The CpG island searcher: a new WWW resource.

PubMed

Takai, Daiya; Jones, Peter A

2003-01-01

Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

Relatively high rates of G:C → A:T transitions at CpG sites were observed in certain epithelial tissues including pancreas and submaxillary gland of adult big blue® mice.

PubMed

Prtenjaca, Anita; Tarnowski, Heather E; Marr, Alison M; Heney, Melanie A; Creamer, Laura; Sathiamoorthy, Sarmitha; Hill, Kathleen A

2014-01-01

With few exceptions, spontaneous mutation frequency and pattern are similar across tissue types and relatively constant in young to middle adulthood in wild type mice. Underrepresented in surveys of spontaneous mutations across murine tissues is the diversity of epithelial tissues. For the first time, spontaneous mutations were detected in pancreas and submaxillary gland and compared with kidney, lung, and male germ cells from five adult male Big Blue® mice. Mutation load was assessed quantitatively through measurement of mutant and mutation frequency and qualitatively through identification of mutations and characterization of recurrent mutations, multiple mutations, mutation pattern, and mutation spectrum. A total of 9.6 million plaque forming units were screened, 226 mutants were collected, and 196 independent mutations were identified. Four novel mutations were discovered. Spontaneous mutation frequency was low in pancreas and high in the submaxillary gland. The submaxillary gland had multiple recurrent mutations in each of the mice and one mutant had two independent mutations. Mutation patterns for epithelial tissues differed from that observed in male germ cells with a striking bias for G:C to A:T transitions at CpG sites. A comprehensive review of lacI spontaneous mutation patterns in young adult mice and rats identified additional examples of this mutational bias. An overarching observation about spontaneous mutation frequency in adult tissues of the mouse remains one of stability. A repeated observation in certain epithelial tissues is a higher rate of G:C to A:T transitions at CpG sites and the underlying mechanisms for this bias are not known. Copyright © 2013 Wiley Periodicals, Inc.

Methylomics of gene expression in human monocytes

PubMed Central

Liu, Yongmei; Ding, Jingzhong; Reynolds, Lindsay M.; Lohman, Kurt; Register, Thomas C.; De La Fuente, Alberto; Howard, Timothy D.; Hawkins, Greg A.; Cui, Wei; Morris, Jessica; Smith, Shelly G.; Barr, R. Graham; Kaufman, Joel D.; Burke, Gregory L.; Post, Wendy; Shea, Steven; Mccall, Charles E.; Siscovick, David; Jacobs, David R.; Tracy, Russell P.; Herrington, David M.; Hoeschele, Ina

2013-01-01

DNA methylation is one of several epigenetic mechanisms that contribute to the regulation of gene expression; however, the extent to which methylation of CpG dinucleotides correlates with gene expression at the genome-wide level is still largely unknown. Using purified primary monocytes from subjects in a large community-based cohort (n = 1264), we characterized methylation (>485 000 CpG sites) and mRNA expression (>48K transcripts) and carried out genome-wide association analyses of 8370 expression phenotypes. We identified 11 203 potential cis-acting CpG loci whose degree of methylation was associated with gene expression (eMS) at a false discovery rate threshold of 0.001. Most of the associations were consistent in effect size and direction of effect across sex and three ethnicities. Contrary to expectation, these eMS were not predominately enriched in promoter regions, or CpG islands, but rather in the 3′ UTR, gene bodies, CpG shores or ‘offshore’ sites, and both positive and negative correlations between methylation and expression were observed across all locations. eMS were enriched for regions predicted to be regulatory by ENCODE (Encyclopedia of DNA Elements) data in multiple cell types, particularly enhancers. One of the strongest association signals detected (P < 2.2 × 10−308) was a methylation probe (cg17005068) in the promoter/enhancer region of the glutathione S-transferase theta 1 gene (GSTT1, encoding the detoxification enzyme) with GSTT1 mRNA expression. Our study provides a detailed description of the epigenetic architecture in human monocytes and its relationship to gene expression. These data may help prioritize interrogation of biologically relevant methylation loci and provide new insights into the epigenetic basis of human health and diseases. PMID:23900078

Aging as an Epigenetic Phenomenon

PubMed Central

Ashapkin, Vasily V.; Kutueva, Lyudmila I.; Vanyushin, Boris F.

2017-01-01

Introduction: Hypermethylation of genes associated with promoter CpG islands, and hypomethylation of CpG poor genes, repeat sequences, transposable elements and intergenic genome sections occur during aging in mammals. Methylation levels of certain CpG sites display strict correlation to age and could be used as “epigenetic clock” to predict biological age. Multi-substrate deacetylases SIRT1 and SIRT6 affect aging via locus-specific modulations of chromatin structure and activity of multiple regulatory proteins involved in aging. Random errors in DNA methylation and other epigenetic marks during aging increase the transcriptional noise, and thus lead to enhanced phenotypic variation between cells of the same tissue. Such variation could cause progressive organ dysfunction observed in aged individuals. Multiple experimental data show that induction of NF-κB regulated gene sets occurs in various tissues of aged mammals. Upregulation of multiple miRNAs occurs at mid age leading to downregulation of enzymes and regulatory proteins involved in basic cellular functions, such as DNA repair, oxidative phosphorylation, intermediate metabolism, and others. Conclusion: Strong evidence shows that all epigenetic systems contribute to the lifespan control in various organisms. Similar to other cell systems, epigenome is prone to gradual degradation due to the genome damage, stressful agents, and other aging factors. But unlike mutations and other kinds of the genome damage, age-related epigenetic changes could be fully or partially reversed to a “young” state. PMID:29081695

Promoter methylation assay of SASH1 gene in breast cancer.

PubMed

Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He

2013-01-01

To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.

Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

PubMed

Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

2018-05-01

DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion

PubMed Central

Dayeh, Tasnim; Volkov, Petr; Salö, Sofia; Hall, Elin; Nilsson, Emma; Olsson, Anders H.; Kirkpatrick, Clare L.; Wollheim, Claes B.; Eliasson, Lena; Rönn, Tina; Bacos, Karl; Ling, Charlotte

2014-01-01

Impaired insulin secretion is a hallmark of type 2 diabetes (T2D). Epigenetics may affect disease susceptibility. To describe the human methylome in pancreatic islets and determine the epigenetic basis of T2D, we analyzed DNA methylation of 479,927 CpG sites and the transcriptome in pancreatic islets from T2D and non-diabetic donors. We provide a detailed map of the global DNA methylation pattern in human islets, β- and α-cells. Genomic regions close to the transcription start site showed low degrees of methylation and regions further away from the transcription start site such as the gene body, 3′UTR and intergenic regions showed a higher degree of methylation. While CpG islands were hypomethylated, the surrounding 2 kb shores showed an intermediate degree of methylation, whereas regions further away (shelves and open sea) were hypermethylated in human islets, β- and α-cells. We identified 1,649 CpG sites and 853 genes, including TCF7L2, FTO and KCNQ1, with differential DNA methylation in T2D islets after correction for multiple testing. The majority of the differentially methylated CpG sites had an intermediate degree of methylation and were underrepresented in CpG islands (∼7%) and overrepresented in the open sea (∼60%). 102 of the differentially methylated genes, including CDKN1A, PDE7B, SEPT9 and EXOC3L2, were differentially expressed in T2D islets. Methylation of CDKN1A and PDE7B promoters in vitro suppressed their transcriptional activity. Functional analyses demonstrated that identified candidate genes affect pancreatic β- and α-cells as Exoc3l silencing reduced exocytosis and overexpression of Cdkn1a, Pde7b and Sept9 perturbed insulin and glucagon secretion in clonal β- and α-cells, respectively. Together, our data can serve as a reference methylome in human islets. We provide new target genes with altered DNA methylation and expression in human T2D islets that contribute to perturbed insulin and glucagon secretion. These results highlight the importance of epigenetics in the pathogenesis of T2D. PMID:24603685

The impact of methylation quantitative trait loci (mQTLs) on active smoking-related DNA methylation changes.

PubMed

Gao, Xu; Thomsen, Hauke; Zhang, Yan; Breitling, Lutz Philipp; Brenner, Hermann

2017-01-01

Methylation quantitative trait loci (mQTLs) are the genetic variants that may affect the DNA methylation patterns of CpG sites. However, their roles in influencing the disturbances of smoking-related epigenetic changes have not been well established. This study was conducted to address whether mQTLs exist in the vicinity of smoking-related CpG sites (± 50 kb) and to examine their associations with smoking exposure and all-cause mortality in older adults. We obtained DNA methylation profiles in whole blood samples by Illumina Infinium Human Methylation 450 BeadChip array of two independent subsamples of the ESTHER study (discovery set, n  = 581; validation set, n  = 368) and their corresponding genotyping data using the Illumina Infinium OncoArray BeadChip. After correction for multiple testing (FDR), we successfully identified that 70 out of 151 previously reported smoking-related CpG sites were significantly associated with 192 SNPs within the 50 kb search window of each locus. The 192 mQTLs significantly influenced the active smoking-related DNA methylation changes, with percentage changes ranging from 0.01 to 18.96%, especially for the weakly/moderately smoking-related CpG sites. However, these identified mQTLs were not directly associated with active smoking exposure or all-cause mortality. Our findings clearly demonstrated that if not dealt with properly, the mQTLs might impair the power of epigenetic-based models of smoking exposure to a certain extent. In addition, such genetic variants could be the key factor to distinguish between the heritable and smoking-induced impact on epigenome disparities. These mQTLs are of special importance when DNA methylation markers measured by Illumina Infinium assay are used for any comparative population studies related to smoking-related cancers and chronic diseases.

Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas

PubMed Central

Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

2009-01-01

The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone. PMID:19224763

Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas.

PubMed

Everhard, Sibille; Tost, Jörg; El Abdalaoui, Hafida; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

2009-08-01

The O(6)-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone.

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

PubMed

Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-08-16

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

PubMed Central

Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-01-01

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients.

PubMed

Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele

2011-05-26

The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.

Nucleosome dynamics and maintenance of epigenetic states of CpG islands

NASA Astrophysics Data System (ADS)

Sneppen, Kim; Dodd, Ian B.

2016-06-01

Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

Development of an Enhanced Recovery After Surgery Guideline and Implementation Strategy Based on the Knowledge-to-action Cycle.

PubMed

McLeod, Robin S; Aarts, Mary-Anne; Chung, Frances; Eskicioglu, Cagla; Forbes, Shawn S; Conn, Lesley Gotlib; McCluskey, Stuart; McKenzie, Marg; Morningstar, Beverly; Nadler, Ashley; Okrainec, Allan; Pearsall, Emily A; Sawyer, Jason; Siddique, Naveed; Wood, Trevor

2015-12-01

Enhanced Recovery After Surgery (ERAS) protocols have been shown to increase recovery, decrease complications, and reduce length of stay. However, they are difficult to implement. To develop and implement an ERAS clinical practice guideline (CPG) at multiple hospitals. A tailored strategy based on the Knowledge-to-action (KTA) cycle was used to develop and implement an ERAS CPG at 15 academic hospitals in Canada. This included an initial audit to identify gaps and interviews to assess barriers and enablers to implementation. Implementation included development of an ERAS guideline by a multidisciplinary group, communities of practice led by multidiscipline champions (surgeons, anesthesiologists, and nurses) both provincially and locally, educational tools, and clinical pathways as well as audit and feedback. The initial audit revealed there was greater than 75% compliance in only 2 of 18 CPG recommendations. Main themes identified by stakeholders were that the CPG must be based on best evidence, there must be increased communication and collaboration among perioperative team members, and patient education is essential. ERAS and Pain Management CPGs were developed by a multidisciplinary team and have been adopted at all hospitals. Preliminary data from more than 1000 patients show that the uptake of recommended interventions varies but despite this, mean length of stay has decreased with low readmission rates and adverse events. On the basis of short-term findings, our results suggest that a tailored implementation strategy based on the KTA cycle can be used to successfully implement an ERAS program at multiple sites.

CpG Sites Associated with Cigarette Smoking: Analysis of Epigenome-Wide Data from the Sister Study

PubMed Central

Harlid, Sophia; Xu, Zongli; Panduri, Vijayalakshmi; Sandler, Dale P.

2014-01-01

Background: Smoking increases the risk of many diseases, and it is also linked to blood DNA methylation changes that may be important in disease etiology. Objectives: We sought to identify novel CpG sites associated with cigarette smoking. Methods: We used two epigenome-wide data sets from the Sister Study to identify and confirm CpG sites associated with smoking. One included 908 women with methylation measurements at 27,578 CpG sites using the HumanMethylation27 BeadChip; the other included 200 women with methylation measurements for 473,844 CpG sites using the HumanMethylation450 BeadChip. Significant CpGs from the second data set that were not included in the 27K assay were validated by pyrosequencing in a subset of 476 samples from the first data set. Results: Our study successfully confirmed smoking associations for 9 previously established CpGs and identified 2 potentially novel CpGs: cg26764244 in GNG12 (p = 9.0 × 10–10) and cg22335340 in PTPN6 (p = 2.9 × 10–05). We also found strong evidence of an association between smoking status and cg02657160 in CPOX (p = 7.3 × 10–7), which has not been previously reported. All 12 CpGs were undermethylated in current smokers and showed an increasing percentage of methylation in former and never-smokers. Conclusions: We identified 2 potentially novel smoking related CpG sites, and provided independent replication of 10 previously reported CpGs sites related to smoking, one of which is situated in the gene CPOX. The corresponding enzyme is involved in heme biosynthesis, and smoking is known to increase heme production. Our study extends the evidence base for smoking-related changes in DNA methylation. Citation: Harlid S, Xu Z, Panduri V, Sandler DP, Taylor JA. 2014. CpG sites associated with cigarette smoking: analysis of epigenome-wide data from the Sister Study. Environ Health Perspect 122:673–678; http://dx.doi.org/10.1289/ehp.1307480 PMID:24704585

Interaction of DRD4 Methylation and Phthalate Metabolites Affects Continuous Performance Test Performance in ADHD.

PubMed

Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

2018-05-01

We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.

Comprehensive DNA methylation analysis of human neuroblastoma cells treated with blonanserin.

PubMed

Murata, Yui; Nishioka, Masaki; Bundo, Miki; Sunaga, Fumiko; Kasai, Kiyoto; Iwamoto, Kazuya

2014-03-20

Blonanserin is a second-generation antipsychotic drug for schizophrenia. The pharmacological actions of blonanserin are shown to be the antagonism of dopamine receptor 2 and serotonin receptors. However, its molecular mechanisms in brain cells have not been fully characterized. Accumulating evidence suggests that antipsychotic drugs and mood stabilizers show epigenetic effects on a wide range of genes in animal and cellular models. We performed genome-wide DNA methylation analysis targeting 479,814 CpG sites of cultured human neuroblastoma cells administered with blonanserin. We found that 3,057 CpG sites showed statistically significant changes in DNA methylation at two different doses of blonanserin (1.36 nM and 13.6 nM). These included hypermethylated CpG sites that were enriched in genes related to axonogenesis and cell morphogenesis involved in neuron differentiation. We also showed that the global effect on DNA methylome depends on the concentration of the drug. With a high dose of blonanserin, the overall methylation levels across all CpG sites significantly increased. These increases in DNA methylation were prominent in the CpG sites distant from promoter regions. We further examined DNA methylation changes in specific genes implicated for the actions of antipsychotic drugs, such as the dopamine receptor 2 (DRD2) gene and the serotonin receptor 2A (HTR2A) gene. We observed that CpG sites that were located within DRD2 and HTR2A genes were significantly hypermethylated by blonanserin. The DNA methylation changes induced by the treatment with blonanserin will be useful for understanding its pharmacological actions at the cellular level. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Links between DNA methylation and nucleosome occupancy in the human genome.

PubMed

Collings, Clayton K; Anderson, John N

2017-01-01

DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

DNA methylation of the BRD2 promoter is associated with juvenile myoclonic epilepsy in Caucasians.

PubMed

Pathak, Shilpa; Miller, James; Morris, Emily C; Stewart, William C L; Greenberg, David A

2018-05-01

Juvenile myoclonic epilepsy (JME) is a common adolescent-onset genetic generalized epilepsy (GGE) syndrome. Multiple linkage and association studies have found that BRD2 influences the expression of JME. The BRD2-JME connection is further corroborated by our murine model; Brd2 haploinsufficiency produces characteristics that typify the clinical hallmarks of JME. Neither we, nor several large-scale studies of JME, found JME-related BRD2 coding mutations. Therefore, we investigated noncoding BRD2 regions, seeking the origin of BRD2's JME influence. BRD2's promoter harbors a JME-associated single nucleotide polymorphism (rs3918149) and a CpG (C-phosphate-G dinucleotides) island (CpG76), making it a potential "hotspot" for JME-associated epigenetic variants. Methylating promoter CpG sites causes gene silencing, often resulting in reduced gene expression. We tested for differences in DNA methylation at CpG76 in 3 different subgroups: (1) JME patients versus their unaffected family members, (2) JME versus patients with other forms of GGE, and (3) Caucasian versus non-Caucasian JME patients. We used DNA pyrosequencing to analyze the methylation status of 10 BRD2 promoter CpG sites in lymphoblastoid cells from JME patients of Caucasian and non-Caucasian origin, unaffected family members, and also non-JME GGE patients. We also measured global methylation levels and DNA methyl transferase 1 (DNMT1) transcript expression in JME families by standard methods. CpG76 is highly methylated in JME patients compared to unaffected family members. In families with non-JME GGE, we found no relationship between promoter methylation and epilepsy. In non-Caucasian JME families, promoter methylation was mostly not associated with epilepsy. This makes the BRD2 promoter a JME-specific, ethnicity-specific, differentially methylated region. Global methylation was constant across groups. BRD2 promoter methylation in JME, and the lack of methylation in unaffected relatives, in non-JME GGE patients, and in non-Caucasian JME, demonstrate that methylation specificity is a possible seizure susceptibility motif in JME risk and suggests JME therapeutics targeting BRD2. Wiley Periodicals, Inc. © 2018 International League Against Epilepsy.

Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker

PubMed Central

Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

2015-01-01

Background Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. Methods We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23–60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Results Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=−0.49 to −1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=−0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5–4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Conclusions Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. PMID:26395445

Methylation of HPA axis related genes in men with hypersexual disorder.

PubMed

Jokinen, Jussi; Boström, Adrian E; Chatzittofis, Andreas; Ciuculete, Diana M; Öberg, Katarina Görts; Flanagan, John N; Arver, Stefan; Schiöth, Helgi B

2017-06-01

Hypersexual Disorder (HD) defined as non-paraphilic sexual desire disorder with components of compulsivity, impulsivity and behavioral addiction, and proposed as a diagnosis in the DSM 5, shares some overlapping features with substance use disorder including common neurotransmitter systems and dysregulated hypothalamic-pituitary-adrenal (HPA) axis function. In this study, comprising 67 HD male patients and 39 male healthy volunteers, we aimed to identify HPA-axis coupled CpG-sites, in which modifications of the epigenetic profile are associated with hypersexuality. The genome-wide methylation pattern was measured in whole blood using the Illumina Infinium Methylation EPIC BeadChip, measuring the methylation state of over 850K CpG sites. Prior to analysis, the global DNA methylation pattern was pre-processed according to standard protocols and adjusted for white blood cell type heterogeneity. We included CpG sites located within 2000bp of the transcriptional start site of the following HPA-axis coupled genes: Corticotropin releasing hormone (CRH), corticotropin releasing hormone binding protein (CRHBP), corticotropin releasing hormone receptor 1 (CRHR1), corticotropin releasing hormone receptor 2 (CRHR2), FKBP5 and the glucocorticoid receptor (NR3C1). We performed multiple linear regression models of methylation M-values to a categorical variable of hypersexuality, adjusting for depression, dexamethasone non-suppression status, Childhood Trauma Questionnaire total score and plasma levels of TNF-alpha and IL-6. Of 76 tested individual CpG sites, four were nominally significant (p<0.05), associated with the genes CRH, CRHR2 and NR3C1. Cg23409074-located 48bp upstream of the transcription start site of the CRH gene - was significantly hypomethylated in hypersexual patients after corrections for multiple testing using the FDR-method. Methylation levels of cg23409074 were positively correlated with gene expression of the CRH gene in an independent cohort of 11 healthy male subjects. The methylation levels at the identified CRH site, cg23409074, were significantly correlated between blood and four different brain regions. CRH is an important integrator of neuroendocrine stress responses in the brain, with a key role in the addiction processes. Our results show epigenetic changes in the CRH gene related to hypersexual disorder in men. Copyright © 2017 Elsevier Ltd. All rights reserved.

Providers' perceptions of spinal cord injury pressure ulcer guidelines.

PubMed

Thomason, Susan S; Evitt, Celinda P; Harrow, Jeffrey J; Love, Linda; Moore, D Helen; Mullins, Maria A; Powell-Cope, Gail; Nelson, Audrey L

2007-01-01

Pressure ulcers are a serious complication for people with spinal cord injury (SCI). The Consortium for Spinal Cord Medicine (CSCM) published clinical practice guidelines (CPGs) that provided guidance for pressure ulcer prevention and treatment after SCI. The aim of this study was to assess providers' perceptions for each of the 32 CPG recommendations regarding their agreement with CPGs, degree of CPG implementation, and CPG implementation barriers and facilitators. This descriptive mixed-methods study included both qualitative (focus groups) and quantitative (survey) data collection approaches. The sample (n = 60) included 24 physicians and 36 nurses who attended the 2004 annual national conferences of the American Paraplegia Society or American Association of Spinal Cord Injury Nurses. This sample drew from two sources: a purposive sample from a list of preregistered participants and a convenience sample of conference attendee volunteers. We analyzed quantitative data using descriptive statistics and qualitative data using a coding scheme to capture barriers and facilitators. The focus groups agreed unanimously on the substance of 6 of the 32 recommendations. Nurse and physician focus groups disagreed on the degree of CGP implementation at their sites, with nurses as a group perceiving less progress in implementation of the guideline recommendations. The focus groups identified only one recommendation, complications of surgery, as being fully implemented at their sites. Categories of barriers and facilitators for implementation of CPGs that emerged from the qualitative analysis included (a) characteristics of CPGs: need for research/evidence, (b) characteristics of CPGs: complexity of design and wording, (c) organizational factors, (d) lack of knowledge, and (e) lack of resources. Although generally SCI physicians and nurses agreed with the CPG recommendations as written, they did not feel these recommendations were fully implemented in their respective clinical settings. The focus groups identified multiple barriers to the implementation of the CPGs and suggested several facilitators/solutions to improve implementation of these guidelines in SCI. Participants identified organizational factors and the lack of knowledge as the most substantial systems/issues that created barriers to CPG implementation.

CpG Distribution and Methylation Pattern in Porcine Parvovirus

PubMed Central

Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

2013-01-01

Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

Experimental murine myopia induces collagen type Iα1 (COL1A1) DNA methylation and altered COL1A1 messenger RNA expression in sclera

PubMed Central

Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan

2012-01-01

Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110

Differential methylation of the oxytocin receptor gene in patients with anorexia nervosa: a pilot study.

PubMed

Kim, Youl-Ri; Kim, Jeong-Hyun; Kim, Mi Jeong; Treasure, Janet

2014-01-01

Recent studies in patients with anorexia nervosa suggest that oxytocin may be involved in the pathophysiology of anorexia nervosa. We examined whether there was evidence of variation in methylation status of the oxytocin receptor (OXTR) gene in patients with anorexia nervosa that might account for these findings. We analyzed the methylation status of the CpG sites in a region from the exon 1 to the MT2 regions of the OXTR gene in buccal cells from 15 patients and 36 healthy women using bisulfite sequencing. We further examined whether methylation status was associated with markers of illness severity or form. We identified six CpG sites with significant differences in average methylation levels between the patient and control groups. Among the six differentially methylated CpG sites, five showed higher than average methylation levels in patients than those in the control group (64.9-88.8% vs. 6.6-45.0%). The methylation levels of these five CpG sites were negatively associated with body mass index (BMI). BMI, eating disorders psychopathology, and anxiety were identified in a regression analysis as factors affecting the methylation levels of these CpG sites with more variation accounted for by BMI. Epigenetic misregulation of the OXTR gene may be implicated in anorexia nervosa, which may either be a mechanism linking environmental adversity to risk or may be a secondary consequence of the illness.

Unique DNA methylome profiles in CpG island methylator phenotype colon cancers

PubMed Central

Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.

2012-01-01

A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380

Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients

PubMed Central

2011-01-01

Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918

Length of paternal lifespan is manifested in the DNA methylome of their nonagenarian progeny

PubMed Central

Marttila, Saara; Kananen, Laura; Jylhävä, Juulia; Nevalainen, Tapio; Hervonen, Antti; Jylhä, Marja; Hurme, Mikko

2015-01-01

The heritability of lifespan is 20-30%, but only a few genes associated with longevity have been identified. To explain this discrepancy, the inheritance of epigenetic features, such as DNA methylation, have been proposed to contribute to the heritability of lifespan. We investigated whether parental lifespan is associated with DNA methylation profile in nonagenarians. A regression model, adjusted for differences in blood cell proportions, identified 659 CpG sites where the level of methylation was associated with paternal lifespan. However, no association was observed between maternal lifespan and DNA methylation. The 659 CpG sites associated with paternal lifespan were enriched outside of CpG islands and were located in genes associated with development and morphogenesis, as well as cell signaling. The largest difference in the level of methylation between the progeny of the shortest-lived and longest-lived fathers was identified for CpG sites mapping to CXXC5. In addition, the level of methylation in three Notch-genes (NOTCH1, NOTCH3 and NOTCH4) was also associated with paternal lifespan. There are implications for the inheritance of acquired traits via epigenetic mechanisms in mammals. Here we describe DNA methylation features that are associated with paternal lifespan, and we speculate that the identified CpG sites may represent intergenerational epigenetic inheritance. PMID:26436701

Examination of DNA methylation status of the ELOVL2 marker may be useful for human age prediction in forensic science.

PubMed

Zbieć-Piekarska, Renata; Spólnicka, Magdalena; Kupiec, Tomasz; Makowska, Żanetta; Spas, Anna; Parys-Proszek, Agnieszka; Kucharczyk, Krzysztof; Płoski, Rafał; Branicki, Wojciech

2015-01-01

Age estimation in forensic investigations may complement the prediction of externally visible characteristics and the inference of biogeographical ancestry, thus allowing a better description of an unknown individual. Multiple CpG sites that show linear correlation between age and degree of DNA methylation have been identified in the human genome, providing a selection of candidates for age prediction. In this study, we optimized an assay based on bisulfite conversion and pyrosequencing of 7 CpG sites located in the ELOVL2 gene. Examination of 303 blood samples collected from individuals aged 2-75 years allowed selection of the most informative site, explaining 83% of variation in age. The final linear regression model included two CpG sites in ELOVL2 and enabled age prediction with R(2)=0.859, prediction error=6.85 and mean absolute deviation MAD=5.03. Examination of a testing set of 124 blood samples (MAD=5.75) showed that 68.5% of samples were correctly predicted, assuming that chronological and predicted ages matched ± 7 years. It was found that the ELOVL2 methylation status in bloodstains had not changed significantly after 4 weeks of storage in room temperature conditions. Analysis of 45 bloodstains deposited on tissue paper after 5, 10 and 15 years of storage in room conditions indicated that although a gradual decrease of positive PCR results was observed, the general age prediction success rate remained similar and equaled 60-78%. The obtained results show that the ELOVL2 locus provides a very good source of information about human chronological age based on analysis of blood, including bloodstains, and it may constitute a powerful and reliable predictor in future forensic age estimation models. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.

PubMed

Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi

2017-01-01

Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.

Extensive Variation in the Mutation Rate Between and Within Human Genes Associated with Mendelian Disease.

PubMed

Smith, Thomas; Ho, Gladys; Christodoulou, John; Price, Elizabeth Ann; Onadim, Zerrin; Gauthier-Villars, Marion; Dehainault, Catherine; Houdayer, Claude; Parfait, Beatrice; van Minkelen, Rick; Lohman, Dietmar; Eyre-Walker, Adam

2016-05-01

We have investigated whether the mutation rate varies between genes and sites using de novo mutations (DNMs) from three genes associated with Mendelian diseases (RB1, NF1, and MECP2). We show that the relative frequency of mutations at CpG dinucleotides relative to non-CpG sites varies between genes and relative to the genomic average. In particular we show that the rate of transition mutation at CpG sites relative to the rate of non-CpG transversion is substantially higher in our disease genes than amongst DNMs in general; the rate of CpG transition can be several hundred-fold greater than the rate of non-CpG transversion. We also show that the mutation rate varies significantly between sites of a particular mutational type, such as non-CpG transversion, within a gene. We estimate that for all categories of sites, except CpG transitions, there is at least a 30-fold difference in the mutation rate between the 10% of sites with the highest and lowest mutation rates. However, our best estimate is that the mutation rate varies by several hundred-fold variation. We suggest that the presence of hypermutable sites may be one reason certain genes are associated with disease. © 2016 WILEY PERIODICALS, INC.

Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine termination. Black-Right-Pointing-Pointer Single CpG methylation located at Pax6 binding motif regulates StAR expression.« less

CpG methylation in human papillomavirus (HPV) type 31 long control region (LCR) in cervical infections associated with cytological abnormalities.

PubMed

László, Brigitta; Ferenczi, Annamária; Madar, László; Gyöngyösi, Eszter; Szalmás, Anita; Szakács, Levente; Veress, György; Kónya, József

2016-08-01

The mechanisms that regulate papillomavirus gene expression include DNA methylation. The transcription of papillomavirus oncogenes E6 and E7 is controlled by certain regulatory elements in the LCR, which include binding sites for the E2 protein, a viral regulator of oncogene expression. In HPV-31-infected exfoliated cervical cells, the CpG methylation of the entire LCR was determined by next-generation sequencing after bisulfite modification. Six of the 22 cases had methylated CpG sites in the HPV-31 LCR, including position 7479 and/or 7485, at the promoter distal E2 binding site, thus suggesting a potential regulatory mechanism for papillomavirus transcription.

Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker.

PubMed

Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

2015-12-01

Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23-60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=-0.49 to -1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=-0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5-4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Genome-Wide Associations between Genetic and Epigenetic Variation Influence mRNA Expression and Insulin Secretion in Human Pancreatic Islets

PubMed Central

Olsson, Anders H.; Volkov, Petr; Bacos, Karl; Dayeh, Tasnim; Hall, Elin; Nilsson, Emma A.; Ladenvall, Claes; Rönn, Tina; Ling, Charlotte

2014-01-01

Genetic and epigenetic mechanisms may interact and together affect biological processes and disease development. However, most previous studies have investigated genetic and epigenetic mechanisms independently, and studies examining their interactions throughout the human genome are lacking. To identify genetic loci that interact with the epigenome, we performed the first genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human pancreatic islets. We related 574,553 single nucleotide polymorphisms (SNPs) with genome-wide DNA methylation data of 468,787 CpG sites targeting 99% of RefSeq genes in islets from 89 donors. We identified 67,438 SNP-CpG pairs in cis, corresponding to 36,783 SNPs (6.4% of tested SNPs) and 11,735 CpG sites (2.5% of tested CpGs), and 2,562 significant SNP-CpG pairs in trans, corresponding to 1,465 SNPs (0.3% of tested SNPs) and 383 CpG sites (0.08% of tested CpGs), showing significant associations after correction for multiple testing. These include reported diabetes loci, e.g. ADCY5, KCNJ11, HLA-DQA1, INS, PDX1 and GRB10. CpGs of significant cis-mQTLs were overrepresented in the gene body and outside of CpG islands. Follow-up analyses further identified mQTLs associated with gene expression and insulin secretion in human islets. Causal inference test (CIT) identified SNP-CpG pairs where DNA methylation in human islets is the potential mediator of the genetic association with gene expression or insulin secretion. Functional analyses further demonstrated that identified candidate genes (GPX7, GSTT1 and SNX19) directly affect key biological processes such as proliferation and apoptosis in pancreatic β-cells. Finally, we found direct correlations between DNA methylation of 22,773 (4.9%) CpGs with mRNA expression of 4,876 genes, where 90% of the correlations were negative when CpGs were located in the region surrounding transcription start site. Our study demonstrates for the first time how genome-wide genetic and epigenetic variation interacts to influence gene expression, islet function and potential diabetes risk in humans. PMID:25375650

The evolution of CpG density and lifespan in conserved primate and mammalian promoters

PubMed Central

McLain, Adam T.

2018-01-01

Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

DNA methylation of ANKK1 and response to aripiprazole in patients with acute schizophrenia: A preliminary study.

PubMed

Miura, Itaru; Kunii, Yasuto; Hino, Mizuki; Hoshino, Hiroshi; Matsumoto, Junya; Kanno-Nozaki, Keiko; Horikoshi, Sho; Kaneko, Haruka; Bundo, Miki; Iwamoto, Kazuya; Yabe, Hirooki

2018-05-01

Epigenetic modification including DNA methylation may affect pathophysiology and the response to antipsychotic drugs in patients with schizophrenia. The objective of the present study was to investigate the effect of the DNA methylation of ANKK1 (ankyrin repeat and kinase domain containing 1) on the response to aripiprazole and plasma levels of monoamine metabolites in antipsychotic-free acute schizophrenia patients. The subjects were 34 Japanese patients with schizophrenia who had been treated with aripiprazole for 6 weeks. Comprehensive DNA methylation of ANKK1 was determined using a next-generation sequencer. DNA methylation levels at CpG site 387 of ANKK1 were higher in responders to treatment with aripiprazole and correlated with the changes in Positive and Negative Syndrome Scale scores, although the associations did not remain significant after Bonferroni correction. In responders, methylation at all CpG sites was significantly correlated with plasma levels of homovanillic acid (r = 0.587, p = 0.035) and 3-methoxy-4hydroxyphenylglycol (r = 0.684, p = 0.010) at baseline. Despite our non-significant results after multiple correction, our preliminary findings suggest that methylation levels at CpG site 387 of ANKK1 may be associated with treatment response to aripiprazole. Furthermore, methylation of ANKK1 may affect dopaminergic neural transmission in the treatment of schizophrenia, and may influence treatment response. Caution is needed in interpreting these findings because of the small sample size, and further studies are needed to confirm and expand our preliminary results. Copyright © 2018. Published by Elsevier Ltd.

Fragile X mental retardation 1 (FMR1) intron 1 methylation in blood predicts verbal cognitive impairment in female carriers of expanded FMR1 alleles: evidence from a pilot study.

PubMed

Godler, David E; Slater, Howard R; Bui, Quang M; Storey, Elsdon; Ono, Michele Y; Gehling, Freya; Inaba, Yoshimi; Francis, David; Hopper, John L; Kinsella, Glynda; Amor, David J; Hagerman, Randi J; Loesch, Danuta Z

2012-03-01

Cognitive status in females with mutations in the FMR1 (fragile X mental retardation 1) gene is highly variable. A biomarker would be of value for predicting which individuals were liable to develop cognitive impairment and could benefit from early intervention. A detailed analysis of CpG sites bridging exon 1 and intron 1 of FMR1, known as fragile X-related epigenetic element 2 (FREE2), suggests that a simple blood test could identify these individuals. Study participants included 74 control females (<40 CGG repeats), 62 premutation (PM) females (55-200 CGG repeats), and 18 full-mutation (FM) females assessed with Wechsler intelligence quotient (IQ) tests. We used MALDI-TOF mass spectrometry to determine the methylation status of FREE2 CpG sites that best identified low-functioning (IQ <70) FM females (>200 CGG repeats), compared the results with those for Southern blot FMR1 activation ratios, and related these assessments to the level of production of the FMR1 protein product in blood. A methylation analysis of intron 1 CpG sites 10-12 showed the highest diagnostic sensitivity (100%) and specificity (98%) of all the molecular measures tested for detecting females with a standardized verbal IQ of <70 among the study participants. In the group consisting of only FM females, methylation of these sites was significantly correlated with full-scale IQ, verbal IQ, and performance IQ. Several verbal subtest scores showed strong correlation with the methylation of these sites (P = 1.2 × 10(-5)) after adjustment for multiple measures. The data suggest that hypermethylation of the FMR1 intron 1 sites in blood is predictive of cognitive impairment in FM females, with implications for improved fragile X syndrome diagnostics in young children and screening of the newborn population.

DNA methylation analysis of phenotype specific stratified Indian population.

PubMed

Rotti, Harish; Mallya, Sandeep; Kabekkodu, Shama Prasada; Chakrabarty, Sanjiban; Bhale, Sameer; Bharadwaj, Ramachandra; Bhat, Balakrishna K; Dedge, Amrish P; Dhumal, Vikram Ram; Gangadharan, G G; Gopinath, Puthiya M; Govindaraj, Periyasamy; Joshi, Kalpana S; Kondaiah, Paturu; Nair, Sreekumaran; Nair, S N Venugopalan; Nayak, Jayakrishna; Prasanna, B V; Shintre, Pooja; Sule, Mayura; Thangaraj, Kumarasamy; Patwardhan, Bhushan; Valiathan, Marthanda Varma Sankaran; Satyamoorthy, Kapaettu

2015-05-08

DNA methylation and its perturbations are an established attribute to a wide spectrum of phenotypic variations and disease conditions. Indian traditional system practices personalized medicine through indigenous concept of distinctly descriptive physiological, psychological and anatomical features known as prakriti. Here we attempted to establish DNA methylation differences in these three prakriti phenotypes. Following structured and objective measurement of 3416 subjects, whole blood DNA of 147 healthy male individuals belonging to defined prakriti (Vata, Pitta and Kapha) between the age group of 20-30years were subjected to methylated DNA immunoprecipitation (MeDIP) and microarray analysis. After data analysis, prakriti specific signatures were validated through bisulfite DNA sequencing. Differentially methylated regions in CpG islands and shores were significantly enriched in promoters/UTRs and gene body regions. Phenotypes characterized by higher metabolism (Pitta prakriti) in individuals showed distinct promoter (34) and gene body methylation (204), followed by Vata prakriti which correlates to motion showed DNA methylation in 52 promoters and 139 CpG islands and finally individuals with structural attributes (Kapha prakriti) with 23 and 19 promoters and CpG islands respectively. Bisulfite DNA sequencing of prakriti specific multiple CpG sites in promoters and 5'-UTR such as; LHX1 (Vata prakriti), SOX11 (Pitta prakriti) and CDH22 (Kapha prakriti) were validated. Kapha prakriti specific CDH22 5'-UTR CpG methylation was also found to be associated with higher body mass index (BMI). Differential DNA methylation signatures in three distinct prakriti phenotypes demonstrate the epigenetic basis of Indian traditional human classification which may have relevance to personalized medicine.

Integrative Cardiac Health Project, Windber Research Institute

DTIC Science & Technology

2014-07-01

laparoscopically placed adjustable gastric banding (LAGB) baseline (5) and one year (5), control baseline (5) and one year (5). OD260/280 ratios...coverage and detection of 3-4 million CpG sites . All samples had a bisulfite conversion rate of >98.25%; number of CpG (methylated) sites per sample...methylation) and hyper-methylated (increasing methylation) sites in the three groups were identified. For LAGB patients, a heat map based on

Collaborations between CpG sites in DNA methylation

NASA Astrophysics Data System (ADS)

Song, You; Ren, Honglei; Lei, Jinzhi

2017-08-01

DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.

Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing.

PubMed

Grasso, Chiara; Trevisan, Morena; Fiano, Valentina; Tarallo, Valentina; De Marco, Laura; Sacerdote, Carlotta; Richiardi, Lorenzo; Merletti, Franco; Gillio-Tos, Anna

2016-01-01

Pyrosequencing has emerged as an alternative method of nucleic acid sequencing, well suited for many applications which aim to characterize single nucleotide polymorphisms, mutations, microbial types and CpG methylation in the target DNA. The commercially available pyrosequencing systems can harbor two different types of software which allow analysis in AQ or CpG mode, respectively, both widely employed for DNA methylation analysis. Aim of the study was to assess the performance for DNA methylation analysis at CpG sites of the two pyrosequencing software which allow analysis in AQ or CpG mode, respectively. Despite CpG mode having been specifically generated for CpG methylation quantification, many investigations on this topic have been carried out with AQ mode. As proof of equivalent performance of the two software for this type of analysis is not available, the focus of this paper was to evaluate if the two modes currently used for CpG methylation assessment by pyrosequencing may give overlapping results. We compared the performance of the two software in quantifying DNA methylation in the promoter of selected genes (GSTP1, MGMT, LINE-1) by testing two case series which include DNA from paraffin embedded prostate cancer tissues (PC study, N = 36) and DNA from blood fractions of healthy people (DD study, N = 28), respectively. We found discrepancy in the two pyrosequencing software-based quality assignment of DNA methylation assays. Compared to the software for analysis in the AQ mode, less permissive criteria are supported by the Pyro Q-CpG software, which enables analysis in CpG mode. CpG mode warns the operators about potential unsatisfactory performance of the assay and ensures a more accurate quantitative evaluation of DNA methylation at CpG sites. The implementation of CpG mode is strongly advisable in order to improve the reliability of the methylation analysis results achievable by pyrosequencing.

Quantitative methylation level of the EPHX1 promoter in peripheral blood DNA is associated with polycystic ovary syndrome.

PubMed

Sang, Qing; Li, Xin; Wang, Haojue; Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei

2014-01-01

Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13-14 (P<0.05), 15-16 (P<0.001), and 19-24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13-14 and CpG cluster 19-24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction.

Quantitative Methylation Level of the EPHX1 Promoter in Peripheral Blood DNA Is Associated with Polycystic Ovary Syndrome

PubMed Central

Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei

2014-01-01

Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13–14 (P<0.05), 15–16 (P<0.001), and 19–24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13–14 and CpG cluster 19–24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction. PMID:24505354

Association of Tissue-Specific DNA Methylation Alterations with α-Thalassemia Southeast Asian Deletion

PubMed Central

Pangeson, Tanapat; Sanguansermsri, Phanchana; Sanguansermsri, Torpong; Seeratanachot, Teerapat; Suwanakhon, Narutchala; Srikummool, Metawee; Kaewkong, Worasak; Mahingsa, Khwanruedee

2017-01-01

In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA) deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA. PMID:29162979

Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.

PubMed

Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J

2016-08-01

Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.

Computational Modeling Approach in Probing the Effects of Cytosine Methylation on the Transcription Factor Binding to DNA.

PubMed

Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo

2017-01-01

Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

PubMed Central

Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

1988-01-01

Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

Exploratory analysis of ERCC2 DNA methylation in survival among pediatric medulloblastoma patients.

PubMed

Banfield, Emilyn; Brown, Austin L; Peckham, Erin C; Rednam, Surya P; Murray, Jeffrey; Okcu, M Fatih; Mitchell, Laura E; Chintagumpala, Murali M; Lau, Ching C; Scheurer, Michael E; Lupo, Philip J

2016-10-01

Medulloblastoma is the most frequent malignant pediatric brain tumor. While survival rates have improved due to multimodal treatment including cisplatin-based chemotherapy, there are few prognostic factors for adverse treatment outcomes. Notably, genes involved in the nucleotide excision repair pathway, including ERCC2, have been implicated in cisplatin sensitivity in other cancers. Therefore, this study evaluated the role of ERCC2 DNA methylation profiles on pediatric medulloblastoma survival. The study population included 71 medulloblastoma patients (age <18years at diagnosis) and recruited from Texas Children's Cancer Center between 2004 and 2009. DNA methylation profiles were generated from peripheral blood samples using the Illumina Infinium Human Methylation 450 Beadchip. Sixteen ERCC2-associated CpG sites were evaluated in this analysis. Multivariable regression models were used to determine the adjusted association between DNA methylation and survival. Cox regression and Kaplan-Meier curves were used to compare 5-year overall survival between hyper- and hypo-methylation at each CpG site. In total, 12.7% (n=9) of the patient population died within five years of diagnosis. In our population, methylation of the cg02257300 probe (Hazard Ratio=9.33; 95% Confidence Interval: 1.17-74.64) was associated with death (log-rank p=0.01). This association remained suggestive after correcting for multiple comparisons (FDR p<0.2). No other ERCC2-associated CpG site was associated with survival in this population of pediatric medulloblastoma patients. These findings provide the first evidence that DNA methylation within the promoter region of the ERCC2 gene may be associated with survival in pediatric medulloblastoma. If confirmed in future studies, this information may lead to improved risk stratification or promote the development of novel, targeted therapeutics. Copyright © 2016 Elsevier Ltd. All rights reserved.

miRNA-Processing Gene Methylation and Cancer Risk.

PubMed

Joyce, Brian T; Zheng, Yinan; Zhang, Zhou; Liu, Lei; Kocherginsky, Masha; Murphy, Robert; Achenbach, Chad J; Musa, Jonah; Wehbe, Firas; Just, Allan; Shen, Jincheng; Vokonas, Pantel; Schwartz, Joel; Baccarelli, Andrea A; Hou, Lifang

2018-05-01

Background: Dysregulation of miRNA and methylation levels are epigenetic hallmarks of cancer, potentially linked via miRNA-processing genes. Studies have found genetic alterations to miRNA-processing genes in cancer cells and human population studies. Our objective was to prospectively examine changes in DNA methylation of miRNA-processing genes and their associations with cancer risk. Methods: We examined cohort data from the Department of Veterans' Affairs Normative Aging Study. Participants were assessed every 3 to 5 years starting in 1999 through 2013 including questionnaires, medical record review, and blood collection. Blood from 686 consenting participants was analyzed using the Illumina 450K BeadChip array to measure methylation at CpG sites throughout the genome. We selected 19 genes based on a literature review, with 519 corresponding CpG sites. We then used Cox proportional hazards models to examine associations with cancer incidence, and generalized estimating equations to examine associations with cancer prevalence. Associations at false discovery rate < 0.05 were considered statistically significant. Results: Methylation of three CpGs ( DROSHA : cg23230564, TNRC6B : cg06751583, and TNRC6B : cg21034183) was prospectively associated with time to cancer development (positively for cg06751583, inversely for cg23230564 and cg21034183), whereas methylation of one CpG site ( DROSHA : cg16131300) was positively associated with cancer prevalence. Conclusions: DNA methylation of DROSHA , a key miRNA-processing gene, and TNRC6B may play a role in early carcinogenesis. Impact: Changes in miRNA processing may exert multiple effects on cancer development, including protecting against it via altered global miRNAs, and may be a useful early detection biomarker of cancer. Cancer Epidemiol Biomarkers Prev; 27(5); 550-7. ©2018 AACR . ©2018 American Association for Cancer Research.

Sex-specific effects of early life cadmium exposure on DNA methylation and implications for birth weight.

PubMed

Kippler, Maria; Engström, Karin; Mlakar, Simona Jurkovic; Bottai, Matteo; Ahmed, Sultan; Hossain, Mohammad Bakhtiar; Raqib, Rubhana; Vahter, Marie; Broberg, Karin

2013-05-01

Dietary cadmium exposure was recently found to alter DNA methylation in adults, but data on effects early in life are lacking. Our objective was to evaluate associations between prenatal cadmium exposure, DNA methylation and birth weight. In total 127 mother-child pairs from rural Bangladesh were studied. For comparison, we included 56 children at 4.5 y. Cadmium concentrations in mothers' blood (gestational week 14) and children's urine were measured by ICPMS. Global DNA methylation was analyzed by Infinium HumanMethylation450K BeadChip in cord blood and children's blood. Maternal cadmium exposure was associated with cord blood DNA methylation (p-value < 10 (-16) ). The association was markedly sex-specific. In boys, 96% of the top 500 CpG sites showed positive correlations (rS-values > 0.50), whereas most associations in girls were inverse; only 29% were positive (rS > 0.45). In girls we found overrepresentation of methylation changes in genes associated with organ development, morphology and mineralization of bone, whereas changes in boys were found in cell death-related genes. Several individual CpG sites that were positively associated with cadmium were inversely correlated with birth weight, although none statistically significant after correction for multiple comparisons. The associations were, however, fairly robust in multivariable-adjusted linear regression models. We identified CpG sites that were significantly associated with cadmium exposure in both newborns and 4.5-y-old children. In conclusion, cadmium exposure in early life appears to alter DNA methylation differently in girls and boys. This is consistent with previous findings of sex-specific cadmium toxicity. Cadmium-related changes in methylation were also related to lower birth weight.

Sex-specific effects of early life cadmium exposure on DNA methylation and implications for birth weight

PubMed Central

Kippler, Maria; Engström, Karin; Mlakar, Simona Jurkovic; Bottai, Matteo; Ahmed, Sultan; Hossain, Mohammad Bakhtiar; Raqib, Rubhana; Vahter, Marie; Broberg, Karin

2013-01-01

Dietary cadmium exposure was recently found to alter DNA methylation in adults, but data on effects early in life are lacking. Our objective was to evaluate associations between prenatal cadmium exposure, DNA methylation and birth weight. In total 127 mother-child pairs from rural Bangladesh were studied. For comparison, we included 56 children at 4.5 y. Cadmium concentrations in mothers’ blood (gestational week 14) and children’s urine were measured by ICPMS. Global DNA methylation was analyzed by Infinium HumanMethylation450K BeadChip in cord blood and children’s blood. Maternal cadmium exposure was associated with cord blood DNA methylation (p-value < 10–16). The association was markedly sex-specific. In boys, 96% of the top 500 CpG sites showed positive correlations (rS-values > 0.50), whereas most associations in girls were inverse; only 29% were positive (rS > 0.45). In girls we found overrepresentation of methylation changes in genes associated with organ development, morphology and mineralization of bone, whereas changes in boys were found in cell death-related genes. Several individual CpG sites that were positively associated with cadmium were inversely correlated with birth weight, although none statistically significant after correction for multiple comparisons. The associations were, however, fairly robust in multivariable-adjusted linear regression models. We identified CpG sites that were significantly associated with cadmium exposure in both newborns and 4.5-y-old children. In conclusion, cadmium exposure in early life appears to alter DNA methylation differently in girls and boys. This is consistent with previous findings of sex-specific cadmium toxicity. Cadmium-related changes in methylation were also related to lower birth weight. PMID:23644563

Mediation analysis of alcohol consumption, DNA methylation, and epithelial ovarian cancer.

PubMed

Wu, Dongyan; Yang, Haitao; Winham, Stacey J; Natanzon, Yanina; Koestler, Devin C; Luo, Tiane; Fridley, Brooke L; Goode, Ellen L; Zhang, Yanbo; Cui, Yuehua

2018-03-01

Epigenetic factors and consumption of alcohol, which suppresses DNA methylation, may influence the development and progression of epithelial ovarian cancer (EOC). However, there is a lack of understanding whether these factors interact to affect the EOC risk. In this study, we aimed to gain insight into this relationship by identifying leukocyte-derived DNA methylation markers acting as potential mediators of alcohol-associated EOC. We implemented a causal inference test (CIT) and the VanderWeele and Vansteelandt multiple mediator model to examine CpG sites that mediate the association between alcohol consumption and EOC risk. We modified one step of the CIT by adopting a high-dimensional inference procedure. The data were based on 196 cases and 202 age-matched controls from the Mayo Clinic Ovarian Cancer Case-Control Study. Implementation of the CIT test revealed two CpG sites (cg09358725, cg11016563), which represent potential mediators of the relationship between alcohol consumption and EOC case-control status. Implementation of the VanderWeele and Vansteelandt multiple mediator model further revealed that these two CpGs were the key mediators. Decreased methylation at both CpGs was more common in cases who drank alcohol at the time of enrollment vs. those who did not. cg11016563 resides in TRPC6 which has been previously shown to be overexpressed in EOC. These findings suggest two CpGs may serve as novel biomarkers for EOC susceptibility.

Inhibitory and modulatory inputs to the vocal central pattern generator of a teleost fish

PubMed Central

Rosner, Elisabeth; Rohmann, Kevin N.; Bass, Andrew H.

2018-01-01

Abstract Vocalization is a behavioral feature that is shared among multiple vertebrate lineages, including fish. The temporal patterning of vocal communication signals is set, in part, by central pattern generators (CPGs). Toadfishes are well‐established models for CPG coding of vocalization at the hindbrain level. The vocal CPG comprises three topographically separate nuclei: pre‐pacemaker, pacemaker, motor. While the connectivity between these nuclei is well understood, their neurochemical profile remains largely unexplored. The highly vocal Gulf toadfish, Opsanus beta, has been the subject of previous behavioral, neuroanatomical and neurophysiological studies. Combining transneuronal neurobiotin‐labeling with immunohistochemistry, we map the distribution of inhibitory neurotransmitters and neuromodulators along with gap junctions in the vocal CPG of this species. Dense GABAergic and glycinergic label is found throughout the CPG, with labeled somata immediately adjacent to or within CPG nuclei, including a distinct subset of pacemaker neurons co‐labeled with neurobiotin and glycine. Neurobiotin‐labeled motor and pacemaker neurons are densely co‐labeled with the gap junction protein connexin 35/36, supporting the hypothesis that transneuronal neurobiotin‐labeling occurs, at least in part, via gap junction coupling. Serotonergic and catecholaminergic label is also robust within the entire vocal CPG, with additional cholinergic label in pacemaker and prepacemaker nuclei. Likely sources of these putative modulatory inputs are neurons within or immediately adjacent to vocal CPG neurons. Together with prior neurophysiological investigations, the results reveal potential mechanisms for generating multiple classes of social context‐dependent vocalizations with widely divergent temporal and spectral properties. PMID:29424431

Integrated Multiregional Analysis Proposing a New Model of Colorectal Cancer Evolution.

PubMed

Uchi, Ryutaro; Takahashi, Yusuke; Niida, Atsushi; Shimamura, Teppei; Hirata, Hidenari; Sugimachi, Keishi; Sawada, Genta; Iwaya, Takeshi; Kurashige, Junji; Shinden, Yoshiaki; Iguchi, Tomohiro; Eguchi, Hidetoshi; Chiba, Kenichi; Shiraishi, Yuichi; Nagae, Genta; Yoshida, Kenichi; Nagata, Yasunobu; Haeno, Hiroshi; Yamamoto, Hirofumi; Ishii, Hideshi; Doki, Yuichiro; Iinuma, Hisae; Sasaki, Shin; Nagayama, Satoshi; Yamada, Kazutaka; Yachida, Shinichi; Kato, Mamoru; Shibata, Tatsuhiro; Oki, Eiji; Saeki, Hiroshi; Shirabe, Ken; Oda, Yoshinao; Maehara, Yoshihiko; Komune, Shizuo; Mori, Masaki; Suzuki, Yutaka; Yamamoto, Ken; Aburatani, Hiroyuki; Ogawa, Seishi; Miyano, Satoru; Mimori, Koshi

2016-02-01

Understanding intratumor heterogeneity is clinically important because it could cause therapeutic failure by fostering evolutionary adaptation. To this end, we profiled the genome and epigenome in multiple regions within each of nine colorectal tumors. Extensive intertumor heterogeneity is observed, from which we inferred the evolutionary history of the tumors. First, clonally shared alterations appeared, in which C>T transitions at CpG site and CpG island hypermethylation were relatively enriched. Correlation between mutation counts and patients' ages suggests that the early-acquired alterations resulted from aging. In the late phase, a parental clone was branched into numerous subclones. Known driver alterations were observed frequently in the early-acquired alterations, but rarely in the late-acquired alterations. Consistently, our computational simulation of the branching evolution suggests that extensive intratumor heterogeneity could be generated by neutral evolution. Collectively, we propose a new model of colorectal cancer evolution, which is useful for understanding and confronting this heterogeneous disease.

Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

PubMed

Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

2012-06-06

First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

Formaldehyde activation of mitoxantrone yields CpG and CpA specific DNA adducts

PubMed Central

Parker, Belinda S.; Cutts, Suzanne M.; Cullinane, Carleen; Phillips, Don R.

2000-01-01

Recently we have found that mitoxantrone, like Adriamycin, can be activated by formaldehyde and subsequently form adducts which stabilise double-stranded DNA in vitro. This activation by formaldehyde may be biologically relevant since formaldehyde levels are elevated in those tumours in which mitoxantrone is most cytotoxic. In vitro transcription analysis revealed that these adducts block the progression of RNA polymerase during transcription and cause truncated RNA transcripts. There was an absolute requirement for both mitoxantrone and formaldehyde in transcriptional blockage formation and the activated complex was found to exhibit site specificity, with blockage occurring prior to CpG and CpA sites in the DNA (non-template strand). The stability of the adduct at 37°C was site dependent. The half-lives ranged from 45 min to ~5 h and this was dependent on both the central 2 bp blockage site as well as flanking sequences. The CpG specificity of mitoxantrone adduct sites was also confirmed independently by a λ exonuclease digestion assay. PMID:10648792

DNA methylation signatures of chronic low-grade inflammation are associated with complex diseases.

