrolled into the study. With a median follow-up of 30 months, 449 bone scans were taken (150 at baseline and 299 in follow-up evaluations); all 299 follow-up scans were negative for bone metastasis. Hence, the true rate of positive follow-up bone scans was estimated to be 0-1.0% (95% confidence). In all, 171 patients had at least one follow-up bone scan; of these, the number (%) of patients who had 1, 2, 3, 4 and >or= 5 follow-up scans was 89 (52), 53 (31), 17 (10), eight (4.7) and four (2.3), respectively. The PSA levels (ng/mL) corresponding to all follow-up bone scans were: 214 scans at PSA < 10, 61 at 10-14.9, 18 at 15-19.9 and six at >or= 20 (range 20.2-24.9). The probability of a negative bone scan was estimated to be 88-100% (95% confidence interval) when a PSA threshold of 15 ng/mL was used. The probability of positive findings in serial bone scans in untreated, localized, low to intermediate grade prostate cancer was low when the follow-up PSA level remained < 15 ng/mL. Avoiding bone scans in this group of patients would translate into a significant cost saving and reduction in their psychological and physical burden. As for those with a follow-up PSA of> 15 ng/mL, the role of serial bone scintigraphy remains undefined, as a longer follow-up and a larger sample are needed.

  9. Paeonol Suppresses Chondrosarcoma Metastasis through Up-Regulation of miR-141 by Modulating PKCδ and c-Src Signaling Pathway

    PubMed Central

    Horng, Chi-Ting; Shieh, Po-Chuen; Tan, Tzu-Wei; Yang, Wei-Hung; Tang, Chih-Hsin

    2014-01-01

    Chondrosarcoma, a primary malignant bone cancer, has potential for local invasion and distant metastasis, especially to the lungs. Patients diagnosed with it show poor prognosis. Paeonol (2'-hydroxy-4'-methoxyacetophenone), the main active compound of traditional Chinese remedy Paeonia lactiflora Pallas, exhibits anti-inflammatory and anti-tumor activity; whether paeonol regulates metastatic chondrosarcoma is largely unknown. Here, we find paeonol do not increase apoptosis. By contrast, at non-cytotoxic concentrations, paeonol suppresses migration and invasion of chondrosarcoma cells. We also demonstrate paeonol enhancing miR-141 expression and miR-141 inhibitor reversing paeonol-inhibited cell motility; paeonol also reduces protein kinase C (PKC)δ and c-Src kinase activity. Since paeonol inhibits migration and invasion of human chondrosarcoma via up-regulation of miR-141 via PKCδ and c-Src pathways, it thus might be a novel anti-metastasis agent for treatment of metastatic chondrosarcoma. PMID:24992595

  10. Recurrent malignant pheochromocytoma with unusual omental metastasis: 68Ga-DOTANOC PET/CT and 131I-MIBG SPECT/CT scintigraphy findings

    PubMed Central

    Arora, Saurabh; Agarwal, Krishan Kant; Karunanithi, Sellam; Tripathi, Madhavi; Kumar, Rakesh

    2014-01-01

    Pheochromocytomas are rare catecholamine-secreting tumors derived from the sympathetic nervous system. The most common sites of metastasis for pheochromocytoma or extra-adrenal paraganglioma are lymph nodes, bones, lungs, and liver. Patients with known or suspected malignancy should undergo staging with computed tomography (CT) or magnetic resonance imaging as well as functional imaging (e.g. with 123I/131I-MIBG (131I-metaiodobenzylguanidine) and 68Ga-DOTANOC (68Ga-labeled [1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid]-1-NaI3-octreotide) positron emission tomography (PET)/CT) to determine the extent and location of disease. We present a case of recurrent malignant pheochromocytoma with unusual site of metastasis in omentum, which was positive on 68Ga-DOTANOC PET/CT and 131I-MIBG single-photon emission computed tomography (SPECT/)/CT scintigraphy. PMID:25400380

  11. Recurrent malignant pheochromocytoma with unusual omental metastasis: (68)Ga-DOTANOC PET/CT and (131)I-MIBG SPECT/CT scintigraphy findings.

    PubMed

    Arora, Saurabh; Agarwal, Krishan Kant; Karunanithi, Sellam; Tripathi, Madhavi; Kumar, Rakesh

    2014-10-01

    Pheochromocytomas are rare catecholamine-secreting tumors derived from the sympathetic nervous system. The most common sites of metastasis for pheochromocytoma or extra-adrenal paraganglioma are lymph nodes, bones, lungs, and liver. Patients with known or suspected malignancy should undergo staging with computed tomography (CT) or magnetic resonance imaging as well as functional imaging (e.g. with (123)I/(131)I-MIBG ((131)I-metaiodobenzylguanidine) and (68)Ga-DOTANOC ((68)Ga-labeled [1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid]-1-NaI3-octreotide) positron emission tomography (PET)/CT) to determine the extent and location of disease. We present a case of recurrent malignant pheochromocytoma with unusual site of metastasis in omentum, which was positive on (68)Ga-DOTANOC PET/CT and (131)I-MIBG single-photon emission computed tomography (SPECT/)/CT scintigraphy.

