[Stability analysis of reference gene based on real-time PCR in Artemisia annua under cadmium treatment].

PubMed

Zhou, Liang-Yun; Mo, Ge; Wang, Sheng; Tang, Jin-Fu; Yue, Hong; Huang, Lu-Qi; Shao, Ai-Juan; Guo, Lan-Ping

2014-03-01

In this study, Actin, 18S rRNA, PAL, GAPDH and CPR of Artemisia annua were selected as candidate reference genes, and their gene-specific primers for real-time PCR were designed, then geNorm, NormFinder, BestKeeper, Delta CT and RefFinder were used to evaluate their expression stability in the leaves of A. annua under treatment of different concentrations of Cd, with the purpose of finding a reliable reference gene to ensure the reliability of gene-expression analysis. The results showed that there were some significant differences among the candidate reference genes under different treatments and the order of expression stability of candidate reference gene was Actin > 18S rRNA > PAL > GAPDH > CPR. These results suggested that Actin, 18S rRNA and PAL could be used as ideal reference genes of gene expression analysis in A. annua and multiple internal control genes were adopted for results calibration. In addition, differences in expression stability of candidate reference genes in the leaves of A. annua under the same concentrations of Cd were observed, which suggested that the screening of candidate reference genes was needed even under the same treatment. To our best knowledge, this study for the first time provided the ideal reference genes under Cd treatment in the leaves of A. annua and offered reference for the gene expression analysis of A. annua under other conditions.

Database of cattle candidate genes and genetic markers for milk production and mastitis

PubMed Central

Ogorevc, J; Kunej, T; Razpet, A; Dovc, P

2009-01-01

A cattle database of candidate genes and genetic markers for milk production and mastitis has been developed to provide an integrated research tool incorporating different types of information supporting a genomic approach to study lactation, udder development and health. The database contains 943 genes and genetic markers involved in mammary gland development and function, representing candidates for further functional studies. The candidate loci were drawn on a genetic map to reveal positional overlaps. For identification of candidate loci, data from seven different research approaches were exploited: (i) gene knockouts or transgenes in mice that result in specific phenotypes associated with mammary gland (143 loci); (ii) cattle QTL for milk production (344) and mastitis related traits (71); (iii) loci with sequence variations that show specific allele-phenotype interactions associated with milk production (24) or mastitis (10) in cattle; (iv) genes with expression profiles associated with milk production (207) or mastitis (107) in cattle or mouse; (v) cattle milk protein genes that exist in different genetic variants (9); (vi) miRNAs expressed in bovine mammary gland (32) and (vii) epigenetically regulated cattle genes associated with mammary gland function (1). Fourty-four genes found by multiple independent analyses were suggested as the most promising candidates and were further in silico analysed for expression levels in lactating mammary gland, genetic variability and top biological functions in functional networks. A miRNA target search for mammary gland expressed miRNAs identified 359 putative binding sites in 3′UTRs of candidate genes. PMID:19508288

Replication and validation of genetic polymorphisms associated with survival after allogeneic blood or marrow transplant

PubMed Central

Karaesmen, Ezgi; Rizvi, Abbas A.; Preus, Leah M.; McCarthy, Philip L.; Pasquini, Marcelo C.; Onel, Kenan; Zhu, Xiaochun; Spellman, Stephen; Haiman, Christopher A.; Stram, Daniel O.; Pooler, Loreall; Sheng, Xin; Zhu, Qianqian; Yan, Li; Liu, Qian; Hu, Qiang; Webb, Amy; Brock, Guy; Clay-Gilmour, Alyssa I.; Battaglia, Sebastiano; Tritchler, David; Liu, Song; Hahn, Theresa

2017-01-01

Multiple candidate gene-association studies of non-HLA single-nucleotide polymorphisms (SNPs) and outcomes after blood or marrow transplant (BMT) have been conducted. We identified 70 publications reporting 45 SNPs in 36 genes significantly associated with disease-related mortality, progression-free survival, transplant-related mortality, and/or overall survival after BMT. Replication and validation of these SNP associations were performed using DISCOVeRY-BMT (Determining the Influence of Susceptibility COnveying Variants Related to one-Year mortality after BMT), a well-powered genome-wide association study consisting of 2 cohorts, totaling 2888 BMT recipients with acute myeloid leukemia, acute lymphoblastic leukemia, or myelodysplastic syndrome, and their HLA-matched unrelated donors, reported to the Center for International Blood and Marrow Transplant Research. Gene-based tests were used to assess the aggregate effect of SNPs on outcome. None of the previously reported significant SNPs replicated at P < .05 in DISCOVeRY-BMT. Validation analyses showed association with one previously reported donor SNP at P < .05 and survival; more associations would be anticipated by chance alone. No gene-based tests were significant at P < .05. Functional annotation with publicly available data shows these candidate SNPs most likely do not have biochemical function; only 13% of candidate SNPs correlate with gene expression or are predicted to impact transcription factor binding. Of these, half do not impact the candidate gene of interest; the other half correlate with expression of multiple genes. These findings emphasize the peril of pursing candidate approaches and the importance of adequately powered tests of unbiased genome-wide associations with BMT clinical outcomes given the ultimate goal of improving patient outcomes. PMID:28811306

Influence of SNPs in nutrient-sensitive candidate genes and gene-diet interactions on blood lipids: the DiOGenes study.

PubMed

Brahe, Lena K; Ängquist, Lars; Larsen, Lesli H; Vimaleswaran, Karani S; Hager, Jörg; Viguerie, Nathalie; Loos, Ruth J F; Handjieva-Darlenska, Teodora; Jebb, Susan A; Hlavaty, Petr; Larsen, Thomas M; Martinez, J Alfredo; Papadaki, Angeliki; Pfeiffer, Andreas F H; van Baak, Marleen A; Sørensen, Thorkild I A; Holst, Claus; Langin, Dominique; Astrup, Arne; Saris, Wim H M

2013-09-14

Blood lipid response to a given dietary intervention could be determined by the effect of diet, gene variants or gene-diet interactions. The objective of the present study was to investigate whether variants in presumed nutrient-sensitive genes involved in lipid metabolism modified lipid profile after weight loss and in response to a given diet, among overweight European adults participating in the Diet Obesity and Genes study. By multiple linear regressions, 240 SNPs in twenty-four candidate genes were investigated for SNP main and SNP-diet interaction effects on total cholesterol, LDL-cholesterol, HDL-cholesterol and TAG after an 8-week low-energy diet (only main effect) ,and a 6-month ad libitum weight maintenance diet, with different contents of dietary protein or glycaemic index. After adjusting for multiple testing, a SNP-dietary protein interaction effect on TAG was identified for lipin 1 (LPIN1) rs4315495, with a decrease in TAG of 20.26 mmol/l per A-allele/protein unit (95% CI 20.38, 20.14, P=0.000043). In conclusion, we investigated SNP-diet interactions for blood lipid profiles for 240 SNPs in twenty-four candidate genes, selected for their involvement in lipid metabolism pathways, and identified one significant interaction between LPIN1 rs4315495 and dietary protein for TAG concentration.

Cellular and synaptic network defects in autism

PubMed Central

Peça, João; Feng, Guoping

2012-01-01

Many candidate genes are now thought to confer susceptibility to autism spectrum disorder (ASD). Here we review four interrelated complexes, each composed of multiple families of genes that functionally coalesce on common cellular pathways. We illustrate a common thread in the organization of glutamatergic synapses and suggest a link between genes involved in Tuberous Sclerosis Complex, Fragile X syndrome, Angelman syndrome and several synaptic ASD candidate genes. When viewed in this context, progress in deciphering the molecular architecture of cellular protein-protein interactions together with the unraveling of synaptic dysfunction in neural networks may prove pivotal to advancing our understanding of ASDs. PMID:22440525

Identification of Inherited Retinal Disease-Associated Genetic Variants in 11 Candidate Genes.

PubMed

Astuti, Galuh D N; van den Born, L Ingeborgh; Khan, M Imran; Hamel, Christian P; Bocquet, Béatrice; Manes, Gaël; Quinodoz, Mathieu; Ali, Manir; Toomes, Carmel; McKibbin, Martin; El-Asrag, Mohammed E; Haer-Wigman, Lonneke; Inglehearn, Chris F; Black, Graeme C M; Hoyng, Carel B; Cremers, Frans P M; Roosing, Susanne

2018-01-10

Inherited retinal diseases (IRDs) display an enormous genetic heterogeneity. Whole exome sequencing (WES) recently identified genes that were mutated in a small proportion of IRD cases. Consequently, finding a second case or family carrying pathogenic variants in the same candidate gene often is challenging. In this study, we searched for novel candidate IRD gene-associated variants in isolated IRD families, assessed their causality, and searched for novel genotype-phenotype correlations. Whole exome sequencing was performed in 11 probands affected with IRDs. Homozygosity mapping data was available for five cases. Variants with minor allele frequencies ≤ 0.5% in public databases were selected as candidate disease-causing variants. These variants were ranked based on their: (a) presence in a gene that was previously implicated in IRD; (b) minor allele frequency in the Exome Aggregation Consortium database (ExAC); (c) in silico pathogenicity assessment using the combined annotation dependent depletion (CADD) score; and (d) interaction of the corresponding protein with known IRD-associated proteins. Twelve unique variants were found in 11 different genes in 11 IRD probands. Novel autosomal recessive and dominant inheritance patterns were found for variants in Small Nuclear Ribonucleoprotein U5 Subunit 200 ( SNRNP200 ) and Zinc Finger Protein 513 ( ZNF513 ), respectively. Using our pathogenicity assessment, a variant in DEAH-Box Helicase 32 ( DHX32 ) was the top ranked novel candidate gene to be associated with IRDs, followed by eight medium and lower ranked candidate genes. The identification of candidate disease-associated sequence variants in 11 single families underscores the notion that the previously identified IRD-associated genes collectively carry > 90% of the defects implicated in IRDs. To identify multiple patients or families with variants in the same gene and thereby provide extra proof for pathogenicity, worldwide data sharing is needed.

An assessment of heavy ion irradiation mutagenesis for reverse genetics in wheat (Triticum aestivum L.).

PubMed

Fitzgerald, Timothy L; Powell, Jonathan J; Stiller, Jiri; Weese, Terri L; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C Lynne; Li, Zhongyi; Manners, John M; Kazan, Kemal

2015-01-01

Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed.

An Assessment of Heavy Ion Irradiation Mutagenesis for Reverse Genetics in Wheat (Triticum aestivum L.)

PubMed Central

Fitzgerald, Timothy L.; Powell, Jonathan J.; Stiller, Jiri; Weese, Terri L.; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C. Lynne; Li, Zhongyi; Manners, John M.; Kazan, Kemal

2015-01-01

Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed. PMID:25719507

Analysis of 30 Genes (355 SNPS) Related to Energy Homeostasis for Association with Adiposity in European-American and Yup'ik Eskimo Populations

PubMed Central

Chung, Wendy K.; Patki, Amit; Matsuoka, Naoki; Boyer, Bert B.; Liu, Nianjun; Musani, Solomon K.; Goropashnaya, Anna V.; Tan, Perciliz L.; Katsanis, Nicholas; Johnson, Stephen B.; Gregersen, Peter K.; Allison, David B.; Leibel, Rudolph L.; Tiwari, Hemant K.

2009-01-01

Objective Human adiposity is highly heritable, but few of the genes that predispose to obesity in most humans are known. We tested candidate genes in pathways related to food intake and energy expenditure for association with measures of adiposity. Methods We studied 355 genetic variants in 30 candidate genes in 7 molecular pathways related to obesity in two groups of adult subjects: 1,982 unrelated European Americans living in the New York metropolitan area drawn from the extremes of their body mass index (BMI) distribution and 593 related Yup'ik Eskimos living in rural Alaska characterized for BMI, body composition, waist circumference, and skin fold thicknesses. Data were analyzed by using a mixed model in conjunction with a false discovery rate (FDR) procedure to correct for multiple testing. Results After correcting for multiple testing, two single nucleotide polymorphisms (SNPs) in Ghrelin (GHRL) (rs35682 and rs35683) were associated with BMI in the New York European Americans. This association was not replicated in the Yup'ik participants. There was no evidence for gene × gene interactions among genes within the same molecular pathway after adjusting for multiple testing via FDR control procedure. Conclusion Genetic variation in GHRL may have a modest impact on BMI in European Americans. PMID:19077438

Analysis of 30 genes (355 SNPS) related to energy homeostasis for association with adiposity in European-American and Yup'ik Eskimo populations.

PubMed

Chung, Wendy K; Patki, Amit; Matsuoka, Naoki; Boyer, Bert B; Liu, Nianjun; Musani, Solomon K; Goropashnaya, Anna V; Tan, Perciliz L; Katsanis, Nicholas; Johnson, Stephen B; Gregersen, Peter K; Allison, David B; Leibel, Rudolph L; Tiwari, Hemant K

2009-01-01

Human adiposity is highly heritable, but few of the genes that predispose to obesity in most humans are known. We tested candidate genes in pathways related to food intake and energy expenditure for association with measures of adiposity. We studied 355 genetic variants in 30 candidate genes in 7 molecular pathways related to obesity in two groups of adult subjects: 1,982 unrelated European Americans living in the New York metropolitan area drawn from the extremes of their body mass index (BMI) distribution and 593 related Yup'ik Eskimos living in rural Alaska characterized for BMI, body composition, waist circumference, and skin fold thicknesses. Data were analyzed by using a mixed model in conjunction with a false discovery rate (FDR) procedure to correct for multiple testing. After correcting for multiple testing, two single nucleotide polymorphisms (SNPs) in Ghrelin (GHRL) (rs35682 and rs35683) were associated with BMI in the New York European Americans. This association was not replicated in the Yup'ik participants. There was no evidence for gene x gene interactions among genes within the same molecular pathway after adjusting for multiple testing via FDR control procedure. Genetic variation in GHRL may have a modest impact on BMI in European Americans.

Constructing an integrated gene similarity network for the identification of disease genes.

PubMed

Tian, Zhen; Guo, Maozu; Wang, Chunyu; Xing, LinLin; Wang, Lei; Zhang, Yin

2017-09-20

Discovering novel genes that are involved human diseases is a challenging task in biomedical research. In recent years, several computational approaches have been proposed to prioritize candidate disease genes. Most of these methods are mainly based on protein-protein interaction (PPI) networks. However, since these PPI networks contain false positives and only cover less half of known human genes, their reliability and coverage are very low. Therefore, it is highly necessary to fuse multiple genomic data to construct a credible gene similarity network and then infer disease genes on the whole genomic scale. We proposed a novel method, named RWRB, to infer causal genes of interested diseases. First, we construct five individual gene (protein) similarity networks based on multiple genomic data of human genes. Then, an integrated gene similarity network (IGSN) is reconstructed based on similarity network fusion (SNF) method. Finally, we employee the random walk with restart algorithm on the phenotype-gene bilayer network, which combines phenotype similarity network, IGSN as well as phenotype-gene association network, to prioritize candidate disease genes. We investigate the effectiveness of RWRB through leave-one-out cross-validation methods in inferring phenotype-gene relationships. Results show that RWRB is more accurate than state-of-the-art methods on most evaluation metrics. Further analysis shows that the success of RWRB is benefited from IGSN which has a wider coverage and higher reliability comparing with current PPI networks. Moreover, we conduct a comprehensive case study for Alzheimer's disease and predict some novel disease genes that supported by literature. RWRB is an effective and reliable algorithm in prioritizing candidate disease genes on the genomic scale. Software and supplementary information are available at http://nclab.hit.edu.cn/~tianzhen/RWRB/ .

Prioritization of candidate disease genes by topological similarity between disease and protein diffusion profiles.

PubMed

Zhu, Jie; Qin, Yufang; Liu, Taigang; Wang, Jun; Zheng, Xiaoqi

2013-01-01

Identification of gene-phenotype relationships is a fundamental challenge in human health clinic. Based on the observation that genes causing the same or similar phenotypes tend to correlate with each other in the protein-protein interaction network, a lot of network-based approaches were proposed based on different underlying models. A recent comparative study showed that diffusion-based methods achieve the state-of-the-art predictive performance. In this paper, a new diffusion-based method was proposed to prioritize candidate disease genes. Diffusion profile of a disease was defined as the stationary distribution of candidate genes given a random walk with restart where similarities between phenotypes are incorporated. Then, candidate disease genes are prioritized by comparing their diffusion profiles with that of the disease. Finally, the effectiveness of our method was demonstrated through the leave-one-out cross-validation against control genes from artificial linkage intervals and randomly chosen genes. Comparative study showed that our method achieves improved performance compared to some classical diffusion-based methods. To further illustrate our method, we used our algorithm to predict new causing genes of 16 multifactorial diseases including Prostate cancer and Alzheimer's disease, and the top predictions were in good consistent with literature reports. Our study indicates that integration of multiple information sources, especially the phenotype similarity profile data, and introduction of global similarity measure between disease and gene diffusion profiles are helpful for prioritizing candidate disease genes. Programs and data are available upon request.

Genomic and Coexpression Analyses Predict Multiple Genes Involved in Triterpene Saponin Biosynthesis in Medicago truncatula[C][W

PubMed Central

Naoumkina, Marina A.; Modolo, Luzia V.; Huhman, David V.; Urbanczyk-Wochniak, Ewa; Tang, Yuhong; Sumner, Lloyd W.; Dixon, Richard A.

2010-01-01

Saponins, an important group of bioactive plant natural products, are glycosides of triterpenoid or steroidal aglycones (sapogenins). Saponins possess many biological activities, including conferring potential health benefits for humans. However, most of the steps specific for the biosynthesis of triterpene saponins remain uncharacterized at the molecular level. Here, we use comprehensive gene expression clustering analysis to identify candidate genes involved in the elaboration, hydroxylation, and glycosylation of the triterpene skeleton in the model legume Medicago truncatula. Four candidate uridine diphosphate glycosyltransferases were expressed in Escherichia coli, one of which (UGT73F3) showed specificity for multiple sapogenins and was confirmed to glucosylate hederagenin at the C28 position. Genetic loss-of-function studies in M. truncatula confirmed the in vivo function of UGT73F3 in saponin biosynthesis. This report provides a basis for future studies to define genetically the roles of multiple cytochromes P450 and glycosyltransferases in triterpene saponin biosynthesis in Medicago. PMID:20348429

Association Study of 60 Candidate Genes with Antipsychotic-induced Weight Gain in Schizophrenia Patients.

PubMed

Ryu, S; Huh, I-S; Cho, E-Y; Cho, Y; Park, T; Yoon, S C; Joo, Y H; Hong, K S

2016-03-01

This study aimed to investigate the association of multiple candidate genes with weight gain and appetite change during antipsychotic treatment. A total of 233 single nucleotide polymorphisms (SNPs) within 60 candidate genes were genotyped. BMI changes for up to 8 weeks in 84 schizophrenia patients receiving antipsychotic medication were analyzed using a linear mixed model. In addition, we assessed appetite change during antipsychotic treatment in a different group of 46 schizophrenia patients using the Drug-Related Eating Behavior Questionnaire. No SNP showed a statistically significant association with BMI or appetite change after correction for multiple testing. We observed trends of association (P<0.05) between 19 SNPs of 11 genes and weight gain, and between 7 SNPs of 5 genes and appetite change. In particular, rs696217 in GHRL showed suggestive evidence of association with not only weight gain (P=0.001) but also appetite change (P=0.042). Patients carrying the GG genotype of rs696217 exhibited higher increase in both BMI and appetite compared to patients carrying the GT/TT genotype. Our findings suggested the involvement of a GHRL polymorphism in weight gain, which was specifically mediated by appetite change, during antipsychotic treatment in schizophrenia patients. © Georg Thieme Verlag KG Stuttgart · New York.

Genomic analysis of Meckel–Gruber syndrome in Arabs reveals marked genetic heterogeneity and novel candidate genes

PubMed Central

Shaheen, Ranad; Faqeih, Eissa; Alshammari, Muneera J; Swaid, Abdulrahman; Al-Gazali, Lihadh; Mardawi, Elham; Ansari, Shinu; Sogaty, Sameera; Seidahmed, Mohammed Z; AlMotairi, Muhammed I; Farra, Chantal; Kurdi, Wesam; Al-Rasheed, Shatha; Alkuraya, Fowzan S

2013-01-01

Meckel–Gruber syndrome (MKS, OMIM #249000) is a multiple congenital malformation syndrome that represents the severe end of the ciliopathy phenotypic spectrum. Despite the relatively common occurrence of this syndrome among Arabs, little is known about its genetic architecture in this population. This is a series of 18 Arab families with MKS, who were evaluated clinically and studied using autozygome-guided mutation analysis and exome sequencing. We show that autozygome-guided candidate gene analysis identified the underlying mutation in the majority (n=12, 71%). Exome sequencing revealed a likely pathogenic mutation in three novel candidate MKS disease genes. These include C5orf42, Ellis–van-Creveld disease gene EVC2 and SEC8 (also known as EXOC4), which encodes an exocyst protein with an established role in ciliogenesis. This is the largest and most comprehensive genomic study on MKS in Arabs and the results, in addition to revealing genetic and allelic heterogeneity, suggest that previously reported disease genes and the novel candidates uncovered by this study account for the overwhelming majority of MKS patients in our population. PMID:23169490

Allelic association of sequence variants in the herpes virus entry mediator-B gene (PVRL2) with the severity of multiple sclerosis.

PubMed

Schmidt, S; Pericak-Vance, M A; Sawcer, S; Barcellos, L F; Hart, J; Sims, J; Prokop, A M; van der Walt, J; DeLoa, C; Lincoln, R R; Oksenberg, J R; Compston, A; Hauser, S L; Haines, J L; Gregory, S G

2006-07-01

Discrepant findings have been reported regarding an association of the apolipoprotein E (APOE) gene with the clinical course of multiple sclerosis (MS). To resolve these discrepancies, we examined common sequence variation in six candidate genes residing in a 380-kb genomic region surrounding and including the APOE locus for an association with MS severity. We genotyped at least three polymorphisms in each of six candidate genes in 1,540 Caucasian MS families (729 single-case and multiple-case families from the United States, 811 single-case families from the UK). By applying the quantitative transmission/disequilibrium test to a recently proposed MS severity score, the only statistically significant (P=0.003) association with MS severity was found for an intronic variant in the Herpes Virus Entry Mediator-B Gene PVRL2. Additional genotyping extended the association to a 16.6 kb block spanning intron 1 to intron 2 of the gene. Sequencing of PVRL2 failed to identify variants with an obvious functional role. In conclusion, the analysis of a very large data set suggests that genetic polymorphisms in PVRL2 may influence MS severity and supports the possibility that viral factors may contribute to the clinical course of MS, consistent with previous reports.

Semantic Web Ontology and Data Integration: a Case Study in Aiding Psychiatric Drug Repurposing.

PubMed

Liang, Chen; Sun, Jingchun; Tao, Cui

2015-01-01

There remain significant difficulties selecting probable candidate drugs from existing databases. We describe an ontology-oriented approach to represent the nexus between genes, drugs, phenotypes, symptoms, and diseases from multiple information sources. We also report a case study in which we attempted to explore candidate drugs effective for bipolar disorder and epilepsy. We constructed an ontology incorporating knowledge between the two diseases and performed semantic reasoning tasks with the ontology. The results suggested 48 candidate drugs that hold promise for further breakthrough. The evaluation demonstrated the validity our approach. Our approach prioritizes the candidate drugs that have potential associations among genes, phenotypes and symptoms, and thus facilitates the data integration and drug repurposing in psychiatric disorders.

Replication of type 2 diabetes candidate genes variations in three geographically unrelated Indian population groups.

PubMed

Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Singh, Yoginder Pal; Kaul, Nabodita; Behura, Anita; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K; Chainy, Gagan B N; Bhanwer, Amarjit S; Sharma, Swarkar; Bamezai, Rameshwar N K

2013-01-01

Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, p<5.5E-04) with T2D susceptibility in combined population. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E-08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67-3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D.

Replication of Type 2 Diabetes Candidate Genes Variations in Three Geographically Unrelated Indian Population Groups

PubMed Central

Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K.; Chainy, Gagan B. N.; Bhanwer, Amarjit S.; Sharma, Swarkar; Bamezai, Rameshwar N. K.

2013-01-01

Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, p<5.5E−04) with T2D susceptibility in combined population. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E−08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67–3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D. PMID:23527042

confFuse: High-Confidence Fusion Gene Detection across Tumor Entities.

PubMed

Huang, Zhiqin; Jones, David T W; Wu, Yonghe; Lichter, Peter; Zapatka, Marc

2017-01-01

Background: Fusion genes play an important role in the tumorigenesis of many cancers. Next-generation sequencing (NGS) technologies have been successfully applied in fusion gene detection for the last several years, and a number of NGS-based tools have been developed for identifying fusion genes during this period. Most fusion gene detection tools based on RNA-seq data report a large number of candidates (mostly false positives), making it hard to prioritize candidates for experimental validation and further analysis. Selection of reliable fusion genes for downstream analysis becomes very important in cancer research. We therefore developed confFuse, a scoring algorithm to reliably select high-confidence fusion genes which are likely to be biologically relevant. Results: confFuse takes multiple parameters into account in order to assign each fusion candidate a confidence score, of which score ≥8 indicates high-confidence fusion gene predictions. These parameters were manually curated based on our experience and on certain structural motifs of fusion genes. Compared with alternative tools, based on 96 published RNA-seq samples from different tumor entities, our method can significantly reduce the number of fusion candidates (301 high-confidence from 8,083 total predicted fusion genes) and keep high detection accuracy (recovery rate 85.7%). Validation of 18 novel, high-confidence fusions detected in three breast tumor samples resulted in a 100% validation rate. Conclusions: confFuse is a novel downstream filtering method that allows selection of highly reliable fusion gene candidates for further downstream analysis and experimental validations. confFuse is available at https://github.com/Zhiqin-HUANG/confFuse.

Genomic Diversity of Burkholderia pseudomallei Clinical Isolates: Subtractive Hybridization Reveals a Burkholderia mallei-Specific Propage in B. pseudomallei 1026b

DTIC Science & Technology

2004-06-01

identification of several new virulence gene candidates. In particular, K96243 harbors multiple genomic islands with relatively low GC contents, suggesting...coli, Streptococcus pyogenes, Staphylococcus aureus, S. enterica, and Xylella fastidiosa (11, 16, 17). The genomic sequencing results for multiple... virulence genes by subtractive hybridization: identifica- tion of capsular polysaccharide of Burkholderia pseudomallei as a major virulence determinant

Array-based comparative genomic hybridization-guided identification of reference genes for normalization of real-time quantitative polymerase chain reaction assay data for lymphomas, histiocytic sarcomas, and osteosarcomas of dogs.

PubMed

Tsai, Pei-Chien; Breen, Matthew

2012-09-01

To identify suitable reference genes for normalization of real-time quantitative PCR (RT-qPCR) assay data for common tumors of dogs. Malignant lymph node (n = 8), appendicular osteosarcoma (9), and histiocytic sarcoma (12) samples and control samples of various nonneoplastic canine tissues. Array-based comparative genomic hybridization (aCGH) data were used to guide selection of 9 candidate reference genes. Expression stability of candidate reference genes and 4 commonly used reference genes was determined for tumor samples with RT-qPCR assays and 3 software programs. LOC611555 was the candidate reference gene with the highest expression stability among the 3 tumor types. Of the commonly used reference genes, expression stability of HPRT was high in histiocytic sarcoma samples, and expression stability of Ubi and RPL32 was high in osteosarcoma samples. Some of the candidate reference genes had higher expression stability than did the commonly used reference genes. Data for constitutively expressed genes with high expression stability are required for normalization of RT-qPCR assay results. Without such data, accurate quantification of gene expression in tumor tissue samples is difficult. Results of the present study indicated LOC611555 may be a useful RT-qPCR assay reference gene for multiple tissue types. Some commonly used reference genes may be suitable for normalization of gene expression data for tumors of dogs, such as lymphomas, osteosarcomas, or histiocytic sarcomas.

Elevated transcription factor specificity protein 1 in autistic brains alters the expression of autism candidate genes.

PubMed

Thanseem, Ismail; Anitha, Ayyappan; Nakamura, Kazuhiko; Suda, Shiro; Iwata, Keiko; Matsuzaki, Hideo; Ohtsubo, Masafumi; Ueki, Takatoshi; Katayama, Taiichi; Iwata, Yasuhide; Suzuki, Katsuaki; Minoshima, Shinsei; Mori, Norio

2012-03-01

Profound changes in gene expression can result from abnormalities in the concentrations of sequence-specific transcription factors like specificity protein 1 (Sp1). Specificity protein 1 binding sites have been reported in the promoter regions of several genes implicated in autism. We hypothesize that dysfunction of Sp1 could affect the expression of multiple autism candidate genes, contributing to the heterogeneity of autism. We assessed any alterations in the expression of Sp1 and that of autism candidate genes in the postmortem brain (anterior cingulate gyrus [ACG], motor cortex, and thalamus) of autism patients (n = 8) compared with healthy control subjects (n = 13). Alterations in the expression of candidate genes upon Sp1/DNA binding inhibition with mithramycin and Sp1 silencing by RNAi were studied in SK-N-SH neuronal cells. We observed elevated expression of Sp1 in ACG of autism patients (p = .010). We also observed altered expression of several autism candidate genes. GABRB3, RELN, and HTR2A showed reduced expression, whereas CD38, ITGB3, MAOA, MECP2, OXTR, and PTEN showed elevated expression in autism. In SK-N-SH cells, OXTR, PTEN, and RELN showed reduced expression upon Sp1/DNA binding inhibition and Sp1 silencing. The RNA integrity number was not available for any of the samples. Transcription factor Sp1 is dysfunctional in the ACG of autistic brain. Consequently, the expression of potential autism candidate genes regulated by Sp1, especially OXTR and PTEN, could be affected. The diverse downstream pathways mediated by the Sp1-regulated genes, along with the environmental and intracellular signal-related regulation of Sp1, could explain the complex phenotypes associated with autism.

Vitamin D receptor gene Alw I, Fok I, Apa I, and Taq I polymorphisms in patients with urinary stone.

PubMed

Seo, Ill Young; Kang, In-Hong; Chae, Soo-Cheon; Park, Seung Chol; Lee, Young-Jin; Yang, Yun Sik; Ryu, Soo Bang; Rim, Joung Sik

2010-04-01

To evaluate vitamin D receptor (VDR) gene polymorphisms in Korean patients so as to identify the candidate genes associated with urinary stones. Urinary stones are a multifactorial disease that includes various genetic factors. A normal control group of 535 healthy subjects and 278 patients with urinary stones was evaluated. Of 125 patients who presented stone samples, 102 had calcium stones on chemical analysis. The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms were evaluated using the polymerase chain reaction-restriction fragment length polymorphism analysis. Allelic and genotypic frequencies were calculated to identify associations in both groups. The haplotype frequencies of the VDR gene polymorphisms for multiple loci were also determined. For the VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms, there was no statistically significant difference between the patients with urinary stones and the healthy controls. There was also no statistically significant difference between the patients with calcium stones and the healthy controls. A novel haplotype (Ht 4; CTTT) was identified in 13.5% of the patients with urinary stones and in 8.3% of the controls (P = .001). The haplotype frequencies were significantly different between the patients with calcium stones and the controls (P = .004). The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms does not seem to be candidate genetic markers for urinary stones in Korean patients. However, 1 novel haplotype of the VDR gene polymorphisms for multiple loci might be a candidate genetic marker. Copyright 2010 Elsevier Inc. All rights reserved.

Identification of homogeneous genetic architecture of multiple genetically correlated traits by block clustering of genome-wide associations.

PubMed

Gupta, Mayetri; Cheung, Ching-Lung; Hsu, Yi-Hsiang; Demissie, Serkalem; Cupples, L Adrienne; Kiel, Douglas P; Karasik, David

2011-06-01

Genome-wide association studies (GWAS) using high-density genotyping platforms offer an unbiased strategy to identify new candidate genes for osteoporosis. It is imperative to be able to clearly distinguish signal from noise by focusing on the best phenotype in a genetic study. We performed GWAS of multiple phenotypes associated with fractures [bone mineral density (BMD), bone quantitative ultrasound (QUS), bone geometry, and muscle mass] with approximately 433,000 single-nucleotide polymorphisms (SNPs) and created a database of resulting associations. We performed analysis of GWAS data from 23 phenotypes by a novel modification of a block clustering algorithm followed by gene-set enrichment analysis. A data matrix of standardized regression coefficients was partitioned along both axes--SNPs and phenotypes. Each partition represents a distinct cluster of SNPs that have similar effects over a particular set of phenotypes. Application of this method to our data shows several SNP-phenotype connections. We found a strong cluster of association coefficients of high magnitude for 10 traits (BMD at several skeletal sites, ultrasound measures, cross-sectional bone area, and section modulus of femoral neck and shaft). These clustered traits were highly genetically correlated. Gene-set enrichment analyses indicated the augmentation of genes that cluster with the 10 osteoporosis-related traits in pathways such as aldosterone signaling in epithelial cells, role of osteoblasts, osteoclasts, and chondrocytes in rheumatoid arthritis, and Parkinson signaling. In addition to several known candidate genes, we also identified PRKCH and SCNN1B as potential candidate genes for multiple bone traits. In conclusion, our mining of GWAS results revealed the similarity of association results between bone strength phenotypes that may be attributed to pleiotropic effects of genes. This knowledge may prove helpful in identifying novel genes and pathways that underlie several correlated phenotypes, as well as in deciphering genetic and phenotypic modularity underlying osteoporosis risk. Copyright © 2011 American Society for Bone and Mineral Research.

Defining the proximal border of the Huntington disease candidate region by multipoint recombination analyses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Skraastad, M.I.; De Rooij, K.E.; De Koning Gans, P.A.M.

1993-06-01

The candidate region for the Huntington disease (HD) gene has been narrowed down to a 2.2-Mb region between D4S10 and D4S98 on the short arm of chromosome 4. To map the HD gene within this candidate region 65 Dutch HD families were studied. In total 338 informative meioses were analyzed and 11 multiple informative crossovers were detected. Assuming a minimum number of recombinations and no double recombinations, the multiple informative crossovers are consistent with one specific genetic order for 12 loci: D4S10-(D4S81,D4S126)-D4S125-(D4S127,D4S95)-D4S43-(D4S115, D4S96, D4S111, D4S90, D4S141).This is in agreement with the known data derived from similar and other methods. Themore » loci between brackets could not be mapped relative to each other. In the family material, two informative three-point marker recombination events were detected in the proximal HD candidate region, which are also informative for HD. Both recombination events map the HD gene distal to D4S81 and most likely distal to D4S125, narrowing down the HD candidate region to a 1.7-Mb region between D4S125 and D4S98. 39 refs., 3 figs., 2 tabs.« less

Detection of genomic signatures of recent selection in commercial broiler chickens.

PubMed

Fu, Weixuan; Lee, William R; Abasht, Behnam

2016-08-26

Identification of the genomic signatures of recent selection may help uncover causal polymorphisms controlling traits relevant to recent decades of selective breeding in livestock. In this study, we aimed at detecting signatures of recent selection in commercial broiler chickens using genotype information from single nucleotide polymorphisms (SNPs). A total of 565 chickens from five commercial purebred lines, including three broiler sire (male) lines and two broiler dam (female) lines, were genotyped using the 60K SNP Illumina iSelect chicken array. To detect genomic signatures of recent selection, we applied two methods based on population comparison, cross-population extended haplotype homozygosity (XP-EHH) and cross-population composite likelihood ratio (XP-CLR), and further analyzed the results to find genomic regions under recent selection in multiple purebred lines. A total of 321 candidate selection regions spanning approximately 1.45 % of the chicken genome in each line were detected by consensus of results of both XP-EHH and XP-CLR methods. To minimize false discovery due to genetic drift, only 42 of the candidate selection regions that were shared by 2 or more purebred lines were considered as high-confidence selection regions in the study. Of these 42 regions, 20 were 50 kb or less while 4 regions were larger than 0.5 Mb. In total, 91 genes could be found in the 42 regions, among which 19 regions contained only 1 or 2 genes, and 9 regions were located at gene deserts. Our results provide a genome-wide scan of recent selection signatures in five purebred lines of commercial broiler chickens. We found several candidate genes for recent selection in multiple lines, such as SOX6 (Sex Determining Region Y-Box 6) and cTR (Thyroid hormone receptor beta). These genes may have been under recent selection due to their essential roles in growth, development and reproduction in chickens. Furthermore, our results suggest that in some candidate regions, the same or opposite alleles have been under recent selection in multiple lines. Most of the candidate genes in the selection regions are novel, and as such they should be of great interest for future research into the genetic architecture of traits relevant to modern broiler breeding.

An Integrative Genetics Approach to Identify Candidate Genes Regulating BMD: Combining Linkage, Gene Expression, and Association

PubMed Central

Farber, Charles R; van Nas, Atila; Ghazalpour, Anatole; Aten, Jason E; Doss, Sudheer; Sos, Brandon; Schadt, Eric E; Ingram-Drake, Leslie; Davis, Richard C; Horvath, Steve; Smith, Desmond J; Drake, Thomas A; Lusis, Aldons J

2009-01-01

Numerous quantitative trait loci (QTLs) affecting bone traits have been identified in the mouse; however, few of the underlying genes have been discovered. To improve the process of transitioning from QTL to gene, we describe an integrative genetics approach, which combines linkage analysis, expression QTL (eQTL) mapping, causality modeling, and genetic association in outbred mice. In C57BL/6J × C3H/HeJ (BXH) F2 mice, nine QTLs regulating femoral BMD were identified. To select candidate genes from within each QTL region, microarray gene expression profiles from individual F2 mice were used to identify 148 genes whose expression was correlated with BMD and regulated by local eQTLs. Many of the genes that were the most highly correlated with BMD have been previously shown to modulate bone mass or skeletal development. Candidates were further prioritized by determining whether their expression was predicted to underlie variation in BMD. Using network edge orienting (NEO), a causality modeling algorithm, 18 of the 148 candidates were predicted to be causally related to differences in BMD. To fine-map QTLs, markers in outbred MF1 mice were tested for association with BMD. Three chromosome 11 SNPs were identified that were associated with BMD within the Bmd11 QTL. Finally, our approach provides strong support for Wnt9a, Rasd1, or both underlying Bmd11. Integration of multiple genetic and genomic data sets can substantially improve the efficiency of QTL fine-mapping and candidate gene identification. PMID:18767929

Biological pathways, candidate genes and molecular markers associated with quality-of-life domains: an update

PubMed Central

Sprangers, Mirjam A.G.; Thong, Melissa S.Y.; Bartels, Meike; Barsevick, Andrea; Ordoñana, Juan; Shi, Qiuling; Wang, Xin Shelley; Klepstad, Pål; Wierenga, Eddy A.; Singh, Jasvinder A.; Sloan, Jeff A.

2014-01-01

Background There is compelling evidence of a genetic foundation of patient-reported QOL. Given the rapid development of substantial scientific advances in this area of research, the current paper updates and extends reviews published in 2010. Objectives The objective is to provide an updated overview of the biological pathways, candidate genes and molecular markers involved in fatigue, pain, negative (depressed mood) and positive (well-being/happiness) emotional functioning, social functioning, and overall QOL. Methods We followed a purposeful search algorithm of existing literature to capture empirical papers investigating the relationship between biological pathways and molecular markers and the identified QOL domains. Results Multiple major pathways are involved in each QOL domain. The inflammatory pathway has the strongest evidence as a controlling mechanism underlying fatigue. Inflammation and neurotransmission are key processes involved in pain perception and the COMT gene is associated with multiple sorts of pain. The neurotransmitter and neuroplasticity theories have the strongest evidence for their relationship with depression. Oxytocin-related genes and genes involved in the serotonergic and dopaminergic pathways play a role in social functioning. Inflammatory pathways, via cytokines, also play an important role in overall QOL. Conclusions Whereas the current findings need future experiments and replication efforts, they will provide researchers supportive background information when embarking on studies relating candidate genes and/or molecular markers to QOL domains. The ultimate goal of this area of research is to enhance patients’ QOL. PMID:24604075

Biological pathways, candidate genes, and molecular markers associated with quality-of-life domains: an update.

PubMed

Sprangers, Mirjam A G; Thong, Melissa S Y; Bartels, Meike; Barsevick, Andrea; Ordoñana, Juan; Shi, Qiuling; Wang, Xin Shelley; Klepstad, Pål; Wierenga, Eddy A; Singh, Jasvinder A; Sloan, Jeff A

2014-09-01

There is compelling evidence of a genetic foundation of patient-reported quality of life (QOL). Given the rapid development of substantial scientific advances in this area of research, the current paper updates and extends reviews published in 2010. The objective was to provide an updated overview of the biological pathways, candidate genes, and molecular markers involved in fatigue, pain, negative (depressed mood) and positive (well-being/happiness) emotional functioning, social functioning, and overall QOL. We followed a purposeful search algorithm of existing literature to capture empirical papers investigating the relationship between biological pathways and molecular markers and the identified QOL domains. Multiple major pathways are involved in each QOL domain. The inflammatory pathway has the strongest evidence as a controlling mechanism underlying fatigue. Inflammation and neurotransmission are key processes involved in pain perception, and the catechol-O-methyltransferase (COMT) gene is associated with multiple sorts of pain. The neurotransmitter and neuroplasticity theories have the strongest evidence for their relationship with depression. Oxytocin-related genes and genes involved in the serotonergic and dopaminergic pathways play a role in social functioning. Inflammatory pathways, via cytokines, also play an important role in overall QOL. Whereas the current findings need future experiments and replication efforts, they will provide researchers supportive background information when embarking on studies relating candidate genes and/or molecular markers to QOL domains. The ultimate goal of this area of research is to enhance patients' QOL.

Integrative Functional Genomics for Systems Genetics in GeneWeaver.org.

PubMed

Bubier, Jason A; Langston, Michael A; Baker, Erich J; Chesler, Elissa J

2017-01-01

The abundance of existing functional genomics studies permits an integrative approach to interpreting and resolving the results of diverse systems genetics studies. However, a major challenge lies in assembling and harmonizing heterogeneous data sets across species for facile comparison to the positional candidate genes and coexpression networks that come from systems genetic studies. GeneWeaver is an online database and suite of tools at www.geneweaver.org that allows for fast aggregation and analysis of gene set-centric data. GeneWeaver contains curated experimental data together with resource-level data such as GO annotations, MP annotations, and KEGG pathways, along with persistent stores of user entered data sets. These can be entered directly into GeneWeaver or transferred from widely used resources such as GeneNetwork.org. Data are analyzed using statistical tools and advanced graph algorithms to discover new relations, prioritize candidate genes, and generate function hypotheses. Here we use GeneWeaver to find genes common to multiple gene sets, prioritize candidate genes from a quantitative trait locus, and characterize a set of differentially expressed genes. Coupling a large multispecies repository curated and empirical functional genomics data to fast computational tools allows for the rapid integrative analysis of heterogeneous data for interpreting and extrapolating systems genetics results.

Identification of prostate cancer modifier pathways using parental strain expression mapping

PubMed Central

Xu, Qing; Majumder, Pradip K.; Ross, Kenneth; Shim, Yeonju; Golub, Todd R.; Loda, Massimo; Sellers, William R.

2007-01-01

Inherited genetic risk factors play an important role in cancer. However, other than the Mendelian fashion cancer susceptibility genes found in familial cancer syndromes, little is known about risk modifiers that control individual susceptibility. Here we developed a strategy, parental strain expression mapping, that utilizes the homogeneity of inbred mice and genome-wide mRNA expression analyses to directly identify candidate germ-line modifier genes and pathways underlying phenotypic differences among murine strains exposed to transgenic activation of AKT1. We identified multiple candidate modifier pathways and, specifically, the glycolysis pathway as a candidate negative modulator of AKT1-induced proliferation. In keeping with the findings in the murine models, in multiple human prostate expression data set, we found that enrichment of glycolysis pathways in normal tissues was associated with decreased rates of cancer recurrence after prostatectomy. Together, these data suggest that parental strain expression mapping can directly identify germ-line modifier pathways of relevance to human disease. PMID:17978178

Comparative analysis of transcriptome in two wheat genotypes with contrasting levels of drought tolerance

USDA-ARS?s Scientific Manuscript database

Drought tolerance is a complex trait that is governed by multiple genes. To identify the potential candidate genes, comparative analysis of drought stress-responsive transcriptome between drought-tolerant (Triticum aestivum Cv. C306) and drought-sensitive (Triticum aestivum Cv. WL711) genotypes was ...

The Candidate Cancer Gene Database: a database of cancer driver genes from forward genetic screens in mice.

PubMed

Abbott, Kenneth L; Nyre, Erik T; Abrahante, Juan; Ho, Yen-Yi; Isaksson Vogel, Rachel; Starr, Timothy K

2015-01-01

Identification of cancer driver gene mutations is crucial for advancing cancer therapeutics. Due to the overwhelming number of passenger mutations in the human tumor genome, it is difficult to pinpoint causative driver genes. Using transposon mutagenesis in mice many laboratories have conducted forward genetic screens and identified thousands of candidate driver genes that are highly relevant to human cancer. Unfortunately, this information is difficult to access and utilize because it is scattered across multiple publications using different mouse genome builds and strength metrics. To improve access to these findings and facilitate meta-analyses, we developed the Candidate Cancer Gene Database (CCGD, http://ccgd-starrlab.oit.umn.edu/). The CCGD is a manually curated database containing a unified description of all identified candidate driver genes and the genomic location of transposon common insertion sites (CISs) from all currently published transposon-based screens. To demonstrate relevance to human cancer, we performed a modified gene set enrichment analysis using KEGG pathways and show that human cancer pathways are highly enriched in the database. We also used hierarchical clustering to identify pathways enriched in blood cancers compared to solid cancers. The CCGD is a novel resource available to scientists interested in the identification of genetic drivers of cancer. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Exome sequencing of a large family identifies potential candidate genes contributing risk to bipolar disorder.

PubMed

Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P

2018-03-01

Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of novel candidate drivers connecting different dysfunctional levels for lung adenocarcinoma using protein-protein interactions and a shortest path approach

NASA Astrophysics Data System (ADS)

Chen, Lei; Huang, Tao; Zhang, Yu-Hang; Jiang, Yang; Zheng, Mingyue; Cai, Yu-Dong

2016-07-01

Tumors are formed by the abnormal proliferation of somatic cells with disordered growth regulation under the influence of tumorigenic factors. Recently, the theory of “cancer drivers” connects tumor initiation with several specific mutations in the so-called cancer driver genes. According to the differentiation of four basic levels between tumor and adjacent normal tissues, the cancer drivers can be divided into the following: (1) Methylation level, (2) microRNA level, (3) mutation level, and (4) mRNA level. In this study, a computational method is proposed to identify novel lung adenocarcinoma drivers based on dysfunctional genes on the methylation, microRNA, mutation and mRNA levels. First, a large network was constructed using protein-protein interactions. Next, we searched all of the shortest paths connecting dysfunctional genes on different levels and extracted new candidate genes lying on these paths. Finally, the obtained candidate genes were filtered by a permutation test and an additional strict selection procedure involving a betweenness ratio and an interaction score. Several candidate genes remained, which are deemed to be related to two different levels of cancer. The analyses confirmed our assertions that some have the potential to contribute to the tumorigenesis process on multiple levels.

Candidate-gene association study of mothers with pre-eclampsia, and their infants, analyzing 775 SNPs in 190 genes.

PubMed

Goddard, Katrina A B; Tromp, Gerard; Romero, Roberto; Olson, Jane M; Lu, Qing; Xu, Zhiying; Parimi, Neeta; Nien, Jyh Kae; Gomez, Ricardo; Behnke, Ernesto; Solari, Margarita; Espinoza, Jimmy; Santolaya, Joaquin; Chaiworapongsa, Tinnakorn; Lenk, Guy M; Volkenant, Kimberly; Anant, Madan Kumar; Salisbury, Benjamin A; Carr, Janet; Lee, Min Soeb; Vovis, Gerald F; Kuivaniemi, Helena

2007-01-01

Pre-eclampsia (PE) affects 5-7% of pregnancies in the US, and is a leading cause of maternal death and perinatal morbidity and mortality worldwide. To identify genes with a role in PE, we conducted a large-scale association study evaluating 775 SNPs in 190 candidate genes selected for a potential role in obstetrical complications. SNP discovery was performed by DNA sequencing, and genotyping was carried out in a high-throughput facility using the MassARRAY(TM) System. Women with PE (n = 394) and their offspring (n = 324) were compared with control women (n = 602) and their offspring (n = 631) from the same hospital-based population. Haplotypes were estimated for each gene using the EM algorithm, and empirical p values were obtained for a logistic regression-based score test, adjusted for significant covariates. An interaction model between maternal and offspring genotypes was also evaluated. The most significant findings for association with PE were COL1A1 (p = 0.0011) and IL1A (p = 0.0014) for the maternal genotype, and PLAUR (p = 0.0008) for the offspring genotype. Common candidate genes for PE, including MTHFR and NOS3, were not significantly associated with PE. For the interaction model, SNPs within IGF1 (p = 0.0035) and IL4R (p = 0.0036) gave the most significant results. This study is one of the most comprehensive genetic association studies of PE to date, including an evaluation of offspring genotypes that have rarely been considered in previous studies. Although we did not identify statistically significant evidence of association for any of the candidate loci evaluated here after adjusting for multiple testing using the false discovery rate, additional compelling evidence exists, including multiple SNPs with nominally significant p values in COL1A1 and the IL1A region, and previous reports of association for IL1A, to support continued interest in these genes as candidates for PE. Identification of the genetic regulators of PE may have broader implications, since women with PE are at increased risk of death from cardiovascular diseases later in life.

Candidate genes for cooperation and aggression in the social wasp Polistes dominula.

PubMed

Manfredini, Fabio; Brown, Mark J F; Toth, Amy L

2018-05-01

Cooperation and aggression are ubiquitous in social groups, and the genetic mechanisms underlying these behaviours are of great interest for understanding how social group formation is regulated and how it evolves. In this study, we used a candidate gene approach to investigate the patterns of expression of key genes for cooperation and aggression in the brain of a primitively eusocial wasp, Polistes dominula, during colony founding, when multiple foundresses can join the same nest and establish subtle hierarchies of dominance. We used a comparative approach to select candidate genes for cooperation and aggression looking at two previously published studies on global gene expression in wasps and ants. We tested the expression of these genes in P. dominula wasps that were either displaying aggressive behaviour (dominant and single foundresses) or cooperation (subordinate foundresses and workers) towards nestmates. One gene in particular, the egg yolk protein vitellogenin, known for its reproductive role in insects, displayed patterns of expression that strongly matched wasp social rank. We characterize the genomic context of vitellogenin by building a head co-expression gene network for P. dominula, and we discuss a potential role for vitellogenin as a mediator of social interactions in wasps.

A genomic scan for selection reveals candidates for genes involved in the evolution of cultivated sunflower (Helianthus annuus).

PubMed

Chapman, Mark A; Pashley, Catherine H; Wenzler, Jessica; Hvala, John; Tang, Shunxue; Knapp, Steven J; Burke, John M

2008-11-01

Genomic scans for selection are a useful tool for identifying genes underlying phenotypic transitions. In this article, we describe the results of a genome scan designed to identify candidates for genes targeted by selection during the evolution of cultivated sunflower. This work involved screening 492 loci derived from ESTs on a large panel of wild, primitive (i.e., landrace), and improved sunflower (Helianthus annuus) lines. This sampling strategy allowed us to identify candidates for selectively important genes and investigate the likely timing of selection. Thirty-six genes showed evidence of selection during either domestication or improvement based on multiple criteria, and a sequence-based test of selection on a subset of these loci confirmed this result. In view of what is known about the structure of linkage disequilibrium across the sunflower genome, these genes are themselves likely to have been targeted by selection, rather than being merely linked to the actual targets. While the selection candidates showed a broad range of putative functions, they were enriched for genes involved in amino acid synthesis and protein catabolism. Given that a similar pattern has been detected in maize (Zea mays), this finding suggests that selection on amino acid composition may be a general feature of the evolution of crop plants. In terms of genomic locations, the selection candidates were significantly clustered near quantitative trait loci (QTL) that contribute to phenotypic differences between wild and cultivated sunflower, and specific instances of QTL colocalization provide some clues as to the roles that these genes may have played during sunflower evolution.

Placental genome and maternal-placental genetic interactions: a genome-wide and candidate gene association study of placental abruption.

PubMed

Denis, Marie; Enquobahrie, Daniel A; Tadesse, Mahlet G; Gelaye, Bizu; Sanchez, Sixto E; Salazar, Manuel; Ananth, Cande V; Williams, Michelle A

2014-01-01

While available evidence supports the role of genetics in the pathogenesis of placental abruption (PA), PA-related placental genome variations and maternal-placental genetic interactions have not been investigated. Maternal blood and placental samples collected from participants in the Peruvian Abruptio Placentae Epidemiology study were genotyped using Illumina's Cardio-Metabochip platform. We examined 118,782 genome-wide SNPs and 333 SNPs in 32 candidate genes from mitochondrial biogenesis and oxidative phosphorylation pathways in placental DNA from 280 PA cases and 244 controls. We assessed maternal-placental interactions in the candidate gene SNPS and two imprinted regions (IGF2/H19 and C19MC). Univariate and penalized logistic regression models were fit to estimate odds ratios. We examined the combined effect of multiple SNPs on PA risk using weighted genetic risk scores (WGRS) with repeated ten-fold cross-validations. A multinomial model was used to investigate maternal-placental genetic interactions. In placental genome-wide and candidate gene analyses, no SNP was significant after false discovery rate correction. The top genome-wide association study (GWAS) hits were rs544201, rs1484464 (CTNNA2), rs4149570 (TNFRSF1A) and rs13055470 (ZNRF3) (p-values: 1.11e-05 to 3.54e-05). The top 200 SNPs of the GWAS overrepresented genes involved in cell cycle, growth and proliferation. The top candidate gene hits were rs16949118 (COX10) and rs7609948 (THRB) (p-values: 6.00e-03 and 8.19e-03). Participants in the highest quartile of WGRS based on cross-validations using SNPs selected from the GWAS and candidate gene analyses had a 8.40-fold (95% CI: 5.8-12.56) and a 4.46-fold (95% CI: 2.94-6.72) higher odds of PA compared to participants in the lowest quartile. We found maternal-placental genetic interactions on PA risk for two SNPs in PPARG (chr3:12313450 and chr3:12412978) and maternal imprinting effects for multiple SNPs in the C19MC and IGF2/H19 regions. Variations in the placental genome and interactions between maternal-placental genetic variations may contribute to PA risk. Larger studies may help advance our understanding of PA pathogenesis.

Genomic Diversity of Burkholderia pseudomallei Clinical Isolates: Subtractive Hybridization Reveals a Burkholderia mallei-Specific Prophage in B. pseudomallei 1026b

DTIC Science & Technology

2004-06-01

identification of several new virulence gene candidates. In particular, K96243 harbors multiple genomic islands with relatively low GC contents...differences were observed. Prophage-encoded virulence factors in other bacterial species have been described (5), and it was of interest to see if gene ... Xylella fastidiosa (11, 16, 17). The genomic sequencing results for multiple strains of Streptococcus and Xylella suggest that different disease

Association between Variants in Atopy-Related Immunologic Candidate Genes and Pancreatic Cancer Risk.

PubMed

Cotterchio, Michelle; Lowcock, Elizabeth; Bider-Canfield, Zoe; Lemire, Mathieu; Greenwood, Celia; Gallinger, Steven; Hudson, Thomas

2015-01-01

Many epidemiology studies report that atopic conditions such as allergies are associated with reduced pancreas cancer risk. The reason for this relationship is not yet understood. This is the first study to comprehensively evaluate the association between variants in atopy-related candidate genes and pancreatic cancer risk. A population-based case-control study of pancreas cancer cases diagnosed during 2011-2012 (via Ontario Cancer Registry), and controls recruited using random digit dialing utilized DNA from 179 cases and 566 controls. Following an exhaustive literature review, SNPs in 180 candidate genes were pre-screened using dbGaP pancreas cancer GWAS data; 147 SNPs in 56 allergy-related immunologic genes were retained and genotyped. Logistic regression was used to estimate age-adjusted odd ratio (AOR) for each variant and false discovery rate was used to adjust Wald p-values for multiple testing. Subsequently, a risk allele score was derived based on statistically significant variants. 18 SNPs in 14 candidate genes (CSF2, DENND1B, DPP10, FLG, IL13, IL13RA2, LRP1B, NOD1, NPSR1, ORMDL3, RORA, STAT4, TLR6, TRA) were significantly associated with pancreas cancer risk. After adjustment for multiple comparisons, two LRP1B SNPs remained statistically significant; for example, LRP1B rs1449477 (AA vs. CC: AOR=0.37, 95% CI: 0.22-0.62; p (adjusted)=0.04). Furthermore, the risk allele score was associated with a significant reduction in pancreas cancer risk (p=0.0007). Preliminary findings suggest certain atopy-related variants may be associated with pancreas cancer risk. Further studies are needed to replicate this, and to elucidate the biology behind the growing body of epidemiologic evidence suggesting allergies may reduce pancreatic cancer risk.

Integration of genome-wide association studies with biological knowledge identifies six novel genes related to kidney function.

PubMed

Chasman, Daniel I; Fuchsberger, Christian; Pattaro, Cristian; Teumer, Alexander; Böger, Carsten A; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C; O'Seaghdha, Conall M; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V; O'Connell, Jeffrey R; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D; Gierman, Hinco J; Feitosa, Mary F; Hwang, Shih-Jen; Atkinson, Elizabeth J; Lohman, Kurt; Cornelis, Marilyn C; Johansson, Asa; Tönjes, Anke; Dehghan, Abbas; Lambert, Jean-Charles; Holliday, Elizabeth G; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y; Murgia, Federico; Trompet, Stella; Imboden, Medea; Coassin, Stefan; Pistis, Giorgio; Harris, Tamara B; Launer, Lenore J; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank; Demirkan, Ayse; Oostra, Ben A; de Andrade, Mariza; Turner, Stephen T; Ding, Jingzhong; Andrews, Jeanette S; Freedman, Barry I; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Meisinger, Christa; Gieger, Christian; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H; Wright, Alan F; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G; Rivadeneira, Fernando; Aulchenko, Yurii S; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K; Portas, Laura; Ford, Ian; Buckley, Brendan M; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J Wouter; Probst-Hensch, Nicole M; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S; van Duijn, Cornelia M; Borecki, Ingrid B; Kardia, Sharon L R; Liu, Yongmei; Curhan, Gary C; Rudan, Igor; Gyllensten, Ulf; Wilson, James F; Franke, Andre; Pramstaller, Peter P; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Parsa, Afshin; Bochud, Murielle; Heid, Iris M; Kao, W H Linda; Fox, Caroline S; Köttgen, Anna

2012-12-15

In conducting genome-wide association studies (GWAS), analytical approaches leveraging biological information may further understanding of the pathophysiology of clinical traits. To discover novel associations with estimated glomerular filtration rate (eGFR), a measure of kidney function, we developed a strategy for integrating prior biological knowledge into the existing GWAS data for eGFR from the CKDGen Consortium. Our strategy focuses on single nucleotide polymorphism (SNPs) in genes that are connected by functional evidence, determined by literature mining and gene ontology (GO) hierarchies, to genes near previously validated eGFR associations. It then requires association thresholds consistent with multiple testing, and finally evaluates novel candidates by independent replication. Among the samples of European ancestry, we identified a genome-wide significant SNP in FBXL20 (P = 5.6 × 10(-9)) in meta-analysis of all available data, and additional SNPs at the INHBC, LRP2, PLEKHA1, SLC3A2 and SLC7A6 genes meeting multiple-testing corrected significance for replication and overall P-values of 4.5 × 10(-4)-2.2 × 10(-7). Neither the novel PLEKHA1 nor FBXL20 associations, both further supported by association with eGFR among African Americans and with transcript abundance, would have been implicated by eGFR candidate gene approaches. LRP2, encoding the megalin receptor, was identified through connection with the previously known eGFR gene DAB2 and extends understanding of the megalin system in kidney function. These findings highlight integration of existing genome-wide association data with independent biological knowledge to uncover novel candidate eGFR associations, including candidates lacking known connections to kidney-specific pathways. The strategy may also be applicable to other clinical phenotypes, although more testing will be needed to assess its potential for discovery in general.

Integration of genome-wide association studies with biological knowledge identifies six novel genes related to kidney function

PubMed Central

Chasman, Daniel I.; Fuchsberger, Christian; Pattaro, Cristian; Teumer, Alexander; Böger, Carsten A.; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C.; O'Seaghdha, Conall M.; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V.; O'Connell, Jeffrey R.; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D.; Gierman, Hinco J.; Feitosa, Mary F.; Hwang, Shih-Jen; Atkinson, Elizabeth J.; Lohman, Kurt; Cornelis, Marilyn C.; Johansson, Åsa; Tönjes, Anke; Dehghan, Abbas; Lambert, Jean-Charles; Holliday, Elizabeth G.; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y.; Murgia, Federico; Trompet, Stella; Imboden, Medea; Coassin, Stefan; Pistis, Giorgio; Harris, Tamara B.; Launer, Lenore J.; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D.; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank; Demirkan, Ayse; Oostra, Ben A.; de Andrade, Mariza; Turner, Stephen T.; Ding, Jingzhong; Andrews, Jeanette S.; Freedman, Barry I.; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Meisinger, Christa; Gieger, Christian; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E.; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H.; Wright, Alan F.; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K.; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G.; Rivadeneira, Fernando; Aulchenko, Yurii S.; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K.; Portas, Laura; Ford, Ian; Buckley, Brendan M.; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K.; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J. Wouter; Probst-Hensch, Nicole M.; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R.; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S.; van Duijn, Cornelia M.; Borecki, Ingrid B.; Kardia, Sharon L.R.; Liu, Yongmei; Curhan, Gary C.; Rudan, Igor; Gyllensten, Ulf; Wilson, James F.; Franke, Andre; Pramstaller, Peter P.; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Parsa, Afshin; Bochud, Murielle; Heid, Iris M.; Kao, W.H. Linda; Fox, Caroline S.; Köttgen, Anna

2012-01-01

In conducting genome-wide association studies (GWAS), analytical approaches leveraging biological information may further understanding of the pathophysiology of clinical traits. To discover novel associations with estimated glomerular filtration rate (eGFR), a measure of kidney function, we developed a strategy for integrating prior biological knowledge into the existing GWAS data for eGFR from the CKDGen Consortium. Our strategy focuses on single nucleotide polymorphism (SNPs) in genes that are connected by functional evidence, determined by literature mining and gene ontology (GO) hierarchies, to genes near previously validated eGFR associations. It then requires association thresholds consistent with multiple testing, and finally evaluates novel candidates by independent replication. Among the samples of European ancestry, we identified a genome-wide significant SNP in FBXL20 (P = 5.6 × 10−9) in meta-analysis of all available data, and additional SNPs at the INHBC, LRP2, PLEKHA1, SLC3A2 and SLC7A6 genes meeting multiple-testing corrected significance for replication and overall P-values of 4.5 × 10−4–2.2 × 10−7. Neither the novel PLEKHA1 nor FBXL20 associations, both further supported by association with eGFR among African Americans and with transcript abundance, would have been implicated by eGFR candidate gene approaches. LRP2, encoding the megalin receptor, was identified through connection with the previously known eGFR gene DAB2 and extends understanding of the megalin system in kidney function. These findings highlight integration of existing genome-wide association data with independent biological knowledge to uncover novel candidate eGFR associations, including candidates lacking known connections to kidney-specific pathways. The strategy may also be applicable to other clinical phenotypes, although more testing will be needed to assess its potential for discovery in general. PMID:22962313

PRKCA: A Positional Candidate Gene for Body Mass Index and Asthma

PubMed Central

Murphy, Amy; Tantisira, Kelan G.; Soto-Quirós, Manuel E.; Avila, Lydiana; Klanderman, Barbara J.; Lake, Stephen; Weiss, Scott T.; Celedón, Juan C.

2009-01-01

Asthma incidence and prevalence are higher in obese individuals. A potential mechanistic basis for this relationship is pleiotropy. We hypothesized that significant linkage and candidate-gene association would be found for body mass index (BMI) in a population ascertained on asthma affection status. Linkage analysis for BMI was performed on 657 subjects in eight Costa Rican families enrolled in a study of asthma. Family-based association studies were conducted for BMI with SNPs within a positional candidate gene, PRKCA. SNPs within PRKCA were also tested for association with asthma. Association studies were conducted in 415 Costa Rican parent-child trios and 493 trios participating in the Childhood Asthma Management Program (CAMP). Although only modest evidence of linkage for BMI was obtained for the whole cohort, significant linkage was noted for BMI in females on chromosome 17q (peak LOD = 3.39). Four SNPs in a candidate gene in this region (PRKCA) had unadjusted association p values < 0.05 for BMI in both cohorts, with the joint p value for two SNPs remaining significant after adjustment for multiple comparisons (rs228883 and rs1005651, joint p values = 9.5 × 10−5 and 5.6 × 10−5). Similarly, eight SNPs had unadjusted association p values < 0.05 for asthma in both populations, with one SNP remaining significant after adjustment for multiple comparisons (rs11079657, joint p value = 2.6 × 10−5). PRKCA is a pleiotropic locus that is associated with both BMI and asthma and that has been identified via linkage analysis of BMI in a population ascertained on asthma. PMID:19576566

Integrated computational biology analysis to evaluate target genes for chronic myelogenous leukemia.

PubMed

Zheng, Yu; Wang, Yu-Ping; Cao, Hongbao; Chen, Qiusheng; Zhang, Xi

2018-06-05

Although hundreds of genes have been linked to chronic myelogenous leukemia (CML), many of the results lack reproducibility. In the present study, data across multiple modalities were integrated to evaluate 579 CML candidate genes, including literature‑based CML‑gene relation data, Gene Expression Omnibus RNA expression data and pathway‑based gene‑gene interaction data. The expression data included samples from 76 patients with CML and 73 healthy controls. For each target gene, four metrics were proposed and tested with case/control classification. The effectiveness of the four metrics presented was demonstrated by the high classification accuracy (94.63%; P<2x10‑4). Cross metric analysis suggested nine top candidate genes for CML: Epidermal growth factor receptor, tumor protein p53, catenin β 1, janus kinase 2, tumor necrosis factor, abelson murine leukemia viral oncogene homolog 1, vascular endothelial growth factor A, B‑cell lymphoma 2 and proto‑oncogene tyrosine‑protein kinase. In addition, 145 CML candidate pathways enriched with 485 out of 579 genes were identified (P<8.2x10‑11; q=0.005). In conclusion, weighted genetic networks generated using computational biology may be complementary to biological experiments for the evaluation of known or novel CML target genes.

Identification of evolutionarily conserved DNA damage response genes that alter sensitivity to cisplatin

PubMed Central

Gaponova, Anna V.; Deneka, Alexander Y.; Beck, Tim N.; Liu, Hanqing; Andrianov, Gregory; Nikonova, Anna S.; Nicolas, Emmanuelle; Einarson, Margret B.; Golemis, Erica A.; Serebriiskii, Ilya G.

2017-01-01

Ovarian, head and neck, and other cancers are commonly treated with cisplatin and other DNA damaging cytotoxic agents. Altered DNA damage response (DDR) contributes to resistance of these tumors to chemotherapies, some targeted therapies, and radiation. DDR involves multiple protein complexes and signaling pathways, some of which are evolutionarily ancient and involve protein orthologs conserved from yeast to humans. To identify new regulators of cisplatin-resistance in human tumors, we integrated high throughput and curated datasets describing yeast genes that regulate sensitivity to cisplatin and/or ionizing radiation. Next, we clustered highly validated genes based on chemogenomic profiling, and then mapped orthologs of these genes in expanded genomic networks for multiple metazoans, including humans. This approach identified an enriched candidate set of genes involved in the regulation of resistance to radiation and/or cisplatin in humans. Direct functional assessment of selected candidate genes using RNA interference confirmed their activity in influencing cisplatin resistance, degree of γH2AX focus formation and ATR phosphorylation, in ovarian and head and neck cancer cell lines, suggesting impaired DDR signaling as the driving mechanism. This work enlarges the set of genes that may contribute to chemotherapy resistance and provides a new contextual resource for interpreting next generation sequencing (NGS) genomic profiling of tumors. PMID:27863405

Association of Common Mitochondrial DNA Variants with Multiple Sclerosis and Systemic Lupus Erythematosus

PubMed Central

Vyshkina, Tamara; Sylvester, Andrew; Sadiq, Saud; Bonilla, Eduardo; Canter, Jeff A.; Perl, Andras; Kalman, Bernadette

2008-01-01

Mitochondrial dysfunction has been implicated in the pathogenesis of multiple sclerosis (MS) and systemic lupus erythematosus (SLE). This study re-investigates the roles of previously suggested candidate genes of energy metabolism (Complex I genes located in the nucleus and in the mitochondria) in patients with MS relative to ethnically matched SLE patients and healthy controls. After stringent correction for multiple testing, we reproduce the association of the mitochondrial (mt)DNA haplotype K* with MS, but reject the importance of previously suggested borderline associations with nuclear genes of Complex I. In addition, we detect the association of common variants of the mitochondrial ND2 and ATP6 genes with both MS and SLE, which raises the possibility of a shared mitochondrial genetic background of these two autoimmune diseases. PMID:18708297

Exclusion of candidate genes from the chromosome 1q juvenile glaucoma region and mapping of the peripheral cannabis receptor gene (CNR2) to chromosome 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sunden, S.L.F.; Nichols, B.E.; Alward, W.L.M.

Juvenile onset primary open angle glaucoma has been mapped by linkage to 1q21-q31. Several candidate genes were evaluated in the same family used to identify the primary linkage. Atrionatriuretic peptide receptor A (NPR1) and laminin C1 (LAMC1) have been previously mapped to this region and could putatively play a role in the pathogenesis of glaucoma. A third gene, the peripheral cannabis receptor (CNR2) was not initially mapped in humans but was a candidate because of the relief that cannabis affords some patients with primary open angle glaucoma. Microsatellites associated with NPR1 and LAMC1 revealed multiple recombinations in affected members ofmore » this pedigree. CNR2 was shown to be on chromosome 1 by PCR amplification of a 150 bp fragment of the 3{prime} untranslated region in monochromosomal somatic cell hybrids (NIGMS panel No. 2). These primers also revealed a two allele single strand conformation polymorphism which showed multiple recombinants with juvenile onset primary open angle glaucoma in large pedigrees, segregating this disorder. The marker was then mapped to 1p34-p36 by linkage, with the most likely location between liver alkaline phosphatase (ALPL) and alpha-L-1 fucosidase (FUCA1).« less

Identification of candidate genes associated with fibromyalgia susceptibility in southern Spanish women: the al-Ándalus project.

PubMed

Estévez-López, Fernando; Camiletti-Moirón, Daniel; Aparicio, Virginia A; Segura-Jiménez, Víctor; Álvarez-Gallardo, Inmaculada C; Soriano-Maldonado, Alberto; Borges-Cosic, Milkana; Acosta-Manzano, Pedro; Geenen, Rinie; Delgado-Fernández, Manuel; Martínez-González, Luis J; Ruiz, Jonatan R; Álvarez-Cubero, María J

2018-02-27

Candidate-gene studies on fibromyalgia susceptibility often include a small number of single nucleotide polymorphisms (SNPs), which is a limitation. Moreover, there is a paucity of evidence in Europe. Therefore, we compared genotype frequencies of candidate SNPs in a well-characterised sample of Spanish women with fibromyalgia and healthy non-fibromyalgia women. A total of 314 women with a diagnosis of fibromyalgia (cases) and 112 non-fibromyalgia healthy (controls) women participated in this candidate-gene study. Buccal swabs were collected for DNA extraction. Using TaqMan™ OpenArray™, we analysed 61 SNPs of 33 genes related to fibromyalgia susceptibility, symptoms, or potential mechanisms. We observed that the rs841 and rs1799971 GG genotype was more frequently observed in fibromyalgia than in controls (p = 0.04 and p = 0.02, respectively). The rs2097903 AT/TT genotypes were also more often present in the fibromyalgia participants than in their control peers (p = 0.04). There were no differences for the remaining SNPs. We identified, for the first time, associations of the rs841 (guanosine triphosphate cyclohydrolase 1 gene) and rs2097903 (catechol-O-methyltransferase gene) SNPs with higher risk of fibromyalgia susceptibility. We also confirmed that the rs1799971 SNP (opioid receptor μ1 gene) might confer genetic risk of fibromyalgia. We did not adjust for multiple comparisons, which would be too stringent and yield to non-significant differences in the genotype frequencies between cases and controls. Our findings may be biologically meaningful and informative, and should be further investigated in other populations. Of particular interest is to replicate the present study in a larger independent sample to confirm or refute our findings. On the other hand, by including 61 SNPs of 33 candidate-genes with a strong rationale (they were previously investigated in relation to fibromyalgia susceptibility, symptoms or potential mechanisms), the present research is the most comprehensive candidate-gene study on fibromyalgia susceptibility to date.

Identifying metabolic enzymes with multiple types of association evidence

PubMed Central

Kharchenko, Peter; Chen, Lifeng; Freund, Yoav; Vitkup, Dennis; Church, George M

2006-01-01

Background Existing large-scale metabolic models of sequenced organisms commonly include enzymatic functions which can not be attributed to any gene in that organism. Existing computational strategies for identifying such missing genes rely primarily on sequence homology to known enzyme-encoding genes. Results We present a novel method for identifying genes encoding for a specific metabolic function based on a local structure of metabolic network and multiple types of functional association evidence, including clustering of genes on the chromosome, similarity of phylogenetic profiles, gene expression, protein fusion events and others. Using E. coli and S. cerevisiae metabolic networks, we illustrate predictive ability of each individual type of association evidence and show that significantly better predictions can be obtained based on the combination of all data. In this way our method is able to predict 60% of enzyme-encoding genes of E. coli metabolism within the top 10 (out of 3551) candidates for their enzymatic function, and as a top candidate within 43% of the cases. Conclusion We illustrate that a combination of genome context and other functional association evidence is effective in predicting genes encoding metabolic enzymes. Our approach does not rely on direct sequence homology to known enzyme-encoding genes, and can be used in conjunction with traditional homology-based metabolic reconstruction methods. The method can also be used to target orphan metabolic activities. PMID:16571130

Candidate gene analysis for Alzheimer's disease in adults with Down syndrome.

PubMed

Lee, Joseph H; Lee, Annie J; Dang, Lam-Ha; Pang, Deborah; Kisselev, Sergey; Krinsky-McHale, Sharon J; Zigman, Warren B; Luchsinger, José A; Silverman, Wayne; Tycko, Benjamin; Clark, Lorraine N; Schupf, Nicole

2017-08-01

Individuals with Down syndrome (DS) overexpress many genes on chromosome 21 due to trisomy and have high risk of dementia due to the Alzheimer's disease (AD) neuropathology. However, there is a wide range of phenotypic differences (e.g., age at onset of AD, amyloid β levels) among adults with DS, suggesting the importance of factors that modify risk within this particularly vulnerable population, including genotypic variability. Previous genetic studies in the general population have identified multiple genes that are associated with AD. This study examined the contribution of polymorphisms in these genes to the risk of AD in adults with DS ranging from 30 to 78 years of age at study entry (N = 320). We used multiple logistic regressions to estimate the likelihood of AD using single-nucleotide polymorphisms (SNPs) in candidate genes, adjusting for age, sex, race/ethnicity, level of intellectual disability and APOE genotype. This study identified multiple SNPs in APP and CST3 that were associated with AD at a gene-wise level empirical p-value of 0.05, with odds ratios in the range of 1.5-2. SNPs in MARK4 were marginally associated with AD. CST3 and MARK4 may contribute to our understanding of potential mechanisms where CST3 may contribute to the amyloid pathway by inhibiting plaque formation, and MARK4 may contribute to the regulation of the transition between stable and dynamic microtubules. Copyright © 2017 Elsevier Inc. All rights reserved.

A Gene-Oriented Haplotype Comparison Reveals Recently Selected Genomic Regions in Temperate and Tropical Maize Germplasm

PubMed Central

Zhang, Jie; Li, Yongxiang; Zheng, Jun; Zhang, Hongwei; Yang, Xiaohong; Wang, Jianhua; Wang, Guoying

2017-01-01

The extensive genetic variation present in maize (Zea mays) germplasm makes it possible to detect signatures of positive artificial selection that occurred during temperate and tropical maize improvement. Here we report an analysis of 532,815 polymorphisms from a maize association panel consisting of 368 diverse temperate and tropical inbred lines. We developed a gene-oriented approach adapting exonic polymorphisms to identify recently selected alleles by comparing haplotypes across the maize genome. This analysis revealed evidence of selection for more than 1100 genomic regions during recent improvement, and included regulatory genes and key genes with visible mutant phenotypes. We find that selected candidate target genes in temperate maize are enriched in biosynthetic processes, and further examination of these candidates highlights two cases, sucrose flux and oil storage, in which multiple genes in a common pathway can be cooperatively selected. Finally, based on available parallel gene expression data, we hypothesize that some genes were selected for regulatory variations, resulting in altered gene expression. PMID:28099470

Scuba: scalable kernel-based gene prioritization.

PubMed

Zampieri, Guido; Tran, Dinh Van; Donini, Michele; Navarin, Nicolò; Aiolli, Fabio; Sperduti, Alessandro; Valle, Giorgio

2018-01-25

The uncovering of genes linked to human diseases is a pressing challenge in molecular biology and precision medicine. This task is often hindered by the large number of candidate genes and by the heterogeneity of the available information. Computational methods for the prioritization of candidate genes can help to cope with these problems. In particular, kernel-based methods are a powerful resource for the integration of heterogeneous biological knowledge, however, their practical implementation is often precluded by their limited scalability. We propose Scuba, a scalable kernel-based method for gene prioritization. It implements a novel multiple kernel learning approach, based on a semi-supervised perspective and on the optimization of the margin distribution. Scuba is optimized to cope with strongly unbalanced settings where known disease genes are few and large scale predictions are required. Importantly, it is able to efficiently deal both with a large amount of candidate genes and with an arbitrary number of data sources. As a direct consequence of scalability, Scuba integrates also a new efficient strategy to select optimal kernel parameters for each data source. We performed cross-validation experiments and simulated a realistic usage setting, showing that Scuba outperforms a wide range of state-of-the-art methods. Scuba achieves state-of-the-art performance and has enhanced scalability compared to existing kernel-based approaches for genomic data. This method can be useful to prioritize candidate genes, particularly when their number is large or when input data is highly heterogeneous. The code is freely available at https://github.com/gzampieri/Scuba .

Analysis of shared homozygosity regions in Saudi siblings with attention deficit hyperactivity disorder

PubMed Central

Al Yemni, Eman A.A.; Alnaemi, Faten M.; Abebe, Dejene; Al-Abdulaziz, Basma S.; Al Mubarak, Bashayer R.; Ghaziuddin, Mohammad; Al Tassan, Nada A.

2017-01-01

Aim Genetic and clinical complexities are common features of most psychiatric illnesses that pose a major obstacle in risk-gene identification. Attention deficit hyperactivity disorder (ADHD) is the most prevalent child-onset psychiatric illness, with high heritability. Over the past decade, numerous genetic studies utilizing various approaches, such as genome-wide association, candidate-gene association, and linkage analysis, have identified a multitude of candidate loci/genes. However, such studies have yielded diverse findings that are rarely reproduced, indicating that other genetic determinants have not been discovered yet. In this study, we carried out sib-pair analysis on seven multiplex families with ADHD from Saudi Arabia. We aimed to identify the candidate chromosomal regions and genes linked to the disease. Patients and methods A total of 41 individuals from multiplex families were analyzed for shared regions of homozygosity. Genes within these regions were prioritized according to their potential relevance to ADHD. Results We identified multiple genomic regions spanning different chromosomes to be shared among affected members of each family; these included chromosomes 3, 5, 6, 7, 8, 9, 10, 13, 17, and 18. We also found specific regions on chromosomes 8 and 17 to be shared between affected individuals from more than one family. Among the genes present in the regions reported here were involved in neurotransmission (GRM3, SIGMAR1, CHAT, and SLC18A3) and members of the HLA gene family (HLA-A, HLA-DPA1, and MICC). Conclusion The candidate regions identified in this study highlight the genetic diversity of ADHD. Upon further investigation, these loci may reveal candidate genes that enclose variants associated with ADHD. Although most ADHD studies were conducted in other populations, our study provides insight from an understudied, ethnically interesting population. PMID:28452824

Analysis of shared homozygosity regions in Saudi siblings with attention deficit hyperactivity disorder.

PubMed

Shinwari, Jameela M A; Al Yemni, Eman A A; Alnaemi, Faten M; Abebe, Dejene; Al-Abdulaziz, Basma S; Al Mubarak, Bashayer R; Ghaziuddin, Mohammad; Al Tassan, Nada A

2017-08-01

Genetic and clinical complexities are common features of most psychiatric illnesses that pose a major obstacle in risk-gene identification. Attention deficit hyperactivity disorder (ADHD) is the most prevalent child-onset psychiatric illness, with high heritability. Over the past decade, numerous genetic studies utilizing various approaches, such as genome-wide association, candidate-gene association, and linkage analysis, have identified a multitude of candidate loci/genes. However, such studies have yielded diverse findings that are rarely reproduced, indicating that other genetic determinants have not been discovered yet. In this study, we carried out sib-pair analysis on seven multiplex families with ADHD from Saudi Arabia. We aimed to identify the candidate chromosomal regions and genes linked to the disease. A total of 41 individuals from multiplex families were analyzed for shared regions of homozygosity. Genes within these regions were prioritized according to their potential relevance to ADHD. We identified multiple genomic regions spanning different chromosomes to be shared among affected members of each family; these included chromosomes 3, 5, 6, 7, 8, 9, 10, 13, 17, and 18. We also found specific regions on chromosomes 8 and 17 to be shared between affected individuals from more than one family. Among the genes present in the regions reported here were involved in neurotransmission (GRM3, SIGMAR1, CHAT, and SLC18A3) and members of the HLA gene family (HLA-A, HLA-DPA1, and MICC). The candidate regions identified in this study highlight the genetic diversity of ADHD. Upon further investigation, these loci may reveal candidate genes that enclose variants associated with ADHD. Although most ADHD studies were conducted in other populations, our study provides insight from an understudied, ethnically interesting population.

EBF proteins participate in transcriptional regulation of Xenopus muscle development.

PubMed

Green, Yangsook Song; Vetter, Monica L

2011-10-01

EBF proteins have diverse functions in the development of multiple lineages, including neurons, B cells and adipocytes. During Drosophila muscle development EBF proteins are expressed in muscle progenitors and are required for muscle cell differentiation, but there is no known function of EBF proteins in vertebrate muscle development. In this study, we examine the expression of ebf genes in Xenopus muscle tissue and show that EBF activity is necessary for aspects of Xenopus skeletal muscle development, including somite organization, migration of hypaxial muscle anlagen toward the ventral abdomen, and development of jaw muscle. From a microarray screen, we have identified multiple candidate targets of EBF activity with known roles in muscle development. The candidate targets we have verified are MYOD, MYF5, M-Cadherin and SEB-4. In vivo overexpression of the ebf2 and ebf3 genes leads to ectopic expression of these candidate targets, and knockdown of EBF activity causes downregulation of the endogenous expression of the candidate targets. Furthermore, we found that MYOD and MYF5 are likely to be direct targets. Finally we show that MYOD can upregulate the expression of ebf genes, indicating the presence of a positive feedback loop between EBF and MYOD that we find to be important for maintenance of MYOD expression in Xenopus. These results suggest that EBF activity is important for both stabilizing commitment and driving aspects of differentiation in Xenopus muscle cells. Copyright © 2010 Elsevier Inc. All rights reserved.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Identification and characterization of nuclear genes involved in photosynthesis in Populus

PubMed Central

2014-01-01

Background The gap between the real and potential photosynthetic rate under field conditions suggests that photosynthesis could potentially be improved. Nuclear genes provide possible targets for improving photosynthetic efficiency. Hence, genome-wide identification and characterization of the nuclear genes affecting photosynthetic traits in woody plants would provide key insights on genetic regulation of photosynthesis and identify candidate processes for improvement of photosynthesis. Results Using microarray and bulked segregant analysis strategies, we identified differentially expressed nuclear genes for photosynthesis traits in a segregating population of poplar. We identified 515 differentially expressed genes in this population (FC ≥ 2 or FC ≤ 0.5, P < 0.05), 163 up-regulated and 352 down-regulated. Real-time PCR expression analysis confirmed the microarray data. Singular Enrichment Analysis identified 48 significantly enriched GO terms for molecular functions (28), biological processes (18) and cell components (2). Furthermore, we selected six candidate genes for functional examination by a single-marker association approach, which demonstrated that 20 SNPs in five candidate genes significantly associated with photosynthetic traits, and the phenotypic variance explained by each SNP ranged from 2.3% to 12.6%. This revealed that regulation of photosynthesis by the nuclear genome mainly involves transport, metabolism and response to stimulus functions. Conclusions This study provides new genome-scale strategies for the discovery of potential candidate genes affecting photosynthesis in Populus, and for identification of the functions of genes involved in regulation of photosynthesis. This work also suggests that improving photosynthetic efficiency under field conditions will require the consideration of multiple factors, such as stress responses. PMID:24673936

Network-based Analysis of Genome Wide Association Data Provides Novel Candidate Genes for Lipid and Lipoprotein Traits*

PubMed Central

Sharma, Amitabh; Gulbahce, Natali; Pevzner, Samuel J.; Menche, Jörg; Ladenvall, Claes; Folkersen, Lasse; Eriksson, Per; Orho-Melander, Marju; Barabási, Albert-László

2013-01-01

Genome wide association studies (GWAS) identify susceptibility loci for complex traits, but do not identify particular genes of interest. Integration of functional and network information may help in overcoming this limitation and identifying new susceptibility loci. Using GWAS and comorbidity data, we present a network-based approach to predict candidate genes for lipid and lipoprotein traits. We apply a prediction pipeline incorporating interactome, co-expression, and comorbidity data to Global Lipids Genetics Consortium (GLGC) GWAS for four traits of interest, identifying phenotypically coherent modules. These modules provide insights regarding gene involvement in complex phenotypes with multiple susceptibility alleles and low effect sizes. To experimentally test our predictions, we selected four candidate genes and genotyped representative SNPs in the Malmö Diet and Cancer Cardiovascular Cohort. We found significant associations with LDL-C and total-cholesterol levels for a synonymous SNP (rs234706) in the cystathionine beta-synthase (CBS) gene (p = 1 × 10−5 and adjusted-p = 0.013, respectively). Further, liver samples taken from 206 patients revealed that patients with the minor allele of rs234706 had significant dysregulation of CBS (p = 0.04). Despite the known biological role of CBS in lipid metabolism, SNPs within the locus have not yet been identified in GWAS of lipoprotein traits. Thus, the GWAS-based Comorbidity Module (GCM) approach identifies candidate genes missed by GWAS studies, serving as a broadly applicable tool for the investigation of other complex disease phenotypes. PMID:23882023

Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

PubMed Central

Jiang, Yiwei

2013-01-01

Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse perennial ryegrass (Lolium perenne L.) accessions from 43 countries. The panel showed significant variations in leaf wilting, leaf water content, canopy and air temperature difference, and chlorophyll fluorescence under well-watered and drought conditions across six environments. Analysis of 109 simple sequence repeat markers revealed five population structures in the mapping panel. A total of 2520 expression-based sequence readings were obtained for a set of candidate genes involved in antioxidant metabolism, dehydration, water movement across membranes, and signal transduction, from which 346 single nucleotide polymorphisms were identified. Significant associations were identified between a putative LpLEA3 encoding late embryogenesis abundant group 3 protein and a putative LpFeSOD encoding iron superoxide dismutase and leaf water content, as well as between a putative LpCyt Cu-ZnSOD encoding cytosolic copper-zinc superoxide dismutase and chlorophyll fluorescence under drought conditions. Four of these identified significantly associated single nucleotide polymorphisms from these three genes were also translated to amino acid substitutions in different genotypes. These results indicate that allelic variation in these genes may affect whole-plant response to drought stress in perennial ryegrass. PMID:23386684

Inactivation of the mouse Magel2 gene results in growth abnormalities similar to Prader-Willi syndrome.

PubMed

Bischof, Jocelyn M; Stewart, Colin L; Wevrick, Rachel

2007-11-15

Prader-Willi syndrome (PWS) is an imprinted genetic obesity disorder characterized by abnormalities of growth and metabolism. Multiple mouse models with deficiency of one or more PWS candidate genes have partially correlated individual genes with aspects of the PWS phenotype, although the genetic origin of defects in growth and metabolism has not been elucidated. Gene-targeted mutation of the PWS candidate gene Magel2 in mice causes altered circadian rhythm output and reduced motor activity. We now report that Magel2-null mice exhibit neonatal growth retardation, excessive weight gain after weaning, and increased adiposity with altered metabolism in adulthood, recapitulating fundamental aspects of the PWS phenotype. Magel2-null mice provide an important opportunity to examine the physiological basis for PWS neonatal failure to thrive and post-weaning weight gain and for the relationships among circadian rhythm, feeding behavior, and metabolism.

Cross-species multiple environmental stress responses: An integrated approach to identify candidate genes for multiple stress tolerance in sorghum (Sorghum bicolor (L.) Moench) and related model species

PubMed Central

Modise, David M.; Gemeildien, Junaid; Ndimba, Bongani K.; Christoffels, Alan

2018-01-01

Background Crop response to the changing climate and unpredictable effects of global warming with adverse conditions such as drought stress has brought concerns about food security to the fore; crop yield loss is a major cause of concern in this regard. Identification of genes with multiple responses across environmental stresses is the genetic foundation that leads to crop adaptation to environmental perturbations. Methods In this paper, we introduce an integrated approach to assess candidate genes for multiple stress responses across-species. The approach combines ontology based semantic data integration with expression profiling, comparative genomics, phylogenomics, functional gene enrichment and gene enrichment network analysis to identify genes associated with plant stress phenotypes. Five different ontologies, viz., Gene Ontology (GO), Trait Ontology (TO), Plant Ontology (PO), Growth Ontology (GRO) and Environment Ontology (EO) were used to semantically integrate drought related information. Results Target genes linked to Quantitative Trait Loci (QTLs) controlling yield and stress tolerance in sorghum (Sorghum bicolor (L.) Moench) and closely related species were identified. Based on the enriched GO terms of the biological processes, 1116 sorghum genes with potential responses to 5 different stresses, such as drought (18%), salt (32%), cold (20%), heat (8%) and oxidative stress (25%) were identified to be over-expressed. Out of 169 sorghum drought responsive QTLs associated genes that were identified based on expression datasets, 56% were shown to have multiple stress responses. On the other hand, out of 168 additional genes that have been evaluated for orthologous pairs, 90% were conserved across species for drought tolerance. Over 50% of identified maize and rice genes were responsive to drought and salt stresses and were co-located within multifunctional QTLs. Among the total identified multi-stress responsive genes, 272 targets were shown to be co-localized within QTLs associated with different traits that are responsive to multiple stresses. Ontology mapping was used to validate the identified genes, while reconstruction of the phylogenetic tree was instrumental to infer the evolutionary relationship of the sorghum orthologs. The results also show specific genes responsible for various interrelated components of drought response mechanism such as drought tolerance, drought avoidance and drought escape. Conclusions We submit that this approach is novel and to our knowledge, has not been used previously in any other research; it enables us to perform cross-species queries for genes that are likely to be associated with multiple stress tolerance, as a means to identify novel targets for engineering stress resistance in sorghum and possibly, in other crop species. PMID:29590108

Molecular insight into the association between cartilage regeneration and ear wound healing in genetic mouse models: targeting new genes in regeneration.

PubMed

Rai, Muhammad Farooq; Schmidt, Eric J; McAlinden, Audrey; Cheverud, James M; Sandell, Linda J

2013-11-06

Tissue regeneration is a complex trait with few genetic models available. Mouse strains LG/J and MRL are exceptional healers. Using recombinant inbred strains from a large (LG/J, healer) and small (SM/J, nonhealer) intercross, we have previously shown a positive genetic correlation between ear wound healing, knee cartilage regeneration, and protection from osteoarthritis. We hypothesize that a common set of genes operates in tissue healing and articular cartilage regeneration. Taking advantage of archived histological sections from recombinant inbred strains, we analyzed expression of candidate genes through branched-chain DNA technology directly from tissue lysates. We determined broad-sense heritability of candidates, Pearson correlation of candidates with healing phenotypes, and Ward minimum variance cluster analysis for strains. A bioinformatic assessment of allelic polymorphisms within and near candidate genes was also performed. The expression of several candidates was significantly heritable among strains. Although several genes correlated with both ear wound healing and cartilage healing at a marginal level, the expression of four genes representing DNA repair (Xrcc2, Pcna) and Wnt signaling (Axin2, Wnt16) pathways was significantly positively correlated with both phenotypes. Cluster analysis accurately classified healers and nonhealers for seven out of eight strains based on gene expression. Specific sequence differences between LG/J and SM/J were identified as potential causal polymorphisms. Our study suggests a common genetic basis between tissue healing and osteoarthritis susceptibility. Mapping genetic variations causing differences in diverse healing responses in multiple tissues may reveal generic healing processes in pursuit of new therapeutic targets designed to induce or enhance regeneration and, potentially, protection from osteoarthritis.

Candidate genes, pathways and mechanisms for alcoholism: an expanded convergent functional genomics approach.

PubMed

Rodd, Z A; Bertsch, B A; Strother, W N; Le-Niculescu, H; Balaraman, Y; Hayden, E; Jerome, R E; Lumeng, L; Nurnberger, J I; Edenberg, H J; McBride, W J; Niculescu, A B

2007-08-01

We describe a comprehensive translational approach for identifying candidate genes for alcoholism. The approach relies on the cross-matching of animal model brain gene expression data with human genetic linkage data, as well as human tissue data and biological roles data, an approach termed convergent functional genomics. An analysis of three animal model paradigms, based on inbred alcohol-preferring (iP) and alcohol-non-preferring (iNP) rats, and their response to treatments with alcohol, was used. A comprehensive analysis of microarray gene expression data from five key brain regions (frontal cortex, amygdala, caudate-putamen, nucleus accumbens and hippocampus) was carried out. The Bayesian-like integration of multiple independent lines of evidence, each by itself lacking sufficient discriminatory power, led to the identification of high probability candidate genes, pathways and mechanisms for alcoholism. These data reveal that alcohol has pleiotropic effects on multiple systems, which may explain the diverse neuropsychiatric and medical pathology in alcoholism. Some of the pathways identified suggest avenues for pharmacotherapy of alcoholism with existing agents, such as angiotensin-converting enzyme (ACE) inhibitors. Experiments we carried out in alcohol-preferring rats with an ACE inhibitor show a marked modulation of alcohol intake. Other pathways are new potential targets for drug development. The emergent overall picture is that physical and physiological robustness may permit alcohol-preferring individuals to withstand the aversive effects of alcohol. In conjunction with a higher reactivity to its rewarding effects, they may able to ingest enough of this nonspecific drug for a strong hedonic and addictive effect to occur.

Identification and Analyses of AUX-IAA target genes controlling multiple pathways in developing fiber cells of Gossypium hirsutum L

PubMed Central

Nigam, Deepti; Sawant, Samir V

2013-01-01

Technological development led to an increased interest in systems biological approaches in plants to characterize developmental mechanism and candidate genes relevant to specific tissue or cell morphology. AUX-IAA proteins are important plant-specific putative transcription factors. There are several reports on physiological response of this family in Arabidopsis but in cotton fiber the transcriptional network through which AUX-IAA regulated its target genes is still unknown. in-silico modelling of cotton fiber development specific gene expression data (108 microarrays and 22,737 genes) using Algorithm for the Reconstruction of Accurate Cellular Networks (ARACNe) reveals 3690 putative AUX-IAA target genes of which 139 genes were known to be AUX-IAA co-regulated within Arabidopsis. Further AUX-IAA targeted gene regulatory network (GRN) had substantial impact on the transcriptional dynamics of cotton fiber, as showed by, altered TF networks, and Gene Ontology (GO) biological processes and metabolic pathway associated with its target genes. Analysis of the AUX-IAA-correlated gene network reveals multiple functions for AUX-IAA target genes such as unidimensional cell growth, cellular nitrogen compound metabolic process, nucleosome organization, DNA-protein complex and process related to cell wall. These candidate networks/pathways have a variety of profound impacts on such cellular functions as stress response, cell proliferation, and cell differentiation. While these functions are fairly broad, their underlying TF networks may provide a global view of AUX-IAA regulated gene expression and a GRN that guides future studies in understanding role of AUX-IAA box protein and its targets regulating fiber development. PMID:24497725

Genomic signatures of fine-scale local selection in Atlantic salmon suggest involvement of sexual maturation, energy homeostasis and immune defence-related genes.