PubMed

Ligthart, Symen; Marzi, Carola; Aslibekyan, Stella; Mendelson, Michael M; Conneely, Karen N; Tanaka, Toshiko; Colicino, Elena; Waite, Lindsay L; Joehanes, Roby; Guan, Weihua; Brody, Jennifer A; Elks, Cathy; Marioni, Riccardo; Jhun, Min A; Agha, Golareh; Bressler, Jan; Ward-Caviness, Cavin K; Chen, Brian H; Huan, Tianxiao; Bakulski, Kelly; Salfati, Elias L; Fiorito, Giovanni; Wahl, Simone; Schramm, Katharina; Sha, Jin; Hernandez, Dena G; Just, Allan C; Smith, Jennifer A; Sotoodehnia, Nona; Pilling, Luke C; Pankow, James S; Tsao, Phil S; Liu, Chunyu; Zhao, Wei; Guarrera, Simonetta; Michopoulos, Vasiliki J; Smith, Alicia K; Peters, Marjolein J; Melzer, David; Vokonas, Pantel; Fornage, Myriam; Prokisch, Holger; Bis, Joshua C; Chu, Audrey Y; Herder, Christian; Grallert, Harald; Yao, Chen; Shah, Sonia; McRae, Allan F; Lin, Honghuang; Horvath, Steve; Fallin, Daniele; Hofman, Albert; Wareham, Nicholas J; Wiggins, Kerri L; Feinberg, Andrew P; Starr, John M; Visscher, Peter M; Murabito, Joanne M; Kardia, Sharon L R; Absher, Devin M; Binder, Elisabeth B; Singleton, Andrew B; Bandinelli, Stefania; Peters, Annette; Waldenberger, Melanie; Matullo, Giuseppe; Schwartz, Joel D; Demerath, Ellen W; Uitterlinden, André G; van Meurs, Joyce B J; Franco, Oscar H; Chen, Yii-Der Ida; Levy, Daniel; Turner, Stephen T; Deary, Ian J; Ressler, Kerry J; Dupuis, Josée; Ferrucci, Luigi; Ong, Ken K; Assimes, Themistocles L; Boerwinkle, Eric; Koenig, Wolfgang; Arnett, Donna K; Baccarelli, Andrea A; Benjamin, Emelia J; Dehghan, Abbas

2016-12-12

Chronic low-grade inflammation reflects a subclinical immune response implicated in the pathogenesis of complex diseases. Identifying genetic loci where DNA methylation is associated with chronic low-grade inflammation may reveal novel pathways or therapeutic targets for inflammation. We performed a meta-analysis of epigenome-wide association studies (EWAS) of serum C-reactive protein (CRP), which is a sensitive marker of low-grade inflammation, in a large European population (n = 8863) and trans-ethnic replication in African Americans (n = 4111). We found differential methylation at 218 CpG sites to be associated with CRP (P < 1.15 × 10 -7 ) in the discovery panel of European ancestry and replicated (P < 2.29 × 10 -4 ) 58 CpG sites (45 unique loci) among African Americans. To further characterize the molecular and clinical relevance of the findings, we examined the association with gene expression, genetic sequence variants, and clinical outcomes. DNA methylation at nine (16%) CpG sites was associated with whole blood gene expression in cis (P < 8.47 × 10 -5 ), ten (17%) CpG sites were associated with a nearby genetic variant (P < 2.50 × 10 -3 ), and 51 (88%) were also associated with at least one related cardiometabolic entity (P < 9.58 × 10 -5 ). An additive weighted score of replicated CpG sites accounted for up to 6% inter-individual variation (R2) of age-adjusted and sex-adjusted CRP, independent of known CRP-related genetic variants. We have completed an EWAS of chronic low-grade inflammation and identified many novel genetic loci underlying inflammation that may serve as targets for the development of novel therapeutic interventions for inflammation.

DNA methylation profiles of donor nuclei cells and tissues of cloned bovine fetuses.

PubMed

Kremenskoy, Maksym; Kremenska, Yuliya; Suzuki, Masako; Imai, Kei; Takahashi, Seiya; Hashizume, Kazuyoshi; Yagi, Shintaro; Shiota, Kunio

2006-04-01

Methylation of DNA in CpG islands plays an important role during fetal development and differentiation because CpG islands are preferentially located in upstream regions of mammalian genomic DNA, including the transcription start site of housekeeping genes and are also associated with tissue-specific genes. Somatic nuclear transfer (NT) technology has been used to generate live clones in numerous mammalian species, but only a low percentage of nuclear transferred animals develop to term. Abnormal epigenetic changes in the CpG islands of donor nuclei after nuclear transfer could contribute to a high rate of abortion during early gestation and increase perinatal death. These changes have yet to be explored. Thus, we investigated the genome-wide DNA methylation profiles of CpG islands in nuclei donor cells and NT animals. Using Restriction Landmark Genomic Scanning (RLGS), we showed, for the first time, the epigenetic profile formation of tissues from NT bovine fetuses produced from cumulus cells. From approximately 2600 unmethylated NotI sites visualized on the RLGS profile, at least 35 NotI sites showed different methylation statuses. Moreover, we proved that fetal and placental tissues from artificially inseminated and cloned cattle have tissue-specific differences in the genome-wide methylation profiles of the CpG islands. We also found that possible abnormalities occurred in the fetal brain and placental tissues of cloned animals.

Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

PubMed Central

Ngô, V; Gourdji, D; Laverrière, J N

1996-01-01

The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

Decreased interferon-α production in response to CpG DNA dysregulates cytokine responses in patients with multiple sclerosis.

PubMed

Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao

2012-05-01

Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.

Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration.

PubMed

Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

2015-01-01

Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn't affect Egf mRNA expression during the re-organization phase.

Next-generation sequencing identifies major DNA methylation changes during progression of Ph+ chronic myeloid leukemia

PubMed Central

Heller, G; Topakian, T; Altenberger, C; Cerny-Reiterer, S; Herndlhofer, S; Ziegler, B; Datlinger, P; Byrgazov, K; Bock, C; Mannhalter, C; Hörmann, G; Sperr, W R; Lion, T; Zielinski, C C; Valent, P; Zöchbauer-Müller, S

2016-01-01

Little is known about the impact of DNA methylation on the evolution/progression of Ph+ chronic myeloid leukemia (CML). We investigated the methylome of CML patients in chronic phase (CP-CML), accelerated phase (AP-CML) and blast crisis (BC-CML) as well as in controls by reduced representation bisulfite sequencing. Although only ~600 differentially methylated CpG sites were identified in samples obtained from CP-CML patients compared with controls, ~6500 differentially methylated CpG sites were found in samples from BC-CML patients. In the majority of affected CpG sites, methylation was increased. In CP-CML patients who progressed to AP-CML/BC-CML, we identified up to 897 genes that were methylated at the time of progression but not at the time of diagnosis. Using RNA-sequencing, we observed downregulated expression of many of these genes in BC-CML compared with CP-CML samples. Several of them are well-known tumor-suppressor genes or regulators of cell proliferation, and gene re-expression was observed by the use of epigenetic active drugs. Together, our results demonstrate that CpG site methylation clearly increases during CML progression and that it may provide a useful basis for revealing new targets of therapy in advanced CML. PMID:27211271

Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

PubMed Central

Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

2015-01-01

Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

Region of interest methylation analysis: a comparison of MSP with MS-HRM and direct BSP.

PubMed

Akika, Reem; Awada, Zainab; Mogharbil, Nahed; Zgheib, Nathalie K

2017-07-01

The aim of this study was to compare and contrast three DNA methylation methods of a specific region of interest (ROI): methylation-specific PCR (MSP), methylation-sensitive high resolution melting (MS-HRM) and direct bisulfite sequencing (BSP). The methylation of a CpG area in the promoter region of Estrogen receptor alpha (ESR1) was evaluated by these three methods with samples and standards of different methylation percentages. MSP data were neither reproducible nor sensitive, and the assay was not specific due to non-specific binding of primers. MS-HRM was highly reproducible and a step forward into categorizing the methylation status of the samples as percent ranges. Direct BSP was the most informative method regarding methylation percentage of each CpG site. Though not perfect, it was reproducible and sensitive. We recommend the use of either method depending on the research question and target amplicon, and provided that the designed primers and expected amplicons are within recommendations. If the research question targets a limited number of CpG sites and simple yes/no results are enough, MSP may be attempted. For short amplicons that are crowded with CpG sites and of single melting domain, MS-HRM may be the method of choice though it only indicates the overall methylation percentage of the entire amplicon. Although the assay is highly reproducible, being semi-quantitative makes it of lesser interest to study ROI methylation of samples with little methylation differences. Direct BSP is a step forward as it gives information about the methylation percentage at each CpG site.

dbCPG: A web resource for cancer predisposition genes.

PubMed

Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

2016-06-21

Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes.

Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain

PubMed Central

Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

2014-01-01

Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ∼3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ∼2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5′ CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ∼750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain. PMID:25482058

Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain.

PubMed

Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

2014-11-01

Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ~3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ~2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5' CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ~750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain.

Maternal BMI as a predictor of methylation of obesity-related genes in saliva samples from preschool-age Hispanic children at-risk for obesity.

PubMed

Oelsner, Kathryn Tully; Guo, Yan; To, Sophie Bao-Chieu; Non, Amy L; Barkin, Shari L

2017-01-09

The study of epigenetic processes and mechanisms present a dynamic approach to assess complex individual variation in obesity susceptibility. However, few studies have examined epigenetic patterns in preschool-age children at-risk for obesity despite the relevance of this developmental stage to trajectories of weight gain. We hypothesized that salivary DNA methylation patterns of key obesogenic genes in Hispanic children would 1) correlate with maternal BMI and 2) allow for identification of pathways associated with children at-risk for obesity. Genome-wide DNA methylation was conducted on 92 saliva samples collected from Hispanic preschool children using the Infinium Illumina HumanMethylation 450 K BeadChip (Illumina, San Diego, CA, USA), which interrogates >484,000 CpG sites associated with ~24,000 genes. The analysis was limited to 936 genes that have been associated with obesity in a prior GWAS Study. Child DNA methylation at 17 CpG sites was found to be significantly associated with maternal BMI, with increased methylation at 12 CpG sites and decreased methylation at 5 CpG sites. Pathway analysis revealed methylation at these sites related to homocysteine and methionine degradation as well as cysteine biosynthesis and circadian rhythm. Furthermore, eight of the 17 CpG sites reside in genes (FSTL1, SORCS2, NRF1, DLC1, PPARGC1B, CHN2, NXPH1) that have prior known associations with obesity, diabetes, and the insulin pathway. Our study confirms that saliva is a practical human tissue to obtain in community settings and in pediatric populations. These salivary findings indicate potential epigenetic differences in Hispanic preschool children at risk for pediatric obesity. Identifying early biomarkers and understanding pathways that are epigenetically regulated during this critical stage of child development may present an opportunity for prevention or early intervention for addressing childhood obesity. The clinical trial protocol is available at ClinicalTrials.gov ( NCT01316653 ). Registered 3 March 2011.

DNA methylation markers in combination with skeletal and dental ages to improve age estimation in children.

PubMed

Shi, Lei; Jiang, Fan; Ouyang, Fengxiu; Zhang, Jun; Wang, Zhimin; Shen, Xiaoming

2018-03-01

Age estimation is critical in forensic science, in competitive sports and games and in other age-related fields, but the current methods are suboptimal. The combination of age-associated DNA methylation markers with skeletal age (SA) and dental age (DA) may improve the accuracy and precision of age estimation, but no study has examined this topic. In the current study, we measured SA (GP, TW3-RUS, and TW3-Carpal methods) and DA (Demirjian and Willems methods) by X-ray examination in 124 Chinese children (78 boys and 46 girls) aged 6-15 years. To identify age-associated CpG sites, we analyzed methylome-wide DNA methylation profiling by using the Illumina HumanMethylation450 BeadChip system in 48 randomly selected children. Five CpG sites were identified as associated with chronologic age (CA), with an absolute value of Pearson's correlation coefficient (r)>0.5 (p<0.01) and a false discovery rate<0.01. The validation of age-associated CpG sites was performed using droplet digital PCR techniques in all 124 children. After validation, four CpG sites for boys and five CpG sites for girls were further adopted to build the age estimation model with SA and DA using multivariate linear stepwise regressions. These CpG sites were located at 4 known genes: DDO, PRPH2, DHX8, and ITGA2B and at one unknown gene with the Illumina ID number of 22398226. The accuracy of age estimation methods was compared according to the mean absolute error (MAE) and root mean square error (RMSE). The best single measure for SA was the TW3-RUS method (MAE=0.69years, RMSE=0.95years) in boys, and the GP method (MAE=0.74years, RMSE=0.94years) in girls. For DA, the Willems method was the best single measure for both boys (MAE=0.63years, RMSE=0.78years) and girls (MAE=0.54years, RMSE=0.68years). The models that incorporated SA and DA with the methylation levels of age-associated CpG sites provided the highest accuracy of age estimation in both boys (MAE=0.47years, R 2 =0.886) and girls (MAE=0.33years, R 2 =0.941). Cross validation of the results confirmed the reliability and validity of the models. In conclusion, age-associated DNA methylation markers in combination with SA and DA greatly improve the accuracy of age estimation in Chinese children. This method may be applied in forensic science, in competitive sports and games and in other age-related fields. Copyright © 2017. Published by Elsevier B.V.

The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

NASA Technical Reports Server (NTRS)

Nillen, Jeannie L.; Smith, Scott M.

2003-01-01

A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

Smoking-Associated Site-Specific Differential Methylation in Buccal Mucosa in the COPDGene Study

PubMed Central

Qiu, Weiliang; Carey, Vincent J.; Morrow, Jarrett; Bacherman, Helene; Foreman, Marilyn G.; Hokanson, John E.; Bowler, Russell P.; Crapo, James D.; DeMeo, Dawn L.

2015-01-01

DNA methylation is a complex, tissue-specific phenomenon that can reflect both endogenous factors and exogenous exposures. Buccal brushings represent an easily accessible source of DNA, which may be an appropriate surrogate tissue in the study of environmental exposures and chronic respiratory diseases. Buccal brushings were obtained from a subset of current and former smokers from the COPDGene study. Genome-wide DNA methylation data were obtained in the discovery cohort (n = 82) using the Illumina HumanMethylation450K array. Empirical Bayes methods were used to test for differential methylation by current smoking status at 468,219 autosomal CpG sites using linear models adjusted for age, sex, and race. Pyrosequencing was performed in a nonoverlapping replication cohort (n = 130). Current smokers were significantly younger than former smokers in both the discovery and replication cohorts. Seven CpG sites were associated with current smoking at a false discovery rate less than 0.05 in the discovery cohort. Six of the seven significant sites were pyrosequenced in the replication cohort; five CpG sites, including sites annotated to CYP1B1 and PARVA, were replicated. Correlations between cumulative smoke exposure and time since smoking cessation were observed in a subset of the significantly associated CpG sites. A significant correlation between reduced lung function and increased radiographic emphysema with methylation at cg02162897 (CYP1B1) was observed among female subjects. Site-specific methylation of DNA isolated from buccal mucosa is associated with exposure to cigarette smoke, and may provide insights into the mechanisms underlying differential susceptibility toward the development of smoking-related chronic respiratory diseases. PMID:25517428

Global Epigenetic Changes May Underlie Ethnic Differences and susceptibility to Prostate Cancer

DTIC Science & Technology

2012-09-01

tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA methylation occurs at CpG sites in the human...that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to be targets of DNA hypermethylation-associated...One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men in comparison with EA and Asians [12]. Another

CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

PubMed Central

Qiao, Huan; May, James M.

2013-01-01

SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

DNA methylation profile distinguishes clear cell sarcoma of the kidney from other pediatric renal tumors.

PubMed

Ueno, Hitomi; Okita, Hajime; Akimoto, Shingo; Kobayashi, Kenichiro; Nakabayashi, Kazuhiko; Hata, Kenichiro; Fujimoto, Junichiro; Hata, Jun-Ichi; Fukuzawa, Masahiro; Kiyokawa, Nobutaka

2013-01-01

A number of specific, distinct neoplastic entities occur in the pediatric kidney, including Wilms' tumor, clear cell sarcoma of the kidney (CCSK), congenital mesoblastic nephroma (CMN), rhabdoid tumor of the kidney (RTK), and the Ewing's sarcoma family of tumors (ESFT). By employing DNA methylation profiling using Illumina Infinium HumanMethylation27, we analyzed the epigenetic characteristics of the sarcomas including CCSK, RTK, and ESFT in comparison with those of the non-neoplastic kidney (NK), and these tumors exhibited distinct DNA methylation profiles in a tumor-type-specific manner. CCSK is the most frequently hypermethylated, but least frequently hypomethylated, at CpG sites among these sarcomas, and exhibited 490 hypermethylated and 46 hypomethylated CpG sites in compared with NK. We further validated the results by MassARRAY, and revealed that a combination of four genes was sufficient for the DNA methylation profile-based differentiation of these tumors by clustering analysis. Furthermore, THBS1 CpG sites were found to be specifically hypermethylated in CCSK and, thus, the DNA methylation status of these THBS1 sites alone was sufficient for the distinction of CCSK from other pediatric renal tumors, including Wilms' tumor and CMN. Moreover, combined bisulfite restriction analysis could be applied for the detection of hypermethylation of a THBS1 CpG site. Besides the biological significance in the pathogenesis, the DNA methylation profile should be useful for the differential diagnosis of pediatric renal tumors.

Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

PubMed

Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

2015-08-01

DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

Predicting aberrant CpG island methylation

PubMed Central

Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

2003-01-01

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

Predicting aberrant CpG island methylation.

PubMed

Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

2003-10-14

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

Immortalization of T-cells is accompanied by gradual changes in CpG methylation resulting in a profile resembling a subset of T-cell leukemias.

PubMed

Degerman, Sofie; Landfors, Mattias; Siwicki, Jan Konrad; Revie, John; Borssén, Magnus; Evelönn, Emma; Forestier, Erik; Chrzanowska, Krystyna H; Rydén, Patrik; Keith, W Nicol; Roos, Göran

2014-07-01

We have previously described gene expression changes during spontaneous immortalization of T-cells, thereby identifying cellular processes important for cell growth crisis escape and unlimited proliferation. Here, we analyze the same model to investigate the role of genome-wide methylation in the immortalization process at different time points pre-crisis and post-crisis using high-resolution arrays. We show that over time in culture there is an overall accumulation of methylation alterations, with preferential increased methylation close to transcription start sites (TSSs), islands, and shore regions. Methylation and gene expression alterations did not correlate for the majority of genes, but for the fraction that correlated, gain of methylation close to TSS was associated with decreased gene expression. Interestingly, the pattern of CpG site methylation observed in immortal T-cell cultures was similar to clinical T-cell acute lymphoblastic leukemia (T-ALL) samples classified as CpG island methylator phenotype positive. These sites were highly overrepresented by polycomb target genes and involved in developmental, cell adhesion, and cell signaling processes. The presence of non-random methylation events in in vitro immortalized T-cell cultures and diagnostic T-ALL samples indicates altered methylation of CpG sites with a possible role in malignant hematopoiesis. Copyright © 2014 Neoplasia Press, Inc. Published by Elsevier Inc. All rights reserved.

dbCPG: A web resource for cancer predisposition genes

PubMed Central

Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

2016-01-01

Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes. PMID:27192119

DNA methylation and exposure to ambient air pollution in two prospective cohorts.

PubMed

Plusquin, Michelle; Guida, Florence; Polidoro, Silvia; Vermeulen, Roel; Raaschou-Nielsen, Ole; Campanella, Gianluca; Hoek, Gerard; Kyrtopoulos, Soterios A; Georgiadis, Panagiotis; Naccarati, Alessio; Sacerdote, Carlotta; Krogh, Vittorio; Bas Bueno-de-Mesquita, H; Monique Verschuren, W M; Sayols-Baixeras, Sergi; Panni, Tommaso; Peters, Annette; Hebels, Dennie G A J; Kleinjans, Jos; Vineis, Paolo; Chadeau-Hyam, Marc

2017-11-01

Long-term exposure to air pollution has been associated with several adverse health effects including cardiovascular, respiratory diseases and cancers. However, underlying molecular alterations remain to be further investigated. The aim of this study is to investigate the effects of long-term exposure to air pollutants on (a) average DNA methylation at functional regions and, (b) individual differentially methylated CpG sites. An assumption is that omic measurements, including the methylome, are more sensitive to low doses than hard health outcomes. This study included blood-derived DNA methylation (Illumina-HM450 methylation) for 454 Italian and 159 Dutch participants from the European Prospective Investigation into Cancer and Nutrition (EPIC). Long-term air pollution exposure levels, including NO 2 , NO x , PM 2.5 , PM coarse , PM 10 , PM 2.5 absorbance (soot) were estimated using models developed within the ESCAPE project, and back-extrapolated to the time of sampling when possible. We meta-analysed the associations between the air pollutants and global DNA methylation, methylation in functional regions and epigenome-wide methylation. CpG sites found differentially methylated with air pollution were further investigated for functional interpretation in an independent population (EnviroGenoMarkers project), where (N=613) participants had both methylation and gene expression data available. Exposure to NO 2 was associated with a significant global somatic hypomethylation (p-value=0.014). Hypomethylation of CpG island's shores and shelves and gene bodies was significantly associated with higher exposures to NO 2 and NO x . Meta-analysing the epigenome-wide findings of the 2 cohorts did not show genome-wide significant associations at single CpG site level. However, several significant CpG were found if the analyses were separated by countries. By regressing gene expression levels against methylation levels of the exposure-related CpG sites, we identified several significant CpG-transcript pairs and highlighted 5 enriched pathways for NO 2 and 9 for NO x mainly related to the immune system and its regulation. Our findings support results on global hypomethylation associated with air pollution, and suggest that the shores and shelves of CpG islands and gene bodies are mostly affected by higher exposure to NO 2 and NO x . Functional differences in the immune system were suggested by transcriptome analyses. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

PubMed Central

2010-01-01

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

PubMed

Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

2010-02-05

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

Epigenome-wide association study of fasting measures of glucose, insulin, and HOMA-IR in the Genetics of Lipid Lowering Drugs and Diet Network study.

PubMed

Hidalgo, Bertha; Irvin, M Ryan; Sha, Jin; Zhi, Degui; Aslibekyan, Stella; Absher, Devin; Tiwari, Hemant K; Kabagambe, Edmond K; Ordovas, Jose M; Arnett, Donna K

2014-02-01

Known genetic susceptibility loci for type 2 diabetes (T2D) explain only a small proportion of heritable T2D risk. We hypothesize that DNA methylation patterns may contribute to variation in diabetes-related risk factors, and this epigenetic variation across the genome can contribute to the missing heritability in T2D and related metabolic traits. We conducted an epigenome-wide association study for fasting glucose, insulin, and homeostasis model assessment of insulin resistance (HOMA-IR) among 837 nondiabetic participants in the Genetics of Lipid Lowering Drugs and Diet Network study, divided into discovery (N = 544) and replication (N = 293) stages. Cytosine guanine dinucleotide (CpG) methylation at ∼470,000 CpG sites was assayed in CD4(+) T cells using the Illumina Infinium HumanMethylation 450 Beadchip. We fit a mixed model with the methylation status of each CpG as the dependent variable, adjusting for age, sex, study site, and T-cell purity as fixed-effects and family structure as a random-effect. A Bonferroni corrected P value of 1.1 × 10(-7) was considered significant in the discovery stage. Significant associations were tested in the replication stage using identical models. Methylation of a CpG site in ABCG1 on chromosome 21 was significantly associated with insulin (P = 1.83 × 10(-7)) and HOMA-IR (P = 1.60 × 10(-9)). Another site in the same gene was significant for HOMA-IR and of borderline significance for insulin (P = 1.29 × 10(-7) and P = 3.36 × 10(-6), respectively). Associations with the top two signals replicated for insulin and HOMA-IR (P = 5.75 × 10(-3) and P = 3.35 × 10(-2), respectively). Our findings suggest that methylation of a CpG site within ABCG1 is associated with fasting insulin and merits further evaluation as a novel disease risk marker.

Integrated Multiregional Analysis Proposing a New Model of Colorectal Cancer Evolution

PubMed Central

Niida, Atsushi; Shimamura, Teppei; Hirata, Hidenari; Sugimachi, Keishi; Sawada, Genta; Iwaya, Takeshi; Kurashige, Junji; Shinden, Yoshiaki; Iguchi, Tomohiro; Eguchi, Hidetoshi; Chiba, Kenichi; Shiraishi, Yuichi; Nagae, Genta; Yoshida, Kenichi; Nagata, Yasunobu; Haeno, Hiroshi; Yamamoto, Hirofumi; Ishii, Hideshi; Doki, Yuichiro; Iinuma, Hisae; Sasaki, Shin; Nagayama, Satoshi; Yamada, Kazutaka; Yachida, Shinichi; Kato, Mamoru; Shibata, Tatsuhiro; Oki, Eiji; Saeki, Hiroshi; Shirabe, Ken; Oda, Yoshinao; Maehara, Yoshihiko; Komune, Shizuo; Mori, Masaki; Suzuki, Yutaka; Yamamoto, Ken; Aburatani, Hiroyuki; Ogawa, Seishi; Miyano, Satoru; Mimori, Koshi

2016-01-01

Understanding intratumor heterogeneity is clinically important because it could cause therapeutic failure by fostering evolutionary adaptation. To this end, we profiled the genome and epigenome in multiple regions within each of nine colorectal tumors. Extensive intertumor heterogeneity is observed, from which we inferred the evolutionary history of the tumors. First, clonally shared alterations appeared, in which C>T transitions at CpG site and CpG island hypermethylation were relatively enriched. Correlation between mutation counts and patients’ ages suggests that the early-acquired alterations resulted from aging. In the late phase, a parental clone was branched into numerous subclones. Known driver alterations were observed frequently in the early-acquired alterations, but rarely in the late-acquired alterations. Consistently, our computational simulation of the branching evolution suggests that extensive intratumor heterogeneity could be generated by neutral evolution. Collectively, we propose a new model of colorectal cancer evolution, which is useful for understanding and confronting this heterogeneous disease. PMID:26890883

Whole-genome fingerprint of the DNA methylome during human B cell differentiation.

PubMed

Kulis, Marta; Merkel, Angelika; Heath, Simon; Queirós, Ana C; Schuyler, Ronald P; Castellano, Giancarlo; Beekman, Renée; Raineri, Emanuele; Esteve, Anna; Clot, Guillem; Verdaguer-Dot, Néria; Duran-Ferrer, Martí; Russiñol, Nuria; Vilarrasa-Blasi, Roser; Ecker, Simone; Pancaldi, Vera; Rico, Daniel; Agueda, Lidia; Blanc, Julie; Richardson, David; Clarke, Laura; Datta, Avik; Pascual, Marien; Agirre, Xabier; Prosper, Felipe; Alignani, Diego; Paiva, Bruno; Caron, Gersende; Fest, Thierry; Muench, Marcus O; Fomin, Marina E; Lee, Seung-Tae; Wiemels, Joseph L; Valencia, Alfonso; Gut, Marta; Flicek, Paul; Stunnenberg, Hendrik G; Siebert, Reiner; Küppers, Ralf; Gut, Ivo G; Campo, Elías; Martín-Subero, José I

2015-07-01

We analyzed the DNA methylome of ten subpopulations spanning the entire B cell differentiation program by whole-genome bisulfite sequencing and high-density microarrays. We observed that non-CpG methylation disappeared upon B cell commitment, whereas CpG methylation changed extensively during B cell maturation, showing an accumulative pattern and affecting around 30% of all measured CpG sites. Early differentiation stages mainly displayed enhancer demethylation, which was associated with upregulation of key B cell transcription factors and affected multiple genes involved in B cell biology. Late differentiation stages, in contrast, showed extensive demethylation of heterochromatin and methylation gain at Polycomb-repressed areas, and genes with apparent functional impact in B cells were not affected. This signature, which has previously been linked to aging and cancer, was particularly widespread in mature cells with an extended lifespan. Comparing B cell neoplasms with their normal counterparts, we determined that they frequently acquire methylation changes in regions already undergoing dynamic methylation during normal B cell differentiation.

Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

PubMed

Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

2014-10-20

The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

Trichloroethylene-induced alterations in DNA methylation were enriched in polycomb protein binding sites in effector/memory CD4+ T cells

PubMed Central

Gilbert, Kathleen M.; Blossom, Sarah J.; Reisfeld, Brad; Erickson, Stephen W.; Vyas, Kanan; Maher, Mary; Broadfoot, Brannon; West, Kirk; Bai, Shasha; Cooney, Craig A.; Bhattacharyya, Sudeepa

2017-01-01

Abstract Exposure to industrial solvent and water pollutant trichloroethylene (TCE) can promote autoimmunity, and expand effector/memory (CD62L) CD4+ T cells. In order to better understand etiology reduced representation bisulfite sequencing was used to study how a 40-week exposure to TCE in drinking water altered methylation of ∼337 770 CpG sites across the entire genome of effector/memory CD4+ T cells from MRL+/+ mice. Regardless of TCE exposure, 62% of CpG sites in autosomal chromosomes were hypomethylated (0–15% methylation), and 25% were hypermethylated (85–100% methylation). In contrast, only 6% of the CpGs on the X chromosome were hypomethylated, and 51% had mid-range methylation levels. In terms of TCE impact, TCE altered (≥ 10%) the methylation of 233 CpG sites in effector/memory CD4+ T cells. Approximately 31.7% of these differentially methylated sites occurred in regions known to bind one or more Polycomb group (PcG) proteins, namely Ezh2, Suz12, Mtf2 or Jarid2. In comparison, only 23.3% of CpG sites not differentially methylated by TCE were found in PcG protein binding regions. Transcriptomics revealed that TCE altered the expression of ∼560 genes in the same effector/memory CD4+ T cells. At least 80% of the immune genes altered by TCE had binding sites for PcG proteins flanking their transcription start site, or were regulated by other transcription factors that were in turn ordered by PcG proteins at their own transcription start site. Thus, PcG proteins, and the differential methylation of their binding sites, may represent a new mechanism by which TCE could alter the function of effector/memory CD4+ T cells. PMID:29129997

Hypermethylation of MST1 in IgG4-related autoimmune pancreatitis and rheumatoid arthritis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fukuhara, Takataro; Tomiyama, Takashi; Yasuda, Kaneki

The serine/threonine kinase Mst1 plays important roles in the control of immune cell trafficking, proliferation, and differentiation. Previously, we reported that Mst1 was required for thymocyte selection and regulatory T-cell functions, thereby the prevention of autoimmunity in mice. In humans, MST1 null mutations cause T-cell immunodeficiency and hypergammaglobulinemia with autoantibody production. RASSF5C(RAPL) is an activator of MST1 and it is frequently methylated in some tumors. Herein, we investigated methylation of the promoter regions of MST1 and RASSF5C(RAPL) in leukocytes from patients with IgG4-related autoimmune pancreatitis (AIP) and rheumatoid arthritis (RA). Increased number of CpG methylation in the 5′ region ofmore » MST1 was detected in AIP patients with extrapancreatic lesions, whereas AIP patients without extrapancreatic lesions were similar to controls. In RA patients, we detected a slight increased CpG methylation in MST1, although the overall number of methylation sites was lower than that of AIP patients with extrapancreatic lesions. There were no significant changes of the methylation levels of the CpG islands in the 5′ region of RASSF5C(RAPL) in leukocytes from AIP and RA patients. Consistently, we found a significantly down-regulated expression of MST1 in regulatory T cells of AIP patients. Our results suggest that the decreased expression of MST1 in regulatory T cells due to hypermethylation of the promoter contributes to the pathogenesis of IgG4-related AIP. - Highlights: • Mst1 controls immune cells trafficking, cell proliferation and differentiation. • Autoimmune pancreatitis (AIP) is an idiopathic pancreatitis affecting multiple organs. • Decreased MST1 expression and increased CpG methylation of promoter of MST1 in AIP. • Slight increased CpG methylation of MST1 in rheumatoid arthritis patients. • MST1 contributes pathogenesis of IgG4-related AIP.« less

Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

PubMed

Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

2015-07-08

The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Comprehensive Cancer-Predisposition Gene Testing in an Adult Multiple Primary Tumor Series Shows a Broad Range of Deleterious Variants and Atypical Tumor Phenotypes.

PubMed

Whitworth, James; Smith, Philip S; Martin, Jose-Ezequiel; West, Hannah; Luchetti, Andrea; Rodger, Faye; Clark, Graeme; Carss, Keren; Stephens, Jonathan; Stirrups, Kathleen; Penkett, Chris; Mapeta, Rutendo; Ashford, Sofie; Megy, Karyn; Shakeel, Hassan; Ahmed, Munaza; Adlard, Julian; Barwell, Julian; Brewer, Carole; Casey, Ruth T; Armstrong, Ruth; Cole, Trevor; Evans, Dafydd Gareth; Fostira, Florentia; Greenhalgh, Lynn; Hanson, Helen; Henderson, Alex; Hoffman, Jonathan; Izatt, Louise; Kumar, Ajith; Kwong, Ava; Lalloo, Fiona; Ong, Kai Ren; Paterson, Joan; Park, Soo-Mi; Chen-Shtoyerman, Rakefet; Searle, Claire; Side, Lucy; Skytte, Anne-Bine; Snape, Katie; Woodward, Emma R; Tischkowitz, Marc D; Maher, Eamonn R

2018-06-12

Multiple primary tumors (MPTs) affect a substantial proportion of cancer survivors and can result from various causes, including inherited predisposition. Currently, germline genetic testing of MPT-affected individuals for variants in cancer-predisposition genes (CPGs) is mostly targeted by tumor type. We ascertained pre-assessed MPT individuals (with at least two primary tumors by age 60 years or at least three by 70 years) from genetics centers and performed whole-genome sequencing (WGS) on 460 individuals from 440 families. Despite previous negative genetic assessment and molecular investigations, pathogenic variants in moderate- and high-risk CPGs were detected in 67/440 (15.2%) probands. WGS detected variants that would not be (or were not) detected by targeted resequencing strategies, including low-frequency structural variants (6/440 [1.4%] probands). In most individuals with a germline variant assessed as pathogenic or likely pathogenic (P/LP), at least one of their tumor types was characteristic of variants in the relevant CPG. However, in 29 probands (42.2% of those with a P/LP variant), the tumor phenotype appeared discordant. The frequency of individuals with truncating or splice-site CPG variants and at least one discordant tumor type was significantly higher than in a control population (χ 2 = 43.642; p ≤ 0.0001). 2/67 (3%) probands with P/LP variants had evidence of multiple inherited neoplasia allele syndrome (MINAS) with deleterious variants in two CPGs. Together with variant detection rates from a previous series of similarly ascertained MPT-affected individuals, the present results suggest that first-line comprehensive CPG analysis in an MPT cohort referred to clinical genetics services would detect a deleterious variant in about a third of individuals. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Promoter methylation of glucocorticoid receptor gene is associated with subclinical atherosclerosis: A monozygotic twin study.

PubMed

Zhao, Jinying; An, Qiang; Goldberg, Jack; Quyyumi, Arshed A; Vaccarino, Viola

2015-09-01

Endothelial dysfunction assessed by brachial artery flow-mediated dilation (FMD) is a marker of early atherosclerosis. Glucocorticoid receptor gene (NR3C1) regulates many biological processes, including stress response, behavioral, cardiometabolic and immunologic functions. Genetic variants in NR3C1 have been associated with atherosclerosis and related risk factors. This study investigated the association of NR3C1 promoter methylation with FMD, independent of genetic and family-level environmental factors. We studied 84 middle-aged, male-male monozygotic twin pairs recruited from the Vietnam Era Twin Registry. Brachial artery FMD was measured by ultrasound. DNA methylation levels at 22 CpG residues in the NR3C1 exon 1F promoter region were quantified by bisulfite pyrosequencing in genomic DNA isolated from peripheral blood leukocytes. Co-twin control analyses were conducted to examine the association of methylation variation with FMD, adjusting for smoking, physical activity, body mass index, lipids, blood pressure, fasting glucose, and depressive symptoms. Multiple testing was corrected using the false discovery rate. Mean methylation level across the 22 studied CpG sites was 2.02%. Methylation alterations at 12 out of the 22 CpG residues were significantly associated with FMD. On average, a 1% increase in the intra-pair difference in mean DNA methylation was associated with 2.83% increase in the intra-pair difference in FMD (95% CI: 1.46-4.20; P < 0.0001) after adjusting for risk factors and multiple testing. Methylation variation in NR3C1 exon 1F promoter significantly influences subclinical atherosclerosis, independent of genetic, early family environmental and other risk factors. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

CpG island mapping by epigenome prediction.

PubMed

Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

2007-06-01

CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic epigenetic and functional states. And it is superior to purely experimental epigenome mapping for CpG island detection since it abstracts from specific properties that are limited to a single cell type or tissue. In addition, using computational epigenetics methods we could identify high correlation between the epigenome and characteristics of the DNA sequence, a finding which emphasizes the need for a better understanding of the mechanistic links between genome and epigenome.

Conserved DNA methylation patterns in healthy blood cells and extensive changes in leukemia measured by a new quantitative technique

PubMed Central

Jelinek, Jaroslav; Liang, Shoudan; Lu, Yue; He, Rong; Ramagli, Louis S.; Shpall, Elizabeth J.; Estecio, Marcos R.H.; Issa, Jean-Pierre J.

2012-01-01

Genome wide analysis of DNA methylation provides important information in a variety of diseases, including cancer. Here, we describe a simple method, Digital Restriction Enzyme Analysis of Methylation (DREAM), based on next generation sequencing analysis of methylation-specific signatures created by sequential digestion of genomic DNA with SmaI and XmaI enzymes. DREAM provides information on 150,000 unique CpG sites, of which 39,000 are in CpG islands and 30,000 are at transcription start sites of 13,000 RefSeq genes. We analyzed DNA methylation in healthy white blood cells and found methylation patterns to be remarkably uniform. Inter individual differences > 30% were observed only at 227 of 28,331 (0.8%) of autosomal CpG sites. Similarly, > 30% differences were observed at only 59 sites when we comparing the cord and adult blood. These conserved methylation patterns contrasted with extensive changes affecting 18–40% of CpG sites in a patient with acute myeloid leukemia and in two leukemia cell lines. The method is cost effective, quantitative (r2 = 0.93 when compared with bisulfite pyrosequencing) and reproducible (r2 = 0.997). Using 100-fold coverage, DREAM can detect differences in methylation greater than 10% or 30% with a false positive rate below 0.05 or 0.001, respectively. DREAM can be useful in quantifying epigenetic effects of environment and nutrition, correlating developmental epigenetic variation with phenotypes, understanding epigenetics of cancer and chronic diseases, measuring the effects of drugs on DNA methylation or deriving new biological insights into mammalian genomes. PMID:23075513

Novel epigenetic determinants of type 2 diabetes in Mexican-American families.

PubMed

Kulkarni, Hemant; Kos, Mark Z; Neary, Jennifer; Dyer, Thomas D; Kent, Jack W; Göring, Harald H H; Cole, Shelley A; Comuzzie, Anthony G; Almasy, Laura; Mahaney, Michael C; Curran, Joanne E; Blangero, John; Carless, Melanie A

2015-09-15

Although DNA methylation is now recognized as an important mediator of complex diseases, the extent to which the genetic basis of such diseases is accounted for by DNA methylation is unknown. In the setting of large, extended families representing a minority, high-risk population of the USA, we aimed to characterize the role of epigenome-wide DNA methylation in type 2 diabetes (T2D). Using Illumina HumanMethylation450 BeadChip arrays, we tested for association of DNA methylation at 446 356 sites with age, sex and phenotypic traits related to T2D in 850 pedigreed Mexican-American individuals. Robust statistical analyses showed that (i) 15% of the methylome is significantly heritable, with a median heritability of 0.14; (ii) DNA methylation at 14% of CpG sites is associated with nearby sequence variants; (iii) 22% and 3% of the autosomal CpG sites are associated with age and sex, respectively; (iv) 53 CpG sites were significantly associated with liability to T2D, fasting blood glucose and insulin resistance; (v) DNA methylation levels at five CpG sites, mapping to three well-characterized genes (TXNIP, ABCG1 and SAMD12) independently explained 7.8% of the heritability of T2D (vi) methylation at these five sites was unlikely to be influenced by neighboring DNA sequence variation. Our study has identified novel epigenetic indicators of T2D risk in Mexican Americans who have increased risk for this disease. These results provide new insights into potential treatment targets of T2D. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Epigenome-wide DNA methylation study of IgE concentration in relation to self-reported allergies.

PubMed

Ek, Weronica E; Ahsan, Muhammad; Rask-Andersen, Mathias; Liang, Liming; Moffatt, Miriam F; Gyllensten, Ulf; Johansson, Åsa

2017-04-01

Epigenetic mechanisms are critical for normal immune development and epigenetic alterations might therefore be possible contributors to immune diseases. To investigate if DNA methylation in whole blood is associated with total and allergen-specific IgE levels. We performed an epigenome-wide association study to investigate the association between DNA methylation and IgE level, allergen-specific IgE and self-reported immune diseases and allergies in 728 individuals. We identified and replicated 15 CpG sites associated with IgE, mapping to biologically relevant genes, including ACOT7, ILR5A, KCNH2, PRG2 and EPX. A total of 331 loci were associated with allergen-specific IgE, but none of these CpG sites were associated with self-reported allergies and immune diseases. This study shows that IgE levels are associated with DNA methylation levels at numerous CpG sites, which might provide new leads for investigating the links between IgE and allergic inflammation.

Systematic feature selection improves accuracy of methylation-based forensic age estimation in Han Chinese males.

PubMed

Feng, Lei; Peng, Fuduan; Li, Shanfei; Jiang, Li; Sun, Hui; Ji, Anquan; Zeng, Changqing; Li, Caixia; Liu, Fan

2018-03-23

Estimating individual age from biomarkers may provide key information facilitating forensic investigations. Recent progress has shown DNA methylation at age-associated CpG sites as the most informative biomarkers for estimating the individual age of an unknown donor. Optimal feature selection plays a critical role in determining the performance of the final prediction model. In this study we investigate methylation levels at 153 age-associated CpG sites from 21 previously reported genomic regions using the EpiTYPER system for their predictive power on individual age in 390 Han Chinese males ranging from 15 to 75 years of age. We conducted a systematic feature selection using a stepwise backward multiple linear regression analysis as well as an exhaustive searching algorithm. Both approaches identified the same subset of 9 CpG sites, which in linear combination provided the optimal model fitting with mean absolute deviation (MAD) of 2.89 years of age and explainable variance (R 2 ) of 0.92. The final model was validated in two independent Han Chinese male samples (validation set 1, N = 65, MAD = 2.49, R 2  = 0.95, and validation set 2, N = 62, MAD = 3.36, R 2  = 0.89). Other competing models such as support vector machine and artificial neural network did not outperform the linear model to any noticeable degree. The validation set 1 was additionally analyzed using Pyrosequencing technology for cross-platform validation and was termed as validation set 3. Directly applying our model, in which the methylation levels were detected by the EpiTYPER system, to the data from pyrosequencing technology showed, however, less accurate results in terms of MAD (validation set 3, N = 65 Han Chinese males, MAD = 4.20, R 2  = 0.93), suggesting the presence of a batch effect between different data generation platforms. This batch effect could be partially overcome by a z-score transformation (MAD = 2.76, R 2  = 0.93). Overall, our systematic feature selection identified 9 CpG sites as the optimal subset for forensic age estimation and the prediction model consisting of these 9 markers demonstrated high potential in forensic practice. An age estimator implementing our prediction model allowing missing markers is freely available at http://liufan.big.ac.cn/AgePrediction. Copyright © 2018 Elsevier B.V. All rights reserved.

Profiling DNA methylome landscapes of mammalian cells with single-cell reduced-representation bisulfite sequencing.

PubMed

Guo, Hongshan; Zhu, Ping; Guo, Fan; Li, Xianlong; Wu, Xinglong; Fan, Xiaoying; Wen, Lu; Tang, Fuchou

2015-05-01

The heterogeneity of DNA methylation within a population of cells necessitates DNA methylome profiling at single-cell resolution. Recently, we developed a single-cell reduced-representation bisulfite sequencing (scRRBS) technique in which we modified the original RRBS method by integrating all the experimental steps before PCR amplification into a single-tube reaction. These modifications enable scRRBS to provide digitized methylation information on ∼1 million CpG sites within an individual diploid mouse or human cell at single-base resolution. Compared with the single-cell bisulfite sequencing (scBS) technique, scRRBS covers fewer CpG sites, but it provides better coverage for CpG islands (CGIs), which are likely to be the most informative elements for DNA methylation. The entire procedure takes ∼3 weeks, and it requires strong molecular biology skills.

DNA methylation in the APOE genomic region is associated with cognitive function in African Americans.

PubMed

Liu, Jiaxuan; Zhao, Wei; Ware, Erin B; Turner, Stephen T; Mosley, Thomas H; Smith, Jennifer A

2018-05-08

Genetic variations in apolipoprotein E (APOE) and proximal genes (PVRL2, TOMM40, and APOC1) are associated with cognitive function and dementia, particularly Alzheimer's disease. Epigenetic mechanisms such as DNA methylation play a central role in the regulation of gene expression. Recent studies have found evidence that DNA methylation may contribute to the pathogenesis of dementia, but its association with cognitive function in populations without dementia remains unclear. We assessed DNA methylation levels of 48 CpG sites in the APOE genomic region in peripheral blood leukocytes collected from 289 African Americans (mean age = 67 years) from the Genetic Epidemiology Network of Arteriopathy (GENOA) study. Using linear regression, we examined the relationship between methylation in the APOE genomic region and multiple cognitive measures including learning, memory, processing speed, concentration, language and global cognitive function. We identified eight CpG sites in three genes (PVRL2, TOMM40, and APOE) that showed an inverse association between methylation level and delayed recall, a measure of memory, after adjusting for age and sex (False Discovery Rate q-value < 0.1). All eight CpGs are located in either CpG islands (CGIs) or CGI shelves, and six of them are in promoter regions. Education and APOE ε4 carrier status significantly modified the effect of methylation in cg08583001 (PVRL2) and cg22024783 (TOMM40), respectively. Together, methylation of the eight CpGs explained an additional 8.7% of the variance in delayed recall, after adjustment for age, sex, education, and APOE ε4 carrier status. Methylation was not significantly associated with any other cognitive measures. Our results suggest that methylation levels at multiple CpGs in the APOE genomic region are inversely associated with delayed recall during normal cognitive aging, even after accounting for known genetic predictors for cognition. Our findings highlight the important role of epigenetic mechanisms in influencing cognitive performance, and suggest that changes in blood methylation may be an early indicator of individuals at risk for dementia as well as potential targets for intervention in asymptomatic populations.

Three SRA-Domain Methylcytosine-Binding Proteins Cooperate to Maintain Global CpG Methylation and Epigenetic Silencing in Arabidopsis

PubMed Central

Woo, Hye Ryun; Dittmer, Travis A.; Richards, Eric J.

2008-01-01

Methylcytosine-binding proteins decipher the epigenetic information encoded by DNA methylation and provide a link between DNA methylation, modification of chromatin structure, and gene silencing. VARIANT IN METHYLATION 1 (VIM1) encodes an SRA (SET- and RING-associated) domain methylcytosine-binding protein in Arabidopsis thaliana, and loss of VIM1 function causes centromere DNA hypomethylation and centromeric heterochromatin decondensation in interphase. In the Arabidopsis genome, there are five VIM genes that share very high sequence similarity and encode proteins containing a PHD domain, two RING domains, and an SRA domain. To gain further insight into the function and potential redundancy among the VIM proteins, we investigated strains combining different vim mutations and transgenic vim knock-down lines that down-regulate multiple VIM family genes. The vim1 vim3 double mutant and the transgenic vim knock-down lines showed decreased DNA methylation primarily at CpG sites in genic regions, as well as repeated sequences in heterochromatic regions. In addition, transcriptional silencing was released in these plants at most heterochromatin regions examined. Interestingly, the vim1 vim3 mutant and vim knock-down lines gained ectopic CpHpH methylation in the 5S rRNA genes against a background of CpG hypomethylation. The vim1 vim2 vim3 triple mutant displayed abnormal morphological phenotypes including late flowering, which is associated with DNA hypomethylation of the 5′ region of FWA and release of FWA gene silencing. Our findings demonstrate that VIM1, VIM2, and VIM3 have overlapping functions in maintenance of global CpG methylation and epigenetic transcriptional silencing. PMID:18704160

Prenatal exposure to allergen, DNA methylation, and allergy in grandoffspring mice.

PubMed

Niedzwiecki, M; Zhu, H; Corson, L; Grunig, G; Factor, P H; Chu, S; Jiang, H; Miller, R L

2012-07-01

Prenatal allergen exposure has been linked to both induction and protection of allergic sensitization in offspring. We hypothesized that prenatal exposure of mice (F0) to Aspergillus fumigatus (A. fumigatus) would be associated with decreased immunoglobulin (Ig) E and airway eosinophilia and alterations in CpG methylation of T-helper genes in third-generation mice (F2). Female BALB/c mice were sensitized to A. fumigatus (62.5, 125, 1250 μg, or saline) and re-exposed to the same dose on days 7 and 14 (early) or days 12 and 17 (late) gestation. Grandoffspring were treated with A. fumigatus (62.5 μg) at 9 weeks. IgE, IgG(1) , and IgG(2a) levels and cell counts from bronchoalveolar lavage fluid were determined. Lung DNA was pyrosequenced at multiple sites in the interferon (IFN)-γ and interleukin (IL)-4 promoters. Grandoffspring of mothers dosed with 1250 μg early during pregnancy developed increased airway eosinophilia (P < 0.05). Grandoffspring of mothers dosed late in pregnancy developed lower IgE (P < 0.05) and airway eosinophilia (P < 0.05). Grandoffspring of mothers dosed early had lower methylation at IL-4 CpG(-408) and CpG(-393) compared to late dosed mice (P < 0.005 across all doses). Few correlations were found between methylation levels and airway eosinophilia and IgE. Prenatal exposure to A. fumigatus late during pregnancy, but not early, was associated with lower IgE and airway eosinophilia in grandoffspring. Prenatal exposure to A. fumigatus was associated with changes in CpG methylation in the IFN-γ and IL-4 promoters that did not correlate consistently with indicators of allergic sensitization. © 2012 John Wiley & Sons A/S.

ampliMethProfiler: a pipeline for the analysis of CpG methylation profiles of targeted deep bisulfite sequenced amplicons.

PubMed

Scala, Giovanni; Affinito, Ornella; Palumbo, Domenico; Florio, Ermanno; Monticelli, Antonella; Miele, Gennaro; Chiariotti, Lorenzo; Cocozza, Sergio

2016-11-25

CpG sites in an individual molecule may exist in a binary state (methylated or unmethylated) and each individual DNA molecule, containing a certain number of CpGs, is a combination of these states defining an epihaplotype. Classic quantification based approaches to study DNA methylation are intrinsically unable to fully represent the complexity of the underlying methylation substrate. Epihaplotype based approaches, on the other hand, allow methylation profiles of cell populations to be studied at the single molecule level. For such investigations, next-generation sequencing techniques can be used, both for quantitative and for epihaplotype analysis. Currently available tools for methylation analysis lack output formats that explicitly report CpG methylation profiles at the single molecule level and that have suited statistical tools for their interpretation. Here we present ampliMethProfiler, a python-based pipeline for the extraction and statistical epihaplotype analysis of amplicons from targeted deep bisulfite sequencing of multiple DNA regions. ampliMethProfiler tool provides an easy and user friendly way to extract and analyze the epihaplotype composition of reads from targeted bisulfite sequencing experiments. ampliMethProfiler is written in python language and requires a local installation of BLAST and (optionally) QIIME tools. It can be run on Linux and OS X platforms. The software is open source and freely available at http://amplimethprofiler.sourceforge.net .

Analysis of the association between CIMP and BRAF in colorectal cancer by DNA methylation profiling.

PubMed

Hinoue, Toshinori; Weisenberger, Daniel J; Pan, Fei; Campan, Mihaela; Kim, Myungjin; Young, Joanne; Whitehall, Vicki L; Leggett, Barbara A; Laird, Peter W

2009-12-21

A CpG island methylator phenotype (CIMP) is displayed by a distinct subset of colorectal cancers with a high frequency of DNA hypermethylation in a specific group of CpG islands. Recent studies have shown that an activating mutation of BRAF (BRAF(V600E)) is tightly associated with CIMP, raising the question of whether BRAF(V600E) plays a causal role in the development of CIMP or whether CIMP provides a favorable environment for the acquisition of BRAF(V600E). We employed Illumina GoldenGate DNA methylation technology, which interrogates 1,505 CpG sites in 807 different genes, to further study this association. We first examined whether expression of BRAF(V600E) causes DNA hypermethylation by stably expressing BRAF(V600E) in the CIMP-negative, BRAF wild-type COLO 320DM colorectal cancer cell line. We determined 100 CIMP-associated CpG sites and examined changes in DNA methylation in eight stably transfected clones over multiple passages. We found that BRAF(V600E) is not sufficient to induce CIMP in our system. Secondly, considering the alternative possibility, we identified genes whose DNA hypermethylation was closely linked to BRAF(V600E) and CIMP in 235 primary colorectal tumors. Interestingly, genes that showed the most significant link include those that mediate various signaling pathways implicated in colorectal tumorigenesis, such as BMP3 and BMP6 (BMP signaling), EPHA3, KIT, and FLT1 (receptor tyrosine kinases) and SMO (Hedgehog signaling). Furthermore, we identified CIMP-dependent DNA hypermethylation of IGFBP7, which has been shown to mediate BRAF(V600E)-induced cellular senescence and apoptosis. Promoter DNA hypermethylation of IGFBP7 was associated with silencing of the gene. CIMP-specific inactivation of BRAF(V600E)-induced senescence and apoptosis pathways by IGFBP7 DNA hypermethylation might create a favorable context for the acquisition of BRAF(V600E) in CIMP+ colorectal cancer. Our data will be useful for future investigations toward understanding CIMP in colorectal cancer and gaining insights into the role of aberrant DNA hypermethylation in colorectal tumorigenesis.

Heritable DNA methylation in CD4+ cells among complex families displays genetic and non-genetic effects

USDA-ARS?s Scientific Manuscript database

DNA methylation at CpG sites is both heritable and influenced by environment, but the relative contributions of each to DNA methylation levels are unclear. We conducted a heritability analysis of CpG methylation in human CD4+ cells across 975 individuals from 163 families in the Genetics of Lipid-lo...

GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

PubMed

Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

2017-05-24

As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

Characterization and machine learning prediction of allele-specific DNA methylation.

PubMed

He, Jianlin; Sun, Ming-an; Wang, Zhong; Wang, Qianfei; Li, Qing; Xie, Hehuang

2015-12-01

A large collection of Single Nucleotide Polymorphisms (SNPs) has been identified in the human genome. Currently, the epigenetic influences of SNPs on their neighboring CpG sites remain elusive. A growing body of evidence suggests that locus-specific information, including genomic features and local epigenetic state, may play important roles in the epigenetic readout of SNPs. In this study, we made use of mouse methylomes with known SNPs to develop statistical models for the prediction of SNP associated allele-specific DNA methylation (ASM). ASM has been classified into parent-of-origin dependent ASM (P-ASM) and sequence-dependent ASM (S-ASM), which comprises scattered-S-ASM (sS-ASM) and clustered-S-ASM (cS-ASM). We found that P-ASM and cS-ASM CpG sites are both enriched in CpG rich regions, promoters and exons, while sS-ASM CpG sites are enriched in simple repeat and regions with high frequent SNP occurrence. Using Lasso-grouped Logistic Regression (LGLR), we selected 21 out of 282 genomic and methylation related features that are powerful in distinguishing cS-ASM CpG sites and trained the classifiers with machine learning techniques. Based on 5-fold cross-validation, the logistic regression classifier was found to be the best for cS-ASM prediction with an ACC of 0.77, an AUC of 0.84 and an MCC of 0.54. Lastly, we applied the logistic regression classifier on human brain methylome and predicted 608 genes associated with cS-ASM. Gene ontology term enrichment analysis indicated that these cS-ASM associated genes are significantly enriched in the category coding for transcripts with alternative splicing forms. In summary, this study provided an analytical procedure for cS-ASM prediction and shed new light on the understanding of different types of ASM events. Published by Elsevier Inc.