  12. Breast cancer metastatic to the kidney with renal vein involvement.

    PubMed

    Nasu, Hatsuko; Miura, Katsutoshi; Baba, Megumi; Nagata, Masao; Yoshida, Masayuki; Ogura, Hiroyuki; Takehara, Yasuo; Sakahara, Harumi

    2015-02-01

    The common sites of breast cancer metastases include bones, lung, brain, and liver. Renal metastasis from the breast is rare. We report a case of breast cancer metastatic to the kidney with extension into the renal vein. A 40-year-old woman had undergone left mastectomy for breast cancer at the age of 38. A gastric tumor, which was later proved to be metastasis from breast cancer, was detected by endoscopy. Computed tomography performed for further examination of the gastric tumor revealed a large left renal tumor with extension into the left renal vein. It mimicked a primary renal tumor. Percutaneous biopsy of the renal tumor confirmed metastasis from breast cancer. Surgical intervention of the stomach and the kidney was avoided, and she was treated with systemic chemotherapy. Breast cancer metastatic to the kidney may present a solitary renal mass with extension into the renal vein, which mimics a primary renal tumor.

  13. Development of Raman spectral markers to assess metastatic bone in breast cancer

    PubMed Central

    Ding, Hao; Nyman, Jeffry S.; Sterling, Julie A.; Perrien, Daniel S.; Mahadevan-Jansen, Anita; Bi, Xiaohong

    2014-01-01

    Abstract. Bone is the most common site for breast cancer metastases. One of the major complications of bone metastasis is pathological bone fracture caused by chronic bone loss and degeneration. Current guidelines for the prediction of pathological fracture mainly rely on radiographs or computed tomography, which are limited in their ability to predict fracture risk. The present study explored the feasibility of using Raman spectroscopy to estimate pathological fracture risk by characterizing the alterations in the compositional properties of metastatic bones. Tibiae with evident bone destruction were investigated using Raman spectroscopy. The carbonation level calculated by the ratio of carbonate/phosphate ν1 significantly increased in the tumor-bearing bone at all the sampling regions at the proximal metaphysis and diaphysis, while tumor-induced elevation in mineralization and crystallinity was more pronounced in the metaphysis. Furthermore, the increased carbonation level is positively correlated to bone lesion size, indicating that this parameter could serve as a unique spectral marker for tumor progression and bone loss. With the promising advances in the development of spatially offset Raman spectroscopy for deep tissue measurement, this spectral marker can potentially be used for future noninvasive evaluation of metastatic bone and prediction of pathological fracture risk. PMID:24933683

  14. Development of Raman spectral markers to assess metastatic bone in breast cancer

    NASA Astrophysics Data System (ADS)

    Ding, Hao; Nyman, Jeffry S.; Sterling, Julie A.; Perrien, Daniel S.; Mahadevan-Jansen, Anita; Bi, Xiaohong

    2014-11-01

    Bone is the most common site for breast cancer metastases. One of the major complications of bone metastasis is pathological bone fracture caused by chronic bone loss and degeneration. Current guidelines for the prediction of pathological fracture mainly rely on radiographs or computed tomography, which are limited in their ability to predict fracture risk. The present study explored the feasibility of using Raman spectroscopy to estimate pathological fracture risk by characterizing the alterations in the compositional properties of metastatic bones. Tibiae with evident bone destruction were investigated using Raman spectroscopy. The carbonation level calculated by the ratio of carbonate/phosphate ν1 significantly increased in the tumor-bearing bone at all the sampling regions at the proximal metaphysis and diaphysis, while tumor-induced elevation in mineralization and crystallinity was more pronounced in the metaphysis. Furthermore, the increased carbonation level is positively correlated to bone lesion size, indicating that this parameter could serve as a unique spectral marker for tumor progression and bone loss. With the promising advances in the development of spatially offset Raman spectroscopy for deep tissue measurement, this spectral marker can potentially be used for future noninvasive evaluation of metastatic bone and prediction of pathological fracture risk.

  15. Predictive significance of bone sialoprotein and osteopontin for bone metastases in resected Chinese non-small-cell lung cancer patients: a large cohort retrospective study.

    PubMed

    Zhang, Li; Hou, Xue; Lu, Shun; Rao, Huilan; Hou, Jinghui; Luo, Rongzhen; Huang, He; Zhao, Hongyun; Jian, Hong; Chen, Zhiwei; Liao, Meilin; Wang, Xin