PubMed

Pritchard, Victoria L; Mäkinen, Hannu; Vähä, Juha-Pekka; Erkinaro, Jaakko; Orell, Panu; Primmer, Craig R

2018-06-01

Elucidating the genetic basis of adaptation to the local environment can improve our understanding of how the diversity of life has evolved. In this study, we used a dense SNP array to identify candidate loci potentially underlying fine-scale local adaptation within a large Atlantic salmon (Salmo salar) population. By combining outlier, gene-environment association and haplotype homozygosity analyses, we identified multiple regions of the genome with strong evidence for diversifying selection. Several of these candidate regions had previously been identified in other studies, demonstrating that the same loci could be adaptively important in Atlantic salmon at subdrainage, regional and continental scales. Notably, we identified signals consistent with local selection around genes associated with variation in sexual maturation, energy homeostasis and immune defence. These included the large-effect age-at-maturity gene vgll3, the known obesity gene mc4r, and major histocompatibility complex II. Most strikingly, we confirmed a genomic region on Ssa09 that was extremely differentiated among subpopulations and that is also a candidate for local selection over the global range of Atlantic salmon. This region colocalized with a haplotype strongly associated with spawning ecotype in sockeye salmon (Oncorhynchus nerka), with circumstantial evidence that the same gene (six6) may be the selective target in both cases. The phenotypic effect of this region in Atlantic salmon remains cryptic, although allelic variation is related to upstream catchment area and covaries with timing of the return spawning migration. Our results further inform management of Atlantic salmon and open multiple avenues for future research. © 2018 John Wiley & Sons Ltd.

Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability

PubMed Central

Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

2017-01-01

Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1–3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal–parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID. PMID:27457812

Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

PubMed

Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

2017-11-01

Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

The genomic architecture and association genetics of adaptive characters using a candidate SNP approach in boreal black spruce

PubMed Central

2013-01-01

Background The genomic architecture of adaptive traits remains poorly understood in non-model plants. Various approaches can be used to bridge this gap, including the mapping of quantitative trait loci (QTL) in pedigrees, and genetic association studies in non-structured populations. Here we present results on the genomic architecture of adaptive traits in black spruce, which is a widely distributed conifer of the North American boreal forest. As an alternative to the usual candidate gene approach, a candidate SNP approach was developed for association testing. Results A genetic map containing 231 gene loci was used to identify QTL that were related to budset timing and to tree height assessed over multiple years and sites. Twenty-two unique genomic regions were identified, including 20 that were related to budset timing and 6 that were related to tree height. From results of outlier detection and bulk segregant analysis for adaptive traits using DNA pool sequencing of 434 genes, 52 candidate SNPs were identified and subsequently tested in genetic association studies for budset timing and tree height assessed over multiple years and sites. A total of 34 (65%) SNPs were significantly associated with budset timing, or tree height, or both. Although the percentages of explained variance (PVE) by individual SNPs were small, several significant SNPs were shared between sites and among years. Conclusions The sharing of genomic regions and significant SNPs between budset timing and tree height indicates pleiotropic effects. Significant QTLs and SNPs differed quite greatly among years, suggesting that different sets of genes for the same characters are involved at different stages in the tree’s life history. The functional diversity of genes carrying significant SNPs and low observed PVE further indicated that a large number of polymorphisms are involved in adaptive genetic variation. Accordingly, for undomesticated species such as black spruce with natural populations of large effective size and low linkage disequilibrium, efficient marker systems that are predictive of adaptation should require the survey of large numbers of SNPs. Candidate SNP approaches like the one developed in the present study could contribute to reducing these numbers. PMID:23724860

Xenopus as a Model Organism for Birth Defects – Congenital Heart Disease and Heterotaxy

PubMed Central

Duncan, Anna R.; Khokha, Mustafa K.

2016-01-01

Congenital heart disease is the leading cause of birth defects, affecting 9 out of 1000 newborns each year. A particularly severe form of congenital heart disease is heterotaxy, a disorder of left-right development. Despite aggressive surgical management, patients with heterotaxy have poor survival rates and severe morbidity due to their complex congenital heart disease. Recent genetic analysis of affected patients has found novel candidate genes for heterotaxy although their underlying mechanisms remain unknown. In this review, we discuss the importance and challenges of birth defects research including high locus heterogeneity and few second alleles that make defining disease causality difficult. A powerful strategy moving forward is to analyze these candidate genes in a high-throughput human disease model. Xenopus is ideal for these studies. We present multiple examples demonstrating the power of Xenopus in discovery new biology from the analysis of candidate heterotaxy genes such as GALNT11, NEK2 and BCOR. These genes have diverse roles in embryos and have led to a greater understanding of complex signaling pathways and basic developmental biology. It is our hope that the mechanistic analysis of these candidate genes in Xenopus enabled by next generation sequencing of patients will provide clinicians with a greater understanding of patient pathophysiology allowing more precise and personalized medicine, to help them more effectively in the future. PMID:26910255

A role for genetic susceptibility in sporadic focal segmental glomerulosclerosis

PubMed Central

Yu, Haiyang; Artomov, Mykyta; Brähler, Sebastian; Stander, M. Christine; Shamsan, Ghaidan; Sampson, Matthew G.; White, J. Michael; Kretzler, Matthias; Jain, Sanjay; Winkler, Cheryl A.; Mitra, Robi D.; Daly, Mark J.; Shaw, Andrey S.

2016-01-01

Focal segmental glomerulosclerosis (FSGS) is a syndrome that involves kidney podocyte dysfunction and causes chronic kidney disease. Multiple factors including chemical toxicity, inflammation, and infection underlie FSGS; however, highly penetrant disease genes have been identified in a small fraction of patients with a family history of FSGS. Variants of apolipoprotein L1 (APOL1) have been linked to FSGS in African Americans with HIV or hypertension, supporting the proposal that genetic factors enhance FSGS susceptibility. Here, we used sequencing to investigate whether genetics plays a role in the majority of FSGS cases that are identified as primary or sporadic FSGS and have no known cause. Given the limited number of biopsy-proven cases with ethnically matched controls, we devised an analytic strategy to identify and rank potential candidate genes and used an animal model for validation. Nine candidate FSGS susceptibility genes were identified in our patient cohort, and three were validated using a high-throughput mouse method that we developed. Specifically, we introduced a podocyte-specific, doxycycline-inducible transactivator into a murine embryonic stem cell line with an FSGS-susceptible genetic background that allows shRNA-mediated targeting of candidate genes in the adult kidney. Our analysis supports a broader role for genetic susceptibility of both sporadic and familial cases of FSGS and provides a tool to rapidly evaluate candidate FSGS-associated genes. PMID:26901816

Candidate genetic modifiers for breast and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers

PubMed Central

Peterlongo, Paolo; Chang-Claude, Jenny; Moysich, Kirsten B.; Rudolph, Anja; Schmutzler, Rita K.; Simard, Jacques; Soucy, Penny; Eeles, Rosalind A.; Easton, Douglas F.; Hamann, Ute; Wilkening, Stefan; Chen, Bowang; Rookus, Matti A.; Schmidt, Marjanka K; van der Baan, Frederieke H.; Spurdle, Amanda B.; Walker, Logan C.; Lose, Felicity; Maia, Ana-Teresa; Montagna, Marco; Matricardi, Laura; Lubinski, Jan; Jakubowska, Anna; Gómez Garcia, Encarna B.; Olopade, Olufunmilayo I.; Nussbaum, Robert L.; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy R.; Arun, Banu K.; Karlan, Beth Y.; Orsulic, Sandra; Lester, Jenny; Chung, Wendy K.; Miron, Alex; Southey, Melissa C.; Goldgar, David E.; Buys, Saundra S.; Janavicius, Ramunas; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Ding, Yuan Chun; Neuhausen, Susan L.; Hansen, Thomas V. O.; Gerdes, Anne-Marie; Ejlertsen, Bent; Jønson, Lars; Osorio, Ana; Martínez-Bouzas, Cristina; Benitez, Javier; Conway, Edye E.; Blazer, Kathleen R.; Weitzel, Jeffrey N.; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Barile, Monica; Ficarazzi, Filomena; Mariette, Frederique; Fortuzzi, Stefano; Viel, Alessandra; Giannini, Giuseppe; Papi, Laura; Martayan, Aline; Tibiletti, Maria Grazia; Radice, Paolo; Vratimos, Athanassios; Fostira, Florentia; Garber, Judy E.; Donaldson, Alan; Brewer, Carole; Foo, Claire; Evans, D. Gareth R.; Frost, Debra; Eccles, Diana; Brady, Angela; Cook, Jackie; Tischkowitz, Marc; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E.; Kennedy, M. John; Rogers, Mark T.; Porteous, Mary E.; Morrison, Patrick J.; Platte, Radka; Davidson, Rosemarie; Hodgson, Shirley V.; Ellis, Steve; Cole, Trevor; Godwin, Andrew K.; Claes, Kathleen; Van Maerken, Tom; Meindl, Alfons; Gehrig, Andrea; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Wappenschmidt, Barbara; Wang-Gohrke, Shan; Bressac-de Paillerets, Brigitte; Buecher, Bruno; Delnatte, Capucine; Houdayer, Claude; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Coupier, Isabelle; Barjhoux, Laure; Venat-Bouvet, Laurence; Golmard, Lisa; Boutry-Kryza, Nadia; Sinilnikova, Olga M.; Caron, Olivier; Pujol, Pascal; Mazoyer, Sylvie; Belotti, Muriel; Piedmonte, Marion; Friedlander, Michael L.; Rodriguez, Gustavo C.; Copeland, Larry J; de la Hoya, Miguel; Segura, Pedro Perez; Nevanlinna, Heli; Aittomäki, Kristiina; van Os, Theo A.M.; Meijers-Heijboer, Hanne E.J.; van der Hout, Annemarie H.; Vreeswijk, Maaike P.G.; Hoogerbrugge, Nicoline; Ausems, Margreet G.E.M.; van Doorn, Helena C.; Collée, J. Margriet; Olah, Edith; Diez, Orland; Blanco, Ignacio; Lazaro, Conxi; Brunet, Joan; Feliubadalo, Lidia; Cybulski, Cezary; Gronwald, Jacek; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Sukiennicki, Grzegorz; Arason, Adalgeir; Chiquette, Jocelyne; Teixeira, Manuel R.; Olswold, Curtis; Couch, Fergus J.; Lindor, Noralane M.; Wang, Xianshu; Szabo, Csilla I.; Offit, Kenneth; Corines, Marina; Jacobs, Lauren; Robson, Mark E.; Zhang, Liying; Joseph, Vijai; Berger, Andreas; Singer, Christian F.; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng M.; Phelan, Catherine M.; Greene, Mark H.; Mai, Phuong L.; Rennert, Gad; Mulligan, Anna Marie; Glendon, Gord; Tchatchou, Sandrine; Andrulis, Irene L.; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Thomassen, Mads; Jensen, Uffe Birk; Laitman, Yael; Rantala, Johanna; von Wachenfeldt, Anna; Ehrencrona, Hans; Askmalm, Marie Stenmark; Borg, Åke; Kuchenbaecker, Karoline B.; McGuffog, Lesley; Barrowdale, Daniel; Healey, Sue; Lee, Andrew; Pharoah, Paul D.P.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Friedman, Eitan

2014-01-01

Background BRCA1 and BRCA2 mutation carriers are at substantially increased risk for developing breast and ovarian cancer. The incomplete penetrance coupled with the variable age at diagnosis in carriers of the same mutation suggests the existence of genetic and non-genetic modifying factors. In this study we evaluated the putative role of variants in many candidate modifier genes. Methods Genotyping data from 15,252 BRCA1 and 8,211 BRCA2 mutation carriers, for known variants (n=3,248) located within or around 445 candidate genes, were available through the iCOGS custom-designed array. Breast and ovarian cancer association analysis was performed within a retrospective cohort approach. Results The observed p-values of association ranged between 0.005-1.000. None of the variants was significantly associated with breast or ovarian cancer risk in either BRCA1 or BRCA2 mutation carriers, after multiple testing adjustments. Conclusion There is little evidence that any of the evaluated candidate variants act as modifiers of breast and/or ovarian cancer risk in BRCA1 or BRCA2 mutation carriers. Impact Genome-wide association studies have been more successful at identifying genetic modifiers of BRCA1/2 penetrance than candidate gene studies. PMID:25336561

Candidate genetic modifiers for breast and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers.

PubMed

Peterlongo, Paolo; Chang-Claude, Jenny; Moysich, Kirsten B; Rudolph, Anja; Schmutzler, Rita K; Simard, Jacques; Soucy, Penny; Eeles, Rosalind A; Easton, Douglas F; Hamann, Ute; Wilkening, Stefan; Chen, Bowang; Rookus, Matti A; Schmidt, Marjanka K; van der Baan, Frederieke H; Spurdle, Amanda B; Walker, Logan C; Lose, Felicity; Maia, Ana-Teresa; Montagna, Marco; Matricardi, Laura; Lubinski, Jan; Jakubowska, Anna; Gómez Garcia, Encarna B; Olopade, Olufunmilayo I; Nussbaum, Robert L; Nathanson, Katherine L; Domchek, Susan M; Rebbeck, Timothy R; Arun, Banu K; Karlan, Beth Y; Orsulic, Sandra; Lester, Jenny; Chung, Wendy K; Miron, Alex; Southey, Melissa C; Goldgar, David E; Buys, Saundra S; Janavicius, Ramunas; Dorfling, Cecilia M; van Rensburg, Elizabeth J; Ding, Yuan Chun; Neuhausen, Susan L; Hansen, Thomas V O; Gerdes, Anne-Marie; Ejlertsen, Bent; Jønson, Lars; Osorio, Ana; Martínez-Bouzas, Cristina; Benitez, Javier; Conway, Edye E; Blazer, Kathleen R; Weitzel, Jeffrey N; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Barile, Monica; Ficarazzi, Filomena; Mariette, Frederique; Fortuzzi, Stefano; Viel, Alessandra; Giannini, Giuseppe; Papi, Laura; Martayan, Aline; Tibiletti, Maria Grazia; Radice, Paolo; Vratimos, Athanassios; Fostira, Florentia; Garber, Judy E; Donaldson, Alan; Brewer, Carole; Foo, Claire; Evans, D Gareth R; Frost, Debra; Eccles, Diana; Brady, Angela; Cook, Jackie; Tischkowitz, Marc; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E; Kennedy, M John; Rogers, Mark T; Porteous, Mary E; Morrison, Patrick J; Platte, Radka; Davidson, Rosemarie; Hodgson, Shirley V; Ellis, Steve; Cole, Trevor; Godwin, Andrew K; Claes, Kathleen; Van Maerken, Tom; Meindl, Alfons; Gehrig, Andrea; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Wappenschmidt, Barbara; Wang-Gohrke, Shan; Bressac-de Paillerets, Brigitte; Buecher, Bruno; Delnatte, Capucine; Houdayer, Claude; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Coupier, Isabelle; Barjhoux, Laure; Venat-Bouvet, Laurence; Golmard, Lisa; Boutry-Kryza, Nadia; Sinilnikova, Olga M; Caron, Olivier; Pujol, Pascal; Mazoyer, Sylvie; Belotti, Muriel; Piedmonte, Marion; Friedlander, Michael L; Rodriguez, Gustavo C; Copeland, Larry J; de la Hoya, Miguel; Segura, Pedro Perez; Nevanlinna, Heli; Aittomäki, Kristiina; van Os, Theo A M; Meijers-Heijboer, Hanne E J; van der Hout, Annemarie H; Vreeswijk, Maaike P G; Hoogerbrugge, Nicoline; Ausems, Margreet G E M; van Doorn, Helena C; Collée, J Margriet; Olah, Edith; Diez, Orland; Blanco, Ignacio; Lazaro, Conxi; Brunet, Joan; Feliubadalo, Lidia; Cybulski, Cezary; Gronwald, Jacek; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Sukiennicki, Grzegorz; Arason, Adalgeir; Chiquette, Jocelyne; Teixeira, Manuel R; Olswold, Curtis; Couch, Fergus J; Lindor, Noralane M; Wang, Xianshu; Szabo, Csilla I; Offit, Kenneth; Corines, Marina; Jacobs, Lauren; Robson, Mark E; Zhang, Liying; Joseph, Vijai; Berger, Andreas; Singer, Christian F; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng M; Phelan, Catherine M; Greene, Mark H; Mai, Phuong L; Rennert, Gad; Mulligan, Anna Marie; Glendon, Gord; Tchatchou, Sandrine; Andrulis, Irene L; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Thomassen, Mads; Jensen, Uffe Birk; Laitman, Yael; Rantala, Johanna; von Wachenfeldt, Anna; Ehrencrona, Hans; Askmalm, Marie Stenmark; Borg, Åke; Kuchenbaecker, Karoline B; McGuffog, Lesley; Barrowdale, Daniel; Healey, Sue; Lee, Andrew; Pharoah, Paul D P; Chenevix-Trench, Georgia; Antoniou, Antonis C; Friedman, Eitan

2015-01-01

BRCA1 and BRCA2 mutation carriers are at substantially increased risk for developing breast and ovarian cancer. The incomplete penetrance coupled with the variable age at diagnosis in carriers of the same mutation suggests the existence of genetic and nongenetic modifying factors. In this study, we evaluated the putative role of variants in many candidate modifier genes. Genotyping data from 15,252 BRCA1 and 8,211 BRCA2 mutation carriers, for known variants (n = 3,248) located within or around 445 candidate genes, were available through the iCOGS custom-designed array. Breast and ovarian cancer association analysis was performed within a retrospective cohort approach. The observed P values of association ranged between 0.005 and 1.000. None of the variants was significantly associated with breast or ovarian cancer risk in either BRCA1 or BRCA2 mutation carriers, after multiple testing adjustments. There is little evidence that any of the evaluated candidate variants act as modifiers of breast and/or ovarian cancer risk in BRCA1 or BRCA2 mutation carriers. Genome-wide association studies have been more successful at identifying genetic modifiers of BRCA1/2 penetrance than candidate gene studies. ©2014 American Association for Cancer Research.

A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

PubMed

Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

2002-07-01

Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

Transcriptomic Identification of ADH1B as a Novel Candidate Gene for Obesity and Insulin Resistance in Human Adipose Tissue in Mexican Americans from the Veterans Administration Genetic Epidemiology Study (VAGES)

PubMed Central

Winnier, Deidre A.; Fourcaudot, Marcel; Norton, Luke; Abdul-Ghani, Muhammad A.; Hu, Shirley L.; Farook, Vidya S.; Coletta, Dawn K.; Kumar, Satish; Puppala, Sobha; Chittoor, Geetha; Dyer, Thomas D.; Arya, Rector; Carless, Melanie; Lehman, Donna M.; Curran, Joanne E.; Cromack, Douglas T.; Tripathy, Devjit; Blangero, John; Duggirala, Ravindranath; Göring, Harald H. H.; DeFronzo, Ralph A.; Jenkinson, Christopher P.

2015-01-01

Type 2 diabetes (T2D) is a complex metabolic disease that is more prevalent in ethnic groups such as Mexican Americans, and is strongly associated with the risk factors obesity and insulin resistance. The goal of this study was to perform whole genome gene expression profiling in adipose tissue to detect common patterns of gene regulation associated with obesity and insulin resistance. We used phenotypic and genotypic data from 308 Mexican American participants from the Veterans Administration Genetic Epidemiology Study (VAGES). Basal fasting RNA was extracted from adipose tissue biopsies from a subset of 75 unrelated individuals, and gene expression data generated on the Illumina BeadArray platform. The number of gene probes with significant expression above baseline was approximately 31,000. We performed multiple regression analysis of all probes with 15 metabolic traits. Adipose tissue had 3,012 genes significantly associated with the traits of interest (false discovery rate, FDR ≤ 0.05). The significance of gene expression changes was used to select 52 genes with significant (FDR ≤ 10-4) gene expression changes across multiple traits. Gene sets/Pathways analysis identified one gene, alcohol dehydrogenase 1B (ADH1B) that was significantly enriched (P < 10-60) as a prime candidate for involvement in multiple relevant metabolic pathways. Illumina BeadChip derived ADH1B expression data was consistent with quantitative real time PCR data. We observed significant inverse correlations with waist circumference (2.8 x 10-9), BMI (5.4 x 10-6), and fasting plasma insulin (P < 0.001). These findings are consistent with a central role for ADH1B in obesity and insulin resistance and provide evidence for a novel genetic regulatory mechanism for human metabolic diseases related to these traits. PMID:25830378

STAYGREEN (CsSGR) is a candidate for the anthracnose (Colletotrichum orbiculare) resistance locus cla in Gy14 cucumber.

PubMed

Pan, Junsong; Tan, Junyi; Wang, Yuhui; Zheng, Xiangyang; Owens, Ken; Li, Dawei; Li, Yuhong; Weng, Yiqun

2018-04-21

Map-based cloning identified a candidate gene for resistance to the anthracnose fungal pathogen Colletotrichum orbiculare in cucumber, which reveals a novel function for the highly conserved STAYGREEN family genes for host disease resistance in plants. Colletotrichum orbiculare is a hemibiotrophic fungal pathogen that causes anthracnose disease in cucumber and other cucurbit crops. No host resistance genes against the anthracnose pathogens have been cloned in crop plants. Here, we reported fine mapping and cloning of a resistance gene to the race 1 anthracnose pathogen in cucumber inbred lines Gy14 and WI 2757. Phenotypic and QTL analysis in multiple populations revealed that a single recessive gene, cla, was underlying anthracnose resistance in both lines, but WI2757 carried an additional minor-effect QTL. Fine mapping using 150 Gy14 × 9930 recombinant inbred lines and 1043 F 2 individuals delimited the cla locus into a 32 kb region in cucumber Chromosome 5 with three predicted genes. Multiple lines of evidence suggested that the cucumber STAYGREEN (CsSGR) gene is a candidate for the anthracnose resistance locus. A single nucleotide mutation in the third exon of CsSGR resulted in the substitution of Glutamine in 9930 to Arginine in Gy14 in CsSGR protein which seems responsible for the differential anthracnose inoculation responses between Gy14 and 9930. Quantitative real-time PCR analysis indicated that CsSGR was significantly upregulated upon anthracnose pathogen inoculation in the susceptible 9930, while its expression was much lower in the resistant Gy14. Investigation of allelic diversities in natural cucumber populations revealed that the resistance allele in almost all improved cultivars or breeding lines of the U.S. origin was derived from PI 197087. This work reveals an unknown function for the highly conserved STAYGREEN (SGR) family genes for host disease resistance in plants.

Cross-platform method for identifying candidate network biomarkers for prostate cancer.

PubMed

Jin, G; Zhou, X; Cui, K; Zhang, X-S; Chen, L; Wong, S T C

2009-11-01

Discovering biomarkers using mass spectrometry (MS) and microarray expression profiles is a promising strategy in molecular diagnosis. Here, the authors proposed a new pipeline for biomarker discovery that integrates disease information for proteins and genes, expression profiles in both genomic and proteomic levels, and protein-protein interactions (PPIs) to discover high confidence network biomarkers. Using this pipeline, a total of 474 molecules (genes and proteins) related to prostate cancer were identified and a prostate-cancer-related network (PCRN) was derived from the integrative information. Thus, a set of candidate network biomarkers were identified from multiple expression profiles composed by eight microarray datasets and one proteomics dataset. The network biomarkers with PPIs can accurately distinguish the prostate patients from the normal ones, which potentially provide more reliable hits of biomarker candidates than conventional biomarker discovery methods.

Genetic neuropathology of obsessive psychiatric syndromes

PubMed Central

Jaffe, A E; Deep-Soboslay, A; Tao, R; Hauptman, D T; Kaye, W H; Arango, V; Weinberger, D R; Hyde, T M; Kleinman, J E

2014-01-01

Anorexia nervosa (AN), bulimia nervosa (BN) and obsessive-compulsive disorder (OCD) are complex psychiatric disorders with shared obsessive features, thought to arise from the interaction of multiple genes of small effect with environmental factors. Potential candidate genes for AN, BN and OCD have been identified through clinical association and neuroimaging studies; however, recent genome-wide association studies of eating disorders (ED) so far have failed to report significant findings. In addition, few, if any, studies have interrogated postmortem brain tissue for evidence of expression quantitative trait loci (eQTLs) associated with candidate genes, which has particular promise as an approach to elucidating molecular mechanisms of association. We therefore selected single-nucleotide polymorphisms (SNPs) based on candidate gene studies for AN, BN and OCD from the literature, and examined the association of these SNPs with gene expression across the lifespan in prefrontal cortex of a nonpsychiatric control cohort (N=268). Several risk-predisposing SNPs were significantly associated with gene expression among control subjects. We then measured gene expression in the prefrontal cortex of cases previously diagnosed with obsessive psychiatric disorders, for example, ED (N=15) and OCD/obsessive-compulsive personality disorder or tics (OCD/OCPD/Tic; N=16), and nonpsychiatric controls (N=102) and identified 6 and 286 genes that were differentially expressed between ED compared with controls and OCD cases compared with controls, respectively (false discovery rate (FDR) <5%). However, none of the clinical risk SNPs were among the eQTLs and none were significantly associated with gene expression within the broad obsessive cohort, suggesting larger sample sizes or other brain regions may be required to identify candidate molecular mechanisms of clinical association in postmortem brain data sets. PMID:25180571

Genetic neuropathology of obsessive psychiatric syndromes.

PubMed

Jaffe, A E; Deep-Soboslay, A; Tao, R; Hauptman, D T; Kaye, W H; Arango, V; Weinberger, D R; Hyde, T M; Kleinman, J E

2014-09-02

Anorexia nervosa (AN), bulimia nervosa (BN) and obsessive-compulsive disorder (OCD) are complex psychiatric disorders with shared obsessive features, thought to arise from the interaction of multiple genes of small effect with environmental factors. Potential candidate genes for AN, BN and OCD have been identified through clinical association and neuroimaging studies; however, recent genome-wide association studies of eating disorders (ED) so far have failed to report significant findings. In addition, few, if any, studies have interrogated postmortem brain tissue for evidence of expression quantitative trait loci (eQTLs) associated with candidate genes, which has particular promise as an approach to elucidating molecular mechanisms of association. We therefore selected single-nucleotide polymorphisms (SNPs) based on candidate gene studies for AN, BN and OCD from the literature, and examined the association of these SNPs with gene expression across the lifespan in prefrontal cortex of a nonpsychiatric control cohort (N=268). Several risk-predisposing SNPs were significantly associated with gene expression among control subjects. We then measured gene expression in the prefrontal cortex of cases previously diagnosed with obsessive psychiatric disorders, for example, ED (N=15) and OCD/obsessive-compulsive personality disorder or tics (OCD/OCPD/Tic; N=16), and nonpsychiatric controls (N=102) and identified 6 and 286 genes that were differentially expressed between ED compared with controls and OCD cases compared with controls, respectively (false discovery rate (FDR) <5%). However, none of the clinical risk SNPs were among the eQTLs and none were significantly associated with gene expression within the broad obsessive cohort, suggesting larger sample sizes or other brain regions may be required to identify candidate molecular mechanisms of clinical association in postmortem brain data sets.

Nucleotide polymorphisms in a pine ortholog of the Arabidopsis degrading enzyme cellulase KORRIGAN are associated with early growth performance in Pinus pinaster.

PubMed

Cabezas, José Antonio; González-Martínez, Santiago C; Collada, Carmen; Guevara, María Angeles; Boury, Christophe; de María, Nuria; Eveno, Emmanuelle; Aranda, Ismael; Garnier-Géré, Pauline H; Brach, Jean; Alía, Ricardo; Plomion, Christophe; Cervera, María Teresa

2015-09-01

We have carried out a candidate-gene-based association genetic study in Pinus pinaster Aiton and evaluated the predictive performance for genetic merit gain of the most significantly associated genes and single nucleotide polymorphisms (SNPs). We used a second generation 384-SNP array enriched with candidate genes for growth and wood properties to genotype mother trees collected in 20 natural populations covering most of the European distribution of the species. Phenotypic data for total height, polycyclism, root-collar diameter and biomass were obtained from a replicated provenance-progeny trial located in two sites with contrasting environments (Atlantic vs Mediterranean climate). General linear models identified strong associations between growth traits (total height and polycyclism) and four SNPs from the korrigan candidate gene, after multiple testing corrections using false discovery rate. The combined genomic breeding value predictions assessed for the four associated korrigan SNPs by ridge regression-best linear unbiased prediction (RR-BLUP) and cross-validation accounted for up to 8 and 15% of the phenotypic variance for height and polycyclic growth, respectively, and did not improve adding SNPs from other growth-related candidate genes. For root-collar diameter and total biomass, they accounted for 1.6 and 1.1% of the phenotypic variance, respectively, but increased to 15 and 4.1% when other SNPs from lp3.1, lp3.3 and cad were included in RR-BLUP models. These results point towards a desirable integration of candidate-gene studies as a means to pre-select relevant markers, and aid genomic selection in maritime pine breeding programs. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Genetic variation in cell death genes and risk of non-Hodgkin lymphoma.

PubMed

Schuetz, Johanna M; Daley, Denise; Graham, Jinko; Berry, Brian R; Gallagher, Richard P; Connors, Joseph M; Gascoyne, Randy D; Spinelli, John J; Brooks-Wilson, Angela R

2012-01-01

Non-Hodgkin lymphomas are a heterogeneous group of solid tumours that constitute the 5(th) highest cause of cancer mortality in the United States and Canada. Poor control of cell death in lymphocytes can lead to autoimmune disease or cancer, making genes involved in programmed cell death of lymphocytes logical candidate genes for lymphoma susceptibility. We tested for genetic association with NHL and NHL subtypes, of SNPs in lymphocyte cell death genes using an established population-based study. 17 candidate genes were chosen based on biological function, with 123 SNPs tested. These included tagSNPs from HapMap and novel SNPs discovered by re-sequencing 47 cases in genes for which SNP representation was judged to be low. The main analysis, which estimated odds ratios by fitting data to an additive logistic regression model, used European ancestry samples that passed quality control measures (569 cases and 547 controls). A two-tiered approach for multiple testing correction was used: correction for number of tests within each gene by permutation-based methodology, followed by correction for the number of genes tested using the false discovery rate. Variant rs928883, near miR-155, showed an association (OR per A-allele: 2.80 [95% CI: 1.63-4.82]; p(F) = 0.027) with marginal zone lymphoma that is significant after correction for multiple testing. This is the first reported association between a germline polymorphism at a miRNA locus and lymphoma.

Composite selection signals can localize the trait specific genomic regions in multi-breed populations of cattle and sheep

PubMed Central

2014-01-01

Background Discerning the traits evolving under neutral conditions from those traits evolving rapidly because of various selection pressures is a great challenge. We propose a new method, composite selection signals (CSS), which unifies the multiple pieces of selection evidence from the rank distribution of its diverse constituent tests. The extreme CSS scores capture highly differentiated loci and underlying common variants hauling excess haplotype homozygosity in the samples of a target population. Results The data on high-density genotypes were analyzed for evidence of an association with either polledness or double muscling in various cohorts of cattle and sheep. In cattle, extreme CSS scores were found in the candidate regions on autosome BTA-1 and BTA-2, flanking the POLL locus and MSTN gene, for polledness and double muscling, respectively. In sheep, the regions with extreme scores were localized on autosome OAR-2 harbouring the MSTN gene for double muscling and on OAR-10 harbouring the RXFP2 gene for polledness. In comparison to the constituent tests, there was a partial agreement between the signals at the four candidate loci; however, they consistently identified additional genomic regions harbouring no known genes. Persuasively, our list of all the additional significant CSS regions contains genes that have been successfully implicated to secondary phenotypic diversity among several subpopulations in our data. For example, the method identified a strong selection signature for stature in cattle capturing selective sweeps harbouring UQCC-GDF5 and PLAG1-CHCHD7 gene regions on BTA-13 and BTA-14, respectively. Both gene pairs have been previously associated with height in humans, while PLAG1-CHCHD7 has also been reported for stature in cattle. In the additional analysis, CSS identified significant regions harbouring multiple genes for various traits under selection in European cattle including polledness, adaptation, metabolism, growth rate, stature, immunity, reproduction traits and some other candidate genes for dairy and beef production. Conclusions CSS successfully localized the candidate regions in validation datasets as well as identified previously known and novel regions for various traits experiencing selection pressure. Together, the results demonstrate the utility of CSS by its improved power, reduced false positives and high-resolution of selection signals as compared to individual constituent tests. PMID:24636660

A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family

PubMed Central

Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.

2015-01-01

Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the genes that contribute to cellulose content in cereal culms and to a greater understanding of the interactions between them. PMID:26154104

A Simple Screening Approach To Prioritize Genes for Functional Analysis Identifies a Role for Interferon Regulatory Factor 7 in the Control of Respiratory Syncytial Virus Disease

PubMed Central

McDonald, Jacqueline U.; Kaforou, Myrsini; Clare, Simon; Hale, Christine; Ivanova, Maria; Huntley, Derek; Dorner, Marcus; Wright, Victoria J.; Levin, Michael; Martinon-Torres, Federico; Herberg, Jethro A.

2016-01-01

ABSTRACT Greater understanding of the functions of host gene products in response to infection is required. While many of these genes enable pathogen clearance, some enhance pathogen growth or contribute to disease symptoms. Many studies have profiled transcriptomic and proteomic responses to infection, generating large data sets, but selecting targets for further study is challenging. Here we propose a novel data-mining approach combining multiple heterogeneous data sets to prioritize genes for further study by using respiratory syncytial virus (RSV) infection as a model pathogen with a significant health care impact. The assumption was that the more frequently a gene is detected across multiple studies, the more important its role is. A literature search was performed to find data sets of genes and proteins that change after RSV infection. The data sets were standardized, collated into a single database, and then panned to determine which genes occurred in multiple data sets, generating a candidate gene list. This candidate gene list was validated by using both a clinical cohort and in vitro screening. We identified several genes that were frequently expressed following RSV infection with no assigned function in RSV control, including IFI27, IFIT3, IFI44L, GBP1, OAS3, IFI44, and IRF7. Drilling down into the function of these genes, we demonstrate a role in disease for the gene for interferon regulatory factor 7, which was highly ranked on the list, but not for IRF1, which was not. Thus, we have developed and validated an approach for collating published data sets into a manageable list of candidates, identifying novel targets for future analysis. IMPORTANCE Making the most of “big data” is one of the core challenges of current biology. There is a large array of heterogeneous data sets of host gene responses to infection, but these data sets do not inform us about gene function and require specialized skill sets and training for their utilization. Here we describe an approach that combines and simplifies these data sets, distilling this information into a single list of genes commonly upregulated in response to infection with RSV as a model pathogen. Many of the genes on the list have unknown functions in RSV disease. We validated the gene list with new clinical, in vitro, and in vivo data. This approach allows the rapid selection of genes of interest for further, more-detailed studies, thus reducing time and costs. Furthermore, the approach is simple to use and widely applicable to a range of diseases. PMID:27822537

Single nucleotide polymorphisms in multiple sclerosis: disease susceptibility and treatment response biomarkers.

PubMed

Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija

2012-04-01

Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.

SNP-by-fitness and SNP-by-BMI interactions from seven candidate genes and incident hypertension after 20 years of follow-up: the CARDIA Fitness Study.

PubMed

Sarzynski, M A; Rankinen, T; Sternfeld, B; Fornage, M; Sidney, S; Bouchard, C

2011-08-01

The association of single nucleotide polymorphisms (SNPs) from seven candidate genes, including genotype-by-baseline fitness and genotype-by-baseline body mass index (BMI) interactions, with incident hypertension over 20 years was investigated in 2663 participants (1301 blacks, 1362 whites) of the Coronary Artery Risk Development in Young Adults Study (CARDIA). Baseline cardiorespiratory fitness was determined from duration of a modified Balke treadmill test. A total of 98 SNPs in blacks and 89 SNPs in whites from seven candidate genes were genotyped. Participants that became hypertensive (295 blacks and 146 whites) had significantly higher blood pressure and BMI (both races), and lower fitness (blacks only) at baseline than those who remained normotensive. Markers at the peroxisome proliferative activated receptor gamma coactivator 1α (PPARGC1A) and bradykinin β2 receptor (BDKRB2) genes were nominally associated with greater risk of hypertension, although one marker each at the BDKRB2 and endothelial nitric oxide synthase-3 (NOS3) genes were nominally associated with lower risk. The association of baseline fitness with risk of hypertension was nominally modified by genotype at markers within the angiotensin converting enzyme, angiotensinogen, BDKRB2 and NOS3 genes in blacks and the BDKRB2, endothelin-1 and PPARGC1A genes in whites. BDKRB2 rs4900318 showed nominal interactions with baseline fitness on the risk of hypertension in both races. The association of baseline BMI with risk of hypertension was nominally modified by GNB3 rs2301339 genotype in whites. None of the above associations were statistically significant after correcting for multiple testing. We found that SNPs in these candidate genes did not modify the association between baseline fitness or BMI and risk of hypertension in CARDIA participants.

LNDriver: identifying driver genes by integrating mutation and expression data based on gene-gene interaction network.

PubMed

Wei, Pi-Jing; Zhang, Di; Xia, Junfeng; Zheng, Chun-Hou

2016-12-23

Cancer is a complex disease which is characterized by the accumulation of genetic alterations during the patient's lifetime. With the development of the next-generation sequencing technology, multiple omics data, such as cancer genomic, epigenomic and transcriptomic data etc., can be measured from each individual. Correspondingly, one of the key challenges is to pinpoint functional driver mutations or pathways, which contributes to tumorigenesis, from millions of functional neutral passenger mutations. In this paper, in order to identify driver genes effectively, we applied a generalized additive model to mutation profiles to filter genes with long length and constructed a new gene-gene interaction network. Then we integrated the mutation data and expression data into the gene-gene interaction network. Lastly, greedy algorithm was used to prioritize candidate driver genes from the integrated data. We named the proposed method Length-Net-Driver (LNDriver). Experiments on three TCGA datasets, i.e., head and neck squamous cell carcinoma, kidney renal clear cell carcinoma and thyroid carcinoma, demonstrated that the proposed method was effective. Also, it can identify not only frequently mutated drivers, but also rare candidate driver genes.

OVA: integrating molecular and physical phenotype data from multiple biomedical domain ontologies with variant filtering for enhanced variant prioritization.

PubMed

Antanaviciute, Agne; Watson, Christopher M; Harrison, Sally M; Lascelles, Carolina; Crinnion, Laura; Markham, Alexander F; Bonthron, David T; Carr, Ian M

2015-12-01

Exome sequencing has become a de facto standard method for Mendelian disease gene discovery in recent years, yet identifying disease-causing mutations among thousands of candidate variants remains a non-trivial task. Here we describe a new variant prioritization tool, OVA (ontology variant analysis), in which user-provided phenotypic information is exploited to infer deeper biological context. OVA combines a knowledge-based approach with a variant-filtering framework. It reduces the number of candidate variants by considering genotype and predicted effect on protein sequence, and scores the remainder on biological relevance to the query phenotype.We take advantage of several ontologies in order to bridge knowledge across multiple biomedical domains and facilitate computational analysis of annotations pertaining to genes, diseases, phenotypes, tissues and pathways. In this way, OVA combines information regarding molecular and physical phenotypes and integrates both human and model organism data to effectively prioritize variants. By assessing performance on both known and novel disease mutations, we show that OVA performs biologically meaningful candidate variant prioritization and can be more accurate than another recently published candidate variant prioritization tool. OVA is freely accessible at http://dna2.leeds.ac.uk:8080/OVA/index.jsp. Supplementary data are available at Bioinformatics online. umaan@leeds.ac.uk. © The Author 2015. Published by Oxford University Press.

Neurotransmitter systems and neurotrophic factors in autism: association study of 37 genes suggests involvement of DDC.

PubMed

Toma, Claudio; Hervás, Amaia; Balmaña, Noemí; Salgado, Marta; Maristany, Marta; Vilella, Elisabet; Aguilera, Francisco; Orejuela, Carmen; Cuscó, Ivon; Gallastegui, Fátima; Pérez-Jurado, Luis Alberto; Caballero-Andaluz, Rafaela; Diego-Otero, Yolanda de; Guzmán-Alvarez, Guadalupe; Ramos-Quiroga, Josep Antoni; Ribasés, Marta; Bayés, Mònica; Cormand, Bru

2013-09-01

Neurotransmitter systems and neurotrophic factors can be considered strong candidates for autism spectrum disorder (ASD). The serotoninergic and dopaminergic systems are involved in neurotransmission, brain maturation and cortical organization, while neurotrophic factors (NTFs) participate in neurodevelopment, neuronal survival and synapses formation. We aimed to test the contribution of these candidate pathways to autism through a case-control association study of genes selected both for their role in central nervous system functions and for pathophysiological evidences. The study sample consisted of 326 unrelated autistic patients and 350 gender-matched controls from Spain. We genotyped 369 tagSNPs to perform a case-control association study of 37 candidate genes. A significant association was obtained between the DDC gene and autism in the single-marker analysis (rs6592961, P = 0.00047). Haplotype-based analysis pinpointed a four-marker combination in this gene associated with the disorder (rs2329340C-rs2044859T-rs6592961A-rs11761683T, P = 4.988e-05). No significant results were obtained for the remaining genes after applying multiple testing corrections. However, the rs167771 marker in DRD3, associated with ASD in a previous study, displayed a nominal association in our analysis (P = 0.023). Our data suggest that common allelic variants in the DDC gene may be involved in autism susceptibility.

Isolation and characterization of multiple F-box genes linked to the S9- and S10-RNase in apple (Malus × domestica Borkh.).

PubMed

Okada, Kazuma; Moriya, Shigeki; Haji, Takashi; Abe, Kazuyuki

2013-06-01

Using 11 consensus primer pairs designed from S-linked F-box genes of apple and Japanese pear, 10 new F-box genes (MdFBX21 to 30) were isolated from the apple cultivar 'Spartan' (S(9)S(10)). MdFBX21 to 23 and MdFBX24 to 30 were completely linked to the S(9) -RNase and S(10-)RNase, respectively, and showed pollen-specific expression and S-haplotype-specific polymorphisms. Therefore, these 10 F-box genes are good candidates for the pollen determinant of self-incompatibility in apple. Phylogenetic analysis and comparison of deduced amino acid sequences of MdFBX21 to 30 with those of 25 S-linked F-box genes previously isolated from apple showed that a deduced amino acid identity of greater than 88.0 % can be used as the tentative criterion to classify F-box genes into one type. Using this criterion, 31 of 35 F-box genes of apple were classified into 11 types (SFBB1-11). All types included F-box genes derived from S(3-) and S(9-)haplotypes, and seven types included F-box genes derived from S(3-), S(9-), and S(10-)haplotypes. Moreover, comparison of nucleotide sequences of S-RNases and multiple F-box genes among S(3-), S(9-), and S(10-)haplotypes suggested that F-box genes within each type showed high nucleotide identity regardless of the identity of the S-RNase. The large number of F-box genes as candidates for the pollen determinant and the high degree of conservation within each type are consistent with the collaborative non-self-recognition model reported for Petunia. These findings support that the collaborative non-self-recognition system also exists in apple.

Common genetic variants related to genomic integrity and risk of papillary thyroid cancer

PubMed Central

Neta, Gila; Brenner, Alina V.; Sturgis, Erich M.; Pfeiffer, Ruth M.; Hutchinson, Amy A.; Aschebrook-Kilfoy, Briseis; Yeager, Meredith; Xu, Li; Wheeler, William; Abend, Michael; Ron, Elaine; Tucker, Margaret A.; Chanock, Stephen J.; Sigurdson, Alice J.

2011-01-01

DNA damage is an important mechanism in carcinogenesis, so genes related to maintaining genomic integrity may influence papillary thyroid cancer (PTC) risk. Candidate gene studies targeting some of these genes have identified only a few polymorphisms associated with risk of PTC. Here, we expanded the scope of previous candidate studies by increasing the number and coverage of genes related to maintenance of genomic integrity. We evaluated 5077 tag single-nucleotide polymorphisms (SNPs) from 340 candidate gene regions hypothesized to be involved in DNA repair, epigenetics, tumor suppression, apoptosis, telomere function and cell cycle control and signaling pathways in a case–control study of 344 PTC cases and 452 matched controls. We estimated odds ratios for associations of single SNPs with PTC risk and combined P values for SNPs in the same gene region or pathway to obtain gene region-specific or pathway-specific P values using adaptive rank-truncated product methods. Nine SNPs had P values <0.0005, three of which were in HDAC4 and were inversely related to PTC risk. After multiple comparisons adjustment, no SNPs remained associated with PTC risk. Seven gene regions were associated with PTC risk at P < 0.01, including HUS1, ALKBH3, HDAC4, BAK1, FAF1_CDKN2C, DACT3 and FZD6. Our results suggest a possible role of genes involved in maintenance of genomic integrity in relation to risk of PTC. PMID:21642358

A "candidate-interactome" aggregate analysis of genome-wide association data in multiple sclerosis.

PubMed

Mechelli, Rosella; Umeton, Renato; Policano, Claudia; Annibali, Viviana; Coarelli, Giulia; Ricigliano, Vito A G; Vittori, Danila; Fornasiero, Arianna; Buscarinu, Maria Chiara; Romano, Silvia; Salvetti, Marco; Ristori, Giovanni

2013-01-01

Though difficult, the study of gene-environment interactions in multifactorial diseases is crucial for interpreting the relevance of non-heritable factors and prevents from overlooking genetic associations with small but measurable effects. We propose a "candidate interactome" (i.e. a group of genes whose products are known to physically interact with environmental factors that may be relevant for disease pathogenesis) analysis of genome-wide association data in multiple sclerosis. We looked for statistical enrichment of associations among interactomes that, at the current state of knowledge, may be representative of gene-environment interactions of potential, uncertain or unlikely relevance for multiple sclerosis pathogenesis: Epstein-Barr virus, human immunodeficiency virus, hepatitis B virus, hepatitis C virus, cytomegalovirus, HHV8-Kaposi sarcoma, H1N1-influenza, JC virus, human innate immunity interactome for type I interferon, autoimmune regulator, vitamin D receptor, aryl hydrocarbon receptor and a panel of proteins targeted by 70 innate immune-modulating viral open reading frames from 30 viral species. Interactomes were either obtained from the literature or were manually curated. The P values of all single nucleotide polymorphism mapping to a given interactome were obtained from the last genome-wide association study of the International Multiple Sclerosis Genetics Consortium & the Wellcome Trust Case Control Consortium, 2. The interaction between genotype and Epstein Barr virus emerges as relevant for multiple sclerosis etiology. However, in line with recent data on the coexistence of common and unique strategies used by viruses to perturb the human molecular system, also other viruses have a similar potential, though probably less relevant in epidemiological terms.

A “Candidate-Interactome” Aggregate Analysis of Genome-Wide Association Data in Multiple Sclerosis

PubMed Central

Policano, Claudia; Annibali, Viviana; Coarelli, Giulia; Ricigliano, Vito A. G.; Vittori, Danila; Fornasiero, Arianna; Buscarinu, Maria Chiara; Romano, Silvia; Salvetti, Marco; Ristori, Giovanni

2013-01-01

Though difficult, the study of gene-environment interactions in multifactorial diseases is crucial for interpreting the relevance of non-heritable factors and prevents from overlooking genetic associations with small but measurable effects. We propose a “candidate interactome” (i.e. a group of genes whose products are known to physically interact with environmental factors that may be relevant for disease pathogenesis) analysis of genome-wide association data in multiple sclerosis. We looked for statistical enrichment of associations among interactomes that, at the current state of knowledge, may be representative of gene-environment interactions of potential, uncertain or unlikely relevance for multiple sclerosis pathogenesis: Epstein-Barr virus, human immunodeficiency virus, hepatitis B virus, hepatitis C virus, cytomegalovirus, HHV8-Kaposi sarcoma, H1N1-influenza, JC virus, human innate immunity interactome for type I interferon, autoimmune regulator, vitamin D receptor, aryl hydrocarbon receptor and a panel of proteins targeted by 70 innate immune-modulating viral open reading frames from 30 viral species. Interactomes were either obtained from the literature or were manually curated. The P values of all single nucleotide polymorphism mapping to a given interactome were obtained from the last genome-wide association study of the International Multiple Sclerosis Genetics Consortium & the Wellcome Trust Case Control Consortium, 2. The interaction between genotype and Epstein Barr virus emerges as relevant for multiple sclerosis etiology. However, in line with recent data on the coexistence of common and unique strategies used by viruses to perturb the human molecular system, also other viruses have a similar potential, though probably less relevant in epidemiological terms. PMID:23696811

Evidence for the importance of personalized molecular profiling in pancreatic cancer.

PubMed

Lili, Loukia N; Matyunina, Lilya V; Walker, L DeEtte; Daneker, George W; McDonald, John F

2014-03-01

There is a growing body of evidence that targeted gene therapy holds great promise for the future treatment of cancer. A crucial step in this therapy is the accurate identification of appropriate candidate genes/pathways for targeted treatment. One approach is to identify variant genes/pathways that are significantly enriched in groups of afflicted individuals relative to control subjects. However, if there are multiple molecular pathways to the same cancer, the molecular determinants of the disease may be heterogeneous among individuals and possibly go undetected by group analyses. In an effort to explore this question in pancreatic cancer, we compared the most significantly differentially expressed genes/pathways between cancer and control patient samples as determined by group versus personalized analyses. We found little to no overlap between genes/pathways identified by gene expression profiling using group analyses relative to those identified by personalized analyses. Our results indicate that personalized and not group molecular profiling is the most appropriate approach for the identification of putative candidates for targeted gene therapy of pancreatic and perhaps other cancers with heterogeneous molecular etiology.

Investigation of previously implicated genetic variants in chronic tic disorders: a transmission disequilibrium test approach.

PubMed

Abdulkadir, Mohamed; Londono, Douglas; Gordon, Derek; Fernandez, Thomas V; Brown, Lawrence W; Cheon, Keun-Ah; Coffey, Barbara J; Elzerman, Lonneke; Fremer, Carolin; Fründt, Odette; Garcia-Delgar, Blanca; Gilbert, Donald L; Grice, Dorothy E; Hedderly, Tammy; Heyman, Isobel; Hong, Hyun Ju; Huyser, Chaim; Ibanez-Gomez, Laura; Jakubovski, Ewgeni; Kim, Young Key; Kim, Young Shin; Koh, Yun-Joo; Kook, Sodahm; Kuperman, Samuel; Leventhal, Bennett; Ludolph, Andrea G; Madruga-Garrido, Marcos; Maras, Athanasios; Mir, Pablo; Morer, Astrid; Müller-Vahl, Kirsten; Münchau, Alexander; Murphy, Tara L; Plessen, Kerstin J; Roessner, Veit; Shin, Eun-Young; Song, Dong-Ho; Song, Jungeun; Tübing, Jennifer; van den Ban, Els; Visscher, Frank; Wanderer, Sina; Woods, Martin; Zinner, Samuel H; King, Robert A; Tischfield, Jay A; Heiman, Gary A; Hoekstra, Pieter J; Dietrich, Andrea

2018-04-01

Genetic studies in Tourette syndrome (TS) are characterized by scattered and poorly replicated findings. We aimed to replicate findings from candidate gene and genome-wide association studies (GWAS). Our cohort included 465 probands with chronic tic disorder (93% TS) and both parents from 412 families (some probands were siblings). We assessed 75 single nucleotide polymorphisms (SNPs) in 465 parent-child trios; 117 additional SNPs in 211 trios; and 4 additional SNPs in 254 trios. We performed SNP and gene-based transmission disequilibrium tests and compared nominally significant SNP results with those from a large independent case-control cohort. After quality control 71 SNPs were available in 371 trios; 112 SNPs in 179 trios; and 3 SNPs in 192 trios. 17 were candidate SNPs implicated in TS and 2 were implicated in obsessive-compulsive disorder (OCD) or autism spectrum disorder (ASD); 142 were tagging SNPs from eight monoamine neurotransmitter-related genes (including dopamine and serotonin); 10 were top SNPs from TS GWAS; and 13 top SNPs from attention-deficit/hyperactivity disorder, OCD, or ASD GWAS. None of the SNPs or genes reached significance after adjustment for multiple testing. We observed nominal significance for the candidate SNPs rs3744161 (TBCD) and rs4565946 (TPH2) and for five tagging SNPs; none of these showed significance in the independent cohort. Also, SLC1A1 in our gene-based analysis and two TS GWAS SNPs showed nominal significance, rs11603305 (intergenic) and rs621942 (PICALM). We found no convincing support for previously implicated genetic polymorphisms. Targeted re-sequencing should fully appreciate the relevance of candidate genes.

Genetics of cortisol secretion and depressive symptoms: a candidate gene and genome wide association approach.

PubMed

Velders, Fleur P; Kuningas, Maris; Kumari, Meena; Dekker, Marieke J; Uitterlinden, Andre G; Kirschbaum, Clemens; Hek, Karin; Hofman, Albert; Verhulst, Frank C; Kivimaki, Mika; Van Duijn, Cornelia M; Walker, Brian R; Tiemeier, Henning

2011-08-01

Depressive patients often have altered cortisol secretion, but few studies have investigated genetic variants in relation to both cortisol secretion and depression. To identify genes related to both these conditions, we: (1) tested the association of single nucleotide polymorphisms (SNPs) in hypothalamic-pituitary-adrenal-axis (HPA-axis) candidate genes with a summary measure of total cortisol secretion during the day (cortisol(AUC)), (2) performed a genome wide association study (GWAS) of cortisol(AUC), and (3) tested the association of identified cortisol-related SNPs with depressive symptoms. We analyzed data on candidate SNPs for the HPA-axis, genome-wide scans, cortisol secretion (n=1711) and depressive symptoms (the Centre for Epidemiology Studies Depression Scale, CES-D) (n=2928) in elderly persons of the Rotterdam Study. We used data from the Whitehall II study (n=2836) to replicate the GWAS findings. Of the 1456 SNPs in 33 candidate genes, minor alleles of 4 SNPs (rs9470080, rs9394309, rs7748266 and rs1360780) in the FKBP5 gene were associated with a decreased cortisol(AUC) (p<1×10(-4) after correction for multiple testing using permutations). These SNPs were also associated with an increased risk of depressive symptoms (rs9470080: OR 1.19 (95%CI 1.0; 1.4)). The GWAS for cortisol yielded 2 SNPs with p-values of 1×10(-06) (rs8062512, rs2252459), but these associations could not be replicated. These results suggest that variation in the FKBP5 gene is associated with both cortisol(AUC) and the likelihood of depressive symptoms. Copyright © 2011 Elsevier Ltd. All rights reserved.

Genome-wide association study of acute post-surgical pain in humans

PubMed Central

Kim, Hyungsuk; Ramsay, Edward; Lee, Hyewon; Wahl, Sharon; Dionne, Raymond A

2009-01-01

Aims Testing a relatively small genomic region with a few hundred SNPs provides limited information. Genome-wide association studies (GWAS) provide an opportunity to overcome the limitation of candidate gene association studies. Here, we report the results of a GWAS for the responses to an NSAID analgesic. Materials & methods European Americans (60 females and 52 males) undergoing oral surgery were genotyped with Affymetrix 500K SNP assay. Additional SNP genotyping was performed from the gene in linkage disequilibrium with the candidate SNP revealed by the GWAS. Results GWAS revealed a candidate SNP (rs2562456) associated with analgesic onset, which is in linkage disequilibrium with a gene encoding a zinc finger protein. Additional SNP genotyping of ZNF429 confirmed the association with analgesic onset in humans (p = 1.8 × 10−10, degrees of freedom = 103, F = 28.3). We also found candidate loci for the maximum post-operative pain rating (rs17122021, p = 6.9 × 10−7) and post-operative pain onset time (rs6693882, p = 2.1 × 10−6), however, correcting for multiple comparisons did not sustain these genetic associations. Conclusion GWAS for acute clinical pain followed by additional SNP genotyping of a neighboring gene suggests that genetic variations in or near the loci encoding DNA binding proteins play a role in the individual variations in responses to analgesic drugs. PMID:19207018

Factors predicting the occurrence of germline mutations in candidate genes among patients with cutaneous malignant melanoma from South Italy.

PubMed

Casula, Milena; Colombino, Maria; Satta, Maria P; Cossu, Antonio; Lissia, Amelia; Budroni, Mario; Simeone, Ester; Calemma, Rosa; Loddo, Cinzia; Caracò, Corrado; Mozzillo, Nicola; Daponte, Antonio; Comella, Giuseppe; Canzanella, Sergio; Guida, Michele; Castello, Giuseppe; Ascierto, Paolo A; Palmieri, Giuseppe

2007-01-01

Clinical predictors for germline mutations of candidate genes in large clinic based population of patients with cutaneous malignant melanoma (CMM) are widely awaited. Using denaturing high-performance liquid chromatography (DHPLC) analysis and DNA sequencing, 557 consecutively-collected CMM patients originating from South Italy were screened for CDKN2A germline mutations; subsets of them were screened for mutations in the BRAF and BRCA2 genes. Seven CDKN2A mutations were detected in 14 (2.5%) CMM patients. Relative risk of carrying a CDKN2A mutation for CMM patients was demonstrated to significantly increase with the presence of familial recurrence of melanoma (risk ratio (RR)=6.31; p=0.0009), multiple primary melanomas (RR=3.43; p=0.0014), and early onset age (RR=4.56; p=0.0026). All CDKN2A mutations were observed in non-Sardinian patients (14/441; 3.2%), whereas BRAF and BRCA2 genes were found mutated in Sardinian patients (3/116; 2.6%). Such indicators of the presence of CDKN2A mutations will be useful in counselling patients about undergoing genetic testing. Our findings strongly suggest that mutation rates of candidate cancer genes may deeply vary among CMM patients from different geographical areas.

Using Drosophila melanogaster as a Model for Genotoxic Chemical Mutational Studies with a New Program, SnpSift

PubMed Central

Cingolani, Pablo; Patel, Viral M.; Coon, Melissa; Nguyen, Tung; Land, Susan J.; Ruden, Douglas M.; Lu, Xiangyi

2012-01-01

This paper describes a new program SnpSift for filtering differential DNA sequence variants between two or more experimental genomes after genotoxic chemical exposure. Here, we illustrate how SnpSift can be used to identify candidate phenotype-relevant variants including single nucleotide polymorphisms, multiple nucleotide polymorphisms, insertions, and deletions (InDels) in mutant strains isolated from genome-wide chemical mutagenesis of Drosophila melanogaster. First, the genomes of two independently isolated mutant fly strains that are allelic for a novel recessive male-sterile locus generated by genotoxic chemical exposure were sequenced using the Illumina next-generation DNA sequencer to obtain 20- to 29-fold coverage of the euchromatic sequences. The sequencing reads were processed and variants were called using standard bioinformatic tools. Next, SnpEff was used to annotate all sequence variants and their potential mutational effects on associated genes. Then, SnpSift was used to filter and select differential variants that potentially disrupt a common gene in the two allelic mutant strains. The potential causative DNA lesions were partially validated by capillary sequencing of polymerase chain reaction-amplified DNA in the genetic interval as defined by meiotic mapping and deletions that remove defined regions of the chromosome. Of the five candidate genes located in the genetic interval, the Pka-like gene CG12069 was found to carry a separate pre-mature stop codon mutation in each of the two allelic mutants whereas the other four candidate genes within the interval have wild-type sequences. The Pka-like gene is therefore a strong candidate gene for the male-sterile locus. These results demonstrate that combining SnpEff and SnpSift can expedite the identification of candidate phenotype-causative mutations in chemically mutagenized Drosophila strains. This technique can also be used to characterize the variety of mutations generated by genotoxic chemicals. PMID:22435069

SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate

USGS Publications Warehouse

Roffler, Gretchen H.; Amish, Stephen J.; Smith, Seth; Cosart, Ted F.; Kardos, Marty; Schwartz, Michael K.; Luikart, Gordon

2016-01-01

Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding and nearby 5′ and 3′ untranslated regions of chosen candidate genes. Targeted sequences were taken from bighorn sheep (Ovis canadensis) exon capture data and directly from the domestic sheep genome (Ovis aries v. 3; oviAri3). The bighorn sheep sequences used in the Dall's sheep (Ovis dalli dalli) exon capture aligned to 2350 genes on the oviAri3 genome with an average of 2 exons each. We developed a microfluidic qPCR-based SNP chip to genotype 476 Dall's sheep from locations across their range and test for patterns of selection. Using multiple corroborating approaches (lositan and bayescan), we detected 28 SNP loci potentially under selection. We additionally identified candidate loci significantly associated with latitude, longitude, precipitation and temperature, suggesting local environmental adaptation. The three methods demonstrated consistent support for natural selection on nine genes with immune and disease-regulating functions (e.g. Ovar-DRA, APC, BATF2, MAGEB18), cell regulation signalling pathways (e.g. KRIT1, PI3K, ORRC3), and respiratory health (CYSLTR1). Characterizing adaptive allele distributions from novel genetic techniques will facilitate investigation of the influence of environmental variation on local adaptation of a northern alpine ungulate throughout its range. This research demonstrated the utility of exon capture for gene-targeted SNP discovery and subsequent SNP chip genotyping using low-quality samples in a nonmodel species.

Status of Therapeutic Gene Transfer to Treat Cardiovascular Disease in Dogs and Cats.

PubMed

Sleeper, Meg M

2017-09-01

Gene therapy is a procedure resulting in the transfer of a gene into an individual's cells to treat a disease. One goal of gene transfer is to express a functional gene when the endogenous gene is inactive. However, because heart failure is a complex disease characterized by multiple abnormalities at the cellular level, an alternate gene delivery approach is to alter myocardial protein levels to improve function. This article discusses background information on gene delivery, including packaging, administration, and a brief discussion of some of the candidate transgenes likely to alter the progression of naturally occurring heart disease in dogs and cats. Copyright © 2017 Elsevier Inc. All rights reserved.

[Genetic aspects of the Stroop test].

PubMed

Nánási, Tibor; Katonai, Enikő Rózsa; Sasvári-Székely, Mária; Székely, Anna

2012-12-01

Impairment of executive control functions in depression is well documented, and performance on the Stroop Test is one of the most widely used markers to measure the decline. This tool provides reliable quantitative phenotype data that can be used efficiently in candidate gene studies investigating inherited components of executive control. Aim of the present review is to summarize research on genetic factors of Stroop performance. Interestingly, only a few such candidate gene studies have been carried out to date. Twin studies show a 30-60% heritability estimate for the Stroop test, suggesting a significant genetic component. A single genome-wide association study has been carried out on Stroop performance, and it did not show any significant association with any of the tested polymorphisms after correction for multiple testing. Candidate gene studies to date pointed to the polymorphisms of several neurotransmitter systems (dopamine, serotonin, acetylcholine) and to the role of the APOE ε4 allele. Surprisingly, little is known about the genetic role of neurothrophic factors and survival factors. In conclusion, further studies are needed for clarifying the genetic background of Stroop performance, characterizing attentional functions.

The Role of Genetic Factors in the Outbreak Mechanism of Dental Caries.

PubMed

Shimomura-Kuroki, Junko; Nashida, Tomoko; Miyagawa, Yukio; Sekimoto, Tsuneo

The aim of the present study was to investigate the relationships between cariogenic bacterial infection and single nucleotide polymorphisms (SNPs) in candidate genes associated with dental caries, and to explore the factors related to caries in children. Children aged 3 to 11 years were selected. Detection of cariogenic bacteria (Streptococcus mutans, Streptococcus oralis, Streptococcus sobrinus and Lactobacillus) from the plaque of each patient, and SNP analyses of five candidate genes (MBL2, TAS2R38, GLUT2, MMP13 and CA6) were performed using DNA isolated from buccal mucosal cells. The dental caries experience in primary and permanent teeth was determined using the decayed, missing and filled teeth (DMFT) index, and the effects of the observed factors on the DMFT value were analyzed by multiple regression analysis. The results of the multiple regression analysis showed that the DMFT value significantly increased in the presence of S. mutans or S. sobrinus (p < 0.001), while the dmft/DMFT value decreased in the presence of nucleobase C in MBL2 (p < 0.05). These results suggest that the MBL2 gene is related to the pathogenesis of dental caries.

Synteny analysis of genes and distribution of loci controlling oil content and fatty acid profile based on QTL alignment map in Brassica napus.

PubMed

Raboanatahiry, Nadia; Chao, Hongbo; Guo, Liangxing; Gan, Jianping; Xiang, Jun; Yan, Mingli; Zhang, Libin; Yu, Longjiang; Li, Maoteng

2017-10-12

Deciphering the genetic architecture of a species is a good way to understand its evolutionary history, but also to tailor its profile for breeding elite cultivars with desirable traits. Aligning QTLs from diverse population in one map and utilizing it for comparison, but also as a basis for multiple analyses assure a stronger evidence to understand the genetic system related to a given phenotype. In this study, 439 genes involved in fatty acid (FA) and triacylglycerol (TAG) biosyntheses were identified in Brassica napus. B. napus genome showed mixed gene loss and insertion compared to B. rapa and B. oleracea, and C genome had more inserted genes. Identified QTLs for oil (OC-QTLs) and fatty acids (FA-QTLs) from nine reported populations were projected on the physical map of the reference genome "Darmor-bzh" to generate a map. Thus, 335 FA-QTLs and OC-QTLs could be highlighted and 82 QTLs were overlapping. Chromosome C3 contained 22 overlapping QTLs with all trait studied except for C18:3. In total, 218 candidate genes which were potentially involved in FA and TAG were identified in 162 QTLs confidence intervals and some of them might affect many traits. Also, 76 among these candidate genes were found inside 57 overlapping QTLs, and candidate genes for oil content were in majority (61/76 genes). Then, sixteen genes were found in overlapping QTLs involving three populations, and the remaining 60 genes were found in overlapping QTLs of two populations. Interaction network and pathway analysis of these candidate genes indicated ten genes that might have strong influence over the other genes that control fatty acids and oil formation. The present results provided new information for genetic basis of FA and TAG formation in B. napus. A map including QTLs from numerous populations was built, which could serve as reference to study the genome profile of B. napus, and new potential genes emerged which might affect seed oil. New useful tracks were showed for the selection of population or/and selection of interesting genes for breeding improvement purpose.

Selection and validation of suitable reference genes for miRNA expression normalization by quantitative RT-PCR in citrus somatic embryogenic and adult tissues.

PubMed

Kou, Shu-Jun; Wu, Xiao-Meng; Liu, Zheng; Liu, Yuan-Long; Xu, Qiang; Guo, Wen-Wu

2012-12-01

miRNAs have recently been reported to modulate somatic embryogenesis (SE), a key pathway of plant regeneration in vitro. For expression level detection and subsequent function dissection of miRNAs in certain biological processes, qRT-PCR is one of the most effective and sensitive techniques, for which suitable reference gene selection is a prerequisite. In this study, three miRNAs and eight non-coding RNAs (ncRNA) were selected as reference candidates, and their expression stability was inspected in developing citrus SE tissues cultured at 20, 25, and 30 °C. Stability of the eight non-miRNA ncRNAs was further validated in five adult tissues without temperature treatment. The best single reference gene for SE tissues was snoR14 or snoRD25, while for the adult tissues the best one was U4; although they were not as stable as the optimal multiple references snoR14 + U6 for SE tissues and snoR14 + U5 for adult tissues. For expression normalization of less abundant miRNAs in SE tissues, miR3954 was assessed as a viable reference. Single reference gene snoR14 outperformed multiple references for the overall SE and adult tissues. As one of the pioneer systematic studies on reference gene identification for plant miRNA normalization, this study benefits future exploration on miRNA function in citrus and provides valuable information for similar studies in other higher plants. Three miRNAs and eight non-coding RNAs were tested as reference candidates on developing citrus SE tissues. Best single references snoR14 or snoRD25 and optimal multiple references snoR14 + U6, snoR14 + U5 were identified.

Genome-Wide Identification of Differentially Expressed Genes Associated with the High Yielding of Oleoresin in Secondary Xylem of Masson Pine (Pinus massoniana Lamb) by Transcriptomic Analysis

PubMed Central

Liu, Qinghua; Zhou, Zhichun; Wei, Yongcheng; Shen, Danyu; Feng, Zhongping; Hong, Shanping

2015-01-01

Masson pine is an important timber and resource for oleoresin in South China. Increasing yield of oleoresin in stems can raise economic benefits and enhance the resistance to bark beetles. However, the genetic mechanisms for regulating the yield of oleoresin were still unknown. Here, high-throughput sequencing technology was used to investigate the transcriptome and compare the gene expression profiles of high and low oleoresin-yielding genotypes. A total of 40,690,540 reads were obtained and assembled into 137,499 transcripts from the secondary xylem tissues. We identified 84,842 candidate unigenes based on sequence annotation using various databases and 96 unigenes were candidates for terpenoid backbone biosynthesis in pine. By comparing the expression profiles of high and low oleoresin-yielding genotypes, 649 differentially expressed genes (DEGs) were identified. GO enrichment analysis of DEGs revealed that multiple pathways were related to high yield of oleoresin. Nine candidate genes were validated by QPCR analysis. Among them, the candidate genes encoding geranylgeranyl diphosphate synthase (GGPS) and (-)-alpha/beta-pinene synthase were up-regulated in the high oleoresin-yielding genotype, while tricyclene synthase revealed lower expression level, which was in good agreement with the GC/MS result. In addition, DEG encoding ABC transporters, pathogenesis-related proteins (PR5 and PR9), phosphomethylpyrimidine synthase, non-specific lipid-transfer protein-like protein and ethylene responsive transcription factors (ERFs) were also confirmed to be critical for the biosynthesis of oleoresin. The next-generation sequencing strategy used in this study has proven to be a powerful means for analyzing transcriptome variation related to the yield of oleoresin in masson pine. The candidate genes encoding GGPS, (-)-alpha/beta-pinene, tricyclene synthase, ABC transporters, non-specific lipid-transfer protein-like protein, phosphomethylpyrimidine synthase, ERFs and pathogen responses may play important roles in regulating the yield of oleoresin. These DEGs are worthy of special attention in future studies. PMID:26167875

Identifying candidate drivers of drug response in heterogeneous cancer by mining high throughput genomics data.

PubMed

Nabavi, Sheida

2016-08-15

With advances in technologies, huge amounts of multiple types of high-throughput genomics data are available. These data have tremendous potential to identify new and clinically valuable biomarkers to guide the diagnosis, assessment of prognosis, and treatment of complex diseases, such as cancer. Integrating, analyzing, and interpreting big and noisy genomics data to obtain biologically meaningful results, however, remains highly challenging. Mining genomics datasets by utilizing advanced computational methods can help to address these issues. To facilitate the identification of a short list of biologically meaningful genes as candidate drivers of anti-cancer drug resistance from an enormous amount of heterogeneous data, we employed statistical machine-learning techniques and integrated genomics datasets. We developed a computational method that integrates gene expression, somatic mutation, and copy number aberration data of sensitive and resistant tumors. In this method, an integrative method based on module network analysis is applied to identify potential driver genes. This is followed by cross-validation and a comparison of the results of sensitive and resistance groups to obtain the final list of candidate biomarkers. We applied this method to the ovarian cancer data from the cancer genome atlas. The final result contains biologically relevant genes, such as COL11A1, which has been reported as a cis-platinum resistant biomarker for epithelial ovarian carcinoma in several recent studies. The described method yields a short list of aberrant genes that also control the expression of their co-regulated genes. The results suggest that the unbiased data driven computational method can identify biologically relevant candidate biomarkers. It can be utilized in a wide range of applications that compare two conditions with highly heterogeneous datasets.

Genome-wide association study of CSF biomarkers Abeta1-42, t-tau, and p-tau181p in the ADNI cohort.

PubMed

Kim, S; Swaminathan, S; Shen, L; Risacher, S L; Nho, K; Foroud, T; Shaw, L M; Trojanowski, J Q; Potkin, S G; Huentelman, M J; Craig, D W; DeChairo, B M; Aisen, P S; Petersen, R C; Weiner, M W; Saykin, A J

2011-01-04

CSF levels of Aβ1-42, t-tau, and p-tau181p are potential early diagnostic markers for probable Alzheimer disease (AD). The influence of genetic variation on these markers has been investigated for candidate genes but not on a genome-wide basis. We report a genome-wide association study (GWAS) of CSF biomarkers (Aβ1-42, t-tau, p-tau181p, p-tau181p/Aβ1-42, and t-tau/Aβ1-42). A total of 374 non-Hispanic Caucasian participants in the Alzheimer's Disease Neuroimaging Initiative cohort with quality-controlled CSF and genotype data were included in this analysis. The main effect of single nucleotide polymorphisms (SNPs) under an additive genetic model was assessed on each of 5 CSF biomarkers. The p values of all SNPs for each CSF biomarker were adjusted for multiple comparisons by the Bonferroni method. We focused on SNPs with corrected p<0.01 (uncorrected p<3.10×10(-8)) and secondarily examined SNPs with uncorrected p values less than 10(-5) to identify potential candidates. Four SNPs in the regions of the APOE, LOC100129500, TOMM40, and EPC2 genes reached genome-wide significance for associations with one or more CSF biomarkers. SNPs in CCDC134, ABCG2, SREBF2, and NFATC4, although not reaching genome-wide significance, were identified as potential candidates. In addition to known candidate genes, APOE, TOMM40, and one hypothetical gene LOC100129500 partially overlapping APOE; one novel gene, EPC2, and several other interesting genes were associated with CSF biomarkers that are related to AD. These findings, especially the new EPC2 results, require replication in independent cohorts.

Transcriptome analysis of trigeminal ganglia following masseter muscle inflammation in rats

PubMed Central

Park, Jennifer; Asgar, Jamila; Ro, Jin Y.

2016-01-01

Background Chronic pain in masticatory muscles is a major medical problem. Although mechanisms underlying persistent pain in masticatory muscles are not fully understood, sensitization of nociceptive primary afferents following muscle inflammation or injury contributes to muscle hyperalgesia. It is well known that craniofacial muscle injury or inflammation induces regulation of multiple genes in trigeminal ganglia, which is associated with muscle hyperalgesia. However, overall transcriptional profiles within trigeminal ganglia following masseter inflammation have not yet been determined. In the present study, we performed RNA sequencing assay in rat trigeminal ganglia to identify transcriptome profiles of genes relevant to hyperalgesia following inflammation of the rat masseter muscle. Results Masseter inflammation differentially regulated >3500 genes in trigeminal ganglia. Predominant biological pathways were predicted to be related with activation of resident non-neuronal cells within trigeminal ganglia or recruitment of immune cells. To focus our analysis on the genes more relevant to nociceptors, we selected genes implicated in pain mechanisms, genes enriched in small- to medium-sized sensory neurons, and genes enriched in TRPV1-lineage nociceptors. Among the 2320 candidate genes, 622 genes showed differential expression following masseter inflammation. When the analysis was limited to these candidate genes, pathways related with G protein-coupled signaling and synaptic plasticity were predicted to be enriched. Inspection of individual gene expression changes confirmed the transcriptional changes of multiple nociceptor genes associated with masseter hyperalgesia (e.g., Trpv1, Trpa1, P2rx3, Tac1, and Bdnf) and also suggested a number of novel probable contributors (e.g., Piezo2, Tmem100, and Hdac9). Conclusion These findings should further advance our understanding of peripheral mechanisms involved in persistent craniofacial muscle pain conditions and provide a rational basis for identifying novel genes or sets of genes that can be potentially targeted for treating such conditions. PMID:27702909

Systems genetics: a paradigm to improve discovery of candidate genes and mechanisms underlying complex traits.

PubMed

Feltus, F Alex

2014-06-01

Understanding the control of any trait optimally requires the detection of causal genes, gene interaction, and mechanism of action to discover and model the biochemical pathways underlying the expressed phenotype. Functional genomics techniques, including RNA expression profiling via microarray and high-throughput DNA sequencing, allow for the precise genome localization of biological information. Powerful genetic approaches, including quantitative trait locus (QTL) and genome-wide association study mapping, link phenotype with genome positions, yet genetics is less precise in localizing the relevant mechanistic information encoded in DNA. The coupling of salient functional genomic signals with genetically mapped positions is an appealing approach to discover meaningful gene-phenotype relationships. Techniques used to define this genetic-genomic convergence comprise the field of systems genetics. This short review will address an application of systems genetics where RNA profiles are associated with genetically mapped genome positions of individual genes (eQTL mapping) or as gene sets (co-expression network modules). Both approaches can be applied for knowledge independent selection of candidate genes (and possible control mechanisms) underlying complex traits where multiple, likely unlinked, genomic regions might control specific complex traits. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Mixture models for detecting differentially expressed genes in microarrays.

PubMed

Jones, Liat Ben-Tovim; Bean, Richard; McLachlan, Geoffrey J; Zhu, Justin Xi

2006-10-01

An important and common problem in microarray experiments is the detection of genes that are differentially expressed in a given number of classes. As this problem concerns the selection of significant genes from a large pool of candidate genes, it needs to be carried out within the framework of multiple hypothesis testing. In this paper, we focus on the use of mixture models to handle the multiplicity issue. With this approach, a measure of the local FDR (false discovery rate) is provided for each gene. An attractive feature of the mixture model approach is that it provides a framework for the estimation of the prior probability that a gene is not differentially expressed, and this probability can subsequently be used in forming a decision rule. The rule can also be formed to take the false negative rate into account. We apply this approach to a well-known publicly available data set on breast cancer, and discuss our findings with reference to other approaches.

Gene network analysis shows immune-signaling and ERK1/2 as novel genetic markers for multiple addiction phenotypes: alcohol, smoking and opioid addiction.

PubMed

Reyes-Gibby, Cielito C; Yuan, Christine; Wang, Jian; Yeung, Sai-Ching J; Shete, Sanjay

2015-06-05

Addictions to alcohol and tobacco, known risk factors for cancer, are complex heritable disorders. Addictive behaviors have a bidirectional relationship with pain. We hypothesize that the associations between alcohol, smoking, and opioid addiction observed in cancer patients have a genetic basis. Therefore, using bioinformatics tools, we explored the underlying genetic basis and identified new candidate genes and common biological pathways for smoking, alcohol, and opioid addiction. Literature search showed 56 genes associated with alcohol, smoking and opioid addiction. Using Core Analysis function in Ingenuity Pathway Analysis software, we found that ERK1/2 was strongly interconnected across all three addiction networks. Genes involved in immune signaling pathways were shown across all three networks. Connect function from IPA My Pathway toolbox showed that DRD2 is the gene common to both the list of genetic variations associated with all three addiction phenotypes and the components of the brain neuronal signaling network involved in substance addiction. The top canonical pathways associated with the 56 genes were: 1) calcium signaling, 2) GPCR signaling, 3) cAMP-mediated signaling, 4) GABA receptor signaling, and 5) G-alpha i signaling. Cancer patients are often prescribed opioids for cancer pain thus increasing their risk for opioid abuse and addiction. Our findings provide candidate genes and biological pathways underlying addiction phenotypes, which may be future targets for treatment of addiction. Further study of the variations of the candidate genes could allow physicians to make more informed decisions when treating cancer pain with opioid analgesics.

Genome-Wide Association Mapping Combined with Reverse Genetics Identifies New Effectors of Low Water Potential-Induced Proline Accumulation in Arabidopsis1[W][OPEN

PubMed Central

Verslues, Paul E.; Lasky, Jesse R.; Juenger, Thomas E.; Liu, Tzu-Wen; Kumar, M. Nagaraj

2014-01-01

Arabidopsis (Arabidopsis thaliana) exhibits natural genetic variation in drought response, including varying levels of proline (Pro) accumulation under low water potential. As Pro accumulation is potentially important for stress tolerance and cellular redox control, we conducted a genome-wide association (GWAS) study of low water potential-induced Pro accumulation using a panel of natural accessions and publicly available single-nucleotide polymorphism (SNP) data sets. Candidate genomic regions were prioritized for subsequent study using metrics considering both the strength and spatial clustering of the association signal. These analyses found many candidate regions likely containing gene(s) influencing Pro accumulation. Reverse genetic analysis of several candidates identified new Pro effector genes, including thioredoxins and several genes encoding Universal Stress Protein A domain proteins. These new Pro effector genes further link Pro accumulation to cellular redox and energy status. Additional new Pro effector genes found include the mitochondrial protease LON1, ribosomal protein RPL24A, protein phosphatase 2A subunit A3, a MADS box protein, and a nucleoside triphosphate hydrolase. Several of these new Pro effector genes were from regions with multiple SNPs, each having moderate association with Pro accumulation. This pattern supports the use of summary approaches that incorporate clusters of SNP associations in addition to consideration of individual SNP probability values. Further GWAS-guided reverse genetics promises to find additional effectors of Pro accumulation. The combination of GWAS and reverse genetics to efficiently identify new effector genes may be especially applicable for traits difficult to analyze by other genetic screening methods. PMID:24218491

Candidate genes for obesity-susceptibility show enriched association within a large genome-wide association study for BMI.

PubMed

Vimaleswaran, Karani S; Tachmazidou, Ioanna; Zhao, Jing Hua; Hirschhorn, Joel N; Dudbridge, Frank; Loos, Ruth J F

2012-10-15

Before the advent of genome-wide association studies (GWASs), hundreds of candidate genes for obesity-susceptibility had been identified through a variety of approaches. We examined whether those obesity candidate genes are enriched for associations with body mass index (BMI) compared with non-candidate genes by using data from a large-scale GWAS. A thorough literature search identified 547 candidate genes for obesity-susceptibility based on evidence from animal studies, Mendelian syndromes, linkage studies, genetic association studies and expression studies. Genomic regions were defined to include the genes ±10 kb of flanking sequence around candidate and non-candidate genes. We used summary statistics publicly available from the discovery stage of the genome-wide meta-analysis for BMI performed by the genetic investigation of anthropometric traits consortium in 123 564 individuals. Hypergeometric, rank tail-strength and gene-set enrichment analysis tests were used to test for the enrichment of association in candidate compared with non-candidate genes. The hypergeometric test of enrichment was not significant at the 5% P-value quantile (P = 0.35), but was nominally significant at the 25% quantile (P = 0.015). The rank tail-strength and gene-set enrichment tests were nominally significant for the full set of genes and borderline significant for the subset without SNPs at P < 10(-7). Taken together, the observed evidence for enrichment suggests that the candidate gene approach retains some value. However, the degree of enrichment is small despite the extensive number of candidate genes and the large sample size. Studies that focus on candidate genes have only slightly increased chances of detecting associations, and are likely to miss many true effects in non-candidate genes, at least for obesity-related traits.

Genetics of alcoholism.

PubMed

Edenberg, Howard J; Foroud, Tatiana

2014-01-01

Multiple lines of evidence strongly indicate that genetic factors contribute to the risk for alcohol use disorders (AUD). There is substantial heterogeneity in AUD, which complicates studies seeking to identify specific genetic factors. To identify these genetic effects, several different alcohol-related phenotypes have been analyzed, including diagnosis and quantitative measures related to AUDs. Study designs have used candidate gene analyses, genetic linkage studies, genomewide association studies (GWAS), and analyses of rare variants. Two genes that encode enzymes of alcohol metabolism have the strongest effect on AUD: aldehyde dehydrogenase 2 and alcohol dehydrogenase 1B each has strongly protective variants that reduce risk, with odds ratios approximately 0.2-0.4. A number of other genes important in AUD have been identified and replicated, including GABRA2 and alcohol dehydrogenases 1B and 4. GWAS have identified additional candidates. Rare variants are likely also to play a role; studies of these are just beginning. A multifaceted approach to gene identification, targeting both rare and common variations and assembling much larger datasets for meta-analyses, is critical for identifying the key genes and pathways important in AUD. © 2014 Elsevier B.V. All rights reserved.

Using whole-exome sequencing to identify variants inherited from mosaic parents

PubMed Central

Rios, Jonathan J; Delgado, Mauricio R

2015-01-01

Whole-exome sequencing (WES) has allowed the discovery of genes and variants causing rare human disease. This is often achieved by comparing nonsynonymous variants between unrelated patients, and particularly for sporadic or recessive disease, often identifies a single or few candidate genes for further consideration. However, despite the potential for this approach to elucidate the genetic cause of rare human disease, a majority of patients fail to realize a genetic diagnosis using standard exome analysis methods. Although genetic heterogeneity contributes to the difficulty of exome sequence analysis between patients, it remains plausible that rare human disease is not caused by de novo or recessive variants. Multiple human disorders have been described for which the variant was inherited from a phenotypically normal mosaic parent. Here we highlight the potential for exome sequencing to identify a reasonable number of candidate genes when dominant disease variants are inherited from a mosaic parent. We show the power of WES to identify a limited number of candidate genes using this disease model and how sequence coverage affects identification of mosaic variants by WES. We propose this analysis as an alternative to discover genetic causes of rare human disorders for which typical WES approaches fail to identify likely pathogenic variants. PMID:24986828

Exome-based analysis of cardiac arrhythmia, respiratory control, and epilepsy genes in sudden unexpected death in epilepsy.

PubMed

Bagnall, Richard D; Crompton, Douglas E; Petrovski, Slavé; Lam, Lien; Cutmore, Carina; Garry, Sarah I; Sadleir, Lynette G; Dibbens, Leanne M; Cairns, Anita; Kivity, Sara; Afawi, Zaid; Regan, Brigid M; Duflou, Johan; Berkovic, Samuel F; Scheffer, Ingrid E; Semsarian, Christopher

2016-04-01

The leading cause of epilepsy-related premature mortality is sudden unexpected death in epilepsy (SUDEP). The cause of SUDEP remains unknown. To search for genetic risk factors in SUDEP cases, we performed an exome-based analysis of rare variants. Demographic and clinical information of 61 SUDEP cases were collected. Exome sequencing and rare variant collapsing analysis with 2,936 control exomes were performed to test for genes enriched with damaging variants. Additionally, cardiac arrhythmia, respiratory control, and epilepsy genes were screened for variants with frequency of <0.1% and predicted to be pathogenic with multiple in silico tools. The 61 SUDEP cases were categorized as definite SUDEP (n = 54), probable SUDEP (n = 5), and definite SUDEP plus (n = 2). We identified de novo mutations, previously reported pathogenic mutations, or candidate pathogenic variants in 28 of 61 (46%) cases. Four SUDEP cases (7%) had mutations in common genes responsible for the cardiac arrhythmia disease, long QT syndrome (LQTS). Nine cases (15%) had candidate pathogenic variants in dominant cardiac arrhythmia genes. Fifteen cases (25%) had mutations or candidate pathogenic variants in dominant epilepsy genes. No gene reached genome-wide significance with rare variant collapsing analysis; however, DEPDC5 (p = 0.00015) and KCNH2 (p = 0.0037) were among the top 30 genes, genome-wide. A sizeable proportion of SUDEP cases have clinically relevant mutations in cardiac arrhythmia and epilepsy genes. In cases with an LQTS gene mutation, SUDEP may occur as a result of a predictable and preventable cause. Understanding the genetic basis of SUDEP may inform cascade testing of at-risk family members. © 2016 American Neurological Association.

Discovery of cancer common and specific driver gene sets

PubMed Central

2017-01-01

Abstract Cancer is known as a disease mainly caused by gene alterations. Discovery of mutated driver pathways or gene sets is becoming an important step to understand molecular mechanisms of carcinogenesis. However, systematically investigating commonalities and specificities of driver gene sets among multiple cancer types is still a great challenge, but this investigation will undoubtedly benefit deciphering cancers and will be helpful for personalized therapy and precision medicine in cancer treatment. In this study, we propose two optimization models to de novo discover common driver gene sets among multiple cancer types (ComMDP) and specific driver gene sets of one certain or multiple cancer types to other cancers (SpeMDP), respectively. We first apply ComMDP and SpeMDP to simulated data to validate their efficiency. Then, we further apply these methods to 12 cancer types from The Cancer Genome Atlas (TCGA) and obtain several biologically meaningful driver pathways. As examples, we construct a common cancer pathway model for BRCA and OV, infer a complex driver pathway model for BRCA carcinogenesis based on common driver gene sets of BRCA with eight cancer types, and investigate specific driver pathways of the liquid cancer lymphoblastic acute myeloid leukemia (LAML) versus other solid cancer types. In these processes more candidate cancer genes are also found. PMID:28168295

Genomic expression analysis of rat chromosome 4 for skeletal traits at femoral neck.

PubMed

Alam, Imranul; Sun, Qiwei; Liu, Lixiang; Koller, Daniel L; Liu, Yunlong; Edenberg, Howard J; Econs, Michael J; Foroud, Tatiana; Turner, Charles H

2008-10-08

Hip fracture is the most devastating osteoporotic fracture type with significant morbidity and mortality. Several studies in humans and animal models identified chromosomal regions linked to hip size and bone mass. Previously, we identified that the region of 4q21-q41 on rat chromosome (Chr) 4 harbors multiple femoral neck quantitative trait loci (QTLs) in inbred Fischer 344 (F344) and Lewis (LEW) rats. The purpose of this study is to identify the candidate genes for femoral neck structure and density by correlating gene expression in the proximal femur with the femoral neck phenotypes linked to the QTLs on Chr 4. RNA was extracted from proximal femora of 4-wk-old rats from F344 and LEW strains, and two other strains, Copenhagen 2331 and Dark Agouti, were used as a negative control. Microarray analysis was performed using Affymetrix Rat Genome 230 2.0 arrays. A total of 99 genes in the 4q21-q41 region were differentially expressed (P < 0.05) among all strains of rats with a false discovery rate <10%. These 99 genes were then ranked based on the strength of correlation between femoral neck phenotypes measured in F2 animals, homozygous for a particular strain's allele at the Chr 4 QTL and the expression level of the gene in that strain. A total of 18 candidate genes were strongly correlated (r(2) > 0.50) with femoral neck width and prioritized for further analysis. Quantitative PCR analysis confirmed 14 of 18 of the candidate genes. Ingenuity pathway analysis revealed several direct or indirect relationships among the candidate genes related to angiogenesis (VEGF), bone growth (FGF2), bone formation (IGF2 and IGF2BP3), and resorption (TNF). This study provides a shortened list of genetic determinants of skeletal traits at the hip and may lead to novel approaches for prevention and treatment of hip fracture.

Genomic expression analysis of rat chromosome 4 for skeletal traits at femoral neck

PubMed Central

Alam, Imranul; Sun, Qiwei; Liu, Lixiang; Koller, Daniel L.; Liu, Yunlong; Edenberg, Howard J.; Econs, Michael J.; Foroud, Tatiana; Turner, Charles H.

2008-01-01

Hip fracture is the most devastating osteoporotic fracture type with significant morbidity and mortality. Several studies in humans and animal models identified chromosomal regions linked to hip size and bone mass. Previously, we identified that the region of 4q21-q41 on rat chromosome (Chr) 4 harbors multiple femoral neck quantitative trait loci (QTLs) in inbred Fischer 344 (F344) and Lewis (LEW) rats. The purpose of this study is to identify the candidate genes for femoral neck structure and density by correlating gene expression in the proximal femur with the femoral neck phenotypes linked to the QTLs on Chr 4. RNA was extracted from proximal femora of 4-wk-old rats from F344 and LEW strains, and two other strains, Copenhagen 2331 and Dark Agouti, were used as a negative control. Microarray analysis was performed using Affymetrix Rat Genome 230 2.0 arrays. A total of 99 genes in the 4q21-q41 region were differentially expressed (P < 0.05) among all strains of rats with a false discovery rate <10%. These 99 genes were then ranked based on the strength of correlation between femoral neck phenotypes measured in F2 animals, homozygous for a particular strain's allele at the Chr 4 QTL and the expression level of the gene in that strain. A total of 18 candidate genes were strongly correlated (r2 > 0.50) with femoral neck width and prioritized for further analysis. Quantitative PCR analysis confirmed 14 of 18 of the candidate genes. Ingenuity pathway analysis revealed several direct or indirect relationships among the candidate genes related to angiogenesis (VEGF), bone growth (FGF2), bone formation (IGF2 and IGF2BP3), and resorption (TNF). This study provides a shortened list of genetic determinants of skeletal traits at the hip and may lead to novel approaches for prevention and treatment of hip fracture. PMID:18728226

C2cd3 is required for cilia formation and Hedgehog signaling in mouse

PubMed Central

Hoover, Amber N.; Wynkoop, Aaron; Zeng, Huiqing; Jia, Jinping; Niswander, Lee A.; Liu, Aimin

2011-01-01

Cilia are essential for mammalian embryonic development as well as for the physiological activity of various adult organ systems. Despite the multiple crucial roles that cilia play, the mechanisms underlying ciliogenesis in mammals remain poorly understood. Taking a forward genetic approach, we have identified Hearty (Hty), a recessive lethal mouse mutant with multiple defects, including neural tube defects, abnormal dorsal-ventral patterning of the spinal cord, a defect in left-right axis determination and severe polydactyly (extra digits). By genetic mapping, sequence analysis of candidate genes and characterization of a second mutant allele, we identify Hty as C2cd3, a novel gene encoding a vertebrate-specific C2 domain-containing protein. Target gene expression and double-mutant analyses suggest that C2cd3 is an essential regulator of intracellular transduction of the Hedgehog signal. Furthering a link between Hedgehog signaling and cilia function, we find that cilia formation and proteolytic processing of Gli3 are disrupted in C2cd3 mutants. Finally, we observe C2cd3 protein at the basal body, consistent with its essential function in ciliogenesis. Interestingly, the human ortholog for this gene lies in proximity to the critical regions of Meckel-Gruber syndrome 2 (MKS2) and Joubert syndrome 2 (JBTS2), making it a potential candidate for these two human genetic disorders. PMID:19004860

Integrated analysis of phenome, genome, and transcriptome of hybrid rice uncovered multiple heterosis-related loci for yield increase

PubMed Central

Li, Dayong; Huang, Zhiyuan; Song, Shuhui; Xin, Yeyun; Mao, Donghai; Lv, Qiming; Zhou, Ming; Tian, Dongmei; Tang, Mingfeng; Wu, Qi; Liu, Xue; Chen, Tingting; Song, Xianwei; Fu, Xiqin; Zhao, Bingran; Liang, Chengzhi; Li, Aihong; Liu, Guozhen; Li, Shigui; Hu, Songnian; Cao, Xiaofeng; Yu, Jun; Yuan, Longping; Chen, Caiyan; Zhu, Lihuang

2016-01-01

Hybrid rice is the dominant form of rice planted in China, and its use has extended worldwide since the 1970s. It offers great yield advantages and has contributed greatly to the world’s food security. However, the molecular mechanisms underlying heterosis have remained a mystery. In this study we integrated genetics and omics analyses to determine the candidate genes for yield heterosis in a model two-line rice hybrid system, Liang-you-pei 9 (LYP9) and its parents. Phenomics study revealed that the better parent heterosis (BPH) of yield in hybrid is not ascribed to BPH of all the yield components but is specific to the BPH of spikelet number per panicle (SPP) and paternal parent heterosis (PPH) of effective panicle number (EPN). Genetic analyses then identified multiple quantitative trait loci (QTLs) for these two components. Moreover, a number of differentially expressed genes and alleles in the hybrid were mapped by transcriptome profiling to the QTL regions as possible candidate genes. In parallel, a major QTL for yield heterosis, rice heterosis 8 (RH8), was found to be the DTH8/Ghd8/LHD1 gene. Based on the shared allelic heterozygosity of RH8 in many hybrid rice cultivars, a common mechanism for yield heterosis in the present commercial hybrid rice is proposed. PMID:27663737

Multiple interval QTL mapping and searching for PSTOL1 homologs associated with root morphology, biomass accumulation and phosphorus content in maize seedlings under low-P.

PubMed

Azevedo, Gabriel C; Cheavegatti-Gianotto, Adriana; Negri, Bárbara F; Hufnagel, Bárbara; E Silva, Luciano da Costa; Magalhaes, Jurandir V; Garcia, Antonio Augusto F; Lana, Ubiraci G P; de Sousa, Sylvia M; Guimaraes, Claudia T

2015-07-07

Modifications in root morphology are important strategies to maximize soil exploitation under phosphorus starvation in plants. Here, we used two multiple interval models to map QTLs related to root traits, biomass accumulation and P content in a maize RIL population cultivated in nutrient solution. In addition, we searched for putative maize homologs to PSTOL1, a gene responsible to enhance early root growth, P uptake and grain yield in rice and sorghum. Based on path analysis, root surface area was the root morphology component that most strongly contributed to total dry weight and to P content in maize seedling under low-P availability. Multiple interval mapping models for single (MIM) and multiple traits (MT-MIM) were combined and revealed 13 genomic regions significantly associated with the target traits in a complementary way. The phenotypic variances explained by all QTLs and their epistatic interactions using MT-MIM (23.4 to 35.5 %) were higher than in previous studies, and presented superior statistical power. Some of these QTLs were coincident with QTLs for root morphology traits and grain yield previously mapped, whereas others harbored ZmPSTOL candidate genes, which shared more than 55 % of amino acid sequence identity and a conserved serine/threonine kinase domain with OsPSTOL1. Additionally, four ZmPSTOL candidate genes co-localized with QTLs for root morphology, biomass accumulation and/or P content were preferentially expressed in roots of the parental lines that contributed the alleles enhancing the respective phenotypes. QTL mapping strategies adopted in this study revealed complementary results for single and multiple traits with high accuracy. Some QTLs, mainly the ones that were also associated with yield performance in other studies, can be good targets for marker-assisted selection to improve P-use efficiency in maize. Based on the co-localization with QTLs, the protein domain conservation and the coincidence of gene expression, we selected novel maize genes as putative homologs to PSTOL1 that will require further validation studies.