Epigenetic Contribution of the Myosin Light Chain Kinase Gene to the Risk for Acute Respiratory Distress Syndrome

PubMed Central

Szilágyi, Keely L.; Liu, Cong; Zhang, Xu; Wang, Ting; Fortman, Jeffrey D.; Zhang, Wei; Garcia, Joe G.N.

2016-01-01

Acute respiratory distress syndrome (ARDS) is a devastating clinical syndrome with a considerable case fatality rate (~30-40%). Health disparities exist with African descent subjects (ADs) exhibiting greater mortality than European descent individuals (EDs). Myosin light chain kinase (MLCK) is encoded by MYLK whose genetic variants are implicated in ARDS pathogenesis and may influence ARDS mortality. As baseline population-specific epigenetic changes, i.e. cytosine modifications, have been observed between AD and ED individuals, epigenetic variations in MYLK may provide insights into ARDS disparities. We compared methylation levels of MYLK CpGs between ARDS patients and ICU controls overall and by ethnicity in a nested case control study of 39 ARDS cases and 75 non-ARDS intensive care unit controls. Two MYLK CpG sites (cg03892735, cg23344121) were differentially modified between ARDS subjects and controls (p<0.05; q<0.25) in a logistic regression model, where no effect modification from ethnicity or age was found. One CpG site was associated with ARDS in patients less than 58 years old, cg19611163 (intron 19,20). Two CpG sites were associated with ARDS in EDs only, gene body CpG (cg01894985, intron 2,3) and CpG (cg16212219, intron 31,32), with higher modification levels exhibited in ARDS subjects than controls. Cis-acting mQTL (modified cytosine quantitative trait loci) were identified using linear regression between local genetic variants and modification levels for two ARDS-associated CpGs (cg23344121, cg16212219). In summary, these ARDS-associated MYLK CpGs with effect modification by ethnicity and local mQTL, suggest that MYLK epigenetic variation and local genetic background may contribute to health disparities observed in ARDS. PMID:27543902

Activation of the Early B-Cell-Specific mb-1 (Ig-α) Gene by Pax-5 Is Dependent on an Unmethylated Ets Binding Site

PubMed Central

Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James

2003-01-01

Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069

Epigenetic Biomarker to Support Classification into Pluripotent and Non-Pluripotent Cells

NASA Astrophysics Data System (ADS)

Lenz, Michael; Goetzke, Roman; Schenk, Arne; Schubert, Claudia; Veeck, Jürgen; Hemeda, Hatim; Koschmieder, Steffen; Zenke, Martin; Schuppert, Andreas; Wagner, Wolfgang

2015-03-01

Quality control of human induced pluripotent stem cells (iPSCs) can be performed by several methods. These methods are usually relatively labor-intensive, difficult to standardize, or they do not facilitate reliable quantification. Here, we describe a biomarker to distinguish between pluripotent and non-pluripotent cells based on DNA methylation (DNAm) levels at only three specific CpG sites. Two of these CpG sites were selected by their discriminatory power in 258 DNAm profiles - they were either methylated in pluripotent or non-pluripotent cells. The difference between these two β-values provides an Epi-Pluri-Score that was validated on independent DNAm-datasets (264 pluripotent and 1,951 non-pluripotent samples) with 99.9% specificity and 98.9% sensitivity. This score was complemented by a third CpG within the gene POU5F1 (OCT4), which better demarcates early differentiation events. We established pyrosequencing assays for the three relevant CpG sites and thereby correctly classified DNA of 12 pluripotent cell lines and 31 non-pluripotent cell lines. Furthermore, DNAm changes at these three CpGs were tracked in the course of differentiation of iPSCs towards mesenchymal stromal cells. The Epi-Pluri-Score does not give information on lineage-specific differentiation potential, but it provides a simple, reliable, and robust biomarker to support high-throughput classification into either pluripotent or non-pluripotent cells.

Nicotine Induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

PubMed Central

Wang, Tingting; Chen, Man; Liu, Lian; Cheng, Huaiyan; Yan, You-E; Feng, Ying-Hong; Wang, Hui

2011-01-01

Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a single site CpG methylation at nt −377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. PMID:21971485

The androgen receptor gene mutations database.

PubMed

Gottlieb, B; Trifiro, M; Lumbroso, R; Pinsky, L

1997-01-01

The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 212 to 272. We have expanded the database: (i) by adding a large amount of new data on somatic mutations in prostatic cancer tissue; (ii) by defining a new constitutional phenotype, mild androgen insensitivity (MAI); (iii) by placing additional relevant information on an internet site (http://www.mcgill.ca/androgendb/ ). The database has allowed us to examine the contribution of CpG sites to the multiplicity of reports of the same mutation in different families. The database is also available from EMBL (ftp.ebi.ac.uk/pub/databases/androgen) or as a Macintosh Filemaker Pro or Word file (MC33@musica,mcgill.ca)

The androgen receptor gene mutations database.

PubMed Central

Gottlieb, B; Trifiro, M; Lumbroso, R; Pinsky, L

1997-01-01

The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 212 to 272. We have expanded the database: (i) by adding a large amount of new data on somatic mutations in prostatic cancer tissue; (ii) by defining a new constitutional phenotype, mild androgen insensitivity (MAI); (iii) by placing additional relevant information on an internet site (http://www.mcgill.ca/androgendb/ ). The database has allowed us to examine the contribution of CpG sites to the multiplicity of reports of the same mutation in different families. The database is also available from EMBL (ftp.ebi.ac.uk/pub/databases/androgen) or as a Macintosh Filemaker Pro or Word file (MC33@musica,mcgill.ca) PMID:9016528

Design and pilot evaluation of a system to develop computer-based site-specific practice guidelines from decision models.

PubMed

Sanders, G D; Nease, R F; Owens, D K

2000-01-01

Local tailoring of clinical practice guidelines (CPGs) requires experts in medicine and evidence synthesis unavailable in many practice settings. The authors' computer-based system enables developers and users to create, disseminate, and tailor CPGs, using normative decision models (DMs). ALCHEMIST, a web-based system, analyzes a DM, creates a CPG in the form of an annotated algorithm, and displays for the guideline user the optimal strategy. ALCHEMIST'S interface enables remote users to tailor the guideline by changing underlying input variables and observing the new annotated algorithm that is developed automatically. In a pilot evaluation of the system, a DM was used to evaluate strategies for staging non-small-cell lung cancer. Subjects (n = 15) compared the automatically created CPG with published guidelines for this staging and critiqued both using a previously developed instrument to rate the CPGs' usability, accountability, and accuracy on a scale of 0 (worst) to 2 (best), with higher scores reflecting higher quality. The mean overall score for the ALCHEMIST CPG was 1.502, compared with the published-CPG score of 0.987 (p = 0.002). The ALCHEMIST CPG scores for usability, accountability, and accuracy were 1.683, 1.393, and 1.430, respectively; the published CPG scores were 1.192, 0.941, and 0.830 (each comparison p < 0.05). On a scale of 1 (worst) to 5 (best), users' mean ratings of ALCHEMIST'S ease of use, usefulness of content, and presentation format were 4.76, 3.98, and 4.64, respectively. The results demonstrate the feasibility of a web-based system that automatically analyzes a DM and creates a CPG as an annotated algorithm, enabling remote users to develop site-specific CPGs. In the pilot evaluation, the ALCHEMIST guidelines met established criteria for quality and compared favorably with national CPGs. The high usability and usefulness ratings suggest that such systems can be a good tool for guideline development.

DNA Methylation at the DAT Promoter and Risk for Psychopathology: Intergenerational Transmission between School-Age Youths and Their Parents in a Community Sample.

PubMed

Cimino, Silvia; Cerniglia, Luca; Ballarotto, Giulia; Marzilli, Eleonora; Pascale, Esterina; D'Addario, Claudio; Adriani, Walter; Tambelli, Renata

2017-01-01

The effect of gene polymorphisms and promoter methylation, associated with maladaptive developmental outcomes, vary depending on environmental factors (e.g., parental psychopathology). Most studies have focused on 0- to 5-year-old children, adolescents, or adults, whereas there is dearth of research on school-age youths and pre-adolescents. In a sample of 21 families recruited at schools, we addressed parents' psychopathological symptoms (through SCL-90-R); offspring emotional-behavioral functioning (through CBCL-6-18); dopamine transporter gene (DAT1) for epigenetic status of the 5'-untranslated region (UTR) and for genotype, i.e., variable number of tandem repeats polymorphism at the 3'-UTR. Possible associations were explored between bio-genetic and psychological characteristics within the same individual and between triplets of children, mothers, and fathers. DAT methylation of CpG at positions M1, M6, and M7 in mothers was correlated with maternal (phobic) anxiety, whereas in fathers' position M6 was related to paternal depression, anxiety, hostility, psychoticism, and higher Global Severity Index (GSI). No significant correlations were found between maternal and offspring DAT methylation. Significant correlations were found between fathers' methylation at CpG M1 and children's methylation at CpG M6. Linear regressions showed that mothers and fathers' GSI predicted children's methylation at CpG sites M2, M3, and M6, whereas fathers' GSI predicted children's methylation at CpG sites, particularly M1, M2, and M6. Moreover, offspring methylation of DAT at CpG M2 predicted somatic complaint, internalizing and attention problems; methylation of DAT at CpG M6 predicted withdraw. This study may have important clinical implication for the prevention and treatment of emotional-behavioral difficulties in children, as it adds to previous knowledge about the role of genetic and environmental factors in predicting psychopathological symptoms within non-clinical populations.

Clinical practice guidelines (CPGs) reduce costs in the management of isolated splenic injuries at pediatric trauma centers.

PubMed

Gutierrez, Ivan M; Zurakowski, David; Chen, Qiaoli; Mooney, David P

2013-02-01

The American Pediatric Surgical Association Trauma Committee proposed the use of a clinical practice guideline (CPG) for the non-operative management of isolated splenic injuries in 1998. An analysis was conducted to determine the financial impact of CPGs on the management of these injuries. The Pediatric Health Information System database, which contains data from 44 children's hospitals, was used to identify children who sustained a graded isolated splenic injury between June 2005 and June 2010. Demographics, length of stay (LOS), readmission rates, and laboratory, imaging, procedural, and total cost data were determined for all hospitals verified as a pediatric trauma center by the American College of Surgeons and/or designated by their local authority. Comparisons were made between facilities self-identifying as having a splenic injury management CPG and those without a CPG. Children (1,154) with isolated splenic injuries (grades 1-4) were cared for in 26 pediatric trauma centers: 20 with a CPG and 6 without (non-CPG). Median costs were significantly lower at CPG than non-CPG centers for imaging (US $163 vs. US $641, P < .001), laboratory (US $629 vs. US $1,044, P < .001), and total hospital stay (US $9,868 vs. US $10,830, P < .001). The median LOS for CPG and non-CPG centers were similar (3 vs. 2 days, P = .38), as were readmission rates within 90 days (3.1 vs. 5.1 %, P = .21). Multiple linear regression indicated that LOS (P < .001) and utilization of a CPG (P = .007) are significant independent predictors of total cost. Utilization of a CPG to manage children with isolated splenic injuries at a pediatric trauma center results in significantly reduced imaging, laboratory, and total hospital costs independent of patient age, gender, grade, and LOS.

Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

PubMed

Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

2017-08-07

Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

Induction of Cyclooxygenase-2 Expression by Hepatitis B Virus Depends on Demethylation-associated Recruitment of Transcription Factors to the Promoter

PubMed Central

2011-01-01

Background The hepatitis B virus (HBV) is a major etiological factor of inflammation and damage to the liver resulting in hepatocellular carcinoma. Transcription factors play important roles in the disordered gene expression and liver injury caused by HBV. However, the molecular mechanisms behind this observation have not been defined. Results In this study, we observed that circulating prostaglandin (PGE) 2 synthesis was increased in patients with chronic hepatitis B infection, and detected elevated cyclooxygenase (COX)-2 expression in HBV- and HBx-expressing liver cells. Likewise, the association of HBx with C/EBPβ contributed to the induction of COX-2. The COX-2 promoter was hypomethylated in HBV-positive cells, and specific demethylation of CpG dinucleotides within each of the two NF-AT sites in the COX-2 promoter resulted in the increased binding affinity of NF-AT to the cognate sites in the promoter, followed by increased COX-2 expression and PGE2 accumulation. The DNA methylatransferase DNMT3B played a key role in the methylation of the COX-2 promoter, and its decreased binding to the promoter was responsible for the regional demethylation of CpG sites, and for the increased binding of transcription factors in HBV-positive cells. Conclusion Our results indicate that upregulation of COX-2 by HBV and HBx is mediated by both demethylation events and recruitment of multiple transcription factors binding to the promoter. PMID:21401943

Multi-tissue DNA methylation age predictor in mouse.

PubMed

Stubbs, Thomas M; Bonder, Marc Jan; Stark, Anne-Katrien; Krueger, Felix; von Meyenn, Ferdinand; Stegle, Oliver; Reik, Wolf

2017-04-11

DNA methylation changes at a discrete set of sites in the human genome are predictive of chronological and biological age. However, it is not known whether these changes are causative or a consequence of an underlying ageing process. It has also not been shown whether this epigenetic clock is unique to humans or conserved in the more experimentally tractable mouse. We have generated a comprehensive set of genome-scale base-resolution methylation maps from multiple mouse tissues spanning a wide range of ages. Many CpG sites show significant tissue-independent correlations with age which allowed us to develop a multi-tissue predictor of age in the mouse. Our model, which estimates age based on DNA methylation at 329 unique CpG sites, has a median absolute error of 3.33 weeks and has similar properties to the recently described human epigenetic clock. Using publicly available datasets, we find that the mouse clock is accurate enough to measure effects on biological age, including in the context of interventions. While females and males show no significant differences in predicted DNA methylation age, ovariectomy results in significant age acceleration in females. Furthermore, we identify significant differences in age-acceleration dependent on the lipid content of the diet. Here we identify and characterise an epigenetic predictor of age in mice, the mouse epigenetic clock. This clock will be instrumental for understanding the biology of ageing and will allow modulation of its ticking rate and resetting the clock in vivo to study the impact on biological age.

Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

PubMed Central

Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

2013-01-01

A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

Identification of Gene Networks Associated with Acute Myeloid Leukemia by Comparative Molecular Methylation and Expression Profiling

PubMed Central

Dellett, Margaret; O’Hagan, Kathleen Ann; Colyer, Hilary Ann Alexandra; Mills, Ken I.

2010-01-01

Around 80% of acute myeloid leukemia (AML) patients achieve a complete remission, however many will relapse and ultimately die of their disease. The association between karyotype and prognosis has been studied extensively and identified patient cohorts as having favourable [e.g. t(8; 21), inv (16)/t(16; 16), t(15; 17)], intermediate [e.g. cytogenetically normal (NK-AML)] or adverse risk [e.g. complex karyotypes]. Previous studies have shown that gene expression profiling signatures can classify the sub-types of AML, although few reports have shown a similar feature by using methylation markers. The global methylation patterns in 19 diagnostic AML samples were investigated using the Methylated CpG Island Amplification Microarray (MCAM) method and CpG island microarrays containing 12,000 CpG sites. The first analysis, comparing favourable and intermediate cytogenetic risk groups, revealed significantly differentially methylated CpG sites (594 CpG islands) between the two subgroups. Mutations in the NPM1 gene occur at a high frequency (40%) within the NK-AML subgroup and are associated with a more favourable prognosis in these patients. A second analysis comparing the NPM1 mutant and wild-type research study subjects again identified distinct methylation profiles between these two subgroups. Network and pathway analysis revealed possible molecular mechanisms associated with the different risk and/or mutation sub-groups. This may result in a better classification of the risk groups, improved monitoring targets, or the identification of novel molecular therapies. PMID:24179384

CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

PubMed

Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

2007-09-01

The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.

Prediction of CpG-island function: CpG clustering vs. sliding-window methods

PubMed Central

2010-01-01

Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

Modification of Epigenetic Patterns in Low Birth Weight Children: Importance of Hypomethylation of the ACE Gene Promoter

PubMed Central

Rangel, Marina; dos Santos, Jéssica Cassilla; Ortiz, Paula Helena Lima; Hirata, Mario; Jasiulionis, Miriam Galvonas; Araujo, Ronaldo C.; Ierardi, Daniela Filippini; Franco, Maria do Carmo

2014-01-01

There is a growing body of evidence that epigenetic alterations are involved in the pathological mechanisms of many chronic disorders linked to fetal programming. Angiotensin-converting enzyme (ACE) appears as one candidate gene that brings new insights into the epigenetic control and later development of diseases. In this view, we have postulated that epigenetic modifications in the ACE gene might show different interactions between birth weight (BW), blood pressure levels, plasma ACE activity and ACE I/D polymorphism. To explore this hypothesis, we performed a cross-sectional study to evaluate the DNA methylation of 3 CpG sites using pyrosequencing within the ACE gene promoter of peripheral blood leukocytes from 45 LBW children compared with 70 NBW children. Our results have revealed that LBW children have lower methylation levels (P<0.001) in parallel with a higher ACE activity (P = 0.001). Adjusting for prematurity, gender, age, body mass index, and family history of cardiovascular disease did not alter these findings. We have also performed analyses of individual CpG sites. The frequency of DNA methylation was significantly different at two CpG sites (site 1: nucleotide position +555; and site 3: nucleotide position +563). In addition, we have found a significant inverse correlation between degree of DNA methylation and both ACE activity (P<0.001) and systolic blood pressure levels (P<0.001). We also observed that the methylation level was significantly lower in LBW children who are carriers of the DD genotype compared to NBW children with DD genotype (P<0.024). In conclusion, we are able to demonstrate that the hypomethylation in the 3 CpG sites of ACE gene promoter is associated with LBW in 6 to 12 year-old children. The magnitude of these epigenetic changes appears to be clinically important, which is supported by the observation that discrete changes in DNA methylation can affect systolic blood pressure and ACE protein activity levels. PMID:25170764

Modification of epigenetic patterns in low birth weight children: importance of hypomethylation of the ACE gene promoter.

PubMed

Rangel, Marina; dos Santos, Jéssica Cassilla; Ortiz, Paula Helena Lima; Hirata, Mario; Jasiulionis, Miriam Galvonas; Araujo, Ronaldo C; Ierardi, Daniela Filippini; Franco, Maria do Carmo

2014-01-01

There is a growing body of evidence that epigenetic alterations are involved in the pathological mechanisms of many chronic disorders linked to fetal programming. Angiotensin-converting enzyme (ACE) appears as one candidate gene that brings new insights into the epigenetic control and later development of diseases. In this view, we have postulated that epigenetic modifications in the ACE gene might show different interactions between birth weight (BW), blood pressure levels, plasma ACE activity and ACE I/D polymorphism. To explore this hypothesis, we performed a cross-sectional study to evaluate the DNA methylation of 3 CpG sites using pyrosequencing within the ACE gene promoter of peripheral blood leukocytes from 45 LBW children compared with 70 NBW children. Our results have revealed that LBW children have lower methylation levels (P<0.001) in parallel with a higher ACE activity (P = 0.001). Adjusting for prematurity, gender, age, body mass index, and family history of cardiovascular disease did not alter these findings. We have also performed analyses of individual CpG sites. The frequency of DNA methylation was significantly different at two CpG sites (site 1: nucleotide position +555; and site 3: nucleotide position +563). In addition, we have found a significant inverse correlation between degree of DNA methylation and both ACE activity (P<0.001) and systolic blood pressure levels (P<0.001). We also observed that the methylation level was significantly lower in LBW children who are carriers of the DD genotype compared to NBW children with DD genotype (P<0.024). In conclusion, we are able to demonstrate that the hypomethylation in the 3 CpG sites of ACE gene promoter is associated with LBW in 6 to 12 year-old children. The magnitude of these epigenetic changes appears to be clinically important, which is supported by the observation that discrete changes in DNA methylation can affect systolic blood pressure and ACE protein activity levels.

Overrepresentation of missense mutations in mild hemophilia A patients from Belgium: founder effect or independent occurrence?

PubMed

Lannoy, N; Lambert, C; Vikkula, M; Hermans, C

2015-06-01

Roughly 40% of observed mutations responsible for hemophilia A (HA) are novel and present in either a single family or a limited number of unrelated families. During routine diagnostic analysis of 73 unrelated Belgian patients with mild HA, 4 out of 43 different mutations (p.Ser2030Asn, p.Arg2178Cys, p.Arg2178His, and p.Pro2311His) were detected in more than one family, representing 35% of total identified mutations. To discriminate between an independent recurrence or a founder effect, an analysis of intra- and -extragenic single nucleotide polymorphisms (SNPs) and short tandem repeats (STRs) flanking the F8 gene was conducted. SNP haplotype and microsatellite analysis revealed strong evidence that p.Ser2030Asn and p.Pro2311His mutations were probably associated with a founder effect. The two other mutations localized in an F8 cytosine-phosphate-guanine (CpG) site likely resulted from recurrent de novo events. This study suggests that missense mutations producing C-to-T or G-to-A substitutions in CpG dinucleotide can occur de novo with more repetition than other causal substitutions that do not affect the CpG site. Analysis of F8 database implied that CpG sites throughout the F8 gene are not all mutated with the same frequency. Causes are still unknown and remain to be identified. Copyright © 2015 Elsevier Ltd. All rights reserved.

Analysis of estrogen receptor β gene methylation in autistic males in a Chinese Han population.

PubMed

Wang, Xuelai; Liang, Shuang; Sun, Yi; Li, Haixin; Endo, Fumio; Nakao, Mitsuyoshi; Saitoh, Noriko; Wu, Lijie

2017-08-01

Autism spectrum disorder (ASD) is a neurodevelopment disorder with abnormalities of social interaction, communication and repetitive behaviors. The higher prevalence of ASD in men implies a potential relationship between sex hormones and ASD etiology. The ESR2 gene encodes estrogen receptor beta (ESR2) and plays an important role during brain development. A relationship between ESR2 and ASD has been suggested by studies on single nucleotide polymorphisms and mRNA and protein expression levels in ASD patients. Here, we explored the possible epigenetic regulation of the ESR2 gene in autism. We collected genomic DNA from the peripheral blood of Chinese Han males with autism and age-matched normal males and measured DNA methylation of CpG islands in the ESR2 gene, which consisted of 41 CpG sites among the proximal promoter region and an untranslated exon, by bisulfite sequencing. We also investigated a relationship between DNA methylation and phenotypic features of autism, as assessed by the Children Autism Rating Scale. We found little overall difference in the DNA methylation of the ESR2 5'-flanking region in individuals with autism compared with normal individuals. However, detailed analyses revealed that eight specific CpG sites were hypermethylated in autistic individuals and that four specific CpG sites were positively associated with the severity of autistic symptoms. Our study indicates that the epigenetic dysregulation of ESR2 may govern the development of autism.

DNA methylation-based forensic age prediction using artificial neural networks and next generation sequencing.

PubMed

Vidaki, Athina; Ballard, David; Aliferi, Anastasia; Miller, Thomas H; Barron, Leon P; Syndercombe Court, Denise

2017-05-01

The ability to estimate the age of the donor from recovered biological material at a crime scene can be of substantial value in forensic investigations. Aging can be complex and is associated with various molecular modifications in cells that accumulate over a person's lifetime including epigenetic patterns. The aim of this study was to use age-specific DNA methylation patterns to generate an accurate model for the prediction of chronological age using data from whole blood. In total, 45 age-associated CpG sites were selected based on their reported age coefficients in a previous extensive study and investigated using publicly available methylation data obtained from 1156 whole blood samples (aged 2-90 years) analysed with Illumina's genome-wide methylation platforms (27K/450K). Applying stepwise regression for variable selection, 23 of these CpG sites were identified that could significantly contribute to age prediction modelling and multiple regression analysis carried out with these markers provided an accurate prediction of age (R 2 =0.92, mean absolute error (MAE)=4.6 years). However, applying machine learning, and more specifically a generalised regression neural network model, the age prediction significantly improved (R 2 =0.96) with a MAE=3.3 years for the training set and 4.4 years for a blind test set of 231 cases. The machine learning approach used 16 CpG sites, located in 16 different genomic regions, with the top 3 predictors of age belonged to the genes NHLRC1, SCGN and CSNK1D. The proposed model was further tested using independent cohorts of 53 monozygotic twins (MAE=7.1 years) and a cohort of 1011 disease state individuals (MAE=7.2 years). Furthermore, we highlighted the age markers' potential applicability in samples other than blood by predicting age with similar accuracy in 265 saliva samples (R 2 =0.96) with a MAE=3.2 years (training set) and 4.0 years (blind test). In an attempt to create a sensitive and accurate age prediction test, a next generation sequencing (NGS)-based method able to quantify the methylation status of the selected 16 CpG sites was developed using the Illumina MiSeq ® platform. The method was validated using DNA standards of known methylation levels and the age prediction accuracy has been initially assessed in a set of 46 whole blood samples. Although the resulted prediction accuracy using the NGS data was lower compared to the original model (MAE=7.5years), it is expected that future optimization of our strategy to account for technical variation as well as increasing the sample size will improve both the prediction accuracy and reproducibility. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Freudenthal, Bret D.; Beard, William A.; Cuneo, Matthew J.

DNA apurinic-apyrimidinic (AP) sites are prevalent noncoding threats to genomic stability and are processed by AP endonuclease 1 (APE1). APE1 incises the AP-site phosphodiester backbone, generating a DNA-repair intermediate that is potentially cytotoxic. The molecular events of the incision reaction remain elusive, owing in part to limited structural information. Here we report multiple high-resolution human APE1-DNA structures that divulge new features of the APE1 reaction, including the metal-binding site, the nucleophile and the arginine clamps that mediate product release. We also report APE1-DNA structures with a T-G mismatch 5' to the AP site, representing a clustered lesion occurring in methylatedmore » CpG dinucleotides. Moreover, these structures reveal that APE1 molds the T-G mismatch into a unique Watson-Crick-like geometry that distorts the active site, thus reducing incision. Finally, these snapshots provide mechanistic clarity for APE1 while affording a rational framework to manipulate biological responses to DNA damage.« less

Capturing Snapshots of APE1 Processing DNA Damage

PubMed Central

Freudenthal, Bret D.; Beard, William A.; Cuneo, Matthew J.; Dyrkheeva, Nadezhda S.; Wilson, Samuel H.

2015-01-01

DNA apurinic-apyrimidinic (AP) sites are prevalent non-coding threats to genomic stability and are processed by AP endonuclease 1 (APE1). APE1 incises the AP-site phosphodiester backbone, generating a DNA repair intermediate that is potentially cytotoxic. The molecular events of the incision reaction remain elusive due in part to limited structural information. We report multiple high-resolution human APE1:DNA structures that divulge novel features of the APE1 reaction, including the metal binding site, nucleophile, and arginine clamps that mediate product release. We also report APE1:DNA structures with a T:G mismatch 5′ to the AP-site, representing a clustered lesion occurring in methylated CpG dinucleotides. These reveal that APE1 molds the T:G mismatch into a unique Watson-Crick like geometry that distorts the active site reducing incision. These snapshots provide mechanistic clarity for APE1, while affording a rational framework to manipulate biological responses to DNA damage. PMID:26458045

Capturing snapshots of APE1 processing DNA damage

DOE PAGES

Freudenthal, Bret D.; Beard, William A.; Cuneo, Matthew J.; ...

2015-10-12

DNA apurinic-apyrimidinic (AP) sites are prevalent noncoding threats to genomic stability and are processed by AP endonuclease 1 (APE1). APE1 incises the AP-site phosphodiester backbone, generating a DNA-repair intermediate that is potentially cytotoxic. The molecular events of the incision reaction remain elusive, owing in part to limited structural information. Here we report multiple high-resolution human APE1-DNA structures that divulge new features of the APE1 reaction, including the metal-binding site, the nucleophile and the arginine clamps that mediate product release. We also report APE1-DNA structures with a T-G mismatch 5' to the AP site, representing a clustered lesion occurring in methylatedmore » CpG dinucleotides. Moreover, these structures reveal that APE1 molds the T-G mismatch into a unique Watson-Crick-like geometry that distorts the active site, thus reducing incision. Finally, these snapshots provide mechanistic clarity for APE1 while affording a rational framework to manipulate biological responses to DNA damage.« less

Prenatal Arsenic Exposure and DNA Methylation in Maternal and Umbilical Cord Blood Leukocytes

PubMed Central

Baccarelli, Andrea; Hoffman, Elaine; Tarantini, Letizia; Quamruzzaman, Quazi; Rahman, Mahmuder; Mahiuddin, Golam; Mostofa, Golam; Hsueh, Yu-Mei; Wright, Robert O.; Christiani, David C.

2012-01-01

Background: Arsenic is an epigenetic toxicant and could influence fetal developmental programming. Objectives: We evaluated the association between arsenic exposure and DNA methylation in maternal and umbilical cord leukocytes. Methods: Drinking-water and urine samples were collected when women were at ≤ 28 weeks gestation; the samples were analyzed for arsenic using inductively coupled plasma mass spectrometry. DNA methylation at CpG sites in p16 (n = 7) and p53 (n = 4), and in LINE-1 and Alu repetitive elements (3 CpG sites in each), was quantified using pyrosequencing in 113 pairs of maternal and umbilical blood samples. We used general linear models to evaluate the relationship between DNA methylation and tertiles of arsenic exposure. Results: Mean (± SD) drinking-water arsenic concentration was 14.8 ± 36.2 μg/L (range: < 1–230 μg/L). Methylation in LINE-1 increased by 1.36% [95% confidence interval (CI): 0.52, 2.21%] and 1.08% (95% CI: 0.07, 2.10%) in umbilical cord and maternal leukocytes, respectively, in association with the highest versus lowest tertile of total urinary arsenic per gram creatinine. Arsenic exposure was also associated with higher methylation of some of the tested CpG sites in the promoter region of p16 in umbilical cord and maternal leukocytes. No associations were observed for Alu or p53 methylation. Conclusions: Exposure to higher levels of arsenic was positively associated with DNA methylation in LINE-1 repeated elements, and to a lesser degree at CpG sites within the promoter region of the tumor suppressor gene p16. Associations were observed in both maternal and fetal leukocytes. Future research is needed to confirm these results and determine if these small increases in methylation are associated with any health effects. PMID:22466225

Longitudinal study of DNA methylation during the first 5 years of life.

PubMed

Urdinguio, Rocio G; Torró, María Isabel; Bayón, Gustavo F; Álvarez-Pitti, Julio; Fernández, Agustín F; Redon, Pau; Fraga, Mario F; Lurbe, Empar

2016-06-03

Early life epigenetic programming influences adult health outcomes. Moreover, DNA methylation levels have been found to change more rapidly during the first years of life. Our aim was the identification and characterization of the CpG sites that are modified with time during the first years of life. We hypothesize that these DNA methylation changes would lead to the detection of genes that might be epigenetically modulated by environmental factors during early childhood and which, if disturbed, might contribute to susceptibility to diseases later in life. The study of the DNA methylation pattern of 485577 CpG sites was performed on 30 blood samples from 15 subjects, collected both at birth and at 5 years old, using Illumina(®) Infinium 450 k array. To identify differentially methylated CpG (dmCpG) sites, the methylation status of each probe was examined using linear models and the Empirical Bayes Moderated t test implemented in the limma package of R/Bioconductor. Surogate variable analysis was used to account for batch effects. DNA methylation levels significantly changed from birth to 5 years of age in 6641 CpG sites. Of these, 36.79 % were hypermethylated and were associated with genes related mainly to developmental ontology terms, while 63.21 % were hypomethylated probes and associated with genes related to immune function. Our results suggest that DNA methylation alterations with age during the first years of life might play a significant role in development and the regulation of leukocyte-specific functions. This supports the idea that blood leukocytes experience genome remodeling related to their interaction with environmental factors, underlining the importance of environmental exposures during the first years of life and suggesting that new strategies should be take into consideration for disease prevention.

Association between DNA methylation in cord blood and maternal smoking: The Hokkaido Study on Environment and Children's Health.

PubMed

Miyake, Kunio; Kawaguchi, Akio; Miura, Ryu; Kobayashi, Sachiko; Tran, Nguyen Quoc Vuong; Kobayashi, Sumitaka; Miyashita, Chihiro; Araki, Atsuko; Kubota, Takeo; Yamagata, Zentaro; Kishi, Reiko

2018-04-04

Maternal smoking is reported to cause adverse effects on the health of the unborn child, the underlying mechanism for which is thought to involve alterations in DNA methylation. We examined the effects of maternal smoking on DNA methylation in cord blood, in 247 mother-infant pairs in the Sapporo cohort of the Hokkaido Study, using the Infinium HumanMethylation 450K BeadChip. We first identified differentially methylated CpG sites with a false discovery rate (FDR) of <0.05 and the magnitude of DNA methylation changes (|β| >0.02) from the pairwise comparisons of never-smokers (Ne-S), sustained-smokers (Su-S), and stopped-smokers (St-S). Subsequently, secondary comparisons between St-S and Su-S revealed nine common sites that mapped to ACSM3, AHRR, CYP1A1, GFI1, SHANK2, TRIM36, and the intergenic region between ANKRD9 and RCOR1 in Ne-S vs. Su-S, and one common CpG site mapping to EVC2 in Ne-S vs. St-S. Further, we verified these CpG sites and examined neighbouring sites using bisulfite next-generation sequencing, except for AHRR cg21161138. These changes in DNA methylation implicate the effect of smoking cessation. Our findings add to the current knowledge of the association between DNA methylation and maternal smoking and suggest future studies for clarifying this relationship in disease development.

Detection of Turner syndrome using X-chromosome inactivation specific differentially methylated CpG sites: A pilot study.

PubMed

Zhang, Qiang; Guo, Xiaohong; Tian, Tian; Wang, Teng; Li, Qiaoli; Wang, Lei; Liu, Yun; Xing, Qinghe; He, Lin; Zhao, Xinzhi

2017-05-01

Early diagnosis of Turner syndrome (TS) may improve preventive measures and treatment. X-chromosome inactivation specific differentially methylated CpG sites (XIDMSs) that are high methylated in inactive X chromosomes (Xi) and unmethylated in active X chromosomes (Xa) may be potential makers for TS detection. The candidate XIDMSs were screened from 9 male and 12 female DNA samples with normal karyotypes using the Illumina 450k array and validated by bisulfite sequencing PCR and pyrosequencing assay. X chromosome dosage was calculated according to the methylation level of multiple XIDMSs. Overall, 108 candidate XIDMSs were screened by the 450k array. Validations indicated that XIDMSs gathered and formed the X-chromosome inactivation specific differentially methylated regions (XIDMRs). Using 3 XIDMRs at SAT1, UXT and UTP14A loci, 36 TS, 22 normal female and 6 male samples were analyzed. Methylation levels of the 20 XIDMSs in the XIDMRs could distinguish between TS and normal female DNA samples, the X chromosome dosage was consistent with karyotyping data. Analyzing samples of 2 triple X syndrome and 3 Klinefelter syndrome patients suggested that this method could be used to detect X chromosome aneuploids other than TS. XIDMSs are widely spread along the X chromosome and might be effective markers for detection of TS and other X chromosome aneuploids. Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular characterization and transcriptional analysis of the female-enriched chondroitin proteoglycan 2 of Toxocara canis.

PubMed

Ma, G X; Zhou, R Q; Hu, L; Luo, Y L; Luo, Y F; Zhu, H H

2018-03-01

Toxocara canis is an important but neglected zoonotic parasite, and is the causative agent of human toxocariasis. Chondroitin proteoglycans are biological macromolecules, widely distributed in extracellular matrices, with a great diversity of functions in mammals. However, there is limited information regarding chondroitin proteoglycans in nematode parasites. In the present study, a female-enriched chondroitin proteoglycan 2 gene of T. canis (Tc-cpg-2) was cloned and characterized. Quantitative real-time polymerase chain reaction (qRT-PCR) was employed to measure the transcription levels of Tc-cpg-2 among tissues of male and female adult worms. A 485-amino-acid (aa) polypeptide was predicted from a continuous 1458-nuleotide open reading frame and designated as TcCPG2, which contains a 21-aa signal peptide. Conserved domain searching indicated three chitin-binding peritrophin-A (CBM_14) domains in the amino acid sequence of TcCPG2. Multiple alignment with the inferred amino acid sequences of Caenorhabditis elegans and Ascaris suum showed that CBM_14 domains were well conserved among these species. Phylogenetic analysis suggested that TcCPG2 was closely related to the sequence of chondroitin proteoglycan 2 of A. suum. Interestingly, a high level of Tc-cpg-2 was detected in female germline tissues, particularly in the oviduct, suggesting potential roles of this gene in reproduction (e.g. oogenesis and embryogenesis) of adult T. canis. The functional roles of Tc-cpg-2 in reproduction and development in this parasite and related parasitic nematodes warrant further functional studies.

Validation of DAB2IP methylation and its relative significance in predicting outcome in renal cell carcinoma

PubMed Central

Zhao, Liang-Yun; Kapur, Payal; Wu, Kai-Jie; Wang, Bin; Yu, Yan-Hong; Liao, Bing; He, Da-Lin; Chen, Wei; Margulis, Vitaly; Hsieh, Jer-Tsong; Luo, Jun-Hang

2016-01-01

We have recently reported tumor suppressive role of DAB2IP in RCC development. In this study, We identified one CpG methylation biomarker (DAB2IP CpG1) located UTSS of DAB2IP that was associated with poor overall survival in a cohort of 318 ccRCC patients from the Cancer Genome Atlas (TCGA). We further validated the prognostic accuracy of DAB2IP CpG methylation by pyrosequencing quantitative methylation assay in 224 ccRCC patients from multiple Chinese centers (MCHC set), and 239 patients from University of Texas Southwestern Medical Center at Dallas (UTSW set) by using FFPE samples. DAB2IP CpG1 can predict the overall survival of patients in TCGA, MCHC, and UTSW sets independent of patient age, Fuhrman grade and TNM stage (all p<0.05). DAB2IP CpG1 successfully categorized patients into high-risk and low-risk groups with significant differences of clinical outcome in respective clinical subsets, regardless of age, sex, grade, stage, or race (HR: 1.63-7.83; all p<0.05). The detection of DAB2IP CpG1 methylation was minimally affected by ITH in ccRCC. DAB2IP mRNA expression was regulated by DNA methylation in vitro. DAB2IP CpG1 methylation is a practical and repeatable biomarker for ccRCC, which can provide prognostic value that complements the current staging system. PMID:27129174

Methylation analysis of p16, SLIT2, SCARA5, and Runx3 genes in hepatocellular carcinoma

PubMed Central

Sun, Gaofeng; Zhang, Chen; Feng, Min; Liu, Wensheng; Xie, Huifang; Qin, Qin; Zhao, E.; Wan, Li

2017-01-01

Abstract This study is to investigate the methylation status of multiple tumor suppressor 1 (p16), secreted glycoprotein 2 (SLIT2), scavenger receptor class A, member 5 putative (SCARA5), and human runt-related transcription factor 3 (Runx3) genes in the peripheral blood of hepatocellular carcinoma (HCC). This is a case–control study. The peripheral blood samples were collected from 25 HCC patients, 25 patients with high risk of HCC (defined as “internal control group”), and 25 healthy individuals (defined as “external control group”), respectively. Then the methylation status of p16, SLIT2, SCARA5, and Runx3 genes in the blood samples were analyzed by pyrosequencing. The relationship between the methylation and the clinical features of HCC patients were evaluated. The methylation levels in the 7 CpG loci of p16 gene in HCC patients were low and without statistically significant difference (P > .05) compared to the control groups. Although the methylation levels of CpG3 and CpG4 in SLIT2 gene loci were higher than those of the control groups, there was no statistically significant difference (P > .05). However, the methylation rate of CpG2 locus in SCARA5 gene in HCC patients was significantly higher (P < .05). And the methylation rates of CpG1, CpG2, CpG3, CpG4, CpG5, and CpG8 in Runx3 gene in HCC patients were significantly different to that of control groups (P < .05). We also have analyzed the correlations between the CpG islands methylation of Runx3 or SCARA5 genes and the age, gender, hepatitis B, liver cirrhosis, alpha fetal protein, or hepatitis B surface antigen (HBsAg) of the HCC patients, which all showed no significant correlations (P > .05). The methylation status of SCARA5 and Runx3 genes are abnormal in HCC patients, which may further be used as molecular markers for early auxiliary diagnosis of liver cancer. PMID:29019900

Increased methylation of repetitive elements and DNA repair genes is associated with higher DNA oxidation in children in an urbanized, industrial environment.

PubMed

Alvarado-Cruz, Isabel; Sánchez-Guerra, Marco; Hernández-Cadena, Leticia; De Vizcaya-Ruiz, Andrea; Mugica, Violeta; Pelallo-Martínez, Nadia Azenet; Solís-Heredia, María de Jesús; Byun, Hyang-Min; Baccarelli, Andrea; Quintanilla-Vega, Betzabet

2017-01-01

DNA methylation in DNA repair genes participates in the DNA damage regulation. Particulate matter (PM), which has metals and polycyclic aromatic hydrocarbons (PAHs) adsorbed, among others has been linked to adverse health outcomes and may modify DNA methylation. To evaluate PM exposure impact on repetitive elements and gene-specific DNA methylation and DNA damage, we conducted a cross-sectional study in 150 schoolchildren (7-10 years old) from an urbanized, industrial area of the metropolitan area of Mexico City (MAMC), which frequently exhibits PM concentrations above safety standards. Methylation (5mC) of long interspersed nuclear element-1 (LINE1) and DNA repair gene (OGG1, APEX, and PARP1) was assessed by pyrosequencing in peripheral mononuclear cells, DNA damage by comet assay and DNA oxidation by 8-OHdG content. PAH and metal contents in PM 10 (≤10μm aerodynamic diameter) were determined by HPLC-MS and ICP-AES, respectively. Multiple regression analysis between DNA methylation, DNA damage, and PM 10 exposure showed that PM 10 was significantly associated with oxidative DNA damage; a 1% increase in 5mC at all CpG sites in PARP1 promoter was associated with a 35% increase in 8-OHdG, while a 1% increase at 1, 2, and 3 CpG sites resulted in 38, 9, and 56% increments, respectively. An increase of 10pg/m 3 in benzo[b]fluoranthene content of PM 10 was associated with a 6% increase in LINE1 methylation. Acenaphthene, indene [1,2,3-cd] pyrene, and pyrene concentrations correlated with higher dinucleotide methylation in OGG1, APEX and PARP1 genes, respectively. Vanadium concentration correlated with increased methylation at selected APEX and PARP1 CpG sites. DNA repair gene methylation was significantly correlated with DNA damage and with specific PM 10 -associated PAHs and Vanadium. Data suggest that exposure to PM and its components are associated with differences in DNA methylation of repair genes in children, which may contribute to DNA damage. Copyright © 2016 Elsevier B.V. All rights reserved.

The correlation of methylation levels measured using Illumina 450K and EPIC BeadChips in blood samples

PubMed Central

Logue, Mark W; Smith, Alicia K; Wolf, Erika J; Maniates, Hannah; Stone, Annjanette; Schichman, Steven A; McGlinchey, Regina E; Milberg, William; Miller, Mark W

2017-01-01

Aim: We examined concordance of methylation levels across the Illumina Infinium HumanMethylation450 BeadChip and the Infinium MethylationEPIC BeadChip. Methods: We computed the correlation for 145 whole blood DNA samples at each of the 422,524 CpG sites measured by both chips. Results: The correlation at some sites was high (up to r = 0.95), but many sites had low correlation (55% had r < 0.20). The low correspondence between 450K and EPIC measured methylation values at many loci was largely due to the low variability in methylation values for the majority of the CpG sites in blood. Conclusion: Filtering out probes based on the observed correlation or low variability may increase reproducibility of BeadChip-based epidemiological studies. PMID:28809127

Epigenetic contribution of the myosin light chain kinase gene to the risk for acute respiratory distress syndrome.

PubMed

Szilágyi, Keely L; Liu, Cong; Zhang, Xu; Wang, Ting; Fortman, Jeffrey D; Zhang, Wei; Garcia, Joe G N

2017-02-01

Acute respiratory distress syndrome (ARDS) is a devastating clinical syndrome with a considerable case fatality rate (∼30%-40%). Health disparities exist with African descent (AD) subjects exhibiting greater mortality than European descent (ED) individuals. Myosin light chain kinase is encoded by MYLK, whose genetic variants are implicated in ARDS pathogenesis and may influence ARDS mortality. As baseline population-specific epigenetic changes, that is, cytosine modifications, have been observed between AD and ED individuals, epigenetic variations in MYLK may provide insights into ARDS disparities. We compared methylation levels of MYLK cytosine-guanine dinucleotides (CpGs) between ARDS patients and intensive care unit (ICU) controls overall and by ethnicity in a nested case-control study of 39 ARDS cases and 75 non-ARDS ICU controls. Two MYLK CpG sites (cg03892735 and cg23344121) were differentially modified between ARDS subjects and controls (P < 0.05; q < 0.25) in a logistic regression model, where no effect modification by ethnicity or age was found. One CpG site was associated with ARDS in patients aged <58 years, cg19611163 (intron 19, 20). Two CpG sites were associated with ARDS in EDs only, gene body CpG (cg01894985, intron 2, 3) and CpG (cg16212219, intron 31, 32), with higher modification levels exhibited in ARDS subjects than controls. Cis-acting modified cytosine quantitative trait loci (mQTL) were identified using linear regression between local genetic variants and modification levels for 2 ARDS-associated CpGs (cg23344121 and cg16212219). In summary, these ARDS-associated MYLK CpGs with effect modification by ethnicity and local mQTL suggest that MYLK epigenetic variation and local genetic background may contribute to health disparities observed in ARDS. Copyright © 2016 Elsevier Inc. All rights reserved.

Amyloid protein-mediated differential DNA methylation status regulates gene expression in Alzheimer's disease model cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee

2011-11-04

Highlights: Black-Right-Pointing-Pointer Genome-wide DNA methylation pattern in Alzheimer's disease model cell line. Black-Right-Pointing-Pointer Integrated analysis of CpG methylation and mRNA expression profiles. Black-Right-Pointing-Pointer Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. Black-Right-Pointing-Pointer The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer's disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterationsmore » in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2 Prime -deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the -435, -295, and -271 CpG sites of CTIF, and at the -505 to -341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at -432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may contribute to the pathogenesis of AD.« less

Genetic and epigenetic regulation of YKL-40 in childhood.

PubMed

Guerra, Stefano; Melén, Erik; Sunyer, Jordi; Xu, Cheng-Jian; Lavi, Iris; Benet, Marta; Bustamante, Mariona; Carsin, Anne-Elie; Dobaño, Carlota; Guxens, Mònica; Tischer, Christina; Vrijheid, Martine; Kull, Inger; Bergström, Anna; Kumar, Ashish; Söderhäll, Cilla; Gehring, Ulrike; Dijkstra, Dorieke J; van der Vlies, Pieter; Wickman, Magnus; Bousquet, Jean; Postma, Dirkje S; Anto, Josep M; Koppelman, Gerard H

2018-03-01

Circulating levels of the chitinase-like protein YKL-40 are influenced by genetic variation in its encoding gene (chitinase 3-like 1 [CHI3L1]) and are increased in patients with several diseases, including asthma. Epigenetic regulation of circulating YKL-40 early in life is unknown. We sought to determine (1) whether methylation levels at CHI3L1 CpG sites mediate the association of CHI3L1 single nucleotide polymorphisms (SNPs) with YKL-40 levels in the blood and (2) whether these biomarkers (CHI3L1 SNPs, methylation profiles, and YKL-40 levels) are associated with asthma in early childhood. We used data from up to 2405 participants from the Spanish Infancia y Medio Ambiente; the Swedish Barn/Children, Allergy, Milieu, Stockholm, Epidemiological survey; and the Dutch Prevention and Incidence of Asthma and Mite Allergy birth cohorts. Associations between 68 CHI3L1 SNPs, methylation levels at 14 CHI3L1 CpG sites in whole-blood DNA, and circulating YKL-40 levels at 4 years of age were tested by using correlation analysis, multivariable regression, and mediation analysis. Each of these biomarkers was also tested for association with asthma at 4 years of age by using multivariable logistic regression. YKL-40 levels were significantly associated with 7 SNPs and with methylation at 5 CpG sites. Consistent associations between these 7 SNPs (particularly rs10399931 and rs4950928) and 5 CpG sites were observed. Alleles linked to lower YKL-40 levels were associated with higher methylation levels. Participants with high YKL-40 levels (defined as the highest YKL-40 tertile) had increased odds for asthma compared with subjects with low YKL-40 levels (meta-analyzed adjusted odds ratio, 1.90 [95% CI, 1.08-3.36]). In contrast, neither SNPs nor methylation levels at CpG sites in CHI3L1 were associated with asthma. The effects of CHI3L1 genetic variation on circulating YKL-40 levels are partly mediated by methylation profiles. In our study YKL-40 levels, but not CHI3L1 SNPs or methylation levels, were associated with childhood asthma. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

NOVEL EPIGENETIC CHANGES IN CDKN2A ARE ASSOCIATED WITH PROGRESSION OF CERVICAL INTRAEPITHELIAL NEOPLASIA

PubMed Central

Wijetunga, N. Ari; Belbin, Thomas J.; Burk, Robert D.; Whitney, Kathleen; Abadi, Maria; Greally, John M.; Einstein, Mark H.; Schlecht, Nicolas F.

2016-01-01

Objective To conduct a comprehensive mapping of the genomic DNA methylation in CDKN2A, which codes for the p16INK4A and p14ARF proteins, and 14 of the most promising DNA methylation marker candidates previously reported to be associated with progression of low-grade cervical intraepithelial neoplasia (CIN1) to cervical cancer. Methods We analyzed DNA methylation in 68 HIV-seropositive and negative women with incident CIN1, CIN2, CIN3 and invasive cervical cancer, assaying 120 CpG dinucleotide sites spanning APC, CDH1, CDH13, CDKN2A, CDKN2B, DAPK1, FHIT, GSTP1, HIC1, MGMT, MLH1, RARB, RASSF1, TERT and TIMP3 using the Illumina Infinium array. Validation was performed using high resolution mapping of the target genes with HELP-tagging for 286 CpGs, followed by fine mapping of candidate genes with targeted bisulfite sequencing. We assessed for statistical differences in DNA methylation levels for each CpG loci assayed using univariate and multivariate methods correcting for multiple comparisons. Results In our discovery sample set, we identified dose dependent differences in DNA methylation with grade of disease in CDKN2A, APC, MGMT, MLH1 and HIC1, whereas single CpG locus differences between CIN2/3 and cancer groups were seen for CDH13, DAPK1 and TERT. Only those CpGs in the gene body of CDKN2A showed a monotonic increase in methylation between persistent CIN1, CIN2, CIN3 and cancers. Conclusion Our data suggests a novel link between early cervical disease progression and DNA methylation in a region downstream of the CDKN2A transcription start site that may lead to increased p16INK4A/p14ARF expression prior to development of malignant disease. PMID:27401842

Novel epigenetic changes in CDKN2A are associated with progression of cervical intraepithelial neoplasia.

PubMed

Wijetunga, N Ari; Belbin, Thomas J; Burk, Robert D; Whitney, Kathleen; Abadi, Maria; Greally, John M; Einstein, Mark H; Schlecht, Nicolas F

2016-09-01

To conduct a comprehensive mapping of the genomic DNA methylation in CDKN2A, which codes for the p16(INK4A) and p14(ARF) proteins, and 14 of the most promising DNA methylation marker candidates previously reported to be associated with progression of low-grade cervical intraepithelial neoplasia (CIN1) to cervical cancer. We analyzed DNA methylation in 68 HIV-seropositive and negative women with incident CIN1, CIN2, CIN3 and invasive cervical cancer, assaying 120 CpG dinucleotide sites spanning APC, CDH1, CDH13, CDKN2A, CDKN2B, DAPK1, FHIT, GSTP1, HIC1, MGMT, MLH1, RARB, RASSF1, TERT and TIMP3 using the Illumina Infinium array. Validation was performed using high resolution mapping of the target genes with HELP-tagging for 286 CpGs, followed by fine mapping of candidate genes with targeted bisulfite sequencing. We assessed for statistical differences in DNA methylation levels for each CpG loci assayed using univariate and multivariate methods correcting for multiple comparisons. In our discovery sample set, we identified dose dependent differences in DNA methylation with grade of disease in CDKN2A, APC, MGMT, MLH1 and HIC1, whereas single CpG locus differences between CIN2/3 and cancer groups were seen for CDH13, DAPK1 and TERT. Only those CpGs in the gene body of CDKN2A showed a monotonic increase in methylation between persistent CIN1, CIN2, CIN3 and cancers. Our data suggests a novel link between early cervical disease progression and DNA methylation in a region downstream of the CDKN2A transcription start site that may lead to increased p16(INK4A)/p14(ARF) expression prior to development of malignant disease. Copyright © 2016 Elsevier Inc. All rights reserved.

Western environment/lifestyle is associated with increased genome methylation and decreased gene expression in Chinese immigrants living in Australia.

PubMed

Zhang, Guicheng; Wang, Kui; Schultz, Ennee; Khoo, Siew-Kim; Zhang, Xiaopeng; Annamalay, Alicia; Laing, Ingrid A; Hales, Belinda J; Goldblatt, Jack; Le Souëf, Peter N

2016-01-01

Several human diseases and conditions are disproportionally distributed in the world with a significant "Western-developed" vs. "Eastern-developing" gradient. We compared genome-wide DNA methylation of peripheral blood mononuclear cells in 25 newly arrived Chinese immigrants living in a Western environment for less than 6 months ("Newly arrived") with 23 Chinese immigrants living in the Western environment for more than two years ("Long-term") with a mean of 8.7 years, using the Infinium HumanMethylation450 BeadChip. In a sub-group of both subject groups (n = 12 each) we also investigated genome-wide gene expression using a Human HT-12 v4 expression beadChip. There were 62.5% probes among the total number of 382,250 valid CpG sites with greater mean Beta (β) in "Long-term" than in "Newly arrived". In the regions of CpG islands and gene promoters, compared with the CpG sites in all other regions, lower percentages of CpG sites with mean methylation levels in "Long-term" greater than "Newly arrived" were observed, but still >50%. The increase of methylation was associated with a general decrease of gene expression in Chinese immigrants living in the Western environment for a longer period of time. After adjusting for age, gender and other confounding factors the findings remained. Chinese immigrants living in Australia for a longer period of time have increased overall genome methylation and decreased overall gene expression compared with newly arrived immigrants. © 2015 Wiley Periodicals, Inc.

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

PubMed

Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

2016-01-01

Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype

PubMed Central

Toyota, Minoru; Ohe-Toyota, Mutsumi; Ahuja, Nita; Issa, Jean-Pierre J.

2000-01-01

Colorectal cancers (CRCs) are characterized by multiple genetic (mutations) and epigenetic (CpG island methylation) alterations, but it is not known whether these evolve independently through stochastic processes. We have recently described a novel pathway termed CpG island methylator phenotype (CIMP) in CRC, which is characterized by the simultaneous methylation of multiple CpG islands, including several known genes, such as p16, hMLH1, and THBS1. We have now studied mutations in K-RAS, p53, DPC4, and TGFβRII in a panel of colorectal tumors with or without CIMP. We find that CIMP defines two groups of tumors with significantly different genetic lesions: frequent K-RAS mutations were found in CIMP+ CRCs (28/41, 68%) compared with CIMP− cases (14/47, 30%, P = 0.0005). By contrast, p53 mutations were found in 24% (10/41) of CIMP+ CRCs vs. 60% (30/46) of CIMP− cases (P = 0.002). Both of these differences were independent of microsatellite instability. These interactions between CIMP, K-RAS mutations, and p53 mutations were preserved in colorectal adenomas, suggesting that they occur early in carcinogenesis. The distinct combinations of epigenetic and genetic alterations in each group suggest that activation of oncogenes and inactivation of tumor suppressor genes is related to the underlying mechanism of generating molecular diversity in cancer, rather than simply accumulate stochastically during cancer development. PMID:10639144

CpG islands: algorithms and applications in methylation studies.