    2010-01-01

    Bone is one of the most common sites of metastasis in patients with non-small-cell lung cancer (NSCLC). Over-expression of bone sialoprotein (BSP) and osteopontin (OPN) in tumour samples has shown prognostic significance in bone metastasis (BM) of breast and prostate cancer, respectively. However, their importance in BM of NSCLC has not been verified. Therefore, we planned a large cohort retrospective study to investigate the relationship between the expression of these two biomarkers (BSP and OPN) and BM in surgically resected NSCLC patients. 180 completely resected NSCLC patients were included in this study. 40 patients subsequently developed BM. Paraffin-embedded primary tumour tissues of patients were supplied to produce a tissue microarray, and immunohistochemistry method was used for evaluation of the expression of BSP and OPN. Different expressions of these two biomarkers among BM group and non-BM group were estimated by chi(2) test. BM-free survival was analyzed by Kaplan-Meier method. The prognostic impact of clinicopathologic variables and biomarker expression was evaluated by Cox proportional hazards model. BSP expression was associated with BM (p=0.007), whereas OPN expression did not reach statistical significance (p=0.245). Univariate analysis showed that expression of BSP (p=0.010) and N staging (p<0.005) was associated with BM-free survival. Multivariate analyses showed BSP expression (HR=3.322, p=0.003), N staging (HR=1.879, p=0.001), and T staging (HR=1.618, p=0.024) were independent prognostic factors for BM. BSP protein expression in the primary resected NSCLC is strongly associated with BM and could be used to identify high-risk patients. Correlation of OPN protein expression and BM needs further investigation.

  16. Cellular Basis for ADT-Induced Acceleration of Sarcopenia

    DTIC Science & Technology

    2015-10-01

    fractures due to 1) the already high incidence of bone metastasis and 2) ADT-induced acceleration in osteoporosis emphasizes the need for other therapies...acceleration in osteoporosis emphasizes the need for other therapies. In order to devise effective therapies, an understanding as to how ADT results in severe

  17. Alterations of the Bone Marrow Microenvironment Contribute to Prostate Cancer Skeletal Metastasis

    DTIC Science & Technology

    2012-05-01

    potential of tumor cells ( Hiraki et al. 2002, Liao & McCauley 2006). Apoptosis induced by disrupted epithelial cell–matrix interactions was described...enhances survival of chondrocytes under conditions that promote apoptotic cell death. Molecular and Cellular Biology 15 4064–4075. Hiraki A, Ueoka H, Bessho

  18. Discoidin Domain Receptors: Novel Targets in Breast Cancer Bone Metastasis

    DTIC Science & Technology

    2017-02-01

    of invasive BrCa cases with different molecular subtypes, and found a significant inverse association between cytoplasmic DDR1 localization and... inverse association between DDR1 cytoplasmic expression and PR expression in the BrCa tissues analyzed. Specific Aim 2, Task 1 and 2: We defined

  19. The histone demethylase KDM3A, and its downstream target MCAM, promote Ewing Sarcoma cell migration and metastasis

    PubMed Central

    Sechler, Marybeth; Parrish, Janet K.; Birks, Diane K.; Jedlicka, Paul

    2017-01-01

    Ewing Sarcoma is the second most common solid pediatric malignant neoplasm of bone and soft tissue. Driven by EWS/Ets, or rarely variant, oncogenic fusions, Ewing Sarcoma is a biologically and clinically aggressive disease with a high propensity for metastasis. However, the mechanisms underpinning Ewing Sarcoma metastasis are currently not well understood. In the present study, we identify and characterize a novel metastasis-promotional pathway in Ewing Sarcoma, involving the histone demethylase KDM3A, previously identified by our laboratory as a new cancer-promoting gene in this disease. Using global gene expression profiling, we show that KDM3A positively regulates genes and pathways implicated in cell migration and metastasis, and demonstrate, using functional assays, that KDM3A promotes migration in vitro and experimental, post-intravasation, metastasis in vivo. We further identify the Melanoma Cell Adhesion Molecule (MCAM) as a novel KDM3A target gene in Ewing Sarcoma, and an important effector of KDM3A pro-metastatic action. Specifically, we demonstrate that MCAM depletion, like KDM3A depletion, inhibits cell migration in vitro and experimental metastasis in vivo, and that MCAM partially rescues impaired migration due to KDM3A knock-down. Mechanistically, we show that KDM3A regulates MCAM expression both through a direct mechanism, involving modulation of H3K9 methylation at the MCAM promoter, and an indirect mechanism, via the Ets1 transcription factor. Lastly, we identify an association between high MCAM levels in patient tumors and poor survival, in two different Ewing Sarcoma clinical cohorts. Taken together, our studies uncover a new metastasis-promoting pathway in Ewing Sarcoma, with therapeutically targetable components. PMID:28319067

  20. Arachidonic Acid Metabolite as a Novel Therapeutic Target in Breast Cancer Metastasis

    PubMed Central

    Borin, Thaiz F.; Angara, Kartik; Rashid, Mohammad H.; Achyut, Bhagelu R.; Arbab, Ali S.

    2017-01-01

    Metastatic breast cancer (BC) (also referred to as stage IV) spreads beyond the breast to the bones, lungs, liver, or brain and is a major contributor to the deaths of cancer patients. Interestingly, metastasis is a result of stroma-coordinated hallmarks such as invasion and migration of the tumor cells from the primary niche, regrowth of the invading tumor cells in the distant organs, proliferation, vascularization, and immune suppression. Targeted therapies, when used as monotherapies or combination therapies, have shown limited success in decreasing the established metastatic growth and improving survival. Thus, novel therapeutic targets are warranted to improve the metastasis outcomes. We have been actively investigating the cytochrome P450 4 (CYP4) family of enzymes that can biosynthesize 20-hydroxyeicosatetraenoic acid (20-HETE), an important signaling eicosanoid involved in the regulation of vascular tone and angiogenesis. We have shown that 20-HETE can activate several intracellular protein kinases, pro-inflammatory mediators, and chemokines in cancer. This review article is focused on understanding the role of the arachidonic acid metabolic pathway in BC metastasis with an emphasis on 20-HETE as a novel therapeutic target to decrease BC metastasis. We have discussed all the significant investigational mechanisms and put forward studies showing how 20-HETE can promote angiogenesis and metastasis, and how its inhibition could affect the metastatic niches. Potential adjuvant therapies targeting the tumor microenvironment showing anti-tumor properties against BC and its lung metastasis are discussed at the end. This review will highlight the importance of exploring tumor-inherent and stromal-inherent metabolic pathways in the development of novel therapeutics for treating BC metastasis. PMID:29292756