TargetCompare: A web interface to compare simultaneous miRNAs targets

PubMed Central

Moreira, Fabiano Cordeiro; Dustan, Bruno; Hamoy, Igor G; Ribeiro-dos-Santos, André M; dos Santos, Ândrea Ribeiro

2014-01-01

MicroRNAs (miRNAs) are small non-coding nucleotide sequences between 17 and 25 nucleotides in length that primarily function in the regulation of gene expression. A since miRNA has thousand of predict targets in a complex, regulatory cell signaling network. Therefore, it is of interest to study multiple target genes simultaneously. Hence, we describe a web tool (developed using Java programming language and MySQL database server) to analyse multiple targets of pre-selected miRNAs. We cross validated the tool in eight most highly expressed miRNAs in the antrum region of stomach. This helped to identify 43 potential genes that are target of at least six of the referred miRNAs. The developed tool aims to reduce the randomness and increase the chance of selecting strong candidate target genes and miRNAs responsible for playing important roles in the studied tissue. Availability http://lghm.ufpa.br/targetcompare PMID:25352731

TargetCompare: A web interface to compare simultaneous miRNAs targets.

PubMed

Moreira, Fabiano Cordeiro; Dustan, Bruno; Hamoy, Igor G; Ribeiro-Dos-Santos, André M; Dos Santos, Andrea Ribeiro

2014-01-01

MicroRNAs (miRNAs) are small non-coding nucleotide sequences between 17 and 25 nucleotides in length that primarily function in the regulation of gene expression. A since miRNA has thousand of predict targets in a complex, regulatory cell signaling network. Therefore, it is of interest to study multiple target genes simultaneously. Hence, we describe a web tool (developed using Java programming language and MySQL database server) to analyse multiple targets of pre-selected miRNAs. We cross validated the tool in eight most highly expressed miRNAs in the antrum region of stomach. This helped to identify 43 potential genes that are target of at least six of the referred miRNAs. The developed tool aims to reduce the randomness and increase the chance of selecting strong candidate target genes and miRNAs responsible for playing important roles in the studied tissue. http://lghm.ufpa.br/targetcompare.

SZGR 2.0: a one-stop shop of schizophrenia candidate genes

PubMed Central

Jia, Peilin; Han, Guangchun; Zhao, Junfei; Lu, Pinyi; Zhao, Zhongming

2017-01-01

SZGR 2.0 is a comprehensive resource of candidate variants and genes for schizophrenia, covering genetic, epigenetic, transcriptomic, translational and many other types of evidence. By systematic review and curation of multiple lines of evidence, we included almost all variants and genes that have ever been reported to be associated with schizophrenia. In particular, we collected ∼4200 common variants reported in genome-wide association studies, ∼1000 de novo mutations discovered by large-scale sequencing of family samples, 215 genes spanning rare and replication copy number variations, 99 genes overlapping with linkage regions, 240 differentially expressed genes, 4651 differentially methylated genes and 49 genes as antipsychotic drug targets. To facilitate interpretation, we included various functional annotation data, especially brain eQTL, methylation QTL, brain expression featured in deep categorization of brain areas and developmental stages and brain-specific promoter and enhancer annotations. Furthermore, we conducted cross-study, cross-data type and integrative analyses of the multidimensional data deposited in SZGR 2.0, and made the data and results available through a user-friendly interface. In summary, SZGR 2.0 provides a one-stop shop of schizophrenia variants and genes and their function and regulation, providing an important resource in the schizophrenia and other mental disease community. SZGR 2.0 is available at https://bioinfo.uth.edu/SZGR/. PMID:27733502

Systems genetic analysis of multivariate response to iron deficiency in mice

PubMed Central

Yin, Lina; Unger, Erica L.; Jellen, Leslie C.; Earley, Christopher J.; Allen, Richard P.; Tomaszewicz, Ann; Fleet, James C.

2012-01-01

The aim of this study was to identify genes that influence iron regulation under varying dietary iron availability. Male and female mice from 20+ BXD recombinant inbred strains were fed iron-poor or iron-adequate diets from weaning until 4 mo of age. At death, the spleen, liver, and blood were harvested for the measurement of hemoglobin, hematocrit, total iron binding capacity, transferrin saturation, and liver, spleen and plasma iron concentration. For each measure and diet, we found large, strain-related variability. A principal-components analysis (PCA) was performed on the strain means for the seven parameters under each dietary condition for each sex, followed by quantitative trait loci (QTL) analysis on the factors. Compared with the iron-adequate diet, iron deficiency altered the factor structure of the principal components. QTL analysis, combined with PosMed (a candidate gene searching system) published gene expression data and literature citations, identified seven candidate genes, Ptprd, Mdm1, Picalm, lip1, Tcerg1, Skp2, and Frzb based on PCA factor, diet, and sex. Expression of each of these is cis-regulated, significantly correlated with the corresponding PCA factor, and previously reported to regulate iron, directly or indirectly. We propose that polymorphisms in multiple genes underlie individual differences in iron regulation, especially in response to dietary iron challenge. This research shows that iron management is a highly complex trait, influenced by multiple genes. Systems genetics analysis of iron homeostasis holds promise for developing new methods for prevention and treatment of iron deficiency anemia and related diseases. PMID:22461179

Population structure and its effect on haplotype diversity and linkage disequilibrium surrounding the xa5 locus of rice (Oryza sativa L.).

PubMed Central

Garris, Amanda J; McCouch, Susan R; Kresovich, Stephen

2003-01-01

To assess the usefulness of linkage disequilibrium mapping in an autogamous, domesticated species, we have characterized linkage disequilibrium in the candidate region for xa5, a recessive gene conferring race-specific resistance to bacterial blight in rice. This trait and locus have good mapping information, a tractable phenotype, and available sequence data, but no cloned gene. We sampled 13 short segments from the 70-kb candidate region in 114 accessions of Oryza sativa. Five additional segments were sequenced from the adjacent 45-kb region in resistant accessions to estimate the distance at which linkage disequilibrium decays. The data show significant linkage disequilibrium between sites 100 kb apart. The presence of the xa5 resistant reaction in two ecotypes and in accessions with different haplotypes in the candidate region may indicate multiple origins or genetic heterogeneity for resistance. In addition, genetic differentiation between ecotypes emphasizes the need for controlling for population structure in the design of linkage disequilibrium studies in rice. PMID:14573486

Lung cancer signature biomarkers: tissue specific semantic similarity based clustering of digital differential display (DDD) data.

PubMed

Srivastava, Mousami; Khurana, Pankaj; Sugadev, Ragumani

2012-11-02

The tissue-specific Unigene Sets derived from more than one million expressed sequence tags (ESTs) in the NCBI, GenBank database offers a platform for identifying significantly and differentially expressed tissue-specific genes by in-silico methods. Digital differential display (DDD) rapidly creates transcription profiles based on EST comparisons and numerically calculates, as a fraction of the pool of ESTs, the relative sequence abundance of known and novel genes. However, the process of identifying the most likely tissue for a specific disease in which to search for candidate genes from the pool of differentially expressed genes remains difficult. Therefore, we have used 'Gene Ontology semantic similarity score' to measure the GO similarity between gene products of lung tissue-specific candidate genes from control (normal) and disease (cancer) sets. This semantic similarity score matrix based on hierarchical clustering represents in the form of a dendrogram. The dendrogram cluster stability was assessed by multiple bootstrapping. Multiple bootstrapping also computes a p-value for each cluster and corrects the bias of the bootstrap probability. Subsequent hierarchical clustering by the multiple bootstrapping method (α = 0.95) identified seven clusters. The comparative, as well as subtractive, approach revealed a set of 38 biomarkers comprising four distinct lung cancer signature biomarker clusters (panel 1-4). Further gene enrichment analysis of the four panels revealed that each panel represents a set of lung cancer linked metastasis diagnostic biomarkers (panel 1), chemotherapy/drug resistance biomarkers (panel 2), hypoxia regulated biomarkers (panel 3) and lung extra cellular matrix biomarkers (panel 4). Expression analysis reveals that hypoxia induced lung cancer related biomarkers (panel 3), HIF and its modulating proteins (TGM2, CSNK1A1, CTNNA1, NAMPT/Visfatin, TNFRSF1A, ETS1, SRC-1, FN1, APLP2, DMBT1/SAG, AIB1 and AZIN1) are significantly down regulated. All down regulated genes in this panel were highly up regulated in most other types of cancers. These panels of proteins may represent signature biomarkers for lung cancer and will aid in lung cancer diagnosis and disease monitoring as well as in the prediction of responses to therapeutics.

Genome-wide association study for Crohn's disease in the Quebec Founder Population identifies multiple validated disease loci.

PubMed

Raelson, John V; Little, Randall D; Ruether, Andreas; Fournier, Hélène; Paquin, Bruno; Van Eerdewegh, Paul; Bradley, W E C; Croteau, Pascal; Nguyen-Huu, Quynh; Segal, Jonathan; Debrus, Sophie; Allard, René; Rosenstiel, Philip; Franke, Andre; Jacobs, Gunnar; Nikolaus, Susanna; Vidal, Jean-Michel; Szego, Peter; Laplante, Nathalie; Clark, Hilary F; Paulussen, René J; Hooper, John W; Keith, Tim P; Belouchi, Abdelmajid; Schreiber, Stefan

2007-09-11

Genome-wide association (GWA) studies offer a powerful unbiased method for the identification of multiple susceptibility genes for complex diseases. Here we report the results of a GWA study for Crohn's disease (CD) using family trios from the Quebec Founder Population (QFP). Haplotype-based association analyses identified multiple regions associated with the disease that met the criteria for genome-wide significance, with many containing a gene whose function appears relevant to CD. A proportion of these were replicated in two independent German Caucasian samples, including the established CD loci NOD2 and IBD5. The recently described IL23R locus was also identified and replicated. For this region, multiple individuals with all major haplotypes in the QFP were sequenced and extensive fine mapping performed to identify risk and protective alleles. Several additional loci, including a region on 3p21 containing several plausible candidate genes, a region near JAKMIP1 on 4p16.1, and two larger regions on chromosome 17 were replicated. Together with previously published loci, the spectrum of CD genes identified to date involves biochemical networks that affect epithelial defense mechanisms, innate and adaptive immune response, and the repair or remodeling of tissue.

Signatures of Rapid Evolution in Urban and Rural Transcriptomes of White-Footed Mice (Peromyscus leucopus) in the New York Metropolitan Area

PubMed Central

Harris, Stephen E.; Munshi-South, Jason; Obergfell, Craig; O’Neill, Rachel

2013-01-01

Urbanization is a major cause of ecological degradation around the world, and human settlement in large cities is accelerating. New York City (NYC) is one of the oldest and most urbanized cities in North America, but still maintains 20% vegetation cover and substantial populations of some native wildlife. The white-footed mouse, Peromyscus leucopus , is a common resident of NYC’s forest fragments and an emerging model system for examining the evolutionary consequences of urbanization. In this study, we developed transcriptomic resources for urban P . leucopus to examine evolutionary changes in protein-coding regions for an exemplar “urban adapter.” We used Roche 454 GS FLX+ high throughput sequencing to derive transcriptomes from multiple tissues from individuals across both urban and rural populations. From these data, we identified 31,015 SNPs and several candidate genes potentially experiencing positive selection in urban populations of P . leucopus . These candidate genes are involved in xenobiotic metabolism, innate immune response, demethylation activity, and other important biological phenomena in novel urban environments. This study is one of the first to report candidate genes exhibiting signatures of directional selection in divergent urban ecosystems. PMID:24015321

Genomic convergence to identify candidate genes for Alzheimer disease on chromosome 10

PubMed Central

Liang, Xueying; Slifer, Michael; Martin, Eden R.; Schnetz-Boutaud, Nathalie; Bartlett, Jackie; Anderson, Brent; Züchner, Stephan; Gwirtsman, Harry; Gilbert, John R.; Pericak-Vance, Margaret A.; Haines, Jonathan L.

2009-01-01

A broad region of chromosome 10 (chr10) has engendered continued interest in the etiology of late-onset Alzheimer Disease (LOAD) from both linkage and candidate gene studies. However, there is a very extensive heterogeneity on chr10. We converged linkage analysis and gene expression data using the concept of genomic convergence that suggests that genes showing positive results across multiple different data types are more likely to be involved in AD. We identified and examined 28 genes on chr10 for association with AD in a Caucasian case-control dataset of 506 cases and 558 controls with substantial clinical information. The cases were all LOAD (minimum age at onset ≥ 60 years). Both single marker and haplotypic associations were tested in the overall dataset and 8 subsets defined by age, gender, ApoE and clinical status. PTPLA showed allelic, genotypic and haplotypic association in the overall dataset. SORCS1 was significant in the overall data sets (p=0.0025) and most significant in the female subset (allelic association p=0.00002, a 3-locus haplotype had p=0.0005). Odds Ratio of SORCS1 in the female subset was 1.7 (p<0.0001). SORCS1 is an interesting candidate gene involved in the Aβ pathway. Therefore, genetic variations in PTPLA and SORCS1 may be associated and have modest effect to the risk of AD by affecting Aβ pathway. The replication of the effect of these genes in different study populations and search for susceptible variants and functional studies of these genes are necessary to get a better understanding of the roles of the genes in Alzheimer disease. PMID:19241460

An SNP within the Angiotensin-Converting Enzyme Distinguishes between Sprint and Distance Performing Alaskan Sled Dogs in a Candidate Gene Analysis

PubMed Central

Huson, Heather J.; Byers, Alexandra M.; Runstadler, Jonathan

2011-01-01

The Alaskan sled dog offers a unique mechanism for studying the genetics of elite athletic performance. They are a group of mixed breed dogs, comprised of multiple common breeds, and a unique breed entity seen only as a part of the sled dog mix. Alaskan sled dogs are divided into 2 primary groups as determined by their racing skills. Distance dogs are capable of running over 1000 miles in 10 days, whereas sprint dogs run much shorter distances, approximately 30 miles, but in faster times, that is, 18–25 mph. Finding the genes that distinguish these 2 types of performers is likely to illuminate genetic contributors to human athletic performance. In this study, we tested for association between polymorphisms in 2 candidate genes; angiotensin-converting enzyme (ACE) and myostatin (MSTN) and enhanced speed and endurance performance in 174 Alaskan sled dogs. We observed 81 novel genetic variants within the ACE gene and 4 within the MSTN gene, including a polymorphism within the ACE gene that significantly (P value 2.38 × 10−5) distinguished the sprint versus distance populations. PMID:21846742

The ecological genomic basis of salinity adaptation in Tunisian Medicago truncatula.

PubMed

Friesen, Maren L; von Wettberg, Eric J B; Badri, Mounawer; Moriuchi, Ken S; Barhoumi, Fathi; Chang, Peter L; Cuellar-Ortiz, Sonia; Cordeiro, Matilde A; Vu, Wendy T; Arraouadi, Soumaya; Djébali, Naceur; Zribi, Kais; Badri, Yazid; Porter, Stephanie S; Aouani, Mohammed Elarbi; Cook, Douglas R; Strauss, Sharon Y; Nuzhdin, Sergey V

2014-12-22

As our world becomes warmer, agriculture is increasingly impacted by rising soil salinity and understanding plant adaptation to salt stress can help enable effective crop breeding. Salt tolerance is a complex plant phenotype and we know little about the pathways utilized by naturally tolerant plants. Legumes are important species in agricultural and natural ecosystems, since they engage in symbiotic nitrogen-fixation, but are especially vulnerable to salinity stress. Our studies of the model legume Medicago truncatula in field and greenhouse settings demonstrate that Tunisian populations are locally adapted to saline soils at the metapopulation level and that saline origin genotypes are less impacted by salt than non-saline origin genotypes; these populations thus likely contain adaptively diverged alleles. Whole genome resequencing of 39 wild accessions reveals ongoing migration and candidate genomic regions that assort non-randomly with soil salinity. Consistent with natural selection acting at these sites, saline alleles are typically rare in the range-wide species' gene pool and are also typically derived relative to the sister species M. littoralis. Candidate regions for adaptation contain genes that regulate physiological acclimation to salt stress, such as abscisic acid and jasmonic acid signaling, including a novel salt-tolerance candidate orthologous to the uncharacterized gene AtCIPK21. Unexpectedly, these regions also contain biotic stress genes and flowering time pathway genes. We show that flowering time is differentiated between saline and non-saline populations and may allow salt stress escape. This work nominates multiple potential pathways of adaptation to naturally stressful environments in a model legume. These candidates point to the importance of both tolerance and avoidance in natural legume populations. We have uncovered several promising targets that could be used to breed for enhanced salt tolerance in crop legumes to enhance food security in an era of increasing soil salinization.

Dissecting Vancomycin-Intermediate Resistance in Staphylococcus aureus Using Genome-Wide Association

PubMed Central

Alam, Md Tauqeer; Petit, Robert A.; Crispell, Emily K.; Thornton, Timothy A.; Conneely, Karen N.; Jiang, Yunxuan; Satola, Sarah W.; Read, Timothy D.

2014-01-01

Vancomycin-intermediate Staphylococcus aureus (VISA) is currently defined as having minimal inhibitory concentration (MIC) of 4–8 µg/ml. VISA evolves through changes in multiple genetic loci with at least 16 candidate genes identified in clinical and in vitro-selected VISA strains. We report a whole-genome comparative analysis of 49 vancomycin-sensitive S. aureus and 26 VISA strains. Resistance to vancomycin was determined by broth microdilution, Etest, and population analysis profile-area under the curve (PAP-AUC). Genome-wide association studies (GWAS) of 55,977 single-nucleotide polymorphisms identified in one or more strains found one highly significant association (P = 8.78E-08) between a nonsynonymous mutation at codon 481 (H481) of the rpoB gene and increased vancomycin MIC. Additionally, we used a database of public S. aureus genome sequences to identify rare mutations in candidate genes associated with VISA. On the basis of these data, we proposed a preliminary model called ECM+RMCG for the VISA phenotype as a benchmark for future efforts. The model predicted VISA based on the presence of a rare mutation in a set of candidate genes (walKR, vraSR, graSR, and agrA) and/or three previously experimentally verified mutations (including the rpoB H481 locus) with an accuracy of 81% and a sensitivity of 73%. Further, the level of resistance measured by both Etest and PAP-AUC regressed positively with the number of mutations present in a strain. This study demonstrated 1) the power of GWAS for identifying common genetic variants associated with antibiotic resistance in bacteria and 2) that rare mutations in candidate gene, identified using large genomic data sets, can also be associated with resistance phenotypes. PMID:24787619

Pharmacological Validation of Candidate Causal Sleep Genes Identified in an N2 Cross

PubMed Central

Brunner, Joseph I.; Gotter, Anthony L.; Millstein, Joshua; Garson, Susan; Binns, Jacquelyn; Fox, Steven V.; Savitz, Alan T.; Yang, He S.; Fitzpatrick, Karrie; Zhou, Lili; Owens, Joseph R.; Webber, Andrea L.; Vitaterna, Martha H.; Kasarskis, Andrew; Uebele, Victor N.; Turek, Fred; Renger, John J.; Winrow, Christopher J.

2013-01-01

Despite the substantial impact of sleep disturbances on human health and the many years of study dedicated to understanding sleep pathologies, the underlying genetic mechanisms that govern sleep and wake largely remain unknown. Recently, we completed large scale genetic and gene expression analyses in a segregating inbred mouse cross and identified candidate causal genes that regulate the mammalian sleep-wake cycle, across multiple traits including total sleep time, amounts of REM, non-REM, sleep bout duration and sleep fragmentation. Here we describe a novel approach toward validating candidate causal genes, while also identifying potential targets for sleep-related indications. Select small molecule antagonists and agonists were used to interrogate candidate causal gene function in rodent sleep polysomnography assays to determine impact on overall sleep architecture and to evaluate alignment with associated sleep-wake traits. Significant effects on sleep architecture were observed in validation studies using compounds targeting the muscarinic acetylcholine receptor M3 subunit (Chrm3)(wake promotion), nicotinic acetylcholine receptor alpha4 subunit (Chrna4)(wake promotion), dopamine receptor D5 subunit (Drd5)(sleep induction), serotonin 1D receptor (Htr1d)(altered REM fragmentation), glucagon-like peptide-1 receptor (Glp1r)(light sleep promotion and reduction of deep sleep), and Calcium channel, voltage-dependent, T type, alpha 1I subunit (Cacna1i)(increased bout duration slow wave sleep). Taken together, these results show the complexity of genetic components that regulate sleep-wake traits and highlight the importance of evaluating this complex behavior at a systems level. Pharmacological validation of genetically identified putative targets provides a rapid alternative to generating knock out or transgenic animal models, and may ultimately lead towards new therapeutic opportunities. PMID:22091728

Genome structure drives patterns of gene family evolution in ciliates, a case study using Chilodonella uncinata (Protista, Ciliophora, Phyllopharyngea)

PubMed Central

Gao, Feng; Song, Weibo; Katz, Laura A.

2014-01-01

In most lineages, diversity among gene family members results from gene duplication followed by sequence divergence. Because of the genome rearrangements during the development of somatic nuclei, gene family evolution in ciliates involves more complex processes. Previous work on the ciliate Chilodonella uncinata revealed that macronuclear β-tubulin gene family members are generated by alternative processing, in which germline regions are alternatively used in multiple macronuclear chromosomes. To further study genome evolution in this ciliate, we analyzed its transcriptome and found that: 1) alternative processing is extensive among gene families; and 2) such gene families are likely to be C. uncinata-specific. We characterized additional macronuclear and micronuclear copies of one candidate alternatively processed gene family -- a protein kinase domain containing protein (PKc) -- from two C. uncinata strains. Analysis of the PKc sequences reveals: 1) multiple PKc gene family members in the macronucleus share some identical regions flanked by divergent regions; and 2) the shared identical regions are processed from a single micronuclear chromosome. We discuss analogous processes in lineages across the eukaryotic tree of life to provide further insights on the impact of genome structure on gene family evolution in eukaryotes. PMID:24749903

A combination test for detection of gene-environment interaction in cohort studies.

PubMed

Coombes, Brandon; Basu, Saonli; McGue, Matt

2017-07-01

Identifying gene-environment (G-E) interactions can contribute to a better understanding of disease etiology, which may help researchers develop disease prevention strategies and interventions. One big criticism of studying G-E interaction is the lack of power due to sample size. Studies often restrict the interaction search to the top few hundred hits from a genome-wide association study or focus on potential candidate genes. In this paper, we test interactions between a candidate gene and an environmental factor to improve power by analyzing multiple variants within a gene. We extend recently developed score statistic based genetic association testing approaches to the G-E interaction testing problem. We also propose tests for interaction using gene-based summary measures that pool variants together. Although it has recently been shown that these summary measures can be biased and may lead to inflated type I error, we show that under several realistic scenarios, we can still provide valid tests of interaction. These tests use significantly less degrees of freedom and thus can have much higher power to detect interaction. Additionally, we demonstrate that the iSeq-aSum-min test, which combines a gene-based summary measure test, iSeq-aSum-G, and an interaction-based summary measure test, iSeq-aSum-I, provides a powerful alternative to test G-E interaction. We demonstrate the performance of these approaches using simulation studies and illustrate their performance to study interaction between the SNPs in several candidate genes and family climate environment on alcohol consumption using the Minnesota Center for Twin and Family Research dataset. © 2017 WILEY PERIODICALS, INC.

The prediction of candidate genes for cervix related cancer through gene ontology and graph theoretical approach.

PubMed

Hindumathi, V; Kranthi, T; Rao, S B; Manimaran, P

2014-06-01

With rapidly changing technology, prediction of candidate genes has become an indispensable task in recent years mainly in the field of biological research. The empirical methods for candidate gene prioritization that succors to explore the potential pathway between genetic determinants and complex diseases are highly cumbersome and labor intensive. In such a scenario predicting potential targets for a disease state through in silico approaches are of researcher's interest. The prodigious availability of protein interaction data coupled with gene annotation renders an ease in the accurate determination of disease specific candidate genes. In our work we have prioritized the cervix related cancer candidate genes by employing Csaba Ortutay and his co-workers approach of identifying the candidate genes through graph theoretical centrality measures and gene ontology. With the advantage of the human protein interaction data, cervical cancer gene sets and the ontological terms, we were able to predict 15 novel candidates for cervical carcinogenesis. The disease relevance of the anticipated candidate genes was corroborated through a literature survey. Also the presence of the drugs for these candidates was detected through Therapeutic Target Database (TTD) and DrugMap Central (DMC) which affirms that they may be endowed as potential drug targets for cervical cancer.

A Candidate Gene Association Study of Bone Mineral Density in an Iranian Population.

PubMed

Dastgheib, Seyed Alireza; Gartland, Alison; Tabei, Seyed Mohammad Bagher; Omrani, Gholamhossein Ranjbar; Teare, Marion Dawn

2016-01-01

The genetic epidemiology of variation in bone mineral density (BMD) and osteoporosis is not well studied in Iranian populations and needs more research. We report a candidate gene association study of BMD variation in a healthy cross-sectional study of 501 males and females sampled from the Iranian Multi-Centre Osteoporosis Study, Shiraz, Iran. We selected to study the association with 21 single nucleotide polymorphisms (SNPs) located in the 7 candidate genes LRP5, RANK, RANKL, OPG, P2RX7, VDR , and ESR1 . BMD was measured at the three sites L2-L4, neck of femur, and total hip. Association between BMD and each SNP was assessed using multiple linear regression assuming an allele dose (additive effect) on BMD (adjusted for age and sex). Statistically significant (at the unadjusted 5% level) associations were seen with seven SNPs in five of the candidate genes. Two SNPs showed statistically significant association with more than one BMD site. Significant association was seen between BMD at all the three sites with the VDR SNP rs731246 (L2-L4 p  = 0.038; neck of femur p  = 0.001; and total hip p  < 0.001). The T allele was consistently associated with lower BMD than the C allele. Significant association was also seen for the P2RX7 SNP rs3751143, where the G allele was consistently associated with lower BMD than the T allele (L2-L4 p  = 0.069; neck of femur p  = 0.024; and total hip p  = 0.045).

Tumour gene expression predicts response to cetuximab in patients with KRAS wild-type metastatic colorectal cancer.

PubMed

Baker, J B; Dutta, D; Watson, D; Maddala, T; Munneke, B M; Shak, S; Rowinsky, E K; Xu, L-A; Harbison, C T; Clark, E A; Mauro, D J; Khambata-Ford, S

2011-02-01

Although it is accepted that metastatic colorectal cancers (mCRCs) that carry activating mutations in KRAS are unresponsive to anti-epidermal growth factor receptor (EGFR) monoclonal antibodies, a significant fraction of KRAS wild-type (wt) mCRCs are also unresponsive to anti-EGFR therapy. Genes encoding EGFR ligands amphiregulin (AREG) and epiregulin (EREG) are promising gene expression-based markers but have not been incorporated into a test to dichotomise KRAS wt mCRC patients with respect to sensitivity to anti-EGFR treatment. We used RT-PCR to test 110 candidate gene expression markers in primary tumours from 144 KRAS wt mCRC patients who received monotherapy with the anti-EGFR antibody cetuximab. Results were correlated with multiple clinical endpoints: disease control, objective response, and progression-free survival (PFS). Expression of many of the tested candidate genes, including EREG and AREG, strongly associate with all clinical endpoints. Using multivariate analysis with two-layer five-fold cross-validation, we constructed a four-gene predictive classifier. Strikingly, patients below the classifier cutpoint had PFS and disease control rates similar to those of patients with KRAS mutant mCRC. Gene expression appears to identify KRAS wt mCRC patients who receive little benefit from cetuximab. It will be important to test this model in an independent validation study.

Identification of cancer genes that are independent of dominant proliferation and lineage programs

PubMed Central

Selfors, Laura M.; Stover, Daniel G.; Harris, Isaac S.; Brugge, Joan S.; Coloff, Jonathan L.

2017-01-01

Large, multidimensional cancer datasets provide a resource that can be mined to identify candidate therapeutic targets for specific subgroups of tumors. Here, we analyzed human breast cancer data to identify transcriptional programs associated with tumors bearing specific genetic driver alterations. Using an unbiased approach, we identified thousands of genes whose expression was enriched in tumors with specific genetic alterations. However, expression of the vast majority of these genes was not enriched if associations were analyzed within individual breast tumor molecular subtypes, across multiple tumor types, or after gene expression was normalized to account for differences in proliferation or tumor lineage. Together with linear modeling results, these findings suggest that most transcriptional programs associated with specific genetic alterations in oncogenes and tumor suppressors are highly context-dependent and are predominantly linked to differences in proliferation programs between distinct breast cancer subtypes. We demonstrate that such proliferation-dependent gene expression dominates tumor transcriptional programs relative to matched normal tissues. However, we also identified a relatively small group of cancer-associated genes that are both proliferation- and lineage-independent. A subset of these genes are attractive candidate targets for combination therapy because they are essential in breast cancer cell lines, druggable, enriched in stem-like breast cancer cells, and resistant to chemotherapy-induced down-regulation. PMID:29229826

Derived variants at six genes explain nearly half of size reduction in dog breeds.

PubMed

Rimbault, Maud; Beale, Holly C; Schoenebeck, Jeffrey J; Hoopes, Barbara C; Allen, Jeremy J; Kilroy-Glynn, Paul; Wayne, Robert K; Sutter, Nathan B; Ostrander, Elaine A

2013-12-01

Selective breeding of dogs by humans has generated extraordinary diversity in body size. A number of multibreed analyses have been undertaken to identify the genetic basis of this diversity. We analyzed four loci discovered in a previous genome-wide association study that used 60,968 SNPs to identify size-associated genomic intervals, which were too large to assign causative roles to genes. First, we performed fine-mapping to define critical intervals that included the candidate genes GHR, HMGA2, SMAD2, and STC2, identifying five highly associated markers at the four loci. We hypothesize that three of the variants are likely to be causative. We then genotyped each marker, together with previously reported size-associated variants in the IGF1 and IGF1R genes, on a panel of 500 domestic dogs from 93 breeds, and identified the ancestral allele by genotyping the same markers on 30 wild canids. We observed that the derived alleles at all markers correlated with reduced body size, and smaller dogs are more likely to carry derived alleles at multiple markers. However, breeds are not generally fixed at all markers; multiple combinations of genotypes are found within most breeds. Finally, we show that 46%-52.5% of the variance in body size of dog breeds can be explained by seven markers in proximity to exceptional candidate genes. Among breeds with standard weights <41 kg (90 lb), the genotypes accounted for 64.3% of variance in weight. This work advances our understanding of mammalian growth by describing genetic contributions to canine size determination in non-giant dog breeds.

Cumulative Genetic Risk Predicts Platinum/Taxane-Induced Neurotoxicity

PubMed Central

McWhinney-Glass, Sarah; Winham, Stacey J.; Hertz, Daniel L.; Revollo, Jane Yen; Paul, Jim; He, Yijing; Brown, Robert; Motsinger-Reif, Alison A.; McLeod, Howard L.

2013-01-01

Purpose The combination of a platinum and taxane are standard of care for many cancers, but the utility is often limited due to debilitating neurotoxicity. We examined whether single nucleotide polymorphisms (SNPs) from annotated candidate genes will identify genetic risk for chemotherapy-induced neurotoxicity. Patients and Methods A candidate-gene association study was conducted to validate the relevance of 1261 SNPs within 60 candidate genes in 404 ovarian cancer patients receiving platinum/taxane chemotherapy on the SCOTROC1 trial. Statistically significant variants were then assessed for replication in a separate 404 patient replication cohort from SCOTROC1. Results Significant associations with chemotherapy-induced neurotoxicity were identified and replicated for four SNPs in SOX10, BCL2, OPRM1, and TRPV1. The Population Attributable Risk for each of the four SNPs ranged from 5–35%, with a cumulative risk of 62%. According to the multiplicative model, the odds of developing neurotoxicity increase by a factor of 1.64 for every risk genotype. Patients possessing 3 risk variants have an estimated odds ratio of 4.49 (2.36–8.54) compared to individuals with 0 risk variants. Neither the four SNPs nor the risk score were associated with progression free survival or overall survival. Conclusions This study demonstrates that SNPs in four genes have a significant cumulative association with increased risk for the development of chemotherapy-induced neurotoxicity, independent of patient survival. PMID:23963862

Transcriptional mechanisms of resistance to anti-PD-1 therapy

PubMed Central

Ascierto, Maria L.; Makohon-Moore, Alvin; Lipson, Evan J.; Taube, Janis M.; McMiller, Tracee L.; Berger, Alan E.; Fan, Jinshui; Kaunitz, Genevieve J.; Cottrell, Tricia R.; Kohutek, Zachary A.; Favorov, Alexander; Makarov, Vladimir; Riaz, Nadeem; Chan, Timothy A.; Cope, Leslie; Hruban, Ralph H.; Pardoll, Drew M.; Taylor, Barry S.; Solit, David B.; Iacobuzio-Donahue, Christine A; Topalian, Suzanne L.

2017-01-01

Purpose To explore factors associated with response and resistance to anti-PD-1 therapy, we analyzed multiple disease sites at autopsy in a patient with widely metastatic melanoma who had a heterogeneous response. Materials and Methods Twenty-six melanoma specimens (four pre-mortem, 22 post-mortem) were subjected to whole-exome sequencing. Candidate immunologic markers and gene expression were assessed in ten cutaneous metastases showing response or progression during therapy. Results The melanoma was driven by biallelic inactivation of NF1. All lesions had highly concordant mutational profiles and copy number alterations, indicating linear clonal evolution. Expression of candidate immunologic markers was similar in responding and progressing lesions. However, progressing cutaneous metastases were associated with over-expression of genes associated with extracellular matrix and neutrophil function. Conclusions Although mutational and immunologic differences have been proposed as the primary determinants of heterogeneous response/resistance to targeted therapies and immunotherapies, respectively, differential lesional gene expression profiles may also dictate anti-PD-1 outcomes. PMID:28193624

Circadian expression profiles of chromatin remodeling factor genes in Arabidopsis.

PubMed

Lee, Hong Gil; Lee, Kyounghee; Jang, Kiyoung; Seo, Pil Joon

2015-01-01

The circadian clock is a biological time keeper mechanism that regulates biological rhythms to a period of approximately 24 h. The circadian clock enables organisms to anticipate environmental cycles and coordinates internal cellular physiology with external environmental cues. In plants, correct matching of the clock with the environment confers fitness advantages to plant survival and reproduction. Therefore, circadian clock components are regulated at multiple layers to fine-tune the circadian oscillation. Epigenetic regulation provides an additional layer of circadian control. However, little is known about which chromatin remodeling factors are responsible for circadian control. In this work, we analyzed circadian expression of 109 chromatin remodeling factor genes and identified 17 genes that display circadian oscillation. In addition, we also found that a candidate interacts with a core clock component, supporting that clock activity is regulated in part by chromatin modification. As an initial attempt to elucidate the relationship between chromatin modification and circadian oscillation, we identified novel regulatory candidates that provide a platform for future investigations of chromatin regulation of the circadian clock.

Ensemble positive unlabeled learning for disease gene identification.

PubMed

Yang, Peng; Li, Xiaoli; Chua, Hon-Nian; Kwoh, Chee-Keong; Ng, See-Kiong

2014-01-01

An increasing number of genes have been experimentally confirmed in recent years as causative genes to various human diseases. The newly available knowledge can be exploited by machine learning methods to discover additional unknown genes that are likely to be associated with diseases. In particular, positive unlabeled learning (PU learning) methods, which require only a positive training set P (confirmed disease genes) and an unlabeled set U (the unknown candidate genes) instead of a negative training set N, have been shown to be effective in uncovering new disease genes in the current scenario. Using only a single source of data for prediction can be susceptible to bias due to incompleteness and noise in the genomic data and a single machine learning predictor prone to bias caused by inherent limitations of individual methods. In this paper, we propose an effective PU learning framework that integrates multiple biological data sources and an ensemble of powerful machine learning classifiers for disease gene identification. Our proposed method integrates data from multiple biological sources for training PU learning classifiers. A novel ensemble-based PU learning method EPU is then used to integrate multiple PU learning classifiers to achieve accurate and robust disease gene predictions. Our evaluation experiments across six disease groups showed that EPU achieved significantly better results compared with various state-of-the-art prediction methods as well as ensemble learning classifiers. Through integrating multiple biological data sources for training and the outputs of an ensemble of PU learning classifiers for prediction, we are able to minimize the potential bias and errors in individual data sources and machine learning algorithms to achieve more accurate and robust disease gene predictions. In the future, our EPU method provides an effective framework to integrate the additional biological and computational resources for better disease gene predictions.

Genes uniquely expressed in human growth plate chondrocytes uncover a distinct regulatory network.

PubMed

Li, Bing; Balasubramanian, Karthika; Krakow, Deborah; Cohn, Daniel H

2017-12-20

Chondrogenesis is the earliest stage of skeletal development and is a highly dynamic process, integrating the activities and functions of transcription factors, cell signaling molecules and extracellular matrix proteins. The molecular mechanisms underlying chondrogenesis have been extensively studied and multiple key regulators of this process have been identified. However, a genome-wide overview of the gene regulatory network in chondrogenesis has not been achieved. In this study, employing RNA sequencing, we identified 332 protein coding genes and 34 long non-coding RNA (lncRNA) genes that are highly selectively expressed in human fetal growth plate chondrocytes. Among the protein coding genes, 32 genes were associated with 62 distinct human skeletal disorders and 153 genes were associated with skeletal defects in knockout mice, confirming their essential roles in skeletal formation. These gene products formed a comprehensive physical interaction network and participated in multiple cellular processes regulating skeletal development. The data also revealed 34 transcription factors and 11,334 distal enhancers that were uniquely active in chondrocytes, functioning as transcriptional regulators for the cartilage-selective genes. Our findings revealed a complex gene regulatory network controlling skeletal development whereby transcription factors, enhancers and lncRNAs participate in chondrogenesis by transcriptional regulation of key genes. Additionally, the cartilage-selective genes represent candidate genes for unsolved human skeletal disorders.

Methylation analysis of plasma cell-free DNA for breast cancer early detection using bisulfite next-generation sequencing.

PubMed

Li, Zibo; Guo, Xinwu; Tang, Lili; Peng, Limin; Chen, Ming; Luo, Xipeng; Wang, Shouman; Xiao, Zhi; Deng, Zhongping; Dai, Lizhong; Xia, Kun; Wang, Jun

2016-10-01

Circulating cell-free DNA (cfDNA) has been considered as a potential biomarker for non-invasive cancer detection. To evaluate the methylation levels of six candidate genes (EGFR, GREM1, PDGFRB, PPM1E, SOX17, and WRN) in plasma cfDNA as biomarkers for breast cancer early detection, quantitative analysis of the promoter methylation of these genes from 86 breast cancer patients and 67 healthy controls was performed by using microfluidic-PCR-based target enrichment and next-generation bisulfite sequencing technology. The predictive performance of different logistic models based on methylation status of candidate genes was investigated by means of the area under the ROC curve (AUC) and odds ratio (OR) analysis. Results revealed that EGFR, PPM1E, and 8 gene-specific CpG sites showed significantly hypermethylation in cancer patients' plasma and significantly associated with breast cancer (OR ranging from 2.51 to 9.88). The AUC values for these biomarkers were ranging from 0.66 to 0.75. Combinations of multiple hypermethylated genes or CpG sites substantially improved the predictive performance for breast cancer detection. Our study demonstrated the feasibility of quantitative measurement of candidate gene methylation in cfDNA by using microfluidic-PCR-based target enrichment and bisulfite next-generation sequencing, which is worthy of further validation and potentially benefits a broad range of applications in clinical oncology practice. Quantitative analysis of methylation pattern of plasma cfDNA by next-generation sequencing might be a valuable non-invasive tool for early detection of breast cancer.

Genome-wide association study discovered genetic variation and candidate genes of fibre quality traits in Gossypium hirsutum L.

PubMed

Sun, Zhengwen; Wang, Xingfen; Liu, Zhengwen; Gu, Qishen; Zhang, Yan; Li, Zhikun; Ke, Huifeng; Yang, Jun; Wu, Jinhua; Wu, Liqiang; Zhang, Guiyin; Zhang, Caiying; Ma, Zhiying

2017-08-01

Genetic improvement of fibre quality is one of the main breeding goals for the upland cotton, Gossypium hirsutum, but there are difficulties with precise selection of traits. Therefore, it is important to improve the understanding of the genetic basis of phenotypic variation. In this study, we conducted phenotyping and genetic variation analyses of 719 diverse accessions of upland cotton based on multiple environment tests and a recently developed Cotton 63K Illumina Infinium SNP array and performed a genome-wide association study (GWAS) of fibre quality traits. A total of 10 511 polymorphic SNPs distributed in 26 chromosomes were screened across the cotton germplasms, and forty-six significant SNPs associated with five fibre quality traits were detected. These significant SNPs were scattered over 15 chromosomes and were involved in 612 unique candidate genes, many related to polysaccharide biosynthesis, signal transduction and protein translocation. Two major haplotypes for fibre length and strength were identified on chromosomes Dt11 and At07. Furthermore, by combining GWAS and transcriptome analysis, we identified 163 and 120 fibre developmental genes related to length and strength, respectively, of which a number of novel genes and 19 promising genes were screened. These results provide new insight into the genetic basis of fibre quality in G. hirsutum and provide candidate SNPs and genes to accelerate the improvement of upland cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Landscape genomic analysis of candidate genes for climate adaptation in a California endemic oak, Quercus lobata.

PubMed

Sork, Victoria L; Squire, Kevin; Gugger, Paul F; Steele, Stephanie E; Levy, Eric D; Eckert, Andrew J

2016-01-01

The ability of California tree populations to survive anthropogenic climate change will be shaped by the geographic structure of adaptive genetic variation. Our goal is to test whether climate-associated candidate genes show evidence of spatially divergent selection in natural populations of valley oak, Quercus lobata, as preliminary indication of local adaptation. Using DNA from 45 individuals from 13 localities across the species' range, we sequenced portions of 40 candidate genes related to budburst/flowering, growth, osmotic stress, and temperature stress. Using 195 single nucleotide polymorphisms (SNPs), we estimated genetic differentiation across populations and correlated allele frequencies with climate gradients using single-locus and multivariate models. The top 5% of FST estimates ranged from 0.25 to 0.68, yielding loci potentially under spatially divergent selection. Environmental analyses of SNP frequencies with climate gradients revealed three significantly correlated SNPs within budburst/flowering genes and two SNPs within temperature stress genes with mean annual precipitation, after controlling for multiple testing. A redundancy model showed a significant association between SNPs and climate variables and revealed a similar set of SNPs with high loadings on the first axis. In the RDA, climate accounted for 67% of the explained variation, when holding climate constant, in contrast to a putatively neutral SSR data set where climate accounted for only 33%. Population differentiation and geographic gradients of allele frequencies in climate-associated functional genes in Q. lobata provide initial evidence of adaptive genetic variation and background for predicting population response to climate change. © 2016 Botanical Society of America.

Protocadherin α (PCDHA) as a novel susceptibility gene for autism

PubMed Central

Anitha, Ayyappan; Thanseem, Ismail; Nakamura, Kazuhiko; Yamada, Kazuo; Iwayama, Yoshimi; Toyota, Tomoko; Iwata, Yasuhide; Suzuki, Katsuaki; Sugiyama, Toshiro; Tsujii, Masatsugu; Yoshikawa, Takeo; Mori, Norio

2013-01-01

Background Synaptic dysfunction has been shown to be involved in the pathogenesis of autism. We hypothesized that the protocadherin α gene cluster (PCDHA), which is involved in synaptic specificity and in serotonergic innervation of the brain, could be a suitable candidate gene for autism. Methods We examined 14 PCDHA single nucleotide polymorphisms (SNPs) for genetic association with autism in DNA samples of 3211 individuals (841 families, including 574 multiplex families) obtained from the Autism Genetic Resource Exchange. Results Five SNPs (rs251379, rs1119032, rs17119271, rs155806 and rs17119346) showed significant associations with autism. The strongest association (p < 0.001) was observed for rs1119032 (z score of risk allele G = 3.415) in multiplex families; SNP associations withstand multiple testing correction in multiplex families (p = 0.041). Haplotypes involving rs1119032 showed very strong associations with autism, withstanding multiple testing corrections. In quantitative transmission disequilibrium testing of multiplex families, the G allele of rs1119032 showed a significant association (p = 0.033) with scores on the Autism Diagnostic Interview–Revised (ADI-R)_D (early developmental abnormalities). We also found a significant difference in the distribution of ADI-R_A (social interaction) scores between the A/A, A/G and G/G genotypes of rs17119346 (p = 0.002). Limitations Our results should be replicated in an independent population and/or in samples of different racial backgrounds. Conclusion Our study provides strong genetic evidence of PCDHA as a potential candidate gene for autism. PMID:23031252

SZGR 2.0: a one-stop shop of schizophrenia candidate genes.

PubMed

Jia, Peilin; Han, Guangchun; Zhao, Junfei; Lu, Pinyi; Zhao, Zhongming

2017-01-04

SZGR 2.0 is a comprehensive resource of candidate variants and genes for schizophrenia, covering genetic, epigenetic, transcriptomic, translational and many other types of evidence. By systematic review and curation of multiple lines of evidence, we included almost all variants and genes that have ever been reported to be associated with schizophrenia. In particular, we collected ∼4200 common variants reported in genome-wide association studies, ∼1000 de novo mutations discovered by large-scale sequencing of family samples, 215 genes spanning rare and replication copy number variations, 99 genes overlapping with linkage regions, 240 differentially expressed genes, 4651 differentially methylated genes and 49 genes as antipsychotic drug targets. To facilitate interpretation, we included various functional annotation data, especially brain eQTL, methylation QTL, brain expression featured in deep categorization of brain areas and developmental stages and brain-specific promoter and enhancer annotations. Furthermore, we conducted cross-study, cross-data type and integrative analyses of the multidimensional data deposited in SZGR 2.0, and made the data and results available through a user-friendly interface. In summary, SZGR 2.0 provides a one-stop shop of schizophrenia variants and genes and their function and regulation, providing an important resource in the schizophrenia and other mental disease community. SZGR 2.0 is available at https://bioinfo.uth.edu/SZGR/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

A microarray analysis of potential genes underlying the neurosensitivity of mice to propofol.

PubMed

Lowes, Damon A; Galley, Helen F; Lowe, Peter R; Rikke, Brad A; Johnson, Thomas E; Webster, Nigel R

2005-09-01

Establishing the mechanism of action of general anesthetics at the molecular level is difficult because of the multiple targets with which these drugs are associated. Inbred short sleep (ISS) and long sleep (ILS) mice are differentially sensitive in response to ethanol and other sedative hypnotics and contain a single quantitative trait locus (Lorp1) that accounts for the genetic variance of loss-of-righting reflex in response to propofol (LORP). In this study, we used high-density oligonucleotide microarrays to identify global gene expression and candidate genes differentially expressed within the Lorp1 region that may give insight into the molecular mechanism underlying LORP. Microarray analysis was performed using Affymetrix MG-U74Av2 Genechips and a selection of differentially expressed genes was confirmed by semiquantitative reverse transcription-polymerase chain reaction. Global expression in the brains of ILS and ISS mice revealed 3423 genes that were significantly expressed, of which 139 (4%) were differentially expressed. Analysis of genes located within the Lorp1 region showed that 26 genes were significantly expressed and that just 2 genes (7%) were differentially expressed. These genes encoded for the proteins AWP1 (associated with protein kinase 1) and "BTB (POZ) domain containing 1," whose functions are largely uncharacterized. Genes differentially expressed outside Lorp1 included seven genes with previously characterized neuronal functions and thus stand out as additional candidate genes that may be involved in mediating the neurosensitivity differences between ISS and ILS.

Prdm9 controls activation of mammalian recombination hotspots.

PubMed

Parvanov, Emil D; Petkov, Petko M; Paigen, Kenneth

2010-02-12

Mammalian meiotic recombination, which preferentially occurs at specialized sites called hotspots, ensures the orderly segregation of meiotic chromosomes and creates genetic variation among offspring. A locus on mouse chromosome 17, which controls activation of recombination at multiple distant hotspots, has been mapped within a 181-kilobase interval, three of whose genes can be eliminated as candidates. The remaining gene, Prdm9, codes for a zinc finger containing histone H3K4 trimethylase that is expressed in early meiosis and whose deficiency results in sterility in both sexes. Mus musculus exhibits five alleles of Prdm9; human populations exhibit two predominant alleles and multiple minor alleles. The identification of Prdm9 as a protein regulating mammalian recombination hotspots initiates molecular studies of this important biological control system.

No Evidence That Schizophrenia Candidate Genes Are More Associated With Schizophrenia Than Noncandidate Genes.

PubMed

Johnson, Emma C; Border, Richard; Melroy-Greif, Whitney E; de Leeuw, Christiaan A; Ehringer, Marissa A; Keller, Matthew C

2017-11-15

A recent analysis of 25 historical candidate gene polymorphisms for schizophrenia in the largest genome-wide association study conducted to date suggested that these commonly studied variants were no more associated with the disorder than would be expected by chance. However, the same study identified other variants within those candidate genes that demonstrated genome-wide significant associations with schizophrenia. As such, it is possible that variants within historic schizophrenia candidate genes are associated with schizophrenia at levels above those expected by chance, even if the most-studied specific polymorphisms are not. The present study used association statistics from the largest schizophrenia genome-wide association study conducted to date as input to a gene set analysis to investigate whether variants within schizophrenia candidate genes are enriched for association with schizophrenia. As a group, variants in the most-studied candidate genes were no more associated with schizophrenia than were variants in control sets of noncandidate genes. While a small subset of candidate genes did appear to be significantly associated with schizophrenia, these genes were not particularly noteworthy given the large number of more strongly associated noncandidate genes. The history of schizophrenia research should serve as a cautionary tale to candidate gene investigators examining other phenotypes: our findings indicate that the most investigated candidate gene hypotheses of schizophrenia are not well supported by genome-wide association studies, and it is likely that this will be the case for other complex traits as well. Copyright © 2017 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Combined serial analysis of gene expression and transcription factor binding site prediction identifies novel-candidate-target genes of Nr2e1 in neocortex development.

PubMed

Schmouth, Jean-François; Arenillas, David; Corso-Díaz, Ximena; Xie, Yuan-Yun; Bohacec, Slavita; Banks, Kathleen G; Bonaguro, Russell J; Wong, Siaw H; Jones, Steven J M; Marra, Marco A; Simpson, Elizabeth M; Wasserman, Wyeth W

2015-07-24

Nr2e1 (nuclear receptor subfamily 2, group e, member 1) encodes a transcription factor important in neocortex development. Previous work has shown that nuclear receptors can have hundreds of target genes, and bind more than 300 co-interacting proteins. However, recognition of the critical role of Nr2e1 in neural stem cells and neocortex development is relatively recent, thus the molecular mechanisms involved for this nuclear receptor are only beginning to be understood. Serial analysis of gene expression (SAGE), has given researchers both qualitative and quantitative information pertaining to biological processes. Thus, in this work, six LongSAGE mouse libraries were generated from laser microdissected tissue samples of dorsal VZ/SVZ (ventricular zone and subventricular zone) from the telencephalon of wild-type (Wt) and Nr2e1-null embryos at the critical development ages E13.5, E15.5, and E17.5. We then used a novel approach, implementing multiple computational methods followed by biological validation to further our understanding of Nr2e1 in neocortex development. In this work, we have generated a list of 1279 genes that are differentially expressed in response to altered Nr2e1 expression during in vivo neocortex development. We have refined this list to 64 candidate direct-targets of NR2E1. Our data suggested distinct roles for Nr2e1 during different neocortex developmental stages. Most importantly, our results suggest a possible novel pathway by which Nr2e1 regulates neurogenesis, which includes Lhx2 as one of the candidate direct-target genes, and SOX9 as a co-interactor. In conclusion, we have provided new candidate interacting partners and numerous well-developed testable hypotheses for understanding the pathways by which Nr2e1 functions to regulate neocortex development.

Phenome-driven disease genetics prediction toward drug discovery.

PubMed

Chen, Yang; Li, Li; Zhang, Guo-Qiang; Xu, Rong

2015-06-15

Discerning genetic contributions to diseases not only enhances our understanding of disease mechanisms, but also leads to translational opportunities for drug discovery. Recent computational approaches incorporate disease phenotypic similarities to improve the prediction power of disease gene discovery. However, most current studies used only one data source of human disease phenotype. We present an innovative and generic strategy for combining multiple different data sources of human disease phenotype and predicting disease-associated genes from integrated phenotypic and genomic data. To demonstrate our approach, we explored a new phenotype database from biomedical ontologies and constructed Disease Manifestation Network (DMN). We combined DMN with mimMiner, which was a widely used phenotype database in disease gene prediction studies. Our approach achieved significantly improved performance over a baseline method, which used only one phenotype data source. In the leave-one-out cross-validation and de novo gene prediction analysis, our approach achieved the area under the curves of 90.7% and 90.3%, which are significantly higher than 84.2% (P < e(-4)) and 81.3% (P < e(-12)) for the baseline approach. We further demonstrated that our predicted genes have the translational potential in drug discovery. We used Crohn's disease as an example and ranked the candidate drugs based on the rank of drug targets. Our gene prediction approach prioritized druggable genes that are likely to be associated with Crohn's disease pathogenesis, and our rank of candidate drugs successfully prioritized the Food and Drug Administration-approved drugs for Crohn's disease. We also found literature evidence to support a number of drugs among the top 200 candidates. In summary, we demonstrated that a novel strategy combining unique disease phenotype data with system approaches can lead to rapid drug discovery. nlp. edu/public/data/DMN © The Author 2015. Published by Oxford University Press.

Network-Based Identification and Prioritization of Key Regulators of Coronary Artery Disease Loci

PubMed Central

Zhao, Yuqi; Chen, Jing; Freudenberg, Johannes M.; Meng, Qingying; Rajpal, Deepak K.; Yang, Xia

2017-01-01

Objective Recent genome-wide association studies of coronary artery disease (CAD) have revealed 58 genome-wide significant and 148 suggestive genetic loci. However, the molecular mechanisms through which they contribute to CAD and the clinical implications of these findings remain largely unknown. We aim to retrieve gene subnetworks of the 206 CAD loci and identify and prioritize candidate regulators to better understand the biological mechanisms underlying the genetic associations. Approach and Results We devised a new integrative genomics approach that incorporated (1) candidate genes from the top CAD loci, (2) the complete genetic association results from the 1000 genomes-based CAD genome-wide association studies from the Coronary Artery Disease Genome Wide Replication and Meta-Analysis Plus the Coronary Artery Disease consortium, (3) tissue-specific gene regulatory networks that depict the potential relationship and interactions between genes, and (4) tissue-specific gene expression patterns between CAD patients and controls. The networks and top-ranked regulators according to these data-driven criteria were further queried against literature, experimental evidence, and drug information to evaluate their disease relevance and potential as drug targets. Our analysis uncovered several potential novel regulators of CAD such as LUM and STAT3, which possess properties suitable as drug targets. We also revealed molecular relations and potential mechanisms through which the top CAD loci operate. Furthermore, we found that multiple CAD-relevant biological processes such as extracellular matrix, inflammatory and immune pathways, complement and coagulation cascades, and lipid metabolism interact in the CAD networks. Conclusions Our data-driven integrative genomics framework unraveled tissue-specific relations among the candidate genes of the CAD genome-wide association studies loci and prioritized novel network regulatory genes orchestrating biological processes relevant to CAD. PMID:26966275

Single and multiple phenotype QTL analyses of downy mildew resistance in interspecific grapevines.

PubMed

Divilov, Konstantin; Barba, Paola; Cadle-Davidson, Lance; Reisch, Bruce I

2018-05-01

Downy mildew resistance across days post-inoculation, experiments, and years in two interspecific grapevine F 1 families was investigated using linear mixed models and Bayesian networks, and five new QTL were identified. Breeding grapevines for downy mildew disease resistance has traditionally relied on qualitative gene resistance, which can be overcome by pathogen evolution. Analyzing two interspecific F 1 families, both having ancestry derived from Vitis vinifera and wild North American Vitis species, across 2 years and multiple experiments, we found multiple loci associated with downy mildew sporulation and hypersensitive response in both families using a single phenotype model. The loci explained between 7 and 17% of the variance for either phenotype, suggesting a complex genetic architecture for these traits in the two families studied. For two loci, we used RNA-Seq to detect differentially transcribed genes and found that the candidate genes at these loci were likely not NBS-LRR genes. Additionally, using a multiple phenotype Bayesian network analysis, we found effects between the leaf trichome density, hypersensitive response, and sporulation phenotypes. Moderate-high heritabilities were found for all three phenotypes, suggesting that selection for downy mildew resistance is an achievable goal by breeding for either physical- or non-physical-based resistance mechanisms, with the combination of the two possibly providing durable resistance.

Refined mapping of autoimmune disease associated genetic variants with gene expression suggests an important role for non-coding RNAs.

PubMed

Ricaño-Ponce, Isis; Zhernakova, Daria V; Deelen, Patrick; Luo, Oscar; Li, Xingwang; Isaacs, Aaron; Karjalainen, Juha; Di Tommaso, Jennifer; Borek, Zuzanna Agnieszka; Zorro, Maria M; Gutierrez-Achury, Javier; Uitterlinden, Andre G; Hofman, Albert; van Meurs, Joyce; Netea, Mihai G; Jonkers, Iris H; Withoff, Sebo; van Duijn, Cornelia M; Li, Yang; Ruan, Yijun; Franke, Lude; Wijmenga, Cisca; Kumar, Vinod

2016-04-01

Genome-wide association and fine-mapping studies in 14 autoimmune diseases (AID) have implicated more than 250 loci in one or more of these diseases. As more than 90% of AID-associated SNPs are intergenic or intronic, pinpointing the causal genes is challenging. We performed a systematic analysis to link 460 SNPs that are associated with 14 AID to causal genes using transcriptomic data from 629 blood samples. We were able to link 71 (39%) of the AID-SNPs to two or more nearby genes, providing evidence that for part of the AID loci multiple causal genes exist. While 54 of the AID loci are shared by one or more AID, 17% of them do not share candidate causal genes. In addition to finding novel genes such as ULK3, we also implicate novel disease mechanisms and pathways like autophagy in celiac disease pathogenesis. Furthermore, 42 of the AID SNPs specifically affected the expression of 53 non-coding RNA genes. To further understand how the non-coding genome contributes to AID, the SNPs were linked to functional regulatory elements, which suggest a model where AID genes are regulated by network of chromatin looping/non-coding RNAs interactions. The looping model also explains how a causal candidate gene is not necessarily the gene closest to the AID SNP, which was the case in nearly 50% of cases. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Sporulation genes associated with sporulation efficiency in natural isolates of yeast.

PubMed

Tomar, Parul; Bhatia, Aatish; Ramdas, Shweta; Diao, Liyang; Bhanot, Gyan; Sinha, Himanshu

2013-01-01

Yeast sporulation efficiency is a quantitative trait and is known to vary among experimental populations and natural isolates. Some studies have uncovered the genetic basis of this variation and have identified the role of sporulation genes (IME1, RME1) and sporulation-associated genes (FKH2, PMS1, RAS2, RSF1, SWS2), as well as non-sporulation pathway genes (MKT1, TAO3) in maintaining this variation. However, these studies have been done mostly in experimental populations. Sporulation is a response to nutrient deprivation. Unlike laboratory strains, natural isolates have likely undergone multiple selections for quick adaptation to varying nutrient conditions. As a result, sporulation efficiency in natural isolates may have different genetic factors contributing to phenotypic variation. Using Saccharomyces cerevisiae strains in the genetically and environmentally diverse SGRP collection, we have identified genetic loci associated with sporulation efficiency variation in a set of sporulation and sporulation-associated genes. Using two independent methods for association mapping and correcting for population structure biases, our analysis identified two linked clusters containing 4 non-synonymous mutations in genes - HOS4, MCK1, SET3, and SPO74. Five regulatory polymorphisms in five genes such as MLS1 and CDC10 were also identified as putative candidates. Our results provide candidate genes contributing to phenotypic variation in the sporulation efficiency of natural isolates of yeast.

Sporulation Genes Associated with Sporulation Efficiency in Natural Isolates of Yeast

PubMed Central

Ramdas, Shweta; Diao, Liyang; Bhanot, Gyan; Sinha, Himanshu

2013-01-01

Yeast sporulation efficiency is a quantitative trait and is known to vary among experimental populations and natural isolates. Some studies have uncovered the genetic basis of this variation and have identified the role of sporulation genes (IME1, RME1) and sporulation-associated genes (FKH2, PMS1, RAS2, RSF1, SWS2), as well as non-sporulation pathway genes (MKT1, TAO3) in maintaining this variation. However, these studies have been done mostly in experimental populations. Sporulation is a response to nutrient deprivation. Unlike laboratory strains, natural isolates have likely undergone multiple selections for quick adaptation to varying nutrient conditions. As a result, sporulation efficiency in natural isolates may have different genetic factors contributing to phenotypic variation. Using Saccharomyces cerevisiae strains in the genetically and environmentally diverse SGRP collection, we have identified genetic loci associated with sporulation efficiency variation in a set of sporulation and sporulation-associated genes. Using two independent methods for association mapping and correcting for population structure biases, our analysis identified two linked clusters containing 4 non-synonymous mutations in genes – HOS4, MCK1, SET3, and SPO74. Five regulatory polymorphisms in five genes such as MLS1 and CDC10 were also identified as putative candidates. Our results provide candidate genes contributing to phenotypic variation in the sporulation efficiency of natural isolates of yeast. PMID:23874994

Glutamatergic and GABAergic gene sets in attention-deficit/hyperactivity disorder: association to overlapping traits in ADHD and autism.

PubMed

Naaijen, J; Bralten, J; Poelmans, G; Glennon, J C; Franke, B; Buitelaar, J K

2017-01-10

Attention-deficit/hyperactivity disorder (ADHD) and autism spectrum disorders (ASD) often co-occur. Both are highly heritable; however, it has been difficult to discover genetic risk variants. Glutamate and GABA are main excitatory and inhibitory neurotransmitters in the brain; their balance is essential for proper brain development and functioning. In this study we investigated the role of glutamate and GABA genetics in ADHD severity, autism symptom severity and inhibitory performance, based on gene set analysis, an approach to investigate multiple genetic variants simultaneously. Common variants within glutamatergic and GABAergic genes were investigated using the MAGMA software in an ADHD case-only sample (n=931), in which we assessed ASD symptoms and response inhibition on a Stop task. Gene set analysis for ADHD symptom severity, divided into inattention and hyperactivity/impulsivity symptoms, autism symptom severity and inhibition were performed using principal component regression analyses. Subsequently, gene-wide association analyses were performed. The glutamate gene set showed an association with severity of hyperactivity/impulsivity (P=0.009), which was robust to correcting for genome-wide association levels. The GABA gene set showed nominally significant association with inhibition (P=0.04), but this did not survive correction for multiple comparisons. None of single gene or single variant associations was significant on their own. By analyzing multiple genetic variants within candidate gene sets together, we were able to find genetic associations supporting the involvement of excitatory and inhibitory neurotransmitter systems in ADHD and ASD symptom severity in ADHD.

MorphDB: Prioritizing Genes for Specialized Metabolism Pathways and Gene Ontology Categories in Plants.

PubMed

Zwaenepoel, Arthur; Diels, Tim; Amar, David; Van Parys, Thomas; Shamir, Ron; Van de Peer, Yves; Tzfadia, Oren

2018-01-01

Recent times have seen an enormous growth of "omics" data, of which high-throughput gene expression data are arguably the most important from a functional perspective. Despite huge improvements in computational techniques for the functional classification of gene sequences, common similarity-based methods often fall short of providing full and reliable functional information. Recently, the combination of comparative genomics with approaches in functional genomics has received considerable interest for gene function analysis, leveraging both gene expression based guilt-by-association methods and annotation efforts in closely related model organisms. Besides the identification of missing genes in pathways, these methods also typically enable the discovery of biological regulators (i.e., transcription factors or signaling genes). A previously built guilt-by-association method is MORPH, which was proven to be an efficient algorithm that performs particularly well in identifying and prioritizing missing genes in plant metabolic pathways. Here, we present MorphDB, a resource where MORPH-based candidate genes for large-scale functional annotations (Gene Ontology, MapMan bins) are integrated across multiple plant species. Besides a gene centric query utility, we present a comparative network approach that enables researchers to efficiently browse MORPH predictions across functional gene sets and species, facilitating efficient gene discovery and candidate gene prioritization. MorphDB is available at http://bioinformatics.psb.ugent.be/webtools/morphdb/morphDB/index/. We also provide a toolkit, named "MORPH bulk" (https://github.com/arzwa/morph-bulk), for running MORPH in bulk mode on novel data sets, enabling researchers to apply MORPH to their own species of interest.

FISH Oracle: a web server for flexible visualization of DNA copy number data in a genomic context.

PubMed

Mader, Malte; Simon, Ronald; Steinbiss, Sascha; Kurtz, Stefan

2011-07-28

The rapidly growing amount of array CGH data requires improved visualization software supporting the process of identifying candidate cancer genes. Optimally, such software should work across multiple microarray platforms, should be able to cope with data from different sources and should be easy to operate. We have developed a web-based software FISH Oracle to visualize data from multiple array CGH experiments in a genomic context. Its fast visualization engine and advanced web and database technology supports highly interactive use. FISH Oracle comes with a convenient data import mechanism, powerful search options for genomic elements (e.g. gene names or karyobands), quick navigation and zooming into interesting regions, and mechanisms to export the visualization into different high quality formats. These features make the software especially suitable for the needs of life scientists. FISH Oracle offers a fast and easy to use visualization tool for array CGH and SNP array data. It allows for the identification of genomic regions representing minimal common changes based on data from one or more experiments. FISH Oracle will be instrumental to identify candidate onco and tumor suppressor genes based on the frequency and genomic position of DNA copy number changes. The FISH Oracle application and an installed demo web server are available at http://www.zbh.uni-hamburg.de/fishoracle.

FISH Oracle: a web server for flexible visualization of DNA copy number data in a genomic context

PubMed Central

2011-01-01

Background The rapidly growing amount of array CGH data requires improved visualization software supporting the process of identifying candidate cancer genes. Optimally, such software should work across multiple microarray platforms, should be able to cope with data from different sources and should be easy to operate. Results We have developed a web-based software FISH Oracle to visualize data from multiple array CGH experiments in a genomic context. Its fast visualization engine and advanced web and database technology supports highly interactive use. FISH Oracle comes with a convenient data import mechanism, powerful search options for genomic elements (e.g. gene names or karyobands), quick navigation and zooming into interesting regions, and mechanisms to export the visualization into different high quality formats. These features make the software especially suitable for the needs of life scientists. Conclusions FISH Oracle offers a fast and easy to use visualization tool for array CGH and SNP array data. It allows for the identification of genomic regions representing minimal common changes based on data from one or more experiments. FISH Oracle will be instrumental to identify candidate onco and tumor suppressor genes based on the frequency and genomic position of DNA copy number changes. The FISH Oracle application and an installed demo web server are available at http://www.zbh.uni-hamburg.de/fishoracle. PMID:21884636

PGMapper: a web-based tool linking phenotype to genes.

PubMed

Xiong, Qing; Qiu, Yuhui; Gu, Weikuan

2008-04-01

With the availability of whole genome sequence in many species, linkage analysis, positional cloning and microarray are gradually becoming powerful tools for investigating the links between phenotype and genotype or genes. However, in these methods, causative genes underlying a quantitative trait locus, or a disease, are usually located within a large genomic region or a large set of genes. Examining the function of every gene is very time consuming and needs to retrieve and integrate the information from multiple databases or genome resources. PGMapper is a software tool for automatically matching phenotype to genes from a defined genome region or a group of given genes by combining the mapping information from the Ensembl database and gene function information from the OMIM and PubMed databases. PGMapper is currently available for candidate gene search of human, mouse, rat, zebrafish and 12 other species. Available online at http://www.genediscovery.org/pgmapper/index.jsp.

Network-Assisted Investigation of Combined Causal Signals from Genome-Wide Association Studies in Schizophrenia

PubMed Central

Jia, Peilin; Wang, Lily; Fanous, Ayman H.; Pato, Carlos N.; Edwards, Todd L.; Zhao, Zhongming

2012-01-01

With the recent success of genome-wide association studies (GWAS), a wealth of association data has been accomplished for more than 200 complex diseases/traits, proposing a strong demand for data integration and interpretation. A combinatory analysis of multiple GWAS datasets, or an integrative analysis of GWAS data and other high-throughput data, has been particularly promising. In this study, we proposed an integrative analysis framework of multiple GWAS datasets by overlaying association signals onto the protein-protein interaction network, and demonstrated it using schizophrenia datasets. Building on a dense module search algorithm, we first searched for significantly enriched subnetworks for schizophrenia in each single GWAS dataset and then implemented a discovery-evaluation strategy to identify module genes with consistent association signals. We validated the module genes in an independent dataset, and also examined them through meta-analysis of the related SNPs using multiple GWAS datasets. As a result, we identified 205 module genes with a joint effect significantly associated with schizophrenia; these module genes included a number of well-studied candidate genes such as DISC1, GNA12, GNA13, GNAI1, GPR17, and GRIN2B. Further functional analysis suggested these genes are involved in neuronal related processes. Additionally, meta-analysis found that 18 SNPs in 9 module genes had P meta<1×10−4, including the gene HLA-DQA1 located in the MHC region on chromosome 6, which was reported in previous studies using the largest cohort of schizophrenia patients to date. These results demonstrated our bi-directional network-based strategy is efficient for identifying disease-associated genes with modest signals in GWAS datasets. This approach can be applied to any other complex diseases/traits where multiple GWAS datasets are available. PMID:22792057

Genetic study of intracranial aneurysms.

PubMed

Yan, Junxia; Hitomi, Toshiaki; Takenaka, Katsunobu; Kato, Masayasu; Kobayashi, Hatasu; Okuda, Hiroko; Harada, Kouji H; Koizumi, Akio

2015-03-01

Rupture of intracranial aneurysms (IAs) causes subarachnoid hemorrhage, leading to immediate death or severe disability. Identification of the genetic factors involved is critical for disease prevention and treatment. We aimed to identify the susceptibility genes for IAs. Exome sequencing was performed in 12 families with histories of multiple cases of IA (number of cases per family ≥3), with a total of 42 cases. Various filtering strategies were used to select the candidate variants. Replicate association studies of several candidate variants were performed in probands of 24 additional IA families and 426 sporadic IA cases. Functional analysis for the mutations was conducted. After sequencing and filtering, 78 variants were selected for the following reasons: allele frequencies of variants in 42 patients was significantly (P<0.05) larger than expected; variants were completely shared by all patients with IA within ≥1 family; variants predicted damage to the structure or function of the protein by PolyPhen-2 (Polymorphism Phenotyping V2) and SIFT (Sorting Intolerance From Tolerant). We selected 10 variants from 9 genes (GPR63, ADAMST15, MLL2, IL10RA, PAFAH2, THBD, IL11RA, FILIP1L, and ZNF222) to form 78 candidate variants by considering commonness in families, known disease genes, or ontology association with angiogenesis. Replicate association studies revealed that only p.E133Q in ADAMTS15 was aggregated in the familial IA cases (odds ratio, 5.96; 95% confidence interval, 2.40-14.82; P=0.0001; significant after the Bonferroni correction [P=0.05/78=0.0006]). Silencing ADAMTS15 and overexpression of ADAMTS15 p.E133Q accelerated endothelial cell migration, suggesting that ADAMTS15 may have antiangiogenic activity. ADAMTS15 is a candidate gene for IAs. © 2015 American Heart Association, Inc.

Planar Cell Polarity Pathway Genes and Risk for Spina Bifida

PubMed Central

Wen, Shu; Zhu, Huiping; Lu, Wei; Mitchell, Laura E.; Shaw, Gary M.; Lammer, Edward J.; Finnell, Richard H.

2009-01-01

Spina bifida, a neural tube closure defect (NTD) involving the posterior portion of what will ultimately give rise to the spinal cord, is one of the most common and serious birth defects. The etiology of spina bifida is thought to be multi-factorial and involve multiple interacting genes and environmental factors. The causes of this congenital malformation remain largely unknown. However, several candidate genes for spina bifida have been identified in lower vertebrates, including the planar cell polarity (PCP) genes. We used data from a case-control study conducted in California to evaluate the association between variation within several key PCP genes and the risk of spina bifida. The PCP genes included in this study were the human homologues of the Xenopus genes Flamingo, Strabismus, Prickle, Dishevelled and Scrib, two of the homologues of Xenopus Wnt genes, WNT5A and WNT11, and two of the homologues of Xenopus Frizzled, FZD3 and FZD6. None of the 172 SNPs that were evaluated were significantly associated with spina bifida in any racial/ethnic group after correction for multiple testing. However, several SNPs in the PRICKLE2 gene had unadjusted p value<0.01. In conclusion our results, though largely negative, suggest that the PRICKLE2 gene may potentially modify the risk of spina bifida and deserves further investigation. PMID:20101694

Genome structure drives patterns of gene family evolution in ciliates, a case study using Chilodonella uncinata (Protista, Ciliophora, Phyllopharyngea).

PubMed

Gao, Feng; Song, Weibo; Katz, Laura A

2014-08-01

In most lineages, diversity among gene family members results from gene duplication followed by sequence divergence. Because of the genome rearrangements during the development of somatic nuclei, gene family evolution in ciliates involves more complex processes. Previous work on the ciliate Chilodonella uncinata revealed that macronuclear β-tubulin gene family members are generated by alternative processing, in which germline regions are alternatively used in multiple macronuclear chromosomes. To further study genome evolution in this ciliate, we analyzed its transcriptome and found that (1) alternative processing is extensive among gene families; and (2) such gene families are likely to be C. uncinata specific. We characterized additional macronuclear and micronuclear copies of one candidate alternatively processed gene family-a protein kinase domain containing protein (PKc)-from two C. uncinata strains. Analysis of the PKc sequences reveals that (1) multiple PKc gene family members in the macronucleus share some identical regions flanked by divergent regions; and (2) the shared identical regions are processed from a single micronuclear chromosome. We discuss analogous processes in lineages across the eukaryotic tree of life to provide further insights on the impact of genome structure on gene family evolution in eukaryotes. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

Examination of association to autism of common genetic variationin genes related to dopamine.

PubMed

Anderson, B M; Schnetz-Boutaud, N; Bartlett, J; Wright, H H; Abramson, R K; Cuccaro, M L; Gilbert, J R; Pericak-Vance, M A; Haines, J L

2008-12-01

Autism is a severe neurodevelopmental disorder characterized by a triad of complications. Autistic individuals display significant disturbances in language and reciprocal social interactions, combined with repetitive and stereotypic behaviors. Prevalence studies suggest that autism is more common than originally believed, with recent estimates citing a rate of one in 150. Although multiple genetic linkage and association studies have yielded multiple suggestive genes or chromosomal regions, a specific risk locus has yet to be identified and widely confirmed. Because many etiologies have been suggested for this complex syndrome, we hypothesize that one of the difficulties in identifying autism genes is that multiple genetic variants may be required to significantly increase the risk of developing autism. Thus, we took the alternative approach of examining 14 prominent dopamine pathway candidate genes for detailed study by genotyping 28 single nucleotide polymorphisms. Although we did observe a nominally significant association for rs2239535 (P=0.008) on chromosome 20, single-locus analysis did not reveal any results as significant after correction for multiple comparisons. No significant interaction was identified when Multifactor Dimensionality Reduction was employed to test specifically for multilocus effects. Although genome-wide linkage scans in autism have provided support for linkage to various loci along the dopamine pathway, our study does not provide strong evidence of linkage or association to any specific gene or combination of genes within the pathway. These results demonstrate that common genetic variation within the tested genes located within this pathway at most play a minor to moderate role in overall autism pathogenesis.

A Drosophila model for toxicogenomics: Genetic variation in susceptibility to heavy metal exposure

PubMed Central

Luoma, Sarah E.; St. Armour, Genevieve E.; Thakkar, Esha

2017-01-01

The genetic factors that give rise to variation in susceptibility to environmental toxins remain largely unexplored. Studies on genetic variation in susceptibility to environmental toxins are challenging in human populations, due to the variety of clinical symptoms and difficulty in determining which symptoms causally result from toxic exposure; uncontrolled environments, often with exposure to multiple toxicants; and difficulty in relating phenotypic effect size to toxic dose, especially when symptoms become manifest with a substantial time lag. Drosophila melanogaster is a powerful model that enables genome-wide studies for the identification of allelic variants that contribute to variation in susceptibility to environmental toxins, since the genetic background, environmental rearing conditions and toxic exposure can be precisely controlled. Here, we used extreme QTL mapping in an outbred population derived from the D. melanogaster Genetic Reference Panel to identify alleles associated with resistance to lead and/or cadmium, two ubiquitous environmental toxins that present serious health risks. We identified single nucleotide polymorphisms (SNPs) associated with variation in resistance to both heavy metals as well as SNPs associated with resistance specific to each of them. The effects of these SNPs were largely sex-specific. We applied mutational and RNAi analyses to 33 candidate genes and functionally validated 28 of them. We constructed networks of candidate genes as blueprints for orthologous networks of human genes. The latter not only provided functional contexts for known human targets of heavy metal toxicity, but also implicated novel candidate susceptibility genes. These studies validate Drosophila as a translational toxicogenomics gene discovery system. PMID:28732062

Cross-Species Transcriptome Profiling Identifies New Alveolar Epithelial Type I Cell–Specific Genes

PubMed Central

Sunohara, Mitsuhiro; Pouldar, Tiffany M.; Wang, Hongjun; Liu, Yixin; Rieger, Megan E.; Tran, Evelyn; Flodby, Per; Siegmund, Kimberly D.; Crandall, Edward D.; Laird-Offringa, Ite A.

2017-01-01

Diseases involving the distal lung alveolar epithelium include chronic obstructive pulmonary disease, idiopathic pulmonary fibrosis, and lung adenocarcinoma. Accurate labeling of specific cell types is critical for determining the contribution of each to the pathogenesis of these diseases. The distal lung alveolar epithelium is composed of two cell types, alveolar epithelial type 1 (AT1) and type 2 (AT2) cells. Although cell type–specific markers, most prominently surfactant protein C, have allowed detailed lineage tracing studies of AT2 cell differentiation and the cells’ roles in disease, studies of AT1 cells have been hampered by a lack of genes with expression unique to AT1 cells. In this study, we performed genome-wide expression profiling of multiple rat organs together with purified rat AT2, AT1, and in vitro differentiated AT1-like cells, resulting in the identification of 54 candidate AT1 cell markers. Cross-referencing with genes up-regulated in human in vitro differentiated AT1-like cells narrowed the potential list to 18 candidate genes. Testing the top four candidate genes at RNA and protein levels revealed GRAM domain 2 (GRAMD2), a protein of unknown function, as highly specific to AT1 cells. RNA sequencing (RNAseq) confirmed that GRAMD2 is transcriptionally silent in human AT2 cells. Immunofluorescence verified that GRAMD2 expression is restricted to the plasma membrane of AT1 cells and is not expressed in bronchial epithelial cells, whereas reverse transcription–polymerase chain reaction confirmed that it is not expressed in endothelial cells. Using GRAMD2 as a new AT1 cell–specific gene will enhance AT1 cell isolation, the investigation of alveolar epithelial cell differentiation potential, and the contribution of AT1 cells to distal lung diseases. PMID:27749084

The Acid Phosphatase-Encoding Gene GmACP1 Contributes to Soybean Tolerance to Low-Phosphorus Stress

PubMed Central

Hao, Derong; Wang, Hui; Kan, Guizhen; Jin, Hangxia; Yu, Deyue

2014-01-01

Phosphorus (P) is essential for all living cells and organisms, and low-P stress is a major factor constraining plant growth and yield worldwide. In plants, P efficiency is a complex quantitative trait involving multiple genes, and the mechanisms underlying P efficiency are largely unknown. Combining linkage analysis, genome-wide and candidate-gene association analyses, and plant transformation, we identified a soybean gene related to P efficiency, determined its favorable haplotypes and developed valuable functional markers. First, six major genomic regions associated with P efficiency were detected by performing genome-wide associations (GWAs) in various environments. A highly significant region located on chromosome 8, qPE8, was identified by both GWAs and linkage mapping and explained 41% of the phenotypic variation. Then, a regional mapping study was performed with 40 surrounding markers in 192 diverse soybean accessions. A strongly associated haplotype (P = 10−7) consisting of the markers Sat_233 and BARC-039899-07603 was identified, and qPE8 was located in a region of approximately 250 kb, which contained a candidate gene GmACP1 that encoded an acid phosphatase. GmACP1 overexpression in soybean hairy roots increased P efficiency by 11–20% relative to the control. A candidate-gene association analysis indicated that six natural GmACP1 polymorphisms explained 33% of the phenotypic variation. The favorable alleles and haplotypes of GmACP1 associated with increased transcript expression correlated with higher enzyme activity. The discovery of the optimal haplotype of GmACP1 will now enable the accurate selection of soybeans with higher P efficiencies and improve our understanding of the molecular mechanisms underlying P efficiency in plants. PMID:24391523

Disease gene prioritization by integrating tissue-specific molecular networks using a robust multi-network model.

PubMed

Ni, Jingchao; Koyuturk, Mehmet; Tong, Hanghang; Haines, Jonathan; Xu, Rong; Zhang, Xiang

2016-11-10

Accurately prioritizing candidate disease genes is an important and challenging problem. Various network-based methods have been developed to predict potential disease genes by utilizing the disease similarity network and molecular networks such as protein interaction or gene co-expression networks. Although successful, a common limitation of the existing methods is that they assume all diseases share the same molecular network and a single generic molecular network is used to predict candidate genes for all diseases. However, different diseases tend to manifest in different tissues, and the molecular networks in different tissues are usually different. An ideal method should be able to incorporate tissue-specific molecular networks for different diseases. In this paper, we develop a robust and flexible method to integrate tissue-specific molecular networks for disease gene prioritization. Our method allows each disease to have its own tissue-specific network(s). We formulate the problem of candidate gene prioritization as an optimization problem based on network propagation. When there are multiple tissue-specific networks available for a disease, our method can automatically infer the relative importance of each tissue-specific network. Thus it is robust to the noisy and incomplete network data. To solve the optimization problem, we develop fast algorithms which have linear time complexities in the number of nodes in the molecular networks. We also provide rigorous theoretical foundations for our algorithms in terms of their optimality and convergence properties. Extensive experimental results show that our method can significantly improve the accuracy of candidate gene prioritization compared with the state-of-the-art methods. In our experiments, we compare our methods with 7 popular network-based disease gene prioritization algorithms on diseases from Online Mendelian Inheritance in Man (OMIM) database. The experimental results demonstrate that our methods recover true associations more accurately than other methods in terms of AUC values, and the performance differences are significant (with paired t-test p-values less than 0.05). This validates the importance to integrate tissue-specific molecular networks for studying disease gene prioritization and show the superiority of our network models and ranking algorithms toward this purpose. The source code and datasets are available at http://nijingchao.github.io/CRstar/ .

Derived variants at six genes explain nearly half of size reduction in dog breeds

PubMed Central

Rimbault, Maud; Beale, Holly C.; Schoenebeck, Jeffrey J.; Hoopes, Barbara C.; Allen, Jeremy J.; Kilroy-Glynn, Paul; Wayne, Robert K.; Sutter, Nathan B.; Ostrander, Elaine A.

2013-01-01

Selective breeding of dogs by humans has generated extraordinary diversity in body size. A number of multibreed analyses have been undertaken to identify the genetic basis of this diversity. We analyzed four loci discovered in a previous genome-wide association study that used 60,968 SNPs to identify size-associated genomic intervals, which were too large to assign causative roles to genes. First, we performed fine-mapping to define critical intervals that included the candidate genes GHR, HMGA2, SMAD2, and STC2, identifying five highly associated markers at the four loci. We hypothesize that three of the variants are likely to be causative. We then genotyped each marker, together with previously reported size-associated variants in the IGF1 and IGF1R genes, on a panel of 500 domestic dogs from 93 breeds, and identified the ancestral allele by genotyping the same markers on 30 wild canids. We observed that the derived alleles at all markers correlated with reduced body size, and smaller dogs are more likely to carry derived alleles at multiple markers. However, breeds are not generally fixed at all markers; multiple combinations of genotypes are found within most breeds. Finally, we show that 46%–52.5% of the variance in body size of dog breeds can be explained by seven markers in proximity to exceptional candidate genes. Among breeds with standard weights <41 kg (90 lb), the genotypes accounted for 64.3% of variance in weight. This work advances our understanding of mammalian growth by describing genetic contributions to canine size determination in non-giant dog breeds. PMID:24026177

A radiation hybrid map of the proximal long arm of human chromosome 11 containing the multiple endocrine neoplasia type 1 (MEN-1) and bcl-1 disease loci.

PubMed Central

Richard, C W; Withers, D A; Meeker, T C; Maurer, S; Evans, G A; Myers, R M; Cox, D R

1991-01-01

We describe a high-resolution radiation hybrid map of the proximal long arm of human chromosome 11 containing the bcl-1 and multiple endocrine neoplasia type 1 (MEN-1) disease gene loci. We used X-ray irradiation and cell fusion to generate a panel of 102 hamster-human somatic cell hybrids containing fragments of human chromosome 11. Sixteen human loci in the 11q12-13 region were mapped by statistical analysis of the cosegregation of markers in these radiation hybrids. The most likely order for these loci is C1NH-OSBP-(CD5/CD20)-PGA-FTH1-COX8-PYGM -SEA-KRN1-(MTC/P11EH/HSTF1/INT2)-GST3- PPP1A. Our localization of the human protooncogene SEA between PYGM and INT2, two markers that flank MEN-1, suggests SEA as a potential candidate for the MEN-1 locus. We map two mitogenic fibroblast growth factor genes, HSTF1 and INT2, close to bcl-1, a mapping that is consistent with previously published data. Our map places the human leukocyte antigen genes CD5 and CD20 far from the bcl-1 locus, indicating that CD5 and CD20 expression is unlikely to be altered by bcl-1 rearrangements. PPP1A, which has been postulated as a MEN-1 candidate tumor suppressor gene, and GST3, a gene transcriptionally active in many human cancers, both map distal to the bcl-1 translocation cluster and the region containing MEN-1, and therefore are unlikely to be directly involved in bcl-1 or MEN-1. PMID:1684084

Physiogenomic comparison of human fat loss in response to diets restrictive of carbohydrate or fat

PubMed Central

Seip, Richard L; Volek, Jeff S; Windemuth, Andreas; Kocherla, Mohan; Fernandez, Maria Luz; Kraemer, William J; Ruaño, Gualberto

2008-01-01

Background Genetic factors that predict responses to diet may ultimately be used to individualize dietary recommendations. We used physiogenomics to explore associations among polymorphisms in candidate genes and changes in relative body fat (Δ%BF) to low fat and low carbohydrate diets. Methods We assessed Δ%BF using dual energy X-ray absorptiometry (DXA) in 93 healthy adults who consumed a low carbohydrate diet (carbohydrate ~12% total energy) (LC diet) and in 70, a low fat diet (fat ~25% total energy) (LF diet). Fifty-three single nucleotide polymorphisms (SNPs) selected from 28 candidate genes involved in food intake, energy homeostasis, and adipocyte regulation were ranked according to probability of association with the change in %BF using multiple linear regression. Results Dieting reduced %BF by 3.0 ± 2.6% (absolute units) for LC and 1.9 ± 1.6% for LF (p < 0.01). SNPs in nine genes were significantly associated with Δ%BF, with four significant after correction for multiple statistical testing: rs322695 near the retinoic acid receptor beta (RARB) (p < 0.005), rs2838549 in the hepatic phosphofructokinase (PFKL), and rs3100722 in the histamine N-methyl transferase (HNMT) genes (both p < 0.041) due to LF; and the rs5950584 SNP in the angiotensin receptor Type II (AGTR2) gene due to LC (p < 0.021). Conclusion Fat loss under LC and LF diet regimes appears to have distinct mechanisms, with PFKL and HNMT and RARB involved in fat restriction; and AGTR2 involved in carbohydrate restriction. These discoveries could provide clues to important physiologic mechanisms underlying the Δ%BF to low carbohydrate and low fat diets. PMID:18254975

A radiation hybrid map of the proximal long arm of human chromosome 11 containing the multiple endocrine neoplasia type 1 (MEN-1) and bcl-1 disease loci.

PubMed

Richard, C W; Withers, D A; Meeker, T C; Maurer, S; Evans, G A; Myers, R M; Cox, D R

1991-12-01

We describe a high-resolution radiation hybrid map of the proximal long arm of human chromosome 11 containing the bcl-1 and multiple endocrine neoplasia type 1 (MEN-1) disease gene loci. We used X-ray irradiation and cell fusion to generate a panel of 102 hamster-human somatic cell hybrids containing fragments of human chromosome 11. Sixteen human loci in the 11q12-13 region were mapped by statistical analysis of the cosegregation of markers in these radiation hybrids. The most likely order for these loci is C1NH-OSBP-(CD5/CD20)-PGA-FTH1-COX8-PYGM -SEA-KRN1-(MTC/P11EH/HSTF1/INT2)-GST3- PPP1A. Our localization of the human protooncogene SEA between PYGM and INT2, two markers that flank MEN-1, suggests SEA as a potential candidate for the MEN-1 locus. We map two mitogenic fibroblast growth factor genes, HSTF1 and INT2, close to bcl-1, a mapping that is consistent with previously published data. Our map places the human leukocyte antigen genes CD5 and CD20 far from the bcl-1 locus, indicating that CD5 and CD20 expression is unlikely to be altered by bcl-1 rearrangements. PPP1A, which has been postulated as a MEN-1 candidate tumor suppressor gene, and GST3, a gene transcriptionally active in many human cancers, both map distal to the bcl-1 translocation cluster and the region containing MEN-1, and therefore are unlikely to be directly involved in bcl-1 or MEN-1.

Comparative genomics and evolution of eukaryotic phospholipidbiosynthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lykidis, Athanasios

2006-12-01

Phospholipid biosynthetic enzymes produce diverse molecular structures and are often present in multiple forms encoded by different genes. This work utilizes comparative genomics and phylogenetics for exploring the distribution, structure and evolution of phospholipid biosynthetic genes and pathways in 26 eukaryotic genomes. Although the basic structure of the pathways was formed early in eukaryotic evolution, the emerging picture indicates that individual enzyme families followed unique evolutionary courses. For example, choline and ethanolamine kinases and cytidylyltransferases emerged in ancestral eukaryotes, whereas, multiple forms of the corresponding phosphatidyltransferases evolved mainly in a lineage specific manner. Furthermore, several unicellular eukaryotes maintain bacterial-type enzymesmore » and reactions for the synthesis of phosphatidylglycerol and cardiolipin. Also, base-exchange phosphatidylserine synthases are widespread and ancestral enzymes. The multiplicity of phospholipid biosynthetic enzymes has been largely generated by gene expansion in a lineage specific manner. Thus, these observations suggest that phospholipid biosynthesis has been an actively evolving system. Finally, comparative genomic analysis indicates the existence of novel phosphatidyltransferases and provides a candidate for the uncharacterized eukaryotic phosphatidylglycerol phosphate phosphatase.« less

Genetics and Genomics of Social Behavior in a Chicken Model.

PubMed

Johnsson, Martin; Henriksen, Rie; Fogelholm, Jesper; Höglund, Andrey; Jensen, Per; Wright, Dominic

2018-05-01

The identification of genes affecting sociality can give insights into the maintenance and development of sociality and personality. In this study, we used the combination of an advanced intercross between wild and domestic chickens with a combined QTL and eQTL genetical genomics approach to identify genes for social reinstatement, a social and anxiety-related behavior. A total of 24 social reinstatement QTL were identified and overlaid with over 600 eQTL obtained from the same birds using hypothalamic tissue. Correlations between overlapping QTL and eQTL indicated five strong candidate genes, with the gene TTRAP being strongly significantly correlated with multiple aspects of social reinstatement behavior, as well as possessing a highly significant eQTL. Copyright © 2018 by the Genetics Society of America.

Risk of type 1 diabetes progression in islet autoantibody-positive children can be further stratified using expression patterns of multiple genes implicated in peripheral blood lymphocyte activation and function.

PubMed

Jin, Yulan; Sharma, Ashok; Bai, Shan; Davis, Colleen; Liu, Haitao; Hopkins, Diane; Barriga, Kathy; Rewers, Marian; She, Jin-Xiong

2014-07-01

There is tremendous scientific and clinical value to further improving the predictive power of autoantibodies because autoantibody-positive (AbP) children have heterogeneous rates of progression to clinical diabetes. This study explored the potential of gene expression profiles as biomarkers for risk stratification among 104 AbP subjects from the Diabetes Autoimmunity Study in the Young (DAISY) using a discovery data set based on microarray and a validation data set based on real-time RT-PCR. The microarray data identified 454 candidate genes with expression levels associated with various type 1 diabetes (T1D) progression rates. RT-PCR analyses of the top-27 candidate genes confirmed 5 genes (BACH2, IGLL3, EIF3A, CDC20, and TXNDC5) associated with differential progression and implicated in lymphocyte activation and function. Multivariate analyses of these five genes in the discovery and validation data sets identified and confirmed four multigene models (BI, ICE, BICE, and BITE, with each letter representing a gene) that consistently stratify high- and low-risk subsets of AbP subjects with hazard ratios >6 (P < 0.01). The results suggest that these genes may be involved in T1D pathogenesis and potentially serve as excellent gene expression biomarkers to predict the risk of progression to clinical diabetes for AbP subjects. © 2014 by the American Diabetes Association.

Systematic genomic identification of colorectal cancer genes delineating advanced from early clinical stage and metastasis

PubMed Central

2013-01-01

Background Colorectal cancer is the third leading cause of cancer deaths in the United States. The initial assessment of colorectal cancer involves clinical staging that takes into account the extent of primary tumor invasion, determining the number of lymph nodes with metastatic cancer and the identification of metastatic sites in other organs. Advanced clinical stage indicates metastatic cancer, either in regional lymph nodes or in distant organs. While the genomic and genetic basis of colorectal cancer has been elucidated to some degree, less is known about the identity of specific cancer genes that are associated with advanced clinical stage and metastasis. Methods We compiled multiple genomic data types (mutations, copy number alterations, gene expression and methylation status) as well as clinical meta-data from The Cancer Genome Atlas (TCGA). We used an elastic-net regularized regression method on the combined genomic data to identify genetic aberrations and their associated cancer genes that are indicators of clinical stage. We ranked candidate genes by their regression coefficient and level of support from multiple assay modalities. Results A fit of the elastic-net regularized regression to 197 samples and integrated analysis of four genomic platforms identified the set of top gene predictors of advanced clinical stage, including: WRN, SYK, DDX5 and ADRA2C. These genetic features were identified robustly in bootstrap resampling analysis. Conclusions We conducted an analysis integrating multiple genomic features including mutations, copy number alterations, gene expression and methylation. This integrated approach in which one considers all of these genomic features performs better than any individual genomic assay. We identified multiple genes that robustly delineate advanced clinical stage, suggesting their possible role in colorectal cancer metastatic progression. PMID:24308539

Detecting novel genes with sparse arrays

PubMed Central

Haiminen, Niina; Smit, Bart; Rautio, Jari; Vitikainen, Marika; Wiebe, Marilyn; Martinez, Diego; Chee, Christine; Kunkel, Joe; Sanchez, Charles; Nelson, Mary Anne; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Kivioja, Teemu

2014-01-01

Species-specific genes play an important role in defining the phenotype of an organism. However, current gene prediction methods can only efficiently find genes that share features such as sequence similarity or general sequence characteristics with previously known genes. Novel sequencing methods and tiling arrays can be used to find genes without prior information and they have demonstrated that novel genes can still be found from extensively studied model organisms. Unfortunately, these methods are expensive and thus are not easily applicable, e.g., to finding genes that are expressed only in very specific conditions. We demonstrate a method for finding novel genes with sparse arrays, applying it on the 33.9 Mb genome of the filamentous fungus Trichoderma reesei. Our computational method does not require normalisations between arrays and it takes into account the multiple-testing problem typical for analysis of microarray data. In contrast to tiling arrays, that use overlapping probes, only one 25mer microarray oligonucleotide probe was used for every 100 b. Thus, only relatively little space on a microarray slide was required to cover the intergenic regions of a genome. The analysis was done as a by-product of a conventional microarray experiment with no additional costs. We found at least 23 good candidates for novel transcripts that could code for proteins and all of which were expressed at high levels. Candidate genes were found to neighbour ire1 and cre1 and many other regulatory genes. Our simple, low-cost method can easily be applied to finding novel species-specific genes without prior knowledge of their sequence properties. PMID:20691772

Structural and Functional Analysis of the GRAS Gene Family in Grapevine Indicates a Role of GRAS Proteins in the Control of Development and Stress Responses

PubMed Central

Grimplet, Jérôme; Agudelo-Romero, Patricia; Teixeira, Rita T.; Martinez-Zapater, Jose M.; Fortes, Ana M.