PubMed

Zhao, Zhongming; Han, Leng

2009-05-15

Methylation occurs frequently at 5'-cytosine of the CpG dinucleotides in vertebrate genomes; however, this epigenetic feature is rarely observed in CpG islands (CGIs) or CpG clusters in the promoter regions of genes. Aberrant methylation of the promoter-associated CGIs might influence gene expression and cause carcinogenesis. Because of the functional importance, multiple algorithms have been available for identifying CGIs in a genome or a sequence. They can be categorized into the traditional algorithms (e.g., Gardiner-Garden and Frommer (1987), Takai and Jones (2002), and CpGPRoD (2002)) or statistical property based algorithms (CpGcluster (2006) and CG cluster (2007)). We reviewed the features of these algorithms and evaluated their performance on identifying functional CGIs using genome-wide methylation data. Moreover, identification of CGIs is an initial step in many recent studies for predicting methylation status as well as in the design of methylation detection platforms. We reviewed the benchmarks and features used in these studies.

Genome-wide methylation analysis identifies differentially methylated CpG loci associated with severe obesity in childhood.

PubMed

Huang, R C; Garratt, E S; Pan, H; Wu, Y; Davis, E A; Barton, S J; Burdge, G C; Godfrey, K M; Holbrook, J D; Lillycrop, K A

2015-01-01

Childhood obesity is a major public health issue. Here we investigated whether differential DNA methylation was associated with childhood obesity. We studied DNA methylation profiles in whole blood from 78 obese children (mean BMI Z-score: 2.6) and 71 age- and sex-matched controls (mean BMI Z-score: 0.1). DNA samples from obese and control groups were pooled and analyzed using the Infinium HumanMethylation450 BeadChip array. Comparison of the methylation profiles between obese and control subjects revealed 129 differentially methylated CpG (DMCpG) loci associated with 80 unique genes that had a greater than 10% difference in methylation (P-value < 0.05). The top pathways enriched among the DMCpGs included developmental processes, immune system regulation, regulation of cell signaling, and small GTPase-mediated signal transduction. The associations between the methylation of selected DMCpGs with childhood obesity were validated using sodium bisulfite pyrosequencing across loci within the FYN, PIWIL4, and TAOK3 genes in individual subjects. Three CpG loci within FYN were hypermethylated in obese individuals (all P < 0.01), while obesity was associated with lower methylation of CpG loci within PIWIL4 (P = 0.003) and TAOK3 (P = 0.001). After building logistic regression models, we determined that a 1% increase in methylation in TAOK3, multiplicatively decreased the odds of being obese by 0.91 (95% CI: 0.86 - 0.97), and an increase of 1% methylation in FYN CpG3, multiplicatively increased the odds of being obese by 1.03 (95% CI: 0.99 - 1.07). In conclusion, these findings provide evidence that childhood obesity is associated with specific DNA methylation changes in whole blood, which may have utility as biomarkers of obesity risk.

DNA methylation profiles of long- and short-term glioblastoma survivors

PubMed Central

Shinawi, Thoraia; Hill, Victoria K.; Krex, Dietmar; Schackert, Gabriele; Gentle, Dean; Morris, Mark R.; Wei, Wenbin; Cruickshank, Garth; Maher, Eamonn R.; Latif, Farida

2013-01-01

Glioblastoma (GBM) is the most common and malignant type of primary brain tumor in adults and prognosis of most GBM patients is poor. However, a small percentage of patients show a long term survival of 36 mo or longer after diagnosis. Epigenetic profiles can provide molecular markers for patient prognosis: recently, a G-CIMP positive phenotype associated with IDH1 mutations has been described for GBMs with good prognosis. In the present analysis we performed genome-wide DNA methylation profiling of short-term survivors (STS; overall survival < 1 y) and long-term survivors (LTS; overall survival > 3 y) by utilizing the HumanMethylation450K BeadChips to assess quantitative methylation at > 480,000 CpG sites. Cluster analysis has shown that a subset of LTS showed a G-CIMP positive phenotype that was tightly associated with IDH1 mutation status and was confirmed by analysis of the G-CIMP signature genes. Using high stringency criteria for differential hypermethylation between non-cancer brain and tumor samples, we identified 2,638 hypermethylated CpG loci (890 genes) in STS GBMs, 3,101 hypermethylated CpG loci (1,062 genes) in LTS (wild type IDH1) and 11,293 hypermethylated CpG loci in LTS (mutated for IDH1), reflecting the CIMP positive phenotype. The location of differentially hypermethylated CpG loci with respect to CpG content, neighborhood context and functional genomic distribution was similar in our sample set, with the majority of CpG loci residing in CpG islands and in gene promoters. Our preliminary study also identified a set of CpG loci differentially hypermethylated between STS and LTS cases, including members of the homeobox gene family (HOXD8, HOXD13 and HOXC4), the transcription factors NR2F2 and TFAP2A, and Dickkopf 2, a negative regulator of the wnt/β-catenin signaling pathway. PMID:23291739

Hypermethylation of brain natriuretic peptide gene is associated with the risk of rheumatic heart disease

PubMed Central

Li, Ni; Zheng, Dawei; Sun, Lebo; Shi, Huoshun; Zhu, Xiuying; Xu, Guodong; Wang, Qinning; Zhu, Caimin

2016-01-01

To investigate the contribution of brain natriuretic peptide (BNP) promoter DNA methylation to the risk of rheumatic heart disease (RHD) and the influence of warfarin anticoagulant therapy on BNP methylation levels for RHD patients after surgery. BNP methylation levels were determined by bisulfite pyrosequencing from plasma samples of RHD patients compared with healthy controls. Several factors influencing the RHD patients were included like age, smoking and cholesterol levels. A fragment of five CG sites (CpG1–5) in the promoter region of BNP gene was measured. BNP gene hypermethylation was found in CpG4 and CpG5 in RHD patients compared with non-RHD controls. A significant difference was also observed between RHD patients with long-term administration of warfarin and RHD patients who had recently undergone an operation. Moreover, single CpG4 and CpG5 analysis revealed a significant increase in methylation levels in men. BNP gene body hypermethylation is associated with the risk of RHD, and also influenced by the warfarin anticoagulant therapy of RHD patients after surgery, which could represent novel and promising targets for therapeutic development. PMID:27920275

Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

PubMed

Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

2004-09-01

Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

PubMed Central

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

2016-01-01

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

PubMed

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

Genome-wide site-specific differential methylation in the blood of individuals with Klinefelter Syndrome

PubMed Central

Wan, Emily S.; Qiu, Weiliang; Morrow, Jarrett; Beaty, Terri H.; Hetmanski, Jacqueline; Make, Barry J.; Lomas, David A.; Silverman, Edwin K.; DeMeo, Dawn L.

2015-01-01

Klinefelter syndrome (KS) (47 XXY) is a common sex-chromosome aneuploidy with an estimated prevalence of 1 in every 660 male births. Investigations into the associations between DNA methylation and the highly variable clinical manifestations of KS have largely focused on the supernumerary X chromosome; systematic investigations of the epigenome have been limited. We obtained genome-wide DNA methylation data from peripheral blood using the Illumina HumanMethylation450K platform in 5 KS (47 XXY), 102 male (46 XY), and 113 female (46 XX) control subjects participating in the chronic obstructive pulmonary disease (COPD) Gene Study. Empirical Bayes-mediated models were used to test for differential methylation by KS status. CpG sites with a false-discovery rate <0.05 from the first-generation HumanMethylation27K platform were further examined in an independent replication cohort of 2 KS subjects, 590 male, and 495 female controls drawn from the International COPD Genetics Network (ICGN). Differential methylation at sites throughout the genome were identified, including 86 CpG sites that were differentially methylated in KS subjects relative to both male and female controls. CpG sites annotated to the HEN1 methyltransferase homolog 1 (HENMT1), calcyclin-binding protein (CACYBP), and GTPase-activating protein (SH3 domain)-binding protein 1 (G3BP1) genes were among the “KS-specific” loci that were replicated in ICGN. We therefore conclude that site-specific differential methylation exists throughout the genome in KS. The functional impact and clinical relevance of these differentially methylated loci should be explored in future studies. PMID:25988574

Prenatal antidepressant exposure associated with CYP2E1 DNA methylation change in neonates

PubMed Central

Gurnot, Cécile; Martin-Subero, Ignacio; Mah, Sarah M; Weikum, Whitney; Goodman, Sarah J; Brain, Ursula; Werker, Janet F; Kobor, Michael S; Esteller, Manel; Oberlander, Tim F; Hensch, Takao K

2015-01-01

Some but not all neonates are affected by prenatal exposure to serotonin reuptake inhibitor antidepressants (SRI) and maternal mood disturbances. Distinguishing the impact of these 2 exposures is challenging and raises critical questions about whether pharmacological, genetic, or epigenetic factors can explain the spectrum of reported outcomes. Using unbiased DNA methylation array measurements followed by a detailed candidate gene approach, we examined whether prenatal SRI exposure was associated with neonatal DNA methylation changes and whether such changes were associated with differences in birth outcomes. Prenatal SRI exposure was first associated with increased DNA methylation status primarily at CYP2E1(βNon-exposed = 0.06, βSRI-exposed = 0.30, FDR = 0); however, this finding could not be distinguished from the potential impact of prenatal maternal depressed mood. Then, using pyrosequencing of CYP2E1 regulatory regions in an expanded cohort, higher DNA methylation status—both the mean across 16 CpG sites (P < 0.01) and at each specific CpG site (P < 0.05)—was associated with exposure to lower 3rd trimester maternal depressed mood symptoms only in the SRI-exposed neonates, indicating a maternal mood x SRI exposure interaction. In addition, higher DNA methylation levels at CpG2 (P = 0.04), CpG9 (P = 0.04) and CpG10 (P = 0.02), in the interrogated CYP2E1 region, were associated with increased birth weight independently of prenatal maternal mood, SRI drug exposure, or gestational age at birth. Prenatal SRI antidepressant exposure and maternal depressed mood were associated with altered neonatal CYP2E1 DNA methylation status, which, in turn, appeared to be associated with birth weight. PMID:25891251

The survival decrease in gastric cancer is associated with the methylation of B-cell CLL/lymphoma 6 member B promoter.

PubMed

Deng, Jingyu; Liang, Han; Dong, Qiuping; Hou, Yachao; Xie, Xingming; Yu, Jun; Fan, Daiming; Hao, Xishan

2014-07-01

The methylation of B-cell CLL/lymphoma 6 member B (BCL6B) DNA promoter was detected in several malignancies. Here, we quantitatively detect the methylated status of CpG sites of BCL6B DNA promoter of 459 patients with gastric cancer (GC) by using bisulfite gene sequencing. We show that patients with three or more methylated CpG sites in the BCL6B promoter were significantly associated with poor survival. Furthermore, by using the Akaike information criterion value calculation, we show that the methylated count of BCL6B promoter was identified to be the optimal prognostic predictor of GC patients.

Integrating prior knowledge in multiple testing under dependence with applications to detecting differential DNA methylation.

PubMed

Kuan, Pei Fen; Chiang, Derek Y

2012-09-01

DNA methylation has emerged as an important hallmark of epigenetics. Numerous platforms including tiling arrays and next generation sequencing, and experimental protocols are available for profiling DNA methylation. Similar to other tiling array data, DNA methylation data shares the characteristics of inherent correlation structure among nearby probes. However, unlike gene expression or protein DNA binding data, the varying CpG density which gives rise to CpG island, shore and shelf definition provides exogenous information in detecting differential methylation. This article aims to introduce a robust testing and probe ranking procedure based on a nonhomogeneous hidden Markov model that incorporates the above-mentioned features for detecting differential methylation. We revisit the seminal work of Sun and Cai (2009, Journal of the Royal Statistical Society: Series B (Statistical Methodology)71, 393-424) and propose modeling the nonnull using a nonparametric symmetric distribution in two-sided hypothesis testing. We show that this model improves probe ranking and is robust to model misspecification based on extensive simulation studies. We further illustrate that our proposed framework achieves good operating characteristics as compared to commonly used methods in real DNA methylation data that aims to detect differential methylation sites. © 2012, The International Biometric Society.

Epigenetic alterations of the BDNF gene in combat-related post-traumatic stress disorder.

PubMed

Kim, T Y; Kim, S J; Chung, H G; Choi, J H; Kim, S H; Kang, J I

2017-02-01

Brain-derived neurotrophic factor (BDNF) plays a crucial role in modulating resilience and vulnerability to stress. The aim of this study was to investigate whether epigenetic regulation of the BDNF gene is a biomarker of post-traumatic stress disorder (PTSD) development among veterans exposed to combat in the Vietnam War. Using the Clinician-Administered PTSD Scale, combat veterans were grouped into those with (n = 126) and without (n = 122) PTSD. DNA methylation levels at four CpG sites within the BDNF promoter I region were quantified in the peripheral blood using pyrosequencing. The effects of BDNF DNA methylation levels and clinical variables on the diagnosis of PTSD were tested using binary logistic regression analysis. Subjects with PTSD showed a higher DNA methylation of four CpG sites at the BDNF promoter compared with those without PTSD. High methylation levels at the BDNF promoter CpG site, high combat exposure, and alcohol problems were significantly associated with PTSD diagnosis. This study demonstrated an association between higher DNA methylation of the BDNF promoter and PTSD diagnosis in combat-exposed individuals. Our findings suggest that altered BDNF methylation may be a valuable biomarker of PTSD after trauma exposure. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Sex differences in DNA methylation of the cord blood are related to sex-bias psychiatric diseases

NASA Astrophysics Data System (ADS)

Maschietto, Mariana; Bastos, Laura Caroline; Tahira, Ana Carolina; Bastos, Elen Pereira; Euclydes, Veronica Luiza Vale; Brentani, Alexandra; Fink, Günther; de Baumont, Angelica; Felipe-Silva, Aloísio; Francisco, Rossana Pulcineli Vieira; Gouveia, Gisele; Grisi, Sandra Josefina Ferraz Ellero; Escobar, Ana Maria Ulhoa; Moreira-Filho, Carlos Alberto; Polanczyk, Guilherme Vanoni; Miguel, Euripedes Constantino; Brentani, Helena

2017-03-01

Sex differences in the prevalence of psychiatric disorders are well documented, with exposure to stress during gestation differentially impacting females and males. We explored sex-specific DNA methylation in the cord blood of 39 females and 32 males born at term and with appropriate weight at birth regarding their potential connection to psychiatric outcomes. Mothers were interviewed to gather information about environmental factors (gestational exposure) that could interfere with the methylation profiles in the newborns. Bisulphite converted DNA was hybridized to Illumina HumanMethylation450 BeadChips. Excluding XYS probes, there were 2,332 differentially methylated CpG sites (DMSs) between sexes, which were enriched within brain modules of co-methylated CpGs during brain development and also differentially methylated in the brains of boys and girls. Genes associated with the DMSs were enriched for neurodevelopmental disorders, particularly for CpG sites found differentially methylated in brain tissue between patients with schizophrenia and controls. Moreover, the DMS had an overlap of 890 (38%) CpG sites with a cohort submitted to toxic exposition during gestation. This study supports the evidences that sex differences in DNA methylation of autosomes act as a primary driver of sex differences that are found in psychiatric outcomes.

DNA Methylation Pyrosequencing Assay Is Applicable for the Assessment of Epigenetic Active Environmental or Clinical Relevant Chemicals

PubMed Central

Florea, Ana-Maria

2013-01-01

Exposure of cells and organisms to stressors might result in epigenetic changes. Here it is shown that investigation of DNA methylation using pyrosequencing is an alternative for in vitro and in vivo toxicological testing of epigenetic effects induced by chemicals and drugs. An in vitro evaluation of global and CpG site specific DNA methylation upon treatment of cells with chemicals/drugs is shown. Bisulfite genomic sequencing of methylation controls showed high methylation of LINE1 in methylation positive control and low methylation in the negative controls. The CpG sites within the LINE1 element are methylated at different levels. In vitro cell cultures show a methylation level ranging from 56% to 49%. Cultures of drug resistant tumor cells show significant hypomethylation as compared with the originating nonresistant tumor cells. The in vitro testing of epigenetically active chemicals (5-methyl-2'-deoxycytidine and trichostatin A) revealed a significant change of LINE1 methylation status upon treatment, while specific CpG sites were more prone to demethylation than others (focal methylation). In conclusion, DNA methylation using pyrosequencing might be used not only for testing epigenetic toxins/drugs but also in risk assessment of drugs, food, and environmental relevant pollutants. PMID:24093099

Expression and methylation of BDNF in the human brain in schizophrenia.

PubMed

Cheah, Sern-Yih; McLeay, Robert; Wockner, Leesa F; Lawford, Bruce R; Young, Ross McD; Morris, Charles P; Voisey, Joanne

2017-08-01

To examine the combined effect of the BDNF Val66Met (rs6265) polymorphism and BDNF DNA methylation on transcriptional regulation of the BDNF gene. DNA methylation profiles were generated for CpG sites proximal to Val66Met, within BDNF promoter I and exon V for prefrontal cortex samples from 25 schizophrenia and 25 control subjects. Val66Met genotypes and BDNF mRNA expression data were generated by transcriptome sequencing. Expression, methylation and genotype data were correlated and examined for association with schizophrenia. There was 43% more of the BDNF V-VIII-IX transcript in schizophrenia samples. BDNF mRNA expression and DNA methylation of seven CpG sites were not associated with schizophrenia after accounting for age and PMI effects. BDNF mRNA expression and DNA methylation were not altered by Val66Met after accounting for age and PMI effects. DNA methylation of one CpG site had a marginally significant positive correlation with mRNA expression in schizophrenia subjects. Schizophrenia risk was not associated with differential BDNF mRNA expression and DNA methylation. A larger age-matched cohort with comprehensive clinical history is required to accurately identify the effects of genotype, mRNA expression and DNA methylation on schizophrenia risk.

Sex differences in DNA methylation of the cord blood are related to sex-bias psychiatric diseases

PubMed Central

Maschietto, Mariana; Bastos, Laura Caroline; Tahira, Ana Carolina; Bastos, Elen Pereira; Euclydes, Veronica Luiza Vale; Brentani, Alexandra; Fink, Günther; de Baumont, Angelica; Felipe-Silva, Aloísio; Francisco, Rossana Pulcineli Vieira; Gouveia, Gisele; Grisi, Sandra Josefina Ferraz Ellero; Escobar, Ana Maria Ulhoa; Moreira-Filho, Carlos Alberto; Polanczyk, Guilherme Vanoni; Miguel, Euripedes Constantino; Brentani, Helena

2017-01-01

Sex differences in the prevalence of psychiatric disorders are well documented, with exposure to stress during gestation differentially impacting females and males. We explored sex-specific DNA methylation in the cord blood of 39 females and 32 males born at term and with appropriate weight at birth regarding their potential connection to psychiatric outcomes. Mothers were interviewed to gather information about environmental factors (gestational exposure) that could interfere with the methylation profiles in the newborns. Bisulphite converted DNA was hybridized to Illumina HumanMethylation450 BeadChips. Excluding XYS probes, there were 2,332 differentially methylated CpG sites (DMSs) between sexes, which were enriched within brain modules of co-methylated CpGs during brain development and also differentially methylated in the brains of boys and girls. Genes associated with the DMSs were enriched for neurodevelopmental disorders, particularly for CpG sites found differentially methylated in brain tissue between patients with schizophrenia and controls. Moreover, the DMS had an overlap of 890 (38%) CpG sites with a cohort submitted to toxic exposition during gestation. This study supports the evidences that sex differences in DNA methylation of autosomes act as a primary driver of sex differences that are found in psychiatric outcomes. PMID:28303968

Cancer Biomarkers from Genome-Scale DNA Methylation: Comparison of Evolutionary and Semantic Analysis Methods

PubMed Central

Valavanis, Ioannis; Pilalis, Eleftherios; Georgiadis, Panagiotis; Kyrtopoulos, Soterios; Chatziioannou, Aristotelis

2015-01-01

DNA methylation profiling exploits microarray technologies, thus yielding a wealth of high-volume data. Here, an intelligent framework is applied, encompassing epidemiological genome-scale DNA methylation data produced from the Illumina’s Infinium Human Methylation 450K Bead Chip platform, in an effort to correlate interesting methylation patterns with cancer predisposition and, in particular, breast cancer and B-cell lymphoma. Feature selection and classification are employed in order to select, from an initial set of ~480,000 methylation measurements at CpG sites, predictive cancer epigenetic biomarkers and assess their classification power for discriminating healthy versus cancer related classes. Feature selection exploits evolutionary algorithms or a graph-theoretic methodology which makes use of the semantics information included in the Gene Ontology (GO) tree. The selected features, corresponding to methylation of CpG sites, attained moderate-to-high classification accuracies when imported to a series of classifiers evaluated by resampling or blindfold validation. The semantics-driven selection revealed sets of CpG sites performing similarly with evolutionary selection in the classification tasks. However, gene enrichment and pathway analysis showed that it additionally provides more descriptive sets of GO terms and KEGG pathways regarding the cancer phenotypes studied here. Results support the expediency of this methodology regarding its application in epidemiological studies. PMID:27600245

Epigenome-wide cross-tissue predictive modeling and comparison of cord blood and placental methylation in a birth cohort

PubMed Central

De Carli, Margherita M; Baccarelli, Andrea A; Trevisi, Letizia; Pantic, Ivan; Brennan, Kasey JM; Hacker, Michele R; Loudon, Holly; Brunst, Kelly J; Wright, Robert O; Wright, Rosalind J; Just, Allan C

2017-01-01

Aim: We compared predictive modeling approaches to estimate placental methylation using cord blood methylation. Materials & methods: We performed locus-specific methylation prediction using both linear regression and support vector machine models with 174 matched pairs of 450k arrays. Results: At most CpG sites, both approaches gave poor predictions in spite of a misleading improvement in array-wide correlation. CpG islands and gene promoters, but not enhancers, were the genomic contexts where the correlation between measured and predicted placental methylation levels achieved higher values. We provide a list of 714 sites where both models achieved an R2 ≥0.75. Conclusion: The present study indicates the need for caution in interpreting cross-tissue predictions. Few methylation sites can be predicted between cord blood and placenta. PMID:28234020

Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue

PubMed Central

Geybels, Milan S.; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A.; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L.

2016-01-01

Background Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. Methods The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. Results In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value <0.001), the majority of which were hypermethylated (n = 1,946; 95%). DNA methylation profiles accurately distinguished between PCa and benign tissue samples. Twenty-seven top-ranked hypermethylated CpGs had a mean methylation difference of at least 40% between tissue types, which included 25 CpGs in 17 genes. Furthermore, for ten genes over 50% of promoter region CpGs were hypermethylated in PCa versus benign tissue. The top-ranked differentially methylated genes included three genes that were associated with both promoter hypermethylation and reduced gene expression: SCGB3A1, HIF3A, and AOX1. Analysis of The Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. Conclusions This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. PMID:26383847

Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue.

PubMed

Geybels, Milan S; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L

2015-12-01

Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value < 0.001), the majority of which were hypermethylated (n = 1,946; 95%). DNA methylation profiles accurately distinguished between PCa and benign tissue samples. Twenty-seven top-ranked hypermethylated CpGs had a mean methylation difference of at least 40% between tissue types, which included 25 CpGs in 17 genes. Furthermore, for 10 genes over 50% of promoter region CpGs were hypermethylated in PCa versus benign tissue. The top-ranked differentially methylated genes included three genes that were associated with both promoter hypermethylation and reduced gene expression: SCGB3A1, HIF3A, and AOX1. Analysis of The Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. © 2015 Wiley Periodicals, Inc.

A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro

PubMed Central

2013-01-01

Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769

Comprehensive analysis of MGMT promoter methylation: correlation with MGMT expression and clinical response in GBM.

PubMed

Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

2011-01-07

O⁶-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089-13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301-7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting.

Cord blood DNA methylation and adiposity measures in early and mid-childhood.

PubMed

Kresovich, Jacob K; Zheng, Yinan; Cardenas, Andres; Joyce, Brian T; Rifas-Shiman, Sheryl L; Oken, Emily; Gillman, Matthew W; Hivert, Marie-France; Baccarelli, Andrea A; Hou, Lifang

2017-01-01

Excess adiposity in childhood is associated with numerous adverse health outcomes. As this condition is difficult to treat once present, identification of risk early in life can help inform and implement strategies to prevent the onset of the condition. We performed an epigenome-wide association study to prospectively investigate the relationship between cord blood DNA methylation and adiposity measurements in childhood. We measured genome-wide DNA methylation from 478 children in cord blood and measured overall and central adiposity via skinfold caliper measurements in early (range 3.1-3.3 years) and mid-childhood (age range 7.3-8.3 years) and via dual X-ray absorptiometry (DXA) in mid-childhood. Final models were adjusted for maternal age at enrollment, pre-pregnancy body mass index, education, folate intake during pregnancy, smoking during pregnancy, and gestational weight gain, and child sex, race/ethnicity, current age, and cord blood cell composition. We identified four promoter proximal CpG sites that were associated with adiposity as measured by subscapular (SS) and triceps (TR) ratio (SS:TR) in early childhood, in the genes KPRP , SCL9A10 , MYLK2 , and PRLHR . We additionally identified one gene body CpG site associated with early childhood SS + TR on PPAPDC1A ; this site was nominally associated with SS + TR in mid-childhood. Higher methylation at one promoter proximal CpG site in MMP25 was also associated with SS:TR in mid-childhood. In regional analyses, methylation at an exonal region of GFPT2 was positively associated with SS:TR in early childhood. Finally, we identified regions of two long, non-coding RNAs which were associated with SS:TR (LOC100049716) and fat-free mass index (LOC102723493) in mid-childhood. This analysis identified novel CpG loci associated with adiposity outcomes. However, our results suggest little consistency across the various adiposity outcomes tested, particularly among the more accurate DXA measurements of body composition. We recommend using caution when interpreting these associations.

Comprehensive Analysis of MGMT Promoter Methylation: Correlation with MGMT Expression and Clinical Response in GBM

PubMed Central

Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

2011-01-01

O6-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089–13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301–7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting. PMID:21249131

Whole Genome DNA Methylation Analysis of Obstructive Sleep Apnea: IL1R2, NPR2, AR, SP140 Methylation and Clinical Phenotype.

PubMed

Chen, Yung-Che; Chen, Ting-Wen; Su, Mao-Chang; Chen, Chung-Jen; Chen, Kuang-Den; Liou, Chia-Wei; Tang, Petrus; Wang, Ting-Ya; Chang, Jen-Chieh; Wang, Chin-Chou; Lin, Hsin-Ching; Chin, Chien-Hung; Huang, Kuo-Tung; Lin, Meng-Chih; Hsiao, Chang-Chun

2016-04-01

We hypothesized that DNA methylation patterns may contribute to disease severity or the development of hypertension and excessive daytime sleepiness (EDS) in patients with obstructive sleep apnea (OSA). Illumina's (San Diego, CA, USA) DNA methylation 27-K assay was used to identify differentially methylated loci (DML). DNA methylation levels were validated by pyrosequencing. A discovery cohort of 15 patients with OSA and 6 healthy subjects, and a validation cohort of 72 patients with sleep disordered breathing (SDB). Microarray analysis identified 636 DMLs in patients with OSA versus healthy subjects, and 327 DMLs in patients with OSA and hypertension versus those without hypertension. In the validation cohort, no significant difference in DNA methylation levels of six selected genes was found between the primary snoring subjects and OSA patients (primary outcome). However, a secondary outcome analysis showed that interleukin-1 receptor 2 (IL1R2) promoter methylation (-114 cytosine followed by guanine dinucleotide sequence [CpG] site) was decreased and IL1R2 protein levels were increased in the patients with SDB with an oxygen desaturation index > 30. Androgen receptor (AR) promoter methylation (-531 CpG site) and AR protein levels were both increased in the patients with SDB with an oxygen desaturation index > 30. Natriuretic peptide receptor 2 (NPR2) promoter methylation (-608/-618 CpG sites) were decreased, whereas levels of both NPR2 and serum C type natriuretic peptide protein were increased in the SDB patients with EDS. Speckled protein 140 (SP140) promoter methylation (-194 CpG site) was increased, and SP140 protein levels were decreased in the patients with SDB and EDS. IL1R2 hypomethylation and AR hypermethylation may constitute an important determinant of disease severity, whereas NPR2 hypomethylation and SP140 hypermethylation may provide a biomarker for vulnerability to EDS in OSA. A commentary on this article appears in this issue on page 723. © 2016 Associated Professional Sleep Societies, LLC.

A Six Months Exercise Intervention Influences the Genome-wide DNA Methylation Pattern in Human Adipose Tissue

PubMed Central

Rönn, Tina; Volkov, Petr; Davegårdh, Cajsa; Dayeh, Tasnim; Hall, Elin; Olsson, Anders H.; Nilsson, Emma; Tornberg, Åsa; Dekker Nitert, Marloes; Eriksson, Karl-Fredrik; Jones, Helena A.; Groop, Leif; Ling, Charlotte

2013-01-01

Epigenetic mechanisms are implicated in gene regulation and the development of different diseases. The epigenome differs between cell types and has until now only been characterized for a few human tissues. Environmental factors potentially alter the epigenome. Here we describe the genome-wide pattern of DNA methylation in human adipose tissue from 23 healthy men, with a previous low level of physical activity, before and after a six months exercise intervention. We also investigate the differences in adipose tissue DNA methylation between 31 individuals with or without a family history of type 2 diabetes. DNA methylation was analyzed using Infinium HumanMethylation450 BeadChip, an array containing 485,577 probes covering 99% RefSeq genes. Global DNA methylation changed and 17,975 individual CpG sites in 7,663 unique genes showed altered levels of DNA methylation after the exercise intervention (q<0.05). Differential mRNA expression was present in 1/3 of gene regions with altered DNA methylation, including RALBP1, HDAC4 and NCOR2 (q<0.05). Using a luciferase assay, we could show that increased DNA methylation in vitro of the RALBP1 promoter suppressed the transcriptional activity (p = 0.03). Moreover, 18 obesity and 21 type 2 diabetes candidate genes had CpG sites with differences in adipose tissue DNA methylation in response to exercise (q<0.05), including TCF7L2 (6 CpG sites) and KCNQ1 (10 CpG sites). A simultaneous change in mRNA expression was seen for 6 of those genes. To understand if genes that exhibit differential DNA methylation and mRNA expression in human adipose tissue in vivo affect adipocyte metabolism, we silenced Hdac4 and Ncor2 respectively in 3T3-L1 adipocytes, which resulted in increased lipogenesis both in the basal and insulin stimulated state. In conclusion, exercise induces genome-wide changes in DNA methylation in human adipose tissue, potentially affecting adipocyte metabolism. PMID:23825961

DNA methylation profiles of ovarian epithelial carcinoma tumors and cell lines.

PubMed

Houshdaran, Sahar; Hawley, Sarah; Palmer, Chana; Campan, Mihaela; Olsen, Mari N; Ventura, Aviva P; Knudsen, Beatrice S; Drescher, Charles W; Urban, Nicole D; Brown, Patrick O; Laird, Peter W

2010-02-22

Epithelial ovarian carcinoma is a significant cause of cancer mortality in women worldwide and in the United States. Epithelial ovarian cancer comprises several histological subtypes, each with distinct clinical and molecular characteristics. The natural history of this heterogeneous disease, including the cell types of origin, is poorly understood. This study applied recently developed methods for high-throughput DNA methylation profiling to characterize ovarian cancer cell lines and tumors, including representatives of three major histologies. We obtained DNA methylation profiles of 1,505 CpG sites (808 genes) in 27 primary epithelial ovarian tumors and 15 ovarian cancer cell lines. We found that the DNA methylation profiles of ovarian cancer cell lines were markedly different from those of primary ovarian tumors. Aggregate DNA methylation levels of the assayed CpG sites tended to be higher in ovarian cancer cell lines relative to ovarian tumors. Within the primary tumors, those of the same histological type were more alike in their methylation profiles than those of different subtypes. Supervised analyses identified 90 CpG sites (68 genes) that exhibited 'subtype-specific' DNA methylation patterns (FDR<1%) among the tumors. In ovarian cancer cell lines, we estimated that for at least 27% of analyzed autosomal CpG sites, increases in methylation were accompanied by decreases in transcription of the associated gene. The significant difference in DNA methylation profiles between ovarian cancer cell lines and tumors underscores the need to be cautious in using cell lines as tumor models for molecular studies of ovarian cancer and other cancers. Similarly, the distinct methylation profiles of the different histological types of ovarian tumors reinforces the need to treat the different histologies of ovarian cancer as different diseases, both clinically and in biomarker studies. These data provide a useful resource for future studies, including those of potential tumor progenitor cells, which may help illuminate the etiology and natural history of these cancers.

Adjuvant-Loaded Spiky Gold Nanoparticles for Activation of Innate Immune Cells.

PubMed

Nam, Jutaek; Son, Sejin; Moon, James J

2017-10-01

Gold nanoparticles are versatile carriers for delivery of biomacromolecules. Here, we have developed spiky gold nanoparticles (SGNPs) that can efficiently deliver immunostimulatory agents. Our goal was to develop a platform technology for co-delivery of multiple adjuvant molecules for synergistic stimulation and maturation of innate immune cells. SGNPs were synthesized by a seed-mediated, surfactant-free synthesis method and incorporated with polyinosinic-polycytidylic acid (pIC) and DNA oligonucleotide containing unmethylated CpG motif (CpG) by an electrostatic layer-by-layer approach. Adjuvant-loaded SGNP nano-complexes were examined for their biophysical and biochemical properties and studied for immune activation using bone marrow-derived dendritic cells (BMDCs). We have synthesized SGNPs with branched nano-spikes layered with pIC and/or CpG. Adjuvant-loaded SGNP nano-complexes promoted cellular uptake of the adjuvants. Importantly, we achieved spatio-temporal control over co-delivery of pIC and CpG via SGNPs, which produced synergistic enhancement in cytokine release (IL-6, TNF-α) and upregulation of co-stimulatory markers (CD40, CD80, CD86) in BMDCs, compared with pIC, CpG, or their admixtures. SGNPs serve as a versatile delivery platform that allows flexible and on-demand cargo fabrication for strong activation of innate immune cells.

Potential for diagnosis versus therapy monitoring of attention deficit hyperactivity disorder: a new epigenetic biomarker interacting with both genotype and auto-immunity.

PubMed

Adriani, Walter; Romano, Emilia; Pucci, Mariangela; Pascale, Esterina; Cerniglia, Luca; Cimino, Silvia; Tambelli, Renata; Curatolo, Paolo; Granstrem, Oleg; Maccarrone, Mauro; Laviola, Giovanni; D'Addario, Claudio

2018-02-01

In view of the need for easily accessible biomarkers, we evaluated in ADHD children the epigenetic status of the 5'-untranslated region (UTR) in the SLC6A3 gene, coding for human dopamine transporter (DAT). We analysed buccal swabs and sera from 30 children who met DSM-IV-TR criteria for ADHD, assigned to treatment according to severity. Methylation levels at six-selected CpG sites (among which, a CGGCGGCGG and a CGCG motif), alone or in combination with serum titers in auto-antibodies against dopamine transporter (DAT aAbs), were analysed for correlation with CGAS scores (by clinicians) and Conners' scales (by parents), collected at recruitment and after 6 weeks. In addition, we characterized the DAT genotype, i.e., the variable number tandem repeat (VNTR) polymorphisms at the 3'-UTR of the gene. DAT methylation levels were greatly reduced in ADHD patients compared to control, healthy children. Within patients carrying at least one DAT 9 allele (DAT 9/x), methylation at positions CpG2 and/or CpG6 correlated with recovery, as evident from delta-CGAS scores as well as delta Conners' scales ('inattentive' and 'hyperactive' subscales). Moreover, hypermethylation at CpG1 position denoted severity, specifically for those patients carrying a DAT 10/10 genotype. Intriguingly, high serum DAT-aAbs titers appeared to corroborate indications from high CpG1 versus high CpG2/CpG6 levels, likewise denoting severity versus recovery in DAT 10/10 versus 9/x patients, respectively. These profiles suggest that DAT 5'UTR epigenetics plus serum aAbs can serve as suitable biomarkers, to confirm ADHD diagnosis and/or to predict the efficacy of treatment.

Emergency department management of gastro-enteritis in Australia and New Zealand.

PubMed

Schutz, Jacquie; Babl, Franz E; Sheriff, Nisa; Borland, Meredith

2008-10-01

Comparison of clinical practice guideline (CPG) recommendations and reported physician management of gastro-enteritis at Paediatric Research in Emergency Departments International Collaborative (PREDICT) network sites as a baseline for further randomised controlled trials. Two part survey comprising: (i) review of CPGs from PREDICT sites for gastro-enteritis; and (ii) survey of senior emergency department physicians regarding the management of gastro-enteritis. All 11 PREDICT sites participated. Nine CPGs were available with three sites using a common CPG. For moderate dehydration, eight CPGs advocated nasogastric (NG) rehydration in preference to intravenous (IV) rehydration. The IV route was reserved for severe dehydration or failed NG rehydration. In the second component of the survey, 78 of 83 (94%) physicians responded. In moderate dehydration, 82% of respondents used NG rehydration. In severe dehydration, 86% used IV fluids; 12% used NG and 3% an initial IV bolus followed by NG fluid. Serum electrolytes were measured universally with IV fluid use and by 22% using NG rehydration. The IV fluid bolus was with normal saline (86%). Fifty-four per cent used anti-emetics 'rarely' or 'sometimes'. The commonest agents were ondansetron (60%) and metoclopramide (29%). CPG recommendations and physician practice for the management of gastro-enteritis were similar across PREDICT sites with a focus on NG for moderate dehydration and IV for severe dehydration. A variety of fluids and administration rates were used. Anti-emetics were used infrequently. The efficacy and safety of newer anti-emetics should be explored in collaborative studies. Collaborative development of new CPGs should be considered to simplify fluid regimens.

Inhalation of diesel exhaust and allergen alters human bronchial epithelium DNA methylation.

PubMed

Clifford, Rachel L; Jones, Meaghan J; MacIsaac, Julia L; McEwen, Lisa M; Goodman, Sarah J; Mostafavi, Sara; Kobor, Michael S; Carlsten, Chris

2017-01-01

Allergic disease affects 30% to 40% of the world's population, and its development is determined by the interplay between environmental and inherited factors. Air pollution, primarily consisting of diesel exhaust emissions, has increased at a similar rate to allergic disease. Exposure to diesel exhaust may play a role in the development and progression of allergic disease, in particular allergic respiratory disease. One potential mechanism underlying the connection between air pollution and increased allergic disease incidence is DNA methylation, an epigenetic process with the capacity to integrate gene-environment interactions. We sought to investigate the effect of allergen and diesel exhaust exposure on bronchial epithelial DNA methylation. We performed a randomized crossover-controlled exposure study to allergen and diesel exhaust in humans, and measured single-site (CpG) resolution global DNA methylation in bronchial epithelial cells. Exposure to allergen alone, diesel exhaust alone, or allergen and diesel exhaust together (coexposure) led to significant changes in 7 CpG sites at 48 hours. However, when the same lung was exposed to allergen and diesel exhaust but separated by approximately 4 weeks, significant changes in more than 500 sites were observed. Furthermore, sites of differential methylation differed depending on which exposure was experienced first. Functional analysis of differentially methylated CpG sites found genes involved in transcription factor activity, protein metabolism, cell adhesion, and vascular development, among others. These findings suggest that specific exposures can prime the lung for changes in DNA methylation induced by a subsequent insult. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

CpG Methylation Analysis of HPV16 in Laser Capture Microdissected Archival Tissue and Whole Tissue Sections from High Grade Anal Squamous Intraepithelial Lesions: A Potential Disease Biomarker

PubMed Central

Molano, Monica; Tabrizi, Sepehr N.; Garland, Suzanne M.; Roberts, Jennifer M.; Machalek, Dorothy A.; Phillips, Samuel; Chandler, David; Hillman, Richard J.; Grulich, Andrew E.; Jin, Fengyi; Poynten, I. Mary; Templeton, David J.; Cornall, Alyssa M.

2016-01-01

Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL. PMID:27529629

CpG Methylation Analysis of HPV16 in Laser Capture Microdissected Archival Tissue and Whole Tissue Sections from High Grade Anal Squamous Intraepithelial Lesions: A Potential Disease Biomarker.

PubMed

Molano, Monica; Tabrizi, Sepehr N; Garland, Suzanne M; Roberts, Jennifer M; Machalek, Dorothy A; Phillips, Samuel; Chandler, David; Hillman, Richard J; Grulich, Andrew E; Jin, Fengyi; Poynten, I Mary; Templeton, David J; Cornall, Alyssa M

2016-01-01

Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL.

Detection and evaluation of DNA methylation markers found at SCGN and KLF14 loci to estimate human age.

PubMed

Alghanim, Hussain; Antunes, Joana; Silva, Deborah Soares Bispo Santos; Alho, Clarice Sampaio; Balamurugan, Kuppareddi; McCord, Bruce

2017-11-01

Recent developments in the analysis of epigenetic DNA methylation patterns have demonstrated that certain genetic loci show a linear correlation with chronological age. It is the goal of this study to identify a new set of epigenetic methylation markers for the forensic estimation of human age. A total number of 27 CpG sites at three genetic loci, SCGN, DLX5 and KLF14, were examined to evaluate the correlation of their methylation status with age. These sites were evaluated using 72 blood samples and 91 saliva samples collected from volunteers with ages ranging from 5 to 73 years. DNA was bisulfite modified followed by PCR amplification and pyrosequencing to determine the level of DNA methylation at each CpG site. In this study, certain CpG sites in SCGN and KLF14 loci showed methylation levels that were correlated with chronological age, however, the tested CpG sites in DLX5 did not show a correlation with age. Using a 52-saliva sample training set, two age-predictor models were developed by means of a multivariate linear regression analysis for age prediction. The two models performed similarly with a single-locus model explaining 85% of the age variance at a mean absolute deviation of 5.8 years and a dual-locus model explaining 84% of the age variance with a mean absolute deviation of 6.2 years. In the validation set, the mean absolute deviation was measured to be 8.0 years and 7.1 years for the single- and dual-locus model, respectively. Another age predictor model was also developed using a 40-blood sample training set that accounted for 71% of the age variance. This model gave a mean absolute deviation of 6.6 years for the training set and 10.3years for the validation set. The results indicate that specific CpGs in SCGN and KLF14 can be used as potential epigenetic markers to estimate age using saliva and blood specimens. These epigenetic markers could provide important information in cases where the determination of a suspect's age is critical in developing investigative leads. Copyright © 2017. Published by Elsevier B.V.

Kidney Dysfunction in Adult Offspring Exposed In Utero to Type 1 Diabetes Is Associated with Alterations in Genome-Wide DNA Methylation

PubMed Central

Gautier, Jean-François; Porcher, Raphaël; Abi Khalil, Charbel; Bellili-Munoz, Naima; Fetita, Lila Sabrina; Travert, Florence; Choukem, Simeon-Pierre; Riveline, Jean-Pierre; Hadjadj, Samy; Larger, Etienne; Boudou, Philippe; Blondeau, Bertrand; Roussel, Ronan; Ferré, Pascal; Ravussin, Eric; Rouzet, François; Marre, Michel

2015-01-01

Background Fetal exposure to hyperglycemia impacts negatively kidney development and function. Objective Our objective was to determine whether fetal exposure to moderate hyperglycemia is associated with epigenetic alterations in DNA methylation in peripheral blood cells and whether those alterations are related to impaired kidney function in adult offspring. Design Twenty nine adult, non-diabetic offspring of mothers with type 1 diabetes (T1D) (case group) were matched with 28 offspring of T1D fathers (control group) for the study of their leukocyte genome-wide DNA methylation profile (27,578 CpG sites, Human Methylation 27 BeadChip, Illumina Infinium). In a subset of 19 cases and 18 controls, we assessed renal vascular development by measuring Glomerular Filtration Rate (GFR) and Effective Renal Plasma Flow (ERPF) at baseline and during vasodilatation produced by amino acid infusion. Results Globally, DNA was under-methylated in cases vs. controls. Among the 87 CpG sites differently methylated, 74 sites were less methylated and 13 sites more methylated in cases vs. controls. None of these CpG sites were located on a gene known to be directly involved in kidney development and/or function. However, the gene encoding DNA methyltransferase 1 (DNMT1)—a key enzyme involved in gene expression during early development–was under-methylated in cases. The average methylation of the 74 under-methylated sites differently correlated with GFR in cases and controls. Conclusion Alterations in methylation profile imprinted by the hyperglycemic milieu of T1D mothers during fetal development may impact kidney function in adult offspring. The involved pathways seem to be a nonspecific imprinting process rather than specific to kidney development or function. PMID:26258530

Kidney Dysfunction in Adult Offspring Exposed In Utero to Type 1 Diabetes Is Associated with Alterations in Genome-Wide DNA Methylation.

PubMed

Gautier, Jean-François; Porcher, Raphaël; Abi Khalil, Charbel; Bellili-Munoz, Naima; Fetita, Lila Sabrina; Travert, Florence; Choukem, Simeon-Pierre; Riveline, Jean-Pierre; Hadjadj, Samy; Larger, Etienne; Boudou, Philippe; Blondeau, Bertrand; Roussel, Ronan; Ferré, Pascal; Ravussin, Eric; Rouzet, François; Marre, Michel

2015-01-01

Fetal exposure to hyperglycemia impacts negatively kidney development and function. Our objective was to determine whether fetal exposure to moderate hyperglycemia is associated with epigenetic alterations in DNA methylation in peripheral blood cells and whether those alterations are related to impaired kidney function in adult offspring. Twenty nine adult, non-diabetic offspring of mothers with type 1 diabetes (T1D) (case group) were matched with 28 offspring of T1D fathers (control group) for the study of their leukocyte genome-wide DNA methylation profile (27,578 CpG sites, Human Methylation 27 BeadChip, Illumina Infinium). In a subset of 19 cases and 18 controls, we assessed renal vascular development by measuring Glomerular Filtration Rate (GFR) and Effective Renal Plasma Flow (ERPF) at baseline and during vasodilatation produced by amino acid infusion. Globally, DNA was under-methylated in cases vs. controls. Among the 87 CpG sites differently methylated, 74 sites were less methylated and 13 sites more methylated in cases vs. controls. None of these CpG sites were located on a gene known to be directly involved in kidney development and/or function. However, the gene encoding DNA methyltransferase 1 (DNMT1)--a key enzyme involved in gene expression during early development--was under-methylated in cases. The average methylation of the 74 under-methylated sites differently correlated with GFR in cases and controls. Alterations in methylation profile imprinted by the hyperglycemic milieu of T1D mothers during fetal development may impact kidney function in adult offspring. The involved pathways seem to be a nonspecific imprinting process rather than specific to kidney development or function.

Methyl-Cytosine-Driven Structural Changes Enhance Adduction Kinetics of an Exon 7 fragment of the p53 Gene

NASA Astrophysics Data System (ADS)

Malla, Spundana; Kadimisetty, Karteek; Fu, You-Jun; Choudhary, Dharamainder; Schenkman, John B.; Rusling, James F.

2017-01-01

Methylation of cytosine (C) at C-phosphate-guanine (CpG) sites enhances reactivity of DNA towards electrophiles. Mutations at CpG sites on the p53 tumor suppressor gene that can result from these adductions are in turn correlated with specific cancers. Here we describe the first restriction-enzyme-assisted LC-MS/MS sequencing study of the influence of methyl cytosines (MeC) on kinetics of p53 gene adduction by model metabolite benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), using methodology applicable to correlate gene damage sites for drug and pollutant metabolites with mutation sites. This method allows direct kinetic measurements by LC-MS/MS sequencing for oligonucleotides longer than 20 base pairs (bp). We used MeC and non-MeC (C) versions of a 32 bp exon 7 fragment of the p53 gene. Methylation of 19 cytosines increased the rate constant 3-fold for adduction on G at the major reactive CpG in codon 248 vs. the non-MeC fragment. Rate constants for non-CpG codons 244 and 243 were not influenced significantly by MeC. Conformational and hydrophobicity changes in the MeC-p53 exon 7 fragment revealed by CD spectra and molecular modeling increase the BPDE binding constant to G in codon 248 consistent with a pathway in which preceding reactant binding greatly facilitates the rate of covalent SN2 coupling.

Randomized, double-blind, placebo-controlled, safety and immunogenicity study of 4 formulations of Anthrax Vaccine Adsorbed plus CPG 7909 (AV7909) in healthy adult volunteers.

PubMed

Hopkins, Robert J; Daczkowski, Nancy F; Kaptur, Paulina E; Muse, Derek; Sheldon, Eric; LaForce, Craig; Sari, Suha; Rudge, Thomas L; Bernton, Edward

2013-06-26

A new anthrax vaccine that could accelerate the immune response and possibly reduce the number of injections needed for protection would be desirable in a post-exposure setting. This Phase 1 study compared the safety and immunogenicity of 2 IM doses (Days 0 and 14) of 4 formulations of AV7909 (AVA plus CPG 7909) with 2 IM doses of BioThrax(®) (Anthrax Vaccine Adsorbed) and 2 IM doses of saline placebo administered on Days 0 and 14. A total of 105 healthy adults 18-50 years of age were randomized to 1 of 6 study groups: BioThrax (0.5 mL), AV7909 Formulation 1 (0.5 mL AVA+0.5mg CPG 7909), AV7909 Formulation 2 (0.5 mL AVA+0.25mg CPG 7909), AV7909 Formulation 3 (0.25 mL AVA+0.5mg CPG 7909), AV7909 Formulation 4 (0.25 mL AVA+0.25mg CPG 7909), or saline placebo (0.5 mL). All randomized subjects received at least 1 vaccination, and 100 subjects completed the trial. After 2 doses, mean peak normalized toxin neutralizing antibody responses (TNA NF50) in the AV7909 groups were higher than in the BioThrax group. Differences among the 4 AV7909 groups were not statistically significant. Subjects who received AV7909 reached peak titers on Day 28 vs. Day 35 in the BioThrax group. The most common adverse events (AEs) in the BioThrax and AV7909 groups assessed as related to vaccination were injection site reactions. Transient lymphopenia was observed after the first dose in each AV7909 group. Frequencies of injection site and systemic reactions recorded by subjects in diaries for 7 days after each injection were highest with AV7909 Formulation 1. No AEs of special interest (autoimmune events) were observed in the study. Further studies of doses and dosing regimens are planned to assess the immunogenicity and reactogenicity of AV7909. Copyright © 2013 Elsevier Ltd. All rights reserved.

Critical Points and Traveling Wave in Locomotion: Experimental Evidence and Some Theoretical Considerations.

PubMed

Saltiel, Philippe; d'Avella, Andrea; Tresch, Matthew C; Wyler, Kuno; Bizzi, Emilio

2017-01-01

The central pattern generator (CPG) architecture for rhythm generation remains partly elusive. We compare cat and frog locomotion results, where the component unrelated to pattern formation appears as a temporal grid, and traveling wave respectively. Frog spinal cord microstimulation with N-methyl-D-Aspartate (NMDA), a CPG activator, produced a limited set of force directions, sometimes tonic, but more often alternating between directions similar to the tonic forces. The tonic forces were topographically organized, and sites evoking rhythms with different force subsets were located close to the constituent tonic force regions. Thus CPGs consist of topographically organized modules. Modularity was also identified as a limited set of muscle synergies whose combinations reconstructed the EMGs. The cat CPG was investigated using proprioceptive inputs during fictive locomotion. Critical points identified both as abrupt transitions in the effect of phasic perturbations, and burst shape transitions, had biomechanical correlates in intact locomotion. During tonic proprioceptive perturbations, discrete shifts between these critical points explained the burst durations changes, and amplitude changes occurred at one of these points. Besides confirming CPG modularity, these results suggest a fixed temporal grid of anchoring points, to shift modules onsets and offsets. Frog locomotion, reconstructed with the NMDA synergies, showed a partially overlapping synergy activation sequence. Using the early synergy output evoked by NMDA at different spinal sites, revealed a rostrocaudal topographic organization, where each synergy is preferentially evoked from a few, albeit overlapping, cord regions. Comparing the locomotor synergy sequence with this topography suggests that a rostrocaudal traveling wave would activate the synergies in the proper sequence for locomotion. This output was reproduced in a two-layer model using this topography and a traveling wave. Together our results suggest two CPG components: modules, i.e., synergies; and temporal patterning, seen as a temporal grid in the cat, and a traveling wave in the frog. Animal and limb navigation have similarities. Research relating grid cells to the theta rhythm and on segmentation during navigation may relate to our temporal grid and traveling wave results. Winfree's mathematical work, combining critical phases and a traveling wave, also appears important. We conclude suggesting tracing, and imaging experiments to investigate our CPG model.

Inducible nitric oxide synthase gene methylation and parkinsonism in manganese-exposed welders

PubMed Central

Nielsen, Susan Searles; Checkoway, Harvey; Criswell, Susan R.; Farin, Federico M.; Stapleton, Patricia L.; Sheppard, Lianne; Racette, Brad A.

2015-01-01

Introduction Neurologist-assessed parkinsonism signs are prevalent among workers exposed to manganese (Mn)-containing welding fume. Neuroinflammation may possibly play a role. Inducible nitric oxide synthase, coded by NOS2, is involved in inflammation, and particulate exposure increases the gene’s expression through methylation of CpG sites in the 5′ region. Methods We assessed DNA methylation at three CpG sites in the NOS2 exon 1 from blood from 201 welders. All were non-Hispanic Caucasian men 25–65 years old who were examined by a neurologist specializing in movement disorders. We categorized the workers according to their Unified Parkinson Disease Rating Scale motor subsection 3 (UPDRS3) scores as parkinsonism cases (UPDRS3 ≥ 15; n = 49), controls (UPDRS3 < 6; n = 103), or intermediate (UPDRS3 ≥6 to <15; n = 49). Results While accounting for age, examiner and experimental plate, parkinsonism cases had lower mean NOS2 methylation than controls (p-value for trend = 0.04), specifically at CpG site 8329 located in an exonic splicing enhancer of NOS2 (p-value for trend = 0.07). These associations were not observed for the intermediate UPDRS3 group (both p-value for trend ≥ 0.59). Conclusions Inflammation mediated by inducible nitric oxide synthase may possibly contribute to the association between welding fume and parkinsonism, but requires verification in a longitudinal study. PMID:25634431

Methylation Analysis of the BMPR2 Gene Promoter Region in Patients With Pulmonary Arterial Hypertension.

PubMed

Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana

2016-06-01

Pulmonary arterial hypertension is characterizated by obstruction of the pulmonary arteries. The gene mainly related to pathology is the bone morphogenetic protein receptor type II (BMPR2). The aim of this study was to analyze the methylation pattern of the BMPR2 promoter region in patients and controls. We used Methyl Primer Express(®) v.1.0 and MatInspector softwares to analyze this region. Genomic DNA obtained from the peripheral blood of patients and controls was modified with sodium bisulphite. Methylation was analyzed using methylation-specific PCR. DNA treated with CpG methyltransferase was used as a positive control for methylation and H1299 cell culture DNA was used as positive control for gene expression. We identified a CpG island, which may have been methylated, in the BMPR2 promoter region, in addition to NIT-2 (global-acting regulatory protein), sex-determining region Y) and heat shock factor transcription factor binding sites. We found no evidence of methylation in patients and controls. No methylated CpG sites were identified in H1299 cells expressing the BMPR2 gene. The BMPR2 promoter region is the most suitable for study because of the high number of transcription factor binding sites that could alter gene function. No evidence of methylation was detected in this region in patients and controls. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

DNA methylation Landscape of body size variation in sheep.

PubMed

Cao, Jiaxue; Wei, Caihong; Liu, Dongming; Wang, Huihua; Wu, Mingming; Xie, Zhiyuan; Capellini, Terence D; Zhang, Li; Zhao, Fuping; Li, Li; Zhong, Tao; Wang, Linjie; Lu, Jian; Liu, Ruizao; Zhang, Shifang; Du, Yongfei; Zhang, Hongping; Du, Lixin

2015-10-16

Sub-populations of Chinese Mongolian sheep exhibit significant variance in body mass. In the present study, we sequenced the whole genome DNA methylation in these breeds to detect whether DNA methylation plays a role in determining the body mass of sheep by Methylated DNA immunoprecipitation - sequencing method. A high quality methylation map of Chinese Mongolian sheep was obtained in this study. We identified 399 different methylated regions located in 93 human orthologs, which were previously reported as body size related genes in human genome-wide association studies. We tested three regions in LTBP1, and DNA methylation of two CpG sites showed significant correlation with its RNA expression. Additionally, a particular set of differentially methylated windows enriched in the "development process" (GO: 0032502) was identified as potential candidates for association with body mass variation. Next, we validated small part of these windows in 5 genes; DNA methylation of SMAD1, TSC1 and AKT1 showed significant difference across breeds, and six CpG were significantly correlated with RNA expression. Interestingly, two CpG sites showed significant correlation with TSC1 protein expression. This study provides a thorough understanding of body size variation in sheep from an epigenetic perspective.