  1. Facial paralysis caused by metastasis of breast carcinoma to the temporal bone.

    PubMed

    Lan, Ming-Ying; Shiao, An-Suey; Li, Wing-Yin

    2004-11-01

    Metastatic tumors to the temporal bone are very rare. The most common sites of origin of temporal bone metastases are breast, lung, kidney, gastrointestinal tract, larynx, prostate gland, and thyroid gland. The pathogenesis of spread to the temporal bone is most commonly by the hematogenous route. The common otologic symptoms that manifest with facial nerve paralysis are often thought to be due to a mastoid infection. Here is a report on a case of breast carcinoma presenting with otalgia, otorrhea, and facial paralysis for 2 months. The patient was initially diagnosed as mastoiditis, and later the clinical impression was revised to metastatic breast carcinoma to temporal bone, based on the pathologic findings. Metastatic disease should be considered as a possible etiology in patients with a clinical history of malignant neoplasms presenting with common otologic or vestibular symptoms, especially with facial nerve paralysis.

  2. Pancreatic Extraskeletal Osteosarcoma Metastasizing to the Scalp.

    PubMed

    Kim, Young Jae; Kim, Hak Tae; Won, Chong Hyun; Chang, Sung Eun; Lee, Mi Woo; Choi, Jee Ho; Lee, Woo Jin

    2018-06-01

    Extraskeletal osteosarcoma (ESOS) is a rare mesenchymal soft-tissue neoplasm that accounts for approximately 1% of all soft-tissue sarcomas. Over 70% of these malignant tumor progress to local recurrence and metastasis. It commonly metastasizes to the lungs, lymph nodes, bone, and skin and has a poor survival outcome. Cutaneous metastasis is exceedingly rare and known to be a sign of widespread metastases. We present a 57-year-old woman who presented with a rapidly growing protuberant mass on the scalp that was finally diagnosed as metastatic ESOS from a primary pancreatic ESOS. To our knowledge, there has been no reported case of pancreatic ESOS metastasizing to the scalp.

  3. Solitary pancreatic head metastasis from tibial adamantinoma: a rare indication to pancreaticoduodenectomy

    PubMed Central

    Silvestri, S; Sandrucci, S; Comandone, A; Molinaro, L; Chiusa, L; Fronda, G R; Franchello, A

    2018-01-01

    Abstract Pancreatic metastases are rare, <2% of all pancreatic neoplasia. This is the first case of pancreatic metastasis from adamantinoma, a rare, low grade and slow growing tumor which is frequently localized in long bones. We describe a case of a 45-year-old woman presenting with increased bilirubin level. Computed tomography and ecoendoscopic ultra sonography revealed a pancreatic head mass. Fine-needle aspiration biopsy was consistent with metastatic adamantinoma. The patient was submitted to a standard pancreaticoduodenectomy. As in the case presented, standard pancreatic resections are safe and feasible options to treat non-pancreatic primary tumor improving patient’s survival and quality of life. PMID:29479415

  4. Giant cell tumour 2nd metatarsal-Result with en-bloc excision and autologous fibular grafting.

    PubMed

    Agarwal, Saurabh; Chawla, Sumit; Agarwal, Sippy; Agarwal, Puneet

    2015-12-01

    Giant cell tumour (GCT) of the small bones is relatively uncommon tumour. It occurs most commonly in the distal portions of femur and radius and proximal end of tibia. GCT of small bones presents at advanced stages with major bony destruction. These tumours represent more aggressive course; associated with increased local recurrence rates (40%) and metastasis. Various treatment modalities like en-bloc resection, cryosurgery, intralesional curettage with burring/phenolization or bone cement are available. In our case en-bloc resection with reconstruction using nonvascular autogenous fibular strut graft was used in patient of 2nd metatarsal GCT and a favourable functional outcome was observed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Differential Impact of Adenosine Nucleotides Released by Osteocytes on Breast Cancer Growth and Bone Metastasis

    PubMed Central

    Zhou, Jade Z.; Riquelme, Manuel A.; Gao, Xiaoli; Ellies, Lesley G.; Sun, Lu-Zhe; Jiang, Jean X.