2016-01-01

GRAS transcription factors are involved in many processes of plant growth and development (e.g., axillary shoot meristem formation, root radial patterning, nodule morphogenesis, arbuscular development) as well as in plant disease resistance and abiotic stress responses. However, little information is available concerning this gene family in grapevine (Vitis vinifera L.), an economically important woody crop. We performed a model curation of GRAS genes identified in the latest genome annotation leading to the identification of 52 genes. Gene models were improved and three new genes were identified that could be grapevine- or woody-plant specific. Phylogenetic analysis showed that GRAS genes could be classified into 13 groups that mapped on the 19 V. vinifera chromosomes. Five new subfamilies, previously not characterized in other species, were identified. Multiple sequence alignment showed typical GRAS domain in the proteins and new motifs were also described. As observed in other species, both segmental and tandem duplications contributed significantly to the expansion and evolution of the GRAS gene family in grapevine. Expression patterns across a variety of tissues and upon abiotic and biotic conditions revealed possible divergent functions of GRAS genes in grapevine development and stress responses. By comparing the information available for tomato and grapevine GRAS genes, we identified candidate genes that might constitute conserved transcriptional regulators of both climacteric and non-climacteric fruit ripening. Altogether this study provides valuable information and robust candidate genes for future functional analysis aiming at improving the quality of fleshy fruits. PMID:27065316

Multiple genomic signatures of selection in goats and sheep indigenous to a hot arid environment

PubMed Central

Kim, E-S; Elbeltagy, A R; Aboul-Naga, A M; Rischkowsky, B; Sayre, B; Mwacharo, J M; Rothschild, M F

2016-01-01

Goats and sheep are versatile domesticates that have been integrated into diverse environments and production systems. Natural and artificial selection have shaped the variation in the two species, but natural selection has played the major role among indigenous flocks. To investigate signals of natural selection, we analyzed genotype data generated using the caprine and ovine 50K SNP BeadChips from Barki goats and sheep that are indigenous to a hot arid environment in Egypt's Coastal Zone of the Western Desert. We identify several candidate regions under selection that spanned 119 genes. A majority of the genes were involved in multiple signaling and signal transduction pathways in a wide variety of cellular and biochemical processes. In particular, selection signatures spanning several genes that directly or indirectly influenced traits for adaptation to hot arid environments, such as thermo-tolerance (melanogenesis) (FGF2, GNAI3, PLCB1), body size and development (BMP2, BMP4, GJA3, GJB2), energy and digestive metabolism (MYH, TRHDE, ALDH1A3), and nervous and autoimmune response (GRIA1, IL2, IL7, IL21, IL1R1) were identified. We also identified eight common candidate genes under selection in the two species and a shared selection signature that spanned a conserved syntenic segment to bovine chromosome 12 on caprine and ovine chromosomes 12 and 10, respectively, providing, most likely, the evidence for selection in a common environment in two different but closely related species. Our study highlights the importance of indigenous livestock as model organisms for investigating selection sweeps and genome-wide association mapping. PMID:26555032

Obstructive heart defects associated with candidate genes, maternal obesity, and folic acid supplementation.

PubMed

Tang, Xinyu; Cleves, Mario A; Nick, Todd G; Li, Ming; MacLeod, Stewart L; Erickson, Stephen W; Li, Jingyun; Shaw, Gary M; Mosley, Bridget S; Hobbs, Charlotte A

2015-06-01

Right-sided and left-sided obstructive heart defects (OHDs) are subtypes of congenital heart defects, in which the heart valves, arteries, or veins are abnormally narrow or blocked. Previous studies have suggested that the development of OHDs involved a complex interplay between genetic variants and maternal factors. Using the data from 569 OHD case families and 1,644 control families enrolled in the National Birth Defects Prevention Study (NBDPS) between 1997 and 2008, we conducted an analysis to investigate the genetic effects of 877 single nucleotide polymorphisms (SNPs) in 60 candidate genes for association with the risk of OHDs, and their interactions with maternal use of folic acid supplements, and pre-pregnancy obesity. Applying log-linear models based on the hybrid design, we identified a SNP in methylenetetrahydrofolate reductase (MTHFR) gene (C677T polymorphism) with a main genetic effect on the occurrence of OHDs. In addition, multiple SNPs in betaine-homocysteine methyltransferase (BHMT and BHMT2) were also identified to be associated with the occurrence of OHDs through significant main infant genetic effects and interaction effects with maternal use of folic acid supplements. We also identified multiple SNPs in glutamate-cysteine ligase, catalytic subunit (GCLC) and DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3B) that were associated with elevated risk of OHDs among obese women. Our findings suggested that the risk of OHDs was closely related to a combined effect of variations in genes in the folate, homocysteine, or glutathione/transsulfuration pathways, maternal use of folic acid supplements and pre-pregnancy obesity. © 2015 Wiley Periodicals, Inc.

A common variant in DRD3 receptor is associated with autism spectrum disorder.

PubMed

de Krom, Mariken; Staal, Wouter G; Ophoff, Roel A; Hendriks, Judith; Buitelaar, Jan; Franke, Barbara; de Jonge, Maretha V; Bolton, Patrick; Collier, David; Curran, Sarah; van Engeland, Herman; van Ree, Jan M

2009-04-01

The presence of specific and common genetic etiologies for autism spectrum disorders (ASD) and attention-deficit/hyperactivity disorder (ADHD) was investigated for 132 candidate genes in a two-stage design-association study. 1,536 single nucleotide polymorphisms (SNPs) covering these candidate genes were tested in ASD (n = 144) and ADHD (n = 110) patients and control subjects (n = 404) from The Netherlands. A second stage was performed with those SNPs from Stage I reaching a significance threshold for association of p < .01 in an independent sample of ASD patients (n = 128) and controls (n = 124) from the United Kingdom and a Dutch ADHD (n = 150) and control (n = 149) sample. No shared association was found between ASD and ADHD. However, in the first and second ASD samples and in a joint statistical analysis, a significant association between SNP rs167771 located in the DRD3 gene was found (joint analysis uncorrected: p = 3.11 x 10(-6); corrected for multiple testing and potential stratification: p = .00162). The DRD3 gene is related to stereotyped behavior, liability to side effects of antipsychotic medication, and movement disorders and may therefore have important clinical implications for ASD.

Genomic signatures of positive selection in humans and the limits of outlier approaches.

PubMed

Kelley, Joanna L; Madeoy, Jennifer; Calhoun, John C; Swanson, Willie; Akey, Joshua M

2006-08-01

Identifying regions of the human genome that have been targets of positive selection will provide important insights into recent human evolutionary history and may facilitate the search for complex disease genes. However, the confounding effects of population demographic history and selection on patterns of genetic variation complicate inferences of selection when a small number of loci are studied. To this end, identifying outlier loci from empirical genome-wide distributions of genetic variation is a promising strategy to detect targets of selection. Here, we evaluate the power and efficiency of a simple outlier approach and describe a genome-wide scan for positive selection using a dense catalog of 1.58 million SNPs that were genotyped in three human populations. In total, we analyzed 14,589 genes, 385 of which possess patterns of genetic variation consistent with the hypothesis of positive selection. Furthermore, several extended genomic regions were found, spanning >500 kb, that contained multiple contiguous candidate selection genes. More generally, these data provide important practical insights into the limits of outlier approaches in genome-wide scans for selection, provide strong candidate selection genes to study in greater detail, and may have important implications for disease related research.

Characterizations of 9p21 candidate genes in familial melanoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walker, G.J.; Flores, J.F.; Glendening, J.M.

We have previously collected and characterized 16 melanoma families for the inheritance of a familial melanoma predisposition gene on 9p21. Clear evidence for genetic linkage has been detected in 8 of these families with the 9p21 markers D9S126 and 1FNA, while linkage of the remaining families to this region is less certain. A candidate for the 9p21 familial melanoma gene, the cyclin kinase inhibitor gene p16 (also known as the multiple tumor suppressor 1 (MTS1) gene), has been recently indentified. Notably, a nonsense mutation within the p16 gene has been detected in the lymphoblastoid cell line DNA from a dysplasticmore » nevus syndrome (DNS), or familial melanoma, patient. The p16 gene is also known to be frequently deleted or mutated in a variety of tumor cell lines (including melanoma) and resides within a region that has been defined as harboring the 9p21 melanoma predisposition locus. This region is delineated on the distal side by the marker D9S736 (which resides just distal to the p16 gene) and extends in a proximal direction to the marker D9S171. Overall, the entire distance between these two loci is estimated at 3-5Mb. Preliminary analysis of our two largest 9p21-linked melanoma kindreds (by direct sequencing of PCR products) has not yet revealed mutations within the coding region of the p16 gene. Others have reported that 8/11 unrelated 9p21-linked melanoma families do not appear to carry p16 mutations; thus the possibility exists that p16 is not a melanoma susceptibility gene per se, although it appears to play some role in melanoma tumor progression. Our melanoma kindred DNAs are currently being analyzed by SSCP using primers that amplify exons of other candidate genes from the 9p21 region implicated in familial melanoma. These novel genes reside within a distinct critical region of homozygous loss in melanoma which is located >2 Mb from the p16 gene on 9p21.« less

Candidate Gene Study of TRAIL and TRAIL Receptors: Association with Response to Interferon Beta Therapy in Multiple Sclerosis Patients

PubMed Central

Órpez-Zafra, Teresa; Pinto-Medel, María Jesús; Oliver-Martos, Begoña; Ortega-Pinazo, Jesús; Arnáiz, Carlos; Guijarro-Castro, Cristina; Varadé, Jezabel; Álvarez-Lafuente, Roberto; Urcelay, Elena; Sánchez-Jiménez, Francisca

2013-01-01

TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO) and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10−4, pc = 0.048, OR = 0.30). This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A), a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells) were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS. PMID:23658636

Allelic-based gene-gene interaction associated with quantitative traits.

PubMed

Jung, Jeesun; Sun, Bin; Kwon, Deukwoo; Koller, Daniel L; Foroud, Tatiana M

2009-05-01

Recent studies have shown that quantitative phenotypes may be influenced not only by multiple single nucleotide polymorphisms (SNPs) within a gene but also by the interaction between SNPs at unlinked genes. We propose a new statistical approach that can detect gene-gene interactions at the allelic level which contribute to the phenotypic variation in a quantitative trait. By testing for the association of allelic combinations at multiple unlinked loci with a quantitative trait, we can detect the SNP allelic interaction whether or not it can be detected as a main effect. Our proposed method assigns a score to unrelated subjects according to their allelic combination inferred from observed genotypes at two or more unlinked SNPs, and then tests for the association of the allelic score with a quantitative trait. To investigate the statistical properties of the proposed method, we performed a simulation study to estimate type I error rates and power and demonstrated that this allelic approach achieves greater power than the more commonly used genotypic approach to test for gene-gene interaction. As an example, the proposed method was applied to data obtained as part of a candidate gene study of sodium retention by the kidney. We found that this method detects an interaction between the calcium-sensing receptor gene (CaSR), the chloride channel gene (CLCNKB) and the Na, K, 2Cl cotransporter gene (CLC12A1) that contributes to variation in diastolic blood pressure.

Sunflower domestication alleles support single domestication center in eastern North America

PubMed Central

Blackman, Benjamin K.; Scascitelli, Moira; Kane, Nolan C.; Luton, Harry H.; Rasmussen, David A.; Bye, Robert A.; Lentz, David L.; Rieseberg, Loren H.

2011-01-01

Phylogenetic analyses of genes with demonstrated involvement in evolutionary transitions can be an important means of resolving conflicting hypotheses about evolutionary history or process. In sunflower, two genes have previously been shown to have experienced selective sweeps during its early domestication. In the present study, we identified a third candidate early domestication gene and conducted haplotype analyses of all three genes to address a recent, controversial hypothesis about the origin of cultivated sunflower. Although the scientific consensus had long been that sunflower was domesticated once in eastern North America, the discovery of pre-Columbian sunflower remains at archaeological sites in Mexico led to the proposal of a second domestication center in southern Mexico. Previous molecular studies with neutral markers were consistent with the former hypothesis. However, only two indigenous Mexican cultivars were included in these studies, and their provenance and genetic purity have been questioned. Therefore, we sequenced regions of the three candidate domestication genes containing SNPs diagnostic for domestication from large, newly collected samples of Mexican sunflower landraces and Mexican wild populations from a broad geographic range. The new germplasm also was genotyped for 12 microsatellite loci. Our evidence from multiple evolutionarily important loci and from neutral markers supports a single domestication event for extant cultivated sunflower in eastern North America. PMID:21844335

Localization of a translocation breakpoint involved in Smith-Lemli-Opitz syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alley, T.L.; Gray, B.A.; Lee, S.

1994-09-01

Smith-Lemli-Opitz syndrome (SLOS) is a multiple congenital anomaly/mental retardation syndrome, with features including toe syndactyly, genital anomalies, unusual facies, and occasional organ malformations. The gene(s) for this autosomal recessive disorder has not been mapped. Recent biochemical studies suggest that the defect may involve the penultimate step in cholesterol synthesis, as patients have low serum cholesterol and increased 7-dehydrocholesterol (7-DHC) levels. However, the enzyme putatively involved (7-DHC reductase) has not been isolated. We identified an SLOS patient with a de novo balanced chromosome translocation [t(7;20)(q32.1;q13.2)], and we propose that the translocation interrupts one of the patient`s SLOS alleles. We are pursuingmore » positional cloning to identify the SLOS gene. Using fluorescence in situ hybridization (FISH), we recently identified a chromosome 7 yeast artificial chromosome (YAC) that spans the breakpoint and places it onto physical and genetic maps. We are in the process of narrowing this region via overlapping YACs and YAC subclones, from which we will isolate candidate cDNAs. Any candidate gene disrupted by the translocation and mutated on the other allele will be proven to be the SLOS gene. Functional analysis of an SLOS cDNA may also determine its relationship to cholesterol metabolism and the observed biochemical abnormalities.« less

Convergence of GWA and candidate gene studies for alcoholism

PubMed Central

Olfson, Emily; Bierut, Laura Jean

2012-01-01

Background Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Methods Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported SNPs in candidate genes were examined in the Study of Alcohol Addiction: Genetics and Addiction (SAGE), a GWA study comparing alcohol dependent and non-dependent subjects. Results Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1 and rs4680 in COMT, are not replicated in SAGE (p> .05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p=0.0052, OR=1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls and the lowest p value of any SNP was .0006. Discussion We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African Ancestry populations. Due to lack of coverage, we were unable to rule out the contribution of other variants and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more generally complex diseases. PMID:22978509

Identification of 12 new susceptibility loci for different histotypes of epithelial ovarian cancer.

PubMed

Phelan, Catherine M; Kuchenbaecker, Karoline B; Tyrer, Jonathan P; Kar, Siddhartha P; Lawrenson, Kate; Winham, Stacey J; Dennis, Joe; Pirie, Ailith; Riggan, Marjorie J; Chornokur, Ganna; Earp, Madalene A; Lyra, Paulo C; Lee, Janet M; Coetzee, Simon; Beesley, Jonathan; McGuffog, Lesley; Soucy, Penny; Dicks, Ed; Lee, Andrew; Barrowdale, Daniel; Lecarpentier, Julie; Leslie, Goska; Aalfs, Cora M; Aben, Katja K H; Adams, Marcia; Adlard, Julian; Andrulis, Irene L; Anton-Culver, Hoda; Antonenkova, Natalia; Aravantinos, Gerasimos; Arnold, Norbert; Arun, Banu K; Arver, Brita; Azzollini, Jacopo; Balmaña, Judith; Banerjee, Susana N; Barjhoux, Laure; Barkardottir, Rosa B; Bean, Yukie; Beckmann, Matthias W; Beeghly-Fadiel, Alicia; Benitez, Javier; Bermisheva, Marina; Bernardini, Marcus Q; Birrer, Michael J; Bjorge, Line; Black, Amanda; Blankstein, Kenneth; Blok, Marinus J; Bodelon, Clara; Bogdanova, Natalia; Bojesen, Anders; Bonanni, Bernardo; Borg, Åke; Bradbury, Angela R; Brenton, James D; Brewer, Carole; Brinton, Louise; Broberg, Per; Brooks-Wilson, Angela; Bruinsma, Fiona; Brunet, Joan; Buecher, Bruno; Butzow, Ralf; Buys, Saundra S; Caldes, Trinidad; Caligo, Maria A; Campbell, Ian; Cannioto, Rikki; Carney, Michael E; Cescon, Terence; Chan, Salina B; Chang-Claude, Jenny; Chanock, Stephen; Chen, Xiao Qing; Chiew, Yoke-Eng; Chiquette, Jocelyne; Chung, Wendy K; Claes, Kathleen B M; Conner, Thomas; Cook, Linda S; Cook, Jackie; Cramer, Daniel W; Cunningham, Julie M; D'Aloisio, Aimee A; Daly, Mary B; Damiola, Francesca; Damirovna, Sakaeva Dina; Dansonka-Mieszkowska, Agnieszka; Dao, Fanny; Davidson, Rosemarie; DeFazio, Anna; Delnatte, Capucine; Doheny, Kimberly F; Diez, Orland; Ding, Yuan Chun; Doherty, Jennifer Anne; Domchek, Susan M; Dorfling, Cecilia M; Dörk, Thilo; Dossus, Laure; Duran, Mercedes; Dürst, Matthias; Dworniczak, Bernd; Eccles, Diana; Edwards, Todd; Eeles, Ros; Eilber, Ursula; Ejlertsen, Bent; Ekici, Arif B; Ellis, Steve; Elvira, Mingajeva; Eng, Kevin H; Engel, Christoph; Evans, D Gareth; Fasching, Peter A; Ferguson, Sarah; Ferrer, Sandra Fert; Flanagan, James M; Fogarty, Zachary C; Fortner, Renée T; Fostira, Florentia; Foulkes, William D; Fountzilas, George; Fridley, Brooke L; Friebel, Tara M; Friedman, Eitan; Frost, Debra; Ganz, Patricia A; Garber, Judy; García, María J; Garcia-Barberan, Vanesa; Gehrig, Andrea; Gentry-Maharaj, Aleksandra; Gerdes, Anne-Marie; Giles, Graham G; Glasspool, Rosalind; Glendon, Gord; Godwin, Andrew K; Goldgar, David E; Goranova, Teodora; Gore, Martin; Greene, Mark H; Gronwald, Jacek; Gruber, Stephen; Hahnen, Eric; Haiman, Christopher A; Håkansson, Niclas; Hamann, Ute; Hansen, Thomas V O; Harrington, Patricia A; Harris, Holly R; Hauke, Jan; Hein, Alexander; Henderson, Alex; Hildebrandt, Michelle A T; Hillemanns, Peter; Hodgson, Shirley; Høgdall, Claus K; Høgdall, Estrid; Hogervorst, Frans B L; Holland, Helene; Hooning, Maartje J; Hosking, Karen; Huang, Ruea-Yea; Hulick, Peter J; Hung, Jillian; Hunter, David J; Huntsman, David G; Huzarski, Tomasz; Imyanitov, Evgeny N; Isaacs, Claudine; Iversen, Edwin S; Izatt, Louise; Izquierdo, Angel; Jakubowska, Anna; James, Paul; Janavicius, Ramunas; Jernetz, Mats; Jensen, Allan; Jensen, Uffe Birk; John, Esther M; Johnatty, Sharon; Jones, Michael E; Kannisto, Päivi; Karlan, Beth Y; Karnezis, Anthony; Kast, Karin; Kennedy, Catherine J; Khusnutdinova, Elza; Kiemeney, Lambertus A; Kiiski, Johanna I; Kim, Sung-Won; Kjaer, Susanne K; Köbel, Martin; Kopperud, Reidun K; Kruse, Torben A; Kupryjanczyk, Jolanta; Kwong, Ava; Laitman, Yael; Lambrechts, Diether; Larrañaga, Nerea; Larson, Melissa C; Lazaro, Conxi; Le, Nhu D; Le Marchand, Loic; Lee, Jong Won; Lele, Shashikant B; Leminen, Arto; Leroux, Dominique; Lester, Jenny; Lesueur, Fabienne; Levine, Douglas A; Liang, Dong; Liebrich, Clemens; Lilyquist, Jenna; Lipworth, Loren; Lissowska, Jolanta; Lu, Karen H; Lubinński, Jan; Luccarini, Craig; Lundvall, Lene; Mai, Phuong L; Mendoza-Fandiño, Gustavo; Manoukian, Siranoush; Massuger, Leon F A G; May, Taymaa; Mazoyer, Sylvie; McAlpine, Jessica N; McGuire, Valerie; McLaughlin, John R; McNeish, Iain; Meijers-Heijboer, Hanne; Meindl, Alfons; Menon, Usha; Mensenkamp, Arjen R; Merritt, Melissa A; Milne, Roger L; Mitchell, Gillian; Modugno, Francesmary; Moes-Sosnowska, Joanna; Moffitt, Melissa; Montagna, Marco; Moysich, Kirsten B; Mulligan, Anna Marie; Musinsky, Jacob; Nathanson, Katherine L; Nedergaard, Lotte; Ness, Roberta B; Neuhausen, Susan L; Nevanlinna, Heli; Niederacher, Dieter; Nussbaum, Robert L; Odunsi, Kunle; Olah, Edith; Olopade, Olufunmilayo I; Olsson, Håkan; Olswold, Curtis; O'Malley, David M; Ong, Kai-Ren; Onland-Moret, N Charlotte; Orr, Nicholas; Orsulic, Sandra; Osorio, Ana; Palli, Domenico; Papi, Laura; Park-Simon, Tjoung-Won; Paul, James; Pearce, Celeste L; Pedersen, Inge Søkilde; Peeters, Petra H M; Peissel, Bernard; Peixoto, Ana; Pejovic, Tanja; Pelttari, Liisa M; Permuth, Jennifer B; Peterlongo, Paolo; Pezzani, Lidia; Pfeiler, Georg; Phillips, Kelly-Anne; Piedmonte, Marion; Pike, Malcolm C; Piskorz, Anna M; Poblete, Samantha R; Pocza, Timea; Poole, Elizabeth M; Poppe, Bruce; Porteous, Mary E; Prieur, Fabienne; Prokofyeva, Darya; Pugh, Elizabeth; Pujana, Miquel Angel; Pujol, Pascal; Radice, Paolo; Rantala, Johanna; Rappaport-Fuerhauser, Christine; Rennert, Gad; Rhiem, Kerstin; Rice, Patricia; Richardson, Andrea; Robson, Mark; Rodriguez, Gustavo C; Rodríguez-Antona, Cristina; Romm, Jane; Rookus, Matti A; Rossing, Mary Anne; Rothstein, Joseph H; Rudolph, Anja; Runnebaum, Ingo B; Salvesen, Helga B; Sandler, Dale P; Schoemaker, Minouk J; Senter, Leigha; Setiawan, V Wendy; Severi, Gianluca; Sharma, Priyanka; Shelford, Tameka; Siddiqui, Nadeem; Side, Lucy E; Sieh, Weiva; Singer, Christian F; Sobol, Hagay; Song, Honglin; Southey, Melissa C; Spurdle, Amanda B; Stadler, Zsofia; Steinemann, Doris; Stoppa-Lyonnet, Dominique; Sucheston-Campbell, Lara E; Sukiennicki, Grzegorz; Sutphen, Rebecca; Sutter, Christian; Swerdlow, Anthony J; Szabo, Csilla I; Szafron, Lukasz; Tan, Yen Y; Taylor, Jack A; Tea, Muy-Kheng; Teixeira, Manuel R; Teo, Soo-Hwang; Terry, Kathryn L; Thompson, Pamela J; Thomsen, Liv Cecilie Vestrheim; Thull, Darcy L; Tihomirova, Laima; Tinker, Anna V; Tischkowitz, Marc; Tognazzo, Silvia; Toland, Amanda Ewart; Tone, Alicia; Trabert, Britton; Travis, Ruth C; Trichopoulou, Antonia; Tung, Nadine; Tworoger, Shelley S; van Altena, Anne M; Van Den Berg, David; van der Hout, Annemarie H; van der Luijt, Rob B; Van Heetvelde, Mattias; Van Nieuwenhuysen, Els; van Rensburg, Elizabeth J; Vanderstichele, Adriaan; Varon-Mateeva, Raymonda; Vega, Ana; Edwards, Digna Velez; Vergote, Ignace; Vierkant, Robert A; Vijai, Joseph; Vratimos, Athanassios; Walker, Lisa; Walsh, Christine; Wand, Dorothea; Wang-Gohrke, Shan; Wappenschmidt, Barbara; Webb, Penelope M; Weinberg, Clarice R; Weitzel, Jeffrey N; Wentzensen, Nicolas; Whittemore, Alice S; Wijnen, Juul T; Wilkens, Lynne R; Wolk, Alicja; Woo, Michelle; Wu, Xifeng; Wu, Anna H; Yang, Hannah; Yannoukakos, Drakoulis; Ziogas, Argyrios; Zorn, Kristin K; Narod, Steven A; Easton, Douglas F; Amos, Christopher I; Schildkraut, Joellen M; Ramus, Susan J; Ottini, Laura; Goodman, Marc T; Park, Sue K; Kelemen, Linda E; Risch, Harvey A; Thomassen, Mads; Offit, Kenneth; Simard, Jacques; Schmutzler, Rita Katharina; Hazelett, Dennis; Monteiro, Alvaro N; Couch, Fergus J; Berchuck, Andrew; Chenevix-Trench, Georgia; Goode, Ellen L; Sellers, Thomas A; Gayther, Simon A; Antoniou, Antonis C; Pharoah, Paul D P

2017-05-01

To identify common alleles associated with different histotypes of epithelial ovarian cancer (EOC), we pooled data from multiple genome-wide genotyping projects totaling 25,509 EOC cases and 40,941 controls. We identified nine new susceptibility loci for different EOC histotypes: six for serous EOC histotypes (3q28, 4q32.3, 8q21.11, 10q24.33, 18q11.2 and 22q12.1), two for mucinous EOC (3q22.3 and 9q31.1) and one for endometrioid EOC (5q12.3). We then performed meta-analysis on the results for high-grade serous ovarian cancer with the results from analysis of 31,448 BRCA1 and BRCA2 mutation carriers, including 3,887 mutation carriers with EOC. This identified three additional susceptibility loci at 2q13, 8q24.1 and 12q24.31. Integrated analyses of genes and regulatory biofeatures at each locus predicted candidate susceptibility genes, including OBFC1, a new candidate susceptibility gene for low-grade and borderline serous EOC.

Identification of predictive markers of cytarabine response in AML by integrative analysis of gene-expression profiles with multiple phenotypes

PubMed Central

Lamba, Jatinder K; Crews, Kristine R; Pounds, Stanley B; Cao, Xueyuan; Gandhi, Varsha; Plunkett, William; Razzouk, Bassem I; Lamba, Vishal; Baker, Sharyn D; Raimondi, Susana C; Campana, Dario; Pui, Ching-Hon; Downing, James R; Rubnitz, Jeffrey E; Ribeiro, Raul C

2011-01-01

Aim To identify gene-expression signatures predicting cytarabine response by an integrative analysis of multiple clinical and pharmacological end points in acute myeloid leukemia (AML) patients. Materials & methods We performed an integrated analysis to associate the gene expression of diagnostic bone marrow blasts from acute myeloid leukemia (AML) patients treated in the discovery set (AML97; n = 42) and in the independent validation set (AML02; n = 46) with multiple clinical and pharmacological end points. Based on prior biological knowledge, we defined a gene to show a therapeutically beneficial (detrimental) pattern of association of its expression positively (negatively) correlated with favorable phenotypes such as intracellular cytarabine 5´-triphosphate levels, morphological response and event-free survival, and negatively (positively) correlated with unfavorable end points such as post-cytarabine DNA synthesis levels, minimal residual disease and cytarabine LC50. Results We identified 240 probe sets predicting a therapeutically beneficial pattern and 97 predicting detrimental pattern (p ≤ 0.005) in the discovery set. Of these, 60 were confirmed in the independent validation set. The validated probe sets correspond to genes involved in PIK3/PTEN/AKT/mTOR signaling, G-protein-coupled receptor signaling and leukemogenesis. This suggests that targeting these pathways as potential pharmacogenomic and therapeutic candidates could be useful for improving treatment outcomes in AML. Conclusion This study illustrates the power of integrated data analysis of genomic data as well as multiple clinical and pharmacologic end points in the identification of genes and pathways of biological relevance. PMID:21449673

A fast and high performance multiple data integration algorithm for identifying human disease genes

PubMed Central

2015-01-01

Background Integrating multiple data sources is indispensable in improving disease gene identification. It is not only due to the fact that disease genes associated with similar genetic diseases tend to lie close with each other in various biological networks, but also due to the fact that gene-disease associations are complex. Although various algorithms have been proposed to identify disease genes, their prediction performances and the computational time still should be further improved. Results In this study, we propose a fast and high performance multiple data integration algorithm for identifying human disease genes. A posterior probability of each candidate gene associated with individual diseases is calculated by using a Bayesian analysis method and a binary logistic regression model. Two prior probability estimation strategies and two feature vector construction methods are developed to test the performance of the proposed algorithm. Conclusions The proposed algorithm is not only generated predictions with high AUC scores, but also runs very fast. When only a single PPI network is employed, the AUC score is 0.769 by using F2 as feature vectors. The average running time for each leave-one-out experiment is only around 1.5 seconds. When three biological networks are integrated, the AUC score using F3 as feature vectors increases to 0.830, and the average running time for each leave-one-out experiment takes only about 12.54 seconds. It is better than many existing algorithms. PMID:26399620

Glutamatergic and GABAergic gene sets in attention-deficit/hyperactivity disorder: association to overlapping traits in ADHD and autism

PubMed Central

Naaijen, J; Bralten, J; Poelmans, G; Faraone, Stephen; Asherson, Philip; Banaschewski, Tobias; Buitelaar, Jan; Franke, Barbara; P Ebstein, Richard; Gill, Michael; Miranda, Ana; D Oades, Robert; Roeyers, Herbert; Rothenberger, Aribert; Sergeant, Joseph; Sonuga-Barke, Edmund; Anney, Richard; Mulas, Fernando; Steinhausen, Hans-Christoph; Glennon, J C; Franke, B; Buitelaar, J K

2017-01-01

Attention-deficit/hyperactivity disorder (ADHD) and autism spectrum disorders (ASD) often co-occur. Both are highly heritable; however, it has been difficult to discover genetic risk variants. Glutamate and GABA are main excitatory and inhibitory neurotransmitters in the brain; their balance is essential for proper brain development and functioning. In this study we investigated the role of glutamate and GABA genetics in ADHD severity, autism symptom severity and inhibitory performance, based on gene set analysis, an approach to investigate multiple genetic variants simultaneously. Common variants within glutamatergic and GABAergic genes were investigated using the MAGMA software in an ADHD case-only sample (n=931), in which we assessed ASD symptoms and response inhibition on a Stop task. Gene set analysis for ADHD symptom severity, divided into inattention and hyperactivity/impulsivity symptoms, autism symptom severity and inhibition were performed using principal component regression analyses. Subsequently, gene-wide association analyses were performed. The glutamate gene set showed an association with severity of hyperactivity/impulsivity (P=0.009), which was robust to correcting for genome-wide association levels. The GABA gene set showed nominally significant association with inhibition (P=0.04), but this did not survive correction for multiple comparisons. None of single gene or single variant associations was significant on their own. By analyzing multiple genetic variants within candidate gene sets together, we were able to find genetic associations supporting the involvement of excitatory and inhibitory neurotransmitter systems in ADHD and ASD symptom severity in ADHD. PMID:28072412

Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq

PubMed Central

Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

2018-01-01

Flax (Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits. PMID:29375606

Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

PubMed

Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

2017-01-01

Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

Genetic association of angiogenesis- and hypoxia-related gene polymorphisms with osteonecrosis of the femoral head

PubMed Central

Hong, Jung Min; Kim, Tae-Ho; Kim, Hyun-Ju; Park, Eui-Kyun

2010-01-01

Multiple factors have been implicated in the development of osteonecrosis of the femoral head (ONFH). In particular, non-traumatic ONFH is directly or indirectly related to injury of the vascular supply to the femoral head. Thus, hypoxia in the femoral head caused by impaired blood flow may be an important risk factor for ONFH. In this study, we investigated whether genetic variations of angiogenesis- and hypoxia-related genes contribute to an increased risk for the development of ONFH. Candidate genes were selected based on known hypoxia and angiogenesis pathways. An association study was performed using an Affymetrix Targeted Genotyping 3K Chip array with 460 ONFH patients and 300 control subjects. We showed that single nucleotide polymorphisms (SNPs) in the genes TF, VEGFC, IGFBP3, and ACE were associated with an increased risk of ONFH. On the other hand, SNPs in the KDR and NRP1 genes were associated with protection against ONFH. The most important finding was that one SNP (rs2453839) in the IGFBP3 gene was significantly associated with a higher risk of ONFH (P = 0.0061, OR 7.74). In subgroup analysis, most candidate gene variations that were associated with ONFH occurred in the idiopathic subgroup. Among other SNPs, ACE SNPs were associated with steroid-induced ONFH (P = 0.0018-0.0037, OR > 3). Collectively, our findings suggest that genetic variations in angiogenesis- and hypoxia-related genes may help to identify susceptibility factors for the development of ONFH in the Korean population. PMID:20215856

Identification of Streptococcus mitis321A vaccine antigens based on reverse vaccinology

PubMed Central

Zhang, Qiao; Lin, Kexiong; Wang, Changzheng; Xu, Zhi; Yang, Li; Ma, Qianli

2018-01-01

Streptococcus mitis (S. mitis) may transform into highly pathogenic bacteria. The aim of the present study was to identify potential antigen targets for designing an effective vaccine against the pathogenic S. mitis321A. The genome of S. mitis321A was sequenced using an Illumina Hiseq2000 instrument. Subsequently, Glimmer 3.02 and Tandem Repeat Finder (TRF) 4.04 were used to predict genes and tandem repeats, respectively, with DNA sequence function analysis using the Basic Local Alignment Search Tool (BLAST) in the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Cluster of Orthologous Groups of proteins (COG) databases. Putative gene antigen candidates were screened with BLAST ahead of phylogenetic tree analysis. The DNA sequence assembly size was 2,110,680 bp with 40.12% GC, 6 scaffolds and 9 contig. Consequently, 1,944 genes were predicted, and 119 TRF, 56 microsatellite DNA, 10 minisatellite DNA and 154 transposons were acquired. The predicted genes were associated with various pathways and functions concerning membrane transport and energy metabolism. Multiple putative genes encoding surface proteins, secreted proteins and virulence factors, as well as essential genes were determined. The majority of essential genes belonged to a phylogenetic lineage, while 321AGL000129 and 321AGL000299 were on the same branch. The current study provided useful information regarding the biological function of the S. mitis321A genome and recommends putative antigen candidates for developing a potent vaccine against S. mitis. PMID:29620181

A direct molecular link between the autism candidate gene RORa and the schizophrenia candidate MIR137

NASA Astrophysics Data System (ADS)

Devanna, Paolo; Vernes, Sonja C.

2014-02-01

Retinoic acid-related orphan receptor alpha gene (RORa) and the microRNA MIR137 have both recently been identified as novel candidate genes for neuropsychiatric disorders. RORa encodes a ligand-dependent orphan nuclear receptor that acts as a transcriptional regulator and miR-137 is a brain enriched small non-coding RNA that interacts with gene transcripts to control protein levels. Given the mounting evidence for RORa in autism spectrum disorders (ASD) and MIR137 in schizophrenia and ASD, we investigated if there was a functional biological relationship between these two genes. Herein, we demonstrate that miR-137 targets the 3'UTR of RORa in a site specific manner. We also provide further support for MIR137 as an autism candidate by showing that a large number of previously implicated autism genes are also putatively targeted by miR-137. This work supports the role of MIR137 as an ASD candidate and demonstrates a direct biological link between these previously unrelated autism candidate genes.

Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass.

PubMed

Jespersen, David; Belanger, Faith C; Huang, Bingru

2017-01-01

Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection.

Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass

PubMed Central

Jespersen, David; Belanger, Faith C.; Huang, Bingru

2017-01-01

Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection. PMID:28187136

Sequencing of five left-right cerebral asymmetry genes in a cohort of schizophrenia and schizotypal disorder patients from Russia.

PubMed

Levchenko, Anastasia; Davtian, Stepan; Petrova, Natalia; Malashichev, Yegor

2014-04-01

Schizophrenia is a severe psychiatric disorder, affecting ∼1% of the human population. The genetic contribution to schizophrenia is significant, but the genetics are complex and many aspects of brain functioning, from neural development to synapse structure, seem to be involved in the pathogenesis. A novel way to study the molecular causes of schizophrenia is to study the genetics of left-right (LR) brain asymmetry, the disease feature often observed in schizophrenic patients. In this study, we analyzed by sequencing five candidate LR cerebral asymmetry genes in a cohort of 95 schizophrenia and schizotypal disorder patients from Saint Petersburg, Russia. The gene list included LMO4, LRRTM1, FOXP2, the PCDH11X/Y gene pair, and SRY. We found 17 previously unreported variants in the genes LRRTM1, FOXP2, LMO4, and PCDH11X in the 3'-UTR and 5'-UTR. The variants might contribute toward an altered mRNA processing, which could lead to altered mRNA amounts in developing neurons of the brain and establishment of an incorrect LR asymmetry profile. This is the first study in which multiple candidate genes for cerebral LR asymmetry and schizophrenia have been analyzed by sequencing. The approach to study the genetics of schizophrenia from the perspective of an LR cerebral asymmetry disturbance deserves more attention.

Genes controlling seed dormancy and pre-harvest sprouting in a rice-wheat-barley comparison.

PubMed

Li, Chengdao; Ni, Peixiang; Francki, Michael; Hunter, Adam; Zhang, Yong; Schibeci, David; Li, Heng; Tarr, Allen; Wang, Jun; Cakir, Mehmet; Yu, Jun; Bellgard, Matthew; Lance, Reg; Appels, Rudi

2004-05-01

Pre-harvest sprouting results in significant economic loss for the grain industry around the world. Lack of adequate seed dormancy is the major reason for pre-harvest sprouting in the field under wet weather conditions. Although this trait is governed by multiple genes it is also highly heritable. A major QTL controlling both pre-harvest sprouting and seed dormancy has been identified on the long arm of barley chromosome 5H, and it explains over 70% of the phenotypic variation. Comparative genomics approaches among barley, wheat and rice were used to identify candidate gene(s) controlling seed dormancy and hence one aspect of pre-harvest sprouting. The barley seed dormancy/pre-harvest sprouting QTL was located in a region that showed good synteny with the terminal end of the long arm of rice chromosome 3. The rice DNA sequences were annotated and a gene encoding GA20-oxidase was identified as a candidate gene controlling the seed dormancy/pre-harvest sprouting QTL on 5HL. This chromosomal region also shared synteny with the telomere region of wheat chromosome 4AL, but was located outside of the QTL reported for seed dormancy in wheat. The wheat chromosome 4AL QTL region for seed dormancy was syntenic to both rice chromosome 3 and 11. In both cases, corresponding QTLs for seed dormancy have been mapped in rice.

Population Variation Reveals Independent Selection toward Small Body Size in Chinese Debao Pony

PubMed Central

Kader, Adiljan; Li, Yan; Dong, Kunzhe; Irwin, David M.; Zhao, Qianjun; He, Xiaohong; Liu, Jianfeng; Pu, Yabin; Gorkhali, Neena Amatya; Liu, Xuexue; Jiang, Lin; Li, Xiangchen; Guan, Weijun; Zhang, Yaping; Wu, Dong-Dong; Ma, Yuehui

2016-01-01

Body size, one of the most important quantitative traits under evolutionary scrutiny, varies considerably among species and among populations within species. Revealing the genetic basis underlying this variation is very important, particularly in humans where there is a close relationship with diseases and in domestic animals as the selective patterns are associated with improvements in production traits. The Debao pony is a horse breed with small body size that is unique to China; however, it is unknown whether the size-related candidate genes identified in Western breeds also account for the small body size of the Debao pony. Here, we compared individual horses from the Debao population with other two Chinese horse populations using single nucleotide polymorphisms (SNPs) identified with the Equine SNP 65 Bead Chip. The previously reported size-related candidate gene HMGA2 showed a significant signature for selection, consistent with its role observed in human populations. More interestingly, we found a candidate gene TBX3, which had not been observed in previous studies on horse body size that displayed the highest differentiation and most significant association, and thus likely is the dominating factor for the small stature of the Debao pony. Further comparison between the Debao pony and other breeds of horses from around the world demonstrated that TBX3 was selected independently in the Debao pony, suggesting that there were multiple origins of small stature in the horse. PMID:26637467

High density genotyping of STAT4 gene reveals multiple haplotypic associations with Systemic Lupus Erythematosus in different racial groups

PubMed Central

Namjou, Bahram; Sestak, Andrea L.; Armstrong, Don L.; Zidovetzki, Raphael; Kelly, Jennifer A.; Jacob, Noam; Ciobanu, Voicu; Kaufman, Kenneth M.; Ojwang, Joshua O.; Ziegler, Julie; Quismorio, Francesco; Reiff, Andreas; Myones, Barry L.; Guthridge, Joel M.; Nath, Swapan K.; Bruner, Gail R.; Mehrian-Shai, Ruth; Silverman, Earl; Klein-Gitelman, Marisa; McCurdy, Deborah; Wagner-Weiner, Linda; Nocton, James J.; Putterman, Chaim; Bae, Sang-Cheol; Kim, Yun Jung; Petri, Michelle; Reveille, John D.; Vyse, Timothy J.; Gilkeson, Gary S.; Kamen, Diane L.; Alarcón-Riquelme, Marta E.; Gaffney, Patrick M.; Moser, Kathy L; Merrill, Joan T.; Scofield, R. Hal; James, Judith A.; Langefeld, Carl D.; Harley, John B.; Jacob, Chaim O.

2009-01-01

Objective Systemic lupus erythematosus (SLE) is the prototypic systemic autoimmune disorder with complex etiology and a strong genetic component. Recently, gene products involved in the interferon pathway have been under intense investigation in SLE pathogenesis. STAT1 and STAT4 are transcription factors that play key roles in the interferon and Th1 signaling pathways, making them attractive candidates for SLE susceptibility. Methods Fifty-six single-nucleotide polymorphisms (SNPs) across STAT1 and STAT4 genes on chromosome 2 were genotyped using Illumina platform as a part of extensive association study in a large collection of 9923 lupus cases and controls from different racial groups. DNA from patients and controls was obtained from peripheral blood. Principal component analyses and population based case-control association analyses were performed and the p values, FDR q values and Odds ratios with 95% confidence intervals (95% CIs) were calculated. Results We observed strong genetic associations with SLE and multiple SNPs located within the STAT4 gene in different ethnicities (Fisher combined p= 7.02×10−25). In addition to strong confirmation of the association in the 3rd intronic region of this gene reported previously, we identified additional haplotypic association across STAT4 gene and in particular a common risk haplotype that is found in multiple racial groups. In contrast, only a relatively weak suggestive association was observed with STAT1, probably due to the proximity to STAT4. Conclusion Our findings indicate that the STAT4 gene is likely to be a crucial component in SLE pathogenesis among multiple racial groups. The functional effects of this association, when revealed, might improve our understanding of the disease and provide new therapeutic targets. PMID:19333953

NEIBank: Genomics and bioinformatics resources for vision research

PubMed Central

Peterson, Katherine; Gao, James; Buchoff, Patee; Jaworski, Cynthia; Bowes-Rickman, Catherine; Ebright, Jessica N.; Hauser, Michael A.; Hoover, David

2008-01-01

NEIBank is an integrated resource for genomics and bioinformatics in vision research. It includes expressed sequence tag (EST) data and sequence-verified cDNA clones for multiple eye tissues of several species, web-based access to human eye-specific SAGE data through EyeSAGE, and comprehensive, annotated databases of known human eye disease genes and candidate disease gene loci. All expression- and disease-related data are integrated in EyeBrowse, an eye-centric genome browser. NEIBank provides a comprehensive overview of current knowledge of the transcriptional repertoires of eye tissues and their relation to pathology. PMID:18648525

A small number of candidate gene SNPs reveal continental ancestry in African Americans

PubMed Central

KODAMAN, NURI; ALDRICH, MELINDA C.; SMITH, JEFFREY R.; SIGNORELLO, LISA B.; BRADLEY, KEVIN; BREYER, JOAN; COHEN, SARAH S.; LONG, JIRONG; CAI, QIUYIN; GILES, JUSTIN; BUSH, WILLIAM S.; BLOT, WILLIAM J.; MATTHEWS, CHARLES E.; WILLIAMS, SCOTT M.

2013-01-01

SUMMARY Using genetic data from an obesity candidate gene study of self-reported African Americans and European Americans, we investigated the number of Ancestry Informative Markers (AIMs) and candidate gene SNPs necessary to infer continental ancestry. Proportions of African and European ancestry were assessed with STRUCTURE (K=2), using 276 AIMs. These reference values were compared to estimates derived using 120, 60, 30, and 15 SNP subsets randomly chosen from the 276 AIMs and from 1144 SNPs in 44 candidate genes. All subsets generated estimates of ancestry consistent with the reference estimates, with mean correlations greater than 0.99 for all subsets of AIMs, and mean correlations of 0.99±0.003; 0.98± 0.01; 0.93±0.03; and 0.81± 0.11 for subsets of 120, 60, 30, and 15 candidate gene SNPs, respectively. Among African Americans, the median absolute difference from reference African ancestry values ranged from 0.01 to 0.03 for the four AIMs subsets and from 0.03 to 0.09 for the four candidate gene SNP subsets. Furthermore, YRI/CEU Fst values provided a metric to predict the performance of candidate gene SNPs. Our results demonstrate that a small number of SNPs randomly selected from candidate genes can be used to estimate admixture proportions in African Americans reliably. PMID:23278390

Planar cell polarity pathway genes and risk for spina bifida.

PubMed

Wen, Shu; Zhu, Huiping; Lu, Wei; Mitchell, Laura E; Shaw, Gary M; Lammer, Edward J; Finnell, Richard H

2010-02-01

Spina bifida, a neural tube closure defect (NTD) involving the posterior portion of what will ultimately give rise to the spinal cord, is one of the most common and serious birth defects. The etiology of spina bifida is thought to be multi-factorial and involve multiple interacting genes and environmental factors. The causes of this congenital malformation remain largely unknown. However, several candidate genes for spina bifida have been identified in lower vertebrates, including the planar cell polarity (PCP) genes. We used data from a case-control study conducted in California to evaluate the association between variation within several key PCP genes and the risk of spina bifida. The PCP genes included in this study were the human homologs of the Xenopus genes Flamingo, Strabismus, Prickle, Dishevelled, and Scrib, two of the homologs of Xenopus Wnt genes, WNT5A and WNT11, and two of the homologs of Xenopus Frizzled, FZD3 and FZD6. None of the 172 SNPs that were evaluated were significantly associated with spina bifida in any racial/ethnic group after correction for multiple testing. However, several SNPs in the PRICKLE2 gene had unadjusted P-value <0.01. In conclusion, our results, though largely negative, suggest that the PRICKLE2 gene may potentially modify the risk of spina bifida and deserves further investigation. Copyright 2010 Wiley-Liss, Inc.

Degrees of separation as a statistical tool for evaluating candidate genes.

PubMed

Nelson, Ronald M; Pettersson, Mats E

2014-12-01

Selection of candidate genes is an important step in the exploration of complex genetic architecture. The number of gene networks available is increasing and these can provide information to help with candidate gene selection. It is currently common to use the degree of connectedness in gene networks as validation in Genome Wide Association (GWA) and Quantitative Trait Locus (QTL) mapping studies. However, it can cause misleading results if not validated properly. Here we present a method and tool for validating the gene pairs from GWA studies given the context of the network they co-occur in. It ensures that proposed interactions and gene associations are not statistical artefacts inherent to the specific gene network architecture. The CandidateBacon package provides an easy and efficient method to calculate the average degree of separation (DoS) between pairs of genes to currently available gene networks. We show how these empirical estimates of average connectedness are used to validate candidate gene pairs. Validation of interacting genes by comparing their connectedness with the average connectedness in the gene network will provide support for said interactions by utilising the growing amount of gene network information available. Copyright © 2014 Elsevier Ltd. All rights reserved.

Integration of Experiments across Diverse Environments Identifies the Genetic Determinants of Variation in Sorghum bicolor Seed Element Composition.

PubMed

Shakoor, Nadia; Ziegler, Greg; Dilkes, Brian P; Brenton, Zachary; Boyles, Richard; Connolly, Erin L; Kresovich, Stephen; Baxter, Ivan

2016-04-01

Seedling establishment and seed nutritional quality require the sequestration of sufficient element nutrients. The identification of genes and alleles that modify element content in the grains of cereals, including sorghum (Sorghum bicolor), is fundamental to developing breeding and selection methods aimed at increasing bioavailable element content and improving crop growth. We have developed a high-throughput work flow for the simultaneous measurement of multiple elements in sorghum seeds. We measured seed element levels in the genotyped Sorghum Association Panel, representing all major cultivated sorghum races from diverse geographic and climatic regions, and mapped alleles contributing to seed element variation across three environments by genome-wide association. We observed significant phenotypic and genetic correlation between several elements across multiple years and diverse environments. The power of combining high-precision measurements with genome-wide association was demonstrated by implementing rank transformation and a multilocus mixed model to map alleles controlling 20 element traits, identifying 255 loci affecting the sorghum seed ionome. Sequence similarity to genes characterized in previous studies identified likely causative genes for the accumulation of zinc, manganese, nickel, calcium, and cadmium in sorghum seeds. In addition to strong candidates for these five elements, we provide a list of candidate loci for several other elements. Our approach enabled the identification of single-nucleotide polymorphisms in strong linkage disequilibrium with causative polymorphisms that can be evaluated in targeted selection strategies for plant breeding and improvement. © 2016 American Society of Plant Biologists. All Rights Reserved.

Identification of chromosome 7 inversion breakpoints in an autistic family narrows candidate region for autism susceptibility.

PubMed

Cukier, Holly N; Skaar, David A; Rayner-Evans, Melissa Y; Konidari, Ioanna; Whitehead, Patrice L; Jaworski, James M; Cuccaro, Michael L; Pericak-Vance, Margaret A; Gilbert, John R

2009-10-01

Chromosomal breaks and rearrangements have been observed in conjunction with autism and autistic spectrum disorders. A chromosomal inversion has been previously reported in autistic siblings, spanning the region from approximately 7q22.1 to 7q31. This family is distinguished by having multiple individuals with autism and associated disabilities. The region containing the inversion has been strongly implicated in autism by multiple linkage studies, and has been particularly associated with language defects in autism as well as in other disorders with language components. Mapping of the inversion breakpoints by FISH has localized the inversion to the region spanning approximately 99-108.75 Mb of chromosome 7. The proximal breakpoint has the potential to disrupt either the coding sequence or regulatory regions of a number of cytochrome P450 genes while the distal region falls in a relative gene desert. Copy number variant analysis of the breakpoint regions detected no duplication or deletion that could clearly be associated with disease status. Association analysis in our autism data set using single nucleotide polymorphisms located near the breakpoints showed no significant association with proximal breakpoint markers, but has identified markers near the distal breakpoint ( approximately 108-110 Mb) with significant associations to autism. The chromosomal abnormality in this family strengthens the case for an autism susceptibility gene in the chromosome 7q22-31 region and targets a candidate region for further investigation.

Search for sarcoidosis candidate genes by integration of data from genomic, transcriptomic and proteomic studies.

PubMed

Maver, Ales; Medica, Igor; Peterlin, Borut

2009-12-01

The search for gene candidates in multifactorial diseases such as sarcoidosis can be based on the integration of linkage association data, gene expression data, and protein profile data from genomic, transcriptomic and proteomic studies, respectively. In this study we performed a literature-based search for studies reporting such data, followed by integration of collected information. Different databases were examined--Medline, HugGE Navigator, ArrayExpress and Gene Expression Omnibus (GEO). Candidate genes were defined as genes which were reported in at least 2 different types of omics studies. Genes previously investigated in sarcoidosis were excluded from further analyses. We identified 177 genes associated with sarcoidosis as potential new candidate genes. Subsequently, 9 gene candidates identified to overlap in 2 different types of studies (genomic, transcriptomic and/or proteomic) were consistently reported in at least 3 studies: SERPINB1, FABP4, S100A8, HBEGF, IL7R, LRIG1, PTPN23, DPM2 and NUP214. These genes are involved in regulation of immune response, cellular proliferation, apoptosis, inhibition of protease activity, lipid metabolism. Exact biological functions of HBEGF, LRIG1, PTPN23, DPM2 and NUP214 remain to be completely elucidated. We propose 9 candidate genes: SERPINB1, FABP4, S100A8, HBEGF, IL7R, LRIG1, PTPN23, DPM2 and NUP214, as genes with high potential for association with sarcoidosis.

Transposon mutagenesis identifies genes that cooperate with mutant Pten in breast cancer progression

PubMed Central

Rangel, Roberto; Lee, Song-Choon; Hon-Kim Ban, Kenneth; Guzman-Rojas, Liliana; Mann, Michael B.; Newberg, Justin Y.; McNoe, Leslie A.; Selvanesan, Luxmanan; Ward, Jerrold M.; Rust, Alistair G.; Chin, Kuan-Yew; Black, Michael A.; Jenkins, Nancy A.; Copeland, Neal G.

2016-01-01

Triple-negative breast cancer (TNBC) has the worst prognosis of any breast cancer subtype. To better understand the genetic forces driving TNBC, we performed a transposon mutagenesis screen in a phosphatase and tensin homolog (Pten) mutant mice and identified 12 candidate trunk drivers and a much larger number of progression genes. Validation studies identified eight TNBC tumor suppressor genes, including the GATA-like transcriptional repressor TRPS1. Down-regulation of TRPS1 in TNBC cells promoted epithelial-to-mesenchymal transition (EMT) by deregulating multiple EMT pathway genes, in addition to increasing the expression of SERPINE1 and SERPINB2 and the subsequent migration, invasion, and metastasis of tumor cells. Transposon mutagenesis has thus provided a better understanding of the genetic forces driving TNBC and discovered genes with potential clinical importance in TNBC. PMID:27849608

Biomine: predicting links between biological entities using network models of heterogeneous databases.

PubMed

Eronen, Lauri; Toivonen, Hannu

2012-06-06

Biological databases contain large amounts of data concerning the functions and associations of genes and proteins. Integration of data from several such databases into a single repository can aid the discovery of previously unknown connections spanning multiple types of relationships and databases. Biomine is a system that integrates cross-references from several biological databases into a graph model with multiple types of edges, such as protein interactions, gene-disease associations and gene ontology annotations. Edges are weighted based on their type, reliability, and informativeness. We present Biomine and evaluate its performance in link prediction, where the goal is to predict pairs of nodes that will be connected in the future, based on current data. In particular, we formulate protein interaction prediction and disease gene prioritization tasks as instances of link prediction. The predictions are based on a proximity measure computed on the integrated graph. We consider and experiment with several such measures, and perform a parameter optimization procedure where different edge types are weighted to optimize link prediction accuracy. We also propose a novel method for disease-gene prioritization, defined as finding a subset of candidate genes that cluster together in the graph. We experimentally evaluate Biomine by predicting future annotations in the source databases and prioritizing lists of putative disease genes. The experimental results show that Biomine has strong potential for predicting links when a set of selected candidate links is available. The predictions obtained using the entire Biomine dataset are shown to clearly outperform ones obtained using any single source of data alone, when different types of links are suitably weighted. In the gene prioritization task, an established reference set of disease-associated genes is useful, but the results show that under favorable conditions, Biomine can also perform well when no such information is available.The Biomine system is a proof of concept. Its current version contains 1.1 million entities and 8.1 million relations between them, with focus on human genetics. Some of its functionalities are available in a public query interface at http://biomine.cs.helsinki.fi, allowing searching for and visualizing connections between given biological entities.

Matrix metalloproteinases and educational attainment in refractive error: evidence of gene-environment interactions in the AREDS study

PubMed Central

Wojciechowski, Robert; Yee, Stephanie S.; Simpson, Claire L.; Bailey-Wilson, Joan E.; Stambolian, Dwight

2012-01-01

Purpose A previous study of Old Order Amish families has shown association of ocular refraction with markers proximal to matrix metalloproteinase (MMP) genes MMP1 and MMP10 and intragenic to MMP2. We conducted a candidate gene replication study of association between refraction and single nucleotide polymorphisms (SNPs) within these genomic regions. Design Candidate gene genetic association study. Participants 2,000 participants drawn from the Age Related Eye Disease Study (AREDS) were chosen for genotyping. After quality control filtering, 1912 individuals were available for analysis. Methods Microarray genotyping was performed using the HumanOmni 2.5 bead array. SNPs originally typed in the previous Amish association study were extracted for analysis. In addition, haplotype tagging SNPs were genotyped using TaqMan assays. Quantitative trait association analyses of mean spherical equivalent refraction (MSE) were performed on 30 markers using linear regression models and an additive genetic risk model, while adjusting for age, sex, education, and population substructure. Post-hoc analyses were performed after stratifying on a dichotomous education variable. Pointwise (P-emp) and multiple-test study-wise (P-multi) significance levels were calculated empirically through permutation. Main outcome measures MSE was used as a quantitative measure of ocular refraction. Results The mean age and ocular refraction were 68 years (SD=4.7) and +0.55 D (SD=2.14), respectively. Pointwise statistical significance was obtained for rs1939008 (P-emp=0.0326). No SNP attained statistical significance after correcting for multiple testing. In stratified analyses, multiple SNPs reached pointwise significance in the lower-education group: 2 of these were statistically significant after multiple testing correction. The two highest-ranking SNPs in Amish families (rs1939008 and rs9928731) showed pointwise P-emp<0.01 in the lower-education stratum of AREDS participants. Conclusions We show suggestive evidence of replication of an association signal for ocular refraction to a marker between MMP1 and MMP10. We also provide evidence of a gene-environment interaction between previously-reported markers and education on refractive error. Variants in MMP1- MMP10 and MMP2 regions appear to affect population variation in ocular refraction in environmental conditions less favorable for myopia development. PMID:23098370

Identification and reproducibility of diagnostic DNA markers for tuber starch and yield optimization in a novel association mapping population of potato (Solanum tuberosum L.).

PubMed

Schönhals, E M; Ortega, F; Barandalla, L; Aragones, A; Ruiz de Galarreta, J I; Liao, J-C; Sanetomo, R; Walkemeier, B; Tacke, E; Ritter, E; Gebhardt, C

2016-04-01

SNPs in candidate genes Pain - 1, InvCD141 (invertases), SSIV (starch synthase), StCDF1 (transcription factor), LapN (leucine aminopeptidase), and cytoplasm type are associated with potato tuber yield, starch content and/or starch yield. Tuber yield (TY), starch content (TSC), and starch yield (TSY) are complex characters of high importance for the potato crop in general and for industrial starch production in particular. DNA markers associated with superior alleles of genes that control the natural variation of TY, TSC, and TSY could increase precision and speed of breeding new cultivars optimized for potato starch production. Diagnostic DNA markers are identified by association mapping in populations of tetraploid potato varieties and advanced breeding clones. A novel association mapping population of 282 genotypes including varieties, breeding clones and Andean landraces was assembled and field evaluated in Northern Spain for TY, TSC, TSY, tuber number (TN) and tuber weight (TW). The landraces had lower mean values of TY, TW, TN, and TSY. The population was genotyped for 183 microsatellite alleles, 221 single nucleotide polymorphisms (SNPs) in fourteen candidate genes and eight known diagnostic markers for TSC and TSY. Association test statistics including kinship and population structure reproduced five known marker-trait associations of candidate genes and discovered new ones, particularly for tuber yield and starch yield. The inclusion of landraces increased the number of detected marker-trait associations. Integration of the present association mapping results with previous QTL linkage mapping studies for TY, TSC, TSY, TW, TN, and tuberization revealed some hot spots of QTL for these traits in the potato genome. The genomic positions of markers linked or associated with QTL for complex tuber traits suggest high multiplicity and genome wide distribution of the underlying genes.

Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia

PubMed Central

van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.

2012-01-01

Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

Grouping and characterization of putative glycosyltransferase genes from Panax ginseng Meyer.

PubMed

Khorolragchaa, Altanzul; Kim, Yu-Jin; Rahimi, Shadi; Sukweenadhi, Johan; Jang, Moon-Gi; Yang, Deok-Chun

2014-02-15

Glycosyltransferases are members of the multigene family of plants that can transfer single or multiple activated sugars to a range of plant molecules, resulting in the glycosylation of plant compounds. Although the activities of many glycosyltransferases and their products have been recognized for a long time, only in recent years were some glycosyltransferase genes identified and few have been functionally characterized in detail. Korean ginseng (Panax ginseng Meyer), belonging to Araliaceae, has been well known as a popular mysterious medicinal herb in East Asia for over 2,000 years. A total of 704 glycosyltransferase unique sequences have been found from a ginseng expressed sequence tag (EST) library, and these sequences encode enzymes responsible for the secondary metabolite biosynthesis. Finally, twelve UDP glycosyltransferases (UGTs) were selected as the candidates most likely to be involved in triterpenoid synthesis. In this study, we classified the candidate P. ginseng UGTs (PgUGTs) into proper families and groups, which resulted in eight UGT families and six UGT groups. We also investigated those gene candidates encoding for glycosyltransferases by analysis of gene expression in methyl jasmonate (MeJA)-treated ginseng adventitious roots and different tissues from four-year-old ginseng using quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). For organ-specific expression, most of PgUGT transcription levels were higher in leaves and roots compared with flower buds and stems. The transcription of PgUGTs in adventitious roots treated with MeJA increased as compared with the control. PgUGT1 and PgUGT2, which belong to the UGT71 family genes expressed in MeJA-treated adventitious roots, were especially sensitive, showing 33.32 and 38.88-fold expression increases upon 24h post-treatments, respectively. © 2013 Elsevier B.V. All rights reserved.

Mapping eQTLs in the Norfolk Island Genetic Isolate Identifies Candidate Genes for CVD Risk Traits

PubMed Central

Benton, Miles C.; Lea, Rod A.; Macartney-Coxson, Donia; Carless, Melanie A.; Göring, Harald H.; Bellis, Claire; Hanna, Michelle; Eccles, David; Chambers, Geoffrey K.; Curran, Joanne E.; Harper, Jacquie L.; Blangero, John; Griffiths, Lyn R.

2013-01-01

Cardiovascular disease (CVD) affects millions of people worldwide and is influenced by numerous factors, including lifestyle and genetics. Expression quantitative trait loci (eQTLs) influence gene expression and are good candidates for CVD risk. Founder-effect pedigrees can provide additional power to map genes associated with disease risk. Therefore, we identified eQTLs in the genetic isolate of Norfolk Island (NI) and tested for associations between these and CVD risk factors. We measured genome-wide transcript levels of blood lymphocytes in 330 individuals and used pedigree-based heritability analysis to identify heritable transcripts. eQTLs were identified by genome-wide association testing of these transcripts. Testing for association between CVD risk factors (i.e., blood lipids, blood pressure, and body fat indices) and eQTLs revealed 1,712 heritable transcripts (p < 0.05) with heritability values ranging from 0.18 to 0.84. From these, we identified 200 cis-acting and 70 trans-acting eQTLs (p < 1.84 × 10−7) An eQTL-centric analysis of CVD risk traits revealed multiple associations, including 12 previously associated with CVD-related traits. Trait versus eQTL regression modeling identified four CVD risk candidates (NAAA, PAPSS1, NME1, and PRDX1), all of which have known biological roles in disease. In addition, we implicated several genes previously associated with CVD risk traits, including MTHFR and FN3KRP. We have successfully identified a panel of eQTLs in the NI pedigree and used this to implicate several genes in CVD risk. Future studies are required for further assessing the functional importance of these eQTLs and whether the findings here also relate to outbred populations. PMID:24314549

Genetic variation predicting cisplatin cytotoxicity associated with overall survival in lung cancer patients receiving platinum-based chemotherapy †, ‡

PubMed Central

Tan, Xiang-Lin; Moyer, Ann M.; Fridley, Brooke L.; Schaid, Daniel J.; Niu, Nifang; Batzler, Anthony J.; Jenkins, Gregory D.; Abo, Ryan P.; Li, Liang; Cunningham, Julie M.; Sun, Zhifu; Yang, Ping; Wang, Liewei

2011-01-01

Purpose Inherited variability in the prognosis of lung cancer patients treated with platinum-based chemotherapy has been widely investigated. However, the overall contribution of genetic variation to platinum response is not well established. To identify novel candidate SNPs/genes, we performed a genome-wide association study (GWAS) for cisplatin cytotoxicity using lymphoblastoid cell lines (LCLs), followed by an association study of selected SNPs from the GWAS with overall survival (OS) in lung cancer patients. Experimental Design GWAS for cisplatin were performed with 283 ethnically diverse LCLs. 168 top SNPs were genotyped in 222 small cell and 961 non-small cell lung cancer (SCLC, NSCLC) patients treated with platinum-based therapy. Association of the SNPs with OS was determined using the Cox regression model. Selected candidate genes were functionally validated by siRNA knockdown in human lung cancer cells. Results Among 157 successfully genotyped SNPs, 9 and 10 SNPs were top SNPs associated with OS for patients with NSCLC and SCLC, respectively, although they were not significant after adjusting for multiple testing. Fifteen genes, including 7 located within 200 kb up or downstream of the four top SNPs and 8 genes for which expression was correlated with three SNPs in LCLs were selected for siRNA screening. Knockdown of DAPK3 and METTL6, for which expression levels were correlated with the rs11169748 and rs2440915 SNPs, significantly decreased cisplatin sensitivity in lung cancer cells. Conclusions This series of clinical and complementary laboratory-based functional studies identified several candidate genes/SNPs that might help predict treatment outcomes for platinum-based therapy of lung cancer. PMID:21775533

Identification of genetic aberrations on chromosome 22 outside the NF2 locus in schwannomatosis and neurofibromatosis type 2.

PubMed

Buckley, Patrick G; Mantripragada, Kiran K; Díaz de Ståhl, Teresita; Piotrowski, Arkadiusz; Hansson, Caisa M; Kiss, Hajnalka; Vetrie, David; Ernberg, Ingemar T; Nordenskjöld, Magnus; Bolund, Lars; Sainio, Markku; Rouleau, Guy A; Niimura, Michihito; Wallace, Andrew J; Evans, D Gareth R; Grigelionis, Gintautas; Menzel, Uwe; Dumanski, Jan P

2005-12-01

Schwannomatosis is characterized by multiple peripheral and cranial nerve schwannomas that occur in the absence of bilateral 8th cranial nerve schwannomas. The latter is the main diagnostic criterion of neurofibromatosis type 2 (NF2), which is a related but distinct disorder. The genetic factors underlying the differences between schwannomatosis and NF2 are poorly understood, although available evidence implicates chromosome 22 as the primary location of the gene(s) of interest. To investigate this, we comprehensively profiled the DNA copy number in samples from sporadic and familial schwannomatosis, NF2, and a large cohort of normal controls. Using a tiling-path chromosome 22 genomic array, we identified two candidate regions of copy number variation, which were further characterized by a PCR-based array with higher resolution. The latter approach allows the detection of minute alterations in total genomic DNA, with as little as 1.5 kb per measurement point of nonredundant sequence on the array. In DNA derived from peripheral blood from a schwannomatosis patient and a sporadic schwannoma sample, we detected rearrangements of the immunoglobulin lambda (IGL) locus, which is unlikely to be due to a B-cell specific somatic recombination of IGL. Analysis of normal controls indicated that these IGL rearrangements were restricted to schwannomatosis/schwannoma samples. In the second candidate region spanning GSTT1 and CABIN1 genes, we observed a frequent copy number polymorphism at the GSTT1 locus. We further describe missense mutations in the CABIN1 gene that are specific to samples from schwannomatosis and NF2 and make this gene a plausible candidate for contributing to the pathogenesis of these disorders. Copyright 2005 Wiley-Liss, Inc.

Genome-Wide Screening of Genes Showing Altered Expression in Liver Metastases of Human Colorectal Cancers by cDNA Microarray1

PubMed Central

Yanagawa, Rempei; Furukawa, Yoichi; Tsunoda, Tatsuhiko; Kitahara, Osamu; Kameyama, Masao; Murata, Kohei; Ishikawa, Osamu; Nakamura, Yusuke

2001-01-01

Abstract In spite of intensive and increasingly successful attempts to determine the multiple steps involved in colorectal carcinogenesis, the mechanisms responsible for metastasis of colorectal tumors to the liver remain to be clarified. To identify genes that are candidates for involvement in the metastatic process, we analyzed genome-wide expression profiles of 10 primary colorectal cancers and their corresponding metastatic lesions by means of a cDNA microarray consisting of 9121 human genes. This analysis identified 40 genes whose expression was commonly upregulated in metastatic lesions, and 7 that were commonly downregulated. The upregulated genes encoded proteins involved in cell adhesion, or remodeling of the actin cytoskeleton. Investigation of the functions of more of the altered genes should improve our understanding of metastasis and may identify diagnostic markers and/or novel molecular targets for prevention or therapy of metastatic lesions. PMID:11687950

LOD score exclusion analyses for candidate QTLs using random population samples.

PubMed

Deng, Hong-Wen

2003-11-01

While extensive analyses have been conducted to test for, no formal analyses have been conducted to test against, the importance of candidate genes as putative QTLs using random population samples. Previously, we developed an LOD score exclusion mapping approach for candidate genes for complex diseases. Here, we extend this LOD score approach for exclusion analyses of candidate genes for quantitative traits. Under this approach, specific genetic effects (as reflected by heritability) and inheritance models at candidate QTLs can be analyzed and if an LOD score is < or = -2.0, the locus can be excluded from having a heritability larger than that specified. Simulations show that this approach has high power to exclude a candidate gene from having moderate genetic effects if it is not a QTL and is robust to population admixture. Our exclusion analysis complements association analysis for candidate genes as putative QTLs in random population samples. The approach is applied to test the importance of Vitamin D receptor (VDR) gene as a potential QTL underlying the variation of bone mass, an important determinant of osteoporosis.

Genetic modification of the association between peripubertal dioxin exposure and pubertal onset in a cohort of Russian boys.

PubMed

Humblet, Olivier; Korrick, Susan A; Williams, Paige L; Sergeyev, Oleg; Emond, Claude; Birnbaum, Linda S; Burns, Jane S; Altshul, Larisa M; Patterson, Donald G; Turner, Wayman E; Lee, Mary M; Revich, Boris; Hauser, Russ

2013-01-01

Exposure to dioxins has been associated with delayed pubertal onset in both epidemiologic and animal studies. Whether genetic polymorphisms may modify this association is currently unknown. Identifying such genes could provide insight into mechanistic pathways. This is one of the first studies to assess genetic susceptibility to dioxins. We evaluated whether common polymorphisms in genes affecting either molecular responses to dioxin exposure or pubertal onset influence the association between peripubertal serum dioxin concentration and male pubertal onset. In this prospective cohort of Russian adolescent boys (n = 392), we assessed gene-environment interactions for 337 tagging single-nucleotide polymorphisms (SNPs) from 46 candidate genes and two intergenic regions. Dioxins were measured in the boys' serum at age 8-9 years. Pubertal onset was based on testicular volume and on genitalia staging. Statistical approaches for controlling for multiple testing were used, both with and without prescreening for marginal genetic associations. After accounting for multiple testing, two tag SNPs in the glucocorticoid receptor (GR/NR3C1) gene and one in the estrogen receptor-α (ESR1) gene were significant (q < 0.2) modifiers of the association between peripubertal serum dioxin concentration and male pubertal onset defined by genitalia staging, although not by testicular volume. The results were sensitive to whether multiple comparison adjustment was applied to all gene-environment tests or only to those with marginal genetic associations. Common genetic polymorphisms in the glucocorticoid receptor and estrogen receptor-α genes may modify the association between peripubertal serum dioxin concentration and pubertal onset. Further studies are warranted to confirm these findings.

Mutation profiling of 19 candidate genes in acute myeloid leukemia suggests significance of DNMT3A mutations.

PubMed

Shin, Sang-Yong; Lee, Seung-Tae; Kim, Hee-Jin; Cho, Eun Hae; Kim, Jong-Won; Park, Silvia; Jung, Chul Won; Kim, Sun-Hee

2016-08-23

We selected 19 significantly-mutated genes in AMLs, including FLT3, DNMT3A, NPM1, TET2, RUNX1, CEBPA, WT1, IDH1, IDH2, NRAS, ASXL1, SETD2, PTPN11, TP53, KIT, JAK2, KRAS, BRAF and CBL, and performed massively parallel sequencing for 114 patients with acute myeloid leukemias, mainly including those with normal karyotypes (CN-AML). More than 80% of patients had at least one mutation in the genes tested. DNMT3A mutation was significantly associated with adverse outcome in addition to conventional risk stratification such as the European LeukemiaNet (ELN) classification. We observed clinical usefulness of mutation testing on multiple target genes and the association with disease subgroups, clinical features and prognosis in AMLs.

Clinically relevant known and candidate genes for obesity and their overlap with human infertility and reproduction.

PubMed

Butler, Merlin G; McGuire, Austen; Manzardo, Ann M

2015-04-01

Obesity is a growing public health concern now reaching epidemic status worldwide for children and adults due to multiple problems impacting on energy intake and expenditure with influences on human reproduction and infertility. A positive family history and genetic factors are known to play a role in obesity by influencing eating behavior, weight and level of physical activity and also contributing to human reproduction and infertility. Recent advances in genetic technology have led to discoveries of new susceptibility genes for obesity and causation of infertility. The goal of our study was to provide an update of clinically relevant candidate and known genes for obesity and infertility using high resolution chromosome ideograms with gene symbols and tabular form. We used computer-based internet websites including PubMed to search for combinations of key words such as obesity, body mass index, infertility, reproduction, azoospermia, endometriosis, diminished ovarian reserve, estrogen along with genetics, gene mutations or variants to identify evidence for development of a master list of recognized obesity genes in humans and those involved with infertility and reproduction. Gene symbols for known and candidate genes for obesity were plotted on high resolution chromosome ideograms at the 850 band level. Both infertility and obesity genes were listed separately in alphabetical order in tabular form and those highlighted when involved with both conditions. By searching the medical literature and computer generated websites for key words, we found documented evidence for 370 genes playing a role in obesity and 153 genes for human reproduction or infertility. The obesity genes primarily affected common pathways in lipid metabolism, deposition or transport, eating behavior and food selection, physical activity or energy expenditure. Twenty-one of the obesity genes were also associated with human infertility and reproduction. Gene symbols were plotted on high resolution ideograms and their name, precise chromosome band location and description were summarized in tabular form. Meaningful correlations in the obesity phenotype and associated human infertility and reproduction are represented with the location of genes on chromosome ideograms along with description of the gene and position in tabular form. These high resolution chromosome ideograms and tables will be useful in genetic awareness and counseling, diagnosis and treatment to improve clinical outcomes.

Identification of Padi2 as a novel angiogenesis-regulating gene by genome association studies in mice.

PubMed

Khajavi, Mehrdad; Zhou, Yi; Birsner, Amy E; Bazinet, Lauren; Rosa Di Sant, Amanda; Schiffer, Alex J; Rogers, Michael S; Krishnaji, Subrahmanian Tarakkad; Hu, Bella; Nguyen, Vy; Zon, Leonard; D'Amato, Robert J

2017-06-01

Recent findings indicate that growth factor-driven angiogenesis is markedly influenced by genetic variation. This variation in angiogenic responsiveness may alter the susceptibility to a number of angiogenesis-dependent diseases. Here, we utilized the genetic diversity available in common inbred mouse strains to identify the loci and candidate genes responsible for differences in angiogenic response. The corneal micropocket neovascularization assay was performed on 42 different inbred mouse strains using basic fibroblast growth factor (bFGF) pellets. We performed a genome-wide association study utilizing efficient mixed-model association (EMMA) mapping using the induced vessel area from all strains. Our analysis yielded five loci with genome-wide significance on chromosomes 4, 8, 11, 15 and 16. We further refined the mapping on chromosome 4 within a haplotype block containing multiple candidate genes. These genes were evaluated by expression analysis in corneas of various inbred strains and in vitro functional assays in human microvascular endothelial cells (HMVECs). Of these, we found the expression of peptidyl arginine deiminase type II (Padi2), known to be involved in metabolic pathways, to have a strong correlation with a haplotype shared by multiple high angiogenic strains. In addition, inhibition of Padi2 demonstrated a dosage-dependent effect in HMVECs. To investigate its role in vivo, we knocked down Padi2 in transgenic kdrl:zsGreen zebrafish embryos using morpholinos. These embryos had disrupted vessel formation compared to control siblings. The impaired vascular pattern was partially rescued by human PADI2 mRNA, providing evidence for the specificity of the morphant phenotype. Taken together, our study is the first to indicate the potential role of Padi2 as an angiogenesis-regulating gene. The characterization of Padi2 and other genes in associated pathways may provide new understanding of angiogenesis regulation and novel targets for diagnosis and treatment of a wide variety of angiogenesis-dependent diseases.

Identification of Padi2 as a novel angiogenesis-regulating gene by genome association studies in mice

PubMed Central

Zhou, Yi; Bazinet, Lauren; Rosa Di Sant, Amanda; Hu, Bella; Nguyen, Vy; Zon, Leonard

2017-01-01

Recent findings indicate that growth factor-driven angiogenesis is markedly influenced by genetic variation. This variation in angiogenic responsiveness may alter the susceptibility to a number of angiogenesis-dependent diseases. Here, we utilized the genetic diversity available in common inbred mouse strains to identify the loci and candidate genes responsible for differences in angiogenic response. The corneal micropocket neovascularization assay was performed on 42 different inbred mouse strains using basic fibroblast growth factor (bFGF) pellets. We performed a genome-wide association study utilizing efficient mixed-model association (EMMA) mapping using the induced vessel area from all strains. Our analysis yielded five loci with genome-wide significance on chromosomes 4, 8, 11, 15 and 16. We further refined the mapping on chromosome 4 within a haplotype block containing multiple candidate genes. These genes were evaluated by expression analysis in corneas of various inbred strains and in vitro functional assays in human microvascular endothelial cells (HMVECs). Of these, we found the expression of peptidyl arginine deiminase type II (Padi2), known to be involved in metabolic pathways, to have a strong correlation with a haplotype shared by multiple high angiogenic strains. In addition, inhibition of Padi2 demonstrated a dosage-dependent effect in HMVECs. To investigate its role in vivo, we knocked down Padi2 in transgenic kdrl:zsGreen zebrafish embryos using morpholinos. These embryos had disrupted vessel formation compared to control siblings. The impaired vascular pattern was partially rescued by human PADI2 mRNA, providing evidence for the specificity of the morphant phenotype. Taken together, our study is the first to indicate the potential role of Padi2 as an angiogenesis-regulating gene. The characterization of Padi2 and other genes in associated pathways may provide new understanding of angiogenesis regulation and novel targets for diagnosis and treatment of a wide variety of angiogenesis-dependent diseases. PMID:28617813

Phenome-driven disease genetics prediction toward drug discovery

PubMed Central

Chen, Yang; Li, Li; Zhang, Guo-Qiang; Xu, Rong

2015-01-01

Motivation: Discerning genetic contributions to diseases not only enhances our understanding of disease mechanisms, but also leads to translational opportunities for drug discovery. Recent computational approaches incorporate disease phenotypic similarities to improve the prediction power of disease gene discovery. However, most current studies used only one data source of human disease phenotype. We present an innovative and generic strategy for combining multiple different data sources of human disease phenotype and predicting disease-associated genes from integrated phenotypic and genomic data. Results: To demonstrate our approach, we explored a new phenotype database from biomedical ontologies and constructed Disease Manifestation Network (DMN). We combined DMN with mimMiner, which was a widely used phenotype database in disease gene prediction studies. Our approach achieved significantly improved performance over a baseline method, which used only one phenotype data source. In the leave-one-out cross-validation and de novo gene prediction analysis, our approach achieved the area under the curves of 90.7% and 90.3%, which are significantly higher than 84.2% (P < e−4) and 81.3% (P < e−12) for the baseline approach. We further demonstrated that our predicted genes have the translational potential in drug discovery. We used Crohn’s disease as an example and ranked the candidate drugs based on the rank of drug targets. Our gene prediction approach prioritized druggable genes that are likely to be associated with Crohn’s disease pathogenesis, and our rank of candidate drugs successfully prioritized the Food and Drug Administration-approved drugs for Crohn’s disease. We also found literature evidence to support a number of drugs among the top 200 candidates. In summary, we demonstrated that a novel strategy combining unique disease phenotype data with system approaches can lead to rapid drug discovery. Availability and implementation: nlp.case.edu/public/data/DMN Contact: rxx@case.edu PMID:26072493

The Zymomonas mobilis regulator hfq contributes to tolerance against multiple lignocellulosic pretreatment inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Shihui; Pelletier, Dale A; Lu, Tse-Yuan

Zymomonas mobilis produces near theoretical yields of ethanol and recombinant strains are candidate industrial microorganisms. To date, few studies have examined its responses to various stresses at the gene level. Hfq is a conserved bacterial member of the Sm-like family of RNA-binding proteins, coordinating a broad array of responses including multiple stress responses. In a previous study, we observed Z. mobilis ZM4 gene ZMO0347 showed higher expression under anaerobic, stationary phase compared to that of aerobic, stationary conditions. We have shown the utility of the pKNOCK suicide plasmid for mutant construction in Z. mobilis, and constructed a Gateway compatible expressionmore » plasmid for use in Z. mobilis for the first time. We have also used genetics to show Z. mobilis Hfq and S. cerevisiae Lsm proteins play important roles in resisting multiple, important industrially relevant inhibitors. The conserved nature of this global regulator offers the potential to apply insights from these fundamental studies for further industrial strain development.« less

Convergence of genome-wide association and candidate gene studies for alcoholism.

PubMed

Olfson, Emily; Bierut, Laura Jean

2012-12-01

Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported single nucleotide polymorphisms (SNPs) in candidate genes were examined in the Study of Addiction: Genetics and Environment (SAGE), a GWA study comparing alcohol-dependent and nondependent subjects. Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1, and rs4680 in COMT, are not replicated in SAGE (p > 0.05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p = 0.0052, OR = 1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls, and the lowest p-value of any SNP was 0.0006. We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African ancestry populations. Owing to the lack of coverage, we were unable to rule out the contribution of other variants, and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more generally complex diseases. Copyright © 2012 by the Research Society on Alcoholism.

Practical applications of the bioinformatics toolbox for narrowing quantitative trait loci.

PubMed

Burgess-Herbert, Sarah L; Cox, Allison; Tsaih, Shirng-Wern; Paigen, Beverly

2008-12-01

Dissecting the genes involved in complex traits can be confounded by multiple factors, including extensive epistatic interactions among genes, the involvement of epigenetic regulators, and the variable expressivity of traits. Although quantitative trait locus (QTL) analysis has been a powerful tool for localizing the chromosomal regions underlying complex traits, systematically identifying the causal genes remains challenging. Here, through its application to plasma levels of high-density lipoprotein cholesterol (HDL) in mice, we demonstrate a strategy for narrowing QTL that utilizes comparative genomics and bioinformatics techniques. We show how QTL detected in multiple crosses are subjected to both combined cross analysis and haplotype block analysis; how QTL from one species are mapped to the concordant regions in another species; and how genomewide scans associating haplotype groups with their phenotypes can be used to prioritize the narrowed regions. Then we illustrate how these individual methods for narrowing QTL can be systematically integrated for mouse chromosomes 12 and 15, resulting in a significantly reduced number of candidate genes, often from hundreds to <10. Finally, we give an example of how additional bioinformatics resources can be combined with experiments to determine the most likely quantitative trait genes.

Haplotype Analysis in Multiple Crosses to Identify a QTL Gene

PubMed Central

Wang, Xiaosong; Korstanje, Ron; Higgins, David; Paigen, Beverly

2004-01-01

Identifying quantitative trait locus (QTL) genes is a challenging task. Herein, we report using a two-step process to identify Apoa2 as the gene underlying Hdlq5, a QTL for plasma high-density lipoprotein cholesterol (HDL) levels on mouse chromosome 1. First, we performed a sequence analysis of the Apoa2 coding region in 46 genetically diverse mouse strains and found five different APOA2 protein variants, which we named APOA2a to APOA2e. Second, we conducted a haplotype analysis of the strains in 21 crosses that have so far detected HDL QTLs; we found that Hdlq5 was detected only in the nine crosses where one parent had the APOA2b protein variant characterized by an Ala61-to-Val61 substitution. We then found that strains with the APOA2b variant had significantly higher (P ≤ 0.002) plasma HDL levels than those with either the APOA2a or the APOA2c variant. These findings support Apoa2 as the underlying Hdlq5 gene and suggest the Apoa2 polymorphisms responsible for the Hdlq5 phenotype. Therefore, haplotype analysis in multiple crosses can be used to support a candidate QTL gene. PMID:15310659

Haplotype analysis in multiple crosses to identify a QTL gene.

PubMed

Wang, Xiaosong; Korstanje, Ron; Higgins, David; Paigen, Beverly

2004-09-01

Identifying quantitative trait locus (QTL) genes is a challenging task. Herein, we report using a two-step process to identify Apoa2 as the gene underlying Hdlq5, a QTL for plasma high-density lipoprotein cholesterol (HDL) levels on mouse chromosome 1. First, we performed a sequence analysis of the Apoa2 coding region in 46 genetically diverse mouse strains and found five different APOA2 protein variants, which we named APOA2a to APOA2e. Second, we conducted a haplotype analysis of the strains in 21 crosses that have so far detected HDL QTLs; we found that Hdlq5 was detected only in the nine crosses where one parent had the APOA2b protein variant characterized by an Ala61-to-Val61 substitution. We then found that strains with the APOA2b variant had significantly higher (P < or = 0.002) plasma HDL levels than those with either the APOA2a or the APOA2c variant. These findings support Apoa2 as the underlying Hdlq5 gene and suggest the Apoa2 polymorphisms responsible for the Hdlq5 phenotype. Therefore, haplotype analysis in multiple crosses can be used to support a candidate QTL gene.

Thermal tolerance in the keystone species Daphnia magna-a candidate gene and an outlier analysis approach.

PubMed

Jansen, M; Geerts, A N; Rago, A; Spanier, K I; Denis, C; De Meester, L; Orsini, L

2017-04-01

Changes in temperature have occurred throughout Earth's history. However, current warming trends exacerbated by human activities impose severe and rapid loss of biodiversity. Although understanding the mechanisms orchestrating organismal response to climate change is important, remarkably few studies document their role in nature. This is because only few systems enable the combined analysis of genetic and plastic responses to environmental change over long time spans. Here, we characterize genetic and plastic responses to temperature increase in the aquatic keystone grazer Daphnia magna combining a candidate gene and an outlier analysis approach. We capitalize on the short generation time of our species, facilitating experimental evolution, and the production of dormant eggs enabling the analysis of long-term response to environmental change through a resurrection ecology approach. We quantify plasticity in the expression of 35 candidate genes in D. magna populations resurrected from a lake that experienced changes in average temperature over the past century and from experimental populations differing in thermal tolerance isolated from a selection experiment. By measuring expression in multiple genotypes from each of these populations in control and heat treatments, we assess plastic responses to extreme temperature events. By measuring evolutionary changes in gene expression between warm- and cold-adapted populations, we assess evolutionary response to temperature changes. Evolutionary response to temperature increase is also assessed via an outlier analysis using EST-linked microsatellite loci. This study provides the first insights into the role of plasticity and genetic adaptation in orchestrating adaptive responses to environmental change in D. magna. © 2017 John Wiley & Sons Ltd.

Cleft lip with or without cleft palate: Associations with transforming growth factor alpha and retinoic acid receptor loci

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chenevix-Trench, G.; Jones, K.; Green, A.C.

1992-12-01

The first association study of cleft lip with or without cleft palate (CL/P), with candidate genes, found an association with the transforming growth-factor alpha (TGFA) locus. This finding has since been replicated, in whole or in part, in three independent studies. Here the authors extend their original analysis of the TGFA TaqI RFLP to two other TGFA RFLPs and seven other RFLPs at five candidate genes in 117 nonsyndromic cases of CL/P and 113 controls. The other candidate genes were the retinoic acid receptor (RARA), the bcl-2 oncogene, and the homeobox genes 2F, 2G, and EN2. Significant associations with themore » TGFA TaqI and BamHI RFLPs were confirmed, although associations of clefting with previously reported haplotypes did not reach significance. Of particular interest, in view of the known teratogenic role of retinoic acid, was a significant association with the RARA PstI RFLP (P = .016; not corrected for multiple testing). The effect on risk of the A2 allele appears to be additive, and although the A2A2 homozygote only has an odds ratio of about 2 and recurrence risk to first-degree relatives ([lambda][sub 1]) of 1.06, because it is so common it may account for as much as a third of the attributable risk of clefting. There is no evidence of interaction between the TGFA and RARA polymorphisms on risk, and jointly they appear to account for almost half the attributable risk of clefting. 43 refs., 1 fig., 4 tabs.« less

Identification of Causal Genes, Networks, and Transcriptional Regulators of REM Sleep and Wake

PubMed Central

Millstein, Joshua; Winrow, Christopher J.; Kasarskis, Andrew; Owens, Joseph R.; Zhou, Lili; Summa, Keith C.; Fitzpatrick, Karrie; Zhang, Bin; Vitaterna, Martha H.; Schadt, Eric E.; Renger, John J.; Turek, Fred W.

2011-01-01

Study Objective: Sleep-wake traits are well-known to be under substantial genetic control, but the specific genes and gene networks underlying primary sleep-wake traits have largely eluded identification using conventional approaches, especially in mammals. Thus, the aim of this study was to use systems genetics and statistical approaches to uncover the genetic networks underlying 2 primary sleep traits in the mouse: 24-h duration of REM sleep and wake. Design: Genome-wide RNA expression data from 3 tissues (anterior cortex, hypothalamus, thalamus/midbrain) were used in conjunction with high-density genotyping to identify candidate causal genes and networks mediating the effects of 2 QTL regulating the 24-h duration of REM sleep and one regulating the 24-h duration of wake. Setting: Basic sleep research laboratory. Patients or Participants: Male [C57BL/6J × (BALB/cByJ × C57BL/6J*) F1] N2 mice (n = 283). Interventions: None. Measurements and Results: The genetic variation of a mouse N2 mapping cross was leveraged against sleep-state phenotypic variation as well as quantitative gene expression measurement in key brain regions using integrative genomics approaches to uncover multiple causal sleep-state regulatory genes, including several surprising novel candidates, which interact as components of networks that modulate REM sleep and wake. In particular, it was discovered that a core network module, consisting of 20 genes, involved in the regulation of REM sleep duration is conserved across the cortex, hypothalamus, and thalamus. A novel application of a formal causal inference test was also used to identify those genes directly regulating sleep via control of expression. Conclusion: Systems genetics approaches reveal novel candidate genes, complex networks and specific transcriptional regulators of REM sleep and wake duration in mammals. Citation: Millstein J; Winrow CJ; Kasarskis A; Owens JR; Zhou L; Summa KC; Fitzpatrick K; Zhang B; Vitaterna MH; Schadt EE; Renger JJ; Turek FW. Identification of causal genes, networks, and transcriptional regulators of REM sleep and wake. SLEEP 2011;34(11):1469-1477. PMID:22043117

Examination of Association to Autism of Common Genetic Variation in Genes Related to Dopamine

PubMed Central

Anderson, B.M.; Schnetz-Boutaud, N.; Bartlett, J.; Wright, H.H.; Abramson, R.K.; Cuccaro, M.L.; Gilbert, J.R.; Pericak-Vance, M.A.; Haines, J.L.

2010-01-01

Autism is a severe neurodevelopmental disorder characterized by a triad of complications. Autistic individuals display significant disturbances in language and reciprocal social interactions, combined with repetitive and stereotypic behaviors. Prevalence studies suggest that autism is more common than originally believed, with recent estimates citing a rate of one in 150. Although this genomic approach has yielded multiple suggestive regions, a specific risk locus has yet to be identified and widely confirmed. Because many etiologies have been suggested for this complex syndrome, we hypothesize that one of the difficulties in identifying autism genes is that multiple genetic variants may be required to significantly increase the risk of developing autism. Thus we took the alternative approach of examining 14 prominent dopamine pathway candidate genes for detailed study by genotyping 28 SNPs. Although we did observe a nominally significant association for rs2239535 (p=.008) on chromosome 20, single locus analysis did not reveal any results as significant after correction for multiple comparisons. No significant interaction was identified when Multifactor Dimensionality Reduction (MDR) was employed to test specifically for multilocus effects. Although genome-wide linkage scans in autism have provided support for linkage to various loci along the dopamine pathway, our study does not provide strong evidence of linkage or association to any specific gene or combination of genes within the pathway. These results demonstrate that common genetic variation within the tested genes located within this pathway at most play a minor to moderate role in overall autism pathogenesis. PMID:19360691

Investigation of four porcine candidate genes (H-FABP, MYOD1, UCP3 and MASTR) for meat quality traits in Large White pigs.

PubMed

Han, Xuelei; Jiang, Tengfei; Yang, Huawei; Zhang, Qingde; Wang, Weimin; Fan, Bin; Liu, Bang

2012-06-01

Meat quality traits are economically important traits of swine, and are controlled by multiple genes as complex quantitative traits. In the present study four genes, H-FABP (heart fatty acid-binding protein), MASTR (MEF2 activating motif and SAP domain containing transcriptional regulator), UCP3 (uncoupling protein 3) and MYOD1 (myogenic differentiation 1) were researched in Large White pigs. The polymorphisms H-FABP T/C of 5'UTR, MYOD1 g.257 A>C, UCP3 g.1406 G>A in exon 3 and MASTR c.187 C>T have been reported to be associated with meat quality traits in pigs. The aim of this study was to analyze the effect of single and multiple markers for single traits in Large White pigs. The single marker association analysis showed that the H-FABP and MASTR genes were associated with IMF (intramuscular fat content) (P < 0.05), and that the g.257 A>C of MYOD1 gene was most significantly related to muscle pH value (P < 0.01). The multiple markers for IMF were analyzed by combining the markers and quantitative trait modes into the linear regression. The results revealed that H-FABP and MASTR integrate gene networks for IMF. Thus, our study results suggested that H-FABP and MASTR polymorphisms could be used as genetic markers in the marker-assisted selection towards the improvement of IMF in Large White pigs.

Defining the Human Macula Transcriptome and Candidate Retinal Disease Genes UsingEyeSAGE

PubMed Central

Rickman, Catherine Bowes; Ebright, Jessica N.; Zavodni, Zachary J.; Yu, Ling; Wang, Tianyuan; Daiger, Stephen P.; Wistow, Graeme; Boon, Kathy; Hauser, Michael A.

2009-01-01

Purpose To develop large-scale, high-throughput annotation of the human macula transcriptome and to identify and prioritize candidate genes for inherited retinal dystrophies, based on ocular-expression profiles using serial analysis of gene expression (SAGE). Methods Two human retina and two retinal pigment epithelium (RPE)/choroid SAGE libraries made from matched macula or midperipheral retina and adjacent RPE/choroid of morphologically normal 28- to 66-year-old donors and a human central retina longSAGE library made from 41- to 66-year-old donors were generated. Their transcription profiles were entered into a relational database, EyeSAGE, including microarray expression profiles of retina and publicly available normal human tissue SAGE libraries. EyeSAGE was used to identify retina- and RPE-specific and -associated genes, and candidate genes for retina and RPE disease loci. Differential and/or cell-type specific expression was validated by quantitative and single-cell RT-PCR. Results Cone photoreceptor-associated gene expression was elevated in the macula transcription profiles. Analysis of the longSAGE retina tags enhanced tag-to-gene mapping and revealed alternatively spliced genes. Analysis of candidate gene expression tables for the identified Bardet-Biedl syndrome disease gene (BBS5) in the BBS5 disease region table yielded BBS5 as the top candidate. Compelling candidates for inherited retina diseases were identified. Conclusions The EyeSAGE database, combining three different gene-profiling platforms including the authors’ multidonor-derived retina/RPE SAGE libraries and existing single-donor retina/RPE libraries, is a powerful resource for definition of the retina and RPE transcriptomes. It can be used to identify retina-specific genes, including alternatively spliced transcripts and to prioritize candidate genes within mapped retinal disease regions. PMID:16723438

Defining the human macula transcriptome and candidate retinal disease genes using EyeSAGE.