Identification of HIV infection-related DNA methylation sites and advanced epigenetic aging in HIV-positive, treatment-naive U.S. veterans.

PubMed

Nelson, Kristin N; Hui, Qin; Rimland, David; Xu, Ke; Freiberg, Matthew S; Justice, Amy C; Marconi, Vincent C; Sun, Yan V

2017-02-20

HIV-positive individuals are at higher risk than healthy persons for aging-related diseases, including myocardial infarction and non-AIDS defining cancers. Recent evidence suggests that HIV infection may modulate changes in the host cell epigenome, and these changes represent a potential mechanism through which HIV infection accelerates aging. We assessed the difference in DNA methylation (DNAm) age, an aging marker involving multiple age-related cytosine-guanine dinucleotide (CpG) sites, among antiretroviral treatment (ART)-naive HIV-positive and HIV-negative individuals in a cohort of veterans from the Veterans Aging Cohort Study. Peripheral blood samples were collected from 19 ART-naive, HIV-positive, and 19 HIV-negative male participants, matched by age and race. Blood samples were collected from HIV-positive participants 7-11 years after ART initiation. We compared DNAm age between HIV-positive and HIV-negative groups at baseline and between HIV-positive patients at baseline and follow-up. We also performed an epigenome-wide analysis to identify CpG methylation sites associated with HIV infection. DNAm age in HIV-positive individuals is, on average, 11.2 years higher than HIV study participants at baseline, and two of 10 HIV-positive individuals showed an increase in DNAm age after ART initiation. Epigenome-wide association studies showed an association of HIV infection with one site, in gene VPS37B, which approached statistical significance in our cohort (P = 3.30 × 10, Bonferroni-corrected threshold = 1.22 × 10) and was replicated in a second, larger cohort. ART treatment-naive HIV-positive individuals have significantly older DNAm age compared to HIV-negative individuals in the Veterans Aging Cohort Study cohort. Longitudinal changes in DNAm age are highly variable across individuals after initiation of antiretroviral therapy.

A Genome-Wide mQTL Analysis in Human Adipose Tissue Identifies Genetic Variants Associated with DNA Methylation, Gene Expression and Metabolic Traits

PubMed Central

Volkov, Petr; Olsson, Anders H.; Gillberg, Linn; Jørgensen, Sine W.; Brøns, Charlotte; Eriksson, Karl-Fredrik; Groop, Leif; Jansson, Per-Anders; Nilsson, Emma; Rönn, Tina; Vaag, Allan; Ling, Charlotte

2016-01-01

Little is known about the extent to which interactions between genetics and epigenetics may affect the risk of complex metabolic diseases and/or their intermediary phenotypes. We performed a genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human adipose tissue of 119 men, where 592,794 single nucleotide polymorphisms (SNPs) were related to DNA methylation of 477,891 CpG sites, covering 99% of RefSeq genes. SNPs in significant mQTLs were further related to gene expression in adipose tissue and obesity related traits. We found 101,911 SNP-CpG pairs (mQTLs) in cis and 5,342 SNP-CpG pairs in trans showing significant associations between genotype and DNA methylation in adipose tissue after correction for multiple testing, where cis is defined as distance less than 500 kb between a SNP and CpG site. These mQTLs include reported obesity, lipid and type 2 diabetes loci, e.g. ADCY3/POMC, APOA5, CETP, FADS2, GCKR, SORT1 and LEPR. Significant mQTLs were overrepresented in intergenic regions meanwhile underrepresented in promoter regions and CpG islands. We further identified 635 SNPs in significant cis-mQTLs associated with expression of 86 genes in adipose tissue including CHRNA5, G6PC2, GPX7, RPL27A, THNSL2 and ZFP57. SNPs in significant mQTLs were also associated with body mass index (BMI), lipid traits and glucose and insulin levels in our study cohort and public available consortia data. Importantly, the Causal Inference Test (CIT) demonstrates how genetic variants mediate their effects on metabolic traits (e.g. BMI, cholesterol, high-density lipoprotein (HDL), hemoglobin A1c (HbA1c) and homeostatic model assessment of insulin resistance (HOMA-IR)) via altered DNA methylation in human adipose tissue. This study identifies genome-wide interactions between genetic and epigenetic variation in both cis and trans positions influencing gene expression in adipose tissue and in vivo (dys)metabolic traits associated with the development of obesity and diabetes. PMID:27322064

Response of immune response genes to adjuvants poly [di(sodium carboxylatoethylphenoxy)phosphazene] (PCEP), CpG oligodeoxynucleotide and emulsigen at intradermal injection site in pigs.

PubMed

Magiri, R B; Lai, K; Chaffey, A M; Wilson, H L; Berry, W E; Szafron, M L; Mutwiri, G K

2016-07-01

Understanding the mechanisms by which adjuvants mediate their effects provide critical information on how innate immunity influences the development of adaptive immunity. Despite being a critical vaccine component, the mechanisms by which adjuvants mediate their effects are not fully understood and this is especially true when they are used in large animals. This lack of understanding limits our ability to design effective vaccines. In the present study, we administered polyphosphazene (PCEP), CpG oligodeoxynucleotides (CpG), emulsigen or saline via an intradermal injection into pigs and assessed the impact on the expression of reported 'adjuvant response genes' over time. CpG induced a strong upregulation of the chemokine CXL10 several 'Interferon Response Genes', as well as TNFα, and IL-10, and a down-regulation of IL-17 genes. Emulsigen upregulated expression of chemokines CCL2 and CCL5, proinflammatory cytokines IL-6 and TNFα, as well as TLR9, and several IFN response genes. PCEP induced the expression of chemokine CCL2 and proinflammatory cytokine IL-6. These results suggest that emulsigen and CpG may promote recruitment of innate immune cells and Th1 type cytokine production but that PCEP may promote a Th-2 type immune response through the induction of IL-6, an inducer of B cell activity and differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.

Methylation analysis of plasma cell-free DNA for breast cancer early detection using bisulfite next-generation sequencing.

PubMed

Li, Zibo; Guo, Xinwu; Tang, Lili; Peng, Limin; Chen, Ming; Luo, Xipeng; Wang, Shouman; Xiao, Zhi; Deng, Zhongping; Dai, Lizhong; Xia, Kun; Wang, Jun

2016-10-01

Circulating cell-free DNA (cfDNA) has been considered as a potential biomarker for non-invasive cancer detection. To evaluate the methylation levels of six candidate genes (EGFR, GREM1, PDGFRB, PPM1E, SOX17, and WRN) in plasma cfDNA as biomarkers for breast cancer early detection, quantitative analysis of the promoter methylation of these genes from 86 breast cancer patients and 67 healthy controls was performed by using microfluidic-PCR-based target enrichment and next-generation bisulfite sequencing technology. The predictive performance of different logistic models based on methylation status of candidate genes was investigated by means of the area under the ROC curve (AUC) and odds ratio (OR) analysis. Results revealed that EGFR, PPM1E, and 8 gene-specific CpG sites showed significantly hypermethylation in cancer patients' plasma and significantly associated with breast cancer (OR ranging from 2.51 to 9.88). The AUC values for these biomarkers were ranging from 0.66 to 0.75. Combinations of multiple hypermethylated genes or CpG sites substantially improved the predictive performance for breast cancer detection. Our study demonstrated the feasibility of quantitative measurement of candidate gene methylation in cfDNA by using microfluidic-PCR-based target enrichment and bisulfite next-generation sequencing, which is worthy of further validation and potentially benefits a broad range of applications in clinical oncology practice. Quantitative analysis of methylation pattern of plasma cfDNA by next-generation sequencing might be a valuable non-invasive tool for early detection of breast cancer.

MethLAB

PubMed Central

Kilaru, Varun; Barfield, Richard T; Schroeder, James W; Smith, Alicia K

2012-01-01

Recent evidence suggests that DNA methylation changes may underlie numerous complex traits and diseases. The advent of commercial, array-based methods to interrogate DNA methylation has led to a profusion of epigenetic studies in the literature. Array-based methods, such as the popular Illumina GoldenGate and Infinium platforms, estimate the proportion of DNA methylated at single-base resolution for thousands of CpG sites across the genome. These arrays generate enormous amounts of data, but few software resources exist for efficient and flexible analysis of these data. We developed a software package called MethLAB (http://genetics.emory.edu/conneely/MethLAB) using R, an open source statistical language that can be edited to suit the needs of the user. MethLAB features a graphical user interface (GUI) with a menu-driven format designed to efficiently read in and manipulate array-based methylation data in a user-friendly manner. MethLAB tests for association between methylation and relevant phenotypes by fitting a separate linear model for each CpG site. These models can incorporate both continuous and categorical phenotypes and covariates, as well as fixed or random batch or chip effects. MethLAB accounts for multiple testing by controlling the false discovery rate (FDR) at a user-specified level. Standard output includes a spreadsheet-ready text file and an array of publication-quality figures. Considering the growing interest in and availability of DNA methylation data, there is a great need for user-friendly open source analytical tools. With MethLAB, we present a timely resource that will allow users with no programming experience to implement flexible and powerful analyses of DNA methylation data. PMID:22430798

25-Hydroxyvitamin D in pregnancy and genome wide cord blood DNA methylation in two pregnancy cohorts (MoBa and ALSPAC).

PubMed

Suderman, M; Stene, L C; Bohlin, J; Page, C M; Holvik, K; Parr, C L; Magnus, M C; Håberg, S E; Joubert, B R; Wu, M C; London, S J; Relton, C; Nystad, W

2016-05-01

The aim of the study was to investigate whether maternal mid-pregnancy 25-hydroxyvitamin D concentrations are associated with cord blood DNA methylation. DNA methylation was assessed using the Illumina HumanMethylation450 BeadChip, and maternal plasma 25-hydroxyvitamin D was measured in 819 mothers/newborn pairs participating in the Norwegian Mother and Child Cohort (MoBa) and 597 mothers/newborn pairs participating in the Avon Longitudinal Study of Parents and Children (ALSPAC). Across 473,731CpG DNA methylation sites in cord blood DNA, none were strongly associated with maternal 25-hydroxyvitamin D after adjusting for multiple tests (false discovery rate (FDR)>0.5; 473,731 tests). A meta-analysis of the results from both cohorts, using the Fisher method for combining p-values, also did not strengthen findings (FDR>0.2). Further exploration of a set of CpG sites in the proximity of four a priori defined candidate genes (CYP24A1, CYP27B1, CYP27A1 and CYP2R1) did not result in any associations with FDR<0.05 (56 tests). In this large genome wide assessment of the potential influence of maternal vitamin D status on DNA methylation, we did not find any convincing associations in 1416 newborns. If true associations do exist, their identification might require much larger consortium studies, expanded genomic coverage, investigation of alternative cell types or measurements of 25-hydroxyvitamin D at different gestational time points. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Unusual Characteristics of the DNA Binding Domain of Epigenetic Regulatory Protein MeCP2 Determine Its Binding Specificity

PubMed Central

2015-01-01

The protein MeCP2 mediates epigenetic regulation by binding methyl-CpG (mCpG) sites on chromatin. MeCP2 consists of six domains of which one, the methyl binding domain (MBD), binds mCpG sites in duplex DNA. We show that solution conditions with physiological or greater salt concentrations or the presence of nonspecific competitor DNA is necessary for the MBD to discriminate mCpG from CpG with high specificity. The specificity for mCpG over CpG is >100-fold under these solution conditions. In contrast, the MBD does not discriminate hydroxymethyl-CpG from CpG. The MBD is unusual among site-specific DNA binding proteins in that (i) specificity is not conferred by the enhanced affinity for the specific site but rather by suppression of its affinity for generic DNA, (ii) its specific binding to mCpG is highly electrostatic, and (iii) it takes up as well as displaces monovalent cations upon DNA binding. The MBD displays an unusually high affinity for single-stranded DNA independent of modification or sequence. In addition, the MBD forms a discrete dimer on DNA via a noncooperative binding pathway. Because the affinity of the second monomer is 1 order of magnitude greater than that of nonspecific binding, the MBD dimer is a unique molecular complex. The significance of these results in the context of neuronal function and development and MeCP2-related developmental disorders such as Rett syndrome is discussed. PMID:24828757

A DNA methylation fingerprint of 1628 human samples

PubMed Central

Fernandez, Agustin F.; Assenov, Yassen; Martin-Subero, Jose Ignacio; Balint, Balazs; Siebert, Reiner; Taniguchi, Hiroaki; Yamamoto, Hiroyuki; Hidalgo, Manuel; Tan, Aik-Choon; Galm, Oliver; Ferrer, Isidre; Sanchez-Cespedes, Montse; Villanueva, Alberto; Carmona, Javier; Sanchez-Mut, Jose V.; Berdasco, Maria; Moreno, Victor; Capella, Gabriel; Monk, David; Ballestar, Esteban; Ropero, Santiago; Martinez, Ramon; Sanchez-Carbayo, Marta; Prosper, Felipe; Agirre, Xabier; Fraga, Mario F.; Graña, Osvaldo; Perez-Jurado, Luis; Mora, Jaume; Puig, Susana; Prat, Jaime; Badimon, Lina; Puca, Annibale A.; Meltzer, Stephen J.; Lengauer, Thomas; Bridgewater, John; Bock, Christoph; Esteller, Manel

2012-01-01

Most of the studies characterizing DNA methylation patterns have been restricted to particular genomic loci in a limited number of human samples and pathological conditions. Herein, we present a compromise between an extremely comprehensive study of a human sample population with an intermediate level of resolution of CpGs at the genomic level. We obtained a DNA methylation fingerprint of 1628 human samples in which we interrogated 1505 CpG sites. The DNA methylation patterns revealed show this epigenetic mark to be critical in tissue-type definition and stemness, particularly around transcription start sites that are not within a CpG island. For disease, the generated DNA methylation fingerprints show that, during tumorigenesis, human cancer cells underwent a progressive gain of promoter CpG-island hypermethylation and a loss of CpG methylation in non-CpG-island promoters. Although transformed cells are those in which DNA methylation disruption is more obvious, we observed that other common human diseases, such as neurological and autoimmune disorders, had their own distinct DNA methylation profiles. Most importantly, we provide proof of principle that the DNA methylation fingerprints obtained might be useful for translational purposes by showing that we are able to identify the tumor type origin of cancers of unknown primary origin (CUPs). Thus, the DNA methylation patterns identified across the largest spectrum of samples, tissues, and diseases reported to date constitute a baseline for developing higher-resolution DNA methylation maps and provide important clues concerning the contribution of CpG methylation to tissue identity and its changes in the most prevalent human diseases. PMID:21613409

Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

PubMed

DeVry, C G; Tsai, W; Clarke, S

1996-11-15

The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

Genome-Wide Locations of Potential Epimutations Associated with Environmentally Induced Epigenetic Transgenerational Inheritance of Disease Using a Sequential Machine Learning Prediction Approach.

PubMed

Haque, M Muksitul; Holder, Lawrence B; Skinner, Michael K

2015-01-01

Environmentally induced epigenetic transgenerational inheritance of disease and phenotypic variation involves germline transmitted epimutations. The primary epimutations identified involve altered differential DNA methylation regions (DMRs). Different environmental toxicants have been shown to promote exposure (i.e., toxicant) specific signatures of germline epimutations. Analysis of genomic features associated with these epimutations identified low-density CpG regions (<3 CpG / 100bp) termed CpG deserts and a number of unique DNA sequence motifs. The rat genome was annotated for these and additional relevant features. The objective of the current study was to use a machine learning computational approach to predict all potential epimutations in the genome. A number of previously identified sperm epimutations were used as training sets. A novel machine learning approach using a sequential combination of Active Learning and Imbalance Class Learner analysis was developed. The transgenerational sperm epimutation analysis identified approximately 50K individual sites with a 1 kb mean size and 3,233 regions that had a minimum of three adjacent sites with a mean size of 3.5 kb. A select number of the most relevant genomic features were identified with the low density CpG deserts being a critical genomic feature of the features selected. A similar independent analysis with transgenerational somatic cell epimutation training sets identified a smaller number of 1,503 regions of genome-wide predicted sites and differences in genomic feature contributions. The predicted genome-wide germline (sperm) epimutations were found to be distinct from the predicted somatic cell epimutations. Validation of the genome-wide germline predicted sites used two recently identified transgenerational sperm epimutation signature sets from the pesticides dichlorodiphenyltrichloroethane (DDT) and methoxychlor (MXC) exposure lineage F3 generation. Analysis of this positive validation data set showed a 100% prediction accuracy for all the DDT-MXC sperm epimutations. Observations further elucidate the genomic features associated with transgenerational germline epimutations and identify a genome-wide set of potential epimutations that can be used to facilitate identification of epigenetic diagnostics for ancestral environmental exposures and disease susceptibility.

Combined study of genetic and epigenetic biomarker risperidone treatment efficacy in Chinese Han schizophrenia patients

PubMed Central

Shi, Y; Li, M; Song, C; Xu, Q; Huo, R; Shen, L; Xing, Q; Cui, D; Li, W; Zhao, J; He, L; Qin, S

2017-01-01

Nowadays, risperidone is an atypical antipsychotic drug that has been increasingly used for treatment and maintenance therapy in schizophrenia. However, partially affected by genetic or environmental factors, there is significant difference in treatment outcomes among patients. In this study, we aimed to interpret the difference between good and poor responders treated with risperidone in both genetic and epigenetic levels in 288 mainland Chinese patients. We recruited a Henan cohort including 98 patients as initial discovery group and then confirmed our results in Shanghai cohort. In genetic studies, we found 10 candidate single-nucleotide polymorphisms (SNPs) and 2 rare variants in Henan cohort by next-generation sequencing of 100 risperidone-response-related genes. After replication in Shanghai cohort by massarray platform, ultimately, rs6706232 and rs4818 were significantly associated with risperidone response in the two cohort meta-analysis (P=0.024 and 0.04, respectively). Besides, we also selected another reported 17 candidate SNPs associated with risperidone drug response to replicate in our mainland Chinese samples, while, we found no significant SNPs after Bonferroni correction. In epigenetic studies, we investigated the methylation status in promoters or gene-coding region of risperidone drug response-related genes including CYP3A4, CYP2D6, ABCB1, HTR2A, DRD2. Totally we found seven significant CpG sites in the meta-analysis with Bonferroni-corrected PCYP3A4_CpG_-36=0.0014, PCYP3A4_CpG_-258=0.0013, PCYP3A4_CpG_-296=0.0014, PCYP3A4_CpG_-367:-372:-374=0.028, PCYP2D6_CpG_193=0.012, PCYP2D6_CpG_242:244:250=0.00076 and PCYP2D6_CpG_284=0.034, respectively. As genetic and epigenetic factors may interactively affect drug response, we finally carried out a multivariant interaction analysis with multifactor dimensionality reduction and discovered a significant four-locus model (CYP3A4_CpG_-82:-86 +rs6280+rs1800497+rs6265, P=0.038) affecting drug response. These findings could partially explain different risperidone response outcome in Chinese population in a systematic level. PMID:28696411

Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters

PubMed Central

Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.

2014-01-01

While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842

Polycomb-like proteins link the PRC2 complex to CpG islands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Haojie; Liefke, Robert; Jiang, Junyi

The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

Adaptive walking of a quadrupedal robot based on layered biological reflexes

NASA Astrophysics Data System (ADS)

Zhang, Xiuli; Mingcheng, E.; Zeng, Xiangyu; Zheng, Haojun

2012-07-01

A multiple-legged robot is traditionally controlled by using its dynamic model. But the dynamic-model-based approach fails to acquire satisfactory performances when the robot faces rough terrains and unknown environments. Referring animals' neural control mechanisms, a control model is built for a quadruped robot walking adaptively. The basic rhythmic motion of the robot is controlled by a well-designed rhythmic motion controller(RMC) comprising a central pattern generator(CPG) for hip joints and a rhythmic coupler (RC) for knee joints. CPG and RC have relationships of motion-mapping and rhythmic couple. Multiple sensory-motor models, abstracted from the neural reflexes of a cat, are employed. These reflex models are organized and thus interact with the CPG in three layers, to meet different requirements of complexity and response time to the tasks. On the basis of the RMC and layered biological reflexes, a quadruped robot is constructed, which can clear obstacles and walk uphill and downhill autonomously, and make a turn voluntarily in uncertain environments, interacting with the environment in a way similar to that of an animal. The paper provides a biologically inspired architecture, with which a robot can walk adaptively in uncertain environments in a simple and effective way, and achieve better performances.

Induction of anti-glioma NK cell response following multiple low-dose intracerebral CpG therapy

PubMed Central

Alizadeh, Darya; Zhang, Leying; Brown, Christine E.; Farrukh, Omar; Jensen, Michael C.; Badie, Behnam

2010-01-01

Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG-ODN) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. These studies, however, have used high doses of CpG-ODN which can induce toxicity in a clinical setting. The goal of this study was to evaluate the anti-tumor efficacy of multiple low-dose intratumoral CpG- ODN in a glioma model. Experimental Design Mice bearing four-day old intracranial GL261 gliomas received a single or multiple (two or four) intratumoral injections of CpG-ODN (3 μg) every 4 days. Tumor growth was measured by bioluminescent imaging, brain histology, and animal survival. Flow cytometry and cytotoxicity assays were used to assess anti-glioma immune response. Results Two and four intracranial injections of low-dose CpG-ODN, but not a single injection, eradicated gliomas in 70% of mice. Moreover, surviving animals exhibited durable tumor free remission (> 3 months), and were protected from intracranial rechallenge with GL21 gliomas, demonstrating the capacity for long-term anti-tumor immunity. Although most inflammatory cells appeared to increase, activated NK cells (i.e. NK+CD107a+) were more frequent than CD8+CD107a+ in the brains of rechallenged CpG-ODN-treated animals and demonstrated a stronger in vitro cytotoxicity against GL261 target cells. Leukocyte depletion studies confirmed that NK cells played an important role in the initial CpG-ODN anti-tumor response, but both CD8 and NK cells were equally important in long-term immunity against gliomas. Conclusions These findings suggest that multiple low-dose intratumoral injections of CpG-ODN can eradicate intracranial gliomas possibly through mechanisms involving NK mediated effector function. PMID:20570924

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

PubMed Central

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

2017-01-01

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

PubMed

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

2008-10-09

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

Non-linear patterns in age-related DNA methylation may reflect CD4+ T cell differentiation

PubMed Central

Johnson, Nicholas D.; Wiener, Howard W.; Smith, Alicia K.; Nishitani, Shota; Absher, Devin M.; Arnett, Donna K.; Aslibekyan, Stella; Conneely, Karen N.

2017-01-01

ABSTRACT DNA methylation (DNAm) is an important epigenetic process involved in the regulation of gene expression. While many studies have identified thousands of loci associated with age, few have differentiated between linear and non-linear DNAm trends with age. Non-linear trends could indicate early- or late-life gene regulatory processes. Using data from the Illumina 450K array on 336 human peripheral blood samples, we identified 21 CpG sites that associated with age (P<1.03E-7) and exhibited changing rates of DNAm change with age (P<1.94E-6). For 2 of these CpG sites (cg07955995 and cg22285878), DNAm increased with age at an increasing rate, indicating that differential DNAm was greatest among elderly individuals. We observed significant replication for both CpG sites (P<5.0E-8) in a second set of peripheral blood samples. In 8 of 9 additional data sets comprising samples of monocytes, T cell subtypes, and brain tissue, we observed a pattern directionally consistent with DNAm increasing with age at an increasing rate, which was nominally significant in the 3 largest data sets (4.3E-15

Comprehensive analysis of genome-wide DNA methylation across human polycystic ovary syndrome ovary granulosa cell.

PubMed

Xu, Jiawei; Bao, Xiao; Peng, Zhaofeng; Wang, Linlin; Du, Linqing; Niu, Wenbin; Sun, Yingpu

2016-05-10

Polycystic ovary syndrome (PCOS) affects approximately 7% of the reproductive-age women. A growing body of evidence indicated that epigenetic mechanisms contributed to the development of PCOS. The role of DNA modification in human PCOS ovary granulosa cell is still unknown in PCOS progression. Global DNA methylation and hydroxymethylation were detected between PCOS' and controls' granulosa cell. Genome-wide DNA methylation was profiled to investigate the putative function of DNA methylaiton. Selected genes expressions were analyzed between PCOS' and controls' granulosa cell. Our results showed that the granulosa cell global DNA methylation of PCOS patients was significant higher than the controls'. The global DNA hydroxymethylation showed low level and no statistical difference between PCOS and control. 6936 differentially methylated CpG sites were identified between control and PCOS-obesity. 12245 differential methylated CpG sites were detected between control and PCOS-nonobesity group. 5202 methylated CpG sites were significantly differential between PCOS-obesity and PCOS-nonobesity group. Our results showed that DNA methylation not hydroxymethylation altered genome-wide in PCOS granulosa cell. The different methylation genes were enriched in development protein, transcription factor activity, alternative splicing, sequence-specific DNA binding and embryonic morphogenesis. YWHAQ, NCF2, DHRS9 and SCNA were up-regulation in PCOS-obesity patients with no significance different between control and PCOS-nonobesity patients, which may be activated by lower DNA methylaiton. Global and genome-wide DNA methylation alteration may contribute to different genes expression and PCOS clinical pathology.

Variation in the molecular clock of primates.

PubMed

Moorjani, Priya; Amorim, Carlos Eduardo G; Arndt, Peter F; Przeworski, Molly

2016-09-20

Events in primate evolution are often dated by assuming a constant rate of substitution per unit time, but the validity of this assumption remains unclear. Among mammals, it is well known that there exists substantial variation in yearly substitution rates. Such variation is to be expected from differences in life history traits, suggesting it should also be found among primates. Motivated by these considerations, we analyze whole genomes from 10 primate species, including Old World Monkeys (OWMs), New World Monkeys (NWMs), and apes, focusing on putatively neutral autosomal sites and controlling for possible effects of biased gene conversion and methylation at CpG sites. We find that substitution rates are up to 64% higher in lineages leading from the hominoid-NWM ancestor to NWMs than to apes. Within apes, rates are ∼2% higher in chimpanzees and ∼7% higher in the gorilla than in humans. Substitution types subject to biased gene conversion show no more variation among species than those not subject to it. Not all mutation types behave similarly, however; in particular, transitions at CpG sites exhibit a more clocklike behavior than do other types, presumably because of their nonreplicative origin. Thus, not only the total rate, but also the mutational spectrum, varies among primates. This finding suggests that events in primate evolution are most reliably dated using CpG transitions. Taking this approach, we estimate the human and chimpanzee divergence time is 12.1 million years,​ and the human and gorilla divergence time is 15.1 million years​.

Factors affecting the persistence of drug-induced reprogramming of the cancer methylome

PubMed Central

Bell, Joshua S. K.; Kagey, Jacob D.; Barwick, Benjamin G.; Dwivedi, Bhakti; McCabe, Michael T.; Kowalski, Jeanne; Vertino, Paula M.

2016-01-01

ABSTRACT Aberrant DNA methylation is a critical feature of cancer. Epigenetic therapy seeks to reverse these changes to restore normal gene expression. DNA demethylating agents, including 5-aza-2′-deoxycytidine (DAC), are currently used to treat certain leukemias, and can sensitize solid tumors to chemotherapy and immunotherapy. However, it has been difficult to pin the clinical efficacy of these agents to specific demethylation events, and the factors that contribute to the durability of response remain largely unknown. Here we examined the genome-wide kinetics of DAC-induced DNA demethylation and subsequent remethylation after drug withdrawal in breast cancer cells. We find that CpGs differ in both their susceptibility to demethylation and propensity for remethylation after drug removal. DAC-induced demethylation was most apparent at CpGs with higher initial methylation levels and further from CpG islands. Once demethylated, such sites exhibited varied remethylation potentials. The most rapidly remethylating CpGs regained >75% of their starting methylation within a month of drug withdrawal. These sites had higher pretreatment methylation levels, were enriched in gene bodies, marked by H3K36me3, and tended to be methylated in normal breast cells. In contrast, a more resistant class of CpG sites failed to regain even 20% of their initial methylation after 3 months. These sites had lower pretreatment methylation levels, were within or near CpG islands, marked by H3K79me2 or H3K4me2/3, and were overrepresented in sites that become aberrantly hypermethylated in breast cancers. Thus, whereas DAC-induced demethylation affects both endogenous and aberrantly methylated sites, tumor-specific hypermethylation is more slowly regained, even as normal methylation promptly recovers. Taken together, these data suggest that the durability of DAC response is linked to its selective ability to stably reset at least a portion of the cancer methylome. PMID:27082926

The Impact of Social Media on Dissemination and Implementation of Clinical Practice Guidelines: A Longitudinal Observational Study.

PubMed

Narayanaswami, Pushpa; Gronseth, Gary; Dubinsky, Richard; Penfold-Murray, Rebecca; Cox, Julie; Bever, Christopher; Martins, Yolanda; Rheaume, Carol; Shouse, Denise; Getchius, Thomas S D

2015-08-13

Evidence-based clinical practice guidelines (CPGs) are statements that provide recommendations to optimize patient care for a specific clinical problem or question. Merely reading a guideline rarely leads to implementation of recommendations. The American Academy of Neurology (AAN) has a formal process of guideline development and dissemination. The last few years have seen a burgeoning of social media such as Facebook, Twitter, and LinkedIn, and newer methods of dissemination such as podcasts and webinars. The role of these media in guideline dissemination has not been studied. Systematic evaluation of dissemination methods and comparison of the effectiveness of newer methods with traditional methods is not available. It is also not known whether specific dissemination methods may be more effectively targeted to specific audiences. Our aim was to (1) develop an innovative dissemination strategy by adding social media-based dissemination methods to traditional methods for the AAN clinical practice guidelines "Complementary and alternative medicine in multiple sclerosis" ("CAM in MS") and (2) evaluate whether the addition of social media outreach improves awareness of the CPG and knowledge of CPG recommendations, and affects implementation of those recommendations. Outcomes were measured by four surveys in each of the two target populations: patients and physicians/clinicians ("physicians"). The primary outcome was the difference in participants' intent to discuss use of complementary and alternative medicine (CAM) with their physicians or patients, respectively, after novel dissemination, as compared with that after traditional dissemination. Secondary outcomes were changes in awareness of the CPG, knowledge of CPG content, and behavior regarding CAM use in multiple sclerosis (MS). Response rates were 25.08% (622/2480) for physicians and 43.5% (348/800) for patients. Awareness of the CPG increased after traditional dissemination (absolute difference, 95% confidence interval: physicians 36%, 95% CI 25-46, and patients 10%, 95% CI 1-11) but did not increase further after novel dissemination (physicians 0%, 95% CI -11 to 11, and patients -4%, 95% CI -6 to 14). Intent to discuss CAM also increased after traditional dissemination but did not change after novel dissemination (traditional: physicians 12%, 95% CI 2-22, and patients 19%, 95% CI 3-33; novel: physicians 11%, 95% CI -1 to -21, and patients -8%, 95% CI -22 to 8). Knowledge of CPG recommendations and behavior regarding CAM use in MS did not change after either traditional dissemination or novel dissemination. Social media-based dissemination methods did not confer additional benefit over print-, email-, and Internet-based methods in increasing CPG awareness and changing intent in physicians or patients. Research on audience selection, message formatting, and message delivery is required to utilize Web 2.0 technologies optimally for dissemination.

The Impact of Social Media on Dissemination and Implementation of Clinical Practice Guidelines: A Longitudinal Observational Study

PubMed Central

Gronseth, Gary; Dubinsky, Richard; Penfold-Murray, Rebecca; Cox, Julie; Bever Jr, Christopher; Martins, Yolanda; Rheaume, Carol; Shouse, Denise; Getchius, Thomas SD

2015-01-01

Background Evidence-based clinical practice guidelines (CPGs) are statements that provide recommendations to optimize patient care for a specific clinical problem or question. Merely reading a guideline rarely leads to implementation of recommendations. The American Academy of Neurology (AAN) has a formal process of guideline development and dissemination. The last few years have seen a burgeoning of social media such as Facebook, Twitter, and LinkedIn, and newer methods of dissemination such as podcasts and webinars. The role of these media in guideline dissemination has not been studied. Systematic evaluation of dissemination methods and comparison of the effectiveness of newer methods with traditional methods is not available. It is also not known whether specific dissemination methods may be more effectively targeted to specific audiences. Objective Our aim was to (1) develop an innovative dissemination strategy by adding social media-based dissemination methods to traditional methods for the AAN clinical practice guidelines “Complementary and alternative medicine in multiple sclerosis” (“CAM in MS”) and (2) evaluate whether the addition of social media outreach improves awareness of the CPG and knowledge of CPG recommendations, and affects implementation of those recommendations. Methods Outcomes were measured by four surveys in each of the two target populations: patients and physicians/clinicians (“physicians”). The primary outcome was the difference in participants’ intent to discuss use of complementary and alternative medicine (CAM) with their physicians or patients, respectively, after novel dissemination, as compared with that after traditional dissemination. Secondary outcomes were changes in awareness of the CPG, knowledge of CPG content, and behavior regarding CAM use in multiple sclerosis (MS). Results Response rates were 25.08% (622/2480) for physicians and 43.5% (348/800) for patients. Awareness of the CPG increased after traditional dissemination (absolute difference, 95% confidence interval: physicians 36%, 95% CI 25-46, and patients 10%, 95% CI 1-11) but did not increase further after novel dissemination (physicians 0%, 95% CI -11 to 11, and patients -4%, 95% CI -6 to 14). Intent to discuss CAM also increased after traditional dissemination but did not change after novel dissemination (traditional: physicians 12%, 95% CI 2-22, and patients 19%, 95% CI 3-33; novel: physicians 11%, 95% CI -1 to -21, and patients -8%, 95% CI -22 to 8). Knowledge of CPG recommendations and behavior regarding CAM use in MS did not change after either traditional dissemination or novel dissemination. Conclusions Social media-based dissemination methods did not confer additional benefit over print-, email-, and Internet-based methods in increasing CPG awareness and changing intent in physicians or patients. Research on audience selection, message formatting, and message delivery is required to utilize Web 2.0 technologies optimally for dissemination. PMID:26272267

Characterization and expression of cyp19a gene in the Chinese giant salamander Andrias davidianus.

PubMed

Hu, Qiaomu; Xiao, Hanbing; Tian, HaiFeng; Meng, Yan

2016-02-01

We cloned the full length cyp19a of Chinese giant salamander Andrias davidianus, determined its distribution in tissues and developing gonads, and analyzed the CpG methylation pattern of the cyp19a promoter. The results revealed isoforms of 1706 bp (G arom) and 1698 bp (B arom) in length, differing in the 5' flanking region, both encoding 502 amino acids. The G arom gene was observed mainly in the ovary and kidney, with little in other investigated tissues, while B arom expression was high in the brain, ovary, testis, and pituitary, with low or undetected expression in other examined tissues. Total aromatase expression was high in the ovary; moderate in the kidney, brain, testis, and pituitary; and low in the remaining tissues. G arom expression was significantly higher in the ovary than in the testis and gradually decreased with maturation of the salamander. A single injection of methyltestosterone or letrozole resulted in ovarian G arom expression decreasing over a 12-96 h period. A 1366 bp sequence of the cyp19a promoter was cloned and shown to be conserved in selected species. CpG methylation level was negatively correlated with cyp19a expression in the examined tissues and developing ovaries. Five and three CpG methylation sites positively correlated with DNA methylation levels in tissues and developing ovary, suggesting that they play an important role in regulating cyp19a expression. The aromatase gene showed two isoforms with distinct expression patterns, and the promoter methylation level at specific CpG sites was associated with variation in expression profiles of tissues and developing ovaries. Copyright © 2015 Elsevier Inc. All rights reserved.

SU94. Allele-Specific and Trauma-Related Epigenetic Changes in the FKBP5 Gene: Differences Between Psychotic Patients and Healthy Controls

PubMed Central

Mihaljevic, Marina; Franic, Dusica; Soldatovic, Ivan; Andric, Sanja; Mirjanic, Tijana; Novakovic, Ivana; Adzic, Miroslav; Maric, Nadja

2017-01-01

Abstract Background: Hypothalamic-pituitary-adrenal (HPA) axis dysregulation is a proposed etiological mechanism of psychosis. Recent studies highlighted impact of the FKBP5 gene and its functional variant rs1360780, which risk (T) allele affects the activity of HPA axis following stress exposure, on psychotic patients exposed to early trauma (1). Additionally, risk allele and trauma dependent FKBP5 demethylation in intron 7 was observed in traumatized individuals (2). Thus, the purpose of this pilot study was to investigate influence of the risk allele and trauma on FKBP5 DNA methylation levels at intron 7 in psychotic patients and to compare it with healthy individuals. Methods: The sample consisted of 24 psychosis spectrum patients and 24 controls matched by age and gender. All participants were genotyped for rs1360780 and divided into 2 groups depending on the presence of the risk allele (risk and nonrisk group). DNA methylation levels at 3 CpG sites (CpG1, CpG2, and CpG3) in intron 7 were analyzed by Sanger sequencing. Early-life adversities were measured by Childhood Trauma Questionnaire. Pearson correlation and t test were performed as appropriate. Results: Analyses revealed decreased FKBP5 methylation at targeted CpG sites and averaged methylation level (AML) at intron 7 in patients compared to controls (P = .026, P = .017, P = .027, and P = .003, respectively). Decreased AML and methylation at CpG3 were observed comparing risk and nonrisk patients’ groups (P = .018 and P = .016, respectively). Additionally, decreased methylation was found in risk patients’ group compared to risk controls’ group. No differences were found comparing nonrisk groups. Furthermore, strong negative associations between trauma and methylation at CpG3 and AML were observed only in risk controls’ group (r = −0.707, P = .007; r = −0.741, P = .004, respectively). Conclusion: Our preliminary results revealed allele-specific epigenetic changes of the FKBP5 gene in psychotic patients, which is in line with previous reports in traumatized individuals. Trauma-related demethylation in risk controls’ group supports the hypothesis that psychotic and stress-related conditions could share common neurobiological underlying mechanism, such as HPA axis dysregulation, particularly in individuals with genetic predisposition for altered stress response. References 1.Daskalakis NP, Binder EB. Schizophrenia in the spectrum of gene-stress interactions: the FKBP5 example. Schizophr Bull. 2015;41:323–329. 2.Klengel T, Mehta D, Anacker C et al. Allele-specific FKBP5 DNA demethylation mediates gene-childhood trauma interactions. Nat Neurosci. 2013;16:33–41.

Aging effects on DNA methylation modules in human brain and blood tissue

PubMed Central

2012-01-01

Background Several recent studies reported aging effects on DNA methylation levels of individual CpG dinucleotides. But it is not yet known whether aging-related consensus modules, in the form of clusters of correlated CpG markers, can be found that are present in multiple human tissues. Such a module could facilitate the understanding of aging effects on multiple tissues. Results We therefore employed weighted correlation network analysis of 2,442 Illumina DNA methylation arrays from brain and blood tissues, which enabled the identification of an age-related co-methylation module. Module preservation analysis confirmed that this module can also be found in diverse independent data sets. Biological evaluation showed that module membership is associated with Polycomb group target occupancy counts, CpG island status and autosomal chromosome location. Functional enrichment analysis revealed that the aging-related consensus module comprises genes that are involved in nervous system development, neuron differentiation and neurogenesis, and that it contains promoter CpGs of genes known to be down-regulated in early Alzheimer's disease. A comparison with a standard, non-module based meta-analysis revealed that selecting CpGs based on module membership leads to significantly increased gene ontology enrichment, thus demonstrating that studying aging effects via consensus network analysis enhances the biological insights gained. Conclusions Overall, our analysis revealed a robustly defined age-related co-methylation module that is present in multiple human tissues, including blood and brain. We conclude that blood is a promising surrogate for brain tissue when studying the effects of age on DNA methylation profiles. PMID:23034122

Computational Models and Emergent Properties of Respiratory Neural Networks

PubMed Central

Lindsey, Bruce G.; Rybak, Ilya A.; Smith, Jeffrey C.

2012-01-01

Computational models of the neural control system for breathing in mammals provide a theoretical and computational framework bringing together experimental data obtained from different animal preparations under various experimental conditions. Many of these models were developed in parallel and iteratively with experimental studies and provided predictions guiding new experiments. This data-driven modeling approach has advanced our understanding of respiratory network architecture and neural mechanisms underlying generation of the respiratory rhythm and pattern, including their functional reorganization under different physiological conditions. Models reviewed here vary in neurobiological details and computational complexity and span multiple spatiotemporal scales of respiratory control mechanisms. Recent models describe interacting populations of respiratory neurons spatially distributed within the Bötzinger and pre-Bötzinger complexes and rostral ventrolateral medulla that contain core circuits of the respiratory central pattern generator (CPG). Network interactions within these circuits along with intrinsic rhythmogenic properties of neurons form a hierarchy of multiple rhythm generation mechanisms. The functional expression of these mechanisms is controlled by input drives from other brainstem components, including the retrotrapezoid nucleus and pons, which regulate the dynamic behavior of the core circuitry. The emerging view is that the brainstem respiratory network has rhythmogenic capabilities at multiple levels of circuit organization. This allows flexible, state-dependent expression of different neural pattern-generation mechanisms under various physiological conditions, enabling a wide repertoire of respiratory behaviors. Some models consider control of the respiratory CPG by pulmonary feedback and network reconfiguration during defensive behaviors such as cough. Future directions in modeling of the respiratory CPG are considered. PMID:23687564

An epigenome-wide association analysis of cardiac autonomic responses among a population of welders.

PubMed

Zhang, Jinming; Liu, Zhonghua; Umukoro, Peter E; Cavallari, Jennifer M; Fang, Shona C; Weisskopf, Marc G; Lin, Xihong; Mittleman, Murray A; Christiani, David C

2017-02-01

DNA methylation is one of the potential epigenetic mechanisms associated with various adverse cardiovascular effects; however, its association with cardiac autonomic dysfunction, in particular, is unknown. In the current study, we aimed to identify epigenetic variants associated with alterations in cardiac autonomic responses. Cardiac autonomic responses were measured with two novel markers: acceleration capacity (AC) and deceleration capacity (DC). We examined DNA methylation levels at more than 472,506 CpG probes through the Illumina Infinium HumanMethylation450 BeadChip assay. We conducted separate linear mixed models to examine associations of DNA methylation levels at each CpG with AC and DC. One CpG (cg26829071) located in the GPR133 gene was negatively associated with DC values after multiple testing corrections through false discovery rate. Our study suggests the potential functional importance of methylation in cardiac autonomic responses. Findings from the current study need to be replicated in future studies in a larger population.

Transcriptional Regulation of Brain-Derived Neurotrophic Factor (BDNF) by Methyl CpG Binding Protein 2 (MeCP2): a Novel Mechanism for Re-Myelination and/or Myelin Repair Involved in the Treatment of Multiple Sclerosis (MS).

PubMed

KhorshidAhmad, Tina; Acosta, Crystal; Cortes, Claudia; Lakowski, Ted M; Gangadaran, Surendiran; Namaka, Michael

2016-03-01

Multiple sclerosis (MS) is a chronic progressive, neurological disease characterized by the targeted immune system-mediated destruction of central nervous system (CNS) myelin. Autoreactive CD4+ T helper cells have a key role in orchestrating MS-induced myelin damage. Once activated, circulating Th1-cells secrete a variety of inflammatory cytokines that foster the breakdown of blood-brain barrier (BBB) eventually infiltrating into the CNS. Inside the CNS, they become reactivated upon exposure to the myelin structural proteins and continue to produce inflammatory cytokines such as tumor necrosis factor α (TNFα) that leads to direct activation of antibodies and macrophages that are involved in the phagocytosis of myelin. Proliferating oligodendrocyte precursors (OPs) migrating to the lesion sites are capable of acute remyelination but unable to completely repair or restore the immune system-mediated myelin damage. This results in various permanent clinical neurological disabilities such as cognitive dysfunction, fatigue, bowel/bladder abnormalities, and neuropathic pain. At present, there is no cure for MS. Recent remyelination and/or myelin repair strategies have focused on the role of the neurotrophin brain-derived neurotrophic factor (BDNF) and its upstream transcriptional repressor methyl CpG binding protein (MeCP2). Research in the field of epigenetic therapeutics involving histone deacetylase (HDAC) inhibitors and lysine acetyl transferase (KAT) inhibitors is being explored to repress the detrimental effects of MeCP2. This review will address the role of MeCP2 and BDNF in remyelination and/or myelin repair and the potential of HDAC and KAT inhibitors as novel therapeutic interventions for MS.

Genome-wide methylation analysis in Silver-Russell syndrome patients

PubMed Central

Böhm, S; Frost, JM; Puszyk, W; Abu-Amero, S; Stanier, P; Schulz, R; Moore, GE; Oakey, RJ

2015-01-01

Silver-Russell Syndrome (SRS) is a clinically heterogeneous disorder characterised by severe in utero growth restriction and poor postnatal growth, body asymmetry, irregular craniofacial features and several additional minor malformations. The aetiology of SRS is complex and current evidence strongly implicates imprinted genes. Approximately half of all patients exhibit DNA hypomethylation at the H19/IGF2 imprinted domain, and around 10% have maternal uniparental disomy of chromosome 7. We measured DNA methylation in 18 SRS patients at >485,000 CpG sites using DNA methylation microarrays. Using a novel bioinformatics methodology specifically designed to identify subsets of patients with a shared epimutation, we analysed methylation changes genome-wide as well as at known imprinted regions to identify SRS-associated epimutations. Our analysis identifies epimutations at the previously characterised domains of H19/IGF2 and at imprinted regions on chromosome 7, providing proof of principle that our methodology can detect DNA methylation changes at imprinted loci. In addition we discovered two novel epimutations associated with SRS and located at imprinted loci previously linked to relevant mouse and human phenotypes. We identify RB1 as an additional imprinted locus associated with SRS, with a region near the RB1 DMR hypermethylated in 13/18 (~70 %) patients. We also report 6/18 (~33 %) patients were hypermethylated at a CpG island near the ANKRD11 gene. We do not observe consistent cooccurrence of epimutations at multiple imprinted loci in single SRS individuals. SRS is clinically heterogeneous and the absence of multiple imprinted loci epimutations reflects the heterogeneity at the molecular level. Further stratification of SRS patients by molecular phenotypes might aid the identification of disease causes. PMID:25563730

Chronic exposure to water pollutant trichloroethylene increased epigenetic drift in CD4(+) T cells.

PubMed

Gilbert, Kathleen M; Blossom, Sarah J; Erickson, Stephen W; Reisfeld, Brad; Zurlinden, Todd J; Broadfoot, Brannon; West, Kirk; Bai, Shasha; Cooney, Craig A

2016-05-01

Autoimmune disease and CD4(+) T-cell alterations are induced in mice exposed to the water pollutant trichloroethylene (TCE). We examined here whether TCE altered gene-specific DNA methylation in CD4(+) T cells as a possible mechanism of immunotoxicity. Naive and effector/memory CD4(+) T cells from mice exposed to TCE (0.5 mg/ml in drinking water) for 40 weeks were examined by bisulfite next-generation DNA sequencing. A probabilistic model calculated from multiple genes showed that TCE decreased methylation control in CD4(+) T cells. Data from individual genes fitted to a quadratic regression model showed that TCE increased gene-specific methylation variance in both CD4 subsets. TCE increased epigenetic drift of specific CpG sites in CD4(+) T cells.

Differential Genetic and Epigenetic Regulation of catechol-O-methyltransferase is Associated with Impaired Fear Inhibition in Posttraumatic Stress Disorder.

PubMed

Norrholm, Seth Davin; Jovanovic, Tanja; Smith, Alicia K; Binder, Elisabeth; Klengel, Torsten; Conneely, Karen; Mercer, Kristina B; Davis, Jennifer S; Kerley, Kimberly; Winkler, Jennifer; Gillespie, Charles F; Bradley, Bekh; Ressler, Kerry J

2013-01-01

The catechol-O-methyltransferase (COMT) enzyme is critical for the catabolic regulation of synaptic dopamine, resulting in altered cortical functioning. The COMT Val(158)Met polymorphism has been implicated in human mental illness, with Met/Met homozygotes associated with increased susceptibility to posttraumatic stress disorder (PTSD). Our primary objective was to examine the intermediate phenotype of fear inhibition in PTSD stratified by COMT genotype (Met/Met, Val/Met, and Val/Val) and differential gene regulation via methylation status at CpG sites in the COMT promoter region. More specifically, we examined the potential interaction of COMT genotype and PTSD diagnosis on fear-potentiated startle during fear conditioning and extinction and COMT DNA methylation levels (as determined using genomic DNA isolated from whole blood). Participants were recruited from medical and gynecological clinics of an urban hospital in Atlanta, GA, USA. We found that individuals with the Met/Met genotype demonstrated higher fear-potentiated startle to the CS- (safety signal) and during extinction of the CS+ (danger signal) compared to Val/Met and Val/Val genotypes. The PTSD+ Met/Met genotype group had the greatest impairment in fear inhibition to the CS- (p = 0.006), compared to Val carriers. In addition, the Met/Met genotype was associated with DNA methylation at four CpG sites, two of which were associated with impaired fear inhibition to the safety signal. These results suggest that multiple differential mechanisms for regulating COMT function - at the level of protein structure via the Val(158)Met genotype and at the level of gene regulation via differential methylation - are associated with impaired fear inhibition in PTSD.

MethLAB: a graphical user interface package for the analysis of array-based DNA methylation data.

PubMed

Kilaru, Varun; Barfield, Richard T; Schroeder, James W; Smith, Alicia K; Conneely, Karen N

2012-03-01

Recent evidence suggests that DNA methylation changes may underlie numerous complex traits and diseases. The advent of commercial, array-based methods to interrogate DNA methylation has led to a profusion of epigenetic studies in the literature. Array-based methods, such as the popular Illumina GoldenGate and Infinium platforms, estimate the proportion of DNA methylated at single-base resolution for thousands of CpG sites across the genome. These arrays generate enormous amounts of data, but few software resources exist for efficient and flexible analysis of these data. We developed a software package called MethLAB (http://genetics.emory.edu/conneely/MethLAB) using R, an open source statistical language that can be edited to suit the needs of the user. MethLAB features a graphical user interface (GUI) with a menu-driven format designed to efficiently read in and manipulate array-based methylation data in a user-friendly manner. MethLAB tests for association between methylation and relevant phenotypes by fitting a separate linear model for each CpG site. These models can incorporate both continuous and categorical phenotypes and covariates, as well as fixed or random batch or chip effects. MethLAB accounts for multiple testing by controlling the false discovery rate (FDR) at a user-specified level. Standard output includes a spreadsheet-ready text file and an array of publication-quality figures. Considering the growing interest in and availability of DNA methylation data, there is a great need for user-friendly open source analytical tools. With MethLAB, we present a timely resource that will allow users with no programming experience to implement flexible and powerful analyses of DNA methylation data.

DNA Methylation and BMI: Investigating Identified Methylation Sites at HIF3A in a Causal Framework

PubMed Central

Richmond, Rebecca C.; Ward, Mary E.; Fraser, Abigail; Lyttleton, Oliver; McArdle, Wendy L.; Ring, Susan M.; Gaunt, Tom R.; Lawlor, Debbie A.; Davey Smith, George; Relton, Caroline L.

2016-01-01

Multiple differentially methylated sites and regions associated with adiposity have now been identified in large-scale cross-sectional studies. We tested for replication of associations between previously identified CpG sites at HIF3A and adiposity in ∼1,000 mother-offspring pairs from the Avon Longitudinal Study of Parents and Children (ALSPAC). Availability of methylation and adiposity measures at multiple time points, as well as genetic data, allowed us to assess the temporal associations between adiposity and methylation and to make inferences regarding causality and directionality. Overall, our results were discordant with those expected if HIF3A methylation has a causal effect on BMI and provided more evidence for causality in the reverse direction (i.e., an effect of BMI on HIF3A methylation). These results are based on robust evidence from longitudinal analyses and were also partially supported by Mendelian randomization analysis, although this latter analysis was underpowered to detect a causal effect of BMI on HIF3A methylation. Our results also highlight an apparent long-lasting intergenerational influence of maternal BMI on offspring methylation at this locus, which may confound associations between own adiposity and HIF3A methylation. Further work is required to replicate and uncover the mechanisms underlying the direct and intergenerational effect of adiposity on DNA methylation. PMID:26861784

DNA methylome profiling identifies novel methylated genes in African American patients with colorectal neoplasia.

PubMed

Ashktorab, Hassan; Daremipouran, M; Goel, Ajay; Varma, Sudhir; Leavitt, R; Sun, Xueguang; Brim, Hassan

2014-04-01

The identification of genes that are differentially methylated in colorectal cancer (CRC) has potential value for both diagnostic and therapeutic interventions specifically in high-risk populations such as African Americans (AAs). However, DNA methylation patterns in CRC, especially in AAs, have not been systematically explored and remain poorly understood. Here, we performed DNA methylome profiling to identify the methylation status of CpG islands within candidate genes involved in critical pathways important in the initiation and development of CRC. We used reduced representation bisulfite sequencing (RRBS) in colorectal cancer and adenoma tissues that were compared with DNA methylome from a healthy AA subject's colon tissue and peripheral blood DNA. The identified methylation markers were validated in fresh frozen CRC tissues and corresponding normal tissues from AA patients diagnosed with CRC at Howard University Hospital. We identified and validated the methylation status of 355 CpG sites located within 16 gene promoter regions associated with CpG islands. Fifty CpG sites located within CpG islands-in genes ATXN7L1 (2), BMP3 (7), EID3 (15), GAS7 (1), GPR75 (24), and TNFAIP2 (1)-were significantly hypermethylated in tumor vs. normal tissues (P<0.05). The methylation status of BMP3, EID3, GAS7, and GPR75 was confirmed in an independent, validation cohort. Ingenuity pathway analysis mapped three of these markers (GAS7, BMP3 and GPR) in the insulin and TGF-β1 network-the two key pathways in CRC. In addition to hypermethylated genes, our analysis also revealed that LINE-1 repeat elements were progressively hypomethylated in the normal-adenoma-cancer sequence. We conclude that DNA methylome profiling based on RRBS is an effective method for screening aberrantly methylated genes in CRC. While previous studies focused on the limited identification of hypermethylated genes, ours is the first study to systematically and comprehensively identify novel hypermethylated genes, as well as hypomethylated LINE-1 sequences, which may serve as potential biomarkers for CRC in African Americans. Our discovered biomarkers were intimately linked to the insulin/TGF-B1 pathway, further strengthening the association of diabetic disorders with colon oncogenic transformation.

CpG island methylator phenotype (CIMP) in cancer: causes and implications.

PubMed

Teodoridis, Jens M; Hardie, Catriona; Brown, Robert

2008-09-18

Strong evidence exists for a subgroup of tumours, from a variety of tissue types, exhibiting concordant tumour specific DNA methylation: the "CpG island methylator phenotype" (CIMP). Occurrence of CIMP is associated with a range of genetic and environmental factors, although the molecular causes are not well-understood. Both increased expression and aberrant targeting of DNA methyltransferases (DNMTs) could contribute to the occurrence of CIMP. One under-explored area is the possibility that DNA damage may induce or select for CIMP during carcinogenesis or treatment of tumours with chemotherapy. DNA damaging agents can induce DNA damage at guanine rich regions throughout the genome, including CpG islands. This DNA damage can result in stalled DNA synthesis, which will lead to localised increased DNMT1 concentration and therefore potentially increased DNA methylation at these sites. Chemotherapy can select for cells which have increased tolerance to DNA damage due to increased lesion bypass, in some cases by mechanisms which involve inactivation of genes by CpG island methylation. CIMP has been associated with worse patient prognosis, probably due to increased epigenetic plasticity. Therefore, further clinical testing of the diagnostic and prognostic value of the current CIMP markers, as well as increasing our understanding of the molecular causes underlying CIMP are required.