    2015-01-01

    Extracellular ATP has been shown to either inhibit or promote cancer growth and migration; however the mechanism underlying this discrepancy remained elusive. Here, we demonstrate the divergent roles of ATP and adenosine released by bone osteocytes in breast cancers. We showed that conditioned media (CM) collected from osteocytes treated with alendronate (AD), a bisphosphonate drug, inhibited the migration of human breast cancer MDA-MB-231 cells. Removal of the extracellular ATP by apyrase in CM abolished this effect, suggesting the involvement of ATP. ATP exerted its inhibitory effect through the activation of purinergic P2X receptor signaling in breast cancer cells evidenced by the attenuation of the inhibition by an antagonist, oxidized ATP, as well as knocking down P2X07 with siRNA, and the inhibition by an agonist, BzATP. Intriguingly, ATP had a biphasic effect on breast cancer cell behavior–lower dosage inhibited, but higher dosage promoted its migration. The stimulatory effect on migration was blocked by an adenosine receptor antagonist, MRS1754, ARL67156, an ecto-ATPase inhibitor, and A2A receptor siRNA, suggesting that in contrast to the action of ATP, adenosine, a metabolic product of ATP, promoted migration of breast cancer cells. Consistently, non-hydrolyzable ATP, ATPγS, only inhibited, but did not promote cancer cell migration. ATP also had a similar inhibitory effect on the Py8119 mouse mammary carcinoma cells; however, adenosine had no effect due to the absence of the A2A receptor. Consistent with the results of cancer cell migration, ATPγS inhibited, while adenosine promoted anchorage-independent growth of breast cancer cells. Our in vivo xenograft study showed a significant delay of tumor growth with the treatment of ATPγS. Moreover, the extent of bone metastasis in a mouse intratibial model was significantly reduced with the treatment of ATPγS. Together, our results suggest the distinct roles of ATP and adenosine released by osteocytes, and the activation of corresponding receptors P2X7 and A2A signaling on breast cancer cell growth, migration and bone metastasis. PMID:24837364

  6. [A case of gastric metastasis and carcinomatous peritonitis of breast cancer with improved QOL by stent implantation and gemcitabine].

    PubMed

    Mukaibashi, Tomoe; Kojima, Izumi; Yamanaka, Ayumi; Nishiyama, Sachiko; Yamanaka, Takashi; Nakayama, Hirotaka; Matsuura, Hitoshi; Matsuzu, Kenichi; Inaba, Masaaki; Yoshida, Akira; Shimizu, Satoru

    2013-08-01

    A 73-year-old woman had undergone mastectomy for left breast cancer. One year later, bone metastasis was detected. After 7 years, the patient experienced epigastric discomfort, and gastrointestinal endoscopy showed stenosis of the pylorus and enlarged gastric folds. Stomach cancer was suspected at first, but gastric metastasis of breast cancer was diagnosed on the basis of endoscopic reexamination and computed tomography(CT)images. The patient could not drink water, and therefore, gastrointestinal stenting was performed, which facilitated ingestion to some extent. However, at the same time, an elevated serum carcinoembryonic antigen(CEA)level and jaundice were observed. Therefore, biliary tract stenosis due to carcinomatous peritonitis was diagnosed. We attempted to treat the jaundice with endoscopic retrograde cholangiopancreatography( ERCP)or percutaneous transhepatic cholangiography(PTCD), but the treatment was not successful, and an increase in ascites was noted. Accordingly, gemcitabine was administered as systemic therapy. As a result, ascites decreased and jaundice improved. Patients with gastric metastasis of breast cancer have poor quality of life(QOL)because of difficulties in ingestion or vomiting, and poor prognoses, because of frequent concurrent carcinomatous peritonitis. We experienced a case of gastric metastasis and carcinomatous peritonitis, and were able to improve the patient's QOL by gastrointestinal stenting and gemcitabine administration.

  7. Bisphosphonate induced hypocalcaemia - report of six cases and review of the literature.

    PubMed

    Kreutle, Veronika; Blum, Claudine; Meier, Christian; Past, Miriam; Müller, Beat; Schütz, Philipp; Borm, Katrin

    2014-01-01

    Intravenous bisphosphonates are widely used to treat osteoporosis and bone metastasis in cancer patients The risk of hypocalcaemia is a rare but underestimated side effect of anti-resorptive treatment. Clinically apparent hypocalcaemia is mostly related to high-dose treatment with zoledronate and denosumab in cancer patients Particular caution is mandatory in all malnourished patients and patients with renal failure who are treated for either bone metastases or osteoporosis. To avoid serious hypocalcaemia, pre-treatment calcium and vitamin D status should be assessed and corrected if appropriate.