PubMed

Bowes Rickman, Catherine; Ebright, Jessica N; Zavodni, Zachary J; Yu, Ling; Wang, Tianyuan; Daiger, Stephen P; Wistow, Graeme; Boon, Kathy; Hauser, Michael A

2006-06-01

To develop large-scale, high-throughput annotation of the human macula transcriptome and to identify and prioritize candidate genes for inherited retinal dystrophies, based on ocular-expression profiles using serial analysis of gene expression (SAGE). Two human retina and two retinal pigment epithelium (RPE)/choroid SAGE libraries made from matched macula or midperipheral retina and adjacent RPE/choroid of morphologically normal 28- to 66-year-old donors and a human central retina longSAGE library made from 41- to 66-year-old donors were generated. Their transcription profiles were entered into a relational database, EyeSAGE, including microarray expression profiles of retina and publicly available normal human tissue SAGE libraries. EyeSAGE was used to identify retina- and RPE-specific and -associated genes, and candidate genes for retina and RPE disease loci. Differential and/or cell-type specific expression was validated by quantitative and single-cell RT-PCR. Cone photoreceptor-associated gene expression was elevated in the macula transcription profiles. Analysis of the longSAGE retina tags enhanced tag-to-gene mapping and revealed alternatively spliced genes. Analysis of candidate gene expression tables for the identified Bardet-Biedl syndrome disease gene (BBS5) in the BBS5 disease region table yielded BBS5 as the top candidate. Compelling candidates for inherited retina diseases were identified. The EyeSAGE database, combining three different gene-profiling platforms including the authors' multidonor-derived retina/RPE SAGE libraries and existing single-donor retina/RPE libraries, is a powerful resource for definition of the retina and RPE transcriptomes. It can be used to identify retina-specific genes, including alternatively spliced transcripts and to prioritize candidate genes within mapped retinal disease regions.

Genetic variants associated with severe retinopathy of prematurity in extremely low birth weight infants.

PubMed

Hartnett, M Elizabeth; Morrison, Margaux A; Smith, Silvia; Yanovitch, Tammy L; Young, Terri L; Colaizy, Tarah; Momany, Allison; Dagle, John; Carlo, Waldemar A; Clark, Erin A S; Page, Grier; Murray, Jeff; DeAngelis, Margaret M; Cotten, C Michael

2014-08-12

To determine genetic variants associated with severe retinopathy of prematurity (ROP) in a candidate gene cohort study of US preterm infants. Preterm infants in the discovery cohort were enrolled through the Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network, and those in the replication cohort were from the University of Iowa. All infants were phenotyped for ROP severity. Because of differences in the durations of enrollment between cohorts, severe ROP was defined as threshold disease in the discovery cohort and as threshold disease or type 1 ROP in the replication cohort. Whole genome amplified DNA from stored blood spot samples from the Neonatal Research Network biorepository was genotyped using an Illumina GoldenGate platform for candidate gene single nucleotide polymorphisms (SNPs) involving angiogenic, developmental, inflammatory, and oxidative pathways. Three analyses were performed to determine significant epidemiologic variables and SNPs associated with levels of ROP severity. Analyses controlled for multiple comparisons, ancestral eigenvalues, family relatedness, and significant epidemiologic variables. Single nucleotide polymorphisms significantly associated with ROP severity from the discovery cohort were analyzed in the replication cohort and in meta-analysis. Eight hundred seventeen infants in the discovery cohort and 543 in the replication cohort were analyzed. Severe ROP occurred in 126 infants in the discovery and in 14 in the replication cohort. In both cohorts, ventilation days and seizure occurrence were associated with severe ROP. After controlling for significant factors and multiple comparisons, two intronic SNPs in the gene BDNF (rs7934165 and rs2049046, P < 3.1 × 10(-5)) were associated with severe ROP in the discovery cohort and were not associated with severe ROP in the replication cohort. However, when the cohorts were analyzed together in an exploratory meta-analysis, rs7934165 increased in associated significance with severe ROP (P = 2.9 × 10(-7)). Variants in BDNF encoding brain-derived neurotrophic factor were associated with severe ROP in a large candidate gene study of infants with threshold ROP. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

Candidate gene identification of ovulation-inducing genes by RNA sequencing with an in vivo assay in zebrafish.

PubMed

Klangnurak, Wanlada; Fukuyo, Taketo; Rezanujjaman, M D; Seki, Masahide; Sugano, Sumio; Suzuki, Yutaka; Tokumoto, Toshinobu

2018-01-01

We previously reported the microarray-based selection of three ovulation-related genes in zebrafish. We used a different selection method in this study, RNA sequencing analysis. An additional eight up-regulated candidates were found as specifically up-regulated genes in ovulation-induced samples. Changes in gene expression were confirmed by qPCR analysis. Furthermore, up-regulation prior to ovulation during natural spawning was verified in samples from natural pairing. Gene knock-out zebrafish strains of one of the candidates, the starmaker gene (stm), were established by CRISPR genome editing techniques. Unexpectedly, homozygous mutants were fertile and could spawn eggs. However, a high percentage of unfertilized eggs and abnormal embryos were produced from these homozygous females. The results suggest that the stm gene is necessary for fertilization. In this study, we selected additional ovulation-inducing candidate genes, and a novel function of the stm gene was investigated.

Inflammatory gene polymorphisms and risk of postoperative myocardial infarction after cardiac surgery.

PubMed

Podgoreanu, M V; White, W D; Morris, R W; Mathew, J P; Stafford-Smith, M; Welsby, I J; Grocott, H P; Milano, C A; Newman, M F; Schwinn, D A

2006-07-04

The inflammatory response triggered by cardiac surgery with cardiopulmonary bypass (CPB) is a primary mechanism in the pathogenesis of postoperative myocardial infarction (PMI), a multifactorial disorder with significant inter-patient variability poorly predicted by clinical and procedural factors. We tested the hypothesis that candidate gene polymorphisms in inflammatory pathways contribute to risk of PMI after cardiac surgery. We genotyped 48 polymorphisms from 23 candidate genes in a prospective cohort of 434 patients undergoing elective cardiac surgery with CPB. PMI was defined as creatine kinase-MB isoenzyme level > or = 10x upper limit of normal at 24 hours postoperatively. A 2-step analysis strategy was used: marker selection, followed by model building. To minimize false-positive associations, we adjusted for multiple testing by permutation analysis, Bonferroni correction, and controlling the false discovery rate; 52 patients (12%) experienced PMI. After adjusting for multiple comparisons and clinical risk factors, 3 polymorphisms were found to be independent predictors of PMI (adjusted P<0.05; false discovery rate <10%). These gene variants encode the proinflammatory cytokine interleukin 6 (IL6 -572G>C; odds ratio [OR], 2.47), and 2 adhesion molecules: intercellular adhesion molecule-1 (ICAM1 Lys469Glu; OR, 1.88), and E-selectin (SELE 98G>T; OR, 0.16). The inclusion of genotypic information from these polymorphisms improved prediction models for PMI based on traditional risk factors alone (C-statistic 0.764 versus 0.703). Functional genetic variants in cytokine and leukocyte-endothelial interaction pathways are independently associated with severity of myonecrosis after cardiac surgery. This may aid in preoperative identification of high-risk cardiac surgical patients and development of novel cardioprotective strategies.

Cryptosporidium hominis gene catalog: a resource for the selection of novel Cryptosporidium vaccine candidates

PubMed Central

Ifeonu, Olukemi O.; Simon, Raphael; Tennant, Sharon M.; Sheoran, Abhineet S.; Daly, Maria C.; Felix, Victor; Kissinger, Jessica C.; Widmer, Giovanni; Levine, Myron M.; Tzipori, Saul; Silva, Joana C.

2016-01-01

Human cryptosporidiosis, caused primarily by Cryptosporidium hominis and a subset of Cryptosporidium parvum, is a major cause of moderate-to-severe diarrhea in children under 5 years of age in developing countries and can lead to nutritional stunting and death. Cryptosporidiosis is particularly severe and potentially lethal in immunocompromised hosts. Biological and technical challenges have impeded traditional vaccinology approaches to identify novel targets for the development of vaccines against C. hominis, the predominant species associated with human disease. We deemed that the existence of genomic resources for multiple species in the genus, including a much-improved genome assembly and annotation for C. hominis, makes a reverse vaccinology approach feasible. To this end, we sought to generate a searchable online resource, termed C. hominis gene catalog, which registers all C. hominis genes and their properties relevant for the identification and prioritization of candidate vaccine antigens, including physical attributes, properties related to antigenic potential and expression data. Using bioinformatic approaches, we identified ∼400 C. hominis genes containing properties typical of surface-exposed antigens, such as predicted glycosylphosphatidylinositol (GPI)-anchor motifs, multiple transmembrane motifs and/or signal peptides targeting the encoded protein to the secretory pathway. This set can be narrowed further, e.g. by focusing on potential GPI-anchored proteins lacking homologs in the human genome, but with homologs in the other Cryptosporidium species for which genomic data are available, and with low amino acid polymorphism. Additional selection criteria related to recombinant expression and purification include minimizing predicted post-translation modifications and potential disulfide bonds. Forty proteins satisfying these criteria were selected from 3745 proteins in the updated C. hominis annotation. The immunogenic potential of a few of these is currently being tested. Database URL: http://cryptogc.igs.umaryland.edu PMID:28095366

Genetic differentiation in life history traits and thermal stress performance across a heterogeneous dune landscape in Arabidopsis lyrata.

PubMed

Wos, Guillaume; Willi, Yvonne

2018-05-26

Over very short spatial scales, the habitat of a species can differ in multiple abiotic and biotic factors. These factors may impose natural selection on several traits and can cause genetic differentiation within a population. We studied multivariate genetic differentiation in a plant species of a sand dune landscape by linking environmental variation with differences in genotypic trait values and gene expression levels to find traits and candidate genes of microgeographical adaptation. Maternal seed families of Arabidopsis lyrata were collected in Saugatuck Dunes State Park, Michigan, USA, and environmental parameters were recorded at each collection site. Offspring plants were raised in climate chambers and exposed to one of three temperature treatments: regular occurrence of frost, heat, or constant control conditions. Several traits were assessed: plant growth, time to flowering, and frost and heat resistance. The strongest trait-environment association was between a fast switch to sexual reproduction and weaker growth under frost, and growing in the open, away from trees. The second strongest association was between the trait combination of small plant size and early flowering under control conditions combined with large size under frost, and the combination of environmental conditions of growing close to trees, at low vegetation cover, on dune bottoms. Gene expression analysis by RNA-seq revealed candidate genes involved in multivariate trait differentiation. The results support the hypothesis that in natural populations, many environmental factors impose selection, and that they affect multiple traits, with the relative direction of trait change being complex. The results highlight that heterogeneity in the selection environment over small spatial scales is a main driver of the maintenance of adaptive genetic variation within populations.

Neuropsychological performance measures as intermediate phenotypes for attention-deficit/hyperactivity disorder: A multiple mediation analysis

PubMed Central

KAMRADT, JACLYN M.; NIGG, JOEL T.; FRIDERICI, KAREN H.; NIKOLAS, MOLLY A.

2016-01-01

Genetic influences on dopaminergic neurotransmission have been implicated in attention-deficit hyperactivity disorder (ADHD) and are theorized to impact cognitive functioning via alterations in frontal–striatal circuitry. Neuropsychological functioning has been proposed to account for the potential associations between dopamine candidate genes and ADHD. However, to date, this mediation hypothesis has not been directly tested. Participants were 498 youth ages 6–17 years (mean M = 10.8 years, SD = 2.4 years, 55.0% male). All youth completed a multistage, multiple-informant assessment procedure to identify ADHD and non-ADHD cases, as well as a comprehensive neuropsychological battery. Youth provided a saliva sample for DNA analyses; the 480 base pair variable number of tandem repeat polymorphism of the dopamine active transporter 1 gene (DAT1) and the 120 base pair promoter polymorphism of the dopamine receptor D4 gene (DRD4) were genotyped. Multiple mediation analysis revealed significant indirect associations between DAT1 genotype and inattention, hyperactivity–impulsivity, and oppositionality, with specific indirect effects through response inhibition. The results highlight the role of neurocognitive task performance, particularly response inhibition, as a potential intermediate phenotype for ADHD, further elucidating the relationship between genetic polymorphisms and externalizing psychopathology. PMID:27049476

ARCHITECTURE AND DYNAMICS OF KEPLER'S CANDIDATE MULTIPLE TRANSITING PLANET SYSTEMS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lissauer, Jack J.; Jenkins, Jon M.; Borucki, William J.

About one-third of the {approx}1200 transiting planet candidates detected in the first four months of Kepler data are members of multiple candidate systems. There are 115 target stars with two candidate transiting planets, 45 with three, 8 with four, and 1 each with five and six. We characterize the dynamical properties of these candidate multi-planet systems. The distribution of observed period ratios shows that the vast majority of candidate pairs are neither in nor near low-order mean-motion resonances. Nonetheless, there are small but statistically significant excesses of candidate pairs both in resonance and spaced slightly too far apart to bemore » in resonance, particularly near the 2:1 resonance. We find that virtually all candidate systems are stable, as tested by numerical integrations that assume a nominal mass-radius relationship. Several considerations strongly suggest that the vast majority of these multi-candidate systems are true planetary systems. Using the observed multiplicity frequencies, we find that a single population of planetary systems that matches the higher multiplicities underpredicts the number of singly transiting systems. We provide constraints on the true multiplicity and mutual inclination distribution of the multi-candidate systems, revealing a population of systems with multiple super-Earth-size and Neptune-size planets with low to moderate mutual inclinations.« less

Germline mutations in candidate predisposition genes in individuals with cutaneous melanoma and at least two independent additional primary cancers.

PubMed

Pritchard, Antonia L; Johansson, Peter A; Nathan, Vaishnavi; Howlie, Madeleine; Symmons, Judith; Palmer, Jane M; Hayward, Nicholas K

2018-01-01

While a number of autosomal dominant and autosomal recessive cancer syndromes have an associated spectrum of cancers, the prevalence and variety of cancer predisposition mutations in patients with multiple primary cancers have not been extensively investigated. An understanding of the variants predisposing to more than one cancer type could improve patient care, including screening and genetic counselling, as well as advancing the understanding of tumour development. A cohort of 57 patients ascertained due to their cutaneous melanoma (CM) diagnosis and with a history of two or more additional non-cutaneous independent primary cancer types were recruited for this study. Patient blood samples were assessed by whole exome or whole genome sequencing. We focussed on variants in 525 pre-selected genes, including 65 autosomal dominant and 31 autosomal recessive cancer predisposition genes, 116 genes involved in the DNA repair pathway, and 313 commonly somatically mutated in cancer. The same genes were analysed in exome sequence data from 1358 control individuals collected as part of non-cancer studies (UK10K). The identified variants were classified for pathogenicity using online databases, literature and in silico prediction tools. No known pathogenic autosomal dominant or previously described compound heterozygous mutations in autosomal recessive genes were observed in the multiple cancer cohort. Variants typically found somatically in haematological malignancies (in JAK1, JAK2, SF3B1, SRSF2, TET2 and TYK2) were present in lymphocyte DNA of patients with multiple primary cancers, all of whom had a history of haematological malignancy and cutaneous melanoma, as well as colorectal cancer and/or prostate cancer. Other potentially pathogenic variants were discovered in BUB1B, POLE2, ROS1 and DNMT3A. Compared to controls, multiple cancer cases had significantly more likely damaging mutations (nonsense, frameshift ins/del) in tumour suppressor and tyrosine kinase genes and higher overall burden of mutations in all cancer genes. We identified several pathogenic variants that likely predispose to at least one of the tumours in patients with multiple cancers. We additionally present evidence that there may be a higher burden of variants of unknown significance in 'cancer genes' in patients with multiple cancer types. Further screens of this nature need to be carried out to build evidence to show if the cancers observed in these patients form part of a cancer spectrum associated with single germline variants in these genes, whether multiple layers of susceptibility exist (oligogenic or polygenic), or if the occurrence of multiple different cancers is due to random chance.

Production of individualized V gene databases reveals high levels of immunoglobulin genetic diversity

NASA Astrophysics Data System (ADS)

Corcoran, Martin M.; Phad, Ganesh E.; Bernat, Néstor Vázquez; Stahl-Hennig, Christiane; Sumida, Noriyuki; Persson, Mats A. A.; Martin, Marcel; Hedestam, Gunilla B. Karlsson

2016-12-01

Comprehensive knowledge of immunoglobulin genetics is required to advance our understanding of B cell biology. Validated immunoglobulin variable (V) gene databases are close to completion only for human and mouse. We present a novel computational approach, IgDiscover, that identifies germline V genes from expressed repertoires to a specificity of 100%. IgDiscover uses a cluster identification process to produce candidate sequences that, once filtered, results in individualized germline V gene databases. IgDiscover was tested in multiple species, validated by genomic cloning and cross library comparisons and produces comprehensive gene databases even where limited genomic sequence is available. IgDiscover analysis of the allelic content of the Indian and Chinese-origin rhesus macaques reveals high levels of immunoglobulin gene diversity in this species. Further, we describe a novel human IGHV3-21 allele and confirm significant gene differences between Balb/c and C57BL6 mouse strains, demonstrating the power of IgDiscover as a germline V gene discovery tool.

Production of individualized V gene databases reveals high levels of immunoglobulin genetic diversity

PubMed Central

Corcoran, Martin M.; Phad, Ganesh E.; Bernat, Néstor Vázquez; Stahl-Hennig, Christiane; Sumida, Noriyuki; Persson, Mats A.A.; Martin, Marcel; Hedestam, Gunilla B. Karlsson

2016-01-01

Comprehensive knowledge of immunoglobulin genetics is required to advance our understanding of B cell biology. Validated immunoglobulin variable (V) gene databases are close to completion only for human and mouse. We present a novel computational approach, IgDiscover, that identifies germline V genes from expressed repertoires to a specificity of 100%. IgDiscover uses a cluster identification process to produce candidate sequences that, once filtered, results in individualized germline V gene databases. IgDiscover was tested in multiple species, validated by genomic cloning and cross library comparisons and produces comprehensive gene databases even where limited genomic sequence is available. IgDiscover analysis of the allelic content of the Indian and Chinese-origin rhesus macaques reveals high levels of immunoglobulin gene diversity in this species. Further, we describe a novel human IGHV3-21 allele and confirm significant gene differences between Balb/c and C57BL6 mouse strains, demonstrating the power of IgDiscover as a germline V gene discovery tool. PMID:27995928

CRISPR Genome-Wide Screening Identifies Dependence on the Proteasome Subunit PSMC6 for Bortezomib Sensitivity in Multiple Myeloma.

PubMed

Shi, Chang-Xin; Kortüm, K Martin; Zhu, Yuan Xiao; Bruins, Laura A; Jedlowski, Patrick; Votruba, Patrick G; Luo, Moulun; Stewart, Robert A; Ahmann, Jonathan; Braggio, Esteban; Stewart, A Keith

2017-12-01

Bortezomib is highly effective in the treatment of multiple myeloma; however, emergent drug resistance is common. Consequently, we employed CRISPR targeting 19,052 human genes to identify unbiased targets that contribute to bortezomib resistance. Specifically, we engineered an RPMI8226 multiple myeloma cell line to express Cas9 infected by lentiviral vector CRISPR library and cultured derived cells in doses of bortezomib lethal to parental cells. Sequencing was performed on surviving cells to identify inactivated genes responsible for drug resistance. From two independent whole-genome screens, we selected 31 candidate genes and constructed a second CRISPR sgRNA library, specifically targeting each of these 31 genes with four sgRNAs. After secondary screening for bortezomib resistance, the top 20 "resistance" genes were selected for individual validation. Of these 20 targets, the proteasome regulatory subunit PSMC6 was the only gene validated to reproducibly confer bortezomib resistance. We confirmed that inhibition of chymotrypsin-like proteasome activity by bortezomib was significantly reduced in cells lacking PSMC6. We individually investigated other members of the PSMC group (PSMC1 to 5) and found that deficiency in each of those subunits also imparts bortezomib resistance. We found 36 mutations in 19S proteasome subunits out of 895 patients in the IA10 release of the CoMMpass study (https://themmrf.org). Our findings demonstrate that the PSMC6 subunit is the most prominent target required for bortezomib sensitivity in multiple myeloma cells and should be examined in drug-refractory populations. Mol Cancer Ther; 16(12); 2862-70. ©2017 AACR . ©2017 American Association for Cancer Research.

Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean.

PubMed

Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong

2018-03-01

A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.

Glutamate System Genes and Brain Volume Alterations in Pediatric Obsessive-Compulsive Disorder: A Preliminary Study

PubMed Central

Wu, Ke; Hanna, Gregory L.; Easter, Philip; Kennedy, James L.; Rosenberg, David R.; Arnold, Paul D

2012-01-01

Obsessive-compulsive disorder (OCD) has been associated with regional volumetric brain abnormalities, which provide promising intermediate phenotypes of the disorder. In this study, volumes of brain regions selected for a priori evidence of association with OCD (orbitofrontal cortex (OFC), anterior cingulate cortex (ACC), thalamus, caudate, putamen, globus pallidus and pituitary) were measured using structural magnetic resonance imaging (MRI) in 20 psychotropic-naïve pediatric OCD patients. We examined the association between these regional brain volumes and a total of 519 single nucleotide polymorphisms (SNPs) from nine glutamatergic candidate genes (DLGAP1, DLGAP2, DLGAP3, GRIN2B, SLC1A1, GRIK2, GRIK3, SLITRK1 and SLITRK5). These genes were selected based on either previous reported association with OCD in humans or evidence from animal models of OCD. After correcting for multiple comparisons by permutation testing, no SNP remained significantly associated with volumetric changes. The strongest trend toward association was identified between two SNPs in DLGAP2 (rs6558484 and rs7014992) and OFC white matter volume (P = 0.000565, Padjusted= 0.3071). Our other top ranked association findings were with ACC, OFC and thalamus. These preliminary results suggest that sequence variants in glutamate candidate genes may be associated with structural neuroimaging phenotypes of OCD. PMID:23154099

Genetic Association of MPPED2 and ACTN2 with Dental Caries

PubMed Central

Stanley, B.O.C.; Feingold, E.; Cooper, M.; Vanyukov, M.M.; Maher, B.S.; Slayton, R.L.; Willing, M.C.; Reis, S.E.; McNeil, D.W.; Crout, R.J.; Weyant, R.J.; Levy, S.M.; Vieira, A.R.; Marazita, M.L.; Shaffer, J.R.

2014-01-01

The first genome-wide association study of dental caries focused on primary teeth in children aged 3 to 12 yr and nominated several novel genes: ACTN2, EDARADD, EPHA7, LPO, MPPED2, MTR, and ZMPSTE24. Here we interrogated 156 single-nucleotide polymorphisms (SNPs) within these candidate genes for evidence of association with dental caries experience in 13 race- and age-stratified samples from 6 independent studies (n = 3600). Analysis was performed separately for each sample, and results were combined across samples via meta-analysis. MPPED2 was significantly associated with caries via meta-analysis across the 5 childhood samples, with 4 SNPs showing significant associations after gene-wise adjustment for multiple comparisons (p < .0026). These results corroborate the previous genome-wide association study, although the functional role of MPPED2 in caries etiology remains unknown. ACTN2 also showed significant association via meta-analysis across childhood samples (p = .0014). Moreover, in adults, genetic association was observed for ACTN2 SNPs in individual samples (p < .0025), but no single SNP was significant via meta-analysis across all 8 adult samples. Given its compelling biological role in organizing ameloblasts during amelogenesis, this study strengthens the hypothesis that ACTN2 influences caries risk. Results for the other candidate genes neither proved nor precluded their associations with dental caries. PMID:24810274

PhenomeCentral: A Portal for Phenotypic and Genotypic Matchmaking of Patients with Rare Genetic Diseases

PubMed Central

Buske, Orion J.; Girdea, Marta; Dumitriu, Sergiu; Gallinger, Bailey; Hartley, Taila; Trang, Heather; Misyura, Andriy; Friedman, Tal; Beaulieu, Chandree; Bone, William P.; Links, Amanda E.; Washington, Nicole L.; Haendel, Melissa A.; Robinson, Peter N.; Boerkoel, Cornelius F.; Adams, David; Gahl, William A.; Boycott, Kym M.; Brudno, Michael

2017-01-01

The discovery of disease-causing mutations typically requires confirmation of the variant or gene in multiple unrelated individuals, and a large number of rare genetic diseases remain unsolved due to difficulty identifying second families. To enable the secure sharing of case records by clinicians and rare disease scientists, we have developed the PhenomeCentral portal (https://phenomecentral.org). Each record includes a phenotypic description and relevant genetic information (exome or candidate genes). PhenomeCentral identifies similar patients in the database based on semantic similarity between clinical features, automatically prioritized genes from whole-exome data, and candidate genes entered by the users, enabling both hypothesis-free and hypothesis-driven matchmaking. Users can then contact other submitters to follow up on promising matches. PhenomeCentral incorporates data for over 1,000 patients with rare genetic diseases, contributed by the FORGE and Care4Rare Canada projects, the US NIH Undiagnosed Diseases Program, the EU Neuromics and ANDDIrare projects, as well as numerous independent clinicians and scientists. Though the majority of these records have associated exome data, most lack a molecular diagnosis. PhenomeCentral has already been used to identify causative mutations for several patients, and its ability to find matching patients and diagnose these diseases will grow with each additional patient that is entered. PMID:26251998

Convergent functional genomics in addiction research - a translational approach to study candidate genes and gene networks.

PubMed

Spanagel, Rainer

2013-01-01

Convergent functional genomics (CFG) is a translational methodology that integrates in a Bayesian fashion multiple lines of evidence from studies in human and animal models to get a better understanding of the genetics of a disease or pathological behavior. Here the integration of data sets that derive from forward genetics in animals and genetic association studies including genome wide association studies (GWAS) in humans is described for addictive behavior. The aim of forward genetics in animals and association studies in humans is to identify mutations (e.g. SNPs) that produce a certain phenotype; i.e. "from phenotype to genotype". Most powerful in terms of forward genetics is combined quantitative trait loci (QTL) analysis and gene expression profiling in recombinant inbreed rodent lines or genetically selected animals for a specific phenotype, e.g. high vs. low drug consumption. By Bayesian scoring genomic information from forward genetics in animals is then combined with human GWAS data on a similar addiction-relevant phenotype. This integrative approach generates a robust candidate gene list that has to be functionally validated by means of reverse genetics in animals; i.e. "from genotype to phenotype". It is proposed that studying addiction relevant phenotypes and endophenotypes by this CFG approach will allow a better determination of the genetics of addictive behavior.

Genetic dissection of acetic acid tolerance in Saccharomyces cerevisiae.

PubMed

Geng, Peng; Xiao, Yin; Hu, Yun; Sun, Haiye; Xue, Wei; Zhang, Liang; Shi, Gui-Yang

2016-09-01

Dissection of the hereditary architecture underlying Saccharomyces cerevisiae tolerance to acetic acid is essential for ethanol fermentation. In this work, a genomics approach was used to dissect hereditary variations in acetic acid tolerance between two phenotypically different strains. A total of 160 segregants derived from these two strains were obtained. Phenotypic analysis indicated that the acetic acid tolerance displayed a normal distribution in these segregants, and suggested that the acetic acid tolerant traits were controlled by multiple quantitative trait loci (QTLs). Thus, 220 SSR markers covering the whole genome were used to detect QTLs of acetic acid tolerant traits. As a result, three QTLs were located on chromosomes 9, 12, and 16, respectively, which explained 38.8-65.9 % of the range of phenotypic variation. Furthermore, twelve genes of the candidates fell into the three QTL regions by integrating the QTL analysis with candidates of acetic acid tolerant genes. These results provided a novel avenue to obtain more robust strains.

Hindsight regulates photoreceptor axon targeting through transcriptional control of jitterbug/Filamin and multiple genes involved in axon guidance in Drosophila.

PubMed

Oliva, Carlos; Molina-Fernandez, Claudia; Maureira, Miguel; Candia, Noemi; López, Estefanía; Hassan, Bassem; Aerts, Stein; Cánovas, José; Olguín, Patricio; Sierralta, Jimena

2015-09-01

During axon targeting, a stereotyped pattern of connectivity is achieved by the integration of intrinsic genetic programs and the response to extrinsic long and short-range directional cues. How this coordination occurs is the subject of intense study. Transcription factors play a central role due to their ability to regulate the expression of multiple genes required to sense and respond to these cues during development. Here we show that the transcription factor HNT regulates layer-specific photoreceptor axon targeting in Drosophila through transcriptional control of jbug/Filamin and multiple genes involved in axon guidance and cytoskeleton organization.Using a microarray analysis we identified 235 genes whose expression levels were changed by HNT overexpression in the eye primordia. We analyzed nine candidate genes involved in cytoskeleton regulation and axon guidance, six of which displayed significantly altered gene expression levels in hnt mutant retinas. Functional analysis confirmed the role of OTK/PTK7 in photoreceptor axon targeting and uncovered Tiggrin, an integrin ligand, and Jbug/Filamin, a conserved actin- binding protein, as new factors that participate of photoreceptor axon targeting. Moreover, we provided in silico and molecular evidence that supports jbug/Filamin as a direct transcriptional target of HNT and that HNT acts partially through Jbug/Filamin in vivo to regulate axon guidance. Our work broadens the understanding of how HNT regulates the coordinated expression of a group of genes to achieve the correct connectivity pattern in the Drosophila visual system. © 2015 Wiley Periodicals, Inc. Develop Neurobiol 75: 1018-1032, 2015. © 2015 Wiley Periodicals, Inc.

SZDB: A Database for Schizophrenia Genetic Research

PubMed Central

Wu, Yong; Yao, Yong-Gang

2017-01-01

Abstract Schizophrenia (SZ) is a debilitating brain disorder with a complex genetic architecture. Genetic studies, especially recent genome-wide association studies (GWAS), have identified multiple variants (loci) conferring risk to SZ. However, how to efficiently extract meaningful biological information from bulk genetic findings of SZ remains a major challenge. There is a pressing need to integrate multiple layers of data from various sources, eg, genetic findings from GWAS, copy number variations (CNVs), association and linkage studies, gene expression, protein–protein interaction (PPI), co-expression, expression quantitative trait loci (eQTL), and Encyclopedia of DNA Elements (ENCODE) data, to provide a comprehensive resource to facilitate the translation of genetic findings into SZ molecular diagnosis and mechanism study. Here we developed the SZDB database (http://www.szdb.org/), a comprehensive resource for SZ research. SZ genetic data, gene expression data, network-based data, brain eQTL data, and SNP function annotation information were systematically extracted, curated and deposited in SZDB. In-depth analyses and systematic integration were performed to identify top prioritized SZ genes and enriched pathways. Multiple types of data from various layers of SZ research were systematically integrated and deposited in SZDB. In-depth data analyses and integration identified top prioritized SZ genes and enriched pathways. We further showed that genes implicated in SZ are highly co-expressed in human brain and proteins encoded by the prioritized SZ risk genes are significantly interacted. The user-friendly SZDB provides high-confidence candidate variants and genes for further functional characterization. More important, SZDB provides convenient online tools for data search and browse, data integration, and customized data analyses. PMID:27451428

Changes in Gene Expression with Sleep

PubMed Central

Thimgan, Matthew S.; Duntley, Stephen P.; Shaw, Paul J.

2011-01-01

There is general agreement within the sleep community and among public health officials of the need for an accessible biomarker of sleepiness. As the foregoing discussions emphasize, however, it may be more difficult to reach consensus on how to define such a biomarker than to identify candidate molecules that can be then evaluated to determine if they might be useful to solve a variety of real-world problems related to insufficient sleep. With that in mind, a goal of our laboratories has been to develop a rational strategy to expedite the identification of candidate biomarkers. 1 We began with the assumption that since both the genetic and environmental context of a gene can influence its behavior, an effective test of sleep loss will likely be composed of a panel of multiple biomarkers. That is, we believe that it is premature to exclude a candidate analyte simply because it might also be modulated in response to other conditions (e.g., illness, metabolism, sympathetic tone, etc.). Our next assumption was that an easily accessible biomarker would be more useful in real-world settings. Thus, we have focused on saliva, as opposed to urine or blood, as a rich source of biological analytes that can be mined to optimize the chances of bringing a biomarker out into the field. Finally, we recognize that conducting validation studies in humans can be expensive and time consuming. Thus, we have exploited genetic and pharmacological tools in the model organism Drosophila melanogaster to more fully characterize the behavior of the most exciting candidate biomarkers. Citation: Thimgan MS; Duntley SP; Shaw PJ. Changes in gene expression with sleep. J Clin Sleep Med 2011;7(5):Supplement S26-S27. PMID:22003326

Fourteen-Genome Comparison Identifies DNA Markers for Severe-Disease-Associated Strains of Clostridium difficile▿†

PubMed Central

Forgetta, Vincenzo; Oughton, Matthew T.; Marquis, Pascale; Brukner, Ivan; Blanchette, Ruth; Haub, Kevin; Magrini, Vince; Mardis, Elaine R.; Gerding, Dale N.; Loo, Vivian G.; Miller, Mark A.; Mulvey, Michael R.; Rupnik, Maja; Dascal, Andre; Dewar, Ken

2011-01-01

Clostridium difficile is a common cause of infectious diarrhea in hospitalized patients. A severe and increased incidence of C. difficile infection (CDI) is associated predominantly with the NAP1 strain; however, the existence of other severe-disease-associated (SDA) strains and the extensive genetic diversity across C. difficile complicate reliable detection and diagnosis. Comparative genome analysis of 14 sequenced genomes, including those of a subset of NAP1 isolates, allowed the assessment of genetic diversity within and between strain types to identify DNA markers that are associated with severe disease. Comparative genome analysis of 14 isolates, including five publicly available strains, revealed that C. difficile has a core genome of 3.4 Mb, comprising ∼3,000 genes. Analysis of the core genome identified candidate DNA markers that were subsequently evaluated using a multistrain panel of 177 isolates, representing more than 50 pulsovars and 8 toxinotypes. A subset of 117 isolates from the panel had associated patient data that allowed assessment of an association between the DNA markers and severe CDI. We identified 20 candidate DNA markers for species-wide detection and 10,683 single nucleotide polymorphisms (SNPs) associated with the predominant SDA strain (NAP1). A species-wide detection candidate marker, the sspA gene, was found to be the same across 177 sequenced isolates and lacked significant similarity to those of other species. Candidate SNPs in genes CD1269 and CD1265 were found to associate more closely with disease severity than currently used diagnostic markers, as they were also present in the toxin A-negative and B-positive (A-B+) strain types. The genetic markers identified illustrate the potential of comparative genomics for the discovery of diagnostic DNA-based targets that are species specific or associated with multiple SDA strains. PMID:21508155

Investigation of the association of two candidate genes (H-FABP and PSMC1) with growth and carcass traits in Qinchuan beef cattle from China.

PubMed

Liang, W; Zhang, H L; Liu, Y; Lu, B C; Liu, X; Li, Q; Cao, Y

2014-03-17

Growth and carcass traits are economically important quality characteristics of beef cattle and are complex quantitative traits that are controlled by multiple genes. In this study, 2 candidate genes, H-FABP (encoding the heart fatty acid-binding protein) and PSMC1 (encoding the proteasome 26S subunit of ATPase 1) were investigated in Qinchuan beef cattle of China. PCR-SSCP and DNA sequencing methods were used to detect mutations in the H-FABP and PSMC1 genes in Qinchuan cattle, and a T>C mutation in exon 1 of H-FABP and a T>C mutation in exon 9 of PSMC1 were identified. The association of these 2 single nucleotide polymorphisms with growth and carcass traits of Qinchuan cattle was analyzed. The T>C mutation in H-FABP was significantly associated with body length and dressing percentage (P < 0.05) and the T>C mutation in PSMC1 with body length and hip width (P < 0.05), indicating that both of the 2 mutations in H-FABP and PSMC1 had effects on growth and carcass traits in the Qinchuan beef cattle breed. Thus, the results of our study suggest that the H-FABP and PSMC1 gene polymorphisms could be used as genetic markers in marker-assisted selection for improving Qinchuan beef cattle.

Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes.

PubMed

Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary

2014-11-25

The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot be recommended as a preferred means to identify new candidate insecticide resistant genes. Instead the rich data set on in vivo sites of transcription should be consulted when designing follow up qPCR validation steps, or for screening known candidates in field populations.

A Novel Candidate Region for Genetic Adaptation to High Altitude in Andean Populations

PubMed Central

Lippold, Sebastian; de Filippo, Cesare; Tang, Kun; López Herráez, David; Li, Jing; Stoneking, Mark

2015-01-01

Humans living at high altitude (≥2,500 meters above sea level) have acquired unique abilities to survive the associated extreme environmental conditions, including hypoxia, cold temperature, limited food availability and high levels of free radicals and oxidants. Long-term inhabitants of the most elevated regions of the world have undergone extensive physiological and/or genetic changes, particularly in the regulation of respiration and circulation, when compared to lowland populations. Genome scans have identified candidate genes involved in altitude adaption in the Tibetan Plateau and the Ethiopian highlands, in contrast to populations from the Andes, which have not been as intensively investigated. In the present study, we focused on three indigenous populations from Bolivia: two groups of Andean natives, Aymara and Quechua, and the low-altitude control group of Guarani from the Gran Chaco lowlands. Using pooled samples, we identified a number of SNPs exhibiting large allele frequency differences over 900,000 genotyped SNPs. A region in chromosome 10 (within the cytogenetic bands q22.3 and q23.1) was significantly differentiated between highland and lowland groups. We resequenced ~1.5 Mb surrounding the candidate region and identified strong signals of positive selection in the highland populations. A composite of multiple signals like test localized the signal to FAM213A and a related enhancer; the product of this gene acts as an antioxidant to lower oxidative stress and may help to maintain bone mass. The results suggest that positive selection on the enhancer might increase the expression of this antioxidant, and thereby prevent oxidative damage. In addition, the most significant signal in a relative extended haplotype homozygosity analysis was localized to the SFTPD gene, which encodes a surfactant pulmonary-associated protein involved in normal respiration and innate host defense. Our study thus identifies two novel candidate genes and associated pathways that may be involved in high-altitude adaptation in Andean populations. PMID:25961286

Meta-review of protein network regulating obesity between validated obesity candidate genes in the white adipose tissue of high-fat diet-induced obese C57BL/6J mice.

PubMed

Kim, Eunjung; Kim, Eun Jung; Seo, Seung-Won; Hur, Cheol-Goo; McGregor, Robin A; Choi, Myung-Sook

2014-01-01

Worldwide obesity and related comorbidities are increasing, but identifying new therapeutic targets remains a challenge. A plethora of microarray studies in diet-induced obesity models has provided large datasets of obesity associated genes. In this review, we describe an approach to examine the underlying molecular network regulating obesity, and we discuss interactions between obesity candidate genes. We conducted network analysis on functional protein-protein interactions associated with 25 obesity candidate genes identified in a literature-driven approach based on published microarray studies of diet-induced obesity. The obesity candidate genes were closely associated with lipid metabolism and inflammation. Peroxisome proliferator activated receptor gamma (Pparg) appeared to be a core obesity gene, and obesity candidate genes were highly interconnected, suggesting a coordinately regulated molecular network in adipose tissue. In conclusion, the current network analysis approach may help elucidate the underlying molecular network regulating obesity and identify anti-obesity targets for therapeutic intervention.

Finding novel relationships with integrated gene-gene association network analysis of Synechocystis sp. PCC 6803 using species-independent text-mining.

PubMed

Kreula, Sanna M; Kaewphan, Suwisa; Ginter, Filip; Jones, Patrik R

2018-01-01

The increasing move towards open access full-text scientific literature enhances our ability to utilize advanced text-mining methods to construct information-rich networks that no human will be able to grasp simply from 'reading the literature'. The utility of text-mining for well-studied species is obvious though the utility for less studied species, or those with no prior track-record at all, is not clear. Here we present a concept for how advanced text-mining can be used to create information-rich networks even for less well studied species and apply it to generate an open-access gene-gene association network resource for Synechocystis sp. PCC 6803, a representative model organism for cyanobacteria and first case-study for the methodology. By merging the text-mining network with networks generated from species-specific experimental data, network integration was used to enhance the accuracy of predicting novel interactions that are biologically relevant. A rule-based algorithm (filter) was constructed in order to automate the search for novel candidate genes with a high degree of likely association to known target genes by (1) ignoring established relationships from the existing literature, as they are already 'known', and (2) demanding multiple independent evidences for every novel and potentially relevant relationship. Using selected case studies, we demonstrate the utility of the network resource and filter to ( i ) discover novel candidate associations between different genes or proteins in the network, and ( ii ) rapidly evaluate the potential role of any one particular gene or protein. The full network is provided as an open-source resource.

Integrated microarray and ChIP analysis identifies multiple Foxa2 dependent target genes in the notochord.

PubMed

Tamplin, Owen J; Cox, Brian J; Rossant, Janet

2011-12-15

The node and notochord are key tissues required for patterning of the vertebrate body plan. Understanding the gene regulatory network that drives their formation and function is therefore important. Foxa2 is a key transcription factor at the top of this genetic hierarchy and finding its targets will help us to better understand node and notochord development. We performed an extensive microarray-based gene expression screen using sorted embryonic notochord cells to identify early notochord-enriched genes. We validated their specificity to the node and notochord by whole mount in situ hybridization. This provides the largest available resource of notochord-expressed genes, and therefore candidate Foxa2 target genes in the notochord. Using existing Foxa2 ChIP-seq data from adult liver, we were able to identify a set of genes expressed in the notochord that had associated regions of Foxa2-bound chromatin. Given that Foxa2 is a pioneer transcription factor, we reasoned that these sites might represent notochord-specific enhancers. Candidate Foxa2-bound regions were tested for notochord specific enhancer function in a zebrafish reporter assay and 7 novel notochord enhancers were identified. Importantly, sequence conservation or predictive models could not have readily identified these regions. Mutation of putative Foxa2 binding elements in two of these novel enhancers abrogated reporter expression and confirmed their Foxa2 dependence. The combination of highly specific gene expression profiling and genome-wide ChIP analysis is a powerful means of understanding developmental pathways, even for small cell populations such as the notochord. Copyright © 2011 Elsevier Inc. All rights reserved.

ARG1 Is a Novel Bronchodilator Response Gene

PubMed Central

Litonjua, Augusto A.; Lasky-Su, Jessica; Schneiter, Kady; Tantisira, Kelan G.; Lazarus, Ross; Klanderman, Barbara; Lima, John J.; Irvin, Charles G.; Peters, Stephen P.; Hanrahan, John P.; Liggett, Stephen B.; Hawkins, Gregory A.; Meyers, Deborah A.; Bleecker, Eugene R.; Lange, Christoph; Weiss, Scott T.

2008-01-01

Rationale: Inhaled β-agonists are one of the most widely used classes of drugs for the treatment of asthma. However, a substantial proportion of patients with asthma do not have a favorable response to these drugs, and identifying genetic determinants of drug response may aid in tailoring treatment for individual patients. Objectives: To screen variants in candidate genes in the steroid and β-adrenergic pathways for association with response to inhaled β-agonists. Methods: We genotyped 844 single nucleotide polymorphisms (SNPs) in 111 candidate genes in 209 children and their parents participating in the Childhood Asthma Management Program. We screened the association of these SNPs with acute response to inhaled β-agonists (bronchodilator response [BDR]) using a novel algorithm implemented in a family-based association test that ranked SNPs in order of statistical power. Genes that had SNPs with median power in the highest quartile were then taken for replication analyses in three other asthma cohorts. Measurements and Main Results: We identified 17 genes from the screening algorithm and genotyped 99 SNPs from these genes in a second population of patients with asthma. We then genotyped 63 SNPs from four genes with significant associations with BDR, for replication in a third and fourth population of patients with asthma. Evidence for association from the four asthma cohorts was combined, and SNPs from ARG1 were significantly associated with BDR. SNP rs2781659 survived Bonferroni correction for multiple testing (combined P value = 0.00048, adjusted P value = 0.047). Conclusions: These findings identify ARG1 as a novel gene for acute BDR in both children and adults with asthma. PMID:18617639

Whole exome sequencing identifies novel candidate genes that modify chronic obstructive pulmonary disease susceptibility.

PubMed

Bruse, Shannon; Moreau, Michael; Bromberg, Yana; Jang, Jun-Ho; Wang, Nan; Ha, Hongseok; Picchi, Maria; Lin, Yong; Langley, Raymond J; Qualls, Clifford; Klensney-Tait, Julia; Zabner, Joseph; Leng, Shuguang; Mao, Jenny; Belinsky, Steven A; Xing, Jinchuan; Nyunoya, Toru

2016-01-07

Chronic obstructive pulmonary disease (COPD) is characterized by an irreversible airflow limitation in response to inhalation of noxious stimuli, such as cigarette smoke. However, only 15-20 % smokers manifest COPD, suggesting a role for genetic predisposition. Although genome-wide association studies have identified common genetic variants that are associated with susceptibility to COPD, effect sizes of the identified variants are modest, as is the total heritability accounted for by these variants. In this study, an extreme phenotype exome sequencing study was combined with in vitro modeling to identify COPD candidate genes. We performed whole exome sequencing of 62 highly susceptible smokers and 30 exceptionally resistant smokers to identify rare variants that may contribute to disease risk or resistance to COPD. This was a cross-sectional case-control study without therapeutic intervention or longitudinal follow-up information. We identified candidate genes based on rare variant analyses and evaluated exonic variants to pinpoint individual genes whose function was computationally established to be significantly different between susceptible and resistant smokers. Top scoring candidate genes from these analyses were further filtered by requiring that each gene be expressed in human bronchial epithelial cells (HBECs). A total of 81 candidate genes were thus selected for in vitro functional testing in cigarette smoke extract (CSE)-exposed HBECs. Using small interfering RNA (siRNA)-mediated gene silencing experiments, we showed that silencing of several candidate genes augmented CSE-induced cytotoxicity in vitro. Our integrative analysis through both genetic and functional approaches identified two candidate genes (TACC2 and MYO1E) that augment cigarette smoke (CS)-induced cytotoxicity and, potentially, COPD susceptibility.

Linkage analysis of schizophrenia with five dopamine receptor genes in nine pedigrees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coon, H.; Byerley, W.; Holik, J.

Alterations in dopamine neurotransmission have been strongly implicated in the pathogenesis of schizophrenia for nearly 2 decades. Recently, the genes for five dopamine receptors have been cloned and characterized, and genetic and physical map information has become available. Using these five loci as candidate genes, the authors have tested for genetic linkage to schizophrenia in nine multigenerational families which include multiple affected individuals. In addition to testing conservative disease models, the have used a neurophysiological indicator variable, the P50 auditory evoked response. Deficits in gating of the P50 response have been shown to segregate with schizophrenia in this sample andmore » may identify carriers of gene(s) predisposing for schizophrenia. Linkage results were consistently negative, indicating that a defect at any of the actual receptor sites is unlikely to be a major contributor to schizophrenia in the nine families studied. 47 refs., 1 fig., 4 tabs.« less

Chum salmon egg extracts induce upregulation of collagen type I and exert antioxidative effects on human dermal fibroblast cultures.

PubMed

Yoshino, Atsushi; Polouliakh, Natalia; Meguro, Akira; Takeuchi, Masaki; Kawagoe, Tatsukata; Mizuki, Nobuhisa

2016-01-01

Components of fish roe possess antioxidant and antiaging activities, making them potentially very beneficial natural resources. Here, we investigated chum salmon eggs (CSEs) as a source of active ingredients, including vitamins, unsaturated fatty acids, and proteins. We incubated human dermal fibroblast cultures for 48 hours with high and low concentrations of CSE extracts and analyzed changes in gene expression. Cells treated with CSE extract showed concentration-dependent upregulation of collagen type I genes and of multiple antioxidative genes, including OXR1, TXNRD1, and PRDX family genes. We further conducted in silico phylogenetic footprinting analysis of promoter regions. These results suggested that transcription factors such as acute myeloid leukemia-1a and cyclic adenosine monophosphate response element-binding protein may be involved in the observed upregulation of antioxidative genes. Our results support the idea that CSEs are strong candidate sources of antioxidant materials and cosmeceutically effective ingredients.

Applications and Limitations of Mouse Models for Understanding Human Atherosclerosis

PubMed Central

von Scheidt, Moritz; Zhao, Yuqi; Kurt, Zeyneb; Pan, Calvin; Zeng, Lingyao; Yang, Xia; Schunkert, Heribert; Lusis, Aldons J.

2017-01-01

Most of the biological understanding of mechanisms underlying coronary artery disease (CAD) derives from studies of mouse models. The identification of multiple CAD loci and strong candidate genes in large human genome-wide association studies (GWAS) presented an opportunity to examine the relevance of mouse models for the human disease. We comprehensively reviewed the mouse literature, including 827 literature-derived genes, and compared it to human data. First, we observed striking concordance of risk factors for atherosclerosis in mice and humans. Second, there was highly significant overlap of mouse genes with human genes identified by GWAS. In particular, of the 46 genes with strong association signals in CAD-GWAS that were studied in mouse models all but one exhibited consistent effects on atherosclerosis-related phenotypes. Third, we compared 178 CAD-associated pathways derived from human GWAS with 263 from mouse studies and observed that over 50% were consistent between both species. PMID:27916529

Cortical DNA methylation maintains remote memory.

PubMed

Miller, Courtney A; Gavin, Cristin F; White, Jason A; Parrish, R Ryley; Honasoge, Avinash; Yancey, Christopher R; Rivera, Ivonne M; Rubio, María D; Rumbaugh, Gavin; Sweatt, J David

2010-06-01

A behavioral memory's lifetime represents multiple molecular lifetimes, suggesting the necessity for a self-perpetuating signal. One candidate is DNA methylation, a transcriptional repression mechanism that maintains cellular memory throughout development. We found that persistent, gene-specific cortical hypermethylation was induced in rats by a single, hippocampus-dependent associative learning experience and pharmacologic inhibition of methylation 1 month after learning disrupted remote memory. We propose that the adult brain utilizes DNA methylation to preserve long-lasting memories.

Voluntary wheel running reduces voluntary consumption of ethanol in mice: identification of candidate genes through striatal gene expression profiling

PubMed Central

Darlington, Todd M; McCarthy, Riley D; Cox, Ryan J; Miyamoto-Ditmon, Jill; Gallego, Xavier; Ehringer, Marissa A

2016-01-01

Hedonic substitution, where wheel running reduces voluntary ethanol consumption has been observed in prior studies. Here we replicate and expand on previous work showing that mice decrease voluntary ethanol consumption and preference when given access to a running wheel. While earlier work has been limited mainly to behavioral studies, here we assess the underlying molecular mechanisms that may account for this interaction. From four groups of female C57BL/6J mice (control, access to two-bottle choice ethanol, access to a running wheel, and access to both two-bottle choice ethanol and a running wheel), mRNA-sequencing of the striatum identified differential gene expression. Many genes in ethanol preference quantitative trait loci were differentially expressed due to running. Furthermore, we conducted Weighted Gene Co-expression Network Analysis and identified gene networks corresponding to each effect behavioral group. Candidate genes for mediating the behavioral interaction between ethanol consumption and wheel running include multiple potassium channel genes, Oprm1, Prkcg, Stxbp1, Crhr1, Gabra3, Slc6a13, Stx1b, Pomc, Rassf5, Polr2a, and Camta2. After observing an overlap of many genes and functional groups previously identified in studies of initial sensitivity to ethanol, we hypothesized that wheel running may induce a change in sensitivity, thereby affecting ethanol consumption. A behavioral study examining Loss of Righting Reflex to ethanol following exercise trended toward supporting this hypothesis. These data provide a rich resource for future studies that may better characterize the observed transcriptional changes in gene networks in response to ethanol consumption and wheel running. PMID:27063791

Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

PubMed

Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

1998-08-01

The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

Reranking candidate gene models with cross-species comparison for improved gene prediction

PubMed Central

Liu, Qian; Crammer, Koby; Pereira, Fernando CN; Roos, David S

2008-01-01

Background Most gene finders score candidate gene models with state-based methods, typically HMMs, by combining local properties (coding potential, splice donor and acceptor patterns, etc). Competing models with similar state-based scores may be distinguishable with additional information. In particular, functional and comparative genomics datasets may help to select among competing models of comparable probability by exploiting features likely to be associated with the correct gene models, such as conserved exon/intron structure or protein sequence features. Results We have investigated the utility of a simple post-processing step for selecting among a set of alternative gene models, using global scoring rules to rerank competing models for more accurate prediction. For each gene locus, we first generate the K best candidate gene models using the gene finder Evigan, and then rerank these models using comparisons with putative orthologous genes from closely-related species. Candidate gene models with lower scores in the original gene finder may be selected if they exhibit strong similarity to probable orthologs in coding sequence, splice site location, or signal peptide occurrence. Experiments on Drosophila melanogaster demonstrate that reranking based on cross-species comparison outperforms the best gene models identified by Evigan alone, and also outperforms the comparative gene finders GeneWise and Augustus+. Conclusion Reranking gene models with cross-species comparison improves gene prediction accuracy. This straightforward method can be readily adapted to incorporate additional lines of evidence, as it requires only a ranked source of candidate gene models. PMID:18854050

High-throughput cell-based screening reveals a role for ZNF131 as a repressor of ERalpha signaling

PubMed Central

Han, Xiao; Guo, Jinhai; Deng, Weiwei; Zhang, Chenying; Du, Peige; Shi, Taiping; Ma, Dalong

2008-01-01

Background Estrogen receptor α (ERα) is a transcription factor whose activity is affected by multiple regulatory cofactors. In an effort to identify the human genes involved in the regulation of ERα, we constructed a high-throughput, cell-based, functional screening platform by linking a response element (ERE) with a reporter gene. This allowed the cellular activity of ERα, in cells cotransfected with the candidate gene, to be quantified in the presence or absence of its cognate ligand E2. Results From a library of 570 human cDNA clones, we identified zinc finger protein 131 (ZNF131) as a repressor of ERα mediated transactivation. ZNF131 is a typical member of the BTB/POZ family of transcription factors, and shows both ubiquitous expression and a high degree of sequence conservation. The luciferase reporter gene assay revealed that ZNF131 inhibits ligand-dependent transactivation by ERα in a dose-dependent manner. Electrophoretic mobility shift assay clearly demonstrated that the interaction between ZNF131 and ERα interrupts or prevents ERα binding to the estrogen response element (ERE). In addition, ZNF131 was able to suppress the expression of pS2, an ERα target gene. Conclusion We suggest that the functional screening platform we constructed can be applied for high-throughput genomic screening candidate ERα-related genes. This in turn may provide new insights into the underlying molecular mechanisms of ERα regulation in mammalian cells. PMID:18847501

An R2R3-type MYB transcription factor, GmMYB29, regulates isoflavone biosynthesis in soybean

PubMed Central

Liu, Shulin; Zhou, Xiaoqiong; Zhang, Huairen; Wang, Chun-e; Yang, Wenming; Tian, Zhixi; Cheng, Hao; Yu, Deyue

2017-01-01

Isoflavones comprise a group of secondary metabolites produced almost exclusively by plants in the legume family, including soybean [Glycine max (L.) Merr.]. They play vital roles in plant defense and have many beneficial effects on human health. Isoflavone content is a complex quantitative trait controlled by multiple genes, and the genetic mechanisms underlying isoflavone biosynthesis remain largely unknown. Via a genome-wide association study (GWAS), we identified 28 single nucleotide polymorphisms (SNPs) that are significantly associated with isoflavone concentrations in soybean. One of these 28 SNPs was located in the 5’-untranslated region (5’-UTR) of an R2R3-type MYB transcription factor, GmMYB29, and this gene was thus selected as a candidate gene for further analyses. A subcellular localization study confirmed that GmMYB29 was located in the nucleus. Transient reporter gene assays demonstrated that GmMYB29 activated the IFS2 (isoflavone synthase 2) and CHS8 (chalcone synthase 8) gene promoters. Overexpression and RNAi-mediated silencing of GmMYB29 in soybean hairy roots resulted in increased and decreased isoflavone content, respectively. Moreover, a candidate-gene association analysis revealed that 11 natural GmMYB29 polymorphisms were significantly associated with isoflavone contents, and regulation of GmMYB29 expression could partially contribute to the observed phenotypic variation. Taken together, these results provide important genetic insights into the molecular mechanisms underlying isoflavone biosynthesis in soybean. PMID:28489859

Recent progress in the genetics of spontaneously hypertensive rats.

PubMed

Pravenec, M; Křen, V; Landa, V; Mlejnek, P; Musilová, A; Šilhavý, J; Šimáková, M; Zídek, V

2014-01-01

The spontaneously hypertensive rat (SHR) is the most widely used animal model of essential hypertension and accompanying metabolic disturbances. Recent advances in sequencing of genomes of BN-Lx and SHR progenitors of the BXH/HXB recombinant inbred (RI) strains as well as accumulation of multiple data sets of intermediary phenotypes in the RI strains, including mRNA and microRNA abundance, quantitative metabolomics, proteomics, methylomics or histone modifications, will make it possible to systematically search for genetic variants involved in regulation of gene expression and in the etiology of complex pathophysiological traits. New advances in manipulation of the rat genome, including efficient transgenesis and gene targeting, will enable in vivo functional analyses of selected candidate genes to identify QTL at the molecular level or to provide insight into mechanisms whereby targeted genes affect pathophysiological traits in the SHR.

Candidate gene prioritization by network analysis of differential expression using machine learning approaches

PubMed Central

2010-01-01

Background Discovering novel disease genes is still challenging for diseases for which no prior knowledge - such as known disease genes or disease-related pathways - is available. Performing genetic studies frequently results in large lists of candidate genes of which only few can be followed up for further investigation. We have recently developed a computational method for constitutional genetic disorders that identifies the most promising candidate genes by replacing prior knowledge by experimental data of differential gene expression between affected and healthy individuals. To improve the performance of our prioritization strategy, we have extended our previous work by applying different machine learning approaches that identify promising candidate genes by determining whether a gene is surrounded by highly differentially expressed genes in a functional association or protein-protein interaction network. Results We have proposed three strategies scoring disease candidate genes relying on network-based machine learning approaches, such as kernel ridge regression, heat kernel, and Arnoldi kernel approximation. For comparison purposes, a local measure based on the expression of the direct neighbors is also computed. We have benchmarked these strategies on 40 publicly available knockout experiments in mice, and performance was assessed against results obtained using a standard procedure in genetics that ranks candidate genes based solely on their differential expression levels (Simple Expression Ranking). Our results showed that our four strategies could outperform this standard procedure and that the best results were obtained using the Heat Kernel Diffusion Ranking leading to an average ranking position of 8 out of 100 genes, an AUC value of 92.3% and an error reduction of 52.8% relative to the standard procedure approach which ranked the knockout gene on average at position 17 with an AUC value of 83.7%. Conclusion In this study we could identify promising candidate genes using network based machine learning approaches even if no knowledge is available about the disease or phenotype. PMID:20840752

Identification of candidate infection genes from the model entomopathogenic nematode Heterorhabditis bacteriophora.

PubMed

Vadnal, Jonathan; Ratnappan, Ramesh; Keaney, Melissa; Kenney, Eric; Eleftherianos, Ioannis; O'Halloran, Damien; Hawdon, John M

2017-01-03

Despite important progress in the field of innate immunity, our understanding of host immune responses to parasitic nematode infections lags behind that of responses to microbes. A limiting factor has been the obligate requirement for a vertebrate host which has hindered investigation of the parasitic nematode infective process. The nematode parasite Heterorhabditis bacteriophora offers great potential as a model to genetically dissect the process of infection. With its mutualistic Photorhabdus luminescens bacteria, H. bacteriophora invades multiple species of insects, which it kills and exploits as a food source for the development of several nematode generations. The ability to culture the life cycle of H. bacteriophora on plates growing the bacterial symbiont makes it a very exciting model of parasitic infection that can be used to unlock the molecular events occurring during infection of a host that are inaccessible using vertebrate hosts. To profile the transcriptional response of an infective nematode during the early stage of infection, we performed next generation RNA sequencing on H. bacteriophora IJs incubated in Manduca sexta hemolymph plasma for 9 h. A subset of up-regulated and down-regulated genes were validated using qRT-PCR. Comparative analysis of the transcriptome with untreated controls found a number of differentially expressed genes (DEGs) which cover a number of different functional categories. A subset of DEGs is conserved across Clade V parasitic nematodes revealing an array of candidate parasitic genes. Our analysis reveals transcriptional changes in the regulation of a large number of genes, most of which have not been shown previously to play a role in the process of infection. A significant proportion of these genes are unique to parasitic nematodes, suggesting the identification of a group of parasitism factors within nematodes. Future studies using these candidates may provide functional insight into the process of nematode parasitism and also the molecular evolution of parasitism within nematodes.

Exploring the genetic basis of adaptation to high elevations in reptiles: a comparative transcriptome analysis of two toad-headed agamas (genus Phrynocephalus).

PubMed

Yang, Weizhao; Qi, Yin; Fu, Jinzhong

2014-01-01

High elevation adaptation offers an excellent study system to understand the genetic basis of adaptive evolution. We acquired transcriptome sequences of two closely related lizards, Phrynocephalus przewalskii from low elevations and P. vlangalii from high elevations. Within a phylogenetic framework, we compared their genomic data along with green anole, chicken and Chinese softshell turtle, and identified candidate genes and functional categories that are potentially linked to adaptation to high elevation environments. More than 100 million sequence reads were generated for each species via Illumina sequencing. A de novo assembly produced 70,919 and 62,118 transcripts for P. przewalskii and P. vlangalii, respectively. Based on a well-established reptile phylogeny, we detected 143 positively selected genes (PSGs) along the P. vlangalii lineage from the 7,012 putative orthologs using a branch-site model. Furthermore, ten GO categories and one KEGG pathway that are over-represented by PSGs were recognized. In addition, 58 GO categories were revealed to have elevated evolutionary rates along the P. vlangalii lineage relative to P. przewalskii. These functional analyses further filter out PSGs that are most likely involved in the adaptation process to high elevations. Among them, ADAM17, MD, and HSP90B1 likely contributed to response to hypoxia, and POLK likely contributed to DNA repair. Many other candidate genes involved in gene expression and metabolism were also identified. Genome-wide scan for candidate genes may serve as the first step to explore the genetic basis of high elevation adaptation. Detailed comparative study and functional verification are needed to solidify any conclusions. High elevation adaptation requires coordinated changes in multiple genes that involve various physiological and biochemical pathways; we hope that our genetic studies will provide useful directions for future physiological or molecular studies in reptiles as well as other poikilothermic species.

Exploring the Genetic Basis of Adaptation to High Elevations in Reptiles: A Comparative Transcriptome Analysis of Two Toad-Headed Agamas (Genus Phrynocephalus)

PubMed Central

Yang, Weizhao; Qi, Yin; Fu, Jinzhong

2014-01-01

High elevation adaptation offers an excellent study system to understand the genetic basis of adaptive evolution. We acquired transcriptome sequences of two closely related lizards, Phrynocephalus przewalskii from low elevations and P. vlangalii from high elevations. Within a phylogenetic framework, we compared their genomic data along with green anole, chicken and Chinese softshell turtle, and identified candidate genes and functional categories that are potentially linked to adaptation to high elevation environments. More than 100 million sequence reads were generated for each species via Illumina sequencing. A de novo assembly produced 70,919 and 62,118 transcripts for P. przewalskii and P. vlangalii, respectively. Based on a well-established reptile phylogeny, we detected 143 positively selected genes (PSGs) along the P. vlangalii lineage from the 7,012 putative orthologs using a branch-site model. Furthermore, ten GO categories and one KEGG pathway that are over-represented by PSGs were recognized. In addition, 58 GO categories were revealed to have elevated evolutionary rates along the P. vlangalii lineage relative to P. przewalskii. These functional analyses further filter out PSGs that are most likely involved in the adaptation process to high elevations. Among them, ADAM17, MD, and HSP90B1 likely contributed to response to hypoxia, and POLK likely contributed to DNA repair. Many other candidate genes involved in gene expression and metabolism were also identified. Genome-wide scan for candidate genes may serve as the first step to explore the genetic basis of high elevation adaptation. Detailed comparative study and functional verification are needed to solidify any conclusions. High elevation adaptation requires coordinated changes in multiple genes that involve various physiological and biochemical pathways; we hope that our genetic studies will provide useful directions for future physiological or molecular studies in reptiles as well as other poikilothermic species. PMID:25386640

The combined effects of genetic risk and perceived discrimination on blood pressure among African Americans in the Jackson Heart Study

PubMed Central

Taylor, Jacquelyn Y.; Sun, Yan V.; Barcelona de Mendoza, Veronica; Ifatunji, Mosi; Rafferty, Jane; Fox, Ervin R.; Musani, Solomon K.; Sims, Mario; Jackson, James S.

2017-01-01

Abstract Both genomics and environmental stressors play a significant role in increases in blood pressure (BP). In an attempt to further explain the hypertension (HTN) disparity among African Americans (AA), both genetic underpinnings (selected candidate genes) and stress due to perceived racial discrimination (as reported in the literature) have independently been linked to increased BP among AAs. Although Gene x Environment interactions on BP have been examined, the environmental component of these investigations has focused more on lifestyle behaviors such as smoking, diet, and physical activity, and less on psychosocial stressors such as perceived discrimination. The present study uses candidate gene analyses to identify the relationship between Everyday Discrimination (ED) and Major Life Discrimination (MLD) with increases in systolic BP (SBP) and diastolic BP (DBP) among AA in the Jackson Heart Study. Multiple linear regression models reveal no association between discrimination and BP after adjusting for age, sex, body mass index (BMI), antihypertensive medication use, and current smoking status. Subsequent candidate gene analysis identified 5 SNPs (rs7602215, rs3771724, rs1006502, rs1791926, and rs2258119) that interacted with perceived discrimination and SBP, and 3 SNPs (rs2034454, rs7602215, and rs3771724) that interacted with perceived discrimination and DBP. Most notably, there was a significant SNP × discrimination interaction for 2 SNPs on the SLC4A5 gene: rs3771724 (MLD: SBP P = .034, DBP P = .031; ED: DBP: P = .016) and rs1006502 (MLD: SBP P = .034, DBP P = .030; ED: DBP P = .015). This study supports the idea that SNP × discrimination interactions combine to influence clinically relevant traits such as BP. Replication with similar epidemiological samples is required to ascertain the role of genes and psychosocial stressors in the development and expression of high BP in this understudied population. PMID:29069027

The combined effects of genetic risk and perceived discrimination on blood pressure among African Americans in the Jackson Heart Study.

PubMed

Taylor, Jacquelyn Y; Sun, Yan V; Barcelona de Mendoza, Veronica; Ifatunji, Mosi; Rafferty, Jane; Fox, Ervin R; Musani, Solomon K; Sims, Mario; Jackson, James S

2017-10-01

Both genomics and environmental stressors play a significant role in increases in blood pressure (BP). In an attempt to further explain the hypertension (HTN) disparity among African Americans (AA), both genetic underpinnings (selected candidate genes) and stress due to perceived racial discrimination (as reported in the literature) have independently been linked to increased BP among AAs. Although Gene x Environment interactions on BP have been examined, the environmental component of these investigations has focused more on lifestyle behaviors such as smoking, diet, and physical activity, and less on psychosocial stressors such as perceived discrimination.The present study uses candidate gene analyses to identify the relationship between Everyday Discrimination (ED) and Major Life Discrimination (MLD) with increases in systolic BP (SBP) and diastolic BP (DBP) among AA in the Jackson Heart Study. Multiple linear regression models reveal no association between discrimination and BP after adjusting for age, sex, body mass index (BMI), antihypertensive medication use, and current smoking status.Subsequent candidate gene analysis identified 5 SNPs (rs7602215, rs3771724, rs1006502, rs1791926, and rs2258119) that interacted with perceived discrimination and SBP, and 3 SNPs (rs2034454, rs7602215, and rs3771724) that interacted with perceived discrimination and DBP. Most notably, there was a significant SNP × discrimination interaction for 2 SNPs on the SLC4A5 gene: rs3771724 (MLD: SBP P = .034, DBP P = .031; ED: DBP: P = .016) and rs1006502 (MLD: SBP P = .034, DBP P = .030; ED: DBP P = .015).This study supports the idea that SNP × discrimination interactions combine to influence clinically relevant traits such as BP. Replication with similar epidemiological samples is required to ascertain the role of genes and psychosocial stressors in the development and expression of high BP in this understudied population.

Pharmacogenetics of risperidone therapy in autism: association analysis of eight candidate genes with drug efficacy and adverse drug reactions.

PubMed

Correia, C T; Almeida, J P; Santos, P E; Sequeira, A F; Marques, C E; Miguel, T S; Abreu, R L; Oliveira, G G; Vicente, A M

2010-10-01

Little has been reported on the factors, genetic or other, that underlie the variability in individual response, particularly for autism. In this study we simultaneously explored the effects of multiple candidate genes on clinical improvement and occurrence of adverse drug reactions, in 45 autistic patients who received monotherapy with risperidone up to 1 year. Candidate genes involved in the pharmacokinetics (CYP2D6 and ABCB1) and pharmacodynamics (HTR2A, HTR2C, DRD2, DRD3, HTR6) of the drug, and the brain-derived neurotrophic factor (BDNF) gene, were analysed. Using the generalized estimating equation method these genes were tested for association with drug efficacy, assessed with the Autism Treatment Evaluation Checklist, and with safety and tolerability measures, such as prolactin levels, body mass index (BMI), waist circumference and neurological adverse effects, including extrapyramidal movements. Our results confirm that risperidone therapy was very effective in reducing some autism symptoms and caused few serious adverse effects. After adjusting for confounding factors, the HTR2A c.-1438G>A, DRD3 Ser9Gly, HTR2C c.995G>A and ABCB1 1236C>T polymorphisms were predictors for clinical improvement with risperidone therapy. The HTR2A c.-1438G>A, HTR2C c.68G>C (p.C33S), HTR6 c.7154-2542C>T and BDNF c.196G>A (p.V66M) polymorphisms influenced prolactin elevation. HTR2C c.68G>C and CYP2D6 polymorphisms were associated with risperidone-induced increase in BMI or waist circumference. We thus identified for the first time several genes implicated in risperidone efficacy and safety in autism patients. Although association results require replication, given the small sample size, the study makes a preliminary contribution to the personalized therapy of risperidone in autism.

Refinement of light-responsive transcript lists using rice oligonucleotide arrays: evaluation of gene-redundancy.

PubMed

Jung, Ki-Hong; Dardick, Christopher; Bartley, Laura E; Cao, Peijian; Phetsom, Jirapa; Canlas, Patrick; Seo, Young-Su; Shultz, Michael; Ouyang, Shu; Yuan, Qiaoping; Frank, Bryan C; Ly, Eugene; Zheng, Li; Jia, Yi; Hsia, An-Ping; An, Kyungsook; Chou, Hui-Hsien; Rocke, David; Lee, Geun Cheol; Schnable, Patrick S; An, Gynheung; Buell, C Robin; Ronald, Pamela C

2008-10-06

Studies of gene function are often hampered by gene-redundancy, especially in organisms with large genomes such as rice (Oryza sativa). We present an approach for using transcriptomics data to focus functional studies and address redundancy. To this end, we have constructed and validated an inexpensive and publicly available rice oligonucleotide near-whole genome array, called the rice NSF45K array. We generated expression profiles for light- vs. dark-grown rice leaf tissue and validated the biological significance of the data by analyzing sources of variation and confirming expression trends with reverse transcription polymerase chain reaction. We examined trends in the data by evaluating enrichment of gene ontology terms at multiple false discovery rate thresholds. To compare data generated with the NSF45K array with published results, we developed publicly available, web-based tools (www.ricearray.org). The Oligo and EST Anatomy Viewer enables visualization of EST-based expression profiling data for all genes on the array. The Rice Multi-platform Microarray Search Tool facilitates comparison of gene expression profiles across multiple rice microarray platforms. Finally, we incorporated gene expression and biochemical pathway data to reduce the number of candidate gene products putatively participating in the eight steps of the photorespiration pathway from 52 to 10, based on expression levels of putatively functionally redundant genes. We confirmed the efficacy of this method to cope with redundancy by correctly predicting participation in photorespiration of a gene with five paralogs. Applying these methods will accelerate rice functional genomics.

Candidate Genes Involved in Beneficial or Adverse Responses to Commonly Eaten Brassica Vegetables in a New Zealand Crohn’s Disease Cohort

PubMed Central

Laing, Bobbi; Han, Dug Yeo; Ferguson, Lynnette R.

2013-01-01

Crohn’s disease (CD) is one of the two manifestations of inflammatory bowel disease. Particular foods are thought with CD to exacerbate their illness. Vegetables, especially Brassicaceae, are often shunned by people with CD because of the negative effects they are alleged to have on their symptoms. Brassicaceae supply key nutrients which are necessary to meet recommended daily intakes. We sought to identify the candidate genes involved in the beneficial or adverse effects of Brassicaceae most commonly eaten, as reported by the New Zealand adults from the “Genes and Diet in Inflammatory Bowel disease Study” based in Auckland. An analysis of associations between the single nucleotide polymorphisms (SNPs) and the beneficial or adverse effects of the ten most commonly eaten Brassicaceae was carried out. A total of 37 SNPs were significantly associated with beneficial effects (p = 0.00097 to 0.0497) and 64 SNPs were identified with adverse effects (p = 0.0000751 to 0.049). After correcting for multiple testing, rs7515322 (DIO1) and rs9469220 (HLA) remained significant. Our findings show that the tolerance of some varieties of Brassicaceae may be shown by analysis of a person’s genotype. PMID:24352087

X-linked infantile spinal muscular atrophy: clinical definition and molecular mapping.

PubMed

Dressman, Devin; Ahearn, Mary Ellen; Yariz, Kemal O; Basterrecha, Hugo; Martínez, Francisco; Palau, Francesc; Barmada, M Michael; Clark, Robin Dawn; Meindl, Alfons; Wirth, Brunhilde; Hoffman, Eric P; Baumbach-Reardon, Lisa

2007-01-01

X-linked infantile spinal-muscular atrophy (XL-SMA) is a rare disorder, which presents with the clinical characteristics of hypotonia, areflexia, and multiple congenital contractures (arthrogryposis) associated with loss of anterior horn cells and death in infancy. We have previously reported a single family with XL-SMA that mapped to Xp11.3-q11.2. Here we report further clinical description of XL-SMA plus an additional seven unrelated (XL-SMA) families from North America and Europe that show linkage data consistent with the same region. We first investigated linkage to the candidate disease gene region using microsatellite repeat markers. We further saturated the candidate disease gene region using polymorphic microsatellite repeat markers and single nucleotide polymorphisms in an effort to narrow the critical region. Two-point and multipoint linkage analysis was performed using the Allegro software package. Linkage analysis of all XL-SMA families displayed linkage consistent with the original XL-SMA region. The addition of new families and new markers has narrowed the disease gene interval for a XL-SMA locus between SNP FLJ22843 near marker DXS 8080 and SNP ARHGEF9 which is near DXS7132 (Xp11.3-Xq11.1).

Genetic Modifiers of Patent Ductus Arteriosus in Term Infants.

PubMed

Patel, Priti M; Momany, Allison M; Schaa, Kendra L; Romitti, Paul A; Druschel, Charlotte; Cooper, Margaret E; Marazita, Mary L; Murray, Jeffrey C; Dagle, John M

2016-09-01

To identify single-nucleotide polymorphisms (SNPs) in specific candidate genes associated with patent ductus arteriosus in term infants. We conducted an initial family-based, candidate gene study to analyze genotype data from DNA samples obtained from 171 term infants and their parents enrolled in the National Birth Defects Prevention Study (NBDPS). We performed transmission disequilibrium testing (TDT) using a panel of 55 SNPs in 17 genes. Replication of SNPs with P < .1 in the NBDPS trios was performed with a case-control strategy in an independent population. TDT analysis of the NBDPS trios resulted in 6 SNPs reaching the predetermined cutoff (P < .1) to be included in the replication study. These 6 SNPs were genotyped in the independent case-control population. A SNP in TGFBR2 was found to be associated with term patent ductus arteriosus in both populations after we corrected for multiple comparisons. (rs934328, TDT P = 2 × 10(-4), case-control P = 6.6 × 10(-5)). These findings confirm the importance of the transforming growth factor-beta pathway in the closure of the term ductus arteriosus and may suggest new therapeutic targets. Published by Elsevier Inc.

Meta-analysis of shared genetic architecture across ten pediatric autoimmune diseases

PubMed Central

Li, Yun R; Li, Jin; Zhao, Sihai D; Bradfield, Jonathan P; Mentch, Frank D; Maggadottir, S Melkorka; Hou, Cuiping; Abrams, Debra J; Chang, Diana; Gao, Feng; Guo, Yiran; Wei, Zhi; Connolly, John J; Cardinale, Christopher J; Bakay, Marina; Glessner, Joseph T; Li, Dong; Kao, Charlly; Thomas, Kelly A; Qiu, Haijun; Chiavacci, Rosetta M; Kim, Cecilia E; Wang, Fengxiang; Snyder, James; Richie, Marylyn D; Flatø, Berit; Førre, Øystein; Denson, Lee A; Thompson, Susan D; Becker, Mara L; Guthery, Stephen L; Latiano, Anna; Perez, Elena; Resnick, Elena; Russell, Richard K; Wilson, David C; Silverberg, Mark S; Annese, Vito; Lie, Benedicte A; Punaro, Marilynn; Dubinsky, Marla C; Monos, Dimitri S; Strisciuglio, Caterina; Staiano, Annamaria; Miele, Erasmo; Kugathasan, Subra; Ellis, Justine A; Munro, Jane E; Sullivan, Kathleen E; Wise, Carol A; Chapel, Helen; Cunningham-Rundles, Charlotte; Grant, Struan F A; Orange, Jordan S; Sleiman, Patrick M A; Behrens, Edward M; Griffiths, Anne M; Satsangi, Jack; Finkel, Terri H; Keinan, Alon; Prak, Eline T Luning; Polychronakos, Constantin; Baldassano, Robert N; Li, Hongzhe; Keating, Brendan J; Hakonarson, Hakon

2016-01-01

Genome-wide association studies (GWASs) have identified hundreds of susceptibility genes, including shared associations across clinically distinct autoimmune diseases. We performed an inverse χ2 meta-analysis across ten pediatric-age-of-onset autoimmune diseases (pAIDs) in a case-control study including more than 6,035 cases and 10,718 shared population-based controls. We identified 27 genome-wide significant loci associated with one or more pAIDs, mapping to in silico–replicated autoimmune-associated genes (including IL2RA) and new candidate loci with established immunoregulatory functions such as ADGRL2, TENM3, ANKRD30A, ADCY7 and CD40LG. The pAID-associated single-nucleotide polymorphisms (SNPs) were functionally enriched for deoxyribonuclease (DNase)-hypersensitivity sites, expression quantitative trait loci (eQTLs), microRNA (miRNA)-binding sites and coding variants. We also identified biologically correlated, pAID-associated candidate gene sets on the basis of immune cell expression profiling and found evidence of genetic sharing. Network and protein-interaction analyses demonstrated converging roles for the signaling pathways of type 1, 2 and 17 helper T cells (TH1, TH2 and TH17), JAK-STAT, interferon and interleukin in multiple autoimmune diseases. PMID:26301688

Array comparative genomic hybridization and computational genome annotation in constitutional cytogenetics: suggesting candidate genes for novel submicroscopic chromosomal imbalance syndromes.

PubMed

Van Vooren, Steven; Coessens, Bert; De Moor, Bart; Moreau, Yves; Vermeesch, Joris R

2007-09-01

Genome-wide array comparative genomic hybridization screening is uncovering pathogenic submicroscopic chromosomal imbalances in patients with developmental disorders. In those patients, imbalances appear now to be scattered across the whole genome, and most patients carry different chromosomal anomalies. Screening patients with developmental disorders can be considered a forward functional genome screen. The imbalances pinpoint the location of genes that are involved in human development. Because most imbalances encompass regions harboring multiple genes, the challenge is to (1) identify those genes responsible for the specific phenotype and (2) disentangle the role of the different genes located in an imbalanced region. In this review, we discuss novel tools and relevant databases that have recently been developed to aid this gene discovery process. Identification of the functional relevance of genes will not only deepen our understanding of human development but will, in addition, aid in the data interpretation and improve genetic counseling.

Prediction of Human Disease Genes by Human-Mouse Conserved Coexpression Analysis

PubMed Central

Grassi, Elena; Damasco, Christian; Silengo, Lorenzo; Oti, Martin; Provero, Paolo; Di Cunto, Ferdinando

2008-01-01

Background Even in the post-genomic era, the identification of candidate genes within loci associated with human genetic diseases is a very demanding task, because the critical region may typically contain hundreds of positional candidates. Since genes implicated in similar phenotypes tend to share very similar expression profiles, high throughput gene expression data may represent a very important resource to identify the best candidates for sequencing. However, so far, gene coexpression has not been used very successfully to prioritize positional candidates. Methodology/Principal Findings We show that it is possible to reliably identify disease-relevant relationships among genes from massive microarray datasets by concentrating only on genes sharing similar expression profiles in both human and mouse. Moreover, we show systematically that the integration of human-mouse conserved coexpression with a phenotype similarity map allows the efficient identification of disease genes in large genomic regions. Finally, using this approach on 850 OMIM loci characterized by an unknown molecular basis, we propose high-probability candidates for 81 genetic diseases. Conclusion Our results demonstrate that conserved coexpression, even at the human-mouse phylogenetic distance, represents a very strong criterion to predict disease-relevant relationships among human genes. PMID:18369433

Single-Nucleotide Polymorphisms Associated with Skin Naphthyl–Keratin Adduct Levels in Workers Exposed to Naphthalene

PubMed Central

Jiang, Rong; French, John E.; Stober, Vandy P.; Kang-Sickel, Juei-Chuan C.; Zou, Fei

2012-01-01

Background: Individual genetic variation that results in differences in systemic response to xenobiotic exposure is not accounted for as a predictor of outcome in current exposure assessment models. Objective: We developed a strategy to investigate individual differences in single-nucleotide polymorphisms (SNPs) as genetic markers associated with naphthyl–keratin adduct (NKA) levels measured in the skin of workers exposed to naphthalene. Methods: The SNP-association analysis was conducted in PLINK using candidate-gene analysis and genome-wide analysis. We identified significant SNP–NKA associations and investigated the potential impact of these SNPs along with personal and workplace factors on NKA levels using a multiple linear regression model and the Pratt index. Results: In candidate-gene analysis, a SNP (rs4852279) located near the CYP26B1 gene contributed to the 2-naphthyl–keratin adduct (2NKA) level. In the multiple linear regression model, the SNP rs4852279, dermal exposure, exposure time, task replacing foam, age, and ethnicity all were significant predictors of 2NKA level. In genome-wide analysis, no single SNP reached genome-wide significance for NKA levels (all p ≥ 1.05 × 10–5). Pathway and network analyses of SNPs associated with NKA levels were predicted to be involved in the regulation of cellular processes and homeostasis. Conclusions: These results provide evidence that a quantitative biomarker can be used as an intermediate phenotype when investigating the association between genetic markers and exposure–dose relationship in a small, well-characterized exposed worker population. PMID:22391508

Identification of a Bipolar Disorder Vulnerable Gene CHDH at 3p21.1.

PubMed

Chang, Hong; Li, Lingyi; Peng, Tao; Grigoroiu-Serbanescu, Maria; Bergen, Sarah E; Landén, Mikael; Hultman, Christina M; Forstner, Andreas J; Strohmaier, Jana; Hecker, Julian; Schulze, Thomas G; Müller-Myhsok, Bertram; Reif, Andreas; Mitchell, Philip B; Martin, Nicholas G; Cichon, Sven; Nöthen, Markus M; Jamain, Stéphane; Leboyer, Marion; Bellivier, Frank; Etain, Bruno; Kahn, Jean-Pierre; Henry, Chantal; Rietschel, Marcella; Xiao, Xiao; Li, Ming

2017-09-01

Genome-wide analysis (GWA) is an effective strategy to discover extreme effects surpassing genome-wide significant levels in studying complex disorders; however, when sample size is limited, the true effects may fail to achieve genome-wide significance. In such case, there may be authentic results among the pools of nominal candidates, and an alternative approach is to consider nominal candidates but are replicable across different samples. Here, we found that mRNA expression of the choline dehydrogenase gene (CHDH) was uniformly upregulated in the brains of bipolar disorder (BPD) patients compared with healthy controls across different studies. Follow-up genetic analyses of CHDH variants in multiple independent clinical datasets (including 11,564 cases and 17,686 controls) identified a risk SNP rs9836592 showing consistent associations with BPD (P meta  = 5.72 × 10 -4 ), and the risk allele indicated an increased CHDH expression in multiple neuronal tissues (lowest P = 6.70 × 10 -16 ). These converging results may identify a nominal but true BPD susceptibility gene CHDH. Further exploratory analysis revealed suggestive associations of rs9836592 with childhood intelligence (P = 0.044) and educational attainment (P = 0.0039), a "proxy phenotype" of general cognitive abilities. Intriguingly, the CHDH gene is located at chromosome 3p21.1, a risk region implicated in previous BPD genome-wide association studies (GWAS), but CHDH is lying outside of the core GWAS linkage disequilibrium (LD) region, and our studied SNP rs9836592 is ∼1.2 Mb 3' downstream of the previous GWAS loci (e.g., rs2251219) with no LD between them; thus, the association observed here is unlikely a reflection of previous GWAS signals. In summary, our results imply that CHDH may play a previously unknown role in the etiology of BPD and also highlight the informative value of integrating gene expression and genetic code in advancing our understanding of its biological basis.

A genome-wide association study for somatic cell score using the Illumina high-density bovine beadchip identifies several novel QTL potentially related to mastitis susceptibility

PubMed Central

Meredith, Brian K.; Berry, Donagh P.; Kearney, Francis; Finlay, Emma K.; Fahey, Alan G.; Bradley, Daniel G.; Lynn, David J.

2013-01-01

Mastitis is an inflammation-driven disease of the bovine mammary gland that occurs in response to physical damage or infection and is one of the most costly production-related diseases in the dairy industry worldwide. We performed a genome-wide association study (GWAS) to identify genetic loci associated with somatic cell score (SCS), an indicator trait of mammary gland inflammation. A total of 702 Holstein-Friesian bulls were genotyped for 777,962 single nucleotide polymorphisms (SNPs) and associated with SCS phenotypes. The SCS phenotypes were expressed as daughter yield deviations (DYD) based on a large number of progeny performance records. A total of 138 SNPs on 15 different chromosomes reached genome-wide significance (corrected p-value ≤ 0.05) for association with SCS (after correction for multiple testing). We defined 28 distinct QTL regions and a number of candidate genes located in these QTL regions were identified. The most significant association (p-value = 1.70 × 10−7) was observed on chromosome 6. This QTL had no known genes annotated within it, however, the Ensembl Genome Browser predicted the presence of a small non-coding RNA (a Y RNA gene) in this genomic region. This Y RNA gene was 99% identical to human RNY4. Y RNAs are a rare type of non-coding RNA that were originally discovered due to their association with the autoimmune disease, systemic lupus erythematosus. Examining small-RNA sequencing (RNAseq) data being generated by us in multiple different mastitis-pathogen challenged cell-types has revealed that this Y RNA is expressed (but not differentially expressed) in these cells. Other QTL regions identified in this study also encoded strong candidate genes for mastitis susceptibility. A QTL region on chromosome 13, for example, was found to contain a cluster of β-defensin genes, a gene family with known roles in innate immunity. Due to the increased SNP density, this study also refined the boundaries for several known QTL for SCS and mastitis. PMID:24223582

Neurocarta: aggregating and sharing disease-gene relations for the neurosciences.

PubMed

Portales-Casamar, Elodie; Ch'ng, Carolyn; Lui, Frances; St-Georges, Nicolas; Zoubarev, Anton; Lai, Artemis Y; Lee, Mark; Kwok, Cathy; Kwok, Willie; Tseng, Luchia; Pavlidis, Paul

2013-02-26

Understanding the genetic basis of diseases is key to the development of better diagnoses and treatments. Unfortunately, only a small fraction of the existing data linking genes to phenotypes is available through online public resources and, when available, it is scattered across multiple access tools. Neurocarta is a knowledgebase that consolidates information on genes and phenotypes across multiple resources and allows tracking and exploring of the associations. The system enables automatic and manual curation of evidence supporting each association, as well as user-enabled entry of their own annotations. Phenotypes are recorded using controlled vocabularies such as the Disease Ontology to facilitate computational inference and linking to external data sources. The gene-to-phenotype associations are filtered by stringent criteria to focus on the annotations most likely to be relevant. Neurocarta is constantly growing and currently holds more than 30,000 lines of evidence linking over 7,000 genes to 2,000 different phenotypes. Neurocarta is a one-stop shop for researchers looking for candidate genes for any disorder of interest. In Neurocarta, they can review the evidence linking genes to phenotypes and filter out the evidence they're not interested in. In addition, researchers can enter their own annotations from their experiments and analyze them in the context of existing public annotations. Neurocarta's in-depth annotation of neurodevelopmental disorders makes it a unique resource for neuroscientists working on brain development.

Looking into flowering time in almond (Prunus dulcis (Mill) D. A. Webb): the candidate gene approach.

PubMed

Silva, C; Garcia-Mas, J; Sánchez, A M; Arús, P; Oliveira, M M

2005-03-01

Blooming time is one of the most important agronomic traits in almond. Biochemical and molecular events underlying flowering regulation must be understood before methods to stimulate late flowering can be developed. Attempts to elucidate the genetic control of this process have led to the identification of a major gene (Lb) and quantitative trait loci (QTLs) linked to observed phenotypic differences, but although this gene and these QTLs have been placed on the Prunus reference genetic map, their sequences and specific functions remain unknown. The aim of our investigation was to associate these loci with known genes using a candidate gene approach. Two almond cDNAs and eight Prunus expressed sequence tags were selected as candidate genes (CGs) since their sequences were highly identical to those of flowering regulatory genes characterized in other species. The CGs were amplified from both parental lines of the mapping population using specific primers. Sequence comparison revealed DNA polymorphisms between the parental lines, mainly of the single nucleotide type. Polymorphisms were used to develop co-dominant cleaved amplified polymorphic sequence markers or length polymorphisms based on insertion/deletion events for mapping the candidate genes on the Prunus reference map. Ten candidate genes were assigned to six linkage groups in the Prunus genome. The positions of two of these were compatible with the regions where two QTLs for blooming time were detected. One additional candidate was localized close to the position of the Evergrowing gene, which determines a non-deciduous behaviour in peach.

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

NASA Astrophysics Data System (ADS)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Convergent Genomic Studies Identify Association of GRIK2 and NPAS2 with Chronic Fatigue Syndrome

PubMed Central

Smith, Alicia K.; Fang, Hong; Whistler, Toni; Unger, Elizabeth R.; Rajeevan, Mangalathu S.

2011-01-01

Background There is no consistent evidence of specific gene(s) or molecular pathways that contribute to the pathogenesis, therapeutic intervention or diagnosis of chronic fatigue syndrome (CFS). While multiple studies support a role for genetic variation in CFS, genome-wide efforts to identify associated loci remain unexplored. We employed a novel convergent functional genomics approach that incorporates the findings from single-nucleotide polymorphism (SNP) and mRNA expression studies to identify associations between CFS and novel candidate genes for further investigation. Methods We evaluated 116,204 SNPs in 40 CFS and 40 nonfatigued control subjects along with mRNA expression of 20,160 genes in a subset of these subjects (35 CFS subjects and 27 controls) derived from a population-based study. Results Sixty-five SNPs were nominally associated with CFS (p < 0.001), and 165 genes were differentially expressed (≥4-fold; p ≤ 0.05) in peripheral blood mononuclear cells of CFS subjects. Two genes, glutamate receptor, ionotropic, kinase 2 (GRIK2) and neuronal PAS domain protein 2 (NPAS2), were identified by both SNP and gene expression analyses. Subjects with the G allele of rs2247215 (GRIK2) were more likely to have CFS (p = 0.0005), and CFS subjects showed decreased GRIK2 expression (10-fold; p = 0.015). Subjects with the T allele of rs356653 (NPAS2) were more likely to have CFS (p = 0.0007), and NPAS2 expression was increased (10-fold; p = 0.027) in those with CFS. Conclusion Using an integrated genomic strategy, this study suggests a possible role for genes involved in glutamatergic neurotransmission and circadian rhythm in CFS and supports further study of novel candidate genes in independent populations of CFS subjects. PMID:21912186

Cross-Study Comparison Reveals Common Genomic, Network, and Functional Signatures of Desiccation Resistance in Drosophila melanogaster

PubMed Central

Telonis-Scott, Marina; Sgrò, Carla M.; Hoffmann, Ary A.; Griffin, Philippa C.

2016-01-01

Repeated attempts to map the genomic basis of complex traits often yield different outcomes because of the influence of genetic background, gene-by-environment interactions, and/or statistical limitations. However, where repeatability is low at the level of individual genes, overlap often occurs in gene ontology categories, genetic pathways, and interaction networks. Here we report on the genomic overlap for natural desiccation resistance from a Pool-genome-wide association study experiment and a selection experiment in flies collected from the same region in southeastern Australia in different years. We identified over 600 single nucleotide polymorphisms associated with desiccation resistance in flies derived from almost 1,000 wild-caught genotypes, a similar number of loci to that observed in our previous genomic study of selected lines, demonstrating the genetic complexity of this ecologically important trait. By harnessing the power of cross-study comparison, we narrowed the candidates from almost 400 genes in each study to a core set of 45 genes, enriched for stimulus, stress, and defense responses. In addition to gene-level overlap, there was higher order congruence at the network and functional levels, suggesting genetic redundancy in key stress sensing, stress response, immunity, signaling, and gene expression pathways. We also identified variants linked to different molecular aspects of desiccation physiology previously verified from functional experiments. Our approach provides insight into the genomic basis of a complex and ecologically important trait and predicts candidate genetic pathways to explore in multiple genetic backgrounds and related species within a functional framework. PMID:26733490

Modeling the functional genomics of autism using human neurons.

PubMed

Konopka, G; Wexler, E; Rosen, E; Mukamel, Z; Osborn, G E; Chen, L; Lu, D; Gao, F; Gao, K; Lowe, J K; Geschwind, D H

2012-02-01

Human neural progenitors from a variety of sources present new opportunities to model aspects of human neuropsychiatric disease in vitro. Such in vitro models provide the advantages of a human genetic background combined with rapid and easy manipulation, making them highly useful adjuncts to animal models. Here, we examined whether a human neuronal culture system could be utilized to assess the transcriptional program involved in human neural differentiation and to model some of the molecular features of a neurodevelopmental disorder, such as autism. Primary normal human neuronal progenitors (NHNPs) were differentiated into a post-mitotic neuronal state through addition of specific growth factors and whole-genome gene expression was examined throughout a time course of neuronal differentiation. After 4 weeks of differentiation, a significant number of genes associated with autism spectrum disorders (ASDs) are either induced or repressed. This includes the ASD susceptibility gene neurexin 1, which showed a distinct pattern from neurexin 3 in vitro, and which we validated in vivo in fetal human brain. Using weighted gene co-expression network analysis, we visualized the network structure of transcriptional regulation, demonstrating via this unbiased analysis that a significant number of ASD candidate genes are coordinately regulated during the differentiation process. As NHNPs are genetically tractable and manipulable, they can be used to study both the effects of mutations in multiple ASD candidate genes on neuronal differentiation and gene expression in combination with the effects of potential therapeutic molecules. These data also provide a step towards better understanding of the signaling pathways disrupted in ASD.

Association and linkage studies of candidate genes involved in GABAergic neurotransmission in lithium-responsive bipolar disorder.