Neurobehavior related to epigenetic differences in preterm infants

PubMed Central

Lester, Barry M; Marsit, Carmen J; Giarraputo, James; Hawes, Katheleen; LaGasse, Linda L; Padbury, James F

2015-01-01

Preterm birth is associated with medical problems affecting the neuroendocrine system, altering cortisol levels resulting in negative effects on newborn neurobehavior. Newborn neurobehavior is regulated by DNA methylation of NR3C1 and HSD11B2. Aim: Determine if methylation of HSD11B2 and NR3C1 is associated with neurobehavioral profiles in preterm infants. Patients & methods: Neurobehavior was measured before discharge from the hospital in 67 preterm infants. Cheek swabs were collected for DNA extraction. Results: Infants with the high-risk neurobehavioral profile showed more methylation than infants with the low-risk neurobehavioral profile at CpG3 for NR3C1 and less methylation of CpG3 for HSD11B2. Infants with these profiles were more likely to have increased methylation of NR3C1 and decreased methylation of HSD11B2 at these CpG sites. Conclusion: Preterm birth is associated with epigenetic differences in genes that regulate cortisol levels related to high-risk neurobehavioral profiles. PMID:26585459

Profiling the genome-wide DNA methylation pattern of porcine ovaries using reduced representation bisulfite sequencing.

PubMed

Yuan, Xiao-Long; Gao, Ning; Xing, Yan; Zhang, Hai-Bin; Zhang, Ai-Ling; Liu, Jing; He, Jin-Long; Xu, Yuan; Lin, Wen-Mian; Chen, Zan-Mou; Zhang, Hao; Zhang, Zhe; Li, Jia-Qi

2016-02-25

Substantial evidence has shown that DNA methylation regulates the initiation of ovarian and sexual maturation. Here, we investigated the genome-wide profile of DNA methylation in porcine ovaries at single-base resolution using reduced representation bisulfite sequencing. The biological variation was minimal among the three ovarian replicates. We found hypermethylation frequently occurred in regions with low gene abundance, while hypomethylation in regions with high gene abundance. The DNA methylation around transcriptional start sites was negatively correlated with their own CpG content. Additionally, the methylation level in the bodies of genes was higher than that in their 5' and 3' flanking regions. The DNA methylation pattern of the low CpG content promoter genes differed obviously from that of the high CpG content promoter genes. The DNA methylation level of the porcine ovary was higher than that of the porcine intestine. Analyses of the genome-wide DNA methylation in porcine ovaries would advance the knowledge and understanding of the porcine ovarian methylome.

Detecting cooperative sequences in the binding of RNA Polymerase-II

NASA Astrophysics Data System (ADS)

Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

2008-03-01

Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

Formulation of vaccines containing CpG oligonucleotides and alum

PubMed Central

Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

2007-01-01

CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

Prenatal arsenic exposure and the epigenome: identifying sites of 5-methylcytosine alterations that predict functional changes in gene expression in newborn cord blood and subsequent birth outcomes.

PubMed

Rojas, Daniel; Rager, Julia E; Smeester, Lisa; Bailey, Kathryn A; Drobná, Zuzana; Rubio-Andrade, Marisela; Stýblo, Miroslav; García-Vargas, Gonzalo; Fry, Rebecca C

2015-01-01

Prenatal exposure to inorganic arsenic (iAs) is detrimental to the health of newborns and increases the risk of disease development later in life. Here we examined a subset of newborn cord blood leukocyte samples collected from subjects enrolled in the Biomarkers of Exposure to ARsenic (BEAR) pregnancy cohort in Gómez Palacio, Mexico, who were exposed to a range of drinking water arsenic concentrations (0.456-236 µg/l). Changes in iAs-associated DNA 5-methylcytosine methylation were assessed across 424,935 CpG sites representing 18,761 genes and compared with corresponding mRNA expression levels and birth outcomes. In the context of arsenic exposure, a total of 2919 genes were identified with iAs-associated differences in DNA methylation. Site-specific analyses identified DNA methylation changes that were most predictive of gene expression levels where CpG methylation within CpG islands positioned within the first exon, the 5' untranslated region and 200 bp upstream of the transcription start site yielded the most significant association with gene expression levels. A set of 16 genes was identified with correlated iAs-associated changes in DNA methylation and mRNA expression and all were highly enriched for binding sites of the early growth response (EGR) and CCCTC-binding factor (CTCF) transcription factors. Furthermore, DNA methylation levels of 7 of these genes were associated with differences in birth outcomes including gestational age and head circumference.These data highlight the complex interplay between DNA methylation, functional changes in gene expression and health outcomes and underscore the need for functional analyses coupled to epigenetic assessments. © The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

TRAF3 Epigenetic Regulation Is Associated With Vascular Recurrence in Patients With Ischemic Stroke.

PubMed

Gallego-Fabrega, Cristina; Carrera, Caty; Reny, Jean-Luc; Fontana, Pierre; Slowik, Agnieszka; Pera, Joanna; Pezzini, Alessandro; Serrano-Heras, Gemma; Segura, Tomás; Martí-Fàbregas, Joan; Muiño, Elena; Cullell, Natalia; Montaner, Joan; Krupinski, Jerzy; Fernandez-Cadenas, Israel

2016-05-01

Clopidogrel is one of the most used antiplatelet drugs in patients with cardiovascular disease. However, 16% to 50% of patients have a high on-clopidogrel platelet reactivity and an increased risk of ischemic events. The pathogenesis of high on-treatment platelet reactivity in patients with stroke is only partially explained by genetic variations. This study aims to find differentially methylated sites across the genome associated with vascular recurrence in ischemic stroke patients treated with clopidogrel. From a cohort of 1900 patients with ischemic stroke, we selected 42 patients treated with clopidogrel, including 21 with a recurrent vascular event and 21 without vascular recurrence during the first year of follow-up. Over 480 000 DNA methylation sites were analyzed across the genome. Differentially methylated CpG sites were identified by nonparametric testing using R. Replication analysis was performed in a new cohort of 191 subjects and results were correlated with platelet reactivity in a subset of 90 subjects using light transmission aggregometry. A total of 73 differentially methylated CpG sites (P<1×10(-05)) were identified; 3 of them were selected for further replication: cg03548645 (P=1.42×10(-05), TRAF3), cg09533145 (P=7.81×10(-06), ADAMTS2), and cg15107336 (P=1.89×10(-05), XRCC1). The cg03548645 CpG remained significant in the replication study (P=0.034), a deep analysis of this region revealed another methylation site associated with vascular recurrence, P=0.037. Lower cg03548645 (TRAF3) DNA methylation levels were correlated with an increased platelet aggregation (ρ=-0.29, P=0.0075). This study suggests for the first time that epigenetics may significantly contribute to the variability of clopidogrel response and recurrence of ischemic events in patients with stroke. © 2016 American Heart Association, Inc.

Base Excision Repair of Tandem Modifications in a Methylated CpG Dinucleotide*

PubMed Central

Sassa, Akira; Çağlayan, Melike; Dyrkheeva, Nadezhda S.; Beard, William A.; Wilson, Samuel H.

2014-01-01

Cytosine methylation and demethylation in tracks of CpG dinucleotides is an epigenetic mechanism for control of gene expression. The initial step in the demethylation process can be deamination of 5-methylcytosine producing the TpG alteration and T:G mispair, and this step is followed by thymine DNA glycosylase (TDG) initiated base excision repair (BER). A further consideration is that guanine in the CpG dinucleotide may become oxidized to 7,8-dihydro-8-oxoguanine (8-oxoG), and this could affect the demethylation process involving TDG-initiated BER. However, little is known about the enzymology of BER of altered in-tandem CpG dinucleotides; e.g. Tp8-oxoG. Here, we investigated interactions between this altered dinucleotide and purified BER enzymes, the DNA glycosylases TDG and 8-oxoG DNA glycosylase 1 (OGG1), apurinic/apyrimidinic (AP) endonuclease 1, DNA polymerase β, and DNA ligases. The overall TDG-initiated BER of the Tp8-oxoG dinucleotide is significantly reduced. Specifically, TDG and DNA ligase activities are reduced by a 3′-flanking 8-oxoG. In contrast, the OGG1-initiated BER pathway is blocked due to the 5′-flanking T:G mispair; this reduces OGG1, AP endonuclease 1, and DNA polymerase β activities. Furthermore, in TDG-initiated BER, TDG remains bound to its product AP site blocking OGG1 access to the adjacent 8-oxoG. These results reveal BER enzyme specificities enabling suppression of OGG1-initiated BER and coordination of TDG-initiated BER at this tandem alteration in the CpG dinucleotide. PMID:24695738

Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism

PubMed Central

Maguire, S. M.; Phelps, S. M.

2017-01-01

DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564

Intensive hypermethylation of the CpG island of Ras association domain family 1A in hepatitis B virus-associated hepatocellular carcinomas.

PubMed

Zhong, Sheng; Yeo, Winnie; Tang, Mandy W; Wong, Nathalie; Lai, Paul B S; Johnson, Phillip J

2003-08-15

The human Ras association domain family 1A gene (RASSF1A) is a newly isolated tumor suppressor gene. In this study, we analyzed the methylation status of the promoter region of RASSF1A using bisulfite sequencing and PCR-RFLP in four liver cancer cell lines (Hep3B, HepG(2), SK-HEP-1, and Huh-7) and a cohort of 43 hepatitis B virus-associated hepatocellular carcinoma (HCC) tissues and their corresponding nontumor tissue specimens. The methylation of the CpG islands in the RASSF1A promoter was not detected in 4 samples of normal liver tissue or 10 samples of peripheral blood mononuclear cells from normal subjects. However, the CpG islands were completely methylated, and transcription of the RASSF1A was silenced in the four cell lines. Treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine reactivated the expression of RASSF1A in the Hep3B and HepG2 cells. In 41 of 43 (95%) HCC specimens studied, the promoter region of RASSF1A was intensively methylated at its CpG sites. Although heterogeneous methylation was also detected in 16 of the 23 (70%) corresponding nontumorous tissues analyzed, the level of methylation was significantly lower than in the corresponding tumor tissues. HCC has the highest incidence of promoter methylation of RASSF1A among all malignancies yet reported suggesting that hypermethylation of the CpG island promoter of RASSF1A may play an important pathological role in this tumor.

Nightshift work and genome-wide DNA methylation.

PubMed

Bhatti, Parveen; Zhang, Yuzheng; Song, Xiaoling; Makar, Karen W; Sather, Cassandra L; Kelsey, Karl T; Houseman, E Andres; Wang, Pei

2015-02-01

The negative health effects of shift work, including carcinogenesis, may be mediated by changes in DNA methylation, particularly in the circadian genes. Using the Infinium HumanMethylation450 Bead Array (Illumina, San Diego, CA), we compared genome-wide methylation between 65 actively working dayshift workers and 59 actively working nightshift workers in the healthcare industry. A total of 473 800 loci, including 391 loci across the 12 core circadian genes, were analyzed to identify methylation markers associated with shift work status using linear regression models adjusted for gender, age, body mass index, race, smoking status and leukocyte cell profile as measured by flow cytometry. Analyses at the level of gene, CpG island and gene region were also conducted. To account for multiple comparisons, we controlled the false discovery rate (FDR ≤0.05). Significant differences between nightshift and dayshift workers were found at 16 135 of 473 800 loci, across 3769 of 20 164 genes, across 7173 of 22 721 CpG islands and across 5508 of 51 843 gene regions. For each significant loci, gene, CpG island or gene region, average methylation was consistently found to be decreased among nightshift workers compared to dayshift workers. Twenty-one loci located in the circadian genes were also found to be significantly hypomethylated among nightshift workers. The largest differences were observed for three loci located in the gene body of PER3. A total of nine significant loci were found in the CSNK1E gene, most of which were located in a CpG island and near the transcription start site of the gene. Methylation changes in these circadian genes may lead to altered expression of these genes which has been associated with cancer in previous studies. Gene ontology enrichment analysis revealed that among the significantly hypomethylated genes, processes related to host defense and immunity were represented. Our results indicate that the health effects of shift work may be mediated by hypomethylation of a wide variety of genes, including those related to circadian rhythms. While these findings need to be followed-up among a considerably expanded group of shift workers, the data generated by this study supports the need for future targeted research into the potential impacts of shift work on specific carcinogenic mechanisms.

Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

DTIC Science & Technology

2005-09-01

tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

Technical adequacy of bisulfite sequencing and pyrosequencing for detection of mitochondrial DNA methylation: Sources and avoidance of false-positive detection.

PubMed

Owa, Chie; Poulin, Matthew; Yan, Liying; Shioda, Toshi

2018-01-01

The existence of cytosine methylation in mammalian mitochondrial DNA (mtDNA) is a controversial subject. Because detection of DNA methylation depends on resistance of 5'-modified cytosines to bisulfite-catalyzed conversion to uracil, examined parameters that affect technical adequacy of mtDNA methylation analysis. Negative control amplicons (NCAs) devoid of cytosine methylation were amplified to cover the entire human or mouse mtDNA by long-range PCR. When the pyrosequencing template amplicons were gel-purified after bisulfite conversion, bisulfite pyrosequencing of NCAs did not detect significant levels of bisulfite-resistant cytosines (brCs) at ND1 (7 CpG sites) or CYTB (8 CpG sites) genes (CI95 = 0%-0.94%); without gel-purification, significant false-positive brCs were detected from NCAs (CI95 = 4.2%-6.8%). Bisulfite pyrosequencing of highly purified, linearized mtDNA isolated from human iPS cells or mouse liver detected significant brCs (~30%) in human ND1 gene when the sequencing primer was not selective in bisulfite-converted and unconverted templates. However, repeated experiments using a sequencing primer selective in bisulfite-converted templates almost completely (< 0.8%) suppressed brC detection, supporting the false-positive nature of brCs detected using the non-selective primer. Bisulfite-seq deep sequencing of linearized, gel-purified human mtDNA detected 9.4%-14.8% brCs for 9 CpG sites in ND1 gene. However, because all these brCs were associated with adjacent non-CpG brCs showing the same degrees of bisulfite resistance, DNA methylation in this mtDNA-encoded gene was not confirmed. Without linearization, data generated by bisulfite pyrosequencing or deep sequencing of purified mtDNA templates did not pass the quality control criteria. Shotgun bisulfite sequencing of human mtDNA detected extremely low levels of CpG methylation (<0.65%) over non-CpG methylation (<0.55%). Taken together, our study demonstrates that adequacy of mtDNA methylation analysis using methods dependent on bisulfite conversion needs to be established for each experiment, taking effects of incomplete bisulfite conversion and template impurity or topology into consideration.

Effects of Interaction Between DRD4 Methylation and Prenatal Maternal Stress on Methylphenidate-Induced Changes in Continuous Performance Test Performance in Youth with Attention-Deficit/Hyperactivity Disorder.

PubMed

Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

2018-06-15

Environmental factors may interact with genetic factors via the epigenetic process, and this interaction can contribute to inter-individual variability in the treatment response. The purpose of this study was to investigate the interaction effects between dopamine receptor D4 (DRD4) methylation and prenatal maternal stress on the methylphenidate (MPH) response of youth with attention-deficit/hyperactivity disorder (ADHD). This study was an 8-week open-label trial of MPH that included 74 ADHD youth. We investigated the associations between MPH treatment response, which was defined as a score ≤2 on the Clinical Global Impressions-Improvement (CGI-I) scale, and the methylation of 28 cytosine-guanine dinucleotide (CpG) sites of DRD4. Additionally, the interaction effects between DRD4 methylation and prenatal maternal stress on changes in Continuous Performance Test (CPT) scores after MPH treatment were investigated. Although there were no significant sites that showed significant association with treatment response, there was a significant interaction effect of the methylation of CpG7 and prenatal maternal stress on changes in omission errors of the CPT following treatment (p = 0.0001). The present findings indicate that the interaction between methylation of CpG7 of DRD4 and prenatal maternal stress may be predictive of the treatment response to MPH in youth with ADHD.

Microplate array diagonal gel electrophoresis (MADGE), CpG-PCR and temporal thermal ramp-MADGE (Melt-MADGE) for single nucleotide analyses in populations.

PubMed

Day, I N; O'Dell, S D; Spanakis, E; Weavind, G P

1999-02-01

Important requirements for molecular genetic epidemiological studies are economy, sample parallelism, convenience of setup and accessibility, goals inadequately met by existent approaches. We invented microplate array diagonal gel electrophoresis (MADGE) to gain simultaneously the advantages of simple setup, 96-well microplate compatibility, horizontal electrophoresis, and the resolution of polyacrylamide. At essentially no equipment cost (one simple plastic gel former), 10-100-fold savings on time for sample coding, liquid transfers, and data documentation, in addition to volume reductions and gel re-use, can be achieved. MADGE is compatible with ARMS, restriction analysis and other pattern analyses. CpG-PCR is a general PCR approach to CpG sites (10-20% of all human single base variation): both primers have 3' T, and are abutted to the CpG, forcing a TaqI restriction site if the CpG is intact. Typically, a 52 bp PCR product is then cut in half. CpG-PCR also illustrates that PAGE-MADGE readily permits analysis of 'ultrashort' PCRs. Melt-MADGE employs real-time-variable-temperature electrophoresis to examine duplex mobility during melting, achieving DGGE-like de novo, mutation scanning, but with the conveniences of arbitrary programmability, MADGE compatibility and short run time. This suite of methods enhances our capability to type or scan thousands of samples simultaneously, by 10-100-fold.

Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

NASA Astrophysics Data System (ADS)

Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

2015-08-01

In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

Superior diastolic function with KATP channel opener diazoxide in a novel mouse Langendorff model.

PubMed

Makepeace, Carol M; Suarez-Pierre, Alejandro; Kanter, Evelyn M; Schuessler, Richard B; Nichols, Colin G; Lawton, Jennifer S

2018-07-01

Adenosine triphosphate-sensitive potassium (K ATP ) channel openers have been found to be cardioprotective in multiple animal models via an unknown mechanism. Mouse models allow genetic manipulation of K ATP channel components for the investigation of this mechanism. Mouse Langendorff models using 30 min of global ischemia are known to induce measurable myocardial infarction and injury. Prolongation of global ischemia in a mouse Langendorff model could allow the determination of the mechanisms involved in K ATP channel opener cardioprotection. Mouse hearts (C57BL/6) underwent baseline perfusion with Krebs-Henseleit buffer (30 min), assessment of function using a left ventricular balloon, delivery of test solution, and prolonged global ischemia (90 min). Hearts underwent reperfusion (30 min) and functional assessment. Coronary flow was measured using an inline probe. Test solutions included were as follows: hyperkalemic cardioplegia alone (CPG, n = 11) or with diazoxide (CPG + DZX, n = 12). Although the CPG + DZX group had greater percent recovery of developed pressure and coronary flow, this was not statistically significant. Following a mean of 74 min (CPG) and 77 min (CPG + DZX), an additional increase in end-diastolic pressure was noted (plateau), which was significantly higher in the CPG group. Similarly, the end-diastolic pressure (at reperfusion and at the end of experiment) was significantly higher in the CPG group. Prolongation of global ischemia demonstrated added benefit when DZX was added to traditional hyperkalemic CPG. This model will allow the investigation of DZX mechanism of cardioprotection following manipulation of targeted K ATP channel components. This model will also allow translation to prolonged ischemic episodes associated with cardiac surgery. Copyright © 2018 Elsevier Inc. All rights reserved.

Galactic Cosmic Radiation Induces Persistent Epigenome Alterations Relevant to Human Lung Cancer.

PubMed

Kennedy, E M; Powell, D R; Li, Z; Bell, J S K; Barwick, B G; Feng, H; McCrary, M R; Dwivedi, B; Kowalski, J; Dynan, W S; Conneely, K N; Vertino, P M

2018-04-30

Human deep space and planetary travel is limited by uncertainties regarding the health risks associated with exposure to galactic cosmic radiation (GCR), and in particular the high linear energy transfer (LET), heavy ion component. Here we assessed the impact of two high-LET ions 56 Fe and 28 Si, and low-LET X rays on genome-wide methylation patterns in human bronchial epithelial cells. We found that all three radiation types induced rapid and stable changes in DNA methylation but at distinct subsets of CpG sites affecting different chromatin compartments. The 56 Fe ions induced mostly hypermethylation, and primarily affected sites in open chromatin regions including enhancers, promoters and the edges ("shores") of CpG islands. The 28 Si ion-exposure had mixed effects, inducing both hyper and hypomethylation and affecting sites in more repressed heterochromatic environments, whereas X rays induced mostly hypomethylation, primarily at sites in gene bodies and intergenic regions. Significantly, the methylation status of 56 Fe ion sensitive sites, but not those affected by X ray or 28 Si ions, discriminated tumor from normal tissue for human lung adenocarcinomas and squamous cell carcinomas. Thus, high-LET radiation exposure leaves a lasting imprint on the epigenome, and affects sites relevant to human lung cancer. These methylation signatures may prove useful in monitoring the cumulative biological impact and associated cancer risks encountered by astronauts in deep space.

Chronic exposure to water pollutant trichloroethylene increased epigenetic drift in CD4+ T cells

PubMed Central

Gilbert, Kathleen M; Blossom, Sarah J; Erickson, Stephen W; Reisfeld, Brad; Zurlinden, Todd J; Broadfoot, Brannon; West, Kirk; Bai, Shasha; Cooney, Craig A

2016-01-01

Aim: Autoimmune disease and CD4+ T-cell alterations are induced in mice exposed to the water pollutant trichloroethylene (TCE). We examined here whether TCE altered gene-specific DNA methylation in CD4+ T cells as a possible mechanism of immunotoxicity. Materials & methods: Naive and effector/memory CD4+ T cells from mice exposed to TCE (0.5 mg/ml in drinking water) for 40 weeks were examined by bisulfite next-generation DNA sequencing. Results: A probabilistic model calculated from multiple genes showed that TCE decreased methylation control in CD4+ T cells. Data from individual genes fitted to a quadratic regression model showed that TCE increased gene-specific methylation variance in both CD4 subsets. Conclusion: TCE increased epigenetic drift of specific CpG sites in CD4+ T cells. PMID:27092578

The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting

PubMed Central

Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal

2014-01-01

One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251

On Modeling and Analysis of MIMO Wireless Mesh Networks with Triangular Overlay Topology

DOE PAGES

Cao, Zhanmao; Wu, Chase Q.; Zhang, Yuanping; ...

2015-01-01

Multiple input multiple output (MIMO) wireless mesh networks (WMNs) aim to provide the last-mile broadband wireless access to the Internet. Along with the algorithmic development for WMNs, some fundamental mathematical problems also emerge in various aspects such as routing, scheduling, and channel assignment, all of which require an effective mathematical model and rigorous analysis of network properties. In this paper, we propose to employ Cartesian product of graphs (CPG) as a multichannel modeling approach and explore a set of unique properties of triangular WMNs. In each layer of CPG with a single channel, we design a node coordinate scheme thatmore » retains the symmetric property of triangular meshes and develop a function for the assignment of node identity numbers based on their coordinates. We also derive a necessary-sufficient condition for interference-free links and combinatorial formulas to determine the number of the shortest paths for channel realization in triangular WMNs.« less

Exploiting Semantic Web Technologies to Develop OWL-Based Clinical Practice Guideline Execution Engines.

PubMed

Jafarpour, Borna; Abidi, Samina Raza; Abidi, Syed Sibte Raza

2016-01-01

Computerizing paper-based CPG and then executing them can provide evidence-informed decision support to physicians at the point of care. Semantic web technologies especially web ontology language (OWL) ontologies have been profusely used to represent computerized CPG. Using semantic web reasoning capabilities to execute OWL-based computerized CPG unties them from a specific custom-built CPG execution engine and increases their shareability as any OWL reasoner and triple store can be utilized for CPG execution. However, existing semantic web reasoning-based CPG execution engines suffer from lack of ability to execute CPG with high levels of expressivity, high cognitive load of computerization of paper-based CPG and updating their computerized versions. In order to address these limitations, we have developed three CPG execution engines based on OWL 1 DL, OWL 2 DL and OWL 2 DL + semantic web rule language (SWRL). OWL 1 DL serves as the base execution engine capable of executing a wide range of CPG constructs, however for executing highly complex CPG the OWL 2 DL and OWL 2 DL + SWRL offer additional executional capabilities. We evaluated the technical performance and medical correctness of our execution engines using a range of CPG. Technical evaluations show the efficiency of our CPG execution engines in terms of CPU time and validity of the generated recommendation in comparison to existing CPG execution engines. Medical evaluations by domain experts show the validity of the CPG-mediated therapy plans in terms of relevance, safety, and ordering for a wide range of patient scenarios.

CpG Island Methylator Phenotype-High Colorectal Cancers and Their Prognostic Implications and Relationships with the Serrated Neoplasia Pathway.

PubMed

Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon

2017-01-15

The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway.

Bisphenol A-associated epigenomic changes in prepubescent girls: a cross-sectional study in Gharbiah, Egypt

PubMed Central

2013-01-01

Background There is now compelling evidence that epigenetic modifications link adult disease susceptibility to environmental exposures during specific life stages, including pre-pubertal development. Animal studies indicate that bisphenol A (BPA), the monomer used in epoxy resins and polycarbonate plastics, may impact health through epigenetic mechanisms, and epidemiological data associate BPA levels with metabolic disorders, behavior changes, and reproductive effects. Thus, we conducted an environmental epidemiology study of BPA exposure and CpG methylation in pre-adolescent girls from Gharbiah, Egypt hypothesizing that methylation profiles exhibit exposure-dependent trends. Methods Urinary concentrations of total (free plus conjugated) species of BPA in spot samples were quantified for 60 girls aged 10 to 13. Genome-wide CpG methylation was concurrently measured in bisulfite-converted saliva DNA using the Infinium HumanMethylation27 BeadChip (N = 46). CpG sites from four candidate genes were validated via quantitative bisulfite pyrosequencing. Results CpG methylation varied widely among girls, and higher urinary BPA concentrations were generally associated with less genomic methylation. Based on pathway analyses, genes exhibiting reduced methylation with increasing urinary BPA were involved in immune function, transport activity, metabolism, and caspase activity. In particular, hypomethylation of CpG targets on chromosome X was associated with higher urinary BPA. Using the Comparative Toxicogenomics Database, we identified a number of candidate genes in our sample that previously have been associated with BPA-related expression change. Conclusions These data indicate that BPA may affect human health through specific epigenomic modification of genes in relevant pathways. Thus, epigenetic epidemiology holds promise for the identification of biomarkers from previous exposures and the development of epigenetic-based diagnostic strategies. PMID:23590724

Combined epigenetic and intraspecific variation of the DRD4 and SERT genes influence novelty seeking behavior in great tit Parus major

PubMed Central

Riyahi, Sepand; Sánchez-Delgado, Marta; Calafell, Francesc; Monk, David; Senar, Juan Carlos

2015-01-01

DNA methylation is one of the main epigenetic mechanisms that can regulate gene expression and is an important means for creating phenotypic variation. In the present study, we performed methylation profiling of 2 candidate genes for personality traits, namely DRD4 and SERT, in the great tit Parus major to ascertain whether personality traits and behavior within different habitats have evolved with the aid of epigenetic variation. We applied bisulphite PCR and strand-specific sequencing to determine the methylation profile of the CpG dinucleotides in the DRD4 and SERT promoters and also in the CpG island overlapping DRD4 exon 3. Furthermore, we performed pyrosequencing to quantify the total methylation levels at each CpG location. Our results indicated that methylation was ∼1–4% higher in urban than in forest birds, for all loci and tissues analyzed, suggesting that this epigenetic modification is influenced by environmental conditions. Screening of genomic DNA sequence revealed that the SERT promoter is CpG poor region. The methylation at a single CpG dinucleotide located 288 bp from the transcription start site was related to exploration score in urban birds. In addition, the genotypes of the SERT polymorphism SNP234 located within the minimal promoter were significantly correlated with novelty seeking behavior in captivity, with the allele increasing this behavior being more frequent in urban birds. As a conclusion, it seems that both genetic and methylation variability of the SERT gene have an important role in shaping personality traits in great tits, whereas genetic and methylation variation at the DRD4 gene is not strongly involved in behavior and personality traits. PMID:25933062

LINE1 CpG-DNA Hypomethylation in Granulosa Cells and Blood Leukocytes Is Associated With PCOS and Related Traits.

PubMed

Sagvekar, Pooja; Mangoli, Vijay; Desai, Sadhana; Patil, Anushree; Mukherjee, Srabani

2017-04-01

Altered global DNA methylation is indicative of epigenomic instability concerning chronic diseases. Investigating its incidence and association with polycystic ovary syndrome (PCOS) is essential to understand the etiopathogenesis of this disorder. We assessed global DNA methylation differences in peripheral blood leukocytes (PBLs) and cumulus granulosa cells (CGCs) of controls and women with PCOS; and their association with PCOS and its traits. This study included a total of 102 controls and women with PCOS. Forty-one women undergoing controlled ovarian hyperstimulation (COH) and 61 women not undergoing COH were recruited from in vitro fertilization (IVF) and infertility clinics. DNA methylation was measured by ELISA for 5'-methyl-cytosine content and bisulfite sequencing of 5'-untranslated region (5'-UTR) of long interspersed nucleotide element-1 (LINE1/L1). Total 5'-methyl-cytosine and L1 methylation levels in PBLs and CGCs were similar between controls and women with PCOS. Methylation assessed at CpG sites of L1 5'-UTR revealed a single CpG-site (CpG-4) to be consistently hypomethylated in PBLs of both PCOS groups and CGCs of stimulated PCOS group. In unstimulated women, hypomethylation at CpG-4 was strongly associated with PCOS susceptibility, whereas in stimulated group it showed strong associations with PCOS and its hormonal traits. Furthermore, CGCs demonstrated consistent global and CpG-DNA hypomethylation relative to PBLs, irrespective of normal or disease states. Our study revealed strong association of single hypomethylated CpG-site with PCOS. Identification and characterization of more such methyl-CpG signatures in repetitive elements in larger study populations would provide valuable epigenetic insights into PCOS. Copyright © 2017 by the Endocrine Society

Potential link between Fusobacterium enrichment and DNA methylation accumulation in the inflammatory colonic mucosa in ulcerative colitis

PubMed Central

Tahara, Tomomitsu; Hirata, Ichiro; Nakano, Naoko; Tahara, Sayumi; Horiguchi, Noriyuki; Kawamura, Tomohiko; Okubo, Masaaki; Ishizuka, Takamitsu; Yamada, Hyuga; Yoshida, Dai; Ohmori, Takafumi; Maeda, Kohei; Komura, Naruomi; Ikuno, Hirokazu; Jodai, Yasutaka; Kamano, Toshiaki; Nagasaka, Mitsuo; Nakagawa, Yoshihito; Tuskamoto, Tetsuya; Urano, Makoto; Shibata, Tomoyuki; Kuroda, Makoto; Ohmiya, Naoki

2017-01-01

BACKGROUND AND AIM Fusobacterium enrichment has been associated with colorectal cancer development. Ulcerative colitis (UC) associated tumorigenesis is characterized as high degree of methylation accumulation through continuous colonic inflammation. The aim of this study was to investigate a potential link between Fusobacterium enrichment and DNA methylation accumulation in the inflammatory colonic mucosa in UC. METHODS In the candidate analysis, inflamed colonic mucosa from 86 UC patients were characterized the methylation status of colorectal a panel of cancer related 24 genes. In the genome-wide analysis, an Infinium HumanMethylation450 BeadChip array was utilized to characterize the methylation status of >450,000 CpG sites for fourteen UC patients. Results were correlated with Fusobacterium status. RESULTS UC with Fusobacterium enrichment (FB-high) was characterized as high degree of type C (for cancer-specific) methylation compared to other (FB-low/neg) samples (P<0.01). Genes hypermethylated in FB-high samples included well-known type C genes in colorectal cancer, such as MINT2 and 31, P16 and NEUROG1. Multivariate analysis demonstrated that the FB high status held an increased likelihood for methylation high as an independent factor (odds ratio: 16.18, 95% confidence interval: 1.94-135.2, P=0.01). Genome-wide methylation analysis demonstrated a unique methylome signature of FB-high cases irrespective of promoter, outside promoter, CpG and non-CpG sites. Group of promoter CpG sites that were exclusively hypermethylated in FB-high cases significantly codified the genes related to the catalytic activity (P=0.039). CONCLUSION Our findings suggest that Fusobacterium accelerates DNA methylation in specific groups of genes in the inflammatory colonic mucosa in UC. PMID:28977914

Methylation profiling in individuals with Russell-Silver syndrome.

PubMed

Peñaherrera, Maria S; Weindler, Susanne; Van Allen, Margot I; Yong, Siu-Li; Metzger, Daniel L; McGillivray, Barbara; Boerkoel, Cornelius; Langlois, Sylvie; Robinson, Wendy P

2010-02-01

Russell-Silver syndrome (RSS) is a heterogeneous disorder associated with pre- and post-natal growth restriction and relative macrocephaly. Involvement of imprinted genes on both chromosome 7 and 11p15.5 has been reported. To further characterize the role of epimutations in RSS we evaluated the methylation status at both 11p15.5 imprinting control regions (ICRs): ICR1 associated with H19/IGF2 expression and ICR2 (KvDMR1) associated with CDKN1C expression in a series of 35 patients with RSS. We also evaluated methylation at the promoter regions of other imprinted genes involved in growth such as PLAGL1 (6q24), GCE (7q21), and PEG10 (7q21) in this series of 35 patients with RSS. Thirteen of the 35 patient samples, but none of 22 controls, showed methylation levels at ICR1 that were more than 2 SD below the mean for controls. Three RSS patients were highly methylated at the SCGE promoter, all of which were diagnosed with upd(7)mat. To identify further potential global methylation changes in RSS patients, a subset of 22 patients were evaluated at 1505 CpG sites by the Illumina GoldenGate methylation array. Among the few CpG sites displaying a significant difference between RSS patients and controls, was a CpG associated with the H19 promoter. No other sites associated with known imprinted genes were identified as abnormally methylated in RSS patients by this approach. While the association of hypomethylation of the H19/IGF2 ICR1 is clear, the continuous distribution of methylation values among the patients and controls complicates the establishment of clear cut-offs for clinical diagnosis. Copyright 2010 Wiley-Liss, Inc.

DNA methylation of the filaggrin gene adds to the risk of eczema associated with loss-of-function variants

PubMed Central

Ziyab, A. H.; Karmaus, W.; Holloway, J. W.; Zhang, H.; Ewart, S.; Arshad, S. H.

2012-01-01

Background Loss-of-function variants within the filaggrin gene (FLG) are associated with a dysfunctional skin barrier that contributes to the development of eczema. Epigenetic modifications, such as DNA methylation, are genetic regulatory mechanisms that modulate gene expression without changing the DAN sequence. Objectives To investigate whether genetic variants and adjacent differential DNA methylation within the FLG gene synergistically act on the development of eczema. Methods A subsample (n = 245, only females aged 18 years) of the Isle of Wight birth cohort participants (n = 1,456) had available information for FLG variants R501X, 2282del4, and S3247X and DNA methylation levels for 10 CpG sites within the FLG gene. Log-binomial regression was used to estimate the risk ratios (RRs) of eczema associated with FLG variants at different methylation levels. Results The period prevalence of eczema was 15.2% at age 18 years and 9.0% of participants were carriers (heterozygous) of FLG variants. Of the 10 CpG sites spanning the genomic region of FLG, methylation levels of CpG site ‘cg07548383’ showed a significant interaction with FLG sequence variants on the risk for eczema. At 86% methylation level, filaggrin haploinsufficient individuals had 5.48-fold increased risk of eczema when compared to those with wild type FLG genotype (p-value = 0.0008). Conclusions Our novel results indicated that the association between FLG loss-of-function variants and eczema is modulated by DNA methylation. Simultaneously assessing the joint effect of genetic and epigenetic factors within the FLG gene further highlights the importance of this genomic region for eczema manifestation. PMID:23003573

DNA methylation array analysis identifies breast cancer associated RPTOR, MGRN1 and RAPSN hypomethylation in peripheral blood DNA.

PubMed

Tang, Qiuqiong; Holland-Letz, Tim; Slynko, Alla; Cuk, Katarina; Marme, Frederik; Schott, Sarah; Heil, Jörg; Qu, Bin; Golatta, Michael; Bewerunge-Hudler, Melanie; Sutter, Christian; Surowy, Harald; Wappenschmidt, Barbara; Schmutzler, Rita; Hoth, Markus; Bugert, Peter; Bartram, Claus R; Sohn, Christof; Schneeweiss, Andreas; Yang, Rongxi; Burwinkel, Barbara

2016-09-27

DNA methylation changes in peripheral blood DNA have been shown to be associated with solid tumors. We sought to identify methylation alterations in whole blood DNA that are associated with breast cancer (BC). Epigenome-wide DNA methylation profiling on blood DNA from BC cases and healthy controls was performed by applying Infinium HumanMethylation450K BeadChips. Promising CpG sites were selected and validated in three independent larger sample cohorts via MassARRAY EpiTyper assays. CpG sites located in three genes (cg06418238 in RPTOR, cg00736299 in MGRN1 and cg27466532 in RAPSN), which showed significant hypomethylation in BC patients compared to healthy controls in the discovery cohort (p < 1.00 x 10-6) were selected and successfully validated in three independent cohorts (validation I, n =211; validation II, n=378; validation III, n=520). The observed methylation differences are likely not cell-type specific, as the differences were only seen in whole blood, but not in specific sub cell-types of leucocytes. Moreover, we observed in quartile analysis that women in the lower methylation quartiles of these three loci had higher ORs than women in the higher quartiles. The combined AUC of three loci was 0.79 (95%CI 0.73-0.85) in validation cohort I, and was 0.60 (95%CI 0.54-0.66) and 0.62 (95%CI 0.57-0.67) in validation cohort II and III, respectively. Our study suggests that hypomethylation of CpG sites in RPTOR, MGRN1 and RAPSN in blood is associated with BC and might serve as blood-based marker supplements for BC if these could be verified in prospective studies.

Hydrocarbon pyrolysis reactor experimentation and modeling for the production of solar absorbing carbon nanoparticles

NASA Astrophysics Data System (ADS)

Frederickson, Lee Thomas

Much of combustion research focuses on reducing soot particulates in emissions. However, current research at San Diego State University (SDSU) Combustion and Solar Energy Laboratory (CSEL) is underway to develop a high temperature solar receiver which will utilize carbon nanoparticles as a solar absorption medium. To produce carbon nanoparticles for the small particle heat exchange receiver (SPHER), a lab-scale carbon particle generator (CPG) has been built and tested. The CPG is a heated ceramic tube reactor with a set point wall temperature of 1100-1300°C operating at 5-6 bar pressure. Natural gas and nitrogen are fed to the CPG where natural gas undergoes pyrolysis resulting in carbon particles. The gas-particle mixture is met downstream with dilution air and sent to the lab scale solar receiver. To predict soot yield and general trends in CPG performance, a model has been setup in Reaction Design CHEMKIN-PRO software. One of the primary goals of this research is to accurately measure particle properties. Mean particle diameter, size distribution, and index of refraction are calculated using Scanning Electron Microscopy (SEM) and a Diesel Particulate Scatterometer (DPS). Filter samples taken during experimentation are analyzed to obtain a particle size distribution with SEM images processed in ImageJ software. These results are compared with the DPS, which calculates the particle size distribution and the index of refraction from light scattering using Mie theory. For testing with the lab scale receiver, a particle diameter range of 200-500 nm is desired. Test conditions are varied to understand effects of operating parameters on particle size and the ability to obtain the size range. Analysis of particle loading is the other important metric for this research. Particle loading is measured downstream of the CPG outlet and dilution air mixing point. The air-particle mixture flows through an extinction tube where opacity of the mixture is measured with a 532 nm laser and detector. Beer's law is then used to calculate particle loading. The CPG needs to produce a certain particle loading for a corresponding receiver test. By obtaining the particle loading in the system, the reaction conversion to solid carbon in the CPG can be calculated to measure the efficiency of the CPG. To predict trends in reaction conversion and particle size from experimentation, the CHEMKIN-PRO computer model for the CPG is run for various flow rates and wall temperature profiles. These predictions were a reason for testing at higher wall set point temperatures. Based on these research goals, it was shown that the CPG consistently produces a mean particle diameter of 200-400 nm at the conditions tested, fitting perfectly inside the desired range. This led to successful lab scale SPHER testing which produced a 10-point efficiency increase and 150°C temperature difference with particles present. Also, at 3 g/s dilution air flow rate, an efficiency of 80% at an outlet temperature above 800°C was obtained. Promise was shown at higher CPG experimental temperatures to produce higher reaction conversion, both experimentally and in the model. However, based on wall temperature data taken during experimentation, it is apparent that the CPG needs to have multiple heating zones with separate temperature controllers in order to have an isothermal zone rather than a parabolic temperature profile. As for the computer model, it predicted much higher reaction conversion at higher temperature. The mass fraction of fuel in the inlet stream was shown to not affect conversion while increasing residence time led to increasing conversion. Particle size distribution in the model was far off and showed a bimodal distribution for one of the statistical methods. Using the results from experimentation and modeling, a preliminary CPG design is presented that will operate in a 5MWth receiver system.

Epigenetics meets metabolomics: an epigenome-wide association study with blood serum metabolic traits

PubMed Central

Petersen, Ann-Kristin; Zeilinger, Sonja; Kastenmüller, Gabi; Römisch-Margl, Werner; Brugger, Markus; Peters, Annette; Meisinger, Christine; Strauch, Konstantin; Hengstenberg, Christian; Pagel, Philipp; Huber, Fritz; Mohney, Robert P.; Grallert, Harald; Illig, Thomas; Adamski, Jerzy; Waldenberger, Melanie; Gieger, Christian; Suhre, Karsten

2014-01-01

Previously, we reported strong influences of genetic variants on metabolic phenotypes, some of them with clinical relevance. Here, we hypothesize that DNA methylation may have an important and potentially independent effect on human metabolism. To test this hypothesis, we conducted what is to the best of our knowledge the first epigenome-wide association study (EWAS) between DNA methylation and metabolic traits (metabotypes) in human blood. We assess 649 blood metabolic traits from 1814 participants of the Kooperative Gesundheitsforschung in der Region Augsburg (KORA) population study for association with methylation of 457 004 CpG sites, determined on the Infinium HumanMethylation450 BeadChip platform. Using the EWAS approach, we identified two types of methylome–metabotype associations. One type is driven by an underlying genetic effect; the other type is independent of genetic variation and potentially driven by common environmental and life-style-dependent factors. We report eight CpG loci at genome-wide significance that have a genetic variant as confounder (P = 3.9 × 10−20 to 2.0 × 10−108, r2 = 0.036 to 0.221). Seven loci display CpG site-specific associations to metabotypes, but do not exhibit any underlying genetic signals (P = 9.2 × 10−14 to 2.7 × 10−27, r2 = 0.008 to 0.107). We further identify several groups of CpG loci that associate with a same metabotype, such as 4-vinylphenol sulfate and 4-androsten-3-beta,17-beta-diol disulfate. In these cases, the association between CpG-methylation and metabotype is likely the result of a common external environmental factor, including smoking. Our study shows that analysis of EWAS with large numbers of metabolic traits in large population cohorts are, in principle, feasible. Taken together, our data suggest that DNA methylation plays an important role in regulating human metabolism. PMID:24014485

DNA methylation patterns in tissues from mid-gestation bovine foetuses produced by somatic cell nuclear transfer show subtle abnormalities in nuclear reprogramming.

PubMed

Couldrey, Christine; Lee, Rita Sf

2010-03-07

Cloning of cattle by somatic cell nuclear transfer (SCNT) is associated with a high incidence of pregnancy failure characterized by abnormal placental and foetal development. These abnormalities are thought to be due, in part, to incomplete re-setting of the epigenetic state of DNA in the donor somatic cell nucleus to a state that is capable of driving embryonic and foetal development to completion. Here, we tested the hypothesis that DNA methylation patterns were not appropriately established during nuclear reprogramming following SCNT. A panel of imprinted, non-imprinted genes and satellite repeat sequences was examined in tissues collected from viable and failing mid-gestation SCNT foetuses and compared with similar tissues from gestation-matched normal foetuses generated by artificial insemination (AI). Most of the genomic regions examined in tissues from viable and failing SCNT foetuses had DNA methylation patterns similar to those in comparable tissues from AI controls. However, statistically significant differences were found between SCNT and AI at specific CpG sites in some regions of the genome, particularly those associated with SNRPN and KCNQ1OT1, which tended to be hypomethylated in SCNT tissues. There was a high degree of variation between individuals in methylation levels at almost every CpG site in these two regions, even in AI controls. In other genomic regions, methylation levels at specific CpG sites were tightly controlled with little variation between individuals. Only one site (HAND1) showed a tissue-specific pattern of DNA methylation. Overall, DNA methylation patterns in tissues of failing foetuses were similar to apparently viable SCNT foetuses, although there were individuals showing extreme deviant patterns. These results show that SCNT foetuses that had developed to mid-gestation had largely undergone nuclear reprogramming and that the epigenetic signature at this stage was not a good predictor of whether the foetus would develop to term or not.

DNA methylation patterns in tissues from mid-gestation bovine foetuses produced by somatic cell nuclear transfer show subtle abnormalities in nuclear reprogramming

PubMed Central

2010-01-01

Background Cloning of cattle by somatic cell nuclear transfer (SCNT) is associated with a high incidence of pregnancy failure characterized by abnormal placental and foetal development. These abnormalities are thought to be due, in part, to incomplete re-setting of the epigenetic state of DNA in the donor somatic cell nucleus to a state that is capable of driving embryonic and foetal development to completion. Here, we tested the hypothesis that DNA methylation patterns were not appropriately established during nuclear reprogramming following SCNT. A panel of imprinted, non-imprinted genes and satellite repeat sequences was examined in tissues collected from viable and failing mid-gestation SCNT foetuses and compared with similar tissues from gestation-matched normal foetuses generated by artificial insemination (AI). Results Most of the genomic regions examined in tissues from viable and failing SCNT foetuses had DNA methylation patterns similar to those in comparable tissues from AI controls. However, statistically significant differences were found between SCNT and AI at specific CpG sites in some regions of the genome, particularly those associated with SNRPN and KCNQ1OT1, which tended to be hypomethylated in SCNT tissues. There was a high degree of variation between individuals in methylation levels at almost every CpG site in these two regions, even in AI controls. In other genomic regions, methylation levels at specific CpG sites were tightly controlled with little variation between individuals. Only one site (HAND1) showed a tissue-specific pattern of DNA methylation. Overall, DNA methylation patterns in tissues of failing foetuses were similar to apparently viable SCNT foetuses, although there were individuals showing extreme deviant patterns. Conclusion These results show that SCNT foetuses that had developed to mid-gestation had largely undergone nuclear reprogramming and that the epigenetic signature at this stage was not a good predictor of whether the foetus would develop to term or not. PMID:20205951

Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

NASA Astrophysics Data System (ADS)

Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

2012-09-01

CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31189e

High-throughput engineering of a mammalian genome reveals building principles of methylation states at CG rich regions.

PubMed

Krebs, Arnaud R; Dessus-Babus, Sophie; Burger, Lukas; Schübeler, Dirk

2014-09-26

The majority of mammalian promoters are CpG islands; regions of high CG density that require protection from DNA methylation to be functional. Importantly, how sequence architecture mediates this unmethylated state remains unclear. To address this question in a comprehensive manner, we developed a method to interrogate methylation states of hundreds of sequence variants inserted at the same genomic site in mouse embryonic stem cells. Using this assay, we were able to quantify the contribution of various sequence motifs towards the resulting DNA methylation state. Modeling of this comprehensive dataset revealed that CG density alone is a minor determinant of their unmethylated state. Instead, these data argue for a principal role for transcription factor binding sites, a prediction confirmed by testing synthetic mutant libraries. Taken together, these findings establish the hierarchy between the two cis-encoded mechanisms that define the DNA methylation state and thus the transcriptional competence of CpG islands.

Identification of methylation haplotype blocks aids in deconvolution of heterogeneous tissue samples and tumor tissue-of-origin mapping from plasma DNA.

PubMed

Guo, Shicheng; Diep, Dinh; Plongthongkum, Nongluk; Fung, Ho-Lim; Zhang, Kang; Zhang, Kun

2017-04-01

Adjacent CpG sites in mammalian genomes can be co-methylated owing to the processivity of methyltransferases or demethylases, yet discordant methylation patterns have also been observed, which are related to stochastic or uncoordinated molecular processes. We focused on a systematic search and investigation of regions in the full human genome that show highly coordinated methylation. We defined 147,888 blocks of tightly coupled CpG sites, called methylation haplotype blocks, after analysis of 61 whole-genome bisulfite sequencing data sets and validation with 101 reduced-representation bisulfite sequencing data sets and 637 methylation array data sets. Using a metric called methylation haplotype load, we performed tissue-specific methylation analysis at the block level. Subsets of informative blocks were further identified for deconvolution of heterogeneous samples. Finally, using methylation haplotypes we demonstrated quantitative estimation of tumor load and tissue-of-origin mapping in the circulating cell-free DNA of 59 patients with lung or colorectal cancer.

Methylation on the Circadian Gene BMAL1 Is Associated with the Effects of a Weight Loss Intervention on Serum Lipid Levels.

PubMed

Samblas, Mirian; Milagro, Fermin I; Gómez-Abellán, Purificación; Martínez, J Alfredo; Garaulet, Marta

2016-06-01

The circadian clock system has been linked to the onset and development of obesity and some accompanying comorbidities. Epigenetic mechanisms, such as DNA methylation, are putatively involved in the regulation of the circadian clock system. The aim of this study was to investigate the influence of a weight loss intervention based on an energy-controlled Mediterranean dietary pattern in the methylation levels of 3 clock genes, BMAL1, CLOCK, and NR1D1, and the association between the methylation levels and changes induced in the serum lipid profile with the weight loss treatment. The study sample enrolled 61 women (body mass index = 28.6 ± 3.4 kg/m(2); age: 42.2 ± 11.4 years), who followed a nutritional program based on a Mediterranean dietary pattern. DNA was isolated from whole blood obtained at the beginning and end point. Methylation levels at different CpG sites of BMAL1, CLOCK, and NR1D1 were analyzed by Sequenom's MassArray. The energy-restricted intervention modified the methylation levels of different CpG sites in BMAL1 (CpGs 5, 6, 7, 9, 11, and 18) and NR1D1 (CpGs 1, 10, 17, 18, 19, and 22). Changes in cytosine methylation in the CpG 5 to 9 region of BMAL1 with the intervention positively correlated with the eveningness profile (p = 0.019). The baseline methylation of the CpG 5 to 9 region in BMAL1 positively correlated with energy (p = 0.047) and carbohydrate (p = 0.017) intake and negatively correlated with the effect of the weight loss intervention on total cholesterol (p = 0.032) and low-density lipoprotein cholesterol (p = 0.005). Similar significant and positive correlations were found between changes in methylation levels in the CpG 5 to 9 region of BMAL1 due to the intervention and changes in serum lipids (p < 0.05). This research describes apparently for the first time an association between changes in the methylation of the BMAL1 gene with the intervention and the effects of a weight loss intervention on blood lipids levels. © 2016 The Author(s).

Cadmium exposure and the epigenome

PubMed Central

Sanders, Alison P; Smeester, Lisa; Rojas, Daniel; DeBussycher, Tristan; Wu, Michael C; Wright, Fred A; Zhou, Yi-Hui; Laine, Jessica E; Rager, Julia E; Swamy, Geeta K; Ashley-Koch, Allison; Lynn Miranda, Marie; Fry, Rebecca C

2014-01-01

Cadmium (Cd) is prevalent in the environment yet understudied as a developmental toxicant. Cd partially crosses the placental barrier from mother to fetus and is linked to detrimental effects in newborns. Here we examine the relationship between levels of Cd during pregnancy and 5-methylcytosine (5mC) levels in leukocyte DNA collected from 17 mother-newborn pairs. The methylation of cytosines is an epigenetic mechanism known to impact transcriptional signaling and influence health endpoints. A methylated cytosine-guanine (CpG) island recovery assay was used to assess over 4.6 million sites spanning 16,421 CpG islands. Exposure to Cd was classified for each mother-newborn pair according to maternal blood levels and compared with levels of cotinine. Subsets of genes were identified that showed altered DNA methylation levels in their promoter regions in fetal DNA associated with levels of Cd (n = 61), cotinine (n = 366), or both (n = 30). Likewise, in maternal DNA, differentially methylated genes were identified that were associated with Cd (n = 92) or cotinine (n = 134) levels. While the gene sets were largely distinct between maternal and fetal DNA, functional similarities at the biological pathway level were identified including an enrichment of genes that encode for proteins that control transcriptional regulation and apoptosis. Furthermore, conserved DNA motifs with sequence similarity to specific transcription factor binding sites were identified within the CpG islands of the gene sets. This study provides evidence for distinct patterns of DNA methylation or “footprints” in fetal and maternal DNA associated with exposure to Cd. PMID:24169490

Genome-Wide Estimates of Mutation Rates and Spectrum in Schizosaccharomyces pombe Indicate CpG Sites are Highly Mutagenic Despite the Absence of DNA Methylation

PubMed Central

Behringer, Megan G.; Hall, David W.

2015-01-01

We accumulated mutations for 1952 generations in 79 initially identical, haploid lines of the fission yeast Schizosaccharomyces pombe, and then performed whole-genome sequencing to determine the mutation rates and spectrum. We captured 696 spontaneous mutations across the 79 mutation accumulation (MA) lines. We compared the mutation spectrum and rate to a recently published equivalent experiment on the same species, and to another model ascomycetous yeast, the budding yeast Saccharomyces cerevisiae. While the two species are approximately 600 million years diverged from each other, they share similar life histories, genome size and genomic G/C content. We found that Sc. pombe and S. cerevisiae have similar mutation rates, but Sc. pombe exhibits a stronger insertion bias. Intriguingly, we observed an increased mutation rate at cytosine nucleotides, specifically CpG nucleotides, which is also seen in S. cerevisiae. However, the absence of methylation in Sc. pombe and the pattern of mutation at these sites, primarily C → A as opposed to C → T, strongly suggest that the increased mutation rate is not caused by deamination of methylated cytosines. This result implies that the high mutability of CpG dinucleotides in other species may be caused in part by a methylation-independent mechanism. Many of our findings mirror those seen in the recent study, despite the use of different passaging conditions, indicating that MA is a reliable method for estimating mutation rates and spectra. PMID:26564949

SNPs located at CpG sites modulate genome-epigenome interaction

USDA-ARS?s Scientific Manuscript database

DNA methylation is an important molecular-level phenotype that links genotypes and complex disease traits. Previous studies have found local correlation between genetic variants and DNA methylation levels (cis-meQTLs). However, general mechanisms underlying cis-meQTLs are unclear. We conducted a cis...

Whole Genome DNA Methylation Analysis of Obstructive Sleep Apnea: IL1R2, NPR2, AR, SP140 Methylation and Clinical Phenotype

PubMed Central

Chen, Yung-Che; Chen, Ting-Wen; Su, Mao-Chang; Chen, Chung-Jen; Chen, Kuang-Den; Liou, Chia-Wei; Tang, Petrus; Wang, Ting-Ya; Chang, Jen-Chieh; Wang, Chin-Chou; Lin, Hsin-Ching; Chin, Chien-Hung; Huang, Kuo-Tung; Lin, Meng-Chih; Hsiao, Chang-Chun

2016-01-01

Study Objectives: We hypothesized that DNA methylation patterns may contribute to disease severity or the development of hypertension and excessive daytime sleepiness (EDS) in patients with obstructive sleep apnea (OSA). Methods: Illumina's (San Diego, CA, USA) DNA methylation 27-K assay was used to identify differentially methylated loci (DML). DNA methylation levels were validated by pyrosequencing. A discovery cohort of 15 patients with OSA and 6 healthy subjects, and a validation cohort of 72 patients with sleep disordered breathing (SDB). Results: Microarray analysis identified 636 DMLs in patients with OSA versus healthy subjects, and 327 DMLs in patients with OSA and hypertension versus those without hypertension. In the validation cohort, no significant difference in DNA methylation levels of six selected genes was found between the primary snoring subjects and OSA patients (primary outcome). However, a secondary outcome analysis showed that interleukin-1 receptor 2 (IL1R2) promoter methylation (−114 cytosine followed by guanine dinucleotide sequence [CpG] site) was decreased and IL1R2 protein levels were increased in the patients with SDB with an oxygen desaturation index > 30. Androgen receptor (AR) promoter methylation (−531 CpG site) and AR protein levels were both increased in the patients with SDB with an oxygen desaturation index > 30. Natriuretic peptide receptor 2 (NPR2) promoter methylation (−608/−618 CpG sites) were decreased, whereas levels of both NPR2 and serum C type natriuretic peptide protein were increased in the SDB patients with EDS. Speckled protein 140 (SP140) promoter methylation (−194 CpG site) was increased, and SP140 protein levels were decreased in the patients with SDB and EDS. Conclusions: IL1R2 hypomethylation and AR hypermethylation may constitute an important determinant of disease severity, whereas NPR2 hypomethylation and SP140 hypermethylation may provide a biomarker for vulnerability to EDS in OSA. Commentary: A commentary on this article appears in this issue on page 723. Citation: Chen YC, Chen TW, Su MC, Chen CJ, Chen KD, Liou CW, Tang P, Wang TY, Chang JC, Wang CC, Lin HC, Chin CH, Huang KT, Lin MC, Hsiao CC. Whole genome DNA methylation analysis of obstructive sleep apnea: IL1R2, NPR2, AR, SP140 methylation and clinical phenotype. SLEEP 2016;39(4):743–755. PMID:26888452

Oral contraceptives modify the effect of GATA3 polymorphisms on the risk of asthma at the age of 18 years via DNA methylation.