  8. Melorheostosis with renal arterio-venous malformation: A case report with review of literature

    PubMed Central

    Lone, Abdul Rashid; Ahmad, Mushtaq; Aziz, Sheikh Aejaz; Bhat, Gul Mohammad; Bhat, Javid Rasool; Jahan, Rifat; Khan, Shoukat H

    2009-01-01

    Melorheostosis, also known as Leri′s disease and flowing periosteal hyperostosis, is a rare cause of pain and stiffness in a limb. The appearance is of "candle greasing" down one side of one or several bones of the body. We describe a case referred to tertiary care center with suspicion of renal cell carcinoma with diffuse bone metastasis. After reassessment, the patient was diagnosed melorheostosis with renal AV malformation. He was reassured about the benign nature of the disease and is asymptomatic. PMID:20668607

  9. A rare case of chondroblastoma of the acromion.

    PubMed

    Arıkan, Murat; Toğral, Güray; Yıldırım, Ahmet; Irkkan, Çiğdem

    2016-12-01

    We present a 37-year-old patient with a chondroblastoma in his right acromion. The acromion is an unusual site for this type of tumor and the typical surgical treatment involves resection of the involved acromion bone. The patient was surgically treated with resection of the right acromion and autogenous iliac bone grafting. Twenty five months postoperatively, he demonstrated full shoulder function, without evidence of local recurrence or metastasis. Copyright © 2016 Turkish Association of Orthopaedics and Traumatology. Production and hosting by Elsevier B.V. All rights reserved.

  10. Metastasis Suppressor Genes: At the Interface Between the Environment and Tumor Cell Growth

    PubMed Central

    Hurst, Douglas R.; Welch, Danny R.

    2013-01-01

    The molecular mechanisms and genetic programs required for cancer metastasis are sometimes overlapping, but components are clearly distinct from those promoting growth of a primary tumor. Every sequential, rate-limiting step in the sequence of events leading to metastasis requires coordinated expression of multiple genes, necessary signaling events, and favorable environmental conditions or the ability to escape negative selection pressures. Metastasis suppressors are molecules that inhibit the process of metastasis without preventing growth of the primary tumor. The cellular processes regulated by metastasis suppressors are diverse and function at every step in the metastatic cascade. As we gain knowledge into the molecular mechanisms of metastasis suppressors and cofactors with which they interact, we learn more about the process, including appreciation that some are potential targets for therapy of metastasis, the most lethal aspect of cancer. Until now, metastasis suppressors have been described largely by their function. With greater appreciation of their biochemical mechanisms of action, the importance of context is increasingly recognized especially since tumor cells exist in myriad microenvironments. In this review, we assemble the evidence that selected molecules are indeed suppressors of metastasis, collate the data defining the biochemical mechanisms of action, and glean insights regarding how metastasis suppressors regulate tumor cell communication to–from microenvironments. PMID:21199781

  11. MicroRNA-182 drives metastasis of primary sarcomas by targeting multiple genes

    PubMed Central

    Sachdeva, Mohit; Mito, Jeffrey K.; Lee, Chang-Lung; Zhang, Minsi; Li, Zhizhong; Dodd, Rebecca D.; Cason, David; Luo, Lixia; Ma, Yan; Van Mater, David; Gladdy, Rebecca; Lev, Dina C.; Cardona, Diana M.; Kirsch, David G.

    2014-01-01

    Metastasis causes most cancer deaths, but is incompletely understood. MicroRNAs can regulate metastasis, but it is not known whether a single miRNA can regulate metastasis in primary cancer models in vivo. We compared the expression of miRNAs in metastatic and nonmetastatic primary mouse sarcomas and found that microRNA-182 (miR-182) was markedly overexpressed in some tumors that metastasized to the lungs. By utilizing genetically engineered mice with either deletion of or overexpression of miR-182 in primary sarcomas, we discovered that deletion of miR-182 substantially decreased, while overexpression of miR-182 considerably increased, the rate of lung metastasis after amputation of the tumor-bearing limb. Additionally, deletion of miR-182 decreased circulating tumor cells (CTCs), while overexpression of miR-182 increased CTCs, suggesting that miR-182 regulates intravasation of cancer cells into the circulation. We identified 4 miR-182 targets that inhibit either the migration of tumor cells or the degradation of the extracellular matrix. Notably, restoration of any of these targets in isolation did not alter the metastatic potential of sarcoma cells injected orthotopically, but the simultaneous restoration of all 4 targets together substantially decreased the number of metastases. These results demonstrate that a single miRNA can regulate metastasis of primary tumors in vivo by coordinated regulation of multiple genes. PMID:25180607

  12. Novel Genome-Wide Screening Method Identifies Genes Important to Breast Cancer Metastasis | Center for Cancer Research

    Cancer.gov

    For patients with solid tumors, the primary cause of illness and death is metastasis, a complex process involving multiple steps and cooperation between cancerous and normal cells. Many genes must be involved, but few have been found and characterized.

  13. Transient SNAIL1 expression is necessary for metastatic competence in breast cancer.

    PubMed

    Tran, Hung D; Luitel, Krishna; Kim, Michael; Zhang, Kun; Longmore, Gregory D; Tran, David D

    2014-11-01

    SNAIL1 has been suggested to regulate breast cancer metastasis based on analyses of human breast tumor transcriptomes and experiments using cancer cell lines and xenografts. However, in vivo genetic experimental support for a role for SNAIL1 in breast cancer metastasis that develops in an immunocompetent tumor microenvironment has not been determined. To address this question, we created a genetic SNAIL1 model by coupling an endogenous SNAIL1 reporter with an inducible SNAIL1 transgene. Using multiple genetic models of breast cancer, we demonstrated that endogenous SNAIL1 expression was restricted to primary tumors that ultimately disseminate. SNAIL1 gene deletion either during the premalignant phase or after primary tumors have reached a palpable size blunted metastasis, indicating that late metastasis was the main driver of metastasis and that this was dependent on SNAIL1. Importantly, SNAIL1 expression during breast cancer metastasis was transient and forced transient, but not continuous. SNAIL1 expression in breast tumors was sufficient to increase metastasis. ©2014 American Association for Cancer Research.