PubMed Central

Duffy, A; Turecki, G; Grof, P; Cavazzoni, P; Grof, E; Joober, R; Ahrens, B; Berghöfer, A; Müller-Oerlinghausen, B; Dvoráková, M; Libigerová, E; Vojtĕchovský, M; Zvolský, P; Nilsson, A; Licht, R W; Rasmussen, N A; Schou, M; Vestergaard, P; Holzinger, A; Schumann, C; Thau, K; Robertson, C; Rouleau, G A; Alda, M

2000-01-01

OBJECTIVE: To test for genetic linkage and association with GABAergic candidate genes in lithium-responsive bipolar disorder. DESIGN: Polymorphisms located in genes that code for GABRA3, GABRA5 and GABRB3 subunits of the GABAA receptor were investigated using association and linkage strategies. PARTICIPANTS: A total of 138 patients with bipolar 1 disorder with a clear response to lithium prophylaxis, selected from specialized lithium clinics in Canada and Europe that are part of the International Group for the Study of Lithium-Treated Patients, and 108 psychiatrically healthy controls. Families of 24 probands were suitable for linkage analysis. OUTCOME MEASURES: The association between the candidate genes and patients with bipolar disorder versus that of controls and genetic linkage within families. RESULTS: There was no significant association or linkage found between lithium-responsive bipolar disorder and the GABAergic candidate genes investigated. CONCLUSIONS: This study does not support a major role for the GABAergic candidate genes tested in lithium-responsive bipolar disorder. PMID:11022400

Functional mechanisms underlying pleiotropic risk alleles at the 19p13.1 breast–ovarian cancer susceptibility locus

PubMed Central

Lawrenson, Kate; Kar, Siddhartha; McCue, Karen; Kuchenbaeker, Karoline; Michailidou, Kyriaki; Tyrer, Jonathan; Beesley, Jonathan; Ramus, Susan J.; Li, Qiyuan; Delgado, Melissa K.; Lee, Janet M.; Aittomäki, Kristiina; Andrulis, Irene L.; Anton-Culver, Hoda; Arndt, Volker; Arun, Banu K.; Arver, Brita; Bandera, Elisa V.; Barile, Monica; Barkardottir, Rosa B.; Barrowdale, Daniel; Beckmann, Matthias W.; Benitez, Javier; Berchuck, Andrew; Bisogna, Maria; Bjorge, Line; Blomqvist, Carl; Blot, William; Bogdanova, Natalia; Bojesen, Anders; Bojesen, Stig E.; Bolla, Manjeet K.; Bonanni, Bernardo; Børresen-Dale, Anne-Lise; Brauch, Hiltrud; Brennan, Paul; Brenner, Hermann; Bruinsma, Fiona; Brunet, Joan; Buhari, Shaik Ahmad; Burwinkel, Barbara; Butzow, Ralf; Buys, Saundra S.; Cai, Qiuyin; Caldes, Trinidad; Campbell, Ian; Canniotto, Rikki; Chang-Claude, Jenny; Chiquette, Jocelyne; Choi, Ji-Yeob; Claes, Kathleen B. M.; Collonge-Rame, Marie- Agnès; Damette, Alexandre; Barouk-Simonet, Emmanuelle; Bonnet, Françoise; Bubien, Virginie; Sevenet, Nicolas; Longy, Michel; Berthet, Pascaline; Vaur, Dominique; Castera, Laurent; Ferrer, Sandra Fert; Bignon, Yves-Jean; Uhrhammer, Nancy; Coron, Fanny; Faivre, Laurence; Baurand, Amandine; Jacquot, Caroline; Bertolone, Geoffrey; Lizard, Sarab; Leroux, Dominique; Dreyfus, Hélène; Rebischung, Christine; Peysselon, Magalie; Peyrat, Jean-Philippe; Fournier, Joëlle; Révillion, Françoise; Adenis, Claude; Vénat-Bouvet, Laurence; Léone, Mélanie; Boutry-Kryza, Nadia; Calender, Alain; Giraud, Sophie; Verny-Pierre, Carole; Lasset, Christine; Bonadona, Valérie; Barjhoux, Laure; Sobol, Hagay; Bourdon, Violaine; Noguchi, Tetsuro; Remenieras, Audrey; Coupier, Isabelle; Pujol, Pascal; Sokolowska, Johanna; Bronner, Myriam; Delnatte, Capucine; Bézieau, Stéphane; Mari, Véronique; Gauthier-Villars, Marion; Buecher, Bruno; Rouleau, Etienne; Golmard, Lisa; Moncoutier, Virginie; Belotti, Muriel; de Pauw, Antoine; Elan, Camille; Fourme, Emmanuelle; Birot, Anne-Marie; Saule, Claire; Laurent, Maïté; Houdayer, Claude; Lesueur, Fabienne; Mebirouk, Noura; Coulet, Florence; Colas, Chrystelle; Soubrier, Florent; Warcoin, Mathilde; Prieur, Fabienne; Lebrun, Marine; Kientz, Caroline; Muller, Danièle; Fricker, Jean-Pierre; Toulas, Christine; Guimbaud, Rosine; Gladieff, Laurence; Feillel, Viviane; Mortemousque, Isabelle; Bressac-de-Paillerets, Brigitte; Caron, Olivier; Guillaud-Bataille, Marine; Cook, Linda S.; Cox, Angela; Cramer, Daniel W.; Cross, Simon S.; Cybulski, Cezary; Czene, Kamila; Daly, Mary B.; Damiola, Francesca; Dansonka-Mieszkowska, Agnieszka; Darabi, Hatef; Dennis, Joe; Devilee, Peter; Diez, Orland; Doherty, Jennifer A.; Domchek, Susan M.; Dorfling, Cecilia M.; Dörk, Thilo; Dumont, Martine; Ehrencrona, Hans; Ejlertsen, Bent; Ellis, Steve; Gregory, Helen; Miedzybrodzka, Zosia; Morrison, Patrick J.; Donaldson, Alan; Rogers, Mark T.; Kennedy, M. John; Porteous, Mary E.; Brady, Angela; Barwell, Julian; Foo, Claire; Lalloo, Fiona; Side, Lucy E.; Eason, Jacqueline; Henderson, Alex; Walker, Lisa; Cook, Jackie; Snape, Katie; Murray, Alex; McCann, Emma; Engel, Christoph; Lee, Eunjung; Evans, D. Gareth; Fasching, Peter A.; Feliubadalo, Lidia; Figueroa, Jonine; Flesch-Janys, Dieter; Fletcher, Olivia; Flyger, Henrik; Foretova, Lenka; Fostira, Florentia; Foulkes, William D.; Fridley, Brooke L.; Friedman, Eitan; Frost, Debra; Gambino, Gaetana; Ganz, Patricia A.; Garber, Judy; García-Closas, Montserrat; Gentry-Maharaj, Aleksandra; Ghoussaini, Maya; Giles, Graham G.; Glasspool, Rosalind; Godwin, Andrew K.; Goldberg, Mark S.; Goldgar, David E.; González-Neira, Anna; Goode, Ellen L.; Goodman, Marc T.; Greene, Mark H.; Gronwald, Jacek; Guénel, Pascal; Haiman, Christopher A.; Hall, Per; Hallberg, Emily; Hamann, Ute; Hansen, Thomas V. O.; Harrington, Patricia A.; Hartman, Mikael; Hassan, Norhashimah; Healey, Sue; Rookus, M. A.; van Leeuwen, F. E.; van der Kolk, L. E.; Schmidt, M. K.; Russell, N. S.; de Lange, J. L.; Wijnands, R.; Collée, J. M.; Hooning, M. J.; Seynaeve, C.; van Deurzen, C. H. M.; Obdeijn, I. M.; van Asperen, C. J.; Tollenaar, R. A. E. M.; van Cronenburg, T. C. T. E. F.; Kets, C. M.; Ausems, M. G. E. M.; van der Pol, C. C.; van Os, T. A. M.; Waisfisz, Q.; Meijers-Heijboer, H. E. J.; Gómez-Garcia, E. B.; Oosterwijk, J. C.; Mourits, M. J.; de Bock, G. H.; Vasen, H. F.; Siesling, S.; Verloop, J.; Overbeek, L. I. H.; Heitz, Florian; Herzog, Josef; Høgdall, Estrid; Høgdall, Claus K.; Hogervorst, Frans B. L.; Hollestelle, Antoinette; Hopper, John L.; Hulick, Peter J.; Huzarski, Tomasz; Imyanitov, Evgeny N.; Fox, Stephen; Kirk, Judy; Lindeman, Geoff; Price, Melanie; Bowtell, David; deFazio, Anna; Webb, Penny; Isaacs, Claudine; Ito, Hidemi; Jakubowska, Anna; Janavicius, Ramunas; Jensen, Allan; John, Esther M.; Johnson, Nichola; Kabisch, Maria; Kang, Daehee; Kapuscinski, Miroslav; Karlan, Beth Y.; Khan, Sofia; Kiemeney, Lambertus A.; Kjaer, Susanne Kruger; Knight, Julia A.; Konstantopoulou, Irene; Kosma, Veli-Matti; Kristensen, Vessela; Kupryjanczyk, Jolanta; Kwong, Ava; de la Hoya, Miguel; Laitman, Yael; Lambrechts, Diether; Le, Nhu; De Leeneer, Kim; Lester, Jenny; Levine, Douglas A.; Li, Jingmei; Lindblom, Annika; Long, Jirong; Lophatananon, Artitaya; Loud, Jennifer T.; Lu, Karen; Lubinski, Jan; Mannermaa, Arto; Manoukian, Siranoush; Le Marchand, Loic; Margolin, Sara; Marme, Frederik; Massuger, Leon F. A. G.; Matsuo, Keitaro; Mazoyer, Sylvie; McGuffog, Lesley; McLean, Catriona; McNeish, Iain; Meindl, Alfons; Menon, Usha; Mensenkamp, Arjen R.; Milne, Roger L.; Montagna, Marco; Moysich, Kirsten B.; Muir, Kenneth; Mulligan, Anna Marie; Nathanson, Katherine L.; Ness, Roberta B.; Neuhausen, Susan L.; Nevanlinna, Heli; Nord, Silje; Nussbaum, Robert L.; Odunsi, Kunle; Offit, Kenneth; Olah, Edith; Olopade, Olufunmilayo I.; Olson, Janet E.; Olswold, Curtis; O'Malley, David; Orlow, Irene; Orr, Nick; Osorio, Ana; Park, Sue Kyung; Pearce, Celeste L.; Pejovic, Tanja; Peterlongo, Paolo; Pfeiler, Georg; Phelan, Catherine M.; Poole, Elizabeth M.; Pylkäs, Katri; Radice, Paolo; Rantala, Johanna; Rashid, Muhammad Usman; Rennert, Gad; Rhenius, Valerie; Rhiem, Kerstin; Risch, Harvey A.; Rodriguez, Gus; Rossing, Mary Anne; Rudolph, Anja; Salvesen, Helga B.; Sangrajrang, Suleeporn; Sawyer, Elinor J.; Schildkraut, Joellen M.; Schmidt, Marjanka K.; Schmutzler, Rita K.; Sellers, Thomas A.; Seynaeve, Caroline; Shah, Mitul; Shen, Chen-Yang; Shu, Xiao-Ou; Sieh, Weiva; Singer, Christian F.; Sinilnikova, Olga M.; Slager, Susan; Song, Honglin; Soucy, Penny; Southey, Melissa C.; Stenmark-Askmalm, Marie; Stoppa-Lyonnet, Dominique; Sutter, Christian; Swerdlow, Anthony; Tchatchou, Sandrine; Teixeira, Manuel R.; Teo, Soo H.; Terry, Kathryn L.; Terry, Mary Beth; Thomassen, Mads; Tibiletti, Maria Grazia; Tihomirova, Laima; Tognazzo, Silvia; Toland, Amanda Ewart; Tomlinson, Ian; Torres, Diana; Truong, Thérèse; Tseng, Chiu-chen; Tung, Nadine; Tworoger, Shelley S.; Vachon, Celine; van den Ouweland, Ans M. W.; van Doorn, Helena C.; van Rensburg, Elizabeth J.; Van't Veer, Laura J.; Vanderstichele, Adriaan; Vergote, Ignace; Vijai, Joseph; Wang, Qin; Wang-Gohrke, Shan; Weitzel, Jeffrey N.; Wentzensen, Nicolas; Whittemore, Alice S.; Wildiers, Hans; Winqvist, Robert; Wu, Anna H.; Yannoukakos, Drakoulis; Yoon, Sook-Yee; Yu, Jyh-Cherng; Zheng, Wei; Zheng, Ying; Khanna, Kum Kum; Simard, Jacques; Monteiro, Alvaro N.; French, Juliet D.; Couch, Fergus J.; Freedman, Matthew L.; Easton, Douglas F.; Dunning, Alison M.; Pharoah, Paul D.; Edwards, Stacey L.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Gayther, Simon A.

2016-01-01

A locus at 19p13 is associated with breast cancer (BC) and ovarian cancer (OC) risk. Here we analyse 438 SNPs in this region in 46,451 BC and 15,438 OC cases, 15,252 BRCA1 mutation carriers and 73,444 controls and identify 13 candidate causal SNPs associated with serous OC (P=9.2 × 10−20), ER-negative BC (P=1.1 × 10−13), BRCA1-associated BC (P=7.7 × 10−16) and triple negative BC (P-diff=2 × 10−5). Genotype-gene expression associations are identified for candidate target genes ANKLE1 (P=2 × 10−3) and ABHD8 (P<2 × 10−3). Chromosome conformation capture identifies interactions between four candidate SNPs and ABHD8, and luciferase assays indicate six risk alleles increased transactivation of the ADHD8 promoter. Targeted deletion of a region containing risk SNP rs56069439 in a putative enhancer induces ANKLE1 downregulation; and mRNA stability assays indicate functional effects for an ANKLE1 3′-UTR SNP. Altogether, these data suggest that multiple SNPs at 19p13 regulate ABHD8 and perhaps ANKLE1 expression, and indicate common mechanisms underlying breast and ovarian cancer risk. PMID:27601076

Functional mechanisms underlying pleiotropic risk alleles at the 19p13.1 breast-ovarian cancer susceptibility locus.

PubMed

Lawrenson, Kate; Kar, Siddhartha; McCue, Karen; Kuchenbaeker, Karoline; Michailidou, Kyriaki; Tyrer, Jonathan; Beesley, Jonathan; Ramus, Susan J; Li, Qiyuan; Delgado, Melissa K; Lee, Janet M; Aittomäki, Kristiina; Andrulis, Irene L; Anton-Culver, Hoda; Arndt, Volker; Arun, Banu K; Arver, Brita; Bandera, Elisa V; Barile, Monica; Barkardottir, Rosa B; Barrowdale, Daniel; Beckmann, Matthias W; Benitez, Javier; Berchuck, Andrew; Bisogna, Maria; Bjorge, Line; Blomqvist, Carl; Blot, William; Bogdanova, Natalia; Bojesen, Anders; Bojesen, Stig E; Bolla, Manjeet K; Bonanni, Bernardo; Børresen-Dale, Anne-Lise; Brauch, Hiltrud; Brennan, Paul; Brenner, Hermann; Bruinsma, Fiona; Brunet, Joan; Buhari, Shaik Ahmad; Burwinkel, Barbara; Butzow, Ralf; Buys, Saundra S; Cai, Qiuyin; Caldes, Trinidad; Campbell, Ian; Canniotto, Rikki; Chang-Claude, Jenny; Chiquette, Jocelyne; Choi, Ji-Yeob; Claes, Kathleen B M; Cook, Linda S; Cox, Angela; Cramer, Daniel W; Cross, Simon S; Cybulski, Cezary; Czene, Kamila; Daly, Mary B; Damiola, Francesca; Dansonka-Mieszkowska, Agnieszka; Darabi, Hatef; Dennis, Joe; Devilee, Peter; Diez, Orland; Doherty, Jennifer A; Domchek, Susan M; Dorfling, Cecilia M; Dörk, Thilo; Dumont, Martine; Ehrencrona, Hans; Ejlertsen, Bent; Ellis, Steve; Engel, Christoph; Lee, Eunjung; Evans, D Gareth; Fasching, Peter A; Feliubadalo, Lidia; Figueroa, Jonine; Flesch-Janys, Dieter; Fletcher, Olivia; Flyger, Henrik; Foretova, Lenka; Fostira, Florentia; Foulkes, William D; Fridley, Brooke L; Friedman, Eitan; Frost, Debra; Gambino, Gaetana; Ganz, Patricia A; Garber, Judy; García-Closas, Montserrat; Gentry-Maharaj, Aleksandra; Ghoussaini, Maya; Giles, Graham G; Glasspool, Rosalind; Godwin, Andrew K; Goldberg, Mark S; Goldgar, David E; González-Neira, Anna; Goode, Ellen L; Goodman, Marc T; Greene, Mark H; Gronwald, Jacek; Guénel, Pascal; Haiman, Christopher A; Hall, Per; Hallberg, Emily; Hamann, Ute; Hansen, Thomas V O; Harrington, Patricia A; Hartman, Mikael; Hassan, Norhashimah; Healey, Sue; Heitz, Florian; Herzog, Josef; Høgdall, Estrid; Høgdall, Claus K; Hogervorst, Frans B L; Hollestelle, Antoinette; Hopper, John L; Hulick, Peter J; Huzarski, Tomasz; Imyanitov, Evgeny N; Isaacs, Claudine; Ito, Hidemi; Jakubowska, Anna; Janavicius, Ramunas; Jensen, Allan; John, Esther M; Johnson, Nichola; Kabisch, Maria; Kang, Daehee; Kapuscinski, Miroslav; Karlan, Beth Y; Khan, Sofia; Kiemeney, Lambertus A; Kjaer, Susanne Kruger; Knight, Julia A; Konstantopoulou, Irene; Kosma, Veli-Matti; Kristensen, Vessela; Kupryjanczyk, Jolanta; Kwong, Ava; de la Hoya, Miguel; Laitman, Yael; Lambrechts, Diether; Le, Nhu; De Leeneer, Kim; Lester, Jenny; Levine, Douglas A; Li, Jingmei; Lindblom, Annika; Long, Jirong; Lophatananon, Artitaya; Loud, Jennifer T; Lu, Karen; Lubinski, Jan; Mannermaa, Arto; Manoukian, Siranoush; Le Marchand, Loic; Margolin, Sara; Marme, Frederik; Massuger, Leon F A G; Matsuo, Keitaro; Mazoyer, Sylvie; McGuffog, Lesley; McLean, Catriona; McNeish, Iain; Meindl, Alfons; Menon, Usha; Mensenkamp, Arjen R; Milne, Roger L; Montagna, Marco; Moysich, Kirsten B; Muir, Kenneth; Mulligan, Anna Marie; Nathanson, Katherine L; Ness, Roberta B; Neuhausen, Susan L; Nevanlinna, Heli; Nord, Silje; Nussbaum, Robert L; Odunsi, Kunle; Offit, Kenneth; Olah, Edith; Olopade, Olufunmilayo I; Olson, Janet E; Olswold, Curtis; O'Malley, David; Orlow, Irene; Orr, Nick; Osorio, Ana; Park, Sue Kyung; Pearce, Celeste L; Pejovic, Tanja; Peterlongo, Paolo; Pfeiler, Georg; Phelan, Catherine M; Poole, Elizabeth M; Pylkäs, Katri; Radice, Paolo; Rantala, Johanna; Rashid, Muhammad Usman; Rennert, Gad; Rhenius, Valerie; Rhiem, Kerstin; Risch, Harvey A; Rodriguez, Gus; Rossing, Mary Anne; Rudolph, Anja; Salvesen, Helga B; Sangrajrang, Suleeporn; Sawyer, Elinor J; Schildkraut, Joellen M; Schmidt, Marjanka K; Schmutzler, Rita K; Sellers, Thomas A; Seynaeve, Caroline; Shah, Mitul; Shen, Chen-Yang; Shu, Xiao-Ou; Sieh, Weiva; Singer, Christian F; Sinilnikova, Olga M; Slager, Susan; Song, Honglin; Soucy, Penny; Southey, Melissa C; Stenmark-Askmalm, Marie; Stoppa-Lyonnet, Dominique; Sutter, Christian; Swerdlow, Anthony; Tchatchou, Sandrine; Teixeira, Manuel R; Teo, Soo H; Terry, Kathryn L; Terry, Mary Beth; Thomassen, Mads; Tibiletti, Maria Grazia; Tihomirova, Laima; Tognazzo, Silvia; Toland, Amanda Ewart; Tomlinson, Ian; Torres, Diana; Truong, Thérèse; Tseng, Chiu-Chen; Tung, Nadine; Tworoger, Shelley S; Vachon, Celine; van den Ouweland, Ans M W; van Doorn, Helena C; van Rensburg, Elizabeth J; Van't Veer, Laura J; Vanderstichele, Adriaan; Vergote, Ignace; Vijai, Joseph; Wang, Qin; Wang-Gohrke, Shan; Weitzel, Jeffrey N; Wentzensen, Nicolas; Whittemore, Alice S; Wildiers, Hans; Winqvist, Robert; Wu, Anna H; Yannoukakos, Drakoulis; Yoon, Sook-Yee; Yu, Jyh-Cherng; Zheng, Wei; Zheng, Ying; Khanna, Kum Kum; Simard, Jacques; Monteiro, Alvaro N; French, Juliet D; Couch, Fergus J; Freedman, Matthew L; Easton, Douglas F; Dunning, Alison M; Pharoah, Paul D; Edwards, Stacey L; Chenevix-Trench, Georgia; Antoniou, Antonis C; Gayther, Simon A

2016-09-07

A locus at 19p13 is associated with breast cancer (BC) and ovarian cancer (OC) risk. Here we analyse 438 SNPs in this region in 46,451 BC and 15,438 OC cases, 15,252 BRCA1 mutation carriers and 73,444 controls and identify 13 candidate causal SNPs associated with serous OC (P=9.2 × 10(-20)), ER-negative BC (P=1.1 × 10(-13)), BRCA1-associated BC (P=7.7 × 10(-16)) and triple negative BC (P-diff=2 × 10(-5)). Genotype-gene expression associations are identified for candidate target genes ANKLE1 (P=2 × 10(-3)) and ABHD8 (P<2 × 10(-3)). Chromosome conformation capture identifies interactions between four candidate SNPs and ABHD8, and luciferase assays indicate six risk alleles increased transactivation of the ADHD8 promoter. Targeted deletion of a region containing risk SNP rs56069439 in a putative enhancer induces ANKLE1 downregulation; and mRNA stability assays indicate functional effects for an ANKLE1 3'-UTR SNP. Altogether, these data suggest that multiple SNPs at 19p13 regulate ABHD8 and perhaps ANKLE1 expression, and indicate common mechanisms underlying breast and ovarian cancer risk.

Association mapping in sunflower (Helianthus annuus L.) reveals independent control of apical vs. basal branching.

PubMed

Nambeesan, Savithri U; Mandel, Jennifer R; Bowers, John E; Marek, Laura F; Ebert, Daniel; Corbi, Jonathan; Rieseberg, Loren H; Knapp, Steven J; Burke, John M

2015-03-11

Shoot branching is an important determinant of plant architecture and influences various aspects of growth and development. Selection on branching has also played an important role in the domestication of crop plants, including sunflower (Helianthus annuus L.). Here, we describe an investigation of the genetic basis of variation in branching in sunflower via association mapping in a diverse collection of cultivated sunflower lines. Detailed phenotypic analyses revealed extensive variation in the extent and type of branching within the focal population. After correcting for population structure and kinship, association analyses were performed using a genome-wide collection of SNPs to identify genomic regions that influence a variety of branching-related traits. This work resulted in the identification of multiple previously unidentified genomic regions that contribute to variation in branching. Genomic regions that were associated with apical and mid-apical branching were generally distinct from those associated with basal and mid-basal branching. Homologs of known branching genes from other study systems (i.e., Arabidopsis, rice, pea, and petunia) were also identified from the draft assembly of the sunflower genome and their map positions were compared to those of associations identified herein. Numerous candidate branching genes were found to map in close proximity to significant branching associations. In sunflower, variation in branching is genetically complex and overall branching patterns (i.e., apical vs. basal) were found to be influenced by distinct genomic regions. Moreover, numerous candidate branching genes mapped in close proximity to significant branching associations. Although the sunflower genome exhibits localized islands of elevated linkage disequilibrium (LD), these non-random associations are known to decay rapidly elsewhere. The subset of candidate genes that co-localized with significant associations in regions of low LD represents the most promising target for future functional analyses.

Identification of a QTL in Mus musculus for Alcohol Preference, Withdrawal, and Ap3m2 Expression Using Integrative Functional Genomics and Precision Genetics

PubMed Central

Bubier, Jason A.; Jay, Jeremy J.; Baker, Christopher L.; Bergeson, Susan E.; Ohno, Hiroshi; Metten, Pamela; Crabbe, John C.; Chesler, Elissa J.

2014-01-01

Extensive genetic and genomic studies of the relationship between alcohol drinking preference and withdrawal severity have been performed using animal models. Data from multiple such publications and public data resources have been incorporated in the GeneWeaver database with >60,000 gene sets including 285 alcohol withdrawal and preference-related gene sets. Among these are evidence for positional candidates regulating these behaviors in overlapping quantitative trait loci (QTL) mapped in distinct mouse populations. Combinatorial integration of functional genomics experimental results revealed a single QTL positional candidate gene in one of the loci common to both preference and withdrawal. Functional validation studies in Ap3m2 knockout mice confirmed these relationships. Genetic validation involves confirming the existence of segregating polymorphisms that could account for the phenotypic effect. By exploiting recent advances in mouse genotyping, sequence, epigenetics, and phylogeny resources, we confirmed that Ap3m2 resides in an appropriately segregating genomic region. We have demonstrated genetic and alcohol-induced regulation of Ap3m2 expression. Although sequence analysis revealed no polymorphisms in the Ap3m2-coding region that could account for all phenotypic differences, there are several upstream SNPs that could. We have identified one of these to be an H3K4me3 site that exhibits strain differences in methylation. Thus, by making cross-species functional genomics readily computable we identified a common QTL candidate for two related bio-behavioral processes via functional evidence and demonstrate sufficiency of the genetic locus as a source of variation underlying two traits. PMID:24923803

Identification of a QTL in Mus musculus for alcohol preference, withdrawal, and Ap3m2 expression using integrative functional genomics and precision genetics.

PubMed

Bubier, Jason A; Jay, Jeremy J; Baker, Christopher L; Bergeson, Susan E; Ohno, Hiroshi; Metten, Pamela; Crabbe, John C; Chesler, Elissa J

2014-08-01

Extensive genetic and genomic studies of the relationship between alcohol drinking preference and withdrawal severity have been performed using animal models. Data from multiple such publications and public data resources have been incorporated in the GeneWeaver database with >60,000 gene sets including 285 alcohol withdrawal and preference-related gene sets. Among these are evidence for positional candidates regulating these behaviors in overlapping quantitative trait loci (QTL) mapped in distinct mouse populations. Combinatorial integration of functional genomics experimental results revealed a single QTL positional candidate gene in one of the loci common to both preference and withdrawal. Functional validation studies in Ap3m2 knockout mice confirmed these relationships. Genetic validation involves confirming the existence of segregating polymorphisms that could account for the phenotypic effect. By exploiting recent advances in mouse genotyping, sequence, epigenetics, and phylogeny resources, we confirmed that Ap3m2 resides in an appropriately segregating genomic region. We have demonstrated genetic and alcohol-induced regulation of Ap3m2 expression. Although sequence analysis revealed no polymorphisms in the Ap3m2-coding region that could account for all phenotypic differences, there are several upstream SNPs that could. We have identified one of these to be an H3K4me3 site that exhibits strain differences in methylation. Thus, by making cross-species functional genomics readily computable we identified a common QTL candidate for two related bio-behavioral processes via functional evidence and demonstrate sufficiency of the genetic locus as a source of variation underlying two traits. Copyright © 2014 by the Genetics Society of America.

Elucidating the genetic basis of antioxidant status in lettuce (Lactuca sativa)

PubMed Central

Damerum, Annabelle; Selmes, Stacey L; Biggi, Gaia F; Clarkson, Graham JJ; Rothwell, Steve D; Truco, Maria José; Michelmore, Richard W; Hancock, Robert D; Shellcock, Connie; Chapman, Mark A; Taylor, Gail

2015-01-01

A diet rich in phytonutrients from fruit and vegetables has been acknowledged to afford protection against a range of human diseases, but many of the most popular vegetables are low in phytonutrients. Wild relatives of crops may contain allelic variation for genes determining the concentrations of these beneficial phytonutrients, and therefore understanding the genetic basis of this variation is important for breeding efforts to enhance nutritional quality. In this study, lettuce recombinant inbred lines, generated from a cross between wild and cultivated lettuce (Lactuca serriola and Lactuca sativa, respectively), were analysed for antioxidant (AO) potential and important phytonutrients including carotenoids, chlorophyll and phenolic compounds. When grown in two environments, 96 quantitative trait loci (QTL) were identified for these nutritional traits: 4 for AO potential, 2 for carotenoid content, 3 for total chlorophyll content and 87 for individual phenolic compounds (two per compound on average). Most often, the L. serriola alleles conferred an increase in total AOs and metabolites. Candidate genes underlying these QTL were identified by BLASTn searches; in several cases, these had functions suggesting involvement in phytonutrient biosynthetic pathways. Analysis of a QTL on linkage group 3, which accounted for >30% of the variation in AO potential, revealed several candidate genes encoding multiple MYB transcription factors which regulate flavonoid biosynthesis and flavanone 3-hydroxylase, an enzyme involved in the biosynthesis of the flavonoids quercetin and kaempferol, which are known to have powerful AO activity. Follow-up quantitative RT-PCR of these candidates revealed that 5 out of 10 genes investigated were significantly differentially expressed between the wild and cultivated parents, providing further evidence of their potential involvement in determining the contrasting phenotypes. These results offer exciting opportunities to improve the nutritional content and health benefits of lettuce through marker-assisted breeding. PMID:26640696

Elucidating the genetic basis of antioxidant status in lettuce (Lactuca sativa).

PubMed

Damerum, Annabelle; Selmes, Stacey L; Biggi, Gaia F; Clarkson, Graham Jj; Rothwell, Steve D; Truco, Maria José; Michelmore, Richard W; Hancock, Robert D; Shellcock, Connie; Chapman, Mark A; Taylor, Gail

2015-01-01

A diet rich in phytonutrients from fruit and vegetables has been acknowledged to afford protection against a range of human diseases, but many of the most popular vegetables are low in phytonutrients. Wild relatives of crops may contain allelic variation for genes determining the concentrations of these beneficial phytonutrients, and therefore understanding the genetic basis of this variation is important for breeding efforts to enhance nutritional quality. In this study, lettuce recombinant inbred lines, generated from a cross between wild and cultivated lettuce (Lactuca serriola and Lactuca sativa, respectively), were analysed for antioxidant (AO) potential and important phytonutrients including carotenoids, chlorophyll and phenolic compounds. When grown in two environments, 96 quantitative trait loci (QTL) were identified for these nutritional traits: 4 for AO potential, 2 for carotenoid content, 3 for total chlorophyll content and 87 for individual phenolic compounds (two per compound on average). Most often, the L. serriola alleles conferred an increase in total AOs and metabolites. Candidate genes underlying these QTL were identified by BLASTn searches; in several cases, these had functions suggesting involvement in phytonutrient biosynthetic pathways. Analysis of a QTL on linkage group 3, which accounted for >30% of the variation in AO potential, revealed several candidate genes encoding multiple MYB transcription factors which regulate flavonoid biosynthesis and flavanone 3-hydroxylase, an enzyme involved in the biosynthesis of the flavonoids quercetin and kaempferol, which are known to have powerful AO activity. Follow-up quantitative RT-PCR of these candidates revealed that 5 out of 10 genes investigated were significantly differentially expressed between the wild and cultivated parents, providing further evidence of their potential involvement in determining the contrasting phenotypes. These results offer exciting opportunities to improve the nutritional content and health benefits of lettuce through marker-assisted breeding.

cudaMap: a GPU accelerated program for gene expression connectivity mapping.

PubMed

McArt, Darragh G; Bankhead, Peter; Dunne, Philip D; Salto-Tellez, Manuel; Hamilton, Peter; Zhang, Shu-Dong

2013-10-11

Modern cancer research often involves large datasets and the use of sophisticated statistical techniques. Together these add a heavy computational load to the analysis, which is often coupled with issues surrounding data accessibility. Connectivity mapping is an advanced bioinformatic and computational technique dedicated to therapeutics discovery and drug re-purposing around differential gene expression analysis. On a normal desktop PC, it is common for the connectivity mapping task with a single gene signature to take > 2h to complete using sscMap, a popular Java application that runs on standard CPUs (Central Processing Units). Here, we describe new software, cudaMap, which has been implemented using CUDA C/C++ to harness the computational power of NVIDIA GPUs (Graphics Processing Units) to greatly reduce processing times for connectivity mapping. cudaMap can identify candidate therapeutics from the same signature in just over thirty seconds when using an NVIDIA Tesla C2050 GPU. Results from the analysis of multiple gene signatures, which would previously have taken several days, can now be obtained in as little as 10 minutes, greatly facilitating candidate therapeutics discovery with high throughput. We are able to demonstrate dramatic speed differentials between GPU assisted performance and CPU executions as the computational load increases for high accuracy evaluation of statistical significance. Emerging 'omics' technologies are constantly increasing the volume of data and information to be processed in all areas of biomedical research. Embracing the multicore functionality of GPUs represents a major avenue of local accelerated computing. cudaMap will make a strong contribution in the discovery of candidate therapeutics by enabling speedy execution of heavy duty connectivity mapping tasks, which are increasingly required in modern cancer research. cudaMap is open source and can be freely downloaded from http://purl.oclc.org/NET/cudaMap.

Beyond main effects of gene-sets: harsh parenting moderates the association between a dopamine gene-set and child externalizing behavior.

PubMed

Windhorst, Dafna A; Mileva-Seitz, Viara R; Rippe, Ralph C A; Tiemeier, Henning; Jaddoe, Vincent W V; Verhulst, Frank C; van IJzendoorn, Marinus H; Bakermans-Kranenburg, Marian J

2016-08-01

In a longitudinal cohort study, we investigated the interplay of harsh parenting and genetic variation across a set of functionally related dopamine genes, in association with children's externalizing behavior. This is one of the first studies to employ gene-based and gene-set approaches in tests of Gene by Environment (G × E) effects on complex behavior. This approach can offer an important alternative or complement to candidate gene and genome-wide environmental interaction (GWEI) studies in the search for genetic variation underlying individual differences in behavior. Genetic variants in 12 autosomal dopaminergic genes were available in an ethnically homogenous part of a population-based cohort. Harsh parenting was assessed with maternal (n = 1881) and paternal (n = 1710) reports at age 3. Externalizing behavior was assessed with the Child Behavior Checklist (CBCL) at age 5 (71 ± 3.7 months). We conducted gene-set analyses of the association between variation in dopaminergic genes and externalizing behavior, stratified for harsh parenting. The association was statistically significant or approached significance for children without harsh parenting experiences, but was absent in the group with harsh parenting. Similarly, significant associations between single genes and externalizing behavior were only found in the group without harsh parenting. Effect sizes in the groups with and without harsh parenting did not differ significantly. Gene-environment interaction tests were conducted for individual genetic variants, resulting in two significant interaction effects (rs1497023 and rs4922132) after correction for multiple testing. Our findings are suggestive of G × E interplay, with associations between dopamine genes and externalizing behavior present in children without harsh parenting, but not in children with harsh parenting experiences. Harsh parenting may overrule the role of genetic factors in externalizing behavior. Gene-based and gene-set analyses offer promising new alternatives to analyses focusing on single candidate polymorphisms when examining the interplay between genetic and environmental factors.

A large homozygous deletion in the SAMHD1 gene causes atypical Aicardi–Goutiéres syndrome associated with mtDNA deletions

PubMed Central

Leshinsky-Silver, Esther; Malinger, Gustavo; Ben-Sira, Liat; Kidron, Dvora; Cohen, Sarit; Inbar, Shani; Bezaleli, Tali; Levine, Arie; Vinkler, Chana; Lev, Dorit; Lerman-Sagie, Tally

2011-01-01

Aicardi–Goutiéres syndrome (AGS) is a genetic neurodegenerative disorder with clinical symptoms mimicking a congenital viral infection. Five causative genes have been described: three prime repair exonuclease1 (TREX1), ribonucleases H2A, B and C, and most recently SAM domain and HD domain 1 (SAMHD1). We performed a detailed clinical and molecular characterization of a family with autosomal recessive neurodegenerative disorder showing white matter destruction and calcifications, presenting in utero and associated with multiple mtDNA deletions. A muscle biopsy was normal and did not show any evidence of respiratory chain dysfunction. Southern blot analysis of tissue from a living child and affected fetuses demonstrated multiple mtDNA deletions. Molecular analysis of genes involved in mtDNA synthesis and maintenance (POLGα, POLGβ, Twinkle, ANT1, TK2, SUCLA1 and DGOUK) revealed normal sequences. Sequencing of TREX1 and ribonucleases H2A, B and C failed to reveal any mutations. Whole-genome homozygosity mapping revealed a candidate region containing the SAMHD1 gene. Sequencing of the gene in the affected child and two affected fetuses revealed a large deletion (9 kb), spanning the promoter, exon1 and intron 1. The parents were found to be heterozygous for this deletion. The identification of a homozygous large deletion in the SAMHD1 gene causing atypical AGS with multiple mtDNA deletions may add information regarding the involvement of mitochondria in self-activation of innate immunity by cell intrinsic components. PMID:21102625

Changes in gene expression with sleep.

PubMed

Thimgan, Matthew S; Duntley, Stephen P; Shaw, Paul J

2011-10-15

There is general agreement within the sleep community and among public health officials of the need for an accessible biomarker of sleepiness. As the foregoing discussions emphasize, however, it may be more difficult to reach consensus on how to define such a biomarker than to identify candidate molecules that can be then evaluated to determine if they might be useful to solve a variety of real-world problems related to insufficient sleep. With that in mind, a goal of our laboratories has been to develop a rational strategy to expedite the identification of candidate biomarkers. 1 We began with the assumption that since both the genetic and environmental context of a gene can influence its behavior, an effective test of sleep loss will likely be composed of a panel of multiple biomarkers. That is, we believe that it is premature to exclude a candidate analyte simply because it might also be modulated in response to other conditions (e.g., illness, metabolism, sympathetic tone, etc.). Our next assumption was that an easily accessible biomarker would be more useful in real-world settings. Thus, we have focused on saliva, as opposed to urine or blood, as a rich source of biological analytes that can be mined to optimize the chances of bringing a biomarker out into the field. Finally, we recognize that conducting validation studies in humans can be expensive and time consuming. Thus, we have exploited genetic and pharmacological tools in the model organism Drosophila melanogaster to more fully characterize the behavior of the most exciting candidate biomarkers.

Association of the 5′-upstream regulatory region of the α7 nicotinic acetylcholine receptor subunit gene (CHRNA7) with schizophrenia

PubMed Central

Stephens, Sarah H.; Logel, Judith; Barton, Amanda; Franks, Alexis; Schultz, Jessica; Short, Margaret; Dickenson, Jane; James, Benjamin; Fingerlin, Tasha E.; Wagner, Brandie; Hodgkinson, Colin; Graw, Sharon; Ross, Randal G.; Freedman, Robert; Leonard, Sherry

2009-01-01

Background The α7 neuronal nicotinic acetylcholine receptor subunit gene (CHRNA7) is localized in a chromosomal region (15q14) linked to schizophrenia in multiple independent studies. CHRNA7 was selected as the best candidate gene in the region for a well-documented endophenotype of schizophrenia, the P50 sensory processing deficit, by genetic linkage and biochemical studies. Methods Subjects included Caucasian-Non Hispanic and African-American case-control subjects collected in Denver, and schizophrenic subjects from families in the NIMH Genetics Initiative on Schizophrenia. Thirty-five single nucleotide polymorphisms (SNPs) in the 5′-upstream regulatory region of CHRNA7 were genotyped for association with schizophrenia, and for smoking in schizophrenia. Results The rs3087454 SNP, located at position −1831 bp in the upstream regulatory region of CHRNA7, was significantly associated with schizophrenia in the case-control samples after multiple-testing correction (P = 0.0009, African American; P = 0.013, Caucasian-Non Hispanic); the association was supported in family members. There was nominal association of this SNP with smoking in schizophrenia. Conclusions The data support association of regulatory region polymorphisms in the CHRNA7 gene with schizophrenia. PMID:19181484

Defining a new candidate gene for amelogenesis imperfecta: from molecular genetics to biochemistry.

PubMed

Urzúa, Blanca; Ortega-Pinto, Ana; Morales-Bozo, Irene; Rojas-Alcayaga, Gonzalo; Cifuentes, Víctor

2011-02-01

Amelogenesis imperfecta is a group of genetic conditions that affect the structure and clinical appearance of tooth enamel. The types (hypoplastic, hypocalcified, and hypomature) are correlated with defects in different stages of the process of enamel synthesis. Autosomal dominant, recessive, and X-linked types have been previously described. These disorders are considered clinically and genetically heterogeneous in etiology, involving a variety of genes, such as AMELX, ENAM, DLX3, FAM83H, MMP-20, KLK4, and WDR72. The mutations identified within these causal genes explain less than half of all cases of amelogenesis imperfecta. Most of the candidate and causal genes currently identified encode proteins involved in enamel synthesis. We think it is necessary to refocus the search for candidate genes using biochemical processes. This review provides theoretical evidence that the human SLC4A4 gene (sodium bicarbonate cotransporter) may be a new candidate gene.

A public platform for the verification of the phenotypic effect of candidate genes for resistance to aflatoxin accumulation and Aspergillus flavus infection in maize.

PubMed

Warburton, Marilyn L; Williams, William Paul; Hawkins, Leigh; Bridges, Susan; Gresham, Cathy; Harper, Jonathan; Ozkan, Seval; Mylroie, J Erik; Shan, Xueyan

2011-07-01

A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL) mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel) and SNP genotyping in the population(s) for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.

ENU Mutagenesis in Mice Identifies Candidate Genes For Hypogonadism

PubMed Central

Weiss, Jeffrey; Hurley, Lisa A.; Harris, Rebecca M.; Finlayson, Courtney; Tong, Minghan; Fisher, Lisa A.; Moran, Jennifer L.; Beier, David R.; Mason, Christopher; Jameson, J. Larry

2012-01-01

Genome-wide mutagenesis was performed in mice to identify candidate genes for male infertility, for which the predominant causes remain idiopathic. Mice were mutagenized using N-ethyl-N-nitrosourea (ENU), bred, and screened for phenotypes associated with the male urogenital system. Fifteen heritable lines were isolated and chromosomal loci were assigned using low density genome-wide SNP arrays. Ten of the fifteen lines were pursued further using higher resolution SNP analysis to narrow the candidate gene regions. Exon sequencing of candidate genes identified mutations in mice with cystic kidneys (Bicc1), cryptorchidism (Rxfp2), restricted germ cell deficiency (Plk4), and severe germ cell deficiency (Prdm9). In two other lines with severe hypogonadism candidate sequencing failed to identify mutations, suggesting defects in genes with previously undocumented roles in gonadal function. These genomic intervals were sequenced in their entirety and a candidate mutation was identified in SnrpE in one of the two lines. The line harboring the SnrpE variant retains substantial spermatogenesis despite small testis size, an unusual phenotype. In addition to the reproductive defects, heritable phenotypes were observed in mice with ataxia (Myo5a), tremors (Pmp22), growth retardation (unknown gene), and hydrocephalus (unknown gene). These results demonstrate that the ENU screen is an effective tool for identifying potential causes of male infertility. PMID:22258617

An extensive analysis of disease-gene associations using network integration and fast kernel-based gene prioritization methods.

PubMed

Valentini, Giorgio; Paccanaro, Alberto; Caniza, Horacio; Romero, Alfonso E; Re, Matteo

2014-06-01

In the context of "network medicine", gene prioritization methods represent one of the main tools to discover candidate disease genes by exploiting the large amount of data covering different types of functional relationships between genes. Several works proposed to integrate multiple sources of data to improve disease gene prioritization, but to our knowledge no systematic studies focused on the quantitative evaluation of the impact of network integration on gene prioritization. In this paper, we aim at providing an extensive analysis of gene-disease associations not limited to genetic disorders, and a systematic comparison of different network integration methods for gene prioritization. We collected nine different functional networks representing different functional relationships between genes, and we combined them through both unweighted and weighted network integration methods. We then prioritized genes with respect to each of the considered 708 medical subject headings (MeSH) diseases by applying classical guilt-by-association, random walk and random walk with restart algorithms, and the recently proposed kernelized score functions. The results obtained with classical random walk algorithms and the best single network achieved an average area under the curve (AUC) across the 708 MeSH diseases of about 0.82, while kernelized score functions and network integration boosted the average AUC to about 0.89. Weighted integration, by exploiting the different "informativeness" embedded in different functional networks, outperforms unweighted integration at 0.01 significance level, according to the Wilcoxon signed rank sum test. For each MeSH disease we provide the top-ranked unannotated candidate genes, available for further bio-medical investigation. Network integration is necessary to boost the performances of gene prioritization methods. Moreover the methods based on kernelized score functions can further enhance disease gene ranking results, by adopting both local and global learning strategies, able to exploit the overall topology of the network. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

Rare variants in axonogenesis genes connect three families with sound-color synesthesia.

PubMed

Tilot, Amanda K; Kucera, Katerina S; Vino, Arianna; Asher, Julian E; Baron-Cohen, Simon; Fisher, Simon E

2018-03-20

Synesthesia is a rare nonpathological phenomenon where stimulation of one sense automatically provokes a secondary perception in another. Hypothesized to result from differences in cortical wiring during development, synesthetes show atypical structural and functional neural connectivity, but the underlying molecular mechanisms are unknown. The trait also appears to be more common among people with autism spectrum disorder and savant abilities. Previous linkage studies searching for shared loci of large effect size across multiple families have had limited success. To address the critical lack of candidate genes, we applied whole-exome sequencing to three families with sound-color (auditory-visual) synesthesia affecting multiple relatives across three or more generations. We identified rare genetic variants that fully cosegregate with synesthesia in each family, uncovering 37 genes of interest. Consistent with reports indicating genetic heterogeneity, no variants were shared across families. Gene ontology analyses highlighted six genes- COL4A1 , ITGA2 , MYO10 , ROBO3 , SLC9A6 , and SLIT2 -associated with axonogenesis and expressed during early childhood when synesthetic associations are formed. These results are consistent with neuroimaging-based hypotheses about the role of hyperconnectivity in the etiology of synesthesia and offer a potential entry point into the neurobiology that organizes our sensory experiences. Copyright © 2018 the Author(s). Published by PNAS.

Genome-wide identification of the potato WRKY transcription factor family.

PubMed

Zhang, Chao; Wang, Dongdong; Yang, Chenghui; Kong, Nana; Shi, Zheng; Zhao, Peng; Nan, Yunyou; Nie, Tengkun; Wang, Ruoqiu; Ma, Haoli; Chen, Qin

2017-01-01

WRKY transcription factors play pivotal roles in regulation of stress responses. This study identified 79 WRKY genes in potato (Solanum tuberosum). Based on multiple sequence alignment and phylogenetic relationships, WRKY genes were classified into three major groups. The majority of WRKY genes belonged to Group II (52 StWRKYs), Group III had 14 and Group I consisted of 13. The phylogenetic tree further classified Group II into five sub-groups. All StWRKY genes except StWRKY79 were mapped on potato chromosomes, with eight tandem duplication gene pairs and seven segmental duplication gene pairs found from StWRKY family genes. The expression analysis of 22 StWRKYs showed their differential expression levels under various stress conditions. Cis-element prediction showed that a large number of elements related to drought, heat and salicylic acid were present in the promotor regions of StWRKY genes. The expression analysis indicated that seven StWRKYs seemed to respond to stress (heat, drought and salinity) and salicylic acid treatment. These genes are candidates for abiotic stress signaling for further research.

Genome-wide identification of the potato WRKY transcription factor family

PubMed Central

Kong, Nana; Shi, Zheng; Zhao, Peng; Nan, Yunyou; Nie, Tengkun; Wang, Ruoqiu; Ma, Haoli

2017-01-01

WRKY transcription factors play pivotal roles in regulation of stress responses. This study identified 79 WRKY genes in potato (Solanum tuberosum). Based on multiple sequence alignment and phylogenetic relationships, WRKY genes were classified into three major groups. The majority of WRKY genes belonged to Group II (52 StWRKYs), Group III had 14 and Group I consisted of 13. The phylogenetic tree further classified Group II into five sub-groups. All StWRKY genes except StWRKY79 were mapped on potato chromosomes, with eight tandem duplication gene pairs and seven segmental duplication gene pairs found from StWRKY family genes. The expression analysis of 22 StWRKYs showed their differential expression levels under various stress conditions. Cis-element prediction showed that a large number of elements related to drought, heat and salicylic acid were present in the promotor regions of StWRKY genes. The expression analysis indicated that seven StWRKYs seemed to respond to stress (heat, drought and salinity) and salicylic acid treatment. These genes are candidates for abiotic stress signaling for further research. PMID:28727761

The cld mutation: narrowing the critical chromosomal region and selecting candidate genes.

PubMed

Péterfy, Miklós; Mao, Hui Z; Doolittle, Mark H

2006-10-01

Combined lipase deficiency (cld) is a recessive, lethal mutation specific to the tw73 haplotype on mouse Chromosome 17. While the cld mutation results in lipase proteins that are inactive, aggregated, and retained in the endoplasmic reticulum (ER), it maps separately from the lipase structural genes. We have narrowed the gene critical region by about 50% using the tw18 haplotype for deletion mapping and a recombinant chromosome used originally to map cld with respect to the phenotypic marker tf. The region now extends from 22 to 25.6 Mbp on the wild-type chromosome, currently containing 149 genes and 50 expressed sequence tags (ESTs). To identify the affected gene, we have selected candidates based on their known role in associated biological processes, cellular components, and molecular functions that best fit with the predicted function of the cld gene. A secondary approach was based on differences in mRNA levels between mutant (cld/cld) and unaffected (+/cld) cells. Using both approaches, we have identified seven functional candidates with an ER localization and/or an involvement in protein maturation and folding that could explain the lipase deficiency, and six expression candidates that exhibit large differences in mRNA levels between mutant and unaffected cells. Significantly, two genes were found to be candidates with regard to both function and expression, thus emerging as the strongest candidates for cld. We discuss the implications of our mapping results and our selection of candidates with respect to other genes, deletions, and mutations occurring in the cld critical region.

The Architecture of Parent-of-Origin Effects in Mice

PubMed Central

Mott, Richard; Yuan, Wei; Kaisaki, Pamela; Gan, Xiangchao; Cleak, James; Edwards, Andrew; Baud, Amelie; Flint, Jonathan

2014-01-01

Summary The number of imprinted genes in the mammalian genome is predicted to be small, yet we show here, in a survey of 97 traits measured in outbred mice, that most phenotypes display parent-of-origin effects that are partially confounded with family structure. To address this contradiction, using reciprocal F1 crosses, we investigated the effects of knocking out two nonimprinted candidate genes, Man1a2 and H2-ab1, that reside at nonimprinted loci but that show parent-of-origin effects. We show that expression of multiple genes becomes dysregulated in a sex-, tissue-, and parent-of-origin-dependent manner. We provide evidence that nonimprinted genes can generate parent-of-origin effects by interaction with imprinted loci and deduce that the importance of the number of imprinted genes is secondary to their interactions. We propose that this gene network effect may account for some of the missing heritability seen when comparing sibling-based to population-based studies of the phenotypic effects of genetic variants. PMID:24439386

Stratified Whole Genome Linkage Analysis of Chiari Type I Malformation Implicates Known Klippel-Feil Syndrome Genes as Putative Disease Candidates

PubMed Central

Markunas, Christina A.; Soldano, Karen; Dunlap, Kaitlyn; Cope, Heidi; Asiimwe, Edgar; Stajich, Jeffrey; Enterline, David; Grant, Gerald; Fuchs, Herbert

2013-01-01

Chiari Type I Malformation (CMI) is characterized by displacement of the cerebellar tonsils below the base of the skull, resulting in significant neurologic morbidity. Although multiple lines of evidence support a genetic contribution to disease, no genes have been identified. We therefore conducted the largest whole genome linkage screen to date using 367 individuals from 66 families with at least two individuals presenting with nonsyndromic CMI with or without syringomyelia. Initial findings across all 66 families showed minimal evidence for linkage due to suspected genetic heterogeneity. In order to improve power to localize susceptibility genes, stratified linkage analyses were performed using clinical criteria to differentiate families based on etiologic factors. Families were stratified on the presence or absence of clinical features associated with connective tissue disorders (CTDs) since CMI and CTDs frequently co-occur and it has been proposed that CMI patients with CTDs represent a distinct class of patients with a different underlying disease mechanism. Stratified linkage analyses resulted in a marked increase in evidence of linkage to multiple genomic regions consistent with reduced genetic heterogeneity. Of particular interest were two regions (Chr8, Max LOD = 3.04; Chr12, Max LOD = 2.09) identified within the subset of “CTD-negative” families, both of which harbor growth differentiation factors (GDF6, GDF3) implicated in the development of Klippel-Feil syndrome (KFS). Interestingly, roughly 3–5% of CMI patients are diagnosed with KFS. In order to investigate the possibility that CMI and KFS are allelic, GDF3 and GDF6 were sequenced leading to the identification of a previously known KFS missense mutation and potential regulatory variants in GDF6. This study has demonstrated the value of reducing genetic heterogeneity by clinical stratification implicating several convincing biological candidates and further supporting the hypothesis that multiple, distinct mechanisms are responsible for CMI. PMID:23620759

High-resolution genetic mapping of allelic variants associated with cell wall chemistry in Populus.

PubMed

Muchero, Wellington; Guo, Jianjun; DiFazio, Stephen P; Chen, Jin-Gui; Ranjan, Priya; Slavov, Gancho T; Gunter, Lee E; Jawdy, Sara; Bryan, Anthony C; Sykes, Robert; Ziebell, Angela; Klápště, Jaroslav; Porth, Ilga; Skyba, Oleksandr; Unda, Faride; El-Kassaby, Yousry A; Douglas, Carl J; Mansfield, Shawn D; Martin, Joel; Schackwitz, Wendy; Evans, Luke M; Czarnecki, Olaf; Tuskan, Gerald A

2015-01-23

QTL cloning for the discovery of genes underlying polygenic traits has historically been cumbersome in long-lived perennial plants like Populus. Linkage disequilibrium-based association mapping has been proposed as a cloning tool, and recent advances in high-throughput genotyping and whole-genome resequencing enable marker saturation to levels sufficient for association mapping with no a priori candidate gene selection. Here, multiyear and multienvironment evaluation of cell wall phenotypes was conducted in an interspecific P. trichocarpa x P. deltoides pseudo-backcross mapping pedigree and two partially overlapping populations of unrelated P. trichocarpa genotypes using pyrolysis molecular beam mass spectrometry, saccharification, and/ or traditional wet chemistry. QTL mapping was conducted using a high-density genetic map with 3,568 SNP markers. As a fine-mapping approach, chromosome-wide association mapping targeting a QTL hot-spot on linkage group XIV was performed in the two P. trichocarpa populations. Both populations were genotyped using the 34 K Populus Infinium SNP array and whole-genome resequencing of one of the populations facilitated marker-saturation of candidate intervals for gene identification. Five QTLs ranging in size from 0.6 to 1.8 Mb were mapped on linkage group XIV for lignin content, syringyl to guaiacyl (S/G) ratio, 5- and 6-carbon sugars using the mapping pedigree. Six candidate loci exhibiting significant associations with phenotypes were identified within QTL intervals. These associations were reproducible across multiple environments, two independent genotyping platforms, and different plant growth stages. cDNA sequencing for allelic variants of three of the six loci identified polymorphisms leading to variable length poly glutamine (PolyQ) stretch in a transcription factor annotated as an ANGUSTIFOLIA C-terminus Binding Protein (CtBP) and premature stop codons in a KANADI transcription factor as well as a protein kinase. Results from protoplast transient expression assays suggested that each of the polymorphisms conferred allelic differences in the activation of cellulose, hemicelluloses, and lignin pathway marker genes. This study illustrates the utility of complementary QTL and association mapping as tools for gene discovery with no a priori candidate gene selection. This proof of concept in a perennial organism opens up opportunities for discovery of novel genetic determinants of economically important but complex traits in plants.

Examination of Clock and Adcyap1 gene variation in a neotropical migratory passerine

PubMed Central

Bridge, Eli S.; Ross, Jeremy D.; Shipley, J. Ryan; Kelly, Jeffrey F.

2018-01-01

Complex behavioral traits, such as those making up a migratory phenotype, are regulated by multiple environmental factors and multiple genes. We investigated possible relationships between microsatellite variation at two candidate genes implicated in the control of migratory behavior, Clock and Adcyap1, and several aspects of migratory life-history and evolutionary divergence in the Painted Bunting (Passerina ciris), a species that shows wide variation in migratory and molting strategies across a disjunct distribution. We focused on Clock and Adcyap1 microsatellite variation across three Painted Bunting populations in Oklahoma, Louisiana, and North Carolina, and for the Oklahoma breeding population we used published migration tracking data on adult males to explore phenotypic variation in individual migratory behavior. We found no correlation between microsatellite allele size within either Clock and Adcyap1 relative to the initiation or duration of fall migration in adult males breeding in Oklahoma. We also show the lack of significant correlations with aspects of the migratory phenotype for the Louisiana population. Our research highlights the limitations of studying microsatellite allelic mutations that are of undetermined functional influence relative to complex behavioral phenotypes. PMID:29324772

The genetic interacting landscape of 63 candidate genes in Major Depressive Disorder: an explorative study.

PubMed

Lekman, Magnus; Hössjer, Ola; Andrews, Peter; Källberg, Henrik; Uvehag, Daniel; Charney, Dennis; Manji, Husseini; Rush, John A; McMahon, Francis J; Moore, Jason H; Kockum, Ingrid

2014-01-01

Genetic contributions to major depressive disorder (MDD) are thought to result from multiple genes interacting with each other. Different procedures have been proposed to detect such interactions. Which approach is best for explaining the risk of developing disease is unclear. This study sought to elucidate the genetic interaction landscape in candidate genes for MDD by conducting a SNP-SNP interaction analysis using an exhaustive search through 3,704 SNP-markers in 1,732 cases and 1,783 controls provided from the GAIN MDD study. We used three different methods to detect interactions, two logistic regressions models (multiplicative and additive) and one data mining and machine learning (MDR) approach. Although none of the interaction survived correction for multiple comparisons, the results provide important information for future genetic interaction studies in complex disorders. Among the 0.5% most significant observations, none had been reported previously for risk to MDD. Within this group of interactions, less than 0.03% would have been detectable based on main effect approach or an a priori algorithm. We evaluated correlations among the three different models and conclude that all three algorithms detected the same interactions to a low degree. Although the top interactions had a surprisingly large effect size for MDD (e.g. additive dominant model Puncorrected = 9.10E-9 with attributable proportion (AP) value = 0.58 and multiplicative recessive model with Puncorrected = 6.95E-5 with odds ratio (OR estimated from β3) value = 4.99) the area under the curve (AUC) estimates were low (< 0.54). Moreover, the population attributable fraction (PAF) estimates were also low (< 0.15). We conclude that the top interactions on their own did not explain much of the genetic variance of MDD. The different statistical interaction methods we used in the present study did not identify the same pairs of interacting markers. Genetic interaction studies may uncover previously unsuspected effects that could provide novel insights into MDD risk, but much larger sample sizes are needed before this strategy can be powerfully applied.

Reference gene selection for quantitative gene expression studies during biological invasions: A test on multiple genes and tissues in a model ascidian Ciona savignyi.

PubMed

Huang, Xuena; Gao, Yangchun; Jiang, Bei; Zhou, Zunchun; Zhan, Aibin

2016-01-15

As invasive species have successfully colonized a wide range of dramatically different local environments, they offer a good opportunity to study interactions between species and rapidly changing environments. Gene expression represents one of the primary and crucial mechanisms for rapid adaptation to local environments. Here, we aim to select reference genes for quantitative gene expression analysis based on quantitative Real-Time PCR (qRT-PCR) for a model invasive ascidian, Ciona savignyi. We analyzed the stability of ten candidate reference genes in three tissues (siphon, pharynx and intestine) under two key environmental stresses (temperature and salinity) in the marine realm based on three programs (geNorm, NormFinder and delta Ct method). Our results demonstrated only minor difference for stability rankings among the three methods. The use of different single reference gene might influence the data interpretation, while multiple reference genes could minimize possible errors. Therefore, reference gene combinations were recommended for different tissues - the optimal reference gene combination for siphon was RPS15 and RPL17 under temperature stress, and RPL17, UBQ and TubA under salinity treatment; for pharynx, TubB, TubA and RPL17 were the most stable genes under temperature stress, while TubB, TubA and UBQ were the best under salinity stress; for intestine, UBQ, RPS15 and RPL17 were the most reliable reference genes under both treatments. Our results suggest that the necessity of selection and test of reference genes for different tissues under varying environmental stresses. The results obtained here are expected to reveal mechanisms of gene expression-mediated invasion success using C. savignyi as a model species. Copyright © 2015 Elsevier B.V. All rights reserved.

Maternal residential air pollution and placental imprinted gene expression.

PubMed

Kingsley, Samantha L; Deyssenroth, Maya A; Kelsey, Karl T; Awad, Yara Abu; Kloog, Itai; Schwartz, Joel D; Lambertini, Luca; Chen, Jia; Marsit, Carmen J; Wellenius, Gregory A

2017-11-01

Maternal exposure to air pollution is associated with reduced fetal growth, but its relationship with expression of placental imprinted genes (important regulators of fetal growth) has not yet been studied. To examine relationships between maternal residential air pollution and expression of placental imprinted genes in the Rhode Island Child Health Study (RICHS). Women-infant pairs were enrolled following delivery between 2009 and 2013. We geocoded maternal residential addresses at delivery, estimated daily levels of fine particulate matter (PM 2.5 ; n=355) and black carbon (BC; n=336) using spatial-temporal models, and estimated residential distance to nearest major roadway (n=355). Using linear regression models we investigated the associations between each exposure metric and expression of nine candidate genes previously associated with infant birthweight in RICHS, with secondary analyses of a panel of 108 imprinted genes expressed in the placenta. We also explored effect measure modification by infant sex. PM 2.5 and BC were associated with altered expression for seven and one candidate genes, respectively, previously linked with birthweight in this cohort. Adjusting for multiple comparisons, we found that PM 2.5 and BC were associated with changes in expression of 41 and 12 of 108 placental imprinted genes, respectively. Infant sex modified the association between PM 2.5 and expression of CHD7 and between proximity to major roadways and expression of ZDBF2. We found that maternal exposure to residential PM 2.5 and BC was associated with changes in placental imprinted gene expression, which suggests a plausible line of investigation of how air pollution affects fetal growth and development. Copyright © 2017 Elsevier Ltd. All rights reserved.

Finding novel relationships with integrated gene-gene association network analysis of Synechocystis sp. PCC 6803 using species-independent text-mining

PubMed Central

Kreula, Sanna M.; Kaewphan, Suwisa; Ginter, Filip

2018-01-01

The increasing move towards open access full-text scientific literature enhances our ability to utilize advanced text-mining methods to construct information-rich networks that no human will be able to grasp simply from ‘reading the literature’. The utility of text-mining for well-studied species is obvious though the utility for less studied species, or those with no prior track-record at all, is not clear. Here we present a concept for how advanced text-mining can be used to create information-rich networks even for less well studied species and apply it to generate an open-access gene-gene association network resource for Synechocystis sp. PCC 6803, a representative model organism for cyanobacteria and first case-study for the methodology. By merging the text-mining network with networks generated from species-specific experimental data, network integration was used to enhance the accuracy of predicting novel interactions that are biologically relevant. A rule-based algorithm (filter) was constructed in order to automate the search for novel candidate genes with a high degree of likely association to known target genes by (1) ignoring established relationships from the existing literature, as they are already ‘known’, and (2) demanding multiple independent evidences for every novel and potentially relevant relationship. Using selected case studies, we demonstrate the utility of the network resource and filter to (i) discover novel candidate associations between different genes or proteins in the network, and (ii) rapidly evaluate the potential role of any one particular gene or protein. The full network is provided as an open-source resource. PMID:29844966

Contributions of Function-Altering Variants in Genes Implicated in Pubertal Timing and Body Mass for Self-Limited Delayed Puberty.

PubMed

Howard, Sasha R; Guasti, Leonardo; Poliandri, Ariel; David, Alessia; Cabrera, Claudia P; Barnes, Michael R; Wehkalampi, Karoliina; O'Rahilly, Stephen; Aiken, Catherine E; Coll, Anthony P; Ma, Marcella; Rimmington, Debra; Yeo, Giles S H; Dunkel, Leo

2018-02-01

Self-limited delayed puberty (DP) is often associated with a delay in physical maturation, but although highly heritable the causal genetic factors remain elusive. Genome-wide association studies of the timing of puberty have identified multiple loci for age at menarche in females and voice break in males, particularly in pathways controlling energy balance. We sought to assess the contribution of rare variants in such genes to the phenotype of familial DP. We performed whole-exome sequencing in 67 pedigrees (125 individuals with DP and 35 unaffected controls) from our unique cohort of familial self-limited DP. Using a whole-exome sequencing filtering pipeline one candidate gene [fat mass and obesity-associated gene (FTO)] was identified. In silico, in vitro, and mouse model studies were performed to investigate the pathogenicity of FTO variants and timing of puberty in FTO+/- mice. We identified potentially pathogenic, rare variants in genes in linkage disequilibrium with genome-wide association studies of age at menarche loci in 283 genes. Of these, five genes were implicated in the control of body mass. After filtering for segregation with trait, one candidate, FTO, was retained. Two FTO variants, found in 14 affected individuals from three families, were also associated with leanness in these patients with DP. One variant (p.Leu44Val) demonstrated altered demethylation activity of the mutant protein in vitro. Fto+/- mice displayed a significantly delayed timing of pubertal onset (P < 0.05). Mutations in genes implicated in body mass and timing of puberty in the general population may contribute to the pathogenesis of self-limited DP. Copyright © 2017 Endocrine Society

Identification of a neuronal transcription factor network involved in medulloblastoma development.

PubMed

Lastowska, Maria; Al-Afghani, Hani; Al-Balool, Haya H; Sheth, Harsh; Mercer, Emma; Coxhead, Jonathan M; Redfern, Chris P F; Peters, Heiko; Burt, Alastair D; Santibanez-Koref, Mauro; Bacon, Chris M; Chesler, Louis; Rust, Alistair G; Adams, David J; Williamson, Daniel; Clifford, Steven C; Jackson, Michael S

2013-07-11

Medulloblastomas, the most frequent malignant brain tumours affecting children, comprise at least 4 distinct clinicogenetic subgroups. Aberrant sonic hedgehog (SHH) signalling is observed in approximately 25% of tumours and defines one subgroup. Although alterations in SHH pathway genes (e.g. PTCH1, SUFU) are observed in many of these tumours, high throughput genomic analyses have identified few other recurring mutations. Here, we have mutagenised the Ptch+/- murine tumour model using the Sleeping Beauty transposon system to identify additional genes and pathways involved in SHH subgroup medulloblastoma development. Mutagenesis significantly increased medulloblastoma frequency and identified 17 candidate cancer genes, including orthologs of genes somatically mutated (PTEN, CREBBP) or associated with poor outcome (PTEN, MYT1L) in the human disease. Strikingly, these candidate genes were enriched for transcription factors (p=2x10-5), the majority of which (6/7; Crebbp, Myt1L, Nfia, Nfib, Tead1 and Tgif2) were linked within a single regulatory network enriched for genes associated with a differentiated neuronal phenotype. Furthermore, activity of this network varied significantly between the human subgroups, was associated with metastatic disease, and predicted poor survival specifically within the SHH subgroup of tumours. Igf2, previously implicated in medulloblastoma, was the most differentially expressed gene in murine tumours with network perturbation, and network activity in both mouse and human tumours was characterised by enrichment for multiple gene-sets indicating increased cell proliferation, IGF signalling, MYC target upregulation, and decreased neuronal differentiation. Collectively, our data support a model of medulloblastoma development in SB-mutagenised Ptch+/- mice which involves disruption of a novel transcription factor network leading to Igf2 upregulation, proliferation of GNPs, and tumour formation. Moreover, our results identify rational therapeutic targets for SHH subgroup tumours, alongside prognostic biomarkers for the identification of poor-risk SHH patients.

Distinct organization of the candidate tumor suppressor gene RFP2 in human and mouse: multiple mRNA isoforms in both species- and human-specific antisense transcript RFP2OS.

PubMed

Baranova, Ancha; Hammarsund, Marianne; Ivanov, Dmitry; Skoblov, Mikhail; Sangfelt, Olle; Corcoran, Martin; Borodina, Tatiana; Makeeva, Natalia; Pestova, Anna; Tyazhelova, Tatiana; Nazarenko, Svetlana; Gorreta, Francesco; Alsheddi, Tariq; Schlauch, Karen; Nikitin, Eugene; Kapanadze, Bagrat; Shagin, Dmitry; Poltaraus, Andrey; Ivanovich Vorobiev, Andrey; Zabarovsky, Eugene; Lukianov, Sergey; Chandhoke, Vikas; Ibbotson, Rachel; Oscier, David; Einhorn, Stefan; Grander, Dan; Yankovsky, Nick

2003-12-04

In the present study, we describe the human and mouse RFP2 gene structure, multiple RFP2 mRNA isoforms in the two species that have different 5' UTRs and a human-specific antisense transcript RFP2OS. Since the human RFP2 5' UTR is not conserved in mouse, these findings might indicate a different regulation of RFP2 in the two species. The predicted human and mouse RFP2 proteins are shown to contain a tripartite RING finger-B-box-coiled-coil domain (RBCC), also known as a TRIM domain, and therefore belong to a subgroup of RING finger proteins that are often involved in developmental and tumorigenic processes. Because homozygous deletions of chromosomal region 13q14.3 are found in a number of malignancies, including chronic lymphocytic leukemia (CLL) and multiple myeloma (MM), we suggest that RFP2 might be involved in tumor development. This study provides necessary information for evaluation of the role of RFP2 in malignant transformation and other biological processes.

Integrating genome-wide association studies and gene expression data highlights dysregulated multiple sclerosis risk pathways.

PubMed

Liu, Guiyou; Zhang, Fang; Jiang, Yongshuai; Hu, Yang; Gong, Zhongying; Liu, Shoufeng; Chen, Xiuju; Jiang, Qinghua; Hao, Junwei

2017-02-01

Much effort has been expended on identifying the genetic determinants of multiple sclerosis (MS). Existing large-scale genome-wide association study (GWAS) datasets provide strong support for using pathway and network-based analysis methods to investigate the mechanisms underlying MS. However, no shared genetic pathways have been identified to date. We hypothesize that shared genetic pathways may indeed exist in different MS-GWAS datasets. Here, we report results from a three-stage analysis of GWAS and expression datasets. In stage 1, we conducted multiple pathway analyses of two MS-GWAS datasets. In stage 2, we performed a candidate pathway analysis of the large-scale MS-GWAS dataset. In stage 3, we performed a pathway analysis using the dysregulated MS gene list from seven human MS case-control expression datasets. In stage 1, we identified 15 shared pathways. In stage 2, we successfully replicated 14 of these 15 significant pathways. In stage 3, we found that dysregulated MS genes were significantly enriched in 10 of 15 MS risk pathways identified in stages 1 and 2. We report shared genetic pathways in different MS-GWAS datasets and highlight some new MS risk pathways. Our findings provide new insights on the genetic determinants of MS.

Pathogenesis-related proteins and peptides as promising tools for engineering plants with multiple stress tolerance.

PubMed

Ali, Sajad; Ganai, Bashir Ahmad; Kamili, Azra N; Bhat, Ajaz Ali; Mir, Zahoor Ahmad; Bhat, Javaid Akhter; Tyagi, Anshika; Islam, Sheikh Tajamul; Mushtaq, Muntazir; Yadav, Prashant; Rawat, Sandhya; Grover, Anita

Pathogenesis-related (PR) proteins and antimicrobial peptides (AMPs) are a group of diverse molecules that are induced by phytopathogens as well as defense related signaling molecules. They are the key components of plant innate immune system especially systemic acquired resistance (SAR), and are widely used as diagnostic molecular markers of defense signaling pathways. Although, PR proteins and peptides have been isolated much before but their biological function remains largely enigmatic despite the availability of new scientific tools. The earlier studies have demonstrated that PR genes provide enhanced resistance against both biotic and abiotic stresses, which make them one of the most promising candidates for developing multiple stress tolerant crop varieties. In this regard, plant genetic engineering technology is widely accepted as one of the most fascinating approach to develop the disease resistant transgenic crops using different antimicrobial genes like PR genes. Overexpression of PR genes (chitinase, glucanase, thaumatin, defensin and thionin) individually or in combination have greatly uplifted the level of defense response in plants against a wide range of pathogens. However, the detailed knowledge of signaling pathways that regulates the expression of these versatile proteins is critical for improving crop plants to multiple stresses, which is the future theme of plant stress biology. Hence, this review provides an overall overview on the PR proteins like their classification, role in multiple stresses (biotic and abiotic) as well as in various plant defense signaling cascades. We also highlight the success and snags of transgenic plants expressing PR proteins and peptides. Copyright © 2018 Elsevier GmbH. All rights reserved.

An omnibus test for family-based association studies with multiple SNPs and multiple phenotypes.

PubMed

Lasky-Su, Jessica; Murphy, Amy; McQueen, Matthew B; Weiss, Scott; Lange, Christoph

2010-06-01

We propose an omnibus family-based association test (MFBAT) that can be applied to multiple markers and multiple phenotypes and that has only one degree of freedom. The proposed test statistic extends current FBAT methodology to incorporate multiple markers as well as multiple phenotypes. Using simulation studies, power estimates for the proposed methodology are compared with the standard methodologies. On the basis of these simulations, we find that MFBAT substantially outperforms other methods, including haplotypic approaches and doing multiple tests with single single-nucleotide polymorphisms (SNPs) and single phenotypes. The practical relevance of the approach is illustrated by an application to asthma in which SNP/phenotype combinations are identified and reach overall significance that would not have been identified using other approaches. This methodology is directly applicable to cases in which there are multiple SNPs, such as candidate gene studies, cases in which there are multiple phenotypes, such as expression data, and cases in which there are multiple phenotypes and genotypes, such as genome-wide association studies that incorporate expression profiles as phenotypes. This program is available in the PBAT analysis package.

Genetic polymorphisms in 85 DNA repair genes and bladder cancer risk.

PubMed

Michiels, Stefan; Laplanche, Agnès; Boulet, Thomas; Dessen, Philippe; Guillonneau, Bertrand; Méjean, Arnaud; Desgrandchamps, François; Lathrop, Mark; Sarasin, Alain; Benhamou, Simone

2009-05-01

Several defense mechanisms have been developed and maintained during the evolution to protect human cells against damage produced from exogenous or endogenous sources. We examined the associations between bladder cancer and a panel of 652 polymorphisms from 85 genes involved in maintenance of genetic stability [base excision repair, nucleotide excision repair, double-strand break repair (DSBR) and mismatch repair, as well as DNA synthesis and cell cycle regulation pathways] in 201 incident bladder cancer cases and 326 hospital controls. Score statistics were used to test differences in haplotype frequencies between cases and controls in an unconditional logistic regression model. To account for multiple testing, we associated to each P-value the expected proportion of false discoveries (q-value). Haplotype analysis revealed significant associations (P < 0.01) between bladder cancer and two genes (POLB and FANCA) with an associated q-value of 24%. A permutation test was also used to determine whether, in each pathway analyzed, there are more variants whose allelic frequencies are different between cases and controls as compared with what would be expected by chance. Differences were found for cell cycle regulation (P = 0.02) and to a lesser extent for DSBR (P = 0.05) pathways. These results hint to a few potential candidate genes; however, our study was limited by the small sample size and therefore low statistical power to detect associations. It is anticipated that genome-wide association studies will open new perspectives for interpretation of the results of extensive candidate gene studies such as ours.

Association Genetics of Wood Physical Traits in the Conifer White Spruce and Relationships With Gene Expression

PubMed Central

Beaulieu, Jean; Doerksen, Trevor; Boyle, Brian; Clément, Sébastien; Deslauriers, Marie; Beauseigle, Stéphanie; Blais, Sylvie; Poulin, Pier-Luc; Lenz, Patrick; Caron, Sébastien; Rigault, Philippe; Bicho, Paul; Bousquet, Jean; MacKay, John

2011-01-01

Marker-assisted selection holds promise for highly influencing tree breeding, especially for wood traits, by considerably reducing breeding cycles and increasing selection accuracy. In this study, we used a candidate gene approach to test for associations between 944 single-nucleotide polymorphism markers from 549 candidate genes and 25 wood quality traits in white spruce. A mixed-linear model approach, including a weak but nonsignificant population structure, was implemented for each marker–trait combination. Relatedness among individuals was controlled using a kinship matrix estimated either from the known half-sib structure or from the markers. Both additive and dominance effect models were tested. Between 8 and 21 single-nucleotide polymorphisms (SNPs) were found to be significantly associated (P ≤ 0.01) with each of earlywood, latewood, or total wood traits. After controlling for multiple testing (Q ≤ 0.10), 13 SNPs were still significant across as many genes belonging to different families, each accounting for between 3 and 5% of the phenotypic variance in 10 wood characters. Transcript accumulation was determined for genes containing SNPs associated with these traits. Significantly different transcript levels (P ≤ 0.05) were found among the SNP genotypes of a 1-aminocyclopropane-1-carboxylate oxidase, a β-tonoplast intrinsic protein, and a long-chain acyl-CoA synthetase 9. These results should contribute toward the development of efficient marker-assisted selection in an economically important tree species. PMID:21385726

Genome-wide association study to identify potential genetic modifiers in a canine model for Duchenne muscular dystrophy.

PubMed

Brinkmeyer-Langford, Candice; Balog-Alvarez, Cynthia; Cai, James J; Davis, Brian W; Kornegay, Joe N

2016-08-22

Duchenne muscular dystrophy (DMD) causes progressive muscle degeneration, cardiomyopathy and respiratory failure in approximately 1/5,000 boys. Golden Retriever muscular dystrophy (GRMD) resembles DMD both clinically and pathologically. Like DMD, GRMD exhibits remarkable phenotypic variation among affected dogs, suggesting the influence of modifiers. Understanding the role(s) of genetic modifiers of GRMD may identify genes and pathways that also modify phenotypes in DMD and reveal novel therapies. Therefore, our objective in this study was to identify genetic modifiers that affect discrete GRMD phenotypes. We performed a linear mixed-model (LMM) analysis using 16 variably-affected dogs from our GRMD colony (8 dystrophic, 8 non-dystrophic). All of these dogs were either full or half-siblings, and phenotyped for 19 objective, quantitative biomarkers at ages 6 and 12 months. Each biomarker was individually assessed. Gene expression profiles of 59 possible candidate genes were generated for two muscle types: the cranial tibialis and medial head of the gastrocnemius. SNPs significantly associated with GRMD biomarkers were identified on multiple chromosomes (including the X chromosome). Gene expression levels for candidate genes located near these SNPs correlated with biomarker values, suggesting possible roles as GRMD modifiers. The results of this study enhance our understanding of GRMD pathology and represent a first step toward the characterization of GRMD modifiers that may be relevant to DMD pathology. Such modifiers are likely to be useful for DMD treatment development based on their relationships to GRMD phenotypes.

A computational approach to candidate gene prioritization for X-linked mental retardation using annotation-based binary filtering and motif-based linear discriminatory analysis

PubMed Central

2011-01-01

Background Several computational candidate gene selection and prioritization methods have recently been developed. These in silico selection and prioritization techniques are usually based on two central approaches - the examination of similarities to known disease genes and/or the evaluation of functional annotation of genes. Each of these approaches has its own caveats. Here we employ a previously described method of candidate gene prioritization based mainly on gene annotation, in accompaniment with a technique based on the evaluation of pertinent sequence motifs or signatures, in an attempt to refine the gene prioritization approach. We apply this approach to X-linked mental retardation (XLMR), a group of heterogeneous disorders for which some of the underlying genetics is known. Results The gene annotation-based binary filtering method yielded a ranked list of putative XLMR candidate genes with good plausibility of being associated with the development of mental retardation. In parallel, a motif finding approach based on linear discriminatory analysis (LDA) was employed to identify short sequence patterns that may discriminate XLMR from non-XLMR genes. High rates (>80%) of correct classification was achieved, suggesting that the identification of these motifs effectively captures genomic signals associated with XLMR vs. non-XLMR genes. The computational tools developed for the motif-based LDA is integrated into the freely available genomic analysis portal Galaxy (http://main.g2.bx.psu.edu/). Nine genes (APLN, ZC4H2, MAGED4, MAGED4B, RAP2C, FAM156A, FAM156B, TBL1X, and UXT) were highlighted as highly-ranked XLMR methods. Conclusions The combination of gene annotation information and sequence motif-orientated computational candidate gene prediction methods highlight an added benefit in generating a list of plausible candidate genes, as has been demonstrated for XLMR. Reviewers: This article was reviewed by Dr Barbara Bardoni (nominated by Prof Juergen Brosius); Prof Neil Smalheiser and Dr Dustin Holloway (nominated by Prof Charles DeLisi). PMID:21668950

Gene expression analysis of a Helicobacter pylori-infected and high-salt diet-treated mouse gastric tumor model: identification of CD177 as a novel prognostic factor in patients with gastric cancer

PubMed Central

2013-01-01

Background Helicobacter pylori (H. pylori) infection and excessive salt intake are known as important risk factors for stomach cancer in humans. However, interactions of these two factors with gene expression profiles during gastric carcinogenesis remain unclear. In the present study, we investigated the global gene expression associated with stomach carcinogenesis and prognosis of human gastric cancer using a mouse model. Methods To find candidate genes involved in stomach carcinogenesis, we firstly constructed a carcinogen-induced mouse gastric tumor model combined with H. pylori infection and high-salt diet. C57BL/6J mice were given N-methyl-N-nitrosourea in their drinking water and sacrificed after 40 weeks. Animals of a combination group were inoculated with H. pylori and fed a high-salt diet. Gene expression profiles in glandular stomach of the mice were investigated by oligonucleotide microarray. Second, we examined an availability of the candidate gene as prognostic factor for human patients. Immunohistochemical analysis of CD177, one of the up-regulated genes, was performed in human advanced gastric cancer specimens to evaluate the association with prognosis. Results The multiplicity of gastric tumor in carcinogen-treated mice was significantly increased by combination of H. pylori infection and high-salt diet. In the microarray analysis, 35 and 31 more than two-fold up-regulated and down-regulated genes, respectively, were detected in the H. pylori-infection and high-salt diet combined group compared with the other groups. Quantitative RT-PCR confirmed significant over-expression of two candidate genes including Cd177 and Reg3g. On immunohistochemical analysis of CD177 in human advanced gastric cancer specimens, over-expression was evident in 33 (60.0%) of 55 cases, significantly correlating with a favorable prognosis (P = 0.0294). Multivariate analysis including clinicopathological factors as covariates revealed high expression of CD177 to be an independent prognostic factor for overall survival. Conclusions These results suggest that our mouse model combined with H. pylori infection and high-salt diet is useful for gene expression profiling in gastric carcinogenesis, providing evidence that CD177 is a novel prognostic factor for stomach cancer. This is the first report showing a prognostic correlation between CD177 expression and solid tumor behavior. PMID:23899160

Partial trisomy 3p and partial monosomy 11q associated with atrial septal defect, cleft palate, and developmental delay: a case report.

PubMed

Tan, E-C; Lim, E; Cham, B; Knight, L; Ng, I

2011-01-01

Unbalanced translocation involving both chromosome 3p duplication and 11q deletion in the same patient is extremely rare; only 1 live-born case was reported previously. This karyotype was also detected during prenatal diagnosis of 2 different pregnancies in a Taiwanese family which were both terminated. In all 3 cases, only standard karyotyping was done to detect the abnormal karyotypes. Here, we report a 4-year-old boy with cleft palate, atrial septal defect, and hypotonia with gross and fine motor delay. Oligonucleotide-based array comparative genomic hybridization showed copy number gain from 3pter to 3p24.2 (approximately 24.5 Mb) and copy number loss from 11q25 to 11qter (approximately 5.8 Mb). This de novo unbalanced translocation event involving a terminal 3p duplication and a terminal 11q deletion provides candidate genes for further investigation of dosage effect leading to the patient's multiple phenotypic abnormalities. Genotype-phenotype correlation is difficult to make in this case due to the large number of genes involved. However, the description of such cases together with precise gene-level mapping of chromosomal breakpoints will add to further refinement of candidate genes to be investigated for terminal imbalances in 3p and 11q when more similar cases are reported. Copyright © 2011 S. Karger AG, Basel.

The Role of Genetics in IBS

PubMed Central

Saito, Yuri A.

2011-01-01

IBS is a common disorder that has been shown to aggregate in families, to affect multiple generations, but not in a manner consistent with a major Mendelian effect. Relatives of an individual with IBS are two to three times as likely to have IBS, with both genders being affected. The estimated genetic liability ranges between 1–20%, with heritability estimates ranging between 0–57%. Although the role of childhood events such as nasogastric tube placement, poor nutrition, abuse, and other stressors have been clearly associated with IBS, these factors have not been studied in families and are unlikely to completely explain the clustering of bowel dysfunction observed in family studies. Furthermore, the familial clustering of IBS does not appear to be explained by psychological traits, based on family studies as well as candidate gene studies of functional variants associated with other psychiatric disorders. To date, over a hundred genetic variants in over 60 genes from various pathways have been studied in a number of candidate gene studies with several positive associations reported. These findings suggest that there may be distinct, as well as shared, molecular underpinnings for IBS and its subtypes. Much new and confirmatory work remains to be performed to elucidate the role of specific genetic variants in IBS development, as well as the specific ways the genes and environment interact to result in IBS susceptibility. PMID:21333900

Transcriptome analysis of Brassica napus pod using RNA-Seq and identification of lipid-related candidate genes.

PubMed

Xu, Hai-Ming; Kong, Xiang-Dong; Chen, Fei; Huang, Ji-Xiang; Lou, Xiang-Yang; Zhao, Jian-Yi

2015-10-24

Brassica napus is an important oilseed crop. Dissection of the genetic architecture underlying oil-related biological processes will greatly facilitates the genetic improvement of rapeseed. The differential gene expression during pod development offers a snapshot on the genes responsible for oil accumulation in. To identify candidate genes in the linkage peaks reported previously, we used RNA sequencing (RNA-Seq) technology to analyze the pod transcriptomes of German cultivar Sollux and Chinese inbred line Gaoyou. The RNA samples were collected for RNA-Seq at 5-7, 15-17 and 25-27 days after flowering (DAF). Bioinformatics analysis was performed to investigate differentially expressed genes (DEGs). Gene annotation analysis was integrated with QTL mapping and Brassica napus pod transcriptome profiling to detect potential candidate genes in oilseed. Four hundred sixty five and two thousand, one hundred fourteen candidate DEGs were identified, respectively, between two varieties at the same stages and across different periods of each variety. Then, 33 DEGs between Sollux and Gaoyou were identified as the candidate genes affecting seed oil content by combining those DEGs with the quantitative trait locus (QTL) mapping results, of which, one was found to be homologous to Arabidopsis thaliana lipid-related genes. Intervarietal DEGs of lipid pathways in QTL regions represent important candidate genes for oil-related traits. Integrated analysis of transcriptome profiling, QTL mapping and comparative genomics with other relative species leads to efficient identification of most plausible functional genes underlying oil-content related characters, offering valuable resources for bettering breeding program of Brassica napus. This study provided a comprehensive overview on the pod transcriptomes of two varieties with different oil-contents at the three developmental stages.

Prediction of gene-phenotype associations in humans, mice, and plants using phenologs.

PubMed

Woods, John O; Singh-Blom, Ulf Martin; Laurent, Jon M; McGary, Kriston L; Marcotte, Edward M

2013-06-21

Phenotypes and diseases may be related to seemingly dissimilar phenotypes in other species by means of the orthology of underlying genes. Such "orthologous phenotypes," or "phenologs," are examples of deep homology, and may be used to predict additional candidate disease genes. In this work, we develop an unsupervised algorithm for ranking phenolog-based candidate disease genes through the integration of predictions from the k nearest neighbor phenologs, comparing classifiers and weighting functions by cross-validation. We also improve upon the original method by extending the theory to paralogous phenotypes. Our algorithm makes use of additional phenotype data--from chicken, zebrafish, and E. coli, as well as new datasets for C. elegans--establishing that several types of annotations may be treated as phenotypes. We demonstrate the use of our algorithm to predict novel candidate genes for human atrial fibrillation (such as HRH2, ATP4A, ATP4B, and HOPX) and epilepsy (e.g., PAX6 and NKX2-1). We suggest gene candidates for pharmacologically-induced seizures in mouse, solely based on orthologous phenotypes from E. coli. We also explore the prediction of plant gene-phenotype associations, as for the Arabidopsis response to vernalization phenotype. We are able to rank gene predictions for a significant portion of the diseases in the Online Mendelian Inheritance in Man database. Additionally, our method suggests candidate genes for mammalian seizures based only on bacterial phenotypes and gene orthology. We demonstrate that phenotype information may come from diverse sources, including drug sensitivities, gene ontology biological processes, and in situ hybridization annotations. Finally, we offer testable candidates for a variety of human diseases, plant traits, and other classes of phenotypes across a wide array of species.

Differential Network Analysis Reveals Evolutionary Complexity in Secondary Metabolism of Rauvolfia serpentina over Catharanthus roseus

PubMed Central

Pathania, Shivalika; Bagler, Ganesh; Ahuja, Paramvir S.

2016-01-01

Comparative co-expression analysis of multiple species using high-throughput data is an integrative approach to determine the uniformity as well as diversification in biological processes. Rauvolfia serpentina and Catharanthus roseus, both members of Apocyanacae family, are reported to have remedial properties against multiple diseases. Despite of sharing upstream of terpenoid indole alkaloid pathway, there is significant diversity in tissue-specific synthesis and accumulation of specialized metabolites in these plants. This led us to implement comparative co-expression network analysis to investigate the modules and genes responsible for differential tissue-specific expression as well as species-specific synthesis of metabolites. Toward these goals differential network analysis was implemented to identify candidate genes responsible for diversification of metabolites profile. Three genes were identified with significant difference in connectivity leading to differential regulatory behavior between these plants. These genes may be responsible for diversification of secondary metabolism, and thereby for species-specific metabolite synthesis. The network robustness of R. serpentina, determined based on topological properties, was also complemented by comparison of gene-metabolite networks of both plants, and may have evolved to have complex metabolic mechanisms as compared to C. roseus under the influence of various stimuli. This study reveals evolution of complexity in secondary metabolism of R. serpentina, and key genes that contribute toward diversification of specific metabolites. PMID:27588023

Differential Network Analysis Reveals Evolutionary Complexity in Secondary Metabolism of Rauvolfia serpentina over Catharanthus roseus.

PubMed

Pathania, Shivalika; Bagler, Ganesh; Ahuja, Paramvir S

2016-01-01

Comparative co-expression analysis of multiple species using high-throughput data is an integrative approach to determine the uniformity as well as diversification in biological processes. Rauvolfia serpentina and Catharanthus roseus, both members of Apocyanacae family, are reported to have remedial properties against multiple diseases. Despite of sharing upstream of terpenoid indole alkaloid pathway, there is significant diversity in tissue-specific synthesis and accumulation of specialized metabolites in these plants. This led us to implement comparative co-expression network analysis to investigate the modules and genes responsible for differential tissue-specific expression as well as species-specific synthesis of metabolites. Toward these goals differential network analysis was implemented to identify candidate genes responsible for diversification of metabolites profile. Three genes were identified with significant difference in connectivity leading to differential regulatory behavior between these plants. These genes may be responsible for diversification of secondary metabolism, and thereby for species-specific metabolite synthesis. The network robustness of R. serpentina, determined based on topological properties, was also complemented by comparison of gene-metabolite networks of both plants, and may have evolved to have complex metabolic mechanisms as compared to C. roseus under the influence of various stimuli. This study reveals evolution of complexity in secondary metabolism of R. serpentina, and key genes that contribute toward diversification of specific metabolites.

Multiple-strand displacement and identification of single nucleotide polymorphisms as markers of genotypic variation of Pasteuria penetrans biotypes infecting root-knot nematodes.

PubMed

Nong, Guang; Chow, Virginia; Schmidt, Liesbeth M; Dickson, Don W; Preston, James F

2007-08-01

Pasteuria species are endospore-forming obligate bacterial parasites of soil-inhabiting nematodes and water-inhabiting cladocerans, e.g. water fleas, and are closely related to Bacillus spp. by 16S rRNA gene sequence. As naturally occurring bacteria, biotypes of Pasteuria penetrans are attractive candidates for the biocontrol of various Meloidogyne spp. (root-knot nematodes). Failure to culture these bacteria outside their hosts has prevented isolation of genomic DNA in quantities sufficient for identification of genes associated with host recognition and virulence. We have applied multiple-strand displacement amplification (MDA) to generate DNA for comparative genomics of biotypes exhibiting different host preferences. Using the genome of Bacillus subtilis as a paradigm, MDA allowed quantitative detection and sequencing of 12 marker genes from 2000 cells. Meloidogyne spp. infected with P. penetrans P20 or B4 contained single nucleotide polymorphisms (SNPs) in the spoIIAB gene that did not change the amino acid sequence, or that substituted amino acids with similar chemical properties. Individual nematodes infected with P. penetrans P20 or B4 contained SNPs in the spoIIAB gene sequenced in MDA-generated products. Detection of SNPs in the spoIIAB gene in a nematode indicates infection by more than one genotype, supporting the need to sequence genomes of Pasteuria spp. derived from single spore isolates.

Identification of downy mildew resistance gene candidates by positional cloning in maize (Zea mays subsp. mays; Poaceae)1

PubMed Central

Kim, Jae Yoon; Moon, Jun-Cheol; Kim, Hyo Chul; Shin, Seungho; Song, Kitae; Kim, Kyung-Hee; Lee, Byung-Moo

2017-01-01

Premise of the study: Positional cloning in combination with phenotyping is a general approach to identify disease-resistance gene candidates in plants; however, it requires several time-consuming steps including population or fine mapping. Therefore, in the present study, we suggest a new combined strategy to improve the identification of disease-resistance gene candidates. Methods and Results: Downy mildew (DM)–resistant maize was selected from five cultivars using a spreader row technique. Positional cloning and bioinformatics tools were used to identify the DM-resistance quantitative trait locus marker (bnlg1702) and 47 protein-coding gene annotations. Eventually, five DM-resistance gene candidates, including bZIP34, Bak1, and Ppr, were identified by quantitative reverse-transcription PCR (RT-PCR) without fine mapping of the bnlg1702 locus. Conclusions: The combined protocol with the spreader row technique, quantitative trait locus positional cloning, and quantitative RT-PCR was effective for identifying DM-resistance candidate genes. This cloning approach may be applied to other whole-genome-sequenced crops or resistance to other diseases. PMID:28224059

Integrative strategies to identify candidate genes in rodent models of human alcoholism.

PubMed

Treadwell, Julie A

2006-01-01

The search for genes underlying alcohol-related behaviours in rodent models of human alcoholism has been ongoing for many years with only limited success. Recently, new strategies that integrate several of the traditional approaches have provided new insights into the molecular mechanisms underlying ethanol's actions in the brain. We have used alcohol-preferring C57BL/6J (B6) and alcohol-avoiding DBA/2J (D2) genetic strains of mice in an integrative strategy combining high-throughput gene expression screening, genetic segregation analysis, and mapping to previously published quantitative trait loci to uncover candidate genes for the ethanol-preference phenotype. In our study, 2 genes, retinaldehyde binding protein 1 (Rlbp1) and syntaxin 12 (Stx12), were found to be strong candidates for ethanol preference. Such experimental approaches have the power and the potential to greatly speed up the laborious process of identifying candidate genes for the animal models of human alcoholism.

Decoy receptor 1 (DCR1) promoter hypermethylation and response to irinotecan in metastatic colorectal cancer

PubMed Central

Bosch, Linda J.W.; Coupé, Veerle M.H.; Mongera, Sandra; Haan, Josien C.; Richman, Susan D.; Koopman, Miriam; Tol, Jolien; de Meyer, Tim; Louwagie, Joost; Dehaspe, Luc; van Grieken, Nicole C.T.; Ylstra, Bauke; Verheul, Henk M.W.; van Engeland, Manon; Nagtegaal, Iris D.; Herman, James G.; Quirke, Philip; Seymour, Matthew T.; Punt, Cornelis J.A.; van Criekinge, Wim; Carvalho, Beatriz; Meijer, Gerrit A.