PubMed

Guthikonda, Kranthi; Zhang, Hongmei; Nolan, Vikki G; Soto-Ramírez, Nelís; Ziyab, Ali H; Ewart, Susan; Arshad, Hasan S; Patil, Veeresh; Holloway, John W; Lockett, Gabrielle A; Karmaus, Wilfried

2014-01-01

The prevalence of asthma in girls increases after puberty. Previous studies have detected associations between sex hormones and asthma, as well as between sex hormones and T helper 2 (Th2) asthma-typical immune responses. Therefore, we hypothesized that exogenous or endogenous sex hormone exposure (represented by oral contraceptive pill (OCP) use and early menarche, respectively) are associated with DNA methylation (DNA-M) of the Th2 transcription factor gene, GATA3, in turn affecting the risk of asthma in girls, possibly in interaction with genetic variants. Blood samples were collected from 245 female participants aged 18 years randomly selected for methylation analysis from the Isle of Wight birth cohort, UK. Information on use of OCPs, age at menarche, and concurrent asthma were assessed by questionnaire. Genome-wide DNA-M was determined using the Illumina Infinium HumanMethylation450 beadchip. In a first stage, we tested the interaction between sex hormone exposure and genetic variants on DNA-M of specific cytosine-phosphate-guanine (CpG) sites. In a second stage, we determined whether these CpG sites interact with genetic variants in GATA3 to explain the risk of asthma. Interactions between OCP use and seven single nucleotide polymorphisms (SNPs) of GATA3 were analyzed for 14 CpG sites (stage 1). The interaction between OCP use and SNP rs1269486 was found to be associated with the methylation level of cg17124583 (P = 0.002, false discovery rate (FDR) adjusted P = 0.04). DNA-M of this same CpG site was also influenced by the interaction between age at menarche and rs1269486 (P = 0.0017). In stage 2, we found that cg17124583 modified the association of SNP rs422628 with asthma risk at the age of 18 years (P = 0.006, FDR adjusted P = 0.04). Subjects with genotype AG showed an increase in average risk ratio (RR) from 0.31 (95% CI: 0.10 to 0.8) to 11.65 (95% CI: 1.71 to 79.5) when methylation level increased from 0.02 to 0.12, relative to genotype AA. A two-stage model consisting of genetic variants in the GATA3 gene, OCP use, age at menarche, and DNA-M may explain how sex hormones in women can increase the asthma prevalence after puberty.

Greig syndrome: Analysis of the GL13 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grzeschik, K.H.; Gessler, M.; Heid, C.

1994-09-01

Disruption of the zinc finger gene GL13 by translocation events has been implicated as the cause for cephalopolysyndactyly syndrome (GCPS) in several patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GL13 gene. About 550 kb from this area were subdivided into a cosmid contig with a two- to ten-fold clone coverage. In this region the cloned GL13 cDNA appears to correspond to at least 14 exons spread over a distance of 280 kb. A CpG island defined by two NotI sites and several BssHII andmore » KspI sites is located in a genomic fragment covering the most proximal exon of the cloned GL13 cDNA. Further upstream, five segments conserved between man and mouse were found. In the mouse this region has been characterized as the transgene integration site resulting in the add phenotype. Both the CpG islands and the conserved regions are likely candidates to search for GL13 promoter and control elements. Intron-exon boundaries and breakpoints of the translocation events within the gene region of patients were identified and characterized.« less

Depleting tumor-specific Tregs at a single site eradicates disseminated tumors

PubMed Central

Marabelle, Aurélien; Kohrt, Holbrook; Sagiv-Barfi, Idit; Ajami, Bahareh; Axtell, Robert C.; Zhou, Gang; Rajapaksa, Ranjani; Green, Michael R.; Torchia, James; Brody, Joshua; Luong, Richard; Rosenblum, Michael D.; Steinman, Lawrence; Levitsky, Hyam I.; Tse, Victor; Levy, Ronald

2013-01-01

Activation of TLR9 by direct injection of unmethylated CpG nucleotides into a tumor can induce a therapeutic immune response; however, Tregs eventually inhibit the antitumor immune response and thereby limit the power of cancer immunotherapies. In tumor-bearing mice, we found that Tregs within the tumor preferentially express the cell surface markers CTLA-4 and OX40. We show that intratumoral coinjection of anti–CTLA-4 and anti-OX40 together with CpG depleted tumor-infiltrating Tregs. This in situ immunomodulation, which was performed with low doses of antibodies in a single tumor, generated a systemic antitumor immune response that eradicated disseminated disease in mice. Further, this treatment modality was effective against established CNS lymphoma with leptomeningeal metastases, sites that are usually considered to be tumor cell sanctuaries in the context of conventional systemic therapy. These results demonstrate that antitumor immune effectors elicited by local immunomodulation can eradicate tumor cells at distant sites. We propose that, rather than using mAbs to target cancer cells systemically, mAbs could be used to target the tumor infiltrative immune cells locally, thereby eliciting a systemic immune response. PMID:23728179

Crossovers are associated with mutation and biased gene conversion at recombination hotspots.

PubMed

Arbeithuber, Barbara; Betancourt, Andrea J; Ebner, Thomas; Tiemann-Boege, Irene

2015-02-17

Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination.

Crossovers are associated with mutation and biased gene conversion at recombination hotspots

PubMed Central

Arbeithuber, Barbara; Betancourt, Andrea J.; Ebner, Thomas; Tiemann-Boege, Irene

2015-01-01

Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination. PMID:25646453

Healthcare professionals' and policy makers' views on implementing a clinical practice guideline of hypertension management: a qualitative study.

PubMed

Lee, Ping Yein; Liew, Su May; Abdullah, Adina; Abdullah, Nurdiana; Ng, Chirk Jenn; Hanafi, Nik Sherina; Chia, Yook Chin; Lai, Pauline S M; Wong, Stalia S L; Khoo, Ee Ming

2015-01-01

Most studies have reported barriers to guideline usage mainly from doctors' perspective; few have reported the perspective of other stakeholders. This study aimed to determine the views and barriers to adherence of a national clinical practice guideline (CPG) on management of hypertension from the perspectives of policymakers, doctors and allied healthcare professionals. This study used a qualitative approach with purposive sampling. Seven in depth interviews and six focus group discussions were conducted with 35 healthcare professionals (policy makers, doctors, pharmacists and nurses) at a teaching hospital in Kuala Lumpur, Malaysia, between February and June 2013. All interviews were audio-recorded, transcribed verbatim and checked. Thematic approach was used to analyse the data. Two main themes and three sub-themes emerged from this study. The main themes were (1) variation in the use of CPG and (2) barriers to adherence to CPG. The three sub-themes for barriers were issues inherent to the CPG, systems and policy that is not supportive of CPG use, and attitudes and behaviour of stakeholders. The main users of the CPG were the primary care doctors. Pharmacists only partially use the guidelines, while nurses and policy makers were not using the CPG at all. Participants had suggested few strategies to improve usage and adherence to CPG. First, update the CPG regularly and keep its content simple with specific sections for allied health workers. Second, use technology to facilitate CPG accessibility and provide protected time for implementation of CPG recommendations. Third, incorporate local CPG in professional training, link CPG adherence to key performance indicators and provide incentives for its use. Barriers to the use of CPG hypertension management span across all stakeholders. The development and implementation of CPG focused mainly on doctors with lack of involvement of other healthcare stakeholders. Guidelines should be made simple, current, reliable, accessible, inclusive of all stakeholders and with good policy support.

An epigenome-wide study of body mass index and DNA methylation in blood using participants from the Sister Study cohort.

PubMed

Wilson, L E; Harlid, S; Xu, Z; Sandler, D P; Taylor, J A

2017-01-01

The relationship between obesity and chronic disease risk is well-established; the underlying biological mechanisms driving this risk increase may include obesity-related epigenetic modifications. To explore this hypothesis, we conducted a genome-wide analysis of DNA methylation and body mass index (BMI) using data from a subset of women in the Sister Study. The Sister Study is a cohort of 50 884 US women who had a sister with breast cancer but were free of breast cancer themselves at enrollment. Study participants completed examinations which included measurements of height and weight, and provided blood samples. Blood DNA methylation data generated with the Illumina Infinium HumanMethylation27 BeadChip array covering 27,589 CpG sites was available for 871 women from a prior study of breast cancer and DNA methylation. To identify differentially methylated CpG sites associated with BMI, we analyzed this methylation data using robust linear regression with adjustment for age and case status. For those CpGs passing the false discovery rate significance level, we examined the association in a replication set comprised of a non-overlapping group of 187 women from the Sister Study who had DNA methylation data generated using the Infinium HumanMethylation450 BeadChip array. Analysis of this expanded 450 K array identified additional BMI-associated sites which were investigated with targeted pyrosequencing. Four CpG sites reached genome-wide significance (false discovery rate (FDR) q<0.05) in the discovery set and associations for all four were significant at strict Bonferroni correction in the replication set. An additional 23 sites passed FDR in the replication set and five were replicated by pyrosequencing in the discovery set. Several of the genes identified including ANGPT4, RORC, SOCS3, FSD2, XYLT1, ABCG1, STK39, ASB2 and CRHR2 have been linked to obesity and obesity-related chronic diseases. Our findings support the hypothesis that obesity-related epigenetic differences are detectable in blood and may be related to risk of chronic disease.

DHA-rich n-3 fatty acid supplementation decreases DNA methylation in blood leukocytes: the OmegAD study.

PubMed

Karimi, Mohsen; Vedin, Inger; Freund Levi, Yvonne; Basun, Hans; Faxén Irving, Gerd; Eriksdotter, Maria; Wahlund, Lars-Olof; Schultzberg, Marianne; Hjorth, Erik; Cederholm, Tommy; Palmblad, Jan

2017-10-01

Background: Dietary fish oils, rich in long-chain n-3 (ω-3) fatty acids (FAs) [e.g., docosahexaenoic acid (DHA, 22:6n-3) and eicosapentaenoic acid (EPA, 20:5n-3)], modulate inflammatory reactions through various mechanisms, including gene expression, which is measured as messenger RNA concentration. However, the effects of long-term treatment of humans with DHA and EPA on various epigenetic factors-such as DNA methylation, which controls messenger RNA generation-are poorly described. Objective: We wanted to determine the effects of 6 mo of dietary supplementation with an n-3 FA preparation rich in DHA on global DNA methylation of peripheral blood leukocytes (PBLs) and the relation to plasma EPA and DHA concentrations in Alzheimer disease (AD) patients. Design: In the present study, DNA methylation in four 5'-cytosine-phosphate-guanine-3' (CpG) sites of long interspersed nuclear element-1 repetitive sequences was assessed in a group of 63 patients (30 given the n-3 FA preparation and 33 given placebo) as an estimation of the global DNA methylation in blood cells. Patients originated from the randomized, double-blind, placebo-controlled OmegAD study, in which 174 AD patients received either 1.7 g DHA and 0.6 g EPA (the n-3 FA group) or placebo daily for 6 mo. Results: At 6 mo, the n-3 FA group displayed marked increases in DHA and EPA plasma concentrations (2.6- and 3.5-fold), as well as decreased methylation in 2 out of 4 CpG sites ( P < 0.05 for all), respectively. This hypomethylation in CpG2 and CpG4 sites showed a reverse correlation to changes in plasma EPA concentration ( r = -0.25, P = 0.045; and r = -0.26, P = 0.041, respectively), but not to changes in plasma DHA concentration, and were not related to apolipoprotein E-4 allele frequency. Conclusion: Supplementation with n-3 FA for 6 mo was associated with global DNA hypomethylation in PBLs. Our data may be of importance in measuring various effects of marine oils, including gene expression, in patients with AD and in other patients taking n-3 FA supplements. This trial was registered at clinicaltrials.gov as NCT00211159. © 2017 American Society for Nutrition.

Cationic liposomes containing soluble Leishmania antigens (SLA) plus CpG ODNs induce protection against murine model of leishmaniasis.

PubMed

Heravi Shargh, Vahid; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jalali, Seyed Amir; Firouzmand, Hengameh; Abbasi, Azam; Badiee, Ali

2012-07-01

Development of an effective vaccine against leishmaniasis is possible due to the fact that individuals cured from cutaneous leishmaniasis (CL) are protected from further infection. First generation Leishmania vaccines consisting of whole killed parasites reached to phase 3 clinical trials but failed to show enough efficacies mainly due to the lack of an appropriate adjuvant. In this study, an efficient liposomal protein-based vaccine against Leishmania major infection was developed using soluble Leishmania antigens (SLA) as a first generation vaccine and cytidine phosphate guanosine oligodeoxynucleotides (CpG ODNs) as an immunostimulatory adjuvant. 1, 2-Dioleoyl-3-trimethylammonium-propane was used as a cationic lipid to prepare the liposomes due to its intrinsic adjuvanticity. BALB/c mice were immunized subcutaneously (SC), three times in 2-week intervals, with Lip-SLA-CpG, Lip-SLA, SLA + CpG, SLA, or HEPES buffer. As criteria for protection, footpad swelling at the site of challenge and spleen parasite loads were assessed, and the immune responses were evaluated by determination of IFN-γ and IL-4 levels of cultured splenocytes, and IgG subtypes. The group of mice that received Lip-SLA-CpG showed a significantly smaller footpad swelling, lower spleen parasite burden, higher IgG2a antibody, and lower IL-4 level compared to the control groups. It is concluded that cationic liposomes containing SLA and CpG ODNs are appropriate to induce Th1 type of immune response and protection against leishmaniasis.

A systematic review of clinical practice guidelines and best practice statements for the diagnosis and management of varicocele in children and adolescents.

PubMed

Roque, Matheus; Esteves, Sandro C

2016-01-01

A systematic review was conducted to identify and qualitatively analyze the methods as well as recommendations of Clinical Practice Guidelines (CPG) and Best Practice Statements (BPS) concerning varicocele in the pediatric and adolescent population. An electronic search was performed with the MEDLINE, EMBASE, Science Direct, and Scielo databases, as well as guidelines' Web sites until September 2015. Four guidelines were included in the qualitative synthesis. In general, the recommendations provided by the CPG/BPS were consistent despite the existence of some gaps across the studies. The guidelines issued by the American Urological Association (AUA) and American Society for Reproductive Medicine (ASRM) did not provide evidence-based levels for the recommendations given. Most of the recommendations given by the European Association of Urology (EAU) and European Society of Pediatric Urology (ESPU) were derived from nonrandomized clinical trials, retrospective studies, and expert opinion. Among all CPG/BPS, only one was specifically designed for the pediatric population. The studied guidelines did not undertake independent cost-effectiveness and risk-benefit analysis. The main objectives of these guidelines were to translate the best evidence into practice and provide a framework of standardized care while maintaining clinical autonomy and physician judgment. However, the limitations identified in the CPG/BPS for the diagnosis and management of varicocele in children and adolescents indicate ample opportunities for research and future incorporation of higher quality standards in patient care.

DNA methylation levels in candidate genes associated with chronological age in mammals are not conserved in a long-lived seabird

PubMed Central

Polanowski, Andrea M.; McMahon, Clive; Deagle, Bruce E.; Dickinson, Joanne L.; Hindell, Mark A.; Jarman, Simon N.

2017-01-01

Most seabirds do not have any outward identifiers of their chronological age, so estimation of seabird population age structure generally requires expensive, long-term banding studies. We investigated the potential to use a molecular age biomarker to estimate age in short-tailed shearwaters (Ardenna tenuirostris). We quantified DNA methylation in several A. tenuirostris genes that have shown age-related methylation changes in mammals. In birds ranging from chicks to 21 years of age, bisulphite treated blood and feather DNA was sequenced and methylation levels analysed in 67 CpG sites in 13 target gene regions. From blood samples, five of the top relationships with age were identified in KCNC3 loci (CpG66: R2 = 0.325, p = 0.019). In feather samples ELOVL2 (CpG42: R2 = 0.285, p = 0.00048) and EDARADD (CpG46: R2 = 0.168, p = 0.0067) were also weakly correlated with age. However, the majority of markers had no clear association with age (of 131 comparisons only 12 had a p-value < 0.05) and statistical analysis using a penalised lasso approach did not produce an accurate ageing model. Our data indicate that some age-related signatures identified in orthologous mammalian genes are not conserved in the long-lived short tailed shearwater. Alternative molecular approaches will be required to identify a reliable biomarker of chronological age in these seabirds. PMID:29216256

DNA Methylation Suppresses Expression of the Urea Cycle Enzyme Carbamoyl Phosphate Synthetase 1 (CPS1) in Human Hepatocellular Carcinoma

PubMed Central

Liu, Hongyan; Dong, Huijia; Robertson, Keith; Liu, Chen

2011-01-01

Carbamoyl phosphate synthetase 1 (CPS1) is a liver-specific, intramitochondrial, rate-limiting enzyme in the urea cycle. A previous study showed that CPS1 is the antigen for hepatocyte paraffin 1 antibody, a commonly used antibody in surgical pathology practice; and CPS1 expression appears to be down-regulated in liver cancer tissue and cell lines. The aim of this study is to understand how the CPS1 gene is regulated in liver carcinogenesis. In this report, we show that human hepatocellular carcinoma (HCC) cells do not express CPS1, whereas cultured human primary hepatocytes express abundant levels. In addition, CPS1 was silenced or down-regulated in liver tumor tissues compared with the matched noncancerous tissues. The expression of CPS1 in HCC cells was restored with a demethylation agent, 5-azacytidine. We show that two CpG dinucleotides, located near the transcription start site, and a CpG-rich region in the first intron were hypermethylated in HCC cells. The hypermethylation of the two CpG dinucleotides was also detected in HCC tumor tissues compared with noncancerous tissues. Further molecular analysis with mutagenesis indicated that the two CpG dinucleotides play a role in promoter activity of the CPS1 gene. In conclusion, our study demonstrates that DNA methylation is a key mechanism of silencing CPS1 expression in human HCC cells, and CPS1 gene hypermethylation of the two CpG dinucleotides is a potential biomarker for HCC. PMID:21281797

3-Hydroxy-3-methylglutaryl CoA lyase (HL): Mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, S.P.; Robert, M.F.; Mitchell, G.A.

1996-04-01

3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither amore » TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.« less

CpG Island Methylator Phenotype-High Colorectal Cancers and Their Prognostic Implications and Relationships with the Serrated Neoplasia Pathway

PubMed Central

Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon

2017-01-01

The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway. PMID:27885175

Design and control of an embedded vision guided robotic fish with multiple control surfaces.

PubMed

Yu, Junzhi; Wang, Kai; Tan, Min; Zhang, Jianwei

2014-01-01

This paper focuses on the development and control issues of a self-propelled robotic fish with multiple artificial control surfaces and an embedded vision system. By virtue of the hybrid propulsion capability in the body plus the caudal fin and the complementary maneuverability in accessory fins, a synthesized propulsion scheme including a caudal fin, a pair of pectoral fins, and a pelvic fin is proposed. To achieve flexible yet stable motions in aquatic environments, a central pattern generator- (CPG-) based control method is employed. Meanwhile, a monocular underwater vision serves as sensory feedback that modifies the control parameters. The integration of the CPG-based motion control and the visual processing in an embedded microcontroller allows the robotic fish to navigate online. Aquatic tests demonstrate the efficacy of the proposed mechatronic design and swimming control methods. Particularly, a pelvic fin actuated sideward swimming gait was first implemented. It is also found that the speeds and maneuverability of the robotic fish with coordinated control surfaces were largely superior to that of the swimming robot propelled by a single control surface.

Design and Control of an Embedded Vision Guided Robotic Fish with Multiple Control Surfaces

PubMed Central

Wang, Kai; Tan, Min; Zhang, Jianwei

2014-01-01

This paper focuses on the development and control issues of a self-propelled robotic fish with multiple artificial control surfaces and an embedded vision system. By virtue of the hybrid propulsion capability in the body plus the caudal fin and the complementary maneuverability in accessory fins, a synthesized propulsion scheme including a caudal fin, a pair of pectoral fins, and a pelvic fin is proposed. To achieve flexible yet stable motions in aquatic environments, a central pattern generator- (CPG-) based control method is employed. Meanwhile, a monocular underwater vision serves as sensory feedback that modifies the control parameters. The integration of the CPG-based motion control and the visual processing in an embedded microcontroller allows the robotic fish to navigate online. Aquatic tests demonstrate the efficacy of the proposed mechatronic design and swimming control methods. Particularly, a pelvic fin actuated sideward swimming gait was first implemented. It is also found that the speeds and maneuverability of the robotic fish with coordinated control surfaces were largely superior to that of the swimming robot propelled by a single control surface. PMID:24688413

Spatiotemporal clustering of the epigenome reveals rules of dynamic gene regulation

PubMed Central

Yu, Pengfei; Xiao, Shu; Xin, Xiaoyun; Song, Chun-Xiao; Huang, Wei; McDee, Darina; Tanaka, Tetsuya; Wang, Ting; He, Chuan; Zhong, Sheng

2013-01-01

Spatial organization of different epigenomic marks was used to infer functions of the epigenome. It remains unclear what can be learned from the temporal changes of the epigenome. Here, we developed a probabilistic model to cluster genomic sequences based on the similarity of temporal changes of multiple epigenomic marks during a cellular differentiation process. We differentiated mouse embryonic stem (ES) cells into mesendoderm cells. At three time points during this differentiation process, we used high-throughput sequencing to measure seven histone modifications and variants—H3K4me1/2/3, H3K27ac, H3K27me3, H3K36me3, and H2A.Z; two DNA modifications—5-mC and 5-hmC; and transcribed mRNAs and noncoding RNAs (ncRNAs). Genomic sequences were clustered based on the spatiotemporal epigenomic information. These clusters not only clearly distinguished gene bodies, promoters, and enhancers, but also were predictive of bidirectional promoters, miRNA promoters, and piRNAs. This suggests specific epigenomic patterns exist on piRNA genes much earlier than germ cell development. Temporal changes of H3K4me2, unmethylated CpG, and H2A.Z were predictive of 5-hmC changes, suggesting unmethylated CpG and H3K4me2 as potential upstream signals guiding TETs to specific sequences. Several rules on combinatorial epigenomic changes and their effects on mRNA expression and ncRNA expression were derived, including a simple rule governing the relationship between 5-hmC and gene expression levels. A Sox17 enhancer containing a FOXA2 binding site and a Foxa2 enhancer containing a SOX17 binding site were identified, suggesting a positive feedback loop between the two mesendoderm transcription factors. These data illustrate the power of using epigenome dynamics to investigate regulatory functions. PMID:23033340

Differential DNA methylation profile of key genes in malignant prostate epithelial cells transformed by inorganic arsenic or cadmium.

PubMed

Pelch, Katherine E; Tokar, Erik J; Merrick, B Alex; Waalkes, Michael P

2015-08-01

Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10μM Cd for 11weeks (CTPE) or 5μM iAs for 29weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1) were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (>25-fold) and S100P (>40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (>15-fold) and NTM (>1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. Published by Elsevier Inc.

Feed forward and feedback control for over-ground locomotion in anaesthetized cats

NASA Astrophysics Data System (ADS)

Mazurek, K. A.; Holinski, B. J.; Everaert, D. G.; Stein, R. B.; Etienne-Cummings, R.; Mushahwar, V. K.

2012-04-01

The biological central pattern generator (CPG) integrates open and closed loop control to produce over-ground walking. The goal of this study was to develop a physiologically based algorithm capable of mimicking the biological system to control multiple joints in the lower extremities for producing over-ground walking. The algorithm used state-based models of the step cycle each of which produced different stimulation patterns. Two configurations were implemented to restore over-ground walking in five adult anaesthetized cats using intramuscular stimulation (IMS) of the main hip, knee and ankle flexor and extensor muscles in the hind limbs. An open loop controller relied only on intrinsic timing while a hybrid-CPG controller added sensory feedback from force plates (representing limb loading), and accelerometers and gyroscopes (representing limb position). Stimulation applied to hind limb muscles caused extension or flexion in the hips, knees and ankles. A total of 113 walking trials were obtained across all experiments. Of these, 74 were successful in which the cats traversed 75% of the 3.5 m over-ground walkway. In these trials, the average peak step length decreased from 24.9 ± 8.4 to 21.8 ± 7.5 (normalized units) and the median number of steps per trial increased from 7 (Q1 = 6, Q3 = 9) to 9 (8, 11) with the hybrid-CPG controller. Moreover, within these trials, the hybrid-CPG controller produced more successful steps (step length ≤ 20 cm ground reaction force ≥ 12.5% body weight) than the open loop controller: 372 of 544 steps (68%) versus 65 of 134 steps (49%), respectively. This supports our previous preliminary findings, and affirms that physiologically based hybrid-CPG approaches produce more successful stepping than open loop controllers. The algorithm provides the foundation for a neural prosthetic controller and a framework to implement more detailed control of locomotion in the future.

Feed forward and feedback control for over-ground locomotion in anaesthetized cats

PubMed Central

Mazurek, K A; Holinski, B J; Everaert, D G; Stein, R B; Etienne-Cummings, R; Mushahwar, V K

2012-01-01

The biological central pattern generator (CPG) integrates open and closed loop control to produce over-ground walking. The goal of this study was to develop a physiologically based algorithm capable of mimicking the biological system to control multiple joints in the lower extremities for producing over-ground walking. The algorithm used state-based models of the step cycle each of which produced different stimulation patterns. Two configurations were implemented to restore over-ground walking in five adult anaesthetized cats using intramuscular stimulation (IMS) of the main hip, knee and ankle flexor and extensor muscles in the hind limbs. An open loop controller relied only on intrinsic timing while a hybrid-CPG controller added sensory feedback from force plates (representing limb loading), and accelerometers and gyroscopes (representing limb position). Stimulation applied to hind limb muscles caused extension or flexion in the hips, knees and ankles. A total of 113 walking trials were obtained across all experiments. Of these, 74 were successful in which the cats traversed 75% of the 3.5 m over-ground walkway. In these trials, the average peak step length decreased from 24.9 ± 8.4 to 21.8 ± 7.5 (normalized units) and the median number of steps per trial increased from 7 (Q1=6, Q3 = 9) to 9 (8, 11) with the hybrid-CPG controller. Moreover, these trials, the hybrid-CPG controller produced more successful steps (step length ≤ 20 cm; ground reaction force ≥ 12.5% body weight) than the open loop controller: 372 of 544 steps (68%) versus 65 of 134 steps (49%), respectively. This supports our previous preliminary findings, and affirms that physiologically based hybrid-CPG approaches produce more successful stepping than open loop controllers. The algorithm provides the foundation for a neural prosthetic controller and a framework to implement more detailed control of locomotion in the future. PMID:22328615

Identification of body fluid-specific DNA methylation markers for use in forensic science.

PubMed

Park, Jong-Lyul; Kwon, Oh-Hyung; Kim, Jong Hwan; Yoo, Hyang-Sook; Lee, Han-Chul; Woo, Kwang-Man; Kim, Seon-Young; Lee, Seung-Hwan; Kim, Yong Sung

2014-11-01

DNA methylation, which occurs at the 5'-position of the cytosine in CpG dinucleotides, has great potential for forensic identification of body fluids, because tissue-specific patterns of DNA methylation have been demonstrated, and DNA is less prone to degradation than proteins or RNA. Previous studies have reported several body fluid-specific DNA methylation markers, but DNA methylation differences are sometimes low in saliva and vaginal secretions. Moreover, specific DNA methylation markers in four types of body fluids (blood, saliva, semen, and vaginal secretions) have not been investigated with genome-wide profiling. Here, we investigated novel DNA methylation markers for identification of body fluids for use in forensic science using the Illumina HumanMethylation 450K bead array, which contains over 450,000 CpG sites. Using methylome data from 16 samples of blood, saliva, semen, and vaginal secretions, we first selected 2986 hypermethylated or hypomethylated regions that were specific for each type of body fluid. We then selected eight CpG sites as novel, forensically relevant DNA methylation markers: cg06379435 and cg08792630 for blood, cg26107890 and cg20691722 for saliva, cg23521140 and cg17610929 for semen, and cg01774894 and cg14991487 for vaginal secretions. These eight selected markers were evaluated in 80 body fluid samples using pyrosequencing, and all showed high sensitivity and specificity for identification of the target body fluid. We suggest that these eight DNA methylation markers may be good candidates for developing an effective molecular assay for identification of body fluids in forensic science. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

CpG island methylation phenotype (CIMP) in oral cancer: associated with a marked inflammatory response and less aggressive tumour biology.

PubMed

Shaw, Richard J; Hall, Gillian L; Lowe, Derek; Bowers, Naomi L; Liloglou, Triantafillos; Field, John K; Woolgar, Julia A; Risk, Janet M

2007-10-01

Studies in several tumour sites highlight the significance of the CpG island methylation phenotype (CIMP), with distinct features of histology, biological aggression and outcome. We utilise pyrosequencing techniques of quantitative methylation analysis to investigate the presence of CIMP in oral squamous cell carcinoma (OSCC) for the first time, and evaluate its correlation with allelic imbalance, pathology and clinical behaviour. Tumour tissue, control tissue and PBLs were obtained from 74 patients with oral squamous cell carcinoma. Pyrosequencing was used to analyse methylation patterns in 75-200 bp regions of the CpG rich gene promoters of 10 genes with a broad range of cellular functions. Allelic imbalance was investigated using a multiplexed panel of 11 microsatellite markers. Corresponding variables, histopathological staging and grading were correlated with these genetic and epigenetic aberrations. A cluster of tumours with a greater degree of promoter methylation than would be predicted by chance alone (P=0.001) were designated CIMP+ve. This group had less aggressive tumour biology in terms of tumour thickness (p=0.015) and nodal metastasis (P=0.012), this being apparently independent of tumour diameter. Further, it seems that these CIMP+ve tumours excited a greater host inflammatory response (P=0.019). The exact mechanisms underlying CIMP remain obscure but the association with a greater inflammatory host response supports existing theories relating these features in other tumour sites. As CIMP has significant associations with other well documented prognostic indicators, it may prove beneficial to include methylation analyses in molecular risk modelling of tumours.

Obesity and menopause modify the epigenomic profile of breast cancer.

PubMed

Crujeiras, Ana B; Diaz-Lagares, Angel; Stefansson, Olafur A; Macias-Gonzalez, Manuel; Sandoval, Juan; Cueva, Juan; Lopez-Lopez, Rafael; Moran, Sebastian; Jonasson, Jon G; Tryggvadottir, Laufey; Olafsdottir, Elinborg; Tinahones, Francisco J; Carreira, Marcos C; Casanueva, Felipe F; Esteller, Manel

2017-07-01

Obesity is a high risk factor for breast cancer. This relationship could be marked by a specific methylome. The current work was aimed to explore the impact of obesity and menopausal status on variation in breast cancer methylomes. Data from Infinium 450K array-based methylomes of 64 breast tumors were coupled with information on BMI and menopausal status. Additionally, DNA methylation results were validated in 18 non-tumor and 81 tumor breast samples. Breast tumors arising in either pre- or postmenopausal women stratified by BMI or menopausal status alone were not associated with a specific DNA methylation pattern. Intriguingly, the DNA methylation pattern identified in association with the high-risk group (postmenopausal women with high BMI (>25) and premenopausal women with normal or low BMI < 25) exclusively characterized by hypermethylation of 1287 CpG sites as compared with the low-risk group. These CpG sites included the promoter region of fourteen protein-coding genes of which CpG methylation over the ZNF577 promoter region represents the top scoring associated event. In an independent cohort, the ZNF577 promoter methylation remained statistically significant in association with the high-risk group. Additionally, the impact of ZNF577 promoter methylation on mRNA expression levels was demonstrated in breast cancer cell lines after treatment with a demethylating agent (5-azacytidine). In conclusion, the epigenome of breast tumors is affected by a complex interaction between BMI and menopausal status. The ZNF577 methylation quantification is clearly relevant for the development of novel biomarkers of precision therapy in breast cancer. © 2017 Society for Endocrinology.

TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

PubMed Central

Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

2016-01-01

Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

A molecular model for proflavine-DNA intercalation.

PubMed Central

Neidle, S; Pearl, L H; Herzyk, P; Berman, H M

1988-01-01

A molecular model has been derived for the intercalation of proflavine into the CpG site of the decamer duplex of d(GATACGATAC). The starting geometry of the intercalation site was taken from previous crystallographic studies on the d(CpG)-proflavine complex, and molecular mechanics used to obtain a stereochemically acceptable structure. This has widened grooves compared to standard A- or B- double helices, as well as distinct conformational, roll, twist and tilt features. PMID:3174439

Epigenetic Control of Gonadal Aromatase (cyp19a1) in Temperature-Dependent Sex Determination of Red-Eared Slider Turtles

PubMed Central

Matsumoto, Yuiko; Buemio, Alvin; Chu, Randy; Vafaee, Mozhgon; Crews, David

2013-01-01

In the red-eared slider turtle (Trachemys scripta), a species with temperature-dependent sex determination (TSD), the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5′-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5′-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX) and vertebrate steroidogenic factor 1 (SF1) and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development. PMID:23762231

Implementation of antibiotic use guidelines for fresh traumatic wound at Siriraj Hospital.

PubMed

Sirijatuphat, Rujipas; Choochan, Tanatchon; Siritongtaworn, Preecha; Sripojtham, Vipaporn; Thamlikitkul, Visanu

2015-03-01

To determine the effectiveness of implementing a clinical practice guideline (CPG) on antibiotic use for adults with fresh traumatic wounds who attended the trauma center at Siriraj Hospital, Bangkok. A prospective study of 600 adult patients who had fresh traumatic wounds (≤ 6 hours) was conducted at Siriraj Trauma Center from March 2013 to March 2014. The CPG was introduced to physicians, nurses and medical students by posting the CPG at the patient care areas of the trauma center. The outcomes were an appropriate classification of wounds according to the CPG recommendations, prevalence of antibiotic prescribing, incidence of wound infection and compliance with the CPG. Clean-contaminated wounds that did not need antibiotic treatment and clean-contaminated and contaminated wounds that required antibiotics were observed in 63.2, 6.7, and 30.1% ofthe patients, respectively. Antibiotics were given to 512 patients (85.3%). Infections occurred in six patients (1.0%). Antibiotic prescription according to CPG recommendations was observed for 243 patients (40.5%). The prevalence of antibiotic use in the CPG-compliant group (65.8%) was significantly less than that in the CPG-noncompliant group (98.6%) (p < 0.001). The patients in the CPG-compliant group had more contaminated wounds than those in the CPG-noncompliant group (51.4 vs. 15.7%, p < 0.001). The incidences of wound infection were very low in both groups and not significantly different (1.2 vs. 0.8%, p = 0.690). Antibiotic prophylaxis was necessary in less than 36.8% of adults with fresh traumatic wounds who attended Siriraj Trauma Center Compliance to CPG implementation using simple intervention seemed to be low. Adhering to CPG recommendations for antibiotic prophylaxis in adults with fresh traumatic wounds can reduce the unnecessary prescribing of antibiotics without increasing the rate of wound infection.

Selection for avian leukosis virus integration sites determines the clonal progression of B-cell lymphomas

PubMed Central

Malhotra, Sanandan; Justice, James; Morgan, Robin

2017-01-01

Avian leukosis virus (ALV) is a simple retrovirus that causes a wide range of tumors in chickens, the most common of which are B-cell lymphomas. The viral genome integrates into the host genome and uses its strong promoter and enhancer sequences to alter the expression of nearby genes, frequently inducing tumors. In this study, we compare the preferences for ALV integration sites in cultured cells and in tumors, by analysis of over 87,000 unique integration sites. In tissue culture we observed integration was relatively random with slight preferences for genes, transcription start sites and CpG islands. We also observed a preference for integrations in or near expressed and spliced genes. The integration pattern in cultured cells changed over the course of selection for oncogenic characteristics in tumors. In comparison to tissue culture, ALV integrations are more highly selected for proximity to transcription start sites in tumors. There is also a significant selection of ALV integrations away from CpG islands in the highly clonally expanded cells in tumors. Additionally, we utilized a high throughput method to quantify the magnitude of clonality in different stages of tumorigenesis. An ALV-induced tumor carries between 700 and 3000 unique integrations, with an average of 2.3 to 4 copies of proviral DNA per infected cell. We observed increasing tumor clonality during progression of B-cell lymphomas and identified gene players (especially TERT and MYB) and biological processes involved in tumor progression. PMID:29099869

Interferon-gamma promoter hypomethylation and increased expression in chronic periodontitis

PubMed Central

Zhang, Shaoping; Crivello, Antonino; Offenbacher, Steven; Moretti, Antonio; Paquette, David W.; Barros, Silvana P.

2011-01-01

Aim The goal of this investigation was to determine whether epigenetic modifications in the IFNG promoter are associated with an increase of IFNG transcription in different stages of periodontal diseases. Materials and Methods DNA was extracted from gingival biopsy samples collected from 47 total sites from 47 different subjects: 23 periodontally healthy sites, 12 experimentally induced gingivitis sites and 12 chronic periodontitis sites. Levels of DNA methylation within the IFNG promoter containing six CpG dinucleotides were determined using pyrosequencing technology. Interferon gamma mRNA expression was analysed by quantitative polymerase chain reactions using isolated RNA from part of the biological samples mentioned above. Results The methylation level of all six analysed CpG sites within the IFNG promoter region in the periodontitis biopsies {52% [interquartile range, IQR (43.8%, 63%)]} was significantly lower than periodontally healthy samples {62% [IQR (51.3%, 74%)], p =0.007} and gingivitis biopsies {63% [IQR (55%, 74%)], p =0.02}. The transcriptional level of IFNG in periodontitis biopsies was 1.96-fold and significantly higher than tissues with periodontal health (p =0.04). Although the mRNA level from experimental gingivitis samples exhibited an 8.5-fold increase as compared with periodontally healthy samples, no significant methylation difference was observed in experimental gingivitis sample. Conclusions A hypomethylation profile within IFNG promoter region is related to an increase of IFNG transcription present in the chronic periodontitis biopsies, while such an increase of IFNG in experimentally induced gingivitis seems independent of promoter methylation alteration. PMID:20958339

A systematic review of recent clinical practice guidelines and best practice statements for the evaluation of the infertile male.

PubMed

Esteves, Sandro C; Chan, Peter

2015-09-01

We systematically identified and reviewed the methods and consistency of recommendations of recently developed clinical practice guidelines (CPG) and best practice statements (BPS) on the evaluation of the infertile male. MEDLINE and related engines as well as guidelines' Web sites were searched for CPG and BPS written in English on the general evaluation of male infertility published between January 2008 and April 2015. Four guidelines were identified, all of which reported to have been recently updated. Systematic review was not consistently used in the BPS despite being reported in the CPG. Only one of them reported having a patient representative in its development team. The CPG issued by the European Association of Urology (EAU) graded some recommendations and related that to levels (but not quality) of evidence. Overall, the BPS issued respectively by the American Urological Association and American Society for Reproductive Medicine concurred with each other, but both differed from the EAU guidelines with regard to methods of collection, extraction and interpretation of data. None of the guidelines incorporated health economics. Important specific limitations of conventional semen analysis results were ignored by all guidelines. Besides variation in the methodological quality, implementation strategies were not reported in two out of four guidelines. While the various panels of experts who contributed to the development of the CPG and BPS reviewed should be commended on their tremendous efforts aiming to establish a clinical standard in both the evaluation and management of male infertility, we recognized inconsistencies in the methodology of their synthesis and in the contents of their final recommendations. These discrepancies pose a barrier in the general implementation of these guidelines and may limit their utility in standardizing clinical practice or improving health-related outcomes. Continuous efforts are needed to generate high-quality evidence to allow further development of these important guidelines for the evaluation and management of males suffering from infertility.

DNA Methylation and BMI: Investigating Identified Methylation Sites at HIF3A in a Causal Framework.

PubMed

Richmond, Rebecca C; Sharp, Gemma C; Ward, Mary E; Fraser, Abigail; Lyttleton, Oliver; McArdle, Wendy L; Ring, Susan M; Gaunt, Tom R; Lawlor, Debbie A; Davey Smith, George; Relton, Caroline L

2016-05-01

Multiple differentially methylated sites and regions associated with adiposity have now been identified in large-scale cross-sectional studies. We tested for replication of associations between previously identified CpG sites at HIF3A and adiposity in ∼1,000 mother-offspring pairs from the Avon Longitudinal Study of Parents and Children (ALSPAC). Availability of methylation and adiposity measures at multiple time points, as well as genetic data, allowed us to assess the temporal associations between adiposity and methylation and to make inferences regarding causality and directionality. Overall, our results were discordant with those expected if HIF3A methylation has a causal effect on BMI and provided more evidence for causality in the reverse direction (i.e., an effect of BMI on HIF3A methylation). These results are based on robust evidence from longitudinal analyses and were also partially supported by Mendelian randomization analysis, although this latter analysis was underpowered to detect a causal effect of BMI on HIF3A methylation. Our results also highlight an apparent long-lasting intergenerational influence of maternal BMI on offspring methylation at this locus, which may confound associations between own adiposity and HIF3A methylation. Further work is required to replicate and uncover the mechanisms underlying the direct and intergenerational effect of adiposity on DNA methylation. © 2016 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

Expression profiling of clonal lymphocyte cell cultures from Rett syndrome patients

USDA-ARS?s Scientific Manuscript database

More than 85% of Rett syndrome (RTT) patients have heterozygous mutations in the X-linked MECP2 gene which encodes methyl-CpG-binding protein 2, a transcriptional repressor that binds methylated CpG sites. Because MECP2 is subject to X chromosome inactivation (XCI), girls with RTT express either the...

Sexual epigenetic dimorphism in the human placenta: implications for susceptibility during the prenatal period.

PubMed

Martin, Elizabeth; Smeester, Lisa; Bommarito, Paige A; Grace, Matthew R; Boggess, Kim; Kuban, Karl; Karagas, Margaret R; Marsit, Carmen J; O'Shea, T Michael; Fry, Rebecca C

2017-03-01

Sex-based differences in response to adverse prenatal environments and infant outcomes have been observed, yet the underlying mechanisms for this are unclear. The placental epigenome may be a driver of these differences. Placental DNA methylation was assessed at more than 480,000 CpG sites from male and female infants enrolled in the extremely low gestational age newborns cohort (ELGAN) and validated in a separate US-based cohort. The impact of gestational age on placental DNA methylation was further examined using the New Hampshire Birth Cohort Study for a total of n = 467 placentas. A total of n = 2745 CpG sites, representing n = 587 genes, were identified as differentially methylated (p < 1 × 10 -7 ). The majority (n = 582 or 99%) of these were conserved among the New Hampshire Birth Cohort. The identified genes encode proteins related to immune function, growth/transcription factor signaling and transport across cell membranes. These data highlight sex-dependent epigenetic patterning in the placenta and provide insight into differences in infant outcomes and responses to the perinatal environment.

DNA Methylation Errors in Cloned Mouse Sperm by Germ Line Barrier Evasion.

PubMed

Koike, Tasuku; Wakai, Takuya; Jincho, Yuko; Sakashita, Akihiko; Kobayashi, Hisato; Mizutani, Eiji; Wakayama, Sayaka; Miura, Fumihito; Ito, Takashi; Kono, Tomohiro

2016-06-01

The germ line reprogramming barrier resets parental epigenetic modifications according to sex, conferring totipotency to mammalian embryos upon fertilization. However, it is not known whether epigenetic errors are committed during germ line reprogramming that are then transmitted to germ cells, and consequently to offspring. We addressed this question in the present study by performing a genome-wide DNA methylation analysis using a target postbisulfite sequencing method in order to identify DNA methylation errors in cloned mouse sperm. The sperm genomes of two somatic cell-cloned mice (CL1 and CL7) contained significantly higher numbers of differentially methylated CpG sites (P = 0.0045 and P = 0.0116). As a result, they had higher numbers of differentially methylated CpG islands. However, there was no evidence that these sites were transmitted to the sperm genome of offspring. These results suggest that DNA methylation errors resulting from embryo cloning are transmitted to the sperm genome by evading the germ line reprogramming barrier. © 2016 by the Society for the Study of Reproduction, Inc.

New insights into replication origin characteristics in metazoans

PubMed Central

Puy, Aurore; Rialle, Stéphanie; Kaplan, Noam; Segal, Eran

2012-01-01

We recently reported the identification and characterization of DNA replication origins (Oris) in metazoan cell lines. Here, we describe additional bioinformatic analyses showing that the previously identified GC-rich sequence elements form origin G-rich repeated elements (OGREs) that are present in 67% to 90% of the DNA replication origins from Drosophila to human cells, respectively. Our analyses also show that initiation of DNA synthesis takes place precisely at 160 bp (Drosophila) and 280 bp (mouse) from the OGRE. We also found that in most CpG islands, an OGRE is positioned in opposite orientation on each of the two DNA strands and detected two sites of initiation of DNA synthesis upstream or downstream of each OGRE. Conversely, Oris not associated with CpG islands have a single initiation site. OGRE density along chromosomes correlated with previously published replication timing data. Ori sequences centered on the OGRE are also predicted to have high intrinsic nucleosome occupancy. Finally, OGREs predict G-quadruplex structures at Oris that might be structural elements controlling the choice or activation of replication origins. PMID:22373526

Associations among oxytocin receptor gene (OXTR) DNA methylation in adulthood, exposure to early life adversity, and childhood trajectories of anxiousness.

PubMed

Gouin, J P; Zhou, Q Q; Booij, L; Boivin, M; Côté, S M; Hébert, M; Ouellet-Morin, I; Szyf, M; Tremblay, R E; Turecki, G; Vitaro, F

2017-08-07

Recent models propose deoxyribonucleic acid methylation of key neuro-regulatory genes as a molecular mechanism underlying the increased risk of mental disorder associated with early life adversity (ELA). The goal of this study was to examine the association of ELA with oxytocin receptor gene (OXTR) methylation among young adults. Drawing from a 21-year longitudinal cohort, we compared adulthood OXTR methylation frequency of 46 adults (23 males and 23 females) selected for high or low ELA exposure based on childhood socioeconomic status and exposure to physical and sexual abuse during childhood and adolescence. Associations between OXTR methylation and teacher-rated childhood trajectories of anxiousness were also assessed. ELA exposure was associated with one significant CpG site in the first intron among females, but not among males. Similarly, childhood trajectories of anxiousness were related to one significant CpG site within the promoter region among females, but not among males. This study suggests that females might be more sensitive to the impact of ELA on OXTR methylation than males.

Are food and beverage purchases in households with preschoolers changing?: a longitudinal analysis from 2000 to 2011.

PubMed

Ford, Christopher N; Ng, Shu Wen; Popkin, Barry M

2014-09-01

U.S. dietary studies from 2003 to 2010 show decreases in children's caloric intake. We examined purchases of consumer packaged foods/beverages in the U.S. between 2000 and 2011 among households with children aged 2-5 years. To describe changes in consumer packaged goods (CPG) purchases between 2000 and 2011 after adjusting for economic indicators, and explore differences by race, education, and household income level. CPG purchase data were obtained for 42,753 U.S. households with one or more child aged 2-5 years using the Nielsen Homescan Panel. Top sources of purchased calories were grouped, and random effects regression was used to model the relationship between calories purchased from each group and race, female head of household education, and household income. Models adjusted for household composition, market-level unemployment rate, prices, and quarter, with Bonferroni correction for multiple comparisons (α=0.05). Between 2000 and 2011, adjusted total calories purchased from foods (-182 kcal/day) and beverages (-100 kcal/day) declined significantly. Decreases in purchases of milk (-40 kcal); soft drinks (-27 kcal/day); juice and juice drinks (-24 kcal/day); grain-based desserts (-24 kcal/day); savory snacks (-17 kcal/day); and sweet snacks and candy (-13 kcal/day) were among the major changes. Changes in CPG purchases differed significantly by race, female head of household education, and household income. Trends in CPG purchases suggest that solid fats and added sugars are decreasing in the food supply of U.S. preschoolers. Pronounced differences by race, education, and household income persist. Published by Elsevier Inc.

Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

PubMed

Upadhyay, Mohita; Vivekanandan, Perumal

2015-01-01

Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our results highlight the existence of divergent evolutionary pressures leading to CpG dinucleotide depletion among small ds-DNA viruses infecting vertebrate hosts.

Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

PubMed Central

Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

2013-01-01

Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892

CpG DNA in the prevention and treatment of infections.

PubMed

Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

2002-01-01

Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

Emergent central pattern generator behavior in chemical coupled two-compartment models with time delay

NASA Astrophysics Data System (ADS)

Li, Shanshan; Zhang, Guoshan; Wang, Jiang; Chen, Yingyuan; Deng, Bin

2018-02-01

This paper proposes that modified two-compartment Pinsky-Rinzel (PR) neural model can be used to develop the simple form of central pattern generator (CPG). The CPG is called as 'half-central oscillator', which constructed by two inhibitory chemical coupled PR neurons with time delay. Some key properties of PR neural model related to CPG are studied and proved to meet the requirements of CPG. Using the simple CPG network, we first study the relationship between rhythmical output and key factors, including ambient noise, sensory feedback signals, morphological character of single neuron as well as the coupling delay time. We demonstrate that, appropriate intensity noise can enhance synchronization between two coupled neurons. Different output rhythm of CPG network can be entrained by sensory feedback signals. We also show that the morphology of single neuron has strong effect on the output rhythm. The phase synchronization indexes decrease with the increase of morphology parameter's difference. Through adjusting coupled delay time, we can get absolutely phase synchronization and antiphase state of CPG. Those results of simulation show the feasibility of PR neural model as a valid CPG as well as the emergent behaviors of the particularly CPG.

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

PubMed Central

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

PubMed

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

Computationally expanding infinium HumanMethylation450 BeadChip array data to reveal distinct DNA methylation patterns of rheumatoid arthritis

PubMed Central

Li, Chengzhe; Ai, Rizi; Wang, Mengchi; Firestein, Gary S.; Wang, Wei

2016-01-01

Motivation: DNA methylation signatures in rheumatoid arthritis (RA) have been identified in fibroblast-like synoviocytes (FLS) with Illumina HumanMethylation450 array. Since <2% of CpG sites are covered by the Illumina 450K array and whole genome bisulfite sequencing is still too expensive for many samples, computationally predicting DNA methylation levels based on 450K data would be valuable to discover more RA-related genes. Results: We developed a computational model that is trained on 14 tissues with both whole genome bisulfite sequencing and 450K array data. This model integrates information derived from the similarity of local methylation pattern between tissues, the methylation information of flanking CpG sites and the methylation tendency of flanking DNA sequences. The predicted and measured methylation values were highly correlated with a Pearson correlation coefficient of 0.9 in leave-one-tissue-out cross-validations. Importantly, the majority (76%) of the top 10% differentially methylated loci among the 14 tissues was correctly detected using the predicted methylation values. Applying this model to 450K data of RA, osteoarthritis and normal FLS, we successfully expanded the coverage of CpG sites 18.5-fold and accounts for about 30% of all the CpGs in the human genome. By integrative omics study, we identified genes and pathways tightly related to RA pathogenesis, among which 12 genes were supported by triple evidences, including 6 genes already known to perform specific roles in RA and 6 genes as new potential therapeutic targets. Availability and implementation: The source code, required data for prediction, and demo data for test are freely available at: http://wanglab.ucsd.edu/star/LR450K/. Contact: wei-wang@ucsd.edu or gfirestein@ucsd.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26883487

Social Behavior of Pet Dogs Is Associated with Peripheral OXTR Methylation.

PubMed

Cimarelli, Giulia; Virányi, Zsófia; Turcsán, Borbála; Rónai, Zsolt; Sasvári-Székely, Mária; Bánlaki, Zsófia

2017-01-01

Oxytocin is a key modulator of emotional processing and social cognitive function. In line with this, polymorphisms of genes involved in oxytocin signaling, like the oxytocin receptor ( OXTR ) gene, are known to influence social behavior in various species. However, to date, no study has investigated environmental factors possibly influencing the epigenetic variation of the OXTR gene and its behavioral effects in dogs. Pet dogs form individualized and strong relationships with their owners who are central figures in the social environment of their dogs and therefore might influence the methylation levels of their OXTR gene. Here we set out to investigate whether DNA methylation within the OXTR promoter region of pet dogs is linked to their owner's interaction style and to the social behavior of the dogs. To be able to do so, we collected buccal epithelial cells and, in Study 1, we used pyrosequencing techniques to look for differentially methylated CpG sites in the canine OXTR promoter region on a heterogeneous sample of dogs and wolves of different ages and keeping conditions. Four identified sites (at positions -727, -751, -1371, and -1383 from transcription start site) showing more than 10% methylation variation were then, in Study 2, measured in triplicate in 217 pet Border Collies previously tested for reactions to an adverse social situation (i.e., approach by a threatening human) and with available data on their owners' interaction styles. We found that CpG methylation was significantly associated with the behavior of the dogs, in particular with the likelihood that dogs would hide behind their owner or remain passive when approached by a threatening human. On the other hand, CpG methylation was not related to the owners' behavior but to dog sex (at position -1371). Our findings underpin the complex relationship between epigenetics and behavior and highlight the importance of including epigenetic methods in the analysis of dog behavioral development. Further research is needed to investigate which environmental factors influence the epigenetic variation of the OXTR gene.

Methylation of subtelomeric repeat D4Z4 in peripheral blood leukocytes is associated with biochemical recurrence in localized prostate cancer patients.

PubMed

Han, Yuyan; Xu, Junfeng; Kim, Jeri; Wu, Xifeng; Gu, Jian

2017-08-01

Global DNA methylation may affect chromosome structure and genomic stability and is involved in carcinogenesis. In this study, we aimed to investigate whether methylation of pericentromeric repeat NBL2 and subtelomeric repeat D4Z4 in peripheral blood was associated with the aggressiveness of prostate cancer (PCa). We measured the methylation status of different CpG sites of NBL2 and D4Z4 in 795 PCa patients and compared their methylation levels among patients with different Gleason Score at diagnosis. We then analyzed the association of the NBL2 and D4Z4 methylation with the risk of biochemical recurrence (BCR) in patients receiving radical prostatectomy or radiotherapy using a multivariate Cox proportional hazards model. In addition, we used the Kaplan-Meier survival function and log-rank tests to assess BCR-free survival associated with D4Z4 methylation. There was no significant difference in methylation level of NBL2 and D4Z4 between clinically defined aggressive and non-aggressive PCa at diagnosis. However, the methylation of D4Z4 was associated with BCR, while the methylation of NBL2 was not. In tertile analysis, patients in the highest tertile of D4Z4 methylation had an increased risk of BCR (HR = 2.17, 95% CI 1.36-3.48) compared to patients in the lower tertiles after adjustment of age, body mass index, smoking status, pack year, D'Amico risk groups and treatments. Among the four CpG sites in this region, the association was mostly attributable to the methylation of the second CpG site of D4Z4. These data suggest that higher methylation in D4Z4 was associated with worse prognosis of localized PCa patients. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Stress-induced gene expression and behavior are controlled by DNA methylation and methyl donor availability in the dentate gyrus

PubMed Central

Saunderson, Emily A.; Spiers, Helen; Gutierrez-Mecinas, Maria; Trollope, Alexandra F.; Shaikh, Abeera; Mill, Jonathan; Reul, Johannes M. H. M.