  14. Perigastric lymph node metastasis from papillary thyroid carcinoma in a patient with early gastric cancer: the first case report.

    PubMed

    Jeong, Gui-Ae; Kim, Hyung-Chul; Kim, Hee-Kyung; Cho, Gyu-Seok

    2014-09-01

    Distant metastasis from papillary thyroid carcinoma (PTC), particularly from papillary thyroid microcarcinoma, is rare. We present a case of perigastric lymph node metastasis from PTC in a patient with early gastric cancer and breast cancer. During post-surgical follow-up for breast cancer, a 56-year-old woman was diagnosed incidentally with early gastric cancer and synchronous left thyroid cancer. Therefore, laparoscopic distal gastrectomy with lymph node dissection and left thyroidectomy were performed. On the basis of the pathologic findings of the surgical specimens, the patient was diagnosed to have papillary thyroid microcarcinoma with perigastric lymph node metastasis and early gastric cancer with mucosal invasion. Finally, on the basis of immunohistochemical staining with galectin-3, the diagnosis of perigastric lymph node metastasis from PTC was made. When a patient has multiple primary malignancies with lymph node metastasis, careful pathologic examination of the surgical specimen is necessary; immunohistochemical staining may be helpful in determining the primary origin of lymph node metastasis.

  15. Cutaneous metastasis of cholangiocarcinoma.

    PubMed

    Liu, Min; Liu, Bai-Long; Liu, Bin; Guo, Liang; Wang, Qiang; Song, Yan-Qiu; Dong, Li-Hua

    2015-03-14

    To investigate the clinical characteristics and prognostic factors of cutaneous metastasis of cholangiocarcinoma by a retrospective analysis of published cases. An extensive search was conducted in the English literature within the PubMed database using the following keywords: cutaneous metastasis or skin metastasis and cholangiocarcinoma or bile duct. The data of 30 patients from 21 articles from 1978 to 2014 were analyzed. Patient data retrieved from the articles included the following: age, gender, time cutaneous metastasis occurred, number of cutaneous metastases throughout life, sites of initial cutaneous metastasis, anatomic site, pathology and differentiation of cholangiocarcinoma, and immunohistochemical results of the cutaneous metastasis. The assessment of overall survival after cutaneous metastasis (OSCM) was the primary endpoint. The median age at diagnosis of cutaneous metastasis of cholangiocarcinoma was 60.0 years (range: 35-77). This metastasis showed a predilection towards males, with a male to female ratio of 3.29. In 8 cases (27.6%), skin metastasis was the first sign of cholangiocarcinoma. Additionally, 18 cases (60.0%) manifested single cutaneous metastasis, while 12 cases (40.0%) demonstrated multiple skin metastases. In 50.0% of patients, the metastasis occurred in the drainage region, while 50.0% of patients had distant cutaneous metastases. The scalp was the most frequently involved region of distant skin metastasis, occurring in 36.7% of patients. The median OSCM of cholangiocarcinoma was 4.0 mo. Patient age and cutaneous metastatic sites showed no significant relation with OSCM, while male gender and single metastasis of the skin were associated with a poorer OSCM (hazard ratio: 0.168; P = 0.005, and hazard ratio: 0.296; P = 0.011, respectively). The prognosis of cutaneous metastasis of cholangiocarcinoma is dismal. Both male gender and single skin metastasis are associated with a poorer OSCM.

  16. The LPA1/ZEB1/miR-21-activation pathway regulates metastasis in basal breast cancer.

    PubMed

    Sahay, Debashish; Leblanc, Raphael; Grunewald, Thomas G P; Ambatipudi, Srikant; Ribeiro, Johnny; Clézardin, Philippe; Peyruchaud, Olivier

    2015-08-21

    Lysophosphatidic acid (LPA) is a bioactive lipid promoting cancer metastasis. LPA activates a series of six G protein-coupled receptors (LPA1-6). While blockage of LPA1in vivo inhibits breast carcinoma metastasis, down-stream genes mediating LPA-induced metastasis have not been yet identified. Herein we showed by analyzing publicly available expression data from 1488 human primary breast tumors that the gene encoding the transcription factor ZEB1 was the most correlated with LPAR1 encoding LPA1. This correlation was most prominent in basal primary breast carcinomas and restricted to cell lines of basal subtypes. Functional experiments in three different basal cell lines revealed that LPA-induced ZEB1 expression was regulated by the LPA1/Phosphatidylinositol-3-Kinase (Pi3K) axis. DNA microarray and real-time PCR analyses further demonstrated that LPA up-regulated the oncomiR miR-21 through an LPA1/Pi3K/ZEB1-dependent mechanism. Strikingly, treatment with a mirVana miR-21 inhibitor, or silencing LPA1 or ZEB1 completely blocked LPA-induced cell migration in vitro, invasion and tumor cell bone colonization in vivo, which can be restored with a mirVana miR-21 mimic. Finally, high LPAR1 expression in basal breast tumors predicted worse lung-metastasis-free survival. Collectively, our results elucidate a new molecular pathway driving LPA-induced metastasis, thus underscoring the therapeutic potential of targeting LPA1 in patients with basal breast carcinomas.