2017-01-01

Diversity in colorectal cancer biology is associated with variable responses to standard chemotherapy. We aimed to identify and validate DNA hypermethylated genes as predictive biomarkers for irinotecan treatment of metastatic CRC patients. Candidate genes were selected from 389 genes involved in DNA Damage Repair by correlation analyses between gene methylation status and drug response in 32 cell lines. A large series of samples (n=818) from two phase III clinical trials was used to evaluate these candidate genes by correlating methylation status to progression-free survival after treatment with first-line single-agent fluorouracil (Capecitabine or 5-fluorouracil) or combination chemotherapy (Capecitabine or 5-fluorouracil plus irinotecan (CAPIRI/FOLFIRI)). In the discovery (n=185) and initial validation set (n=166), patients with methylated Decoy Receptor 1 (DCR1) did not benefit from CAPIRI over Capecitabine treatment (discovery set: HR=1.2 (95%CI 0.7-1.9, p=0.6), validation set: HR=0.9 (95%CI 0.6-1.4, p=0.5)), whereas patients with unmethylated DCR1 did (discovery set: HR=0.4 (95%CI 0.3-0.6, p=0.00001), validation set: HR=0.5 (95%CI 0.3-0.7, p=0.0008)). These results could not be replicated in the external data set (n=467), where a similar effect size was found in patients with methylated and unmethylated DCR1 for FOLFIRI over 5FU treatment (methylated DCR1: HR=0.7 (95%CI 0.5-0.9, p=0.01), unmethylated DCR1: HR=0.8 (95%CI 0.6-1.2, p=0.4)). In conclusion, DCR1 promoter hypermethylation status is a potential predictive biomarker for response to treatment with irinotecan, when combined with capecitabine. This finding could not be replicated in an external validation set, in which irinotecan was combined with 5FU. These results underline the challenge and importance of extensive clinical evaluation of candidate biomarkers in multiple trials. PMID:28968978

High-density genetic map using whole-genome resequencing for fine mapping and candidate gene discovery for disease resistance in peanut.

PubMed

Agarwal, Gaurav; Clevenger, Josh; Pandey, Manish K; Wang, Hui; Shasidhar, Yaduru; Chu, Ye; Fountain, Jake C; Choudhary, Divya; Culbreath, Albert K; Liu, Xin; Huang, Guodong; Wang, Xingjun; Deshmukh, Rupesh; Holbrook, C Corley; Bertioli, David J; Ozias-Akins, Peggy; Jackson, Scott A; Varshney, Rajeev K; Guo, Baozhu

2018-04-10

Whole-genome resequencing (WGRS) of mapping populations has facilitated development of high-density genetic maps essential for fine mapping and candidate gene discovery for traits of interest in crop species. Leaf spots, including early leaf spot (ELS) and late leaf spot (LLS), and Tomato spotted wilt virus (TSWV) are devastating diseases in peanut causing significant yield loss. We generated WGRS data on a recombinant inbred line population, developed a SNP-based high-density genetic map, and conducted fine mapping, candidate gene discovery and marker validation for ELS, LLS and TSWV. The first sequence-based high-density map was constructed with 8869 SNPs assigned to 20 linkage groups, representing 20 chromosomes, for the 'T' population (Tifrunner × GT-C20) with a map length of 3120 cM and an average distance of 1.45 cM. The quantitative trait locus (QTL) analysis using high-density genetic map and multiple season phenotyping data identified 35 main-effect QTLs with phenotypic variation explained (PVE) from 6.32% to 47.63%. Among major-effect QTLs mapped, there were two QTLs for ELS on B05 with 47.42% PVE and B03 with 47.38% PVE, two QTLs for LLS on A05 with 47.63% and B03 with 34.03% PVE and one QTL for TSWV on B09 with 40.71% PVE. The epistasis and environment interaction analyses identified significant environmental effects on these traits. The identified QTL regions had disease resistance genes including R-genes and transcription factors. KASP markers were developed for major QTLs and validated in the population and are ready for further deployment in genomics-assisted breeding in peanut. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Three ulcerative colitis susceptibility loci are associated with primary sclerosing cholangitis and indicate a role for IL2, REL, and CARD9.

PubMed

Janse, Marcel; Lamberts, Laetitia E; Franke, Lude; Raychaudhuri, Soumya; Ellinghaus, Eva; Muri Boberg, Kirsten; Melum, Espen; Folseraas, Trine; Schrumpf, Erik; Bergquist, Annika; Björnsson, Einar; Fu, Jingyuan; Jan Westra, Harm; Groen, Harry J M; Fehrmann, Rudolf S N; Smolonska, Joanna; van den Berg, Leonard H; Ophoff, Roel A; Porte, Robert J; Weismüller, Tobias J; Wedemeyer, Jochen; Schramm, Christoph; Sterneck, Martina; Günther, Rainer; Braun, Felix; Vermeire, Severine; Henckaerts, Liesbet; Wijmenga, Cisca; Ponsioen, Cyriel Y; Schreiber, Stefan; Karlsen, Tom H; Franke, Andre; Weersma, Rinse K

2011-06-01

Primary sclerosing cholangitis (PSC) is a chronic cholestatic liver disease characterized by inflammation and fibrosis of the bile ducts. Both environmental and genetic factors contribute to its pathogenesis. To further clarify its genetic background, we investigated susceptibility loci recently identified for ulcerative colitis (UC) in a large cohort of 1,186 PSC patients and 1,748 controls. Single nucleotide polymorphisms (SNPs) tagging 13 UC susceptibility loci were initially genotyped in 854 PSC patients and 1,491 controls from Benelux (331 cases, 735 controls), Germany (265 cases, 368 controls), and Scandinavia (258 cases, 388 controls). Subsequently, a joint analysis was performed with an independent second Scandinavian cohort (332 cases, 257 controls). SNPs at chromosomes 2p16 (P-value 4.12 × 10(-4) ), 4q27 (P-value 4.10 × 10(-5) ), and 9q34 (P-value 8.41 × 10(-4) ) were associated with PSC in the joint analysis after correcting for multiple testing. In PSC patients without inflammatory bowel disease (IBD), SNPs at 4q27 and 9q34 were nominally associated (P < 0.05). We applied additional in silico analyses to identify likely candidate genes at PSC susceptibility loci. To identify nonrandom, evidence-based links we used GRAIL (Gene Relationships Across Implicated Loci) analysis showing interconnectivity between genes in six out of in total nine PSC-associated regions. Expression quantitative trait analysis from 1,469 Dutch and UK individuals demonstrated that five out of nine SNPs had an effect on cis-gene expression. These analyses prioritized IL2, CARD9, and REL as novel candidates. We have identified three UC susceptibility loci to be associated with PSC, harboring the putative candidate genes REL, IL2, and CARD9. These results add to the scarce knowledge on the genetic background of PSC and imply an important role for both innate and adaptive immunological factors. Copyright © 2011 American Association for the Study of Liver Diseases.

Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli

DOE PAGES

Javidpour, Pouya; Deutsch, Samuel; Mutalik, Vivek K.; ...

2016-03-14

Ladderanes are hydrocarbon chains with three or five linearly concatenated cyclobutane rings that are uniquely produced as membrane lipid components by anammox (anaerobic ammonia-oxidizing) bacteria. By virtue of their angle and torsional strain, ladderanes are unusually energetic compounds, and if produced biochemically by engineered microbes, could serve as renewable, high-energy-density jet fuel components. The biochemistry and genetics underlying the ladderane biosynthetic pathway are unknown, however, previous studies have identified a pool of 34 candidate genes from the anammox bacterium, Kuenenia stuttgartiensis, some or all of which may be involved with ladderane fatty acid biosynthesis. The goal of the present studymore » was to establish a systematic means of testing the candidate genes from K. stuttgartiensis for involvement in ladderane biosynthesis through heterologous expression in E. coli under anaerobic conditions. This study describes an efficient means of assembly of synthesized, codon-optimized candidate ladderane biosynthesis genes in synthetic operons that allows for changes to regulatory element sequences, as well as modular assembly of multiple operons for simultaneous heterologous expression in E. coli (or potentially other microbial hosts). We also describe in vivo functional tests of putative anammox homologs of the phytoene desaturase CrtI, which plays an important role in the hypothesized ladderane pathway, and a method for soluble purification of one of these enzymes. This study is, to our knowledge, the first experimental effort focusing on the role of specific anammox genes in the production of ladderanes, and lays the foundation for future efforts toward determination of the ladderane biosynthetic pathway. Our substantial, but far from comprehensive, efforts at elucidating the ladderane biosynthetic pathway were not successful. We invite the scientific community to take advantage of the considerable synthetic biology resources and experimental results developed in this study to elucidate the biosynthetic pathway that produces unique and intriguing ladderane lipids.« less

Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Javidpour, Pouya; Deutsch, Samuel; Mutalik, Vivek K.

Ladderanes are hydrocarbon chains with three or five linearly concatenated cyclobutane rings that are uniquely produced as membrane lipid components by anammox (anaerobic ammonia-oxidizing) bacteria. By virtue of their angle and torsional strain, ladderanes are unusually energetic compounds, and if produced biochemically by engineered microbes, could serve as renewable, high-energy-density jet fuel components. The biochemistry and genetics underlying the ladderane biosynthetic pathway are unknown, however, previous studies have identified a pool of 34 candidate genes from the anammox bacterium, Kuenenia stuttgartiensis, some or all of which may be involved with ladderane fatty acid biosynthesis. The goal of the present studymore » was to establish a systematic means of testing the candidate genes from K. stuttgartiensis for involvement in ladderane biosynthesis through heterologous expression in E. coli under anaerobic conditions. This study describes an efficient means of assembly of synthesized, codon-optimized candidate ladderane biosynthesis genes in synthetic operons that allows for changes to regulatory element sequences, as well as modular assembly of multiple operons for simultaneous heterologous expression in E. coli (or potentially other microbial hosts). We also describe in vivo functional tests of putative anammox homologs of the phytoene desaturase CrtI, which plays an important role in the hypothesized ladderane pathway, and a method for soluble purification of one of these enzymes. This study is, to our knowledge, the first experimental effort focusing on the role of specific anammox genes in the production of ladderanes, and lays the foundation for future efforts toward determination of the ladderane biosynthetic pathway. Our substantial, but far from comprehensive, efforts at elucidating the ladderane biosynthetic pathway were not successful. We invite the scientific community to take advantage of the considerable synthetic biology resources and experimental results developed in this study to elucidate the biosynthetic pathway that produces unique and intriguing ladderane lipids.« less

Decoy receptor 1 (DCR1) promoter hypermethylation and response to irinotecan in metastatic colorectal cancer.

PubMed

Bosch, Linda J W; Trooskens, Geert; Snaebjornsson, Petur; Coupé, Veerle M H; Mongera, Sandra; Haan, Josien C; Richman, Susan D; Koopman, Miriam; Tol, Jolien; de Meyer, Tim; Louwagie, Joost; Dehaspe, Luc; van Grieken, Nicole C T; Ylstra, Bauke; Verheul, Henk M W; van Engeland, Manon; Nagtegaal, Iris D; Herman, James G; Quirke, Philip; Seymour, Matthew T; Punt, Cornelis J A; van Criekinge, Wim; Carvalho, Beatriz; Meijer, Gerrit A

2017-09-08

Diversity in colorectal cancer biology is associated with variable responses to standard chemotherapy. We aimed to identify and validate DNA hypermethylated genes as predictive biomarkers for irinotecan treatment of metastatic CRC patients. Candidate genes were selected from 389 genes involved in DNA Damage Repair by correlation analyses between gene methylation status and drug response in 32 cell lines. A large series of samples (n=818) from two phase III clinical trials was used to evaluate these candidate genes by correlating methylation status to progression-free survival after treatment with first-line single-agent fluorouracil (Capecitabine or 5-fluorouracil) or combination chemotherapy (Capecitabine or 5-fluorouracil plus irinotecan (CAPIRI/FOLFIRI)). In the discovery (n=185) and initial validation set (n=166), patients with methylated Decoy Receptor 1 ( DCR1) did not benefit from CAPIRI over Capecitabine treatment (discovery set: HR=1.2 (95%CI 0.7-1.9, p =0.6), validation set: HR=0.9 (95%CI 0.6-1.4, p =0.5)), whereas patients with unmethylated DCR1 did (discovery set: HR=0.4 (95%CI 0.3-0.6, p =0.00001), validation set: HR=0.5 (95%CI 0.3-0.7, p =0.0008)). These results could not be replicated in the external data set (n=467), where a similar effect size was found in patients with methylated and unmethylated DCR1 for FOLFIRI over 5FU treatment (methylated DCR1 : HR=0.7 (95%CI 0.5-0.9, p =0.01), unmethylated DCR1 : HR=0.8 (95%CI 0.6-1.2, p =0.4)). In conclusion, DCR1 promoter hypermethylation status is a potential predictive biomarker for response to treatment with irinotecan, when combined with capecitabine. This finding could not be replicated in an external validation set, in which irinotecan was combined with 5FU. These results underline the challenge and importance of extensive clinical evaluation of candidate biomarkers in multiple trials.

Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli

PubMed Central

Javidpour, Pouya; Deutsch, Samuel; Mutalik, Vivek K.; Hillson, Nathan J.; Petzold, Christopher J.; Keasling, Jay D.; Beller, Harry R.

2016-01-01

Ladderanes are hydrocarbon chains with three or five linearly concatenated cyclobutane rings that are uniquely produced as membrane lipid components by anammox (anaerobic ammonia-oxidizing) bacteria. By virtue of their angle and torsional strain, ladderanes are unusually energetic compounds, and if produced biochemically by engineered microbes, could serve as renewable, high-energy-density jet fuel components. The biochemistry and genetics underlying the ladderane biosynthetic pathway are unknown, however, previous studies have identified a pool of 34 candidate genes from the anammox bacterium, Kuenenia stuttgartiensis, some or all of which may be involved with ladderane fatty acid biosynthesis. The goal of the present study was to establish a systematic means of testing the candidate genes from K. stuttgartiensis for involvement in ladderane biosynthesis through heterologous expression in E. coli under anaerobic conditions. This study describes an efficient means of assembly of synthesized, codon-optimized candidate ladderane biosynthesis genes in synthetic operons that allows for changes to regulatory element sequences, as well as modular assembly of multiple operons for simultaneous heterologous expression in E. coli (or potentially other microbial hosts). We also describe in vivo functional tests of putative anammox homologs of the phytoene desaturase CrtI, which plays an important role in the hypothesized ladderane pathway, and a method for soluble purification of one of these enzymes. This study is, to our knowledge, the first experimental effort focusing on the role of specific anammox genes in the production of ladderanes, and lays the foundation for future efforts toward determination of the ladderane biosynthetic pathway. Our substantial, but far from comprehensive, efforts at elucidating the ladderane biosynthetic pathway were not successful. We invite the scientific community to take advantage of the considerable synthetic biology resources and experimental results developed in this study to elucidate the biosynthetic pathway that produces unique and intriguing ladderane lipids. PMID:26975050

Concurrent Drought Stress and Vascular Pathogen Infection Induce Common and Distinct Transcriptomic Responses in Chickpea

PubMed Central

Sinha, Ranjita; Gupta, Aarti; Senthil-Kumar, Muthappa

2017-01-01

Chickpea (Cicer arietinum); the second largest legume grown worldwide is prone to drought and various pathogen infections. These drought and pathogen stresses often occur concurrently in the field conditions. However, the molecular events in response to that are largely unknown. The present study examines the transcriptome dynamics in chickpea plants exposed to a combination of water-deficit stress and Ralstonia solanacearum infection. R. solanacearum is a potential wilt disease causing pathogen in chickpea. Drought stressed chickpea plants were infected with this pathogen and the plants were allowed to experience progressive drought with 2 and 4 days of R. solanacearum infection called short duration stress (SD stresses) and long duration stress (LD stresses), respectively. Our study showed that R. solanacearum multiplication decreased under SD-combined stress compared to SD-pathogen but there was no significant change in LD-combined stress compared to LD-pathogen. The microarray analysis during these conditions showed that 821 and 1039 differentially expressed genes (DEGs) were unique to SD- and LD-combined stresses, respectively, when compared with individual stress conditions. Three and fifteen genes were common among all the SD-stress treatments and LD-stress treatments, respectively. Genes involved in secondary cell wall biosynthesis, alkaloid biosynthesis, defense related proteins, and osmo-protectants were up-regulated during combined stress. The expression of genes involved in lignin and cellulose biosynthesis were specifically up-regulated in SD-combined, LD-combined, and LD-pathogen stress. A close transcriptomic association of LD-pathogen stress with SD-combined stress was observed in this study which indicates that R. solanacearum infection also exerts drought stress along with pathogen stress thus mimics combined stress effect. Furthermore the expression profiling of candidate genes using real-time quantitative PCR validated the microarray data. The study showed that down-regulation of defense-related genes during LD-combined stress resulted in an increased bacterial multiplication as compared to SD-combined stress. Overall, our study highlights a sub-set of DEGs uniquely expressed in response to combined stress, which serve as potential candidates for further functional characterization to delineate the molecular response of the plant to concurrent drought-pathogen stress. PMID:28382041

LOD score exclusion analyses for candidate genes using random population samples.

PubMed

Deng, H W; Li, J; Recker, R R

2001-05-01

While extensive analyses have been conducted to test for, no formal analyses have been conducted to test against, the importance of candidate genes with random population samples. We develop a LOD score approach for exclusion analyses of candidate genes with random population samples. Under this approach, specific genetic effects and inheritance models at candidate genes can be analysed and if a LOD score is < or = - 2.0, the locus can be excluded from having an effect larger than that specified. Computer simulations show that, with sample sizes often employed in association studies, this approach has high power to exclude a gene from having moderate genetic effects. In contrast to regular association analyses, population admixture will not affect the robustness of our analyses; in fact, it renders our analyses more conservative and thus any significant exclusion result is robust. Our exclusion analysis complements association analysis for candidate genes in random population samples and is parallel to the exclusion mapping analyses that may be conducted in linkage analyses with pedigrees or relative pairs. The usefulness of the approach is demonstrated by an application to test the importance of vitamin D receptor and estrogen receptor genes underlying the differential risk to osteoporotic fractures.

Genome-wide generation and use of informative intron-spanning and intron-length polymorphism markers for high-throughput genetic analysis in rice

PubMed Central

Badoni, Saurabh; Das, Sweta; Sayal, Yogesh K.; Gopalakrishnan, S.; Singh, Ashok K.; Rao, Atmakuri R.; Agarwal, Pinky; Parida, Swarup K.; Tyagi, Akhilesh K.

2016-01-01

We developed genome-wide 84634 ISM (intron-spanning marker) and 16510 InDel-fragment length polymorphism-based ILP (intron-length polymorphism) markers from genes physically mapped on 12 rice chromosomes. These genic markers revealed much higher amplification-efficiency (80%) and polymorphic-potential (66%) among rice accessions even by a cost-effective agarose gel-based assay. A wider level of functional molecular diversity (17–79%) and well-defined precise admixed genetic structure was assayed by 3052 genome-wide markers in a structured population of indica, japonica, aromatic and wild rice. Six major grain weight QTLs (11.9–21.6% phenotypic variation explained) were mapped on five rice chromosomes of a high-density (inter-marker distance: 0.98 cM) genetic linkage map (IR 64 x Sonasal) anchored with 2785 known/candidate gene-derived ISM and ILP markers. The designing of multiple ISM and ILP markers (2 to 4 markers/gene) in an individual gene will broaden the user-preference to select suitable primer combination for efficient assaying of functional allelic variation/diversity and realistic estimation of differential gene expression profiles among rice accessions. The genomic information generated in our study is made publicly accessible through a user-friendly web-resource, “Oryza ISM-ILP marker” database. The known/candidate gene-derived ISM and ILP markers can be enormously deployed to identify functionally relevant trait-associated molecular tags by optimal-resource expenses, leading towards genomics-assisted crop improvement in rice. PMID:27032371

Extensive transcriptional response associated with seasonal plasticity of butterfly wing patterns.

PubMed

Daniels, Emily V; Murad, Rabi; Mortazavi, Ali; Reed, Robert D

2014-12-01

In the eastern United States, the buckeye butterfly, Junonia coenia, shows seasonal wing colour plasticity where adults emerging in the spring are tan, while those emerging in the autumn are dark red. This variation can be artificially induced in laboratory colonies, thus making J. coenia a useful model system to examine the mechanistic basis of plasticity. To better understand the developmental basis of seasonal plasticity, we used RNA-seq to quantify transcription profiles associated with development of alternative seasonal wing morphs. Depending on the developmental stage, between 547 and 1420 transfrags were significantly differentially expressed between morphs. These extensive differences in gene expression stand in contrast to the much smaller numbers of differentially expressed transcripts identified in previous studies of genetic wing pattern variation in other species and suggest that environmentally induced phenotypic shifts arise from very broad systemic processes. Analyses of candidate endocrine and pigmentation transcripts revealed notable genes upregulated in the red morph, including several ecdysone-associated genes, and cinnabar, an ommochrome pigmentation gene implicated in colour pattern variation in other butterflies. We also found multiple melanin-related transcripts strongly upregulated in the red morph, including tan and yellow-family genes, leading us to speculate that dark red pigmentation in autumn J. coenia may involve nonommochrome pigments. While we identified several endocrine and pigmentation genes as obvious candidates for seasonal colour morph differentiation, we speculate that the majority of observed expression differences were due to thermal stress response. The buckeye transcriptome provides a basis for further developmental studies of phenotypic plasticity. © 2014 John Wiley & Sons Ltd.

Identification of Treatment Targets in a Genetic Mouse Model of Voluntary Methamphetamine Drinking.

PubMed

Phillips, T J; Mootz, J R K; Reed, C

2016-01-01

Methamphetamine has powerful stimulant and euphoric effects that are experienced as rewarding and encourage use. Methamphetamine addiction is associated with debilitating illnesses, destroyed relationships, child neglect, violence, and crime; but after many years of research, broadly effective medications have not been identified. Individual differences that may impact not only risk for developing a methamphetamine use disorder but also affect treatment response have not been fully considered. Human studies have identified candidate genes that may be relevant, but lack of control over drug history, the common use or coabuse of multiple addictive drugs, and restrictions on the types of data that can be collected in humans are barriers to progress. To overcome some of these issues, a genetic animal model comprised of lines of mice selectively bred for high and low voluntary methamphetamine intake was developed to identify risk and protective alleles for methamphetamine consumption, and identify therapeutic targets. The mu opioid receptor gene was supported as a target for genes within a top-ranked transcription factor network associated with level of methamphetamine intake. In addition, mice that consume high levels of methamphetamine were found to possess a nonfunctional form of the trace amine-associated receptor 1 (TAAR1). The Taar1 gene is within a mouse chromosome 10 quantitative trait locus for methamphetamine consumption, and TAAR1 function determines sensitivity to aversive effects of methamphetamine that may curb intake. The genes, gene interaction partners, and protein products identified in this genetic mouse model represent treatment target candidates for methamphetamine addiction. © 2016 Elsevier Inc. All rights reserved.

Identification of candidate genes in osteoporosis by integrated microarray analysis.

PubMed

Li, J J; Wang, B Q; Fei, Q; Yang, Y; Li, D

2016-12-01

In order to screen the altered gene expression profile in peripheral blood mononuclear cells of patients with osteoporosis, we performed an integrated analysis of the online microarray studies of osteoporosis. We searched the Gene Expression Omnibus (GEO) database for microarray studies of peripheral blood mononuclear cells in patients with osteoporosis. Subsequently, we integrated gene expression data sets from multiple microarray studies to obtain differentially expressed genes (DEGs) between patients with osteoporosis and normal controls. Gene function analysis was performed to uncover the functions of identified DEGs. A total of three microarray studies were selected for integrated analysis. In all, 1125 genes were found to be significantly differentially expressed between osteoporosis patients and normal controls, with 373 upregulated and 752 downregulated genes. Positive regulation of the cellular amino metabolic process (gene ontology (GO): 0033240, false discovery rate (FDR) = 1.00E + 00) was significantly enriched under the GO category for biological processes, while for molecular functions, flavin adenine dinucleotide binding (GO: 0050660, FDR = 3.66E-01) and androgen receptor binding (GO: 0050681, FDR = 6.35E-01) were significantly enriched. DEGs were enriched in many osteoporosis-related signalling pathways, including those of mitogen-activated protein kinase (MAPK) and calcium. Protein-protein interaction (PPI) network analysis showed that the significant hub proteins contained ubiquitin specific peptidase 9, X-linked (Degree = 99), ubiquitin specific peptidase 19 (Degree = 57) and ubiquitin conjugating enzyme E2 B (Degree = 57). Analysis of gene function of identified differentially expressed genes may expand our understanding of fundamental mechanisms leading to osteoporosis. Moreover, significantly enriched pathways, such as MAPK and calcium, may involve in osteoporosis through osteoblastic differentiation and bone formation.Cite this article: J. J. Li, B. Q. Wang, Q. Fei, Y. Yang, D. Li. Identification of candidate genes in osteoporosis by integrated microarray analysis. Bone Joint Res 2016;5:594-601. DOI: 10.1302/2046-3758.512.BJR-2016-0073.R1. © 2016 Fei et al.

Phenoscape: Identifying Candidate Genes for Evolutionary Phenotypes

PubMed Central

Edmunds, Richard C.; Su, Baofeng; Balhoff, James P.; Eames, B. Frank; Dahdul, Wasila M.; Lapp, Hilmar; Lundberg, John G.; Vision, Todd J.; Dunham, Rex A.; Mabee, Paula M.; Westerfield, Monte

2016-01-01

Phenotypes resulting from mutations in genetic model organisms can help reveal candidate genes for evolutionarily important phenotypic changes in related taxa. Although testing candidate gene hypotheses experimentally in nonmodel organisms is typically difficult, ontology-driven information systems can help generate testable hypotheses about developmental processes in experimentally tractable organisms. Here, we tested candidate gene hypotheses suggested by expert use of the Phenoscape Knowledgebase, specifically looking for genes that are candidates responsible for evolutionarily interesting phenotypes in the ostariophysan fishes that bear resemblance to mutant phenotypes in zebrafish. For this, we searched ZFIN for genetic perturbations that result in either loss of basihyal element or loss of scales phenotypes, because these are the ancestral phenotypes observed in catfishes (Siluriformes). We tested the identified candidate genes by examining their endogenous expression patterns in the channel catfish, Ictalurus punctatus. The experimental results were consistent with the hypotheses that these features evolved through disruption in developmental pathways at, or upstream of, brpf1 and eda/edar for the ancestral losses of basihyal element and scales, respectively. These results demonstrate that ontological annotations of the phenotypic effects of genetic alterations in model organisms, when aggregated within a knowledgebase, can be used effectively to generate testable, and useful, hypotheses about evolutionary changes in morphology. PMID:26500251

Walking the interactome for candidate prioritization in exome sequencing studies of Mendelian diseases

DOE PAGES

Smedley, Damian; Kohler, Sebastian; Czeschik, Johanna Christina; ...

2014-07-30

Here, whole-exome sequencing (WES) has opened up previously unheard of possibilities for identifying novel disease genes in Mendelian disorders, only about half of which have been elucidated to date. However, interpretation of WES data remains challenging. As a result, we analyze protein–protein association (PPA) networks to identify candidate genes in the vicinity of genes previously implicated in a disease. The analysis, using a random-walk with restart (RWR) method, is adapted to the setting of WES by developing a composite variant-gene relevance score based on the rarity, location and predicted pathogenicity of variants and the RWR evaluation of genes harboring themore » variants. Benchmarking using known disease variants from 88 disease-gene families reveals that the correct gene is ranked among the top 10 candidates in ≥50% of cases, a figure which we confirmed using a prospective study of disease genes identified in 2012 and PPA data produced before that date. In conclusion, we implement our method in a freely available Web server, ExomeWalker, that displays a ranked list of candidates together with information on PPAs, frequency and predicted pathogenicity of the variants to allow quick and effective searches for candidates that are likely to reward closer investigation.« less

Integration of QTL and bioinformatic tools to identify candidate genes for triglycerides in mice[S

PubMed Central

Leduc, Magalie S.; Hageman, Rachael S.; Verdugo, Ricardo A.; Tsaih, Shirng-Wern; Walsh, Kenneth; Churchill, Gary A.; Paigen, Beverly

2011-01-01

To identify genetic loci influencing lipid levels, we performed quantitative trait loci (QTL) analysis between inbred mouse strains MRL/MpJ and SM/J, measuring triglyceride levels at 8 weeks of age in F2 mice fed a chow diet. We identified one significant QTL on chromosome (Chr) 15 and three suggestive QTL on Chrs 2, 7, and 17. We also carried out microarray analysis on the livers of parental strains of 282 F2 mice and used these data to find cis-regulated expression QTL. We then narrowed the list of candidate genes under significant QTL using a “toolbox” of bioinformatic resources, including haplotype analysis; parental strain comparison for gene expression differences and nonsynonymous coding single nucleotide polymorphisms (SNP); cis-regulated eQTL in livers of F2 mice; correlation between gene expression and phenotype; and conditioning of expression on the phenotype. We suggest Slc25a7 as a candidate gene for the Chr 7 QTL and, based on expression differences, five genes (Polr3 h, Cyp2d22, Cyp2d26, Tspo, and Ttll12) as candidate genes for Chr 15 QTL. This study shows how bioinformatics can be used effectively to reduce candidate gene lists for QTL related to complex traits. PMID:21622629

Walking the interactome for candidate prioritization in exome sequencing studies of Mendelian diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smedley, Damian; Kohler, Sebastian; Czeschik, Johanna Christina

Here, whole-exome sequencing (WES) has opened up previously unheard of possibilities for identifying novel disease genes in Mendelian disorders, only about half of which have been elucidated to date. However, interpretation of WES data remains challenging. As a result, we analyze protein–protein association (PPA) networks to identify candidate genes in the vicinity of genes previously implicated in a disease. The analysis, using a random-walk with restart (RWR) method, is adapted to the setting of WES by developing a composite variant-gene relevance score based on the rarity, location and predicted pathogenicity of variants and the RWR evaluation of genes harboring themore » variants. Benchmarking using known disease variants from 88 disease-gene families reveals that the correct gene is ranked among the top 10 candidates in ≥50% of cases, a figure which we confirmed using a prospective study of disease genes identified in 2012 and PPA data produced before that date. In conclusion, we implement our method in a freely available Web server, ExomeWalker, that displays a ranked list of candidates together with information on PPAs, frequency and predicted pathogenicity of the variants to allow quick and effective searches for candidates that are likely to reward closer investigation.« less

Identification of Two Candidate Tumor Suppressor Genes on Chromosome 17p13.3: Assessment of Their Roles in Breast and Ovarian Carcinogenesis

DTIC Science & Technology

1999-07-01

but is generally at an advanced stage at the time of detection. Both diseases are controlled by multiple genetic defects, suggesting the involvement of...Functional characterization of OVCA1, a putative tumor suppressor. American Society of Human Genetics , submitted, 1999. Prowse, A.H., Bruening, W...Godwin, A.K. OVCA1, and novel tumor suppressor, is aberrantly expressed in ovarian carcinomas. American Society of Human Genetics , submitted, 1999

The Genetic Basis for Variation in Sensitivity to Lead Toxicity in Drosophila melanogaster.

PubMed

Zhou, Shanshan; Morozova, Tatiana V; Hussain, Yasmeen N; Luoma, Sarah E; McCoy, Lenovia; Yamamoto, Akihiko; Mackay, Trudy F C; Anholt, Robert R H

2016-07-01

Lead toxicity presents a worldwide health problem, especially due to its adverse effects on cognitive development in children. However, identifying genes that give rise to individual variation in susceptibility to lead toxicity is challenging in human populations. Our goal was to use Drosophila melanogaster to identify evolutionarily conserved candidate genes associated with individual variation in susceptibility to lead exposure. To identify candidate genes associated with variation in susceptibility to lead toxicity, we measured effects of lead exposure on development time, viability and adult activity in the Drosophila melanogaster Genetic Reference Panel (DGRP) and performed genome-wide association analyses to identify candidate genes. We used mutants to assess functional causality of candidate genes and constructed a genetic network associated with variation in sensitivity to lead exposure, on which we could superimpose human orthologs. We found substantial heritabilities for all three traits and identified candidate genes associated with variation in susceptibility to lead exposure for each phenotype. The genetic architectures that determine variation in sensitivity to lead exposure are highly polygenic. Gene ontology and network analyses showed enrichment of genes associated with early development and function of the nervous system. Drosophila melanogaster presents an advantageous model to study the genetic underpinnings of variation in susceptibility to lead toxicity. Evolutionary conservation of cellular pathways that respond to toxic exposure allows predictions regarding orthologous genes and pathways across phyla. Thus, studies in the D. melanogaster model system can identify candidate susceptibility genes to guide subsequent studies in human populations. Zhou S, Morozova TV, Hussain YN, Luoma SE, McCoy L, Yamamoto A, Mackay TF, Anholt RR. 2016. The genetic basis for variation in sensitivity to lead toxicity in Drosophila melanogaster. Environ Health Perspect 124:1062-1070; http://dx.doi.org/10.1289/ehp.1510513.

Genetics of primary ovarian insufficiency: new developments and opportunities

PubMed Central

Qin, Yingying; Jiao, Xue; Simpson, Joe Leigh; Chen, Zi-Jiang

2015-01-01

BACKGROUND Primary ovarian insufficiency (POI) is characterized by marked heterogeneity, but with a significant genetic contribution. Identifying exact causative genes has been challenging, with many discoveries not replicated. It is timely to take stock of the field, outlining the progress made, framing the controversies and anticipating future directions in elucidating the genetics of POI. METHODS A search for original articles published up to May 2015 was performed using PubMed and Google Scholar, identifying studies on the genetic etiology of POI. Studies were included if chromosomal analysis, candidate gene screening and a genome-wide study were conducted. Articles identified were restricted to English language full-text papers. RESULTS Chromosomal abnormalities have long been recognized as a frequent cause of POI, with a currently estimated prevalence of 10–13%. Using the traditional karyotype methodology, monosomy X, mosaicism, X chromosome deletions and rearrangements, X-autosome translocations, and isochromosomes have been detected. Based on candidate gene studies, single gene perturbations unequivocally having a deleterious effect in at least one population include Bone morphogenetic protein 15 (BMP15), Progesterone receptor membrane component 1 (PGRMC1), and Fragile X mental retardation 1 (FMR1) premutation on the X chromosome; Growth differentiation factor 9 (GDF9), Folliculogenesis specific bHLH transcription factor (FIGLA), Newborn ovary homeobox gene (NOBOX), Nuclear receptor subfamily 5, group A, member 1 (NR5A1) and Nanos homolog 3 (NANOS3) seem likely as well, but mostly being found in no more than 1–2% of a single population studied. Whole genome approaches have utilized genome-wide association studies (GWAS) to reveal loci not predicted on the basis of a candidate gene, but it remains difficult to locate causative genes and susceptible loci were not always replicated. Cytogenomic methods (array CGH) have identified other regions of interest but studies have not shown consistent results, the resolution of arrays has varied and replication is uncommon. Whole-exome sequencing in non-syndromic POI kindreds has only recently begun, revealing mutations in the Stromal antigen 3 (STAG3), Synaptonemal complex central element 1 (SYCE1), minichromosome maintenance complex component 8 and 9 (MCM8, MCM9) and ATP-dependent DNA helicase homolog (HFM1) genes. Given the slow progress in candidate-gene analysis and relatively small sample sizes available for GWAS, family-based whole exome and whole genome sequencing appear to be the most promising approaches for detecting potential genes responsible for POI. CONCLUSION Taken together, the cytogenetic, cytogenomic (array CGH) and exome sequencing approaches have revealed a genetic causation in ∼20–25% of POI cases. Uncovering the remainder of the causative genes will be facilitated not only by whole genome approaches involving larger cohorts in multiple populations but also incorporating environmental exposures and exploring signaling pathways in intragenic and intergenic regions that point to perturbations in regulatory genes and networks. PMID:26243799

Genetics of primary ovarian insufficiency: new developments and opportunities.

PubMed

Qin, Yingying; Jiao, Xue; Simpson, Joe Leigh; Chen, Zi-Jiang

2015-01-01

Primary ovarian insufficiency (POI) is characterized by marked heterogeneity, but with a significant genetic contribution. Identifying exact causative genes has been challenging, with many discoveries not replicated. It is timely to take stock of the field, outlining the progress made, framing the controversies and anticipating future directions in elucidating the genetics of POI. A search for original articles published up to May 2015 was performed using PubMed and Google Scholar, identifying studies on the genetic etiology of POI. Studies were included if chromosomal analysis, candidate gene screening and a genome-wide study were conducted. Articles identified were restricted to English language full-text papers. Chromosomal abnormalities have long been recognized as a frequent cause of POI, with a currently estimated prevalence of 10-13%. Using the traditional karyotype methodology, monosomy X, mosaicism, X chromosome deletions and rearrangements, X-autosome translocations, and isochromosomes have been detected. Based on candidate gene studies, single gene perturbations unequivocally having a deleterious effect in at least one population include Bone morphogenetic protein 15 (BMP15), Progesterone receptor membrane component 1 (PGRMC1), and Fragile X mental retardation 1 (FMR1) premutation on the X chromosome; Growth differentiation factor 9 (GDF9), Folliculogenesis specific bHLH transcription factor (FIGLA), Newborn ovary homeobox gene (NOBOX), Nuclear receptor subfamily 5, group A, member 1 (NR5A1) and Nanos homolog 3 (NANOS3) seem likely as well, but mostly being found in no more than 1-2% of a single population studied. Whole genome approaches have utilized genome-wide association studies (GWAS) to reveal loci not predicted on the basis of a candidate gene, but it remains difficult to locate causative genes and susceptible loci were not always replicated. Cytogenomic methods (array CGH) have identified other regions of interest but studies have not shown consistent results, the resolution of arrays has varied and replication is uncommon. Whole-exome sequencing in non-syndromic POI kindreds has only recently begun, revealing mutations in the Stromal antigen 3 (STAG3), Synaptonemal complex central element 1 (SYCE1), minichromosome maintenance complex component 8 and 9 (MCM8, MCM9) and ATP-dependent DNA helicase homolog (HFM1) genes. Given the slow progress in candidate-gene analysis and relatively small sample sizes available for GWAS, family-based whole exome and whole genome sequencing appear to be the most promising approaches for detecting potential genes responsible for POI. Taken together, the cytogenetic, cytogenomic (array CGH) and exome sequencing approaches have revealed a genetic causation in ∼20-25% of POI cases. Uncovering the remainder of the causative genes will be facilitated not only by whole genome approaches involving larger cohorts in multiple populations but also incorporating environmental exposures and exploring signaling pathways in intragenic and intergenic regions that point to perturbations in regulatory genes and networks. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology.

Functional and Genomic Features of Human Genes Mutated in Neuropsychiatric Disorders.

PubMed

Forero, Diego A; Prada, Carlos F; Perry, George

2016-01-01

In recent years, a large number of studies around the world have led to the identification of causal genes for hereditary types of common and rare neurological and psychiatric disorders. To explore the functional and genomic features of known human genes mutated in neuropsychiatric disorders. A systematic search was used to develop a comprehensive catalog of genes mutated in neuropsychiatric disorders (NPD). Functional enrichment and protein-protein interaction analyses were carried out. A false discovery rate approach was used for correction for multiple testing. We found several functional categories that are enriched among NPD genes, such as gene ontologies, protein domains, tissue expression, signaling pathways and regulation by brain-expressed miRNAs and transcription factors. Sixty six of those NPD genes are known to be druggable. Several topographic parameters of protein-protein interaction networks and the degree of conservation between orthologous genes were identified as significant among NPD genes. These results represent one of the first analyses of enrichment of functional categories of genes known to harbor mutations for NPD. These findings could be useful for a future creation of computational tools for prioritization of novel candidate genes for NPD.

Functional and Genomic Features of Human Genes Mutated in Neuropsychiatric Disorders

PubMed Central

Forero, Diego A.; Prada, Carlos F.; Perry, George

2016-01-01

Background: In recent years, a large number of studies around the world have led to the identification of causal genes for hereditary types of common and rare neurological and psychiatric disorders. Objective: To explore the functional and genomic features of known human genes mutated in neuropsychiatric disorders. Methods: A systematic search was used to develop a comprehensive catalog of genes mutated in neuropsychiatric disorders (NPD). Functional enrichment and protein-protein interaction analyses were carried out. A false discovery rate approach was used for correction for multiple testing. Results: We found several functional categories that are enriched among NPD genes, such as gene ontologies, protein domains, tissue expression, signaling pathways and regulation by brain-expressed miRNAs and transcription factors. Sixty six of those NPD genes are known to be druggable. Several topographic parameters of protein-protein interaction networks and the degree of conservation between orthologous genes were identified as significant among NPD genes. Conclusion: These results represent one of the first analyses of enrichment of functional categories of genes known to harbor mutations for NPD. These findings could be useful for a future creation of computational tools for prioritization of novel candidate genes for NPD. PMID:27990183

Genetic basis of interindividual susceptibility to cancer cachexia: selection of potential candidate gene polymorphisms for association studies.

PubMed

Johns, N; Tan, B H; MacMillan, M; Solheim, T S; Ross, J A; Baracos, V E; Damaraju, S; Fearon, K C H

2014-12-01

Cancer cachexia is a complex and multifactorial disease. Evolving definitions highlight the fact that a diverse range of biological processes contribute to cancer cachexia. Part of the variation in who will and who will not develop cancer cachexia may be genetically determined. As new definitions, classifications and biological targets continue to evolve, there is a need for reappraisal of the literature for future candidate association studies. This review summarizes genes identified or implicated as well as putative candidate genes contributing to cachexia, identified through diverse technology platforms and model systems to further guide association studies. A systematic search covering 1986-2012 was performed for potential candidate genes / genetic polymorphisms relating to cancer cachexia. All candidate genes were reviewed for functional polymorphisms or clinically significant polymorphisms associated with cachexia using the OMIM and GeneRIF databases. Pathway analysis software was used to reveal possible network associations between genes. Functionality of SNPs/genes was explored based on published literature, algorithms for detecting putative deleterious SNPs and interrogating the database for expression of quantitative trait loci (eQTLs). A total of 154 genes associated with cancer cachexia were identified and explored for functional polymorphisms. Of these 154 genes, 119 had a combined total of 281 polymorphisms with functional and/or clinical significance in terms of cachexia associated with them. Of these, 80 polymorphisms (in 51 genes) were replicated in more than one study with 24 polymorphisms found to influence two or more hallmarks of cachexia (i.e., inflammation, loss of fat mass and/or lean mass and reduced survival). Selection of candidate genes and polymorphisms is a key element of multigene study design. The present study provides a contemporary basis to select genes and/or polymorphisms for further association studies in cancer cachexia, and to develop their potential as susceptibility biomarkers of cachexia.

A fruit quality gene map of Prunus

PubMed Central

2009-01-01

Background Prunus fruit development, growth, ripening, and senescence includes major biochemical and sensory changes in texture, color, and flavor. The genetic dissection of these complex processes has important applications in crop improvement, to facilitate maximizing and maintaining stone fruit quality from production and processing through to marketing and consumption. Here we present an integrated fruit quality gene map of Prunus containing 133 genes putatively involved in the determination of fruit texture, pigmentation, flavor, and chilling injury resistance. Results A genetic linkage map of 211 markers was constructed for an intraspecific peach (Prunus persica) progeny population, Pop-DG, derived from a canning peach cultivar 'Dr. Davis' and a fresh market cultivar 'Georgia Belle'. The Pop-DG map covered 818 cM of the peach genome and included three morphological markers, 11 ripening candidate genes, 13 cold-responsive genes, 21 novel EST-SSRs from the ChillPeach database, 58 previously reported SSRs, 40 RAFs, 23 SRAPs, 14 IMAs, and 28 accessory markers from candidate gene amplification. The Pop-DG map was co-linear with the Prunus reference T × E map, with 39 SSR markers in common to align the maps. A further 158 markers were bin-mapped to the reference map: 59 ripening candidate genes, 50 cold-responsive genes, and 50 novel EST-SSRs from ChillPeach, with deduced locations in Pop-DG via comparative mapping. Several candidate genes and EST-SSRs co-located with previously reported major trait loci and quantitative trait loci for chilling injury symptoms in Pop-DG. Conclusion The candidate gene approach combined with bin-mapping and availability of a community-recognized reference genetic map provides an efficient means of locating genes of interest in a target genome. We highlight the co-localization of fruit quality candidate genes with previously reported fruit quality QTLs. The fruit quality gene map developed here is a valuable tool for dissecting the genetic architecture of fruit quality traits in Prunus crops. PMID:19995417

Identification of FGF7 as a novel susceptibility locus for chronic obstructive pulmonary disease.

PubMed

Brehm, John M; Hagiwara, Koichi; Tesfaigzi, Yohannes; Bruse, Shannon; Mariani, Thomas J; Bhattacharya, Soumyaroop; Boutaoui, Nadia; Ziniti, John P; Soto-Quiros, Manuel E; Avila, Lydiana; Cho, Michael H; Himes, Blanca; Litonjua, Augusto A; Jacobson, Francine; Bakke, Per; Gulsvik, Amund; Anderson, Wayne H; Lomas, David A; Forno, Erick; Datta, Soma; Silverman, Edwin K; Celedón, Juan C

2011-12-01

Traditional genome-wide association studies (GWASs) of large cohorts of subjects with chronic obstructive pulmonary disease (COPD) have successfully identified novel candidate genes, but several other plausible loci do not meet strict criteria for genome-wide significance after correction for multiple testing. The authors hypothesise that by applying unbiased weights derived from unique populations we can identify additional COPD susceptibility loci. Methods The authors performed a homozygosity haplotype analysis on a group of subjects with and without COPD to identify regions of conserved homozygosity haplotype (RCHHs). Weights were constructed based on the frequency of these RCHHs in case versus controls, and used to adjust the p values from a large collaborative GWAS of COPD. The authors identified 2318 RCHHs, of which 576 were significantly (p<0.05) over-represented in cases. After applying the weights constructed from these regions to a collaborative GWAS of COPD, the authors identified two single nucleotide polymorphisms (SNPs) in a novel gene (fibroblast growth factor-7 (FGF7)) that gained genome-wide significance by the false discovery rate method. In a follow-up analysis, both SNPs (rs12591300 and rs4480740) were significantly associated with COPD in an independent population (combined p values of 7.9E-7 and 2.8E-6, respectively). In another independent population, increased lung tissue FGF7 expression was associated with worse measures of lung function. Weights constructed from a homozygosity haplotype analysis of an isolated population successfully identify novel genetic associations from a GWAS on a separate population. This method can be used to identify promising candidate genes that fail to meet strict correction for multiple testing.

Genetic Dissection of Maize Embryonic Callus Regenerative Capacity Using Multi-Locus Genome-Wide Association Studies

PubMed Central

Ma, Langlang; Liu, Min; Yan, Yuanyuan; Qing, Chunyan; Zhang, Xiaoling; Zhang, Yanling; Long, Yun; Wang, Lei; Pan, Lang; Zou, Chaoying; Li, Zhaoling; Wang, Yanli; Peng, Huanwei; Pan, Guangtang; Jiang, Zhou; Shen, Yaou

2018-01-01

The regenerative capacity of the embryonic callus, a complex quantitative trait, is one of the main limiting factors for maize transformation. This trait was decomposed into five traits, namely, green callus rate (GCR), callus differentiating rate (CDR), callus plantlet number (CPN), callus rooting rate (CRR), and callus browning rate (CBR). To dissect the genetic foundation of maize transformation, in this study multi-locus genome-wide association studies (GWAS) for the five traits were performed in a population of 144 inbred lines genotyped with 43,427 SNPs. Using the phenotypic values in three environments and best linear unbiased prediction (BLUP) values, as a result, a total of 127, 56, 160, and 130 significant quantitative trait nucleotides (QTNs) were identified by mrMLM, FASTmrEMMA, ISIS EM-BLASSO, and pLARmEB, respectively. Of these QTNs, 63 QTNs were commonly detected, including 15 across multiple environments and 58 across multiple methods. Allele distribution analysis showed that the proportion of superior alleles for 36 QTNs was <50% in 31 elite inbred lines. Meanwhile, these superior alleles had obviously additive effect on the regenerative capacity. This indicates that the regenerative capacity-related traits can be improved by proper integration of the superior alleles using marker-assisted selection. Moreover, a total of 40 candidate genes were found based on these common QTNs. Some annotated genes were previously reported to relate with auxin transport, cell fate, seed germination, or embryo development, especially, GRMZM2G108933 (WOX2) was found to promote maize transgenic embryonic callus regeneration. These identified candidate genes will contribute to a further understanding of the genetic foundation of maize embryonic callus regeneration. PMID:29755499

Candidate Gene Identification of Feed Efficiency and Coat Color Traits in a C57BL/6J × Kunming F2 Mice Population Using Genome-Wide Association Study.

PubMed

Miao, Yuanxin; Soudy, Fathia; Xu, Zhong; Liao, Mingxing; Zhao, Shuhong; Li, Xinyun

2017-01-01

Feed efficiency (FE) is a very important trait in livestock industry. Identification of the candidate genes could be of benefit for the improvement of FE trait. Mouse is used as the model for many studies in mammals. In this study, the candidate genes related to FE and coat color were identified using C57BL/6J (C57) × Kunming (KM) F2 mouse population. GWAS results showed that 61 and 2 SNPs were genome-wise suggestive significantly associated with feed conversion ratio (FCR) and feed intake (FI) traits, respectively. Moreover, the Erbin, Msrb2, Ptf1a, and Fgf10 were considered as the candidate genes of FE. The Lpl was considered as the candidate gene of FI. Further, the coat color trait was studied. KM mice are white and C57 ones are black. The GWAS results showed that the most significant SNP was located at chromosome 7, and the closely linked gene was Tyr. Therefore, our study offered useful target genes related to FE in mice; these genes may play similar roles in FE of livestock. Also, we identified the major gene of coat color in mice, which would be useful for better understanding of natural mutation of the coat color in mice.

GENIE: a software package for gene-gene interaction analysis in genetic association studies using multiple GPU or CPU cores.

PubMed

Chikkagoudar, Satish; Wang, Kai; Li, Mingyao

2011-05-26

Gene-gene interaction in genetic association studies is computationally intensive when a large number of SNPs are involved. Most of the latest Central Processing Units (CPUs) have multiple cores, whereas Graphics Processing Units (GPUs) also have hundreds of cores and have been recently used to implement faster scientific software. However, currently there are no genetic analysis software packages that allow users to fully utilize the computing power of these multi-core devices for genetic interaction analysis for binary traits. Here we present a novel software package GENIE, which utilizes the power of multiple GPU or CPU processor cores to parallelize the interaction analysis. GENIE reads an entire genetic association study dataset into memory and partitions the dataset into fragments with non-overlapping sets of SNPs. For each fragment, GENIE analyzes: 1) the interaction of SNPs within it in parallel, and 2) the interaction between the SNPs of the current fragment and other fragments in parallel. We tested GENIE on a large-scale candidate gene study on high-density lipoprotein cholesterol. Using an NVIDIA Tesla C1060 graphics card, the GPU mode of GENIE achieves a speedup of 27 times over its single-core CPU mode run. GENIE is open-source, economical, user-friendly, and scalable. Since the computing power and memory capacity of graphics cards are increasing rapidly while their cost is going down, we anticipate that GENIE will achieve greater speedups with faster GPU cards. Documentation, source code, and precompiled binaries can be downloaded from http://www.cceb.upenn.edu/~mli/software/GENIE/.

GENIE: a software package for gene-gene interaction analysis in genetic association studies using multiple GPU or CPU cores

PubMed Central

2011-01-01

Background Gene-gene interaction in genetic association studies is computationally intensive when a large number of SNPs are involved. Most of the latest Central Processing Units (CPUs) have multiple cores, whereas Graphics Processing Units (GPUs) also have hundreds of cores and have been recently used to implement faster scientific software. However, currently there are no genetic analysis software packages that allow users to fully utilize the computing power of these multi-core devices for genetic interaction analysis for binary traits. Findings Here we present a novel software package GENIE, which utilizes the power of multiple GPU or CPU processor cores to parallelize the interaction analysis. GENIE reads an entire genetic association study dataset into memory and partitions the dataset into fragments with non-overlapping sets of SNPs. For each fragment, GENIE analyzes: 1) the interaction of SNPs within it in parallel, and 2) the interaction between the SNPs of the current fragment and other fragments in parallel. We tested GENIE on a large-scale candidate gene study on high-density lipoprotein cholesterol. Using an NVIDIA Tesla C1060 graphics card, the GPU mode of GENIE achieves a speedup of 27 times over its single-core CPU mode run. Conclusions GENIE is open-source, economical, user-friendly, and scalable. Since the computing power and memory capacity of graphics cards are increasing rapidly while their cost is going down, we anticipate that GENIE will achieve greater speedups with faster GPU cards. Documentation, source code, and precompiled binaries can be downloaded from http://www.cceb.upenn.edu/~mli/software/GENIE/. PMID:21615923

MIDAS: Mining differentially activated subpaths of KEGG pathways from multi-class RNA-seq data.

PubMed

Lee, Sangseon; Park, Youngjune; Kim, Sun

2017-07-15

Pathway based analysis of high throughput transcriptome data is a widely used approach to investigate biological mechanisms. Since a pathway consists of multiple functions, the recent approach is to determine condition specific sub-pathways or subpaths. However, there are several challenges. First, few existing methods utilize explicit gene expression information from RNA-seq. More importantly, subpath activity is usually an average of statistical scores, e.g., correlations, of edges in a candidate subpath, which fails to reflect gene expression quantity information. In addition, none of existing methods can handle multiple phenotypes. To address these technical problems, we designed and implemented an algorithm, MIDAS, that determines condition specific subpaths, each of which has different activities across multiple phenotypes. MIDAS utilizes gene expression quantity information fully and the network centrality information to determine condition specific subpaths. To test performance of our tool, we used TCGA breast cancer RNA-seq gene expression profiles with five molecular subtypes. 36 differentially activate subpaths were determined. The utility of our method, MIDAS, was demonstrated in four ways. All 36 subpaths are well supported by the literature information. Subsequently, we showed that these subpaths had a good discriminant power for five cancer subtype classification and also had a prognostic power in terms of survival analysis. Finally, in a performance comparison of MIDAS to a recent subpath prediction method, PATHOME, our method identified more subpaths and much more genes that are well supported by the literature information. http://biohealth.snu.ac.kr/software/MIDAS/. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Linkage analysis of candidate genes in autoimmune thyroid disease. II. Selected gender-related genes and the X-chromosome. International Consortium for the Genetics of Autoimmune Thyroid Disease.

PubMed

Barbesino, G; Tomer, Y; Concepcion, E S; Davies, T F; Greenberg, D A

1998-09-01

Hashimoto's thyroiditis (HT) and Graves' disease (GD) are autoimmune thyroid diseases (AITD) in which multiple genetic factors are suspected to play an important role. Until now, only a few minor risk factors for these diseases have been identified. Susceptibility seems to be stronger in women, pointing toward a possible role for genes related to sex steroid action or mechanisms related to genes on the X-chromosome. We have studied a total of 45 multiplex families, each containing at least 2 members affected with either GD (55 patients) or HT (72 patients), and used linkage analysis to target as candidate susceptibility loci genes involved in estrogen activity, such as the estrogen receptor alpha and beta and the aromatase genes. We then screened the entire X-chromosome using a set of polymorphic microsatellite markers spanning the whole chromosome. We found a region of the X-chromosome (Xq21.33-22) giving positive logarithm of odds (LOD) scores and then reanalyzed this area with dense markers in a multipoint analysis. Our results excluded linkage to the estrogen receptor alpha and aromatase genes when either the patients with GD only, those with HT only, or those with any AITD were considered as affected. Linkage to the estrogen receptor beta could not be totally ruled out, partly due to incomplete mapping information for the gene itself at this time. The X-chromosome data revealed consistently positive LOD scores (maximum of 1.88 for marker DXS8020 and GD patients) when either definition of affectedness was considered. Analysis of the family data using a multipoint analysis with eight closely linked markers generated LOD scores suggestive of linkage to GD in a chromosomal area (Xq21.33-22) extending for about 6 cM and encompassing four markers. The maximum LOD score (2.5) occurred at DXS8020. In conclusion, we ruled out a major role for estrogen receptor alpha and the aromatase genes in the genetic predisposition to AITD. Estrogen receptor beta remains a candidate locus. We found a locus on Xq21.33-22 linked to GD that may help to explain the female predisposition to GD. Confirmation of these data in HT may require study of an extended number of families because of possible heterogeneity.

Identification and association analysis of several hundred single nucleotide polymorphisms within candidate genes for back fat thickness in Italian Large White pigs using a selective genotyping approach.

PubMed

Fontanesi, L; Galimberti, G; Calò, D G; Fronza, R; Martelli, P L; Scotti, E; Colombo, M; Schiavo, G; Casadio, R; Buttazzoni, L; Russo, V

2012-08-01

Combining different approaches (resequencing of portions of 54 obesity candidate genes, literature mining for pig markers associated with fat deposition or related traits in 77 genes, and in silico mining of porcine expressed sequence tags and other sequences available in databases), we identified and analyzed 736 SNP within candidate genes to identify markers associated with back fat thickness (BFT) in Italian Large White sows. Animals were chosen using a selective genotyping approach according to their EBV for BFT (276 with most negative and 279 with most positive EBV) within a population of ≈ 12,000 pigs. Association analysis between the SNP and BFT has been carried out using the MAX test proposed for case-control studies. The designed assays were successful for 656 SNP: 370 were excluded (low call rate or minor allele frequency <5%), whereas the remaining 286 in 212 genes were taken for subsequent analyses, among which 64 showed a P(nominal) value <0.1. To deal with the multiple testing problem in a candidate gene approach, we applied the proportion of false positives (PFP) method. Thirty-eight SNP were significant (P(PFP) < 0.20). The most significant SNP was the IGF2 intron3-g.3072G>A polymorphism (P(nominal) < 1.0E-50). The second most significant SNP was the MC4R c.1426A>G polymorphism (P(nominal) = 8.0E-05). The third top SNP (P(nominal) = 6.2E-04) was the intronic TBC1D1 g.219G>A polymorphic site, in agreement with our previous results obtained in an independent study. The list of significant markers also included SNP in additional genes (ABHD16A, ABHD5, ACP2, ALMS1, APOA2, ATP1A2, CALR, COL14A1, CTSF, DARS, DECR1, ENPP1, ESR1, GH1, GHRL, GNMT, IKBKB, JAK3, MTTP, NFKBIA, NT5E, PLAT, PPARG, PPP2R5D, PRLR, RRAGD, RFC2, SDHD, SERPINF1, UBE2H, VCAM1, and WAT). Functional relationships between genes were obtained using the Ingenuity Pathway Analysis (IPA) Knowledge Base. The top scoring pathway included 19 genes with a P(nominal) < 0.1, 2 of which (IKBKB and NFKBIA) are involved in the hypothalamic IKKβ/NFκB program that could represent a key axis to affect fat deposition traits in pigs. These results represent a starting point to plan marker-assisted selection in Italian Large White nuclei for BFT. Because of similarities between humans and pigs, this study might also provide useful clues to investigate genetic factors affecting human obesity.

Direct interplay between two candidate genes in FSHD muscular dystrophy

PubMed Central

Ferri, Giulia; Huichalaf, Claudia H.; Caccia, Roberta; Gabellini, Davide

2015-01-01

Facioscapulohumeral muscular dystrophy (FSHD) is one of the most common neuromuscular disorders. The major form of the disease (FSHD1) is linked to decrease in copy number of a 3.3-kb tandem repeated macrosatellite (D4Z4), located on chromosome 4q35. D4Z4 deletion alters chromatin structure of the locus leading to aberrant expression of nearby 4q35 genes. Given the high variability in disease onset and progression, multiple factors could contribute to the pathogenesis of FSHD. Among the FSHD candidate genes are double homeobox 4 (DUX4), encoded by the most telomeric D4Z4 unit, and FSHD region gene 1 (FRG1). DUX4 is a sequence-specific transcription factor. Here, we located putative DUX4 binding sites in the human FRG1 genomic area and we show specific DUX4 association to these regions. We found also that ectopically expressed DUX4 up-regulates the endogenous human FRG1 gene in healthy muscle cells, while DUX4 knockdown leads to a decrease in FRG1 expression in FSHD muscle cells. Moreover, DUX4 binds directly and specifically to its binding site located in the human FRG1 gene and transactivates constructs containing FRG1 genomic regions. Intriguingly, the mouse Frg1 genomic area lacks DUX4 binding sites and DUX4 is unable to activate the endogenous mouse Frg1 gene providing a possible explanation for the lack of muscle phenotype in DUX4 transgenic mice. Altogether, our results demonstrate that FRG1 is a direct DUX4 transcriptional target uncovering a novel regulatory circuit contributing to FSHD. PMID:25326393

In silico identification of miRNAs and their target genes and analysis of gene co-expression network in saffron (Crocus sativus L.) stigma

PubMed Central

Zinati, Zahra; Shamloo-Dashtpagerdi, Roohollah; Behpouri, Ali

2016-01-01

As an aromatic and colorful plant of substantive taste, saffron (Crocus sativus L.) owes such properties of matter to growing class of the secondary metabolites derived from the carotenoids, apocarotenoids. Regarding the critical role of microRNAs in secondary metabolic synthesis and the limited number of identified miRNAs in C. sativus, on the other hand, one may see the point how the characterization of miRNAs along with the corresponding target genes in C. sativus might expand our perspectives on the roles of miRNAs in carotenoid/apocarotenoid biosynthetic pathway. A computational analysis was used to identify miRNAs and their targets using EST (Expressed Sequence Tag) library from mature saffron stigmas. Then, a gene co- expression network was constructed to identify genes which are potentially involved in carotenoid/apocarotenoid biosynthetic pathways. EST analysis led to the identification of two putative miRNAs (miR414 and miR837-5p) along with the corresponding stem- looped precursors. To our knowledge, this is the first report on miR414 and miR837-5p in C. sativus. Co-expression network analysis indicated that miR414 and miR837-5p may play roles in C. sativus metabolic pathways and led to identification of candidate genes including six transcription factors and one protein kinase probably involved in carotenoid/apocarotenoid biosynthetic pathway. Presence of transcription factors, miRNAs and protein kinase in the network indicated multiple layers of regulation in saffron stigma. The candidate genes from this study may help unraveling regulatory networks underlying the carotenoid/apocarotenoid biosynthesis in saffron and designing metabolic engineering for enhanced secondary metabolites. PMID:28261627

A Genome-Wide Association Study Identifies Multiple Regions Associated with Head Size in Catfish

PubMed Central

Geng, Xin; Liu, Shikai; Yao, Jun; Bao, Lisui; Zhang, Jiaren; Li, Chao; Wang, Ruijia; Sha, Jin; Zeng, Peng; Zhi, Degui; Liu, Zhanjiang

2016-01-01

Skull morphology is fundamental to evolution and the biological adaptation of species to their environments. With aquaculture fish species, head size is also important for economic reasons because it has a direct impact on fillet yield. However, little is known about the underlying genetic basis of head size. Catfish is the primary aquaculture species in the United States. In this study, we performed a genome-wide association study using the catfish 250K SNP array with backcross hybrid catfish to map the QTL for head size (head length, head width, and head depth). One significantly associated region on linkage group (LG) 7 was identified for head length. In addition, LGs 7, 9, and 16 contain suggestively associated regions for head length. For head width, significantly associated regions were found on LG9, and additional suggestively associated regions were identified on LGs 5 and 7. No region was found associated with head depth. Head size genetic loci were mapped in catfish to genomic regions with candidate genes involved in bone development. Comparative analysis indicated that homologs of several candidate genes are also involved in skull morphology in various other species ranging from amphibian to mammalian species, suggesting possible evolutionary conservation of those genes in the control of skull morphologies. PMID:27558670

Extra Large G-Protein Interactome Reveals Multiple Stress Response Function and Partner-Dependent XLG Subcellular Localization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang, Ying; Gao, Yajun; Jones, Alan M.

The three-member family of Arabidopsis extra-large G proteins (XLG1-3) defines the prototype of an atypical Ga subunit in the heterotrimeric G protein complex. Some recent evidence indicate that XLG subunits operate along with its Gbg dimer in root morphology, stress responsiveness, and cytokinin induced development, however downstream targets of activated XLG proteins in the stress pathways are rarely known. In order to assemble a set of candidate XLG-targeted proteins, a yeast two-hybrid complementation-based screen was performed using XLG protein baits to query interactions between XLG and partner protein found in glucose-treated seedlings, roots, and Arabidopsis cells in culture. Seventy twomore » interactors were identified and >60% of a test set displayed in vivo interaction with XLG proteins. Gene co-expression analysis shows that >70% of the interactors are positively correlated with the corresponding XLG partners. Gene Ontology enrichment for all the candidates indicates stress responses and posits a molecular mechanism involving a specific set of transcription factor partners to XLG. Genes encoding two of these transcription factors, SZF1 and 2, require XLG proteins for full NaCl-induced expression. Furthermore, the subcellular localization of the XLG proteins in the nucleus, endosome, and plasma membrane is dependent on the specific interacting partner.« less

Extra Large G-Protein Interactome Reveals Multiple Stress Response Function and Partner-Dependent XLG Subcellular Localization

DOE PAGES

Liang, Ying; Gao, Yajun; Jones, Alan M.

2017-06-13

The three-member family of Arabidopsis extra-large G proteins (XLG1-3) defines the prototype of an atypical Ga subunit in the heterotrimeric G protein complex. Some recent evidence indicate that XLG subunits operate along with its Gbg dimer in root morphology, stress responsiveness, and cytokinin induced development, however downstream targets of activated XLG proteins in the stress pathways are rarely known. In order to assemble a set of candidate XLG-targeted proteins, a yeast two-hybrid complementation-based screen was performed using XLG protein baits to query interactions between XLG and partner protein found in glucose-treated seedlings, roots, and Arabidopsis cells in culture. Seventy twomore » interactors were identified and >60% of a test set displayed in vivo interaction with XLG proteins. Gene co-expression analysis shows that >70% of the interactors are positively correlated with the corresponding XLG partners. Gene Ontology enrichment for all the candidates indicates stress responses and posits a molecular mechanism involving a specific set of transcription factor partners to XLG. Genes encoding two of these transcription factors, SZF1 and 2, require XLG proteins for full NaCl-induced expression. Furthermore, the subcellular localization of the XLG proteins in the nucleus, endosome, and plasma membrane is dependent on the specific interacting partner.« less

Fruit specific variability in capsaicinoid accumulation and transcription of structural and regulatory genes in Capsicum fruit.

PubMed

Keyhaninejad, Neda; Curry, Jeanne; Romero, Joslynn; O'Connell, Mary A

2014-02-01

Accumulation of capsaicinoids in the placental tissue of ripening chile (Capsicum spp.) fruit follows the coordinated expression of multiple biosynthetic enzymes producing the substrates for capsaicin synthase. Transcription factors are likely agents to regulate expression of these biosynthetic genes. Placental RNAs from habanero fruit (Capsicum chinense) were screened for expression of candidate transcription factors; with two candidate genes identified, both in the ERF family of transcription factors. Characterization of these transcription factors, Erf and Jerf, in nine chile cultivars with distinct capsaicinoid contents demonstrated a correlation of expression with pungency. Amino acid variants were observed in both ERF and JERF from different chile cultivars; none of these changes involved the DNA binding domains. Little to no transcription of Erf was detected in non-pungent Capsium annuum or C. chinense mutants. This correlation was characterized at an individual fruit level in a set of jalapeño (C. annuum) lines again with distinct and variable capsaicinoid contents. Both Erf and Jerf are expressed early in fruit development, 16-20 days post-anthesis, at times prior to the accumulation of capsaicinoids in the placental tissues. These data support the hypothesis that these two members of the complex ERF family participate in regulation of the pungency phenotype in chile. Copyright © 2013. Published by Elsevier Ireland Ltd.

Fruit specific variability in capsaicinoid accumulation and transcription of structural and regulatory genes in Capsicum fruit

PubMed Central

Keyhaninejad, Neda; Curry, Jeanne; Romero, Joslynn; O’Connell, Mary A.

2013-01-01

Accumulation of capsaicinoids in the placental tissue of ripening chile (Capsicum spp.) fruit follows the coordinated expression of multiple biosynthetic enzymes producing the substrates for capsaicin synthase. Transcription factors are likely agents to regulate expression of these biosynthetic genes. Placental RNAs from habanero fruit (C. chinense) were screened for expression of candidate transcription factors; with two candidate genes identified, both in the ERF family of transcription factors. Characterization of these transcription factors, Erf and Jerf, in nine chile cultivars with distinct capsaicinoid contents demonstrated a correlation of expression with pungency. Amino acid variants were observed in both ERF and JERF from different chile cultivars; none of these changes involved the DNA binding domains. Little to no transcription of Erf was detected in non-pungent C. annuum or C. chinense mutants. This correlation was characterized at an individual fruit level in a set of jalapeño (C. annuum) lines again with distinct and variable capsaicinoid contents. Both Erf and Jerf are expressed early in fruit development, 16–20 days post-anthesis, at times prior to the accumulation of capsaicinoids in the placental tissues. These data support the hypothesis that these two members of the complex ERF family participate in regulation of the pungency phenotype in chile. PMID:24388515

Chum salmon egg extracts induce upregulation of collagen type I and exert antioxidative effects on human dermal fibroblast cultures

PubMed Central

Yoshino, Atsushi; Polouliakh, Natalia; Meguro, Akira; Takeuchi, Masaki; Kawagoe, Tatsukata; Mizuki, Nobuhisa

2016-01-01

Components of fish roe possess antioxidant and antiaging activities, making them potentially very beneficial natural resources. Here, we investigated chum salmon eggs (CSEs) as a source of active ingredients, including vitamins, unsaturated fatty acids, and proteins. We incubated human dermal fibroblast cultures for 48 hours with high and low concentrations of CSE extracts and analyzed changes in gene expression. Cells treated with CSE extract showed concentration-dependent upregulation of collagen type I genes and of multiple antioxidative genes, including OXR1, TXNRD1, and PRDX family genes. We further conducted in silico phylogenetic footprinting analysis of promoter regions. These results suggested that transcription factors such as acute myeloid leukemia-1a and cyclic adenosine monophosphate response element-binding protein may be involved in the observed upregulation of antioxidative genes. Our results support the idea that CSEs are strong candidate sources of antioxidant materials and cosmeceutically effective ingredients. PMID:27621603

Genome-wide characterization of the WRKY gene family in radish (Raphanus sativus L.) reveals its critical functions under different abiotic stresses.

PubMed

Karanja, Bernard Kinuthia; Fan, Lianxue; Xu, Liang; Wang, Yan; Zhu, Xianwen; Tang, Mingjia; Wang, Ronghua; Zhang, Fei; Muleke, Everlyne M'mbone; Liu, Liwang

2017-11-01

The radish WRKY gene family was genome-widely identified and played critical roles in response to multiple abiotic stresses. The WRKY is among the largest transcription factors (TFs) associated with multiple biological activities for plant survival, including control response mechanisms against abiotic stresses such as heat, salinity, and heavy metals. Radish is an important root vegetable crop and therefore characterization and expression pattern investigation of WRKY transcription factors in radish is imperative. In the present study, 126 putative WRKY genes were retrieved from radish genome database. Protein sequence and annotation scrutiny confirmed that RsWRKY proteins possessed highly conserved domains and zinc finger motif. Based on phylogenetic analysis results, RsWRKYs candidate genes were divided into three groups (Group I, II and III) with the number 31, 74, and 20, respectively. Additionally, gene structure analysis revealed that intron-exon patterns of the WRKY genes are highly conserved in radish. Linkage map analysis indicated that RsWRKY genes were distributed with varying densities over nine linkage groups. Further, RT-qPCR analysis illustrated the significant variation of 36 RsWRKY genes under one or more abiotic stress treatments, implicating that they might be stress-responsive genes. In total, 126 WRKY TFs were identified from the R. sativus genome wherein, 35 of them showed abiotic stress-induced expression patterns. These results provide a genome-wide characterization of RsWRKY TFs and baseline for further functional dissection and molecular evolution investigation, specifically for improving abiotic stress resistances with an ultimate goal of increasing yield and quality of radish.

Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery.

PubMed

Kneidinger, Doris; Ibrišimović, Mirza; Lion, Thomas; Klein, Reinhard

2012-06-01

Human adenoviruses are a common threat to immunocompromised patients, e.g., HIV-positive individuals or solid-organ and, in particular, allogeneic stem cell transplant recipients. Antiviral drugs have a limited effect on adenoviruses, and existing treatment modalities often fail to prevent fatal outcome. Silencing of viral genes by short interfering RNAs (siRNAs) holds a great promise in the treatment of viral infections. The aim of the present study was to identify adenoviral candidate targets for RNA interference-mediated inhibition of adenoviral replication. We investigated the impact of silencing of a set of early, middle, and late viral genes on the replication of adenovirus 5 in vitro. Adenovirus replication was inhibited by siRNAs directed against the adenoviral E1A, DNA polymerase, preterminal protein (pTP), IVa2, hexon, and protease genes. Silencing of early and middle genes was more effective in inhibiting adenovirus multiplication than was silencing of late genes. A siRNA directed against the viral DNA polymerase mRNA decreased viral genome copy numbers and infectious virus progeny by several orders of magnitude. Since silencing of any of the early genes directly or indirectly affected viral DNA synthesis, our data suggest that reducing viral genome copy numbers is a more promising strategy for the treatment of adenoviral infections than is reducing the numbers of proteins necessary for capsid generation. Thus, adenoviral DNA replication was identified as a key target for RNAi-mediated inhibition of adenovirus multiplication. In addition, the E1A transcripts emerged as a second important target, because its knockdown markedly improved the viability of cells at late stages of infection. Copyright © 2012 Elsevier B.V. All rights reserved.

Defining the role of the MADS-box gene, Zea agamous like1, in maize domestication

USDA-ARS?s Scientific Manuscript database

Genomic scans for genes that show the signature of past selection have been widely applied to a number of species and have identified a large number of selection candidate genes. In cultivated maize (Zea mays ssp. mays) selection scans have identified several hundred candidate domestication genes...

Allele Mining in Barley Genetic Resources Reveals Genes of Race-Non-Specific Powdery Mildew Resistance

PubMed Central

Spies, Annika; Korzun, Viktor; Bayles, Rosemary; Rajaraman, Jeyaraman; Himmelbach, Axel; Hedley, Pete E.; Schweizer, Patrick

2012-01-01

Race-non-specific, or quantitative, pathogen resistance is of high importance to plant breeders due to its expected durability. However, it is usually controlled by multiple quantitative trait loci (QTL) and therefore difficult to handle in practice. Knowing the genes that underlie race-non-specific resistance (NR) would allow its exploitation in a more targeted manner. Here, we performed an association-genetic study in a customized worldwide collection of spring barley accessions for candidate genes of race-NR to the powdery mildew fungus Blumeria graminis f. sp. hordei (Bgh) and combined data with results from QTL mapping as well as functional-genomics approaches. This led to the identification of 11 associated genes with converging evidence for an important role in race-NR in the presence of the Mlo gene for basal susceptibility. Outstanding in this respect was the gene encoding the transcription factor WRKY2. The results suggest that unlocking plant genetic resources and integrating functional-genomic with genetic approaches can accelerate the discovery of genes underlying race-NR in barley and other crop plants. PMID:22629270

An Integrated Cell Purification and Genomics Strategy Reveals Multiple Regulators of Pancreas Development

PubMed Central

Benitez, Cecil M.; Qu, Kun; Sugiyama, Takuya; Pauerstein, Philip T.; Liu, Yinghua; Tsai, Jennifer; Gu, Xueying; Ghodasara, Amar; Arda, H. Efsun; Zhang, Jiajing; Dekker, Joseph D.; Tucker, Haley O.; Chang, Howard Y.; Kim, Seung K.

2014-01-01

The regulatory logic underlying global transcriptional programs controlling development of visceral organs like the pancreas remains undiscovered. Here, we profiled gene expression in 12 purified populations of fetal and adult pancreatic epithelial cells representing crucial progenitor cell subsets, and their endocrine or exocrine progeny. Using probabilistic models to decode the general programs organizing gene expression, we identified co-expressed gene sets in cell subsets that revealed patterns and processes governing progenitor cell development, lineage specification, and endocrine cell maturation. Purification of Neurog3 mutant cells and module network analysis linked established regulators such as Neurog3 to unrecognized gene targets and roles in pancreas development. Iterative module network analysis nominated and prioritized transcriptional regulators, including diabetes risk genes. Functional validation of a subset of candidate regulators with corresponding mutant mice revealed that the transcription factors Etv1, Prdm16, Runx1t1 and Bcl11a are essential for pancreas development. Our integrated approach provides a unique framework for identifying regulatory genes and functional gene sets underlying pancreas development and associated diseases such as diabetes mellitus. PMID:25330008

Genetic and Proteomic Interrogation of Lower Confidence Candidate Genes Reveals Signaling Networks in beta-Catenin-Active Cancers | Office of Cancer Genomics

Cancer.gov

Genome-scale expression studies and comprehensive loss-of-function genetic screens have focused almost exclusively on the highest confidence candidate genes. Here, we describe a strategy for characterizing the lower confidence candidates identified by such approaches.

Linkage Disequilibrium Mapping in Domestic Dog Breeds Narrows the Progressive Rod-Cone Degeneration (prcd) Interval and Identifies Ancestral Disease Transmitting Chromosome

PubMed Central

Goldstein, Orly; Zangerl, Barbara; Pearce-Kelling, Sue; Sidjanin, Duska J.; Kijas, James W.; Felix, Jeanette; Acland, Gregory M; Aguirre, Gustavo D.

2014-01-01

Canine progressive rod-cone degeneration (prcd) is a retinal disease previously mapped to a broad, gene-rich centromeric region of canine chromosome 9. As allelic disorders are present in multiple breeds, we used linkage disequilibrium (LD) to narrow the ∼6.4 Mb interval candidate region. Multiple dog breeds, each representing genetically isolated populations, were typed for SNPs and other polymorphisms identified from BACs. The candidate region was initially localized to a 1.5 Mb zero recombination interval between growth factor receptor-bound protein 2 (GRB2) and SEC14-like 1 (SEC14L). A fine-scale haplotype of the region was developed which reduced the LD interval to 106 Kb, and identified a conserved haplotype of 98 polymorphisms present in all prcd-affected chromosomes from 14 different dog breeds. The findings strongly suggest that a common ancestor transmitted the prcd disease allele to many of the modern dog breeds, and demonstrate the power of LD approach in the canine model. PMID:16859891

A strabismus susceptibility locus on chromosome 7p

PubMed Central

Parikh, Vaishali; Shugart, Yin Yao; Doheny, Kimberly F.; Zhang, Jie; Li, Lan; Williams, John; Hayden, David; Craig, Brian; Capo, Hilda; Chamblee, Denise; Chen, Cathy; Collins, Mary; Dankner, Stuart; Fiergang, Dean; Guyton, David; Hunter, David; Hutcheon, Marcia; Keys, Marshall; Morrison, Nancy; Munoz, Michelle; Parks, Marshall; Plotsky, David; Protzko, Eugene; Repka, Michael X.; Sarubbi, Maria; Schnall, Bruce; Siatkowski, R. Michael; Traboulsi, Elias; Waeltermann, Joanne; Nathans, Jeremy

2003-01-01

Strabismus has been known to have a significant genetic component, but the mode of inheritance and the identity of the relevant genes have been enigmatic. This paper reports linkage analysis of nonsyndromic strabismus. The principal results of this study are: (i) the demonstrated feasibility of identifying and recruiting large families in which multiple members have (or had) strabismus; (ii) the linkage in one large family of a presumptive strabismus susceptibility locus to 7p22.1 with a multipoint logarithm of odds score of 4.51 under a model of recessive inheritance; and (iii) the failure to observe significant linkage to 7p in six other multiplex families, consistent with genetic heterogeneity among families. These findings suggest that it will be possible to localize and ultimately identify strabismus susceptibility genes by linkage analysis and mutation screening of candidate genes. PMID:14519848

Implementing targeted region capture sequencing for the clinical detection of Alagille syndrome: An efficient and cost‑effective method.

PubMed

Huang, Tianhong; Yang, Guilin; Dang, Xiao; Ao, Feijian; Li, Jiankang; He, Yizhou; Tang, Qiyuan; He, Qing

2017-11-01

Alagille syndrome (AGS) is a highly variable, autosomal dominant disease that affects multiple structures including the liver, heart, eyes, bones and face. Targeted region capture sequencing focuses on a panel of known pathogenic genes and provides a rapid, cost‑effective and accurate method for molecular diagnosis. In a Chinese family, this method was used on the proband and Sanger sequencing was applied to validate the candidate mutation. A de novo heterozygous mutation (c.3254_3255insT p.Leu1085PhefsX24) of the jagged 1 gene was identified as the potential disease‑causing gene mutation. In conclusion, the present study suggested that target region capture sequencing is an efficient, reliable and accurate approach for the clinical diagnosis of AGS. Furthermore, these results expand on the understanding of the pathogenesis of AGS.

A powerful approach reveals numerous expression quantitative trait haplotypes in multiple tissues.

PubMed

Ying, Dingge; Li, Mulin Jun; Sham, Pak Chung; Li, Miaoxin

2018-04-26

Recently many studies showed single nucleotide polymorphisms (SNPs) affect gene expression and contribute to development of complex traits/diseases in a tissue context-dependent manner. However, little is known about haplotype's influence on gene expression and complex traits, which reflects the interaction effect between SNPs. In the present study, we firstly proposed a regulatory region guided eQTL haplotype association analysis approach, and then systematically investigate the expression quantitative trait loci (eQTL) haplotypes in 20 different tissues by the approach. The approach has a powerful design of reducing computational burden by the utilization of regulatory predictions for candidate SNP selection and multiple testing corrections on non-independent haplotypes. The application results in multiple tissues showed that haplotype-based eQTLs not only increased the number of eQTL genes in a tissue specific manner, but were also enriched in loci that associated with complex traits in a tissue-matched manner. In addition, we found that tag SNPs of eQTL haplotypes from whole blood were selectively enriched in certain combination of regulatory elements (e.g. promoters and enhancers) according to predicted chromatin states. In summary, this eQTL haplotype detection approach, together with the application results, shed insights into synergistic effect of sequence variants on gene expression and their susceptibility to complex diseases. The executable application "eHaplo" is implemented in Java and is publicly available at http://grass.cgs.hku.hk/limx/ehaplo/. jonsonfox@gmail.com, limiaoxin@mail.sysu.edu.cn. Supplementary data are available at Bioinformatics online.

A candidate gene study in low HDL-cholesterol families provides evidence for the involvement of the APOA2 gene and the APOA1C3A4 gene cluster.

PubMed

Lilja, Heidi E; Soro, Aino; Ylitalo, Kati; Nuotio, Ilpo; Viikari, Jorma S A; Salomaa, Veikko; Vartiainen, Erkki; Taskinen, Marja-Riitta; Peltonen, Leena; Pajukanta, Päivi

2002-09-01

In patients with premature coronary heart disease, the most common lipoprotein abnormality is high-density lipoprotein (HDL) deficiency. To assess the genetic background of the low HDL-cholesterol trait, we performed a candidate gene study in 25 families with low HDL, collected from the genetically isolated population of Finland. We studied 21 genes encoding essential proteins involved in the HDL metabolism by genotyping intragenic and flanking markers for these genes. We found suggestive evidence for linkage in two candidate regions: Marker D1S2844, in the apolipoprotein A-II (APOA2) region, yielded a LOD score of 2.14 and marker D11S939 flanking the apolipoprotein A-I/C-III/A-IV gene cluster (APOA1C3A4) produced a LOD score of 1.69. Interestingly, we identified potential shared haplotypes in these two regions in a subset of low HDL families. These families also contributed to the obtained positive LOD scores, whereas the rest of the families produced negative LOD scores. None of the remaining candidate regions provided any evidence for linkage. Since only a limited number of loci were tested in this candidate gene study, these LOD scores suggest significant involvement of the APOA2 gene and the APOA1C3A4 gene cluster, or loci in their immediate vicinity, in the pathogenesis of low HDL.

Genetic risk prediction and neurobiological understanding of alcoholism.

PubMed

Levey, D F; Le-Niculescu, H; Frank, J; Ayalew, M; Jain, N; Kirlin, B; Learman, R; Winiger, E; Rodd, Z; Shekhar, A; Schork, N; Kiefer, F; Kiefe, F; Wodarz, N; Müller-Myhsok, B; Dahmen, N; Nöthen, M; Sherva, R; Farrer, L; Smith, A H; Kranzler, H R; Rietschel, M; Gelernter, J; Niculescu, A B

2014-05-20

We have used a translational Convergent Functional Genomics (CFG) approach to discover genes involved in alcoholism, by gene-level integration of genome-wide association study (GWAS) data from a German alcohol dependence cohort with other genetic and gene expression data, from human and animal model studies, similar to our previous work in bipolar disorder and schizophrenia. A panel of all the nominally significant P-value SNPs in the top candidate genes discovered by CFG  (n=135 genes, 713 SNPs) was used to generate a genetic  risk prediction score (GRPS), which showed a trend towards significance (P=0.053) in separating  alcohol dependent individuals from controls in an independent German test cohort. We then validated and prioritized our top findings from this discovery work, and subsequently tested them in three independent cohorts, from two continents. A panel of all the nominally significant P-value single-nucleotide length polymorphisms (SNPs) in the top candidate genes discovered by CFG (n=135 genes, 713 SNPs) were used to generate a Genetic Risk Prediction Score (GRPS), which showed a trend towards significance (P=0.053) in separating alcohol-dependent individuals from controls in an independent German test cohort. In order to validate and prioritize the key genes that drive behavior without some of the pleiotropic environmental confounds present in humans, we used a stress-reactive animal model of alcoholism developed by our group, the D-box binding protein (DBP) knockout mouse, consistent with the surfeit of stress theory of addiction proposed by Koob and colleagues. A much smaller panel (n=11 genes, 66 SNPs) of the top CFG-discovered genes for alcoholism, cross-validated and prioritized by this stress-reactive animal model showed better predictive ability in the independent German test cohort (P=0.041). The top CFG scoring gene for alcoholism from the initial discovery step, synuclein alpha (SNCA) remained the top gene after the stress-reactive animal model cross-validation. We also tested this small panel of genes in two other independent test cohorts from the United States, one with alcohol dependence (P=0.00012) and one with alcohol abuse (a less severe form of alcoholism; P=0.0094). SNCA by itself was able to separate alcoholics from controls in the alcohol-dependent cohort (P=0.000013) and the alcohol abuse cohort (P=0.023). So did eight other genes from the panel of 11 genes taken individually, albeit to a lesser extent and/or less broadly across cohorts. SNCA, GRM3 and MBP survived strict Bonferroni correction for multiple comparisons. Taken together, these results suggest that our stress-reactive DBP animal model helped to validate and prioritize from the CFG-discovered genes some of the key behaviorally relevant genes for alcoholism. These genes fall into a series of biological pathways involved in signal transduction, transmission of nerve impulse (including myelination) and cocaine addiction. Overall, our work provides leads towards a better understanding of illness, diagnostics and therapeutics, including treatment with omega-3 fatty acids. We also examined the overlap between the top candidate genes for alcoholism from this work and the top candidate genes for bipolar disorder, schizophrenia, anxiety from previous CFG analyses conducted by us, as well as cross-tested genetic risk predictions. This revealed the significant genetic overlap with other major psychiatric disorder domains, providing a basis for comorbidity and dual diagnosis, and placing alcohol use in the broader context of modulating the mental landscape.

Interaction between polymorphisms in aspirin metabolic pathways, regular aspirin use and colorectal cancer risk: A case-control study in unselected white European populations.

PubMed

Sheth, Harsh; Northwood, Emma; Ulrich, Cornelia M; Scherer, Dominique; Elliott, Faye; Barrett, Jennifer H; Forman, David; Wolf, C Roland; Smith, Gillian; Jackson, Michael S; Santibanez-Koref, Mauro; Haile, Robert; Casey, Graham; Jenkins, Mark; Win, Aung Ko; Hopper, John L; Marchand, Loic Le; Lindor, Noralane M; Thibodeau, Stephen N; Potter, John D; Burn, John; Bishop, D Timothy

2018-01-01

Regular aspirin use is associated with reduced risk of colorectal cancer (CRC). Variation in aspirin's chemoprevention efficacy has been attributed to the presence of single nucleotide polymorphisms (SNPs). We conducted a meta-analysis using two large population-based case-control datasets, the UK-Leeds Colorectal Cancer Study Group and the NIH-Colon Cancer Family Registry, having a combined total of 3325 cases and 2262 controls. The aim was to assess 42 candidate SNPs in 15 genes whose association with colorectal cancer risk was putatively modified by aspirin use, in the literature. Log odds ratios (ORs) and standard errors were estimated for each dataset separately using logistic regression adjusting for age, sex and study site, and dataset-specific results were combined using random effects meta-analysis. Meta-analysis showed association between SNPs rs6983267, rs11694911 and rs2302615 with CRC risk reduction (All P<0.05). Association for SNP rs6983267 in the CCAT2 gene only was noteworthy after multiple test correction (P = 0.001). Site-specific analysis showed association between SNPs rs1799853 and rs2302615 with reduced colon cancer risk only (P = 0.01 and P = 0.004, respectively), however neither reached significance threshold following multiple test correction. Meta-analysis of SNPs rs2070959 and rs1105879 in UGT1A6 gene showed interaction between aspirin use and CRC risk (Pinteraction = 0.01 and 0.02, respectively); stratification by aspirin use showed an association for decreased CRC risk for aspirin users having a wild-type genotype (rs2070959 OR = 0.77, 95% CI = 0.68-0.86; rs1105879 OR = 0.77 95% CI = 0.69-0.86) compared to variant allele cariers. The direction of the interaction however is in contrast to that published in studies on colorectal adenomas. Both SNPs showed potential site-specific interaction with aspirin use and colon cancer risk only (Pinteraction = 0.006 and 0.008, respectively), with the direction of association similar to that observed for CRC. Additionally, they showed interaction between any non-steroidal anti-inflammatory drugs (including aspirin) use and CRC risk (Pinteraction = 0.01 for both). All gene x environment (GxE) interactions however were not significant after multiple test correction. Candidate gene investigation indicated no evidence of GxE interaction between genetic variants in genes involved in aspirin pathways, regular aspirin use and colorectal cancer risk.

Interaction between polymorphisms in aspirin metabolic pathways, regular aspirin use and colorectal cancer risk: A case-control study in unselected white European populations

PubMed Central

Ulrich, Cornelia M.; Scherer, Dominique; Elliott, Faye; Barrett, Jennifer H.; Forman, David; Wolf, C. Roland; Smith, Gillian; Jackson, Michael S.; Santibanez-Koref, Mauro; Haile, Robert; Casey, Graham; Jenkins, Mark; Win, Aung Ko; Hopper, John L.; Marchand, Loic Le; Lindor, Noralane M.; Thibodeau, Stephen N.; Potter, John D.; Burn, John; Bishop, D. Timothy

2018-01-01

Regular aspirin use is associated with reduced risk of colorectal cancer (CRC). Variation in aspirin’s chemoprevention efficacy has been attributed to the presence of single nucleotide polymorphisms (SNPs). We conducted a meta-analysis using two large population-based case-control datasets, the UK-Leeds Colorectal Cancer Study Group and the NIH-Colon Cancer Family Registry, having a combined total of 3325 cases and 2262 controls. The aim was to assess 42 candidate SNPs in 15 genes whose association with colorectal cancer risk was putatively modified by aspirin use, in the literature. Log odds ratios (ORs) and standard errors were estimated for each dataset separately using logistic regression adjusting for age, sex and study site, and dataset-specific results were combined using random effects meta-analysis. Meta-analysis showed association between SNPs rs6983267, rs11694911 and rs2302615 with CRC risk reduction (All P<0.05). Association for SNP rs6983267 in the CCAT2 gene only was noteworthy after multiple test correction (P = 0.001). Site-specific analysis showed association between SNPs rs1799853 and rs2302615 with reduced colon cancer risk only (P = 0.01 and P = 0.004, respectively), however neither reached significance threshold following multiple test correction. Meta-analysis of SNPs rs2070959 and rs1105879 in UGT1A6 gene showed interaction between aspirin use and CRC risk (Pinteraction = 0.01 and 0.02, respectively); stratification by aspirin use showed an association for decreased CRC risk for aspirin users having a wild-type genotype (rs2070959 OR = 0.77, 95% CI = 0.68–0.86; rs1105879 OR = 0.77 95% CI = 0.69–0.86) compared to variant allele cariers. The direction of the interaction however is in contrast to that published in studies on colorectal adenomas. Both SNPs showed potential site-specific interaction with aspirin use and colon cancer risk only (Pinteraction = 0.006 and 0.008, respectively), with the direction of association similar to that observed for CRC. Additionally, they showed interaction between any non-steroidal anti-inflammatory drugs (including aspirin) use and CRC risk (Pinteraction = 0.01 for both). All gene x environment (GxE) interactions however were not significant after multiple test correction. Candidate gene investigation indicated no evidence of GxE interaction between genetic variants in genes involved in aspirin pathways, regular aspirin use and colorectal cancer risk. PMID:29425227

Combining mouse mammary gland gene expression and comparative mapping for the identification of candidate genes for QTL of milk production traits in cattle

PubMed Central

Ron, Micha; Israeli, Galit; Seroussi, Eyal; Weller, Joel I; Gregg, Jeffrey P; Shani, Moshe; Medrano, Juan F

2007-01-01

Background Many studies have found segregating quantitative trait loci (QTL) for milk production traits in different dairy cattle populations. However, even for relatively large effects with a saturated marker map the confidence interval for QTL location by linkage analysis spans tens of map units, or hundreds of genes. Combining mapping and arraying has been suggested as an approach to identify candidate genes. Thus, gene expression analysis in the mammary gland of genes positioned in the confidence interval of the QTL can bridge the gap between fine mapping and quantitative trait nucleotide (QTN) determination. Results We hybridized Affymetrix microarray (MG-U74v2), containing 12,488 murine probes, with RNA derived from mammary gland of virgin, pregnant, lactating and involuting C57BL/6J mice in a total of nine biological replicates. We combined microarray data from two additional studies that used the same design in mice with a total of 75 biological replicates. The same filtering and normalization was applied to each microarray data using GeneSpring software. Analysis of variance identified 249 differentially expressed probe sets common to the three experiments along the four developmental stages of puberty, pregnancy, lactation and involution. 212 genes were assigned to their bovine map positions through comparative mapping, and thus form a list of candidate genes for previously identified QTLs for milk production traits. A total of 82 of the genes showed mammary gland-specific expression with at least 3-fold expression over the median representing all tissues tested in GeneAtlas. Conclusion This work presents a web tool for candidate genes for QTL (cgQTL) that allows navigation between the map of bovine milk production QTL, potential candidate genes and their level of expression in mammary gland arrays and in GeneAtlas. Three out of four confirmed genes that affect QTL in livestock (ABCG2, DGAT1, GDF8, IGF2) were over expressed in the target organ. Thus, cgQTL can be used to determine priority of candidate genes for QTN analysis based on differential expression in the target organ. PMID:17584498

Drug Target Prediction and Repositioning Using an Integrated Network-Based Approach

PubMed Central

Emig, Dorothea; Ivliev, Alexander; Pustovalova, Olga; Lancashire, Lee; Bureeva, Svetlana; Nikolsky, Yuri; Bessarabova, Marina

2013-01-01

The discovery of novel drug targets is a significant challenge in drug development. Although the human genome comprises approximately 30,000 genes, proteins encoded by fewer than 400 are used as drug targets in the treatment of diseases. Therefore, novel drug targets are extremely valuable as the source for first in class drugs. On the other hand, many of the currently known drug targets are functionally pleiotropic and involved in multiple pathologies. Several of them are exploited for treating multiple diseases, which highlights the need for methods to reliably reposition drug targets to new indications. Network-based methods have been successfully applied to prioritize novel disease-associated genes. In recent years, several such algorithms have been developed, some focusing on local network properties only, and others taking the complete network topology into account. Common to all approaches is the understanding that novel disease-associated candidates are in close overall proximity to known disease genes. However, the relevance of these methods to the prediction of novel drug targets has not yet been assessed. Here, we present a network-based approach for the prediction of drug targets for a given disease. The method allows both repositioning drug targets known for other diseases to the given disease and the prediction of unexploited drug targets which are not used for treatment of any disease. Our approach takes as input a disease gene expression signature and a high-quality interaction network and outputs a prioritized list of drug targets. We demonstrate the high performance of our method and highlight the usefulness of the predictions in three case studies. We present novel drug targets for scleroderma and different types of cancer with their underlying biological processes. Furthermore, we demonstrate the ability of our method to identify non-suspected repositioning candidates using diabetes type 1 as an example. PMID:23593264

Fine mapping and positional candidate studies on chromosome 5p13 identify multiple asthma susceptibility loci.

PubMed

Kurz, Thorsten; Hoffjan, Sabine; Hayes, M Geoffrey; Schneider, Dan; Nicolae, Raluca; Heinzmann, Andrea; Jerkic, Sylvija P; Parry, Rod; Cox, Nancy J; Deichmann, Klaus A; Ober, Carole

2006-08-01

Genome-wide linkage scans to identify asthma susceptibility loci have revealed many linked regions, including a broad region on chromosome 5p. To identify a 5p-linked asthma or bronchial hyperresponsiveness (BHR) locus. We performed fine mapping and positional candidate studies of this region in the Hutterites and an outbred case-control sample from Germany by genotyping 89 single nucleotide polymorphisms (SNPs) in 22 genes. SNP and haplotype analyses were performed. Three genes in a distal region (zinc finger RNA binding protein [ZFR], natriuretic peptide receptor C, and a disintegrin and metalloproteinase domain with thrombospondin type 1 motif [ADAMTS12]) were associated with BHR, whereas 4 genes in a proximal region (prolactin receptor, IL-7 receptor [IL7R], leukemia inhibitory factor receptor [LIFR], and prostaglandin E4 receptor [PTGER4]) were associated with asthma symptoms in the Hutterites. Furthermore, nearly the entire original linkage signal in the Hutterites was generated by individuals who had the risk-associated alleles in ZFR3, natriuretic peptide receptor C, ADAMTS12, LIFR, and PTGER4. Variation in ADAMTS12, IL7R, and PTGER4 were also associated with asthma in the outbred Germans, and the frequencies of long-range haplotypes composed of SNPs at ZFR, ADAMTS12, IL7R, LIFR, and PTGER4 were significantly different between both the German and Hutterite cases and controls. There is little linkage disequilbrium between alleles in these 2 regions in either population. These results suggest that a broad region on 5p, separated by >9 Mb, harbors at least 2 and possibly 5 asthma or BHR susceptibility loci. These findings are consistent with the hypothesis that regions providing evidence for linkage in multiple populations may, in fact, house more than 1 susceptibility locus, as appears to be the case for the linked region on 5p. Identifying asthma or BHR genes could lead to novel therapeutic approaches.

Breast Tumors with Elevated Expression of 1q Candidate Genes Confer Poor Clinical Outcome and Sensitivity to Ras/PI3K Inhibition

PubMed Central

Viveka Thangaraj, Soundara; Periasamy, Jayaprakash; Bhaskar Rao, Divya; Barnabas, Georgina D.; Raghavan, Swetha; Ganesan, Kumaresan

2013-01-01

Genomic aberrations are common in cancers and the long arm of chromosome 1 is known for its frequent amplifications in breast cancer. However, the key candidate genes of 1q, and their contribution in breast cancer pathogenesis remain unexplored. We have analyzed the gene expression profiles of 1635 breast tumor samples using meta-analysis based approach and identified clinically significant candidates from chromosome 1q. Seven candidate genes including exonuclease 1 (EXO1) are consistently over expressed in breast tumors, specifically in high grade and aggressive breast tumors with poor clinical outcome. We derived a EXO1 co-expression module from the mRNA profiles of breast tumors which comprises 1q candidate genes and their co-expressed genes. By integrative functional genomics investigation, we identified the involvement of EGFR, RAS, PI3K / AKT, MYC, E2F signaling in the regulation of these selected 1q genes in breast tumors and breast cancer cell lines. Expression of EXO1 module was found as indicative of elevated cell proliferation, genomic instability, activated RAS/AKT/MYC/E2F1 signaling pathways and loss of p53 activity in breast tumors. mRNA–drug connectivity analysis indicates inhibition of RAS/PI3K as a possible targeted therapeutic approach for the patients with activated EXO1 module in breast tumors. Thus, we identified seven 1q candidate genes strongly associated with the poor survival of breast cancer patients and identified the possibility of targeting them with EGFR/RAS/PI3K inhibitors. PMID:24147022

A candidate region for Nevoid Basal Cell Carcinoma Syndrome defined by genetic and physical mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wainwright, B.; Negus, K.; Berkman, J.

1994-09-01

Nevoid Basal Cell Carcinoma Syndrome (NBCCS, or Gorlin`s syndrome) is a cancer predisposition syndrome charcterized by multiple basal cell carcinomas (BCCs) and diverse developmental defects. The gene responsible for NBCCS, which is most likely to be a tumor suppressor gene, has previously been mapped to 9q22.3-q31 in a 12 cM interval between the microsatellite marker loci D9S12 and D9S109. Combined multipoint and haplotype analyses of Australian pedigrees has further refined the localization to a 2 cM interval between markers D9S196 and D9S180. Our loss of heterozygosity (LOH) studies from sporadic (n= 58) and familial (n=41) BCCs indicate that 50% havemore » deletions within the NBCCS candidate region. All LOH is consistent with the genetic mapping of the NBCCS locus. Additionally, one sporadic tumor indicates that the smallest region of overlap in the deletions is within the interval D9S287 (proximal) and D9S180 (distal). A series of YAC clones from within this region has been mapped by FISH to examine chimerism. These clones, which have been mapped with respect to one another, form a contig which encompasses the candidate region from D9S196 to D9S180.« less

Next-generation DNA sequencing identifies novel gene variants and pathways involved in specific language impairment.

PubMed

Chen, Xiaowei Sylvia; Reader, Rose H; Hoischen, Alexander; Veltman, Joris A; Simpson, Nuala H; Francks, Clyde; Newbury, Dianne F; Fisher, Simon E

2017-04-25

A significant proportion of children have unexplained problems acquiring proficient linguistic skills despite adequate intelligence and opportunity. Developmental language disorders are highly heritable with substantial societal impact. Molecular studies have begun to identify candidate loci, but much of the underlying genetic architecture remains undetermined. We performed whole-exome sequencing of 43 unrelated probands affected by severe specific language impairment, followed by independent validations with Sanger sequencing, and analyses of segregation patterns in parents and siblings, to shed new light on aetiology. By first focusing on a pre-defined set of known candidates from the literature, we identified potentially pathogenic variants in genes already implicated in diverse language-related syndromes, including ERC1, GRIN2A, and SRPX2. Complementary analyses suggested novel putative candidates carrying validated variants which were predicted to have functional effects, such as OXR1, SCN9A and KMT2D. We also searched for potential "multiple-hit" cases; one proband carried a rare AUTS2 variant in combination with a rare inherited haplotype affecting STARD9, while another carried a novel nonsynonymous variant in SEMA6D together with a rare stop-gain in SYNPR. On broadening scope to all rare and novel variants throughout the exomes, we identified biological themes that were enriched for such variants, including microtubule transport and cytoskeletal regulation.

Next-generation DNA sequencing identifies novel gene variants and pathways involved in specific language impairment

PubMed Central

Chen, Xiaowei Sylvia; Reader, Rose H.; Hoischen, Alexander; Veltman, Joris A.; Simpson, Nuala H.; Francks, Clyde; Newbury, Dianne F.; Fisher, Simon E.

2017-01-01

A significant proportion of children have unexplained problems acquiring proficient linguistic skills despite adequate intelligence and opportunity. Developmental language disorders are highly heritable with substantial societal impact. Molecular studies have begun to identify candidate loci, but much of the underlying genetic architecture remains undetermined. We performed whole-exome sequencing of 43 unrelated probands affected by severe specific language impairment, followed by independent validations with Sanger sequencing, and analyses of segregation patterns in parents and siblings, to shed new light on aetiology. By first focusing on a pre-defined set of known candidates from the literature, we identified potentially pathogenic variants in genes already implicated in diverse language-related syndromes, including ERC1, GRIN2A, and SRPX2. Complementary analyses suggested novel putative candidates carrying validated variants which were predicted to have functional effects, such as OXR1, SCN9A and KMT2D. We also searched for potential “multiple-hit” cases; one proband carried a rare AUTS2 variant in combination with a rare inherited haplotype affecting STARD9, while another carried a novel nonsynonymous variant in SEMA6D together with a rare stop-gain in SYNPR. On broadening scope to all rare and novel variants throughout the exomes, we identified biological themes that were enriched for such variants, including microtubule transport and cytoskeletal regulation. PMID:28440294

Identification of genes from the Treacher Collins candidate region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixon, M.; Dixon, J.; Edwards, S.

Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development. The TCOF1 locus has previously been mapped to chromosome 5q32-33. The candidate gene region has been defined as being between two flanking markers, ribosomal protein S14 (RPS14) and Annexin 6 (ANX6), by analyzing recombination events in affected individuals. It is estimated that the distance between these flanking markers is 500 kb by three separate analysis methods: (1) radiation hybrid mapping; (2) genetic linkage; and (3) YAC contig analysis. A cosmid contig which spans the candidate gene region for TCOF1 has been constructed by screening the Los Alamos Nationalmore » Laboratory flow-sorted chromosome 5 cosmid library. Cosmids were obtained by using a combination of probes generated from YAC end clones, Alu-PCR fragments from YACs, and asymmetric PCR fragments from both T7 and T3 cosmid ends. Exon amplifications, the selection of genomic coding sequences based upon the presence of functional splice acceptor and donor sites, was used to identify potential exon sequences. Sequences found to be conserved between species were then used to screen cDNA libraries in order to identify candidate genes. To date, four different cDNAs have been isolated from this region and are being analyzed as potential candidate genes for TCOF1. These include the genes encoding plasma glutathione peroxidase (GPX3), heparin sulfate sulfotransferase (HSST), a gene with homology to the ETS family of proteins and one which shows no homology to any known genes. Work is also in progress to identify and characterize additional cDNAs from the candidate gene region.« less

Mapping a candidate gene (MdMYB10) for red flesh and foliage colour in apple

PubMed Central

Chagné, David; Carlisle, Charmaine M; Blond, Céline; Volz, Richard K; Whitworth, Claire J; Oraguzie, Nnadozie C; Crowhurst, Ross N; Allan, Andrew C; Espley, Richard V; Hellens, Roger P; Gardiner, Susan E

2007-01-01

Background Integrating plant genomics and classical breeding is a challenge for both plant breeders and molecular biologists. Marker-assisted selection (MAS) is a tool that can be used to accelerate the development of novel apple varieties such as cultivars that have fruit with anthocyanin through to the core. In addition, determining the inheritance of novel alleles, such as the one responsible for red flesh, adds to our understanding of allelic variation. Our goal was to map candidate anthocyanin biosynthetic and regulatory genes in a population segregating for the red flesh phenotypes. Results We have identified the Rni locus, a major genetic determinant of the red foliage and red colour in the core of apple fruit. In a population segregating for the red flesh and foliage phenotype we have determined the inheritance of the Rni locus and DNA polymorphisms of candidate anthocyanin biosynthetic and regulatory genes. Simple Sequence Repeats (SSRs) and Single Nucleotide Polymorphisms (SNPs) in the candidate genes were also located on an apple genetic map. We have shown that the MdMYB10 gene co-segregates with the Rni locus and is on Linkage Group (LG) 09 of the apple genome. Conclusion We have performed candidate gene mapping in a fruit tree crop and have provided genetic evidence that red colouration in the fruit core as well as red foliage are both controlled by a single locus named Rni. We have shown that the transcription factor MdMYB10 may be the gene underlying Rni as there were no recombinants between the marker for this gene and the red phenotype in a population of 516 individuals. Associating markers derived from candidate genes with a desirable phenotypic trait has demonstrated the application of genomic tools in a breeding programme of a horticultural crop species. PMID:17608951

Antennal transcriptome analysis of the piercing moth Oraesia emarginata (Lepidoptera: Noctuidae)

PubMed Central

Feng, Bo; Guo, Qianshuang; Zheng, Kaidi; Qin, Yuanxia; Du, Yongjun

2017-01-01

The piercing fruit moth Oraesia emarginata is an economically significant pest; however, our understanding of its olfactory mechanisms in infestation is limited. The present study conducted antennal transcriptome analysis of olfactory genes using real-time quantitative reverse transcription PCR analysis (RT-qPCR). We identified a total of 104 candidate chemosensory genes from several gene families, including 35 olfactory receptors (ORs), 41 odorant-binding proteins, 20 chemosensory proteins, 6 ionotropic receptors, and 2 sensory neuron membrane proteins. Seven candidate pheromone receptors (PRs) and 3 candidate pheromone-binding proteins (PBPs) for sex pheromone recognition were found. OemaOR29 and OemaPBP1 had the highest fragments per kb per million fragments (FPKM) values in all ORs and OBPs, respectively. Eighteen olfactory genes were upregulated in females, including 5 candidate PRs, and 20 olfactory genes were upregulated in males, including 2 candidate PRs (OemaOR29 and 4) and 2 PBPs (OemaPBP1 and 3). These genes may have roles in mediating sex-specific behaviors. Most candidate olfactory genes of sex pheromone recognition (except OemaOR29 and OemaPBP3) in O. emarginata were not clustered with those of studied noctuid species (type I pheromone). In addition, OemaOR29 was belonged to cluster PRIII, which comprise proteins that recognize type II pheromones instead of type I pheromones. The structure and function of olfactory genes that encode sex pheromones in O. emarginata might thus differ from those of other studied noctuids. The findings of the present study may help explain the molecular mechanism underlying olfaction and the evolution of olfactory genes encoding sex pheromones in O. emarginata. PMID:28614384

Development of New Candidate Gene and EST-Based Molecular Markers for Gossypium Species

PubMed Central

Buyyarapu, Ramesh; Kantety, Ramesh V.; Yu, John Z.; Saha, Sukumar; Sharma, Govind C.

2011-01-01

New source of molecular markers accelerate the efforts in improving cotton fiber traits and aid in developing high-density integrated genetic maps. We developed new markers based on candidate genes and G. arboreum EST sequences that were used for polymorphism detection followed by genetic and physical mapping. Nineteen gene-based markers were surveyed for polymorphism detection in 26 Gossypium species. Cluster analysis generated a phylogenetic tree with four major sub-clusters for 23 species while three species branched out individually. CAP method enhanced the rate of polymorphism of candidate gene-based markers between G. hirsutum and G. barbadense. Two hundred A-genome based SSR markers were designed after datamining of G. arboreum EST sequences (Mississippi Gossypium arboreum   EST-SSR: MGAES). Over 70% of MGAES markers successfully produced amplicons while 65 of them demonstrated polymorphism between the parents of G. hirsutum and G. barbadense RIL population and formed 14 linkage groups. Chromosomal localization of both candidate gene-based and MGAES markers was assisted by euploid and hypoaneuploid CS-B analysis. Gene-based and MGAES markers were highly informative as they were designed from candidate genes and fiber transcriptome with a potential to be integrated into the existing cotton genetic and physical maps. PMID:22315588

Identification of candidate transmission-blocking antigen genes in Theileria annulata and related vector-borne apicomplexan parasites.

PubMed

Lempereur, Laetitia; Larcombe, Stephen D; Durrani, Zeeshan; Karagenc, Tulin; Bilgic, Huseyin Bilgin; Bakirci, Serkan; Hacilarlioglu, Selin; Kinnaird, Jane; Thompson, Joanne; Weir, William; Shiels, Brian

2017-06-05

Vector-borne apicomplexan parasites are a major cause of mortality and morbidity to humans and livestock globally. The most important disease syndromes caused by these parasites are malaria, babesiosis and theileriosis. Strategies for control often target parasite stages in the mammalian host that cause disease, but this can result in reservoir infections that promote pathogen transmission and generate economic loss. Optimal control strategies should protect against clinical disease, block transmission and be applicable across related genera of parasites. We have used bioinformatics and transcriptomics to screen for transmission-blocking candidate antigens in the tick-borne apicomplexan parasite, Theileria annulata. A number of candidate antigen genes were identified which encoded amino acid domains that are conserved across vector-borne Apicomplexa (Babesia, Plasmodium and Theileria), including the Pfs48/45 6-cys domain and a novel cysteine-rich domain. Expression profiling confirmed that selected candidate genes are expressed by life cycle stages within infected ticks. Additionally, putative B cell epitopes were identified in the T. annulata gene sequences encoding the 6-cys and cysteine rich domains, in a gene encoding a putative papain-family cysteine peptidase, with similarity to the Plasmodium SERA family, and the gene encoding the T. annulata major merozoite/piroplasm surface antigen, Tams1. Candidate genes were identified that encode proteins with similarity to known transmission blocking candidates in related parasites, while one is a novel candidate conserved across vector-borne apicomplexans and has a potential role in the sexual phase of the life cycle. The results indicate that a 'One Health' approach could be utilised to develop a transmission-blocking strategy effective against vector-borne apicomplexan parasites of animals and humans.

Sleeping Beauty transposon mutagenesis identifies genes that cooperate with mutant Smad4 in gastric cancer development

PubMed Central

Takeda, Haruna; Rust, Alistair G.; Ward, Jerrold M.; Yew, Christopher Chin Kuan; Jenkins, Nancy A.; Copeland, Neal G.

2016-01-01

Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4+/− mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC. PMID:27006499

Sleeping Beauty transposon mutagenesis identifies genes that cooperate with mutant Smad4 in gastric cancer development.

PubMed

Takeda, Haruna; Rust, Alistair G; Ward, Jerrold M; Yew, Christopher Chin Kuan; Jenkins, Nancy A; Copeland, Neal G

2016-04-05

Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4(+/-) mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC.

Identification of Candidate Genes Responsible for Stem Pith Production Using Expression Analysis in Solid-Stemmed Wheat.

PubMed

Oiestad, A J; Martin, J M; Cook, J; Varella, A C; Giroux, M J

2017-07-01

The wheat stem sawfly (WSS) is an economically important pest of wheat in the Northern Great Plains. The primary means of WSS control is resistance associated with the single quantitative trait locus (QTL) , which controls most stem solidness variation. The goal of this study was to identify stem solidness candidate genes via RNA-seq. This study made use of 28 single nucleotide polymorphism (SNP) makers derived from expressed sequence tags (ESTs) linked to contained within a 5.13 cM region. Allele specific expression of EST markers was examined in stem tissue for solid and hollow-stemmed pairs of two spring wheat near isogenic lines (NILs) differing for the QTL. Of the 28 ESTs, 13 were located within annotated genes and 10 had detectable stem expression. Annotated genes corresponding to four of the ESTs were differentially expressed between solid and hollow-stemmed NILs and represent possible stem solidness gene candidates. Further examination of the 5.13 cM region containing the 28 EST markers identified 260 annotated genes. Twenty of the 260 linked genes were up-regulated in hollow NIL stems, while only seven genes were up-regulated in solid NIL stems. An -methyltransferase within the region of interest was identified as a candidate based on differential expression between solid and hollow-stemmed NILs and putative function. Further study of these candidate genes may lead to the identification of the gene(s) controlling stem solidness and an increased ability to select for wheat stem solidness and manage WSS. Copyright © 2017 Crop Science Society of America.

Comparative analysis of protein interactome networks prioritizes candidate genes with cancer signatures.

PubMed

Li, Yongsheng; Sahni, Nidhi; Yi, Song

2016-11-29

Comprehensive understanding of human cancer mechanisms requires the identification of a thorough list of cancer-associated genes, which could serve as biomarkers for diagnoses and therapies in various types of cancer. Although substantial progress has been made in functional studies to uncover genes involved in cancer, these efforts are often time-consuming and costly. Therefore, it remains challenging to comprehensively identify cancer candidate genes. Network-based methods have accelerated this process through the analysis of complex molecular interactions in the cell. However, the extent to which various interactome networks can contribute to prediction of candidate genes responsible for cancer is still enigmatic. In this study, we evaluated different human protein-protein interactome networks and compared their application to cancer gene prioritization. Our results indicate that network analyses can increase the power to identify novel cancer genes. In particular, such predictive power can be enhanced with the use of unbiased systematic protein interaction maps for cancer gene prioritization. Functional analysis reveals that the top ranked genes from network predictions co-occur often with cancer-related terms in literature, and further, these candidate genes are indeed frequently mutated across cancers. Finally, our study suggests that integrating interactome networks with other omics datasets could provide novel insights into cancer-associated genes and underlying molecular mechanisms.

Examination of association of genes in the serotonin system to autism.

PubMed

Anderson, B M; Schnetz-Boutaud, N C; Bartlett, J; Wotawa, A M; Wright, H H; Abramson, R K; Cuccaro, M L; Gilbert, J R; Pericak-Vance, M A; Haines, J L

2009-07-01

Autism is characterized as one of the pervasive developmental disorders, a spectrum of often severe behavioral and cognitive disturbances of early development. The high heritability of autism has driven multiple efforts to identify genetic variation that increases autism susceptibility. Numerous studies have suggested that variation in peripheral and central metabolism of serotonin (5-hydroxytryptamine) may play a role in the pathophysiology of autism. We screened 403 autism families for 45 single nucleotide polymorphisms in ten serotonin pathway candidate genes. Although genome-wide linkage scans in autism have provided support for linkage to various loci located within the serotonin pathway, our study does not provide strong evidence for linkage to any specific gene within the pathway. The most significant association (p = 0.0002; p = 0.02 after correcting for multiple comparisons) was found at rs1150220 (HTR3A) located on chromosome 11 ( approximately 113 Mb). To test specifically for multilocus effects, multifactor dimensionality reduction was employed, and a significant two-way interaction (p value = 0.01) was found between rs10830962, near MTNR1B (chromosome11; 92,338,075 bp), and rs1007631, near SLC7A5 (chromosome16; 86,413,596 bp). These data suggest that variation within genes on the serotonin pathway, particularly HTR3A, may have modest effects on autism risk.

Genome-wide association and pathway analysis of feed efficiency in pigs reveal candidate genes and pathways for residual feed intake

PubMed Central

Do, Duy N.; Strathe, Anders B.; Ostersen, Tage; Pant, Sameer D.; Kadarmideen, Haja N.

2014-01-01

Residual feed intake (RFI) is a complex trait that is economically important for livestock production; however, the genetic and biological mechanisms regulating RFI are largely unknown in pigs. Therefore, the study aimed to identify single nucleotide polymorphisms (SNPs), candidate genes and biological pathways involved in regulating RFI using Genome-wide association (GWA) and pathway analyses. A total of 596 Yorkshire boars with phenotypes for two different measures of RFI (RFI1 and 2) and 60k genotypic data was used. GWA analysis was performed using a univariate mixed model and 12 and 7 SNPs were found to be significantly associated with RFI1 and RFI2, respectively. Several genes such as xin actin-binding repeat-containing protein 2 (XIRP2),tetratricopeptide repeat domain 29 (TTC29),suppressor of glucose, autophagy associated 1 (SOGA1),MAS1,G-protein-coupled receptor (GPCR) kinase 5 (GRK5),prospero-homeobox protein 1 (PROX1),GPCR 155 (GPR155), and FYVE domain containing the 26 (ZFYVE26) were identified as putative candidates for RFI based on their genomic location in the vicinity of these SNPs. Genes located within 50 kbp of SNPs significantly associated with RFI and RFI2 (q-value ≤ 0.2) were subsequently used for pathway analyses. These analyses were performed by assigning genes to biological pathways and then testing the association of individual pathways with RFI using a Fisher’s exact test. Metabolic pathway was significantly associated with both RFIs. Other biological pathways regulating phagosome, tight junctions, olfactory transduction, and insulin secretion were significantly associated with both RFI traits when relaxed threshold for cut-off p-value was used (p ≤ 0.05). These results implied porcine RFI is regulated by multiple biological mechanisms, although the metabolic processes might be the most important. Olfactory transduction pathway controlling the perception of feed via smell, insulin pathway controlling food intake might be important pathways for RFI. Furthermore, our study revealed key genes and genetic variants that control feed efficiency that could potentially be useful for genetic selection of more feed efficient pigs. PMID:25250046

Survey of candidate genes for maize resistance to infection by Aspergillus flavus and/or aflatoxin contamination

Treesearch

Leigh Hawkins; Marilyn Warburton; Juliet Tang; John Tomashek; Dafne Alves Oliveira; Oluwaseun Ogunola; J. Smith; W. Williams

2018-01-01

Many projects have identified candidate genes for resistance to aflatoxin accumulation or Aspergillus flavus infection and growth in maize using genetic mapping, genomics, transcriptomics and/or proteomics studies. However, only a small percentage of these candidates have been validated in field conditions, and their relative contribution to...

An Unbiased Systems Genetics Approach to Mapping Genetic Loci Modulating Susceptibility to Severe Streptococcal Sepsis

PubMed Central

Abdeltawab, Nourtan F.; Aziz, Ramy K.; Kansal, Rita; Rowe, Sarah L.; Su, Yin; Gardner, Lidia; Brannen, Charity; Nooh, Mohammed M.; Attia, Ramy R.; Abdelsamed, Hossam A.; Taylor, William L.; Lu, Lu; Williams, Robert W.; Kotb, Malak

2008-01-01

Striking individual differences in severity of group A streptococcal (GAS) sepsis have been noted, even among patients infected with the same bacterial strain. We had provided evidence that HLA class II allelic variation contributes significantly to differences in systemic disease severity by modulating host responses to streptococcal superantigens. Inasmuch as the bacteria produce additional virulence factors that participate in the pathogenesis of this complex disease, we sought to identify additional gene networks modulating GAS sepsis. Accordingly, we applied a systems genetics approach using a panel of advanced recombinant inbred mice. By analyzing disease phenotypes in the context of mice genotypes we identified a highly significant quantitative trait locus (QTL) on Chromosome 2 between 22 and 34 Mb that strongly predicts disease severity, accounting for 25%–30% of variance. This QTL harbors several polymorphic genes known to regulate immune responses to bacterial infections. We evaluated candidate genes within this QTL using multiple parameters that included linkage, gene ontology, variation in gene expression, cocitation networks, and biological relevance, and identified interleukin1 alpha and prostaglandin E synthases pathways as key networks involved in modulating GAS sepsis severity. The association of GAS sepsis with multiple pathways underscores the complexity of traits modulating GAS sepsis and provides a powerful approach for analyzing interactive traits affecting outcomes of other infectious diseases. PMID:18421376

Tracing evolutionary relicts of positive selection on eight malaria-related immune genes in mammals.

PubMed

Huang, Bing-Hong; Liao, Pei-Chun

2015-07-01

Plasmodium-induced malaria widely infects primates and other mammals. Multiple past studies have revealed that positive selection could be the main evolutionary force triggering the genetic diversity of anti-malaria resistance-associated genes in human or primates. However, researchers focused most of their attention on the infra-generic and intra-specific genome evolution rather than analyzing the complete evolutionary history of mammals. Here we extend previous research by testing the evolutionary link of natural selection on eight candidate genes associated with malaria resistance in mammals. Three of the eight genes were detected to be affected by recombination, including TNF-α, iNOS and DARC. Positive selection was detected in the rest five immunogenes multiple times in different ancestral lineages of extant species throughout the mammalian evolution. Signals of positive selection were exposed in four malaria-related immunogenes in primates: CCL2, IL-10, HO1 and CD36. However, selection signals of G6PD have only been detected in non-primate eutherians. Significantly higher evolutionary rates and more radical amino acid replacement were also detected in primate CD36, suggesting its functional divergence from other eutherians. Prevalent positive selection throughout the evolutionary trajectory of mammalian malaria-related genes supports the arms race evolutionary hypothesis of host genetic response of mammalian immunogenes to infectious pathogens. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

A Common Variant at the 14q32 Endometrial Cancer Risk Locus Activates AKT1 through YY1 Binding.

PubMed

Painter, Jodie N; Kaufmann, Susanne; O'Mara, Tracy A; Hillman, Kristine M; Sivakumaran, Haran; Darabi, Hatef; Cheng, Timothy H T; Pearson, John; Kazakoff, Stephen; Waddell, Nicola; Hoivik, Erling A; Goode, Ellen L; Scott, Rodney J; Tomlinson, Ian; Dunning, Alison M; Easton, Douglas F; French, Juliet D; Salvesen, Helga B; Pollock, Pamela M; Thompson, Deborah J; Spurdle, Amanda B; Edwards, Stacey L

2016-06-02

A recent meta-analysis of multiple genome-wide association and follow-up endometrial cancer case-control datasets identified a novel genetic risk locus for this disease at chromosome 14q32.33. To prioritize the functional SNP(s) and target gene(s) at this locus, we employed an in silico fine-mapping approach using genotyped and imputed SNP data for 6,608 endometrial cancer cases and 37,925 controls of European ancestry. Association and functional analyses provide evidence that the best candidate causal SNP is rs2494737. Multiple experimental analyses show that SNP rs2494737 maps to a silencer element located within AKT1, a member of the PI3K/AKT/MTOR intracellular signaling pathway activated in endometrial tumors. The rs2494737 risk A allele creates a YY1 transcription factor-binding site and abrogates the silencer activity in luciferase assays, an effect mimicked by transfection of YY1 siRNA. Our findings suggest YY1 is a positive regulator of AKT1, mediating the stimulatory effects of rs2494737 increasing endometrial cancer risk. Identification of an endometrial cancer risk allele within a member of the PI3K/AKT signaling pathway, more commonly activated in tumors by somatic alterations, raises the possibility that well tolerated inhibitors targeting this pathway could be candidates for evaluation as chemopreventive agents in individuals at high risk of developing endometrial cancer. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Selection of reference genes for tissue/organ samples on day 3 fifth-instar larvae in silkworm, Bombyx mori.

PubMed

Wang, Genhong; Chen, Yanfei; Zhang, Xiaoying; Bai, Bingchuan; Yan, Hao; Qin, Daoyuan; Xia, Qingyou

2018-06-01

The silkworm, Bombyx mori, is one of the world's most economically important insect. Surveying variations in gene expression among multiple tissue/organ samples will provide clues for gene function assignments and will be helpful for identifying genes related to economic traits or specific cellular processes. To ensure their accuracy, commonly used gene expression quantification methods require a set of stable reference genes for data normalization. In this study, 24 candidate reference genes were assessed in 10 tissue/organ samples of day 3 fifth-instar B. mori larvae using geNorm and NormFinder. The results revealed that, using the combination of the expression of BGIBMGA003186 and BGIBMGA008209 was the optimum choice for normalizing the expression data of the B. mori tissue/organ samples. The most stable gene, BGIBMGA003186, is recommended if just one reference gene is used. Moreover, the commonly used reference gene encoding cytoplasmic actin was the least appropriate reference gene of the samples investigated. The reliability of the selected reference genes was further confirmed by evaluating the expression profiles of two cathepsin genes. Our results may be useful for future studies involving the quantification of relative gene expression levels of different tissue/organ samples in B. mori. © 2018 Wiley Periodicals, Inc.

A comparative analysis of genetic diversity of candidate genes associated with type 2 diabetes in worldwide populations.

PubMed

Gong, Xian; Zhang, Chao; Yiliyasi·Aisa, Yiliyasi·Aisa; Shi, Ying; Yang, Xue-wei; NuersimanguliAosiman, NuersimanguliAosiman; Guan, Ya-qun; Xu, Shu-hua

2016-06-20

Over the last decade, a larger number of type 2 diabetes mellitus (T2DM) susceptible candidate genes have been reported by numerous genome-wide association studies (GWAS). Understanding the genetic diversity of these candidate genes among worldwide populations not only facilitates to elucidating the genetic mechanism of T2DM, but also provides guidance to further studies of pathogenesis of T2DM in any certain population. In this study, we identified 170 genes or genomic regions associated with T2DM by searching the GWAS databases and related literatures. We next analyzed the genetic diversity of these genes (or genomic regions) among present-day human populations by curetting the 1000 Genomes Projects phase1 dataset covering 14 worldwide populations. We further compared the characteristics of T2DM genes in different populations. No significant differences of genetic diversity were observed among the 14 worldwide populations between the T2DM candidate genes and the non-T2DM genes in terms of overall pattern. However, we observed some genes, such as IL20RA, RNMTL1-NXN, NOTCH2, ADRA2A-BTBD7P2, TBC1D4, RBM38-HMGB1P1, UBE2E2, and PPARD, show considerable differentiation between populations. In particular, IL20RA (FST=0.1521) displays the greatest population difference which is mainly contributed by that between Africans and non-Africans. Moreover, we revealed genetic differences between East Asians and Europeans on some candidate genes such as DGKB-AGMO (FST=0.173) and JAZF1 (FST=0.182). Our results indicate that some T2DM susceptible candidate genes harbor highly-differentiated variants between populations. These analyses, despite preliminary, should advance our understanding of the population difference of susceptibility to T2DM and provide insightful reference that future studies can relay on.

A gene expression inflammatory signature specifically predicts multiple myeloma evolution and patients survival.

PubMed

Botta, C; Di Martino, M T; Ciliberto, D; Cucè, M; Correale, P; Rossi, M; Tagliaferri, P; Tassone, P

2016-12-16

Multiple myeloma (MM) is closely dependent on cross-talk between malignant plasma cells and cellular components of the inflammatory/immunosuppressive bone marrow milieu, which promotes disease progression, drug resistance, neo-angiogenesis, bone destruction and immune-impairment. We investigated the relevance of inflammatory genes in predicting disease evolution and patient survival. A bioinformatics study by Ingenuity Pathway Analysis on gene expression profiling dataset of monoclonal gammopathy of undetermined significance, smoldering and symptomatic-MM, identified inflammatory and cytokine/chemokine pathways as the most progressively affected during disease evolution. We then selected 20 candidate genes involved in B-cell inflammation and we investigated their role in predicting clinical outcome, through univariate and multivariate analyses (log-rank test, logistic regression and Cox-regression model). We defined an 8-genes signature (IL8, IL10, IL17A, CCL3, CCL5, VEGFA, EBI3 and NOS2) identifying each condition (MGUS/smoldering/symptomatic-MM) with 84% accuracy. Moreover, six genes (IFNG, IL2, LTA, CCL2, VEGFA, CCL3) were found independently correlated with patients' survival. Patients whose MM cells expressed high levels of Th1 cytokines (IFNG/LTA/IL2/CCL2) and low levels of CCL3 and VEGFA, experienced the longest survival. On these six genes, we built a prognostic risk score that was validated in three additional independent datasets. In this study, we provide proof-of-concept that inflammation has a critical role in MM patient progression and survival. The inflammatory-gene prognostic signature validated in different datasets clearly indicates novel opportunities for personalized anti-MM treatment.

Excessive burden of lysosomal storage disorder gene variants in Parkinson's disease.

PubMed

Robak, Laurie A; Jansen, Iris E; van Rooij, Jeroen; Uitterlinden, André G; Kraaij, Robert; Jankovic, Joseph; Heutink, Peter; Shulman, Joshua M

2017-12-01

Mutations in the glucocerebrosidase gene (GBA), which cause Gaucher disease, are also potent risk factors for Parkinson's disease. We examined whether a genetic burden of variants in other lysosomal storage disorder genes is more broadly associated with Parkinson's disease susceptibility. The sequence kernel association test was used to interrogate variant burden among 54 lysosomal storage disorder genes, leveraging whole exome sequencing data from 1156 Parkinson's disease cases and 1679 control subjects. We discovered a significant burden of rare, likely damaging lysosomal storage disorder gene variants in association with Parkinson's disease risk. The association signal was robust to the exclusion of GBA, and consistent results were obtained in two independent replication cohorts, including 436 cases and 169 controls with whole exome sequencing and an additional 6713 cases and 5964 controls with exome-wide genotyping. In secondary analyses designed to highlight the specific genes driving the aggregate signal, we confirmed associations at the GBA and SMPD1 loci and newly implicate CTSD, SLC17A5, and ASAH1 as candidate Parkinson's disease susceptibility genes. In our discovery cohort, the majority of Parkinson's disease cases (56%) have at least one putative damaging variant in a lysosomal storage disorder gene, and 21% carry multiple alleles. Our results highlight several promising new susceptibility loci and reinforce the importance of lysosomal mechanisms in Parkinson's disease pathogenesis. We suggest that multiple genetic hits may act in combination to degrade lysosomal function, enhancing Parkinson's disease susceptibility. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Identification and verification of differentially expressed genes in the caprine hypothalamic-pituitary-gonadal axis that are associated with litter size.

PubMed

Feng, Tao; Cao, Gui-Ling; Chu, Ming-Xing; Di, Ran; Huang, Dong-Wei; Liu, Qiu-Yue; Pan, Zhang-Yuan; Jin, Mei; Zhang, Ying-Jie; Li, Ning

2015-02-01

Litter size is a favorable economic trait for the goat industry, but remains a complex trait controlled by multiple genes in multiple organs. Several genes have been identified that may affect embryo survival, follicular development, and the health of fetuses during pregnancy. Jining Grey goats demonstrate the largest litter size among goat breeds indigenous to China. In order to better understand the genetic basis of this trait, six suppression subtractive hybridization (SSH) cDNA libraries were constructed using pooled mRNAs from hypothalamuses, pituitaries, and ovaries of sexually mature and adult polytocous Jining Grey goats, as testers, versus the pooled corresponding mRNAs of monotocous Liaoning Cashmere goats, as drivers. A total of 1,458 true-positive clones--including 955 known genes and 481 known and 22 unknown expressed sequence tags--were obtained from the SSH libraries by sequencing and alignment. The known genes were categorized into cellular processes and signaling information storage and processing, and metabolism. Three genes (FTH1, GH, and SAA) were selected to validate the SSH results by quantitative real-time PCR; all three were up-regulated in the corresponding tissues in the tester group indicating that these are candidate genes associated with the large litter size of Jining Grey goats. Several other identified genes may affect embryo survival, follicular development, and health during pregnancy. This study provides insights into the mechanistic basis by which the caprine hypothalamic-pituitary-gonadal axis affects reproductive traits and provides a theoretical basis for goat production and breeding. © 2015 Wiley Periodicals, Inc.

MYD88 and functionally related genes are associated with multiple infections in a model population of Kenyan village dogs.

PubMed

Necesankova, Michaela; Vychodilova, Leona; Albrechtova, Katerina; Kennedy, Lorna J; Hlavac, Jan; Sedlak, Kamil; Modry, David; Janova, Eva; Vyskocil, Mirko; Horin, Petr

2016-12-01

The purpose of this study was to seek associations between immunity-related molecular markers and endemic infections in a model population of African village dogs from Northern Kenya with no veterinary care and no selective breeding. A population of village dogs from Northern Kenya composed of three sub-populations from three different areas (84, 50 and 55 dogs) was studied. Canine distemper virus (CDV), Hepatozoon canis, Microfilariae (Acantocheilonema dracunculoides, Acantocheilonema reconditum) and Neospora caninum were the pathogens studied. The presence of antibodies (CDV, Neospora), light microscopy (Hepatozoon) and diagnostic PCR (Microfilariae) were the methods used for diagnosing infection. Genes involved in innate immune mechanisms, NOS3, IL6, TLR1, TLR2, TLR4, TLR7, TLR9, LY96, MYD88, and three major histocompatibility genes class II genes were selected as candidates. Single nucleotide polymorphism (SNP) markers were detected by Sanger sequencing, next generation sequencing and PCR-RFLP. The Fisher´s exact test for additive and non-additive models was used for association analyses. Three SNPs within the MYD88 gene and one TLR4 SNP marker were associated with more than one infection. Combined genotypes and further markers identified by next generation sequencing confirmed associations observed for individual genes. The genes associated with infection and their combinations in specific genotypes match well our knowledge on their biological role and on the role of the relevant biological pathways, respectively. Associations with multiple infections observed between the MYD88 and TLR4 genes suggest their involvement in the mechanisms of anti-infectious defenses in dogs.

Identification of Immunity Related Genes to Study the Physalis peruviana – Fusarium oxysporum Pathosystem

PubMed Central

Enciso-Rodríguez, Felix E.; González, Carolina; Rodríguez, Edwin A.; López, Camilo E.; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

2013-01-01

The Cape gooseberry ( Physalis peruviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P . peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC–NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance. PMID:23844210

Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem.

PubMed

Enciso-Rodríguez, Felix E; González, Carolina; Rodríguez, Edwin A; López, Camilo E; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

2013-01-01

The Cape gooseberry (Physalisperuviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC-NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

Next-generation sequencing for identification of candidate genes for Fusarium wilt and sterility mosaic disease in pigeonpea (Cajanus cajan).

PubMed

Singh, Vikas K; Khan, Aamir W; Saxena, Rachit K; Kumar, Vinay; Kale, Sandip M; Sinha, Pallavi; Chitikineni, Annapurna; Pazhamala, Lekha T; Garg, Vanika; Sharma, Mamta; Sameer Kumar, Chanda Venkata; Parupalli, Swathi; Vechalapu, Suryanarayana; Patil, Suyash; Muniswamy, Sonnappa; Ghanta, Anuradha; Yamini, Kalinati Narasimhan; Dharmaraj, Pallavi Subbanna; Varshney, Rajeev K

2016-05-01

To map resistance genes for Fusarium wilt (FW) and sterility mosaic disease (SMD) in pigeonpea, sequencing-based bulked segregant analysis (Seq-BSA) was used. Resistant (R) and susceptible (S) bulks from the extreme recombinant inbred lines of ICPL 20096 × ICPL 332 were sequenced. Subsequently, SNP index was calculated between R- and S-bulks with the help of draft genome sequence and reference-guided assembly of ICPL 20096 (resistant parent). Seq-BSA has provided seven candidate SNPs for FW and SMD resistance in pigeonpea. In parallel, four additional genotypes were re-sequenced and their combined analysis with R- and S-bulks has provided a total of 8362 nonsynonymous (ns) SNPs. Of 8362 nsSNPs, 60 were found within the 2-Mb flanking regions of seven candidate SNPs identified through Seq-BSA. Haplotype analysis narrowed down to eight nsSNPs in seven genes. These eight nsSNPs were further validated by re-sequencing 11 genotypes that are resistant and susceptible to FW and SMD. This analysis revealed association of four candidate nsSNPs in four genes with FW resistance and four candidate nsSNPs in three genes with SMD resistance. Further, In silico protein analysis and expression profiling identified two most promising candidate genes namely C.cajan_01839 for SMD resistance and C.cajan_03203 for FW resistance. Identified candidate genomic regions/SNPs will be useful for genomics-assisted breeding in pigeonpea. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

A Novel Strategy for Selection and Validation of Reference Genes in Dynamic Multidimensional Experimental Design in Yeast

PubMed Central

Cankorur-Cetinkaya, Ayca; Dereli, Elif; Eraslan, Serpil; Karabekmez, Erkan; Dikicioglu, Duygu; Kirdar, Betul

2012-01-01

Background Understanding the dynamic mechanism behind the transcriptional organization of genes in response to varying environmental conditions requires time-dependent data. The dynamic transcriptional response obtained by real-time RT-qPCR experiments could only be correctly interpreted if suitable reference genes are used in the analysis. The lack of available studies on the identification of candidate reference genes in dynamic gene expression studies necessitates the identification and the verification of a suitable gene set for the analysis of transient gene expression response. Principal Findings In this study, a candidate reference gene set for RT-qPCR analysis of dynamic transcriptional changes in Saccharomyces cerevisiae was determined using 31 different publicly available time series transcriptome datasets. Ten of the twelve candidates (TPI1, FBA1, CCW12, CDC19, ADH1, PGK1, GCN4, PDC1, RPS26A and ARF1) we identified were not previously reported as potential reference genes. Our method also identified the commonly used reference genes ACT1 and TDH3. The most stable reference genes from this pool were determined as TPI1, FBA1, CDC19 and ACT1 in response to a perturbation in the amount of available glucose and as FBA1, TDH3, CCW12 and ACT1 in response to a perturbation in the amount of available ammonium. The use of these newly proposed gene sets outperformed the use of common reference genes in the determination of dynamic transcriptional response of the target genes, HAP4 and MEP2, in response to relaxation from glucose and ammonium limitations, respectively. Conclusions A candidate reference gene set to be used in dynamic real-time RT-qPCR expression profiling in yeast was proposed for the first time in the present study. Suitable pools of stable reference genes to be used under different experimental conditions could be selected from this candidate set in order to successfully determine the expression profiles for the genes of interest. PMID:22675547

The Association of CD81 Polymorphisms with Alloimmunization in Sickle Cell Disease

PubMed Central

Tatari-Calderone, Zohreh; Tamouza, Ryad; Le Bouder, Gama P.; Dewan, Ramita; Luban, Naomi L. C.; Lasserre, Jacqueline; Maury, Jacqueline; Lionnet, François; Krishnamoorthy, Rajagopal; Girot, Robert

2013-01-01

The goal of the present work was to identify the candidate genetic markers predictive of alloimmunization in sickle cell disease (SCD). Red blood cell (RBC) transfusion is indicated for acute treatment, prevention, and abrogation of some complications of SCD. A well-known consequence of multiple RBC transfusions is alloimmunization. Given that a subset of SCD patients develop multiple RBC allo-/autoantibodies, while others do not in a similar multiple transfusional setting, we investigated a possible genetic basis for alloimmunization. Biomarker(s) which predicts (predict) susceptibility to alloimmunization could identify patients at risk before the onset of a transfusion program and thus may have important implications for clinical management. In addition, such markers could shed light on the mechanism(s) underlying alloimmunization. We genotyped 27 single nucleotide polymorphisms (SNPs) in the CD81, CHRNA10, and ARHG genes in two groups of SCD patients. One group (35) of patients developed alloantibodies, and another (40) had no alloantibodies despite having received multiple transfusions. Two SNPs in the CD81 gene, that encodes molecule involved in the signal modulation of B lymphocytes, show a strong association with alloimmunization. If confirmed in prospective studies with larger cohorts, the two SNPs identified in this retrospective study could serve as predictive biomarkers for alloimmunization. PMID:23762099

Loci Contributing to Boric Acid Toxicity in Two Reference Populations of Drosophila melanogaster

PubMed Central

Najarro, Michael A.; Hackett, Jennifer L.; Macdonald, Stuart J.

2017-01-01

Populations maintain considerable segregating variation in the response to toxic, xenobiotic compounds. To identify variants associated with resistance to boric acid, a commonly-used household insecticide with a poorly understood mechanism of action, we assayed thousands of individuals from hundreds of strains. Using the Drosophila Synthetic Population Resource (DSPR), a multi-parental population (MPP) of inbred genotypes, we mapped six QTL to short genomic regions containing few protein-coding genes (3–188), allowing us to identify plausible candidate genes underlying resistance to boric acid toxicity. One interval contains multiple genes from the cytochrome P450 family, and we show that ubiquitous RNAi of one of these genes, Cyp9b2, markedly reduces resistance to the toxin. Resistance to boric acid is positively correlated with caffeine resistance. The two phenotypes additionally share a pair of QTL, potentially suggesting a degree of pleiotropy in the genetic control of resistance to these two distinct xenobiotics. Finally, we screened the Drosophila Genetic Reference Panel (DGRP) in an attempt to identify sequence variants within mapped QTL that are associated with boric acid resistance. The approach was largely unsuccessful, with only one QTL showing any associations at QTL-specific 20% False Discovery Rate (FDR) thresholds. Nonetheless, these associations point to a potential candidate gene that can be targeted in future validation efforts. Although the mapping data resulting from the two reference populations do not clearly overlap, our work provides a starting point for further genetic dissection of the processes underlying boric acid toxicity in insects. PMID:28592646

Loci Contributing to Boric Acid Toxicity in Two Reference Populations of Drosophila melanogaster.

PubMed

Najarro, Michael A; Hackett, Jennifer L; Macdonald, Stuart J

2017-06-07

Populations maintain considerable segregating variation in the response to toxic, xenobiotic compounds. To identify variants associated with resistance to boric acid, a commonly-used household insecticide with a poorly understood mechanism of action, we assayed thousands of individuals from hundreds of strains. Using the Drosophila Synthetic Population Resource (DSPR), a multi-parental population (MPP) of inbred genotypes, we mapped six QTL to short genomic regions containing few protein-coding genes (3-188), allowing us to identify plausible candidate genes underlying resistance to boric acid toxicity. One interval contains multiple genes from the cytochrome P450 family, and we show that ubiquitous RNAi of one of these genes, Cyp9b2 , markedly reduces resistance to the toxin. Resistance to boric acid is positively correlated with caffeine resistance. The two phenotypes additionally share a pair of QTL, potentially suggesting a degree of pleiotropy in the genetic control of resistance to these two distinct xenobiotics. Finally, we screened the Drosophila Genetic Reference Panel (DGRP) in an attempt to identify sequence variants within mapped QTL that are associated with boric acid resistance. The approach was largely unsuccessful, with only one QTL showing any associations at QTL-specific 20% False Discovery Rate (FDR) thresholds. Nonetheless, these associations point to a potential candidate gene that can be targeted in future validation efforts. Although the mapping data resulting from the two reference populations do not clearly overlap, our work provides a starting point for further genetic dissection of the processes underlying boric acid toxicity in insects. Copyright © 2017 Najarro et al.

Improved Innate and Adaptive Immunostimulation by Genetically Modified HIV-1 Protein Expressing NYVAC Vectors

PubMed Central

Quakkelaar, Esther D.; Redeker, Anke; Haddad, Elias K.; Harari, Alexandre; McCaughey, Stella Mayo; Duhen, Thomas; Filali-Mouhim, Abdelali; Goulet, Jean-Philippe; Loof, Nikki M.; Ossendorp, Ferry; Perdiguero, Beatriz; Heinen, Paul; Gomez, Carmen E.; Kibler, Karen V.; Koelle, David M.; Sékaly, Rafick P.; Sallusto, Federica; Lanzavecchia, Antonio; Pantaleo, Giuseppe; Esteban, Mariano; Tartaglia, Jim; Jacobs, Bertram L.; Melief, Cornelis J. M.

2011-01-01

Attenuated poxviruses are safe and capable of expressing foreign antigens. Poxviruses are applied in veterinary vaccination and explored as candidate vaccines for humans. However, poxviruses express multiple genes encoding proteins that interfere with components of the innate and adaptive immune response. This manuscript describes two strategies aimed to improve the immunogenicity of the highly attenuated, host-range restricted poxvirus NYVAC: deletion of the viral gene encoding type-I interferon-binding protein and development of attenuated replication-competent NYVAC. We evaluated these newly generated NYVAC mutants, encoding HIV-1 env, gag, pol and nef, for their ability to stimulate HIV-specific CD8 T-cell responses in vitro from blood mononuclear cells of HIV-infected subjects. The new vectors were evaluated and compared to the parental NYVAC vector in dendritic cells (DCs), RNA expression arrays, HIV gag expression and cross-presentation assays in vitro. Deletion of type-I interferon-binding protein enhanced expression of interferon and interferon-induced genes in DCs, and increased maturation of infected DCs. Restoration of replication competence induced activation of pathways involving antigen processing and presentation. Also, replication-competent NYVAC showed increased Gag expression in infected cells, permitting enhanced cross-presentation to HIV-specific CD8 T cells and proliferation of HIV-specific memory CD8 T-cells in vitro. The recombinant NYVAC combining both modifications induced interferon-induced genes and genes involved in antigen processing and presentation, as well as increased Gag expression. This combined replication-competent NYVAC is a promising candidate for the next generation of HIV vaccines. PMID:21347234

GeneMachine: gene prediction and sequence annotation.

PubMed

Makalowska, I; Ryan, J F; Baxevanis, A D

2001-09-01

A number of free-standing programs have been developed in order to help researchers find potential coding regions and deduce gene structure for long stretches of what is essentially 'anonymous DNA'. As these programs apply inherently different criteria to the question of what is and is not a coding region, multiple algorithms should be used in the course of positional cloning and positional candidate projects to assure that all potential coding regions within a previously-identified critical region are identified. We have developed a gene identification tool called GeneMachine which allows users to query multiple exon and gene prediction programs in an automated fashion. BLAST searches are also performed in order to see whether a previously-characterized coding region corresponds to a region in the query sequence. A suite of Perl programs and modules are used to run MZEF, GENSCAN, GRAIL 2, FGENES, RepeatMasker, Sputnik, and BLAST. The results of these runs are then parsed and written into ASN.1 format. Output files can be opened using NCBI Sequin, in essence using Sequin as both a workbench and as a graphical viewer. The main feature of GeneMachine is that the process is fully automated; the user is only required to launch GeneMachine and then open the resulting file with Sequin. Annotations can then be made to these results prior to submission to GenBank, thereby increasing the intrinsic value of these data. GeneMachine is freely-available for download at http://genome.nhgri.nih.gov/genemachine. A public Web interface to the GeneMachine server for academic and not-for-profit users is available at http://genemachine.nhgri.nih.gov. The Web supplement to this paper may be found at http://genome.nhgri.nih.gov/genemachine/supplement/.

Schizophrenia, vitamin D, and brain development.

PubMed

Mackay-Sim, Alan; Féron, François; Eyles, Darryl; Burne, Thomas; McGrath, John

2004-01-01

Schizophrenia research is invigorated at present by the recent discovery of several plausible candidate susceptibility genes identified from genetic linkage and gene expression studies of brains from persons with schizophrenia. It is a current challenge to reconcile this gathering evidence for specific candidate susceptibility genes with the "neurodevelopmental hypothesis," which posits that schizophrenia arises from gene-environment interactions that disrupt brain development. We make the case here that schizophrenia may result not from numerous genes of small effect, but a few genes of transcriptional regulation acting during brain development. In particular we propose that low vitamin D during brain development interacts with susceptibility genes to alter the trajectory of brain development, probably by epigenetic regulation that alters gene expression throughout adult life. Vitamin D is an attractive "environmental" candidate because it appears to explain several key epidemiological features of schizophrenia. Vitamin D is an attractive "genetic" candidate because its nuclear hormone receptor regulates gene expression and nervous system development. The polygenic quality of schizophrenia, with linkage to many genes of small effect, maybe brought together via this "vitamin D hypothesis." We also discuss the possibility of a broader set of environmental and genetic factors interacting via the nuclear hormone receptors to affect the development of the brain leading to schizophrenia.

Multi-Dimensional Prioritization of Dental Caries Candidate Genes and Its Enriched Dense Network Modules

PubMed Central

Wang, Quan; Jia, Peilin; Cuenco, Karen T.; Feingold, Eleanor; Marazita, Mary L.; Wang, Lily; Zhao, Zhongming

2013-01-01

A number of genetic studies have suggested numerous susceptibility genes for dental caries over the past decade with few definite conclusions. The rapid accumulation of relevant information, along with the complex architecture of the disease, provides a challenging but also unique opportunity to review and integrate the heterogeneous data for follow-up validation and exploration. In this study, we collected and curated candidate genes from four major categories: association studies, linkage scans, gene expression analyses, and literature mining. Candidate genes were prioritized according to the magnitude of evidence related to dental caries. We then searched for dense modules enriched with the prioritized candidate genes through their protein-protein interactions (PPIs). We identified 23 modules comprising of 53 genes. Functional analyses of these 53 genes revealed three major clusters: cytokine network relevant genes, matrix metalloproteinases (MMPs) family, and transforming growth factor-beta (TGF-β) family, all of which have been previously implicated to play important roles in tooth development and carious lesions. Through our extensive data collection and an integrative application of gene prioritization and PPI network analyses, we built a dental caries-specific sub-network for the first time. Our study provided insights into the molecular mechanisms underlying dental caries. The framework we proposed in this work can be applied to other complex diseases. PMID:24146904

Characterization of potential driver mutations involved in human breast cancer by computational approaches

PubMed Central

Rajendran, Barani Kumar; Deng, Chu-Xia

2017-01-01

Breast cancer is the second most frequently occurring form of cancer and is also the second most lethal cancer in women worldwide. A genetic mutation is one of the key factors that alter multiple cellular regulatory pathways and drive breast cancer initiation and progression yet nature of these cancer drivers remains elusive. In this article, we have reviewed various computational perspectives and algorithms for exploring breast cancer driver mutation genes. Using both frequency based and mutational exclusivity based approaches, we identified 195 driver genes and shortlisted 63 of them as candidate drivers for breast cancer using various computational approaches. Finally, we conducted network and pathway analysis to explore their functions in breast tumorigenesis including tumor initiation, progression, and metastasis. PMID:28477017

Mycobacterium tuberculosis toxin Rv2872 is an RNase involved in vancomycin stress response and biofilm development.

PubMed

Wang, Xiaoyu; Zhao, Xiaokang; Wang, Hao; Huang, Xue; Duan, Xiangke; Gu, Yinzhong; Lambert, Nzungize; Zhang, Ke; Kou, Zhenhao; Xie, Jianping

2018-06-11

Bacterial toxin-antitoxin (TA) systems are emerging important regulators of multiple cellular physiological events and candidates for novel antibiotic targets. To explore the role of Mycobacterium tuberculosis function, unknown toxin gene Rv2872 was heterologously expressed in Mycobacterium smegmatis (MS_Rv2872). Upon induction, MS_Rv2872 phenotype differed significantly from the control, such as increased vancomycin resistance, retarded growth, cell wall, and biofilm structure. This phenotype change might result from the RNase activity of Rv2872 as purified Rv2872 toxin protein can cleave the products of several key genes involved in abovementioned phenotypes. In summary, toxin Rv2872 was firstly reported to be a endonuclease involved in antibiotic stress responses, cell wall structure, and biofilm development.

Integrative Approach to Pain Genetics Identifies Pain Sensitivity Loci across Diseases

PubMed Central

Ruau, David; Dudley, Joel T.; Chen, Rong; Phillips, Nicholas G.; Swan, Gary E.; Lazzeroni, Laura C.; Clark, J. David

2012-01-01

Identifying human genes relevant for the processing of pain requires difficult-to-conduct and expensive large-scale clinical trials. Here, we examine a novel integrative paradigm for data-driven discovery of pain gene candidates, taking advantage of the vast amount of existing disease-related clinical literature and gene expression microarray data stored in large international repositories. First, thousands of diseases were ranked according to a disease-specific pain index (DSPI), derived from Medical Subject Heading (MESH) annotations in MEDLINE. Second, gene expression profiles of 121 of these human diseases were obtained from public sources. Third, genes with expression variation significantly correlated with DSPI across diseases were selected as candidate pain genes. Finally, selected candidate pain genes were genotyped in an independent human cohort and prospectively evaluated for significant association between variants and measures of pain sensitivity. The strongest signal was with rs4512126 (5q32, ABLIM3, P = 1.3×10−10) for the sensitivity to cold pressor pain in males, but not in females. Significant associations were also observed with rs12548828, rs7826700 and rs1075791 on 8q22.2 within NCALD (P = 1.7×10−4, 1.8×10−4, and 2.2×10−4 respectively). Our results demonstrate the utility of a novel paradigm that integrates publicly available disease-specific gene expression data with clinical data curated from MEDLINE to facilitate the discovery of pain-relevant genes. This data-derived list of pain gene candidates enables additional focused and efficient biological studies validating additional candidates. PMID:22685391

Genome-wide association studies and epistasis analyses of candidate genes related to age at menarche and age at natural menopause in a Korean population.

PubMed

Pyun, Jung-A; Kim, Sunshin; Cho, Nam H; Koh, InSong; Lee, Jong-Young; Shin, Chol; Kwack, KyuBum

2014-05-01

The aim of this study was to identify polymorphisms and gene-gene interactions that are significantly associated with age at menarche and age at menopause in a Korean population. A total of 3,452 and 1,827 women participated in studies of age at menarche and age at natural menopause, respectively. Linear regression analyses adjusted for residence area were used to perform genome-wide association studies (GWAS), candidate gene association studies, and interactions between the candidate genes for age at menarche and age at natural menopause. In GWAS, four single nucleotide polymorphisms (SNPs; rs7528241, rs1324329, rs11597068, and rs6495785) were strongly associated with age at natural menopause (lowest P = 9.66 × 10). However, GWAS of age at menarche did not reveal any strong associations. In candidate gene association studies, SNPs with P < 0.01 were selected to test their synergistic interactions. For age at natural menopause, there was a significant interaction between intronic SNPs on ADAM metallopeptidase with thrombospondin type I motif 9 (ADAMTS9) and SMAD family member 3 (SMAD3) genes (P = 9.52 × 10). For age at menarche, there were three significant interactions between three intronic SNPs on follicle-stimulating hormone receptor (FSHR) gene and one SNP located at the 3' flanking region of insulin-like growth factor 2 receptor (IGF2R) gene (lowest P = 1.95 × 10). Novel SNPs and synergistic interactions between candidate genes are significantly associated with age at menarche and age at natural menopause in a Korean population.

Genetic Contributions to Disparities in Preterm Birth

PubMed Central

Anum, Emmanuel A.; Springel, Edward H.; Shriver, Mark D.; Strauss, Jerome F.

2008-01-01

Ethnic disparity in preterm delivery between African Americans and European Americans has existed for decades, and is likely the consequence of multiple factors, including socioeconomic status, access to care, environment, and genetics. This review summarizes existing information on genetic variation and its association with preterm birth in African Americans. Candidate gene-based association studies, in which investigators have evaluated particular genes selected primarily because of their potential roles in the process of normal and pathological parturition, provide evidence that genetic contributions from both mother and fetus account for some of the disparity in preterm births. To date, most attention has been focused on genetic variation in pro- and anti-inflammatory cytokine genes and their respective receptors. These genes, particularly the pro-inflammatory cytokine genes and their receptors, are linked to matrix metabolism since these cytokines increase expression of matrix degrading metalloproteinases. However, the role that genetic variants that are different between populations play in preterm birth cannot yet be quantified. Future studies based on genome wide association or admixture mapping may reveal other genes that contribute to disparity in prematurity. PMID:18787421

High-Throughput Analysis of Promoter Occupancy Reveals New Targets for Arx, a Gene Mutated in Mental Retardation and Interneuronopathies

PubMed Central

Quillé, Marie-Lise; Hirchaud, Edouard; Baron, Daniel; Benech, Caroline; Guihot, Jeanne; Placet, Morgane; Mignen, Olivier; Férec, Claude; Houlgatte, Rémi; Friocourt, Gaëlle

2011-01-01

Genetic investigations of X-linked intellectual disabilities have implicated the ARX (Aristaless-related homeobox) gene in a wide spectrum of disorders extending from phenotypes characterised by severe neuronal migration defects such as lissencephaly, to mild or moderate forms of mental retardation without apparent brain abnormalities but with associated features of dystonia and epilepsy. Analysis of Arx spatio-temporal localisation profile in mouse revealed expression in telencephalic structures, mainly restricted to populations of GABAergic neurons at all stages of development. Furthermore, studies of the effects of ARX loss of function in humans and animal models revealed varying defects, suggesting multiple roles of this gene during brain development. However, to date, little is known about how ARX functions as a transcription factor and the nature of its targets. To better understand its role, we combined chromatin immunoprecipitation and mRNA expression with microarray analysis and identified a total of 1006 gene promoters bound by Arx in transfected neuroblastoma (N2a) cells and in mouse embryonic brain. Approximately 24% of Arx-bound genes were found to show expression changes following Arx overexpression or knock-down. Several of the Arx target genes we identified are known to be important for a variety of functions in brain development and some of them suggest new functions for Arx. Overall, these results identified multiple new candidate targets for Arx and should help to better understand the pathophysiological mechanisms of intellectual disability and epilepsy associated with ARX mutations. PMID:21966449

Recent Advances in Utilizing Transcription Factors to Improve Plant Abiotic Stress Tolerance by Transgenic Technology

PubMed Central

Wang, Hongyan; Wang, Honglei; Shao, Hongbo; Tang, Xiaoli

2016-01-01

Agricultural production and quality are adversely affected by various abiotic stresses worldwide and this will be exacerbated by the deterioration of global climate. To feed a growing world population, it is very urgent to breed stress-tolerant crops with higher yields and improved qualities against multiple environmental stresses. Since conventional breeding approaches had marginal success due to the complexity of stress tolerance traits, the transgenic approach is now being popularly used to breed stress-tolerant crops. So identifying and characterizing the critical genes involved in plant stress responses is an essential prerequisite for engineering stress-tolerant crops. Far beyond the manipulation of single functional gene, engineering certain regulatory genes has emerged as an effective strategy now for controlling the expression of many stress-responsive genes. Transcription factors (TFs) are good candidates for genetic engineering to breed stress-tolerant crop because of their role as master regulators of many stress-responsive genes. Many TFs belonging to families AP2/EREBP, MYB, WRKY, NAC, bZIP have been found to be involved in various abiotic stresses and some TF genes have also been engineered to improve stress tolerance in model and crop plants. In this review, we take five large families of TFs as examples and review the recent progress of TFs involved in plant abiotic stress responses and their potential utilization to improve multiple stress tolerance of crops in the field conditions. PMID:26904044

Identification and characterization of a new multigene family in the human MHC: A candidate autoimmune disease susceptibility element (3.8-1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harris, J.M.; Venditti, C.P.; Chorney, M.J.

1994-09-01

An association between idiopathic hemochromatosis (HFE) and the HLA-A3 locus has been previously well-established. In an attempt to identify potential HFE candidate genes, a genomic DNA fragment distal to the HLA-A9 breakpoint was used to screen a B cell cDNA library; a member (3.8-1) of a new multigene family, composed of five distinct genomic cross-reactive fragments, was identified. Clone 3.8-1 represents the 3{prime} end of 9.6 kb transcript which is expressed in multiple tissues including the spleen, thymus, lung and kidney. Sequencing and genome database analysis indicate that 3.8-1 is unique, with no homology to any known entries. The genomicmore » residence of 3-8.1, defined by polymorphism analysis and physical mapping using YAC clones, appears to be absent from the genomes of higher primates, although four other cross-reactivities are maintained. The absence of this gene as well as other probes which map in the TNF to HLA-B interval, suggest that this portion of the human HMC, located between the Class I and Class III regions, arose in humans as the result of a post-speciation insertional event. The large size of the 3.8-1 gene and the possible categorization of 3.8-1 as a human-specific gene are significant given the genetic data that place an autoimmune susceptibility element for IDDM and myasthenia gravis in the precise region where this gene resides. In an attempt to isolate the 5{prime} end of this large transcript, we have constructed a cosmid contig which encompasses the genomic locus of this gene and are progressively isolating coding sequences by exon trapping.« less

A genome-wide association scan for acute insulin response to glucose in Hispanic Americans: The IRAS Family Study

PubMed Central

Rich, S. S.; Goodarzi, M. O.; Palmer, N. D.; Langefeld, C. D.; Ziegler, J.; Haffner, S. M.; Bryer-Ash, M.; Norris, J. M.; Taylor, K. D.; Haritunians, T.; Rotter, J. I.; Chen, Y-D. I.; Wagenknecht, L. E.; Bowden, D. W.; Bergman, R. N.

2009-01-01

Aims/Hypothesis The goal of this study was to identify genes and regions in the human genome that are associated with the acute insulin response to glucose (AIRg), an important predictor of type 2 diabetes, in Hispanic-American participants from the Insulin Resistance Atherosclerosis Family Study (IRAS FS). Methods A two-stage genome-wide association scan (GWAS) was performed in IRAS FS Hispanic-American samples. In the first stage, 318K single nucleotide polymorphisms (SNPs) were assessed in 229 Hispanic-American DNA samples (from 34 families) from San Antonio, TX. SNPs with the most significant associations with AIRg were genotyped in the entire set of IRAS FS Hispanic-American samples (n = 1190). In chromosomal regions with evidence of association, additional SNPs were genotyped to capture variation in genes. Results No individual SNP achieved genome-wide levels of significance (P < 5 × 10-7); however, two regions — chromosomes 6p21 and 20p11 — had multiple highly-ranked SNPs that were associated with AIRg. Additional genotyping in these regions supported the initial evidence for variants contributing to variation in AIRg. One region resides in a gene desert between PXT1 and KCTD20 on 6p21 while the region on 20p11 has several viable candidate genes (ENTPD6, PYGB, GINS1 and R4-691N24.1). Conclusions/Interpretation A GWAS in Hispanic-American samples identified several candidate genes and loci that may be associated with AIRg. These associations explain a small component of variation in AIRg. The genes identified are involved in phosphorylation and ion transport and provide preliminary evidence that these processes have importance in beta cell response. PMID:19430760

A genome-wide association scan for acute insulin response to glucose in Hispanic-Americans: the Insulin Resistance Atherosclerosis Family Study (IRAS FS).

PubMed

Rich, S S; Goodarzi, M O; Palmer, N D; Langefeld, C D; Ziegler, J; Haffner, S M; Bryer-Ash, M; Norris, J M; Taylor, K D; Haritunians, T; Rotter, J I; Chen, Y-D I; Wagenknecht, L E; Bowden, D W; Bergman, R N

2009-07-01

This study sought to identify genes and regions in the human genome that are associated with the acute insulin response to glucose (AIRg), an important predictor of type 2 diabetes, in Hispanic-American participants from the Insulin Resistance Atherosclerosis Family Study (IRAS FS). A two-stage genome-wide association scan (GWAS) was performed in IRAS FS Hispanic-American samples. In the first stage, 317K single nucleotide polymorphisms (SNPs) were assessed in 229 Hispanic-American DNA samples from 34 families from San Antonio, TX, USA. SNPs with the most significant associations with AIRg were genotyped in the entire set of IRAS FS Hispanic-American samples (n = 1,190). In chromosomal regions with evidence of association, additional SNPs were genotyped to capture variation in genes. No individual SNP achieved genome-wide levels of significance (p < 5 x 10(-7)); however, two regions (chromosomes 6p21 and 20p11) had multiple highly ranked SNPs that were associated with AIRg. Additional genotyping in these regions supported the initial evidence of variants contributing to variation in AIRg. One region resides in a gene desert between PXT1 and KCTD20 on 6p21, while the region on 20p11 has several viable candidate genes (ENTPD6, PYGB, GINS1 and RP4-691N24.1). A GWAS in Hispanic-American samples identified several candidate genes and loci that may be associated with AIRg. These associations explain a small component of variation in AIRg. The genes identified are involved in phosphorylation and ion transport, and provide preliminary evidence that these processes are important in beta cell response.

Association, effects and validation of polymorphisms within the NCAPG - LCORL locus located on BTA6 with feed intake, gain, meat and carcass traits in beef cattle

PubMed Central

2011-01-01

Background In a previously reported genome-wide association study based on a high-density bovine SNP genotyping array, 8 SNP were nominally associated (P ≤ 0.003) with average daily gain (ADG) and 3 of these were also associated (P ≤ 0.002) with average daily feed intake (ADFI) in a population of crossbred beef cattle. The SNP were clustered in a 570 kb region around 38 Mb on the draft sequence of bovine chromosome 6 (BTA6), an interval containing several positional and functional candidate genes including the bovine LAP3, NCAPG, and LCORL genes. The goal of the present study was to develop and examine additional markers in this region to optimize the ability to distinguish favorable alleles, with potential to identify functional variation. Results Animals from the original study were genotyped for 47 SNP within or near the gene boundaries of the three candidate genes. Sixteen markers in the NCAPG-LCORL locus displayed significant association with both ADFI and ADG even after stringent correction for multiple testing (P ≤ 005). These markers were evaluated for their effects on meat and carcass traits. The alleles associated with higher ADFI and ADG were also associated with higher hot carcass weight (HCW) and ribeye area (REA), and lower adjusted fat thickness (AFT). A reduced set of markers was genotyped on a separate, crossbred population including genetic contributions from 14 beef cattle breeds. Two of the markers located within the LCORL gene locus remained significant for ADG (P ≤ 0.04). Conclusions Several markers within the NCAPG-LCORL locus were significantly associated with feed intake and body weight gain phenotypes. These markers were also associated with HCW, REA and AFT suggesting that they are involved with lean growth and reduced fat deposition. Additionally, the two markers significant for ADG in the validation population of animals may be more robust for the prediction of ADG and possibly the correlated trait ADFI, across multiple breeds and populations of cattle. PMID:22168586

The Effects of Selenium Supplementation on Gene Expression Related to Insulin and Lipid in Infertile Polycystic Ovary Syndrome Women Candidate for In Vitro Fertilization: a Randomized, Double-Blind, Placebo-Controlled Trial.

PubMed

Zadeh Modarres, Shahrzad; Heidar, Zahra; Foroozanfard, Fatemeh; Rahmati, Zahra; Aghadavod, Esmat; Asemi, Zatollah

2018-06-01

This study was conducted to evaluate the effects of selenium supplementation on gene expression related to insulin and lipid in infertile women with polycystic ovary syndrome (PCOS) candidate for in vitro fertilization (IVF). This randomized double-blind, placebo-controlled trial was conducted among 40 infertile women with PCOS candidate for IVF. Subjects were randomly allocated into two groups to intake either 200-μg selenium (n = 20) or placebo (n = 20) per day for 8 weeks. Gene expression levels related to insulin and lipid were quantified in lymphocytes of women with PCOS candidate for IVF with RT-PCR method. Results of RT-PCR demonstrated that after the 8-week intervention, compared with the placebo, selenium supplementation upregulated gene expression of peroxisome proliferator-activated receptor gamma (PPAR-γ) (1.06 ± 0.15-fold increase vs. 0.94 ± 0.18-fold reduction, P = 0.02) and glucose transporter 1 (GLUT-1) (1.07 ± 0.20-fold increase vs. 0.87 ± 0.18-fold reduction, P = 0.003) in lymphocytes of women with PCOS candidate for IVF. In addition, compared with the placebo, selenium supplementation downregulated gene expression of low-density lipoprotein receptor (LDLR) (0.88 ± 0.17-fold reduction vs. 1.05 ± 0.22-fold increase, P = 0.01) in lymphocytes of women with PCOS candidate for IVF. We did not observe any significant effect of selenium supplementation on gene expression levels of lipoprotein(a) [LP(a)] in lymphocytes of women with PCOS candidate for IVF. Overall, selenium supplementation for 8 weeks in lymphocytes of women with infertile PCOS candidate for IVF significantly increased gene expression levels of PPAR-γ and GLUT-1 and significantly decreased gene expression levels of LDLR, but did not affect LP(a). http://www.irct.ir : IRCT201704245623N113.

Identification of driving network of cellular differentiation from single sample time course gene expression data

NASA Astrophysics Data System (ADS)

Chen, Ye; Wolanyk, Nathaniel; Ilker, Tunc; Gao, Shouguo; Wang, Xujing

Methods developed based on bifurcation theory have demonstrated their potential in driving network identification for complex human diseases, including the work by Chen, et al. Recently bifurcation theory has been successfully applied to model cellular differentiation. However, there one often faces a technical challenge in driving network prediction: time course cellular differentiation study often only contains one sample at each time point, while driving network prediction typically require multiple samples at each time point to infer the variation and interaction structures of candidate genes for the driving network. In this study, we investigate several methods to identify both the critical time point and the driving network through examination of how each time point affects the autocorrelation and phase locking. We apply these methods to a high-throughput sequencing (RNA-Seq) dataset of 42 subsets of thymocytes and mature peripheral T cells at multiple time points during their differentiation (GSE48138 from GEO). We compare the predicted driving genes with known transcription regulators of cellular differentiation. We will discuss the advantages and limitations of our proposed methods, as well as potential further improvements of our methods.

Finding gene regulatory network candidates using the gene expression knowledge base.

PubMed

Venkatesan, Aravind; Tripathi, Sushil; Sanz de Galdeano, Alejandro; Blondé, Ward; Lægreid, Astrid; Mironov, Vladimir; Kuiper, Martin

2014-12-10

Network-based approaches for the analysis of large-scale genomics data have become well established. Biological networks provide a knowledge scaffold against which the patterns and dynamics of 'omics' data can be interpreted. The background information required for the construction of such networks is often dispersed across a multitude of knowledge bases in a variety of formats. The seamless integration of this information is one of the main challenges in bioinformatics. The Semantic Web offers powerful technologies for the assembly of integrated knowledge bases that are computationally comprehensible, thereby providing a potentially powerful resource for constructing biological networks and network-based analysis. We have developed the Gene eXpression Knowledge Base (GeXKB), a semantic web technology based resource that contains integrated knowledge about gene expression regulation. To affirm the utility of GeXKB we demonstrate how this resource can be exploited for the identification of candidate regulatory network proteins. We present four use cases that were designed from a biological perspective in order to find candidate members relevant for the gastrin hormone signaling network model. We show how a combination of specific query definitions and additional selection criteria derived from gene expression data and prior knowledge concerning candidate proteins can be used to retrieve a set of proteins that constitute valid candidates for regulatory network extensions. Semantic web technologies provide the means for processing and integrating various heterogeneous information sources. The GeXKB offers biologists such an integrated knowledge resource, allowing them to address complex biological questions pertaining to gene expression. This work illustrates how GeXKB can be used in combination with gene expression results and literature information to identify new potential candidates that may be considered for extending a gene regulatory network.

The effects of polymorphisms in IL-2, IFN-γ, TGF-β2, IgL, TLR-4, MD-2, and iNOS genes on resistance to Salmonella enteritidis in indigenous chickens.

PubMed

Tohidi, Reza; Idris, Ismail Bin; Panandam, Jothi Malar; Bejo, Mohd Hair

2012-12-01

Salmonella Enteritidis is a major cause of food poisoning worldwide, and poultry products are the main source of S. Enteritidis contamination for humans. Among the numerous strategies for disease control, improving genetic resistance to S. Enteritidis has been the most effective approach. We investigated the association between S. Enteritidis burden in the caecum, spleen, and liver of young indigenous chickens and seven candidate genes, selected on the basis of their critical roles in immunological functions. The genes included those encoding interleukin 2 (IL-2), interferon-γ (IFN-γ), transforming growth factor β2 (TGF-β2), immunoglobulin light chain (IgL), toll-like receptor 4 (TLR-4), myeloid differentiation protein 2 (MD-2), and inducible nitric oxide synthase (iNOS). Two Malaysian indigenous chicken breeds were used as sustainable genetic sources of alleles that are resistant to salmonellosis. The polymerase chain reaction restriction fragment-length polymorphism technique was used to genotype the candidate genes. Three different genotypes were observed in all of the candidate genes, except for MD-2. All of the candidate genes showed the Hardy-Weinberg equilibrium for the two populations. The IL-2-MnlI polymorphism was associated with S. Enteritidis burden in the caecum and spleen. The TGF-β2-RsaI, TLR-4-Sau 96I, and iNOS-AluI polymorphisms were associated with the caecum S. Enteritidis load. The other candidate genes were not associated with S. Enteritidis load in any organ. The results indicate that the IL-2, TGF-β2, TLR-4, and iNOS genes are potential candidates for use in selection programmes for increasing genetic resistance against S. Enteritidis in Malaysian indigenous chickens.

A Systems Level, Functional Genomics Analysis of Chronic Epilepsy

PubMed Central

Bragin, Anatol; Kudo, Lili C.; Gehman, Lauren; Ruidera, Josephine; Geschwind, Daniel H.; Engel, Jerome

2011-01-01

Neither the molecular basis of the pathologic tendency of neuronal circuits to generate spontaneous seizures (epileptogenicity) nor anti-epileptogenic mechanisms that maintain a seizure-free state are well understood. Here, we performed transcriptomic analysis in the intrahippocampal kainate model of temporal lobe epilepsy in rats using both Agilent and Codelink microarray platforms to characterize the epileptic processes. The experimental design allowed subtraction of the confounding effects of the lesion, identification of expression changes associated with epileptogenicity, and genes upregulated by seizures with potential homeostatic anti-epileptogenic effects. Using differential expression analysis, we identified several hundred expression changes in chronic epilepsy, including candidate genes associated with epileptogenicity such as Bdnf and Kcnj13. To analyze these data from a systems perspective, we applied weighted gene co-expression network analysis (WGCNA) to identify groups of co-expressed genes (modules) and their central (hub) genes. One such module contained genes upregulated in the epileptogenic region, including multiple epileptogenicity candidate genes, and was found to be involved the protection of glial cells against oxidative stress, implicating glial oxidative stress in epileptogenicity. Another distinct module corresponded to the effects of chronic seizures and represented changes in neuronal synaptic vesicle trafficking. We found that the network structure and connectivity of one hub gene, Sv2a, showed significant changes between normal and epileptogenic tissue, becoming more highly connected in epileptic brain. Since Sv2a is a target of the antiepileptic levetiracetam, this module may be important in controlling seizure activity. Bioinformatic analysis of this module also revealed a potential mechanism for the observed transcriptional changes via generation of longer alternatively polyadenlyated transcripts through the upregulation of the RNA binding protein HuD. In summary, combining conventional statistical methods and network analysis allowed us to interpret the differentially regulated genes from a systems perspective, yielding new insight into several biological pathways underlying homeostatic anti-epileptogenic effects and epileptogenicity. PMID:21695113

The Genetic Basis for Variation in Sensitivity to Lead Toxicity in Drosophila melanogaster

PubMed Central

Zhou, Shanshan; Morozova, Tatiana V.; Hussain, Yasmeen N.; Luoma, Sarah E.; McCoy, Lenovia; Yamamoto, Akihiko; Mackay, Trudy F.C.; Anholt, Robert R.H.

2016-01-01

Background: Lead toxicity presents a worldwide health problem, especially due to its adverse effects on cognitive development in children. However, identifying genes that give rise to individual variation in susceptibility to lead toxicity is challenging in human populations. Objectives: Our goal was to use Drosophila melanogaster to identify evolutionarily conserved candidate genes associated with individual variation in susceptibility to lead exposure. Methods: To identify candidate genes associated with variation in susceptibility to lead toxicity, we measured effects of lead exposure on development time, viability and adult activity in the Drosophila melanogaster Genetic Reference Panel (DGRP) and performed genome-wide association analyses to identify candidate genes. We used mutants to assess functional causality of candidate genes and constructed a genetic network associated with variation in sensitivity to lead exposure, on which we could superimpose human orthologs. Results: We found substantial heritabilities for all three traits and identified candidate genes associated with variation in susceptibility to lead exposure for each phenotype. The genetic architectures that determine variation in sensitivity to lead exposure are highly polygenic. Gene ontology and network analyses showed enrichment of genes associated with early development and function of the nervous system. Conclusions: Drosophila melanogaster presents an advantageous model to study the genetic underpinnings of variation in susceptibility to lead toxicity. Evolutionary conservation of cellular pathways that respond to toxic exposure allows predictions regarding orthologous genes and pathways across phyla. Thus, studies in the D. melanogaster model system can identify candidate susceptibility genes to guide subsequent studies in human populations. Citation: Zhou S, Morozova TV, Hussain YN, Luoma SE, McCoy L, Yamamoto A, Mackay TF, Anholt RR. 2016. The genetic basis for variation in sensitivity to lead toxicity in Drosophila melanogaster. Environ Health Perspect 124:1062–1070; http://dx.doi.org/10.1289/ehp.1510513 PMID:26859824

Secretome Characterization and Correlation Analysis Reveal Putative Pathogenicity Mechanisms and Identify Candidate Avirulence Genes in the Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici.

PubMed

Xia, Chongjing; Wang, Meinan; Cornejo, Omar E; Jiwan, Derick A; See, Deven R; Chen, Xianming

2017-01-01

Stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat worldwide. Planting resistant cultivars is an effective way to control this disease, but race-specific resistance can be overcome quickly due to the rapid evolving Pst population. Studying the pathogenicity mechanisms is critical for understanding how Pst virulence changes and how to develop wheat cultivars with durable resistance to stripe rust. We re-sequenced 7 Pst isolates and included additional 7 previously sequenced isolates to represent balanced virulence/avirulence profiles for several avirulence loci in seretome analyses. We observed an uneven distribution of heterozygosity among the isolates. Secretome comparison of Pst with other rust fungi identified a large portion of species-specific secreted proteins, suggesting that they may have specific roles when interacting with the wheat host. Thirty-two effectors of Pst were identified from its secretome. We identified candidates for Avr genes corresponding to six Yr genes by correlating polymorphisms for effector genes to the virulence/avirulence profiles of the 14 Pst isolates. The putative AvYr76 was present in the avirulent isolates, but absent in the virulent isolates, suggesting that deleting the coding region of the candidate avirulence gene has produced races virulent to resistance gene Yr76 . We conclude that incorporating avirulence/virulence phenotypes into correlation analysis with variations in genomic structure and secretome, particularly presence/absence polymorphisms of effectors, is an efficient way to identify candidate Avr genes in Pst . The candidate effector genes provide a rich resource for further studies to determine the evolutionary history of Pst populations and the co-evolutionary arms race between Pst and wheat. The Avr candidates identified in this study will lead to cloning avirulence genes in Pst , which will enable us to understand molecular mechanisms underlying Pst -wheat interactions, to determine the effectiveness of resistance genes and further to develop durable resistance to stripe rust.

Gene expression in cerebral ischemia: a new approach for neuroprotection.

PubMed

Millán, Mónica; Arenillas, Juan

2006-01-01

Cerebral ischemia is one of the strongest stimuli for gene induction in the brain. Hundreds of genes have been found to be induced by brain ischemia. Many genes are involved in neurodestructive functions such as excitotoxicity, inflammatory response and neuronal apoptosis. However, cerebral ischemia is also a powerful reformatting and reprogramming stimulus for the brain through neuroprotective gene expression. Several genes may participate in both cellular responses. Thus, isolation of candidate genes for neuroprotection strategies and interpretation of expression changes have been proven difficult. Nevertheless, many studies are being carried out to improve the knowledge of the gene activation and protein expression following ischemic stroke, as well as in the development of new therapies that modify biochemical, molecular and genetic changes underlying cerebral ischemia. Owing to the complexity of the process involving numerous critical genes expressed differentially in time, space and concentration, ongoing therapeutic efforts should be based on multiple interventions at different levels. By modification of the acute gene expression induced by ischemia or the apoptotic gene program, gene therapy is a promising treatment but is still in a very experimental phase. Some hurdles will have to be overcome before these therapies can be introduced into human clinical stroke trials. Copyright 2006 S. Karger AG, Basel.

Multiple capacitors for natural genetic variation in Drosophila melanogaster.

PubMed

Takahashi, Kazuo H

2013-03-01

Cryptic genetic variation (CGV) or a standing genetic variation that is not ordinarily expressed as a phenotype is released when the robustness of organisms is impaired under environmental or genetic perturbations. Evolutionary capacitors modulate the amount of genetic variation exposed to natural selection and hidden cryptically; they have a fundamental effect on the evolvability of traits on evolutionary timescales. In this study, I have demonstrated the effects of multiple genomic regions of Drosophila melanogaster on CGV in wing shape. I examined the effects of 61 genomic deficiencies on quantitative and qualitative natural genetic variation in the wing shape of D. melanogaster. I have identified 10 genomic deficiencies that do not encompass a known candidate evolutionary capacitor, Hsp90, exposing natural CGV differently depending on the location of the deficiencies in the genome. Furthermore, five genomic deficiencies uncovered qualitative CGV in wing morphology. These findings suggest that CGV in wing shape of wild-type D. melanogaster is regulated by multiple capacitors with divergent functions. Future analysis of genes encompassed by these genomic regions would help elucidate novel capacitor genes and better understand the general features of capacitors regarding natural genetic variation. © 2012 Blackwell Publishing Ltd.

Acute monocytic leukemia and multiple abnormalities in a child with duplication of 1q detected by GTG-banding and SKY.

PubMed

Scrideli, Carlos A; Baruffi, Marcelo R; Squire, Jeremy A; Ramos, Ester S; Karaskova, Jana; Heck, Benjamin; Tone, Luiz G

2005-12-01

Patients with 1q duplication have demonstrated a wide range of multiple congenital abnormalities. Alterations involving this chromosomal region have being described in hematopoietic malignancies and a series of candidate genes that may be associated with neoplasias have been mapped in this region. We describe a case of partial trisomy 1q "syndrome" and acute monocytic leukemia. Cytogenetic study of the bone marrow cells by GTG-banding and spectral karyotyping (SKY) showed dup(1)(q23q44) in all cells analyzed. The dismorphological features with the dup(1q) suggest a constitutional chromosome alteration and the first, in our knowledge, association of a trisomy 1q "syndrome" with AML.

The influence of genetic variation on late toxicities in childhood cancer survivors: A review.

PubMed

Clemens, E; van der Kooi, A L F; Broer, L; van Dulmen-den Broeder, E; Visscher, H; Kremer, L; Tissing, W; Loonen, J; Ronckers, C M; Pluijm, S M F; Neggers, S J C M M; Zolk, O; Langer, T; Zehnhoff-Dinnesen, A Am; Wilson, C L; Hudson, M M; Carleton, B; Laven, J S E; Uitterlinden, A G; van den Heuvel-Eibrink, M M

2018-06-01

The variability in late toxicities among childhood cancer survivors (CCS) is only partially explained by treatment and baseline patient characteristics. Inter-individual variability in the association between treatment exposure and risk of late toxicity suggests that genetic variation possibly modifies this association. We reviewed the available literature on genetic susceptibility of late toxicity after childhood cancer treatment related to components of metabolic syndrome, bone mineral density, gonadal impairment and hearing impairment. A systematic literature search was performed, using Embase, Cochrane Library, Google Scholar, MEDLINE, and Web of Science databases. Eligible publications included all English language reports of candidate gene studies and genome wide association studies (GWAS) that aimed to identify genetic risk factors associated with the four late toxicities, defined as toxicity present after end of treatment. Twenty-seven articles were identified, including 26 candidate gene studies: metabolic syndrome (n = 6); BMD (n = 6); gonadal impairment (n = 2); hearing impairment (n = 12) and one GWAS (metabolic syndrome). Eighty percent of the genetic studies on late toxicity after childhood cancer had relatively small sample sizes (n < 200), leading to insufficient power, and lacked adjustment for multiple comparisons. Only four (4/26 = 15%) candidate gene studies had their findings validated in independent replication cohorts as part of their own report. Genetic susceptibility associations are not consistent or not replicated and therefore, currently no evidence-based recommendations can be made for hearing impairment, gonadal impairment, bone mineral density impairment and metabolic syndrome in CCS. To advance knowledge related to genetic variation influencing late toxicities among CCS, future studies need adequate power, independent cohorts for replication, harmonization of disease outcomes and sample collections, and (international) collaboration. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

A Family-Based Association Analysis and Meta-Analysis of the Reading Disabilities Candidate Gene DYX1C1

PubMed Central

Tran, C.; Gagnon, F.; Wigg, K.G.; Feng, Y.; Gomez, L.; Cate-Carter, T.D.; Kerr, E.N.; Field, L.L.; Kaplan, B.J.; Lovett, M.W.; Barr, C.L.

2017-01-01

Reading disabilities (RD) have a significant genetic basis and have shown linkage to multiple regions including chromosome 15q. Dyslexia susceptibility 1 candidate gene 1 (DYX1C1) on chromosome 15q21 was originally proposed as a candidate gene with two potentially functional polymorphisms at the −3G/A and 1249G/T positions showing association with RD. However, subsequent studies have yielded mixed results. We performed a literature review and meta-analysis of the −3G/A and 1249G/T polymorphisms, including new unpublished data from two family-based samples. Ten markers in DYX1C1 were genotyped in the two independently ascertained samples. Single marker and −3G/A:1249G/T haplotype analyses were performed for RD in both samples, and quantitative trait analyses using standardized reading-related measures was performed in one of the samples. For the meta-analysis, we used a random-effects model to summarize studies that tested for association between −3G/A or 1249G/T and RD. No significant association was found between the DYX1C1 SNPs and RD or any of the reading-related measures tested after correction for the number of tests performed. The previously reported risk haplotype (−3A:1249T) was not biased in transmission. A total of 9 and 10 study samples were included in the meta-analysis of the −3G/A and 1249G/T polymorphisms, respectively. Neither polymorphism reached statistical significance, but the heterogeneity for the 1249G/T polymorphism was high. The results of this study do not provide evidence for association between the putatively functional SNPs −3G/A and 1249G/T and RD. PMID:23341075

Characterization of the Chromosome 1q41q42.12 region, and the Candidate Gene DISP1, in Patients with CDH

PubMed Central

Kantarci, Sibel; Ackerman, Kate G; Russell, Meaghan N; Longoni, Mauro; Sougnez, Carrie; Noonan, Kristin M; Hatchwell, Eli; Zhang, Xiaoyun; Vanmarcke, Rafael Pieretti; Anyane-Yeboa, Kwame; Dickman, Paul; Wilson, Jay; Donahoe, Patricia K; Pober, Barbara R

2010-01-01

Cytogenetic and molecular cytogenetic studies demonstrate association between congenital diaphragmatic hernia (CDH) and chromosome 1q41q42 deletions. In this study, we screened a large CDH cohort (N=179) for microdeletions in this interval by the multiplex ligation-dependent probe amplification (MLPA) technique, and also sequenced two candidate genes located therein, dispatched 1 (DISP1) and homo sapiens H2.0-like homeobox (HLX). MLPA analysis verified deletions of this region in two cases, an unreported patient with a 46,XY,del(1)(q41q42.13) karyotype and a previously reported patient with a Fryns syndrome phenotype [Kantarci et al., 2006]. HLX sequencing showed a novel but maternally inherited single nucleotide variant (c.27C>G) in a patient with isolated CDH, while DISP1 sequencing revealed a mosaic de novo heterozygous substitution (c.4412C>G; p.Ala1471Gly) in a male with a left-sided Bochdalek hernia plus multiple other anomalies. Pyrosequencing demonstrated the mutant allele was present in 43%, 12%, and 4.5% of the patient’s lymphoblastoid, peripheral blood lymphocytes, and saliva cells, respectively. We examined Disp1 expression at day E11.5 of mouse diaphragm formation and confirmed its presence in the pleuroperitoneal fold, as well as the nearby lung which also expresses Sonic hedgehog (Shh). Our report describes the first de novo DISP1 point mutation in a patient with complex CDH. Combining this finding with Disp1 embryonic mouse diaphragm and lung tissue expression, as well as previously reported human chromosome 1q41q42 aberrations in patients with CDH, suggests that DISP1 may warrant further consideration as a CDH candidate gene. PMID:20799323

Integrated genomic approaches to identification of candidate genes underlying metabolic and cardiovascular phenotypes in the spontaneously hypertensive rat.

PubMed

Morrissey, Catherine; Grieve, Ian C; Heinig, Matthias; Atanur, Santosh; Petretto, Enrico; Pravenec, Michal; Hubner, Norbert; Aitman, Timothy J

2011-11-07

The spontaneously hypertensive rat (SHR) is a widely used rodent model of hypertension and metabolic syndrome. Previously we identified thousands of cis-regulated expression quantitative trait loci (eQTLs) across multiple tissues using a panel of rat recombinant inbred (RI) strains derived from Brown Norway and SHR progenitors. These cis-eQTLs represent potential susceptibility loci underlying physiological and pathophysiological traits manifested in SHR. We have prioritized 60 cis-eQTLs and confirmed differential expression between the parental strains by quantitative PCR in 43 (72%) of the eQTL transcripts. Quantitative trait transcript (QTT) analysis in the RI strains showed highly significant correlation between cis-eQTL transcript abundance and clinically relevant traits such as systolic blood pressure and blood glucose, with the physical location of a subset of the cis-eQTLs colocalizing with "physiological" QTLs (pQTLs) for these same traits. These colocalizing correlated cis-eQTLs (c3-eQTLs) are highly attractive as primary susceptibility loci for the colocalizing pQTLs. Furthermore, sequence analysis of the c3-eQTL genes identified single nucleotide polymorphisms (SNPs) that are predicted to affect transcription factor binding affinity, splicing and protein function. These SNPs, which potentially alter transcript abundance and stability, represent strong candidate factors underlying not just eQTL expression phenotypes, but also the correlated metabolic and physiological traits. In conclusion, by integration of genomic sequence, eQTL and QTT datasets we have identified several genes that are strong positional candidates for pathophysiological traits observed in the SHR strain. These findings provide a basis for the functional testing and ultimate elucidation of the molecular basis of these metabolic and cardiovascular phenotypes.

Genome-wide association links candidate genes to resistance to Plum Pox Virus in apricot (Prunus armeniaca).

PubMed

Mariette, Stéphanie; Wong Jun Tai, Fabienne; Roch, Guillaume; Barre, Aurélien; Chague, Aurélie; Decroocq, Stéphane; Groppi, Alexis; Laizet, Yec'han; Lambert, Patrick; Tricon, David; Nikolski, Macha; Audergon, Jean-Marc; Abbott, Albert G; Decroocq, Véronique

2016-01-01

In fruit tree species, many important traits have been characterized genetically by using single-family descent mapping in progenies segregating for the traits. However, most mapped loci have not been sufficiently resolved to the individual genes due to insufficient progeny sizes for high resolution mapping and the previous lack of whole-genome sequence resources of the study species. To address this problem for Plum Pox Virus (PPV) candidate resistance gene identification in Prunus species, we implemented a genome-wide association (GWA) approach in apricot. This study exploited the broad genetic diversity of the apricot (Prunus armeniaca) germplasm containing resistance to PPV, next-generation sequence-based genotyping, and the high-quality peach (Prunus persica) genome reference sequence for single nucleotide polymorphism (SNP) identification. The results of this GWA study validated previously reported PPV resistance quantitative trait loci (QTL) intervals, highlighted other potential resistance loci, and resolved each to a limited set of candidate genes for further study. This work substantiates the association genetics approach for resolution of QTL to candidate genes in apricot and suggests that this approach could simplify identification of other candidate genes for other marked trait intervals in this germplasm. © 2015 INRA, UMR 1332 BFP New Phytologist © 2015 New Phytologist Trust.