  17. [Efficacy of Radiation Therapy for Esophageal Cancer with Bone Metastases].

    PubMed

    Katayanagi, So; Watanabe, Takafumi; Makuuchi, Yosuke; Shigoka, Masatoshi; Sumi, Tetsuo; Takagaki, Shinichi; Okubo, Mitsuru; Tachibana, Shingo; Oosaka, Yoshiaki; Tsuchida, Akihiko; Kawachi, Shigeyuki

    2015-11-01

    We retrospectively considered the validity of radiotherapy for patients with bone metastases from esophageal cancer. Eight patients have received radiotherapy in our hospital since 2007. The median age of the patients was 63 years, with 5 men and 3 women. Bone metastatic sites were 4 to the vertebrae, 3 to the ribs, 3 to the femur and 1 each to the humerus, ulna, and radius, respectively. All of the patients had other unresectable sites of metastasis. Radiotherapy reduced pain of 3 patients of PS 1 clearly. Median survival time from the start of radiation therapy was 50 days. When PS was relatively good, the possibility of easing pain and improving QOL was suggested by our data. There is a possibility that radiation therapy for patients with bone metastases from esophageal cancer can improve the QOL and alleviate pain.

  18. An evidence-based knowledgebase of metastasis suppressors to identify key pathways relevant to cancer metastasis

    PubMed Central

    Zhao, Min; Li, Zhe; Qu, Hong

    2015-01-01

    Metastasis suppressor genes (MS genes) are genes that play important roles in inhibiting the process of cancer metastasis without preventing growth of the primary tumor. Identification of these genes and understanding their functions are critical for investigation of cancer metastasis. Recent studies on cancer metastasis have identified many new susceptibility MS genes. However, the comprehensive illustration of diverse cellular processes regulated by metastasis suppressors during the metastasis cascade is lacking. Thus, the relationship between MS genes and cancer risk is still unclear. To unveil the cellular complexity of MS genes, we have constructed MSGene (http://MSGene.bioinfo-minzhao.org/), the first literature-based gene resource for exploring human MS genes. In total, we manually curated 194 experimentally verified MS genes and mapped to 1448 homologous genes from 17 model species. Follow-up functional analyses associated 194 human MS genes with epithelium/tissue morphogenesis and epithelia cell proliferation. In addition, pathway analysis highlights the prominent role of MS genes in activation of platelets and coagulation system in tumor metastatic cascade. Moreover, global mutation pattern of MS genes across multiple cancers may reveal common cancer metastasis mechanisms. All these results illustrate the importance of MSGene to our understanding on cell development and cancer metastasis. PMID:26486520

  19. Benefit of FOLFOX to unresectable liver metastases secondary from colorectal carcinoma in an oncologic emergency.

    PubMed

    Sugimoto, Maki; Yasuda, Hideki; Koda, Keiji; Yamazaki, Masato; Tezuka, Tohru; Takenoue, Tomohiro; Kosugi, Chihiro; Higuchi, Ryota; Yamamoto, Shiho; Watayo, Yoshihisa; Yagawa, Yohsuke; Suzuki, Masato

    2007-09-01

    Liver metastasis is an important prognostic factor in colorectal cancer. The efficacy of resection of metastatic lesions in liver metastasis of colorectal cancer is also widely recognized. However, studies on treatment methods of unresectable cases have not been sufficient and obtaining complete remission (CR) for liver metastasis is rare with chemotherapy. Selection of reliable chemotherapy for unresectable liver metastasis is an urgent necessity. The usefulness of oxaliplatin, 5-flurouracil and leucovorin combination therapy (FOLFOX) has recently been reported, but CR of liver metastasis is rare. The current status and new therapeutic significance of FOLFOX therapy are discussed based on the literature of colorectal cancer chemotherapy to date, and the clinical experience in which we obtained CR for liver metastasis is reported. The patient had stage IV rectal cancer, perforative peritonitis, pelvic abscess and simultaneous multiple liver metastasis. The patient underwent an emergency operation using the Hartmann's procedure. Liver metastasis is considered to be a prognostic factor and FOLFOX was selected as the postoperative chemotherapy, CR of the liver metastasis was obtained. FOLFOX was suggested to have new clinical significance in oncologic emergencies against unresectable liver metastasis in colorectal cancer and should serve as adjuvant chemotherapy that will contribute to improvement of treatment results.

  20. Squamous carcinoma of the lung metastases to the patella.

    PubMed

    Feng, Helin; Li, Huan; Wang, Jin; Zhang, Xiaoyu; Feng, Jiangang

    2015-06-01

    We report a case of a 65-year-old man with newly diagnosed squamous carcinoma of the lung, who presented with worsening left-knee pain. A bone scintigraphy displayed an increased radioactivity in the left patella. The patient underwent left patellectomy. Histopathological examination revealed metastasis to the patella from the known lung cancer.

Top