2016-01-01

Stressful events evoke long-term changes in behavioral responses; however, the underlying mechanisms in the brain are not well understood. Previous work has shown that epigenetic changes and immediate-early gene (IEG) induction in stress-activated dentate gyrus (DG) granule neurons play a crucial role in these behavioral responses. Here, we show that an acute stressful challenge [i.e., forced swimming (FS)] results in DNA demethylation at specific CpG (5′-cytosine–phosphate–guanine-3′) sites close to the c-Fos (FBJ murine osteosarcoma viral oncogene homolog) transcriptional start site and within the gene promoter region of Egr-1 (early growth response protein 1) specifically in the DG. Administration of the (endogenous) methyl donor S-adenosyl methionine (SAM) did not affect CpG methylation and IEG gene expression at baseline. However, administration of SAM before the FS challenge resulted in an enhanced CpG methylation at the IEG loci and suppression of IEG induction specifically in the DG and an impaired behavioral immobility response 24 h later. The stressor also specifically increased the expression of the de novo DNA methyltransferase Dnmt3a [DNA (cytosine-5-)-methyltransferase 3 alpha] in this hippocampus region. Moreover, stress resulted in an increased association of Dnmt3a enzyme with the affected CpG loci within the IEG genes. No effects of SAM were observed on stress-evoked histone modifications, including H3S10p-K14ac (histone H3, phosphorylated serine 10 and acetylated lysine-14), H3K4me3 (histone H3, trimethylated lysine-4), H3K9me3 (histone H3, trimethylated lysine-9), and H3K27me3 (histone H3, trimethylated lysine-27). We conclude that the DNA methylation status of IEGs plays a crucial role in FS-induced IEG induction in DG granule neurons and associated behavioral responses. In addition, the concentration of available methyl donor, possibly in conjunction with Dnmt3a, is critical for the responsiveness of dentate neurons to environmental stimuli in terms of gene expression and behavior. PMID:27078100

A varying T cell subtype explains apparent tobacco smoking induced single CpG hypomethylation in whole blood.

PubMed

Bauer, Mario; Linsel, Gunter; Fink, Beate; Offenberg, Kirsten; Hahn, Anne Maria; Sack, Ulrich; Knaack, Heike; Eszlinger, Markus; Herberth, Gunda

2015-01-01

Many recent epigenetic studies report that cigarette smoking reduces DNA methylation in whole blood at the single CpG site cg19859270 within the GPR15 gene. Within two independent cohorts, we confirmed the differentially expression of the GPR15 gene when smokers and non-smokers subjects are compared. By validating the GPR15 protein expression at the cellular level, we found that the observed decreased methylation at this site in white blood cells (WBC) of smokers is mainly caused by the high proportion of CD3+GPR15+ expressing T cells in peripheral blood. In current smokers, the percentage of GPR15+ cells among CD3+ T cells in peripheral blood is significantly higher (15.5 ± 7.2 %, mean ± standard deviation) compared to non-smokers (3.7 ± 1.6 %). Treatment of peripheral blood mononuclear cell (PBMC) cultures with aqueous cigarette smoke extract did not induce a higher proportion of this T cell subtype. Our results underline that DNA hypomethylation at cg19859270 site, observed in WBCs of smokers, did not arise by direct effect of tobacco smoking compounds on methylation of DNA but rather by the enrichment of a tobacco-smoking-induced lymphocyte population in the peripheral blood.

Effects of soluble and particulate Cr(VI) on genome-wide DNA methylation in human B lymphoblastoid cells.

PubMed

Lou, Jianlin; Wang, Yu; Chen, Junqiang; Ju, Li; Yu, Min; Jiang, Zhaoqiang; Feng, Lingfang; Jin, Lingzhi; Zhang, Xing

2015-10-01

Several previous studies highlighted the potential epigenetic effects of Cr(VI), especially DNA methylation. However, few studies have compared the effects of Cr(VI) on DNA methylation profiles between soluble and particulate chromate in vitro. Accordingly, Illumina Infinium Human Methylation 450K BeadChip array was used to analyze DNA methylation profiles of human B lymphoblastoid cells exposed to potassium dichromate or lead chromate, and the cell viability was also studied. Array based DNA methylation analysis showed that the impacts of Cr(VI) on DNA methylation were limited, only about 40 differentially methylated CpG sites, with an overlap of 15CpG sites, were induced by both potassium dichromate and lead chromate. The results of mRNA expression showed that after Cr(VI) treatment, mRNA expression changes of four genes (TBL1Y, FZD5, IKZF2, and KIAA1949) were consistent with their DNA methylation alteration, but DNA methylation changes of other six genes did not correlate with mRNA expression. In conclusion, both of soluble and particulate Cr(VI) could induce a small amount of differentially methylated sites in human B lymphoblastoid cells, and the correlations between DNA methylation changes and mRNA expression varied between different genes. Copyright © 2015 Elsevier B.V. All rights reserved.

DNA methylation analysis of paediatric low-grade astrocytomas identifies a tumour-specific hypomethylation signature in pilocytic astrocytomas.

PubMed

Jeyapalan, Jennie N; Doctor, Gabriel T; Jones, Tania A; Alberman, Samuel N; Tep, Alexander; Haria, Chirag M; Schwalbe, Edward C; Morley, Isabel C F; Hill, Alfred A; LeCain, Magdalena; Ottaviani, Diego; Clifford, Steven C; Qaddoumi, Ibrahim; Tatevossian, Ruth G; Ellison, David W; Sheer, Denise

2016-05-27

Low-grade gliomas (LGGs) account for about a third of all brain tumours in children. We conducted a detailed study of DNA methylation and gene expression to improve our understanding of the biology of pilocytic and diffuse astrocytomas. Pilocytic astrocytomas were found to have a distinctive signature at 315 CpG sites, of which 312 were hypomethylated and 3 were hypermethylated. Genomic analysis revealed that 182 of these sites are within annotated enhancers. The signature was not present in diffuse astrocytomas, or in published profiles of other brain tumours and normal brain tissue. The AP-1 transcription factor was predicted to bind within 200 bp of a subset of the 315 differentially methylated CpG sites; the AP-1 factors, FOS and FOSL1 were found to be up-regulated in pilocytic astrocytomas. We also analysed splice variants of the AP-1 target gene, CCND1, which encodes cell cycle regulator cyclin D1. CCND1a was found to be highly expressed in both pilocytic and diffuse astrocytomas, but diffuse astrocytomas have far higher expression of the oncogenic variant, CCND1b. These findings highlight novel genetic and epigenetic differences between pilocytic and diffuse astrocytoma, in addition to well-described alterations involving BRAF, MYB and FGFR1.

DNA methylation at a bovine alpha satellite I repeat CpG site during development following fertilization and somatic cell nuclear transfer.

PubMed

Couldrey, Christine; Wells, David N

2013-01-01

Incomplete epigenetic reprogramming is postulated to contribute to the low developmental success following somatic cell nuclear transfer (SCNT). Here, we describe the epigenetic reprogramming of DNA methylation at an alpha satellite I CpG site (αsatI-5) during development of cattle generated either by artificial insemination (AI) or in vitro fertilization (IVF) and SCNT. Quantitative methylation analysis identified that SCNT donor cells were highly methylated at αsatI-5 and resulting SCNT blastocysts showed significantly more methylation than IVF blastocysts. At implantation, no difference in methylation was observed between SCNT and AI in trophoblast tissue at αsatI-5, however, SCNT embryos were significantly hyper-methylated compared to AI controls at this time point. Following implantation, DNA methylation at αsatI-5 decreased in AI but not SCNT placental tissues. In contrast to placenta, the proportion of methylation at αsatI-5 remained high in adrenal, kidney and muscle tissues during development. Differences in the average proportion of methylation were smaller in somatic tissues than placental tissues but, on average, SCNT somatic tissues were hyper-methylated at αsatI-5. Although sperm from all bulls was less methylated than somatic tissues at αsatI-5, on average this site remained hyper-methylated in sperm from cloned bulls compared with control bulls. This developmental time course confirms that epigenetic reprogramming does occur, at least to some extent, following SCNT. However, the elevated methylation levels observed in SCNT blastocysts and cellular derivatives implies that there is either insufficient time or abundance of appropriate reprogramming factors in oocytes to ensure complete reprogramming. Incomplete reprogramming at this CpG site may be a contributing factor to low SCNT success rates, but more likely represents the tip of the iceberg in terms of incompletely reprogramming. Until protocols ensure the epigenetic signature of a differentiated somatic cell is reset to a state resembling totipotency, the efficiency of SCNT is likely to remain low.

DNA Methylation at a Bovine Alpha Satellite I Repeat CpG Site during Development following Fertilization and Somatic Cell Nuclear Transfer

PubMed Central

Couldrey, Christine; Wells, David N.

2013-01-01

Incomplete epigenetic reprogramming is postulated to contribute to the low developmental success following somatic cell nuclear transfer (SCNT). Here, we describe the epigenetic reprogramming of DNA methylation at an alpha satellite I CpG site (αsatI-5) during development of cattle generated either by artificial insemination (AI) or in vitro fertilization (IVF) and SCNT. Quantitative methylation analysis identified that SCNT donor cells were highly methylated at αsatI-5 and resulting SCNT blastocysts showed significantly more methylation than IVF blastocysts. At implantation, no difference in methylation was observed between SCNT and AI in trophoblast tissue at αsatI-5, however, SCNT embryos were significantly hyper-methylated compared to AI controls at this time point. Following implantation, DNA methylation at αsatI-5 decreased in AI but not SCNT placental tissues. In contrast to placenta, the proportion of methylation at αsatI-5 remained high in adrenal, kidney and muscle tissues during development. Differences in the average proportion of methylation were smaller in somatic tissues than placental tissues but, on average, SCNT somatic tissues were hyper-methylated at αsatI-5. Although sperm from all bulls was less methylated than somatic tissues at αsatI-5, on average this site remained hyper-methylated in sperm from cloned bulls compared with control bulls. This developmental time course confirms that epigenetic reprogramming does occur, at least to some extent, following SCNT. However, the elevated methylation levels observed in SCNT blastocysts and cellular derivatives implies that there is either insufficient time or abundance of appropriate reprogramming factors in oocytes to ensure complete reprogramming. Incomplete reprogramming at this CpG site may be a contributing factor to low SCNT success rates, but more likely represents the tip of the iceberg in terms of incompletely reprogramming. Until protocols ensure the epigenetic signature of a differentiated somatic cell is reset to a state resembling totipotency, the efficiency of SCNT is likely to remain low. PMID:23383311

Reversible and formaldehyde-mediated covalent binding of a bis-amino mitoxantrone analogue to DNA.

PubMed

Konda, Shyam K; Kelso, Celine; Pumuye, Paul P; Medan, Jelena; Sleebs, Brad E; Cutts, Suzanne M; Phillips, Don R; Collins, J Grant

2016-05-18

The ability of a bis-amino mitoxantrone anticancer drug (named WEHI-150) to form covalent adducts with DNA, after activation by formaldehyde, has been studied by electrospray ionisation mass spectrometry and HPLC. Mass spectrometry results showed that WEHI-150 could form covalent adducts with d(ACGCGCGT)2 that contained one, two or three covalent links to the octanucleotide, whereas the control drugs (daunorubicin and the anthracenediones mitoxantrone and pixantrone) only formed adducts with one covalent link to the octanucleotide. HPLC was used to examine the extent of covalent bond formation of WEHI-150 with d(CGCGCG)2 and d(CG(5Me)CGCG)2. Incubation of WEHI-150 with d(CG(5Me)CGCG)2 in the presence of formaldehyde resulted in the formation of significantly greater amounts of covalent adducts than was observed with d(CGCGCG)2. In order to understand the observed increase of covalent adducts with d(CG(5Me)CGCG)2, an NMR study of the reversible interaction of WEHI-150 at both CpG and (5Me)CpG sites was undertaken. Intermolecular NOEs were observed in the NOESY spectra of d(ACGGCCGT)2 with added WEHI-150 that indicated that the drug selectively intercalated at the CpG sites and from the major groove. In particular, NOEs were observed from the WEHI-150 H2,3 protons to the H1' protons of G3 and G7 and from the H6,7 protons to the H5 protons of C2 and C6. By contrast, intermolecular NOEs were observed between the WEHI-150 H2,3 protons to the H2'' proton of the (5Me)C3 in d(CG(5Me)CGCG)2, and between the drug aliphatic protons and the H1' proton of G4. This demonstrated that WEHI-150 preferentially intercalates at (5Me)CpG sites, compared to CpG sequences, and predominantly via the minor groove at the (5Me)CpG site. The results of this study demonstrate that WEHI-150 is likely to form interstrand DNA cross-links, upon activation by formaldehyde, and consequently exhibit greater cytotoxicity than other current anthracenedione drugs.

Prenatal lead exposure is associated with decreased cord blood DNA methylation of the glycoprotein VI gene involved in platelet activation and thrombus formation

PubMed Central

Engström, Karin; Rydbeck, Filip; Kippler, Maria; Wojdacz, Tomasz K.; Arifeen, Shams; Vahter, Marie; Broberg, Karin

2015-01-01

Abstract Early-life lead exposure impairs neurodevelopment and later exposure affects the cardiovascular system. Lead has been associated with reduced global 5-methylcytosine DNA methylation, suggesting that lead toxicity acts through epigenetic mechanisms. The objective of this study is to clarify how early-life lead exposure alters DNA methylation of specific genes, using an epigenomic approach. We measured lead concentrations in urine [gestational week (GW), 8] and erythrocytes (GW 14), using inductively coupled plasma mass spectrometry, for 127 pregnant mothers recruited in the MINIMat food and supplementation cohort in rural Bangladesh. Cord blood DNA methylation was analyzed with the Infinium HumanMethylation450K BeadChip, and top sites were validated by methylation-sensitive high-resolution melt curve analysis. Maternal urinary lead concentrations (divided into quartiles) showed significant (after adjustment for false discovery rate) inverse associations with methylation at nine CpGs. Three of these sites were in the 5′-end, including the promoter, of glycoprotein IV (GP6); cg18355337 (q = 0.029, β = −0.30), cg25818583 (q = 0.041, β = −0.18), and cg23796967 (q = 0.047, β = −0.17). The methylation in another CpG site in GP6 was close to significant (cg05374025, q = 0.057, β = − 0.23). The erythrocyte lead concentrations (divided into quartiles) were also inversely associated with CpG methylation in GP6, although this was not statistically significant after false discovery rate adjustments. Eight CpG sites in GP6 constituted a differentially methylated region in relation to urinary lead (P = 0.005, q = 0.48) and erythrocyte lead (P = 0.007, q = 0.46). In conclusion, we found that moderate prenatal lead exposure appears to epigenetically affect GP6, a key component of platelet aggregation and thrombus formation, suggesting a novel link between early lead exposure and cardiovascular disease later in life. PMID:29492281

Neuromodulation intrinsic to the central pattern generator for escape swimming in Tritonia.

PubMed

Katz, P S

1998-11-16

Extrinsic neuromodulatory inputs to central pattern generators (CPGs) can alter the properties and synaptic interactions of neurons in those circuits and thereby modify the output of the CPG. Recent work in a number of systems has now demonstrated that neurons intrinsic to CPG can also evoke neuromodulatory actions on other members of the CPG. Such "intrinsic neuromodulation" plays a role in controlling the CPG underlying the escape swim response of the nudibrach mollusc, Tritonia diomedea. The dorsal swim interneurons (DSIs) are a bilaterally represented set of three serotonergic neurons that participate in the generation of the rhythmic swim motor program. Serotonin released from these CPG neurons functions both as a fast neurotransmitter and as a slower neuromodulator. In its modulatory role, serotonin enhances the release of neurotransmitter from another CPG neuron, C2, and also increases C2 excitability by decreasing spike frequency adaptation. These neuromodulatory actions intrinsic to the CPG may be important for the initial self-configuration of the system into a function CPG and for experience-dependent changes in the output such as behavioral sensitization and habituation.

In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

PubMed

Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

2018-03-01

Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen-, mitogen-, and alloantigen-induced lymphoproliferation in vitro when measured by [3H]-thymidine. The synthetic methylated DNA CpG ODN but not an unmethylated CpG ODN sequence was shown to promote FoxP3 expression in human CD4+ T cells in the presence of TGF beta and IL-2. The induction of FoxP3+ suppressor cells is dose dependent and offers a potential clinical therapeutic application in allergic and autoimmune and inflammatory diseases. The use of this methylated CpG ODN offers a broad clinical application as a novel therapeutic method for Treg induction and, because of its low cost and small size, should facilitate delivery via nasal, respiratory, gastrointestinal routes, and/or by injection, routes of administration important for vaccine delivery to target sites responsible for respiratory, gastrointestinal, and systemic forms of allergic and autoimmune disease.

The dynamic DNA methylation landscape of the mutL homolog 1 shore is altered by MLH1-93G>A polymorphism in normal tissues and colorectal cancer.

PubMed

Savio, Andrea J; Mrkonjic, Miralem; Lemire, Mathieu; Gallinger, Steven; Knight, Julia A; Bapat, Bharat

2017-01-01

Colorectal cancers (CRCs) undergo distinct genetic and epigenetic alterations. Expression of mutL homolog 1 ( MLH1 ), a mismatch repair gene that corrects DNA replication errors, is lost in up to 15% of sporadic tumours due to mutation or, more commonly, due to DNA methylation of its promoter CpG island. A single nucleotide polymorphism (SNP) in the CpG island of MLH1 ( MLH1 -93G>A or rs1800734) is associated with CpG island hypermethylation and decreased MLH1 expression in CRC tumours. Further, in peripheral blood mononuclear cell (PBMC) DNA of both CRC cases and non-cancer controls, the variant allele of rs1800734 is associated with hypomethylation at the MLH1 shore, a region upstream of its CpG island that is less dense in CpG sites . To determine whether this genotype-epigenotype association is present in other tissue types, including colorectal tumours, we assessed DNA methylation in matched normal colorectal tissue, tumour, and PBMC DNA from 349 population-based CRC cases recruited from the Ontario Familial Colorectal Cancer Registry. Using the semi-quantitative real-time PCR-based MethyLight assay, MLH1 shore methylation was significantly higher in tumour tissue than normal colon or PBMCs ( P  < 0.01). When shore methylation levels were stratified by SNP genotype, normal colorectal DNA and PBMC DNA were significantly hypomethylated in association with variant SNP genotype ( P  < 0.05). However, this association was lost in tumour DNA. Among distinct stages of CRC, metastatic stage IV CRC tumours incurred significant hypomethylation compared to stage I-III cases, irrespective of genotype status. Shore methylation of MLH1 was not associated with MSI status or promoter CpG island hypermethylation, regardless of genotype. To confirm these results, bisulfite sequencing was performed in matched tumour and normal colorectal specimens from six CRC cases, including two cases per genotype (wildtype, heterozygous, and homozygous variant). Bisulfite sequencing results corroborated the methylation patterns found by MethyLight, with significant hypomethylation in normal colorectal tissue of variant SNP allele carriers. These results indicate that the normal tissue types tested (colorectum and PBMC) experience dynamic genotype-associated epigenetic alterations at the MLH1 shore, whereas tumour DNA incurs aberrant hypermethylation compared to normal DNA.

Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

PubMed

Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

2015-08-01

The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Triplex-mediated analysis of cytosine methylation at CpA sites in DNA.

PubMed

Johannsen, Marie W; Gerrard, Simon R; Melvin, Tracy; Brown, Tom

2014-01-18

Modified triplex-forming oligonucleotides distinguish 5-methyl cytosine from unmethylated cytosine in DNA duplexes by differences in triplex melting temperatures. The discrimination is sequence-specific; dramatic differences in stabilisation are seen for CpA methylation, whereas CpG methylation is not detected. This direct detection of DNA methylation constitutes a new approach for epigenetic analysis.

Mapping the zebrafish brain methylome using reduced representation bisulfite sequencing

PubMed Central

Chatterjee, Aniruddha; Ozaki, Yuichi; Stockwell, Peter A; Horsfield, Julia A; Morison, Ian M; Nakagawa, Shinichi

2013-01-01

Reduced representation bisulfite sequencing (RRBS) has been used to profile DNA methylation patterns in mammalian genomes such as human, mouse and rat. The methylome of the zebrafish, an important animal model, has not yet been characterized at base-pair resolution using RRBS. Therefore, we evaluated the technique of RRBS in this model organism by generating four single-nucleotide resolution DNA methylomes of adult zebrafish brain. We performed several simulations to show the distribution of fragments and enrichment of CpGs in different in silico reduced representation genomes of zebrafish. Four RRBS brain libraries generated 98 million sequenced reads and had higher frequencies of multiple mapping than equivalent human RRBS libraries. The zebrafish methylome indicates there is higher global DNA methylation in the zebrafish genome compared with its equivalent human methylome. This observation was confirmed by RRBS of zebrafish liver. High coverage CpG dinucleotides are enriched in CpG island shores more than in the CpG island core. We found that 45% of the mapped CpGs reside in gene bodies, and 7% in gene promoters. This analysis provides a roadmap for generating reproducible base-pair level methylomes for zebrafish using RRBS and our results provide the first evidence that RRBS is a suitable technique for global methylation analysis in zebrafish. PMID:23975027

Epigenetic DNA Methylation Profiling with MSRE: A Quantitative NGS Approach Using a Parkinson's Disease Test Case

PubMed Central

Marsh, Adam G.; Cottrell, Matthew T.; Goldman, Morton F.

2016-01-01

Epigenetics is a rapidly developing field focused on deciphering chemical fingerprints that accumulate on human genomes over time. As the nascent idea of precision medicine expands to encompass epigenetic signatures of diagnostic and prognostic relevance, there is a need for methodologies that provide high-throughput DNA methylation profiling measurements. Here we report a novel quantification methodology for computationally reconstructing site-specific CpG methylation status from next generation sequencing (NGS) data using methyl-sensitive restriction endonucleases (MSRE). An integrated pipeline efficiently incorporates raw NGS metrics into a statistical discrimination platform to identify functional linkages between shifts in epigenetic DNA methylation and disease phenotypes in samples being analyzed. In this pilot proof-of-concept study we quantify and compare DNA methylation in blood serum of individuals with Parkinson's Disease relative to matched healthy blood profiles. Even with a small study of only six samples, a high degree of statistical discrimination was achieved based on CpG methylation profiles between groups, with 1008 statistically different CpG sites (p < 0.0025, after false discovery rate correction). A methylation load calculation was used to assess higher order impacts of methylation shifts on genes and pathways and most notably identified FGF3, FGF8, HTT, KMTA5, MIR8073, and YWHAG as differentially methylated genes with high relevance to Parkinson's Disease and neurodegeneration (based on PubMed literature citations). Of these, KMTA5 is a histone methyl-transferase gene and HTT is Huntington Disease Protein or Huntingtin, for which there are well established neurodegenerative impacts. The future need for precision diagnostics now requires more tools for exploring epigenetic processes that may be linked to cellular dysfunction and subsequent disease progression. PMID:27853465

Quantitative DNA Methylation Analysis Identifies a Single CpG Dinucleotide Important for ZAP-70 Expression and Predictive of Prognosis in Chronic Lymphocytic Leukemia

PubMed Central

Claus, Rainer; Lucas, David M.; Stilgenbauer, Stephan; Ruppert, Amy S.; Yu, Lianbo; Zucknick, Manuela; Mertens, Daniel; Bühler, Andreas; Oakes, Christopher C.; Larson, Richard A.; Kay, Neil E.; Jelinek, Diane F.; Kipps, Thomas J.; Rassenti, Laura Z.; Gribben, John G.; Döhner, Hartmut; Heerema, Nyla A.; Marcucci, Guido; Plass, Christoph; Byrd, John C.

2012-01-01

Purpose Increased ZAP-70 expression predicts poor prognosis in chronic lymphocytic leukemia (CLL). Current methods for accurately measuring ZAP-70 expression are problematic, preventing widespread application of these tests in clinical decision making. We therefore used comprehensive DNA methylation profiling of the ZAP-70 regulatory region to identify sites important for transcriptional control. Patients and Methods High-resolution quantitative DNA methylation analysis of the entire ZAP-70 gene regulatory regions was conducted on 247 samples from patients with CLL from four independent clinical studies. Results Through this comprehensive analysis, we identified a small area in the 5′ regulatory region of ZAP-70 that showed large variability in methylation in CLL samples but was universally methylated in normal B cells. High correlation with mRNA and protein expression, as well as activity in promoter reporter assays, revealed that within this differentially methylated region, a single CpG dinucleotide and neighboring nucleotides are particularly important in ZAP-70 transcriptional regulation. Furthermore, by using clustering approaches, we identified a prognostic role for this site in four independent data sets of patients with CLL using time to treatment, progression-free survival, and overall survival as clinical end points. Conclusion Comprehensive quantitative DNA methylation analysis of the ZAP-70 gene in CLL identified important regions responsible for transcriptional regulation. In addition, loss of methylation at a specific single CpG dinucleotide in the ZAP-70 5′ regulatory sequence is a highly predictive and reproducible biomarker of poor prognosis in this disease. This work demonstrates the feasibility of using quantitative specific ZAP-70 methylation analysis as a relevant clinically applicable prognostic test in CLL. PMID:22564988

DNA methylation levels and long-term trihalomethane exposure in drinking water: an epigenome-wide association study

PubMed Central

Salas, Lucas A; Bustamante, Mariona; Gonzalez, Juan R; Gracia-Lavedan, Esther; Moreno, Victor; Kogevinas, Manolis; Villanueva, Cristina M

2015-01-01

Trihalomethanes (THM) are undesired disinfection byproducts (DBPs) formed during water treatment. Mice exposed to DBPs showed global DNA hypomethylation and c-myc and c-jun gene-specific hypomethylation, while evidence of epigenetic effects in humans is scarce. We explored the association between lifetime THM exposure and DNA methylation through an epigenome-wide association study. We selected 138 population-based controls from a case-control study of colorectal cancer conducted in Barcelona, Spain, exposed to average lifetime THM levels ≤85 μg/L vs. >85 μg/L (N = 68 and N = 70, respectively). Mean age of participants was 70 years, and 54% were male. Average lifetime THM level in the exposure groups was 64 and 130 µg/L, respectively. DNA was extracted from whole blood and was bisulphite converted to measure DNA methylation levels using the Illumina HumanMethylation450 BeadChip. Data preprocessing was performed using RnBeads. Methylation was compared between exposure groups using empirical Bayes moderated linear regression for CpG sites and Gaussian kernel for CpG regions. ConsensusPathDB was used for gene set enrichment. Statistically significant differences in methylation between exposure groups was found in 140 CpG sites and 30 gene-related regions, after false discovery rate <0.05 and adjustment for age, sex, methylation first principal component, and blood cell proportion. The annotated genes were localized to several cancer pathways. Among them, 29 CpGs had methylation levels associated with THM levels (|Δβ|≥0.05) located in 11 genes associated with cancer in other studies. Our results suggest that THM exposure may affect DNA methylation in genes related to tumors, including colorectal and bladder cancers. Future confirmation studies are required. PMID:26039576

Serotonin 1B Receptor Gene (HTR1B) Methylation as a Risk Factor for Callous-Unemotional Traits in Antisocial Boys.

PubMed

Moul, Caroline; Dobson-Stone, Carol; Brennan, John; Hawes, David J; Dadds, Mark R

2015-01-01

The serotonin system is thought to play a role in the aetiology of callous-unemotional (CU) traits in children. Previous research identified a functional single nucleotide polymorphism (SNP) from the promoter region of the serotonin 1B receptor gene as being associated with CU traits in boys with antisocial behaviour problems. This research tested the hypothesis that CU traits are associated with reduced methylation of the promoter region of the serotonin 1B receptor gene due to the influence of methylation on gene expression. Participants (N = 117) were boys with antisocial behaviour problems aged 3-16 years referred to University of New South Wales Child Behaviour Research Clinics. Participants volunteered a saliva sample from which the genotype of a SNP from the promoter region of the serotonin 1B receptor gene and the methylation levels of 30 CpG sites from 3 CpG regions surrounding the location of this polymorphism were assayed. Lower levels of serotonin 1B receptor gene methylation were associated with higher levels of CU traits. This relationship, however, was found to be moderated by genotype and carried exclusively by two CpG sites for which levels of methylation were negatively associated with overall methylation levels in this region of the gene. Results provide support to the emerging literature that argues for a genetically-driven system-wide alteration in serotonin function in the aetiology of CU traits. Furthermore, the results suggest that there may be two pathways to CU traits that involve methylation of the serotonin 1B receptor gene; one that is driven by a genotypic risk and another that is associated with risk for generally increased levels of methylation. Future research that aims to replicate and further investigate these results is required.

PRKCZ methylation is associated with sunlight exposure in a North American but not a Mediterranean population

PubMed Central

Aslibekyan, Stella; Dashti, Hassan S.; Tanaka, Toshiko; Sha, Jin; Ferrucci, Luigi; Zhi, Degui; Bandinelli, Stefania; Borecki, Ingrid B.; Absher, Devin M.; Arnett, Donna K.; Ordovas, Jose M.

2015-01-01

Sunlight exposure has been shown to alter DNA methylation patterns across several human cell-types, including T-lymphocytes. Since epigenetic changes establish gene expression profiles, changes in DNA methylation induced by sunlight exposure warrant investigation. The purpose of this study was to assess the effects of sunlight exposure on CD4+ T-cell methylation patterns on an epigenome-wide scale in a North American population of European origin (n = 991). In addition, we investigated the genetic contribution to epigenetic variation (methylQTL). We used linear regression to test the associations between methylation scores at 461 281 cytosine-phosphate-guanine (CpG) sites and sunlight exposure, followed by a genome-wide association analysis (methylQTL) to test for associations between methylation at the top CpG locus and common genetic variants, assuming an additive genetic model. We observed an epigenome-wide significant association between sunlight exposure and methylation status at cg26930596 (p = 9.2 × 10−8), a CpG site located in protein kinase C zeta (PRKCZ), a gene previously shown to be entrained by light. MethylQTL analysis resulted in significant associations between cg26930596 and two intergenic single nucleotide polymorphisms on chromosome 3, rs4574216 (p = 1.5 × 10−10) and rs4405858 (p = 1.9 × 10−9). These common genetic variants reside downstream of WWTR1, a transcriptional co-activator of PRKCZ. Associations observed in the North American population, however, did not replicate in an independent Mediterranean cohort. Our preliminary results support the role of sunlight exposure in epigenetic processes, and lay the groundwork for future studies of the molecular link between sunlight and physiologic processes such as tumorigenesis and metabolism. PMID:25075435

PRKCZ methylation is associated with sunlight exposure in a North American but not a Mediterranean population.

PubMed

Aslibekyan, Stella; Dashti, Hassan S; Tanaka, Toshiko; Sha, Jin; Ferrucci, Luigi; Zhi, Degui; Bandinelli, Stefania; Borecki, Ingrid B; Absher, Devin M; Arnett, Donna K; Ordovas, Jose M

2014-11-01

Sunlight exposure has been shown to alter DNA methylation patterns across several human cell-types, including T-lymphocytes. Since epigenetic changes establish gene expression profiles, changes in DNA methylation induced by sunlight exposure warrant investigation. The purpose of this study was to assess the effects of sunlight exposure on CD4+ T-cell methylation patterns on an epigenome-wide scale in a North American population of European origin (n=991). In addition, we investigated the genetic contribution to epigenetic variation (methylQTL). We used linear regression to test the associations between methylation scores at 461,281 cytosine-phosphate-guanine (CpG) sites and sunlight exposure, followed by a genome-wide association analysis (methylQTL) to test for associations between methylation at the top CpG locus and common genetic variants, assuming an additive genetic model. We observed an epigenome-wide significant association between sunlight exposure and methylation status at cg26930596 (p=9.2×10(-8)), a CpG site located in protein kinase C zeta (PRKCZ), a gene previously shown to be entrained by light. MethylQTL analysis resulted in significant associations between cg26930596 and two intergenic single nucleotide polymorphisms on chromosome 3, rs4574216 (p=1.5×10(-10)) and rs4405858 (p=1.9×10(-9)). These common genetic variants reside downstream of WWTR1, a transcriptional co-activator of PRKCZ. Associations observed in the North American population, however, did not replicate in an independent Mediterranean cohort. Our preliminary results support the role of sunlight exposure in epigenetic processes, and lay the groundwork for future studies of the molecular link between sunlight and physiologic processes such as tumorigenesis and metabolism.

Epigenome-wide association study of metabolic syndrome in African-American adults.

PubMed

Akinyemiju, Tomi; Do, Anh N; Patki, Amit; Aslibekyan, Stella; Zhi, Degui; Hidalgo, Bertha; Tiwari, Hemant K; Absher, Devin; Geng, Xin; Arnett, Donna K; Irvin, Marguerite R

2018-01-01

The high prevalence of obesity among US adults has resulted in significant increases in associated metabolic disorders such as diabetes, dyslipidemia, and high blood pressure. Together, these disorders constitute metabolic syndrome, a clinically defined condition highly prevalent among African-Americans. Identifying epigenetic alterations associated with metabolic syndrome may provide additional information regarding etiology beyond current evidence from genome-wide association studies. Data on metabolic syndrome and DNA methylation was assessed on 614 African-Americans from the Hypertension Genetic Epidemiology Network (HyperGEN) study. Metabolic syndrome was defined using the joint harmonized criteria, and DNA methylation was assessed using the Illumina HumanMethylation450K Bead Chip assay on DNA extracted from buffy coat. Linear mixed effects regression models were used to examine the association between CpG methylation at > 450,000 CpG sites and metabolic syndrome adjusted for study covariates. Replication using DNA from a separate sample of 69 African-Americans, as well as meta-analysis combining both cohorts, was conducted. Two differentially methylated CpG sites in the IGF2BP1 gene on chromosome 17 (cg06638433; p value = 3.10 × 10 - 7 ) and the ABCG1 gene on chromosome 21 (cg06500161; p value = 2.60 × 10 - 8 ) were identified. Results for the ABCG1 gene remained statistically significant in the replication dataset and meta-analysis. Metabolic syndrome was consistently associated with increased methylation in the ABCG1 gene in the discovery and replication datasets, a gene that encodes a protein in the ATP-binding cassette transporter family and is involved in intra- and extra-cellular signaling and lipid transport.

Characterization of tumor cells and stem cells by differential nuclear methylation imaging

NASA Astrophysics Data System (ADS)

Tajbakhsh, Jian; Wawrowsky, Kolja A.; Gertych, Arkadiusz; Bar-Nur, Ori; Vishnevsky, Eugene; Lindsley, Erik H.; Farkas, Daniel L.

2008-02-01

DNA methylation plays a key role in cellular differentiation. Aberrant global methylation patterns are associated with several cancer types, as a result of changes in long-term activation status of up to 50% of genes, including oncogenes and tumor-suppressor genes, which are regulated by methylation and demethylation of promoter region CpG dinucleotides (CpG islands). Furthermore, DNA methylation also occurs in nonisland CpG sites (> 95% of the genome), present once per 80 dinucleotides on average. Nuclear DNA methylation increases during the course of cellular differentiation while cancer cells usually show a net loss in methylation. Given the large dynamic range in DNA methylation load, the methylation pattern of a cell can provide a valuable distinction as to its status during differentiation versus the disease state. By applying immunofluorescence, confocal microscopy and 3D image analysis we assessed the potential of differential nuclear distribution of methylated DNA to be utilized as a biomarker to characterize cells during development and when diseased. There are two major fields that may immediately benefit from this development: (1) the search for factors that contribute to pluripotency and cell fate in human embryonic stem cell expansion and differentiation, and (2) the characterization of tumor cells with regard to their heterogeneity in molecular composition and behavior. We performed topological analysis of the distribution of methylated CpG-sites (MeC) versus heterochromatin. This innovative approach revealed significant differences in colocalization patterns of MeC and heterochromatin-derived signals between undifferentiated and differentiated human embryonic stem cells, as well as untreated AtT20 mouse pituitary tumor cells compared to a subpopulation of these cells treated with 5-azacytidine for 48 hours.

The association of serotonin receptor 3A methylation with maternal violence exposure, neural activity, and child aggression.

PubMed

Schechter, Daniel S; Moser, Dominik A; Pointet, Virginie C; Aue, Tatjana; Stenz, Ludwig; Paoloni-Giacobino, Ariane; Adouan, Wafae; Manini, Aurélia; Suardi, Francesca; Vital, Marylene; Sancho Rossignol, Ana; Cordero, Maria I; Rothenberg, Molly; Ansermet, François; Rusconi Serpa, Sandra; Dayer, Alexandre G

2017-05-15

Methylation of the serotonin 3A receptor gene (HTR3A) has been linked to child maltreatment and adult psychopathology. The present study examined whether HTR3A methylation might be associated with mothers' lifetime exposure to interpersonal violence (IPV), IPV-related psychopathology, child disturbance of attachment, and maternal neural activity. Number of maternal lifetime IPV exposures and measures of maternal psychopathology including posttraumatic stress disorder (PTSD), major depression and aggressive behavior (AgB), and a measure of child attachment disturbance known as "secure base distortion" (SBD) were assessed in a sample of 35 mothers and children aged 12-42 months. Brain fMRI activation was assessed in mothers using 30-s silent film excerpts depicting menacing adult male-female interactions versus prosocial and neutral interactions. Group and continuous analyses were performed to test for associations between clinical and fMRI variables with DNA methylation. Maternal IPV exposure-frequency was associated with maternal PTSD; and maternal IPV-PTSD was in turn associated with child SBD. Methylation status of several CpG sites in the HTR3A gene was associated with maternal IPV and IPV-PTSD severity, AgB and child SBD, in particular, self-endangering behavior. Methylation status at a specific CpG site (CpG2_III) was associated with decreased medial prefrontal cortical (mPFC) activity in response to film-stimuli of adult male-female interactions evocative of violence as compared to prosocial and neutral interactions. Methylation status of the HTR3A gene in mothers is linked to maternal IPV-related psychopathology, trauma-induced brain activation patterns, and child attachment disturbance in the form of SBD during a sensitive period in the development of self-regulation. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

PubMed

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

2011-02-15

Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

PubMed Central

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

2013-01-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

DOE PAGES

Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

2015-09-21

An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

PubMed Central

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

2010-01-01

Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

PubMed

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

2013-12-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

PubMed

Hanagata, Nobutaka

2017-01-01

Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

NASA Astrophysics Data System (ADS)

Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

1997-09-01

Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

Transcript Isoform Variation Associated with Cytosine Modification in Human Lymphoblastoid Cell Lines.

PubMed

Zhang, Xu; Zhang, Wei

2016-06-01

Cytosine modification on DNA is variable among individuals, which could correlate with gene expression variation. The effect of cytosine modification on interindividual transcript isoform variation (TIV), however, remains unclear. In this study, we assessed the extent of cytosine modification-specific TIV in lymphoblastoid cell lines (LCLs) derived from unrelated individuals of European and African descent. Our study detected cytosine modification-specific TIVs for 17% of the analyzed genes at a 5% false discovery rate. Forty-five percent of the TIV-associated cytosine modifications correlated with the overall gene expression levels as well, with the corresponding CpG sites overrepresented in transcript initiation sites, transcription factor binding sites, and distinct histone modification peaks, suggesting that alternative isoform transcription underlies the TIVs. Our analysis also revealed 33% of the TIV-associated cytosine modifications that affected specific exons, with the corresponding CpG sites overrepresented in exon/intron junctions, splicing branching points, and transcript termination sites, implying that the TIVs are attributable to alternative splicing or transcription termination. Genetic and epigenetic regulation of TIV shared target preference but exerted independent effects on 61% of the common exon targets. Cytosine modification-specific TIVs detected from LCLs were differentially enriched in those detected from various tissues in The Cancer Genome Atlas, indicating their developmental dependency. Genes containing cytosine modification-specific TIVs were enriched in pathways of cancers and metabolic disorders. Our study demonstrated a prominent effect of cytosine modification variation on the transcript isoform spectrum over gross transcript abundance and revealed epigenetic contributions to diseases that were mediated through cytosine modification-specific TIV. Copyright © 2016 by the Genetics Society of America.

DNA containing CpG motifs induces angiogenesis

NASA Astrophysics Data System (ADS)

Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

2002-06-01

New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

[Quality and compliance with Clinical Practice Guidelines of Chronic Noncommunicable Diseases in primary care].

PubMed

Poblano-Verástegui, Ofelia; Vieyra-Romero, Waldo I; Galván-García, Ángel F; Fernández-Elorriaga, María; Rodríguez-Martínez, Antonia I; Saturno-Hernández, Pedro J

2017-01-01

To assess the quality and compliance of clinical practice guidelines (CPG) applicable to chronic non-communicable diseases (CNCD) in primary healthcare (CS), and views of staff on the barriers, facilitators and their use. 18 valued CPG with AGREEII, 3 are selected to develop indicators and assess compliance using lot quality acceptance sample (LQAS, standard 75 / 95% threshold 40 / 75% respectively, α:0. 05, β:0. 10) on 5 CS. 70 professionals surveyed about knowledge and use of CPG. Average quality of the CPG was 57.2%; low rating in domains: "Applicability" (<25%), "Stakeholder involvement" (43.5%) and "Rigour of development" (55.0%). Compliance in CS ranges from 39 to 53.4%. Professionals show uneven knowledge of CPG; 44 to 45% (according to CPG), they declare that they are not used, they identify as main barriers the lack of training, and their difficult accessibility and management. The quality and implementation of evaluated CPG is deficient constituting an opportunity of improvement in health services.

Comparative Analyses of DNA Methylation and Sequence Evolution Using Nasonia Genomes

PubMed Central

Park, Jungsun; Peng, Zuogang; Zeng, Jia; Elango, Navin; Park, Taesung; Wheeler, Dave; Werren, John H.; Yi, Soojin V.

2011-01-01

The functional and evolutionary significance of DNA methylation in insect genomes remains to be resolved. Nasonia is well situated for comparative analyses of DNA methylation and genome evolution, since the genomes of a moderately distant outgroup species as well as closely related sibling species are available. Using direct sequencing of bisulfite-converted DNA, we uncovered a substantial level of DNA methylation in 17 of 18 Nasonia vitripennis genes and a strong correlation between methylation level and CpG depletion. Notably, in the sex-determining locus transformer, the exon that is alternatively spliced between the sexes is heavily methylated in both males and females, whereas other exons are only sparsely methylated. Orthologous genes of the honeybee and Nasonia show highly similar relative levels of CpG depletion, despite ∼190 My divergence. Densely and sparsely methylated genes in these species also exhibit similar functional enrichments. We found that the degree of CpG depletion is negatively correlated with substitution rates between closely related Nasonia species for synonymous, nonsynonymous, and intron sites. This suggests that mutation rates increase with decreasing levels of germ line methylation. Thus, DNA methylation is prevalent in the Nasonia genome, may participate in regulatory processes such as sex determination and alternative splicing, and is correlated with several aspects of genome and sequence evolution. PMID:21693438

DNA-inorganic hybrid nanovaccine for cancer immunotherapy

NASA Astrophysics Data System (ADS)

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-01

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f

Prospective study of DNA methylation at chromosome 8q24 in peripheral blood and prostate cancer risk.

PubMed

Barry, Kathryn Hughes; Moore, Lee E; Sampson, Joshua N; Koutros, Stella; Yan, Liying; Meyer, Ann; Reddy, Mahitha; Oler, Andrew J; Cook, Michael B; Fraumeni, Joseph F; Yeager, Meredith; Amundadottir, Laufey T; Berndt, Sonja I

2017-05-23

Chromosome 8q24 has emerged as an important genetic susceptibility region for several cancers, including prostate cancer; however, little is known about the contribution of DNA methylation in this region to risk. We prospectively evaluated DNA methylation at 8q24 in relation to prostate cancer using pre-diagnostic blood samples from 694 prostate cancer cases (including 172 aggressive cases) and 703 controls in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. We used logistic regression to estimate odds ratios and 95% confidence intervals. Although none remained significant after adjustment for multiple testing (q>0.05), of the 50 CpG sites meeting quality control, we identified 8 sites that were nominally associated with prostate cancer (P trend <0.05), including 6 correlated (Spearman ρ: 0.20-0.52) sites in POU5F1B and 2 intergenic sites (most significant site: Chr8:128428897 in POU5F1B, P trend =0.01). We also identified two correlated (ρ=0.39) sites in MYC (Chr8:128753187 and Chr8:128753154) that were associated with aggressive (P trend =0.02 and 0.03), but not non-aggressive disease (P trend =0.70 and 0.20; P heterogeneity =0.01 and 4.6 × 10 -3 ). These findings persisted after adjustment for the top 8q24 prostate cancer variants in our study. Although requiring replication, our findings provide some evidence that 8q24 DNA methylation levels may be associated with prostate cancer risk.

MethBank 3.0: a database of DNA methylomes across a variety of species.

PubMed

Li, Rujiao; Liang, Fang; Li, Mengwei; Zou, Dong; Sun, Shixiang; Zhao, Yongbing; Zhao, Wenming; Bao, Yiming; Xiao, Jingfa; Zhang, Zhang

2018-01-04

MethBank (http://bigd.big.ac.cn/methbank) is a database that integrates high-quality DNA methylomes across a variety of species and provides an interactive browser for visualization of methylation data. Here, we present an updated implementation of MethBank (version 3.0) by incorporating more DNA methylomes from multiple species and equipping with more enhanced functionalities for data annotation and more friendly web interfaces for data presentation, search and visualization. MethBank 3.0 features large-scale integration of high-quality methylomes, involving 34 consensus reference methylomes derived from a large number of human samples, 336 single-base resolution methylomes from different developmental stages and/or tissues of five plants, and 18 single-base resolution methylomes from gametes and early embryos at multiple stages of two animals. Additionally, it is enhanced by improving the functionalities for data annotation, which accordingly enables systematic identification of methylation sites closely associated with age, sites with constant methylation levels across different ages, differentially methylated promoters, age-specific differentially methylated cytosines/regions, and methylated CpG islands. Moreover, MethBank provides tools to estimate human methylation age online and to identify differentially methylated promoters, respectively. Taken together, MethBank is upgraded with significant improvements and advances over the previous version, which is of great help for deciphering DNA methylation regulatory mechanisms for epigenetic studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

A UML approach to process modelling of clinical practice guidelines for enactment.

PubMed

Knape, T; Hederman, L; Wade, V P; Gargan, M; Harris, C; Rahman, Y

2003-01-01

Although clinical practice guidelines (CPGs) have been suggested as a means of encapsulating best practice in evidence-based medical treatment, their usage in clinical environments has been disappointing. Criticisms of guideline representations have been that they are predominantly narrative and are difficult to incorporate into clinical information systems. This paper analyses the use of UML process modelling techniques for guideline representation and proposes the automated generation of executable guidelines using XMI. This hybrid UML-XMI approach provides flexible authoring of guideline decision and control structures whilst integrating appropriate data flow. It also uses an open XMI standard interface to allow the use of authoring tools and process control systems from multiple vendors. The paper first surveys CPG modelling formalisms followed by a brief introduction to process modelling in UMI. Furthermore, the modelling of CPGs in UML is presented leading to a case study of encoding a diabetes mellitus CPG using UML.

The CpG island methylator phenotype (CIMP) in colorectal cancer

PubMed Central

Mojarad, Ehsan Nazemalhosseini; Kuppen, Peter JK; Aghdaei, Hamid Asadzadeh

2013-01-01

It is clear that colorectal cancer (CRC) develops through multiple genetic and epigenetic pathways. These pathways may be determined on the basis of three molecular features: (i) mutations in DNA mismatch repair genes, leading to a DNA microsatellite instability (MSI) phenotype, (ii) mutations in APC and other genes that activate Wnt pathway, characterized by chromosomal instability (CIN) phenotype, and (iii) global genome hypermethylation, resulting in switch off of tumor suppressor genes, indicated as CpG island methylator phenotype (CIMP). Each of these pathways is characterized by specific pathological features, mechanisms of carcinogenesis and process of tumor development. The molecular aspects of these pathways have been used clinically in the diagnosis, screening and management of patients with colorectal cancer. In this review we especially describe various aspects of CIMP, one of the important and rather recently discovered pathways that lead to colorectal cancer. PMID:24834258

The CpG island methylator phenotype (CIMP) in colorectal cancer.

PubMed

Nazemalhosseini Mojarad, Ehsan; Kuppen, Peter Jk; Aghdaei, Hamid Asadzadeh; Zali, Mohammad Reza

2013-01-01

It is clear that colorectal cancer (CRC) develops through multiple genetic and epigenetic pathways. These pathways may be determined on the basis of three molecular features: (i) mutations in DNA mismatch repair genes, leading to a DNA microsatellite instability (MSI) phenotype, (ii) mutations in APC and other genes that activate Wnt pathway, characterized by chromosomal instability (CIN) phenotype, and (iii) global genome hypermethylation, resulting in switch off of tumor suppressor genes, indicated as CpG island methylator phenotype (CIMP). Each of these pathways is characterized by specific pathological features, mechanisms of carcinogenesis and process of tumor development. The molecular aspects of these pathways have been used clinically in the diagnosis, screening and management of patients with colorectal cancer. In this review we especially describe various aspects of CIMP, one of the important and rather recently discovered pathways that lead to colorectal cancer.

Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

PubMed Central

Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

2012-01-01

The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

[Comparative evaluation of clinical practice guidelines for the treatment of schizophrenia].

PubMed

Delessert, D; Pomini, V; Grasset, F; Baumann, P

2008-01-01

Many clinical practice guidelines (CPG) have been published in reply to the development of the concept of "evidence-based medicine" (EBM) and as a solution to the difficulty of synthesizing and selecting relevant medical literature. Taking into account the expansion of new CPG, the question of choice arises: which CPG to consider in a given clinical situation? It is of primary importance to evaluate the quality of the CPG, but until recently, there has been no standardized tool of evaluation or comparison of the quality of the CPG. An instrument of evaluation of the quality of the CPG, called "AGREE" for appraisal of guidelines for research and evaluation was validated in 2002. The six principal CPG concerning the treatment of schizophrenia are compared with the help of the "AGREE" instrument: (1) "the Agence nationale pour le développement de l'évaluation médicale (ANDEM) recommendations"; (2) "The American Psychiatric Association (APA) practice guideline for the treatment of patients with schizophrenia"; (3) "The quick reference guide of APA practice guideline for the treatment of patients with schizophrenia"; (4) "The schizophrenia patient outcomes research team (PORT) treatment recommendations"; (5) "The Texas medication algorithm project (T-MAP)" and (6) "The expert consensus guideline for the treatment of schizophrenia". The results of our study were then compared with those of a similar investigation published in 2005, structured on 24 CPG tackling the treatment of schizophrenia. The "AGREE" tool was also used by two investigators in their study. In general, the scores of the two studies differed little and the two global evaluations of the CPG converged; however, each of the six CPG is perfectible. The rigour of elaboration of the six CPG was in general average. The consideration of the opinion of potential users was incomplete, and an effort made in the presentation of the recommendations would facilitate their clinical use. Moreover, there was little consideration by the authors regarding the applicability of the recommendations. Globally, two CPG are considered as strongly recommended: "the quick reference guide of the APA practice guideline for the treatment of patients with schizophrenia" and "the T-MAP".

DNA methylation profiling for a confirmatory test for blood, saliva, semen, vaginal fluid and menstrual blood.

PubMed

Lee, Hwan Young; Jung, Sang-Eun; Lee, Eun Hee; Yang, Woo Ick; Shin, Kyoung-Jin

2016-09-01

The ability to predict the type of tissues or cells from molecular profiles of crime scene samples has important practical implications in forensics. A previously reported multiplex assay using DNA methylation markers could only discriminate between 4 types of body fluids: blood, saliva, semen, and the body fluid which originates from female reproductive organ. In the present study, we selected 15 menstrual blood-specific CpG marker candidates based on analysis of 12 genome-wide DNA methylation profiles of vaginal fluid and menstrual blood. The menstrual blood-specificity of the candidate markers was confirmed by comparison with HumanMethylation450 BeadChip array data obtained for 58 samples including 12 blood, 12 saliva, 12 semen, 3 vaginal fluid, and 19 skin epidermis samples. Among 15CpG marker candidates, 3 were located in the promoter region of the SLC26A10 gene, and 2 of them (cg09696411 and cg18069290) showed high menstrual blood specificity. DNA methylation at the 2CpG markers was further tested by targeted bisulfite sequencing of 461 additional samples including 49 blood, 52 saliva, 34 semen, 125 vaginal fluid, and 201 menstrual blood. Because the 2 markers showed menstrual blood-specific methylation patterns, we modified our previous multiplex methylation SNaPshot reaction to include these 2 markers. In addition, a blood marker cg01543184 with cross reactivity to semen was replaced with cg08792630, and a semen-specific unmethylation marker cg17621389 was removed. The resultant multiplex methylation SNaPshot allowed positive identification of blood, saliva, semen, vaginal fluid and menstrual blood using the 9CpG markers which show a methylation signal only in the target body fluids. Because of the complexity in cell composition, menstrual bloods produced DNA methylation profiles that vary with menstrual cycle and sample collection methods, which are expected to provide more insight into forensic menstrual blood test. Moreover, because the developed multiplex methylation SNaPshot reaction includes the 4CpG markers of which specificities have been confirmed by multiple studies, it will facilitate confirmatory tests for body fluids that are frequently observed in forensic casework. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Comprehensive analysis of CpG islands in human chromosomes 21 and 22

NASA Astrophysics Data System (ADS)

Takai, Daiya; Jones, Peter A.

2002-03-01

CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

Treatment of Tobacco Dependence, a Critical Gap in Czech Clinical Practice Guidelines.

PubMed

Zvolská, Kamila; Fraser, Keely; Zvolský, Miroslav; Králíková, Eva

2017-06-01

Tobacco related comorbidities and treatment of dependence are relevant to clinicians of all disciplines. Clinicians should provide a brief intervention about tobacco use with smokers at each clinical contact (success rate of 5-10 %). Intensive treatment (success rate >30%) should be available to those who need it. Brief intervention is not yet standard clinical practice. Our aim was to assess clinical practice guidelines (CPG) of selected medical professional societies to determine whether or not tobacco dependence treatment recommendations were included. Between October and December 2013, we conducted a keyword search of CPG for 20 medical professional societies in the Czech Republic. We searched for the keywords "smoking", "tobacco" and "nicotine addiction" in 91 CPG documents, which were freely available on the websites of selected professional societies. We focused specifically on CPG relating to cardiovascular and respiratory diseases as well as cancer. We excluded any CPG focused on acute conditions, diagnostics only, laboratory methods, or administration. There was no mention of smoking in 27.7% (26/94) of CPG documents. Only 16% (15/94) of CPG documents listed smoking as a risk factor. 42.5% (40/94) mentioned smoking related phrases (e.g. "smoking ban"). Only 13.8% (13/94) of CPG included a section on tobacco dependence, referenced tobacco dependence treatment guidelines or mentioned specialized treatment centres where smokers can be referred. Nearly one third of CPG related to cardiovascular and respiratory diseases as well as cancer made no mention of smoking. Despite the clinical significance of smoking, the majority of CPG did not adequately address tobacco dependence and its treatment. Copyright© by the National Institute of Public Health, Prague 2017

DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

PubMed

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-28

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.

Epigenetic regulation of the DRD4 gene and dimensions of attention-deficit/hyperactivity disorder in children.

PubMed

Dadds, Mark R; Schollar-Root, Olivia; Lenroot, Rhoshel; Moul, Caroline; Hawes, David J

2016-10-01

Recent evidence suggests that epigenetic regulation of the DRD4 gene may characterise specific aspects of ADHD symptomology. We tested associations between ADHD symptoms and epigenetic changes to the DRD4 gene in DNA extracted from blood and saliva in N = 330 children referred for a variety of behavioural and emotional problems. ADHD was indexed using DSM diagnoses as well as mother, father, and teacher reports. Methylation levels were assayed for the island of 18 CpG sites in the DRD4 receptor gene. A nearby SNP, rs3758653, was also genotyped as it has previously been shown to influence methylation levels. There was high consistency of methylation levels across CpG sites and tissue sources, and higher methylation levels were associated with the major allele of SNP rs3758653. Higher methylation levels were associated with more severe ADHD independent of SNP status, tissue source, ethnicity, environmental adversity, and comorbid conduct problems. The association applied specifically to the cognitive/attentional, rather than hyperactivity problems that characterise ADHD. The results indicate that epigenetic regulation of the DRD4 gene in the form of increased methylation is associated with the cognitive/attentional deficits in ADHD.

A Hybrid Approach for CpG Island Detection in the Human Genome.

PubMed

Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

2016-01-01

CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

PubMed Central

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre

An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

Conserved nonsense-prone CpG sites in apoptosis-regulatory genes: conditional stop signs on the road to cell death.

PubMed

Zhao, Yongzhong; Epstein, Richard J

2013-01-01

Methylation-prone CpG dinucleotides are strongly conserved in the germline, yet are also predisposed to somatic mutation. Here we quantify the relationship between germline codon mutability and somatic carcinogenesis by comparing usage of the nonsense-prone CGA (→TGA) codons in gene groups that differ in apoptotic function; to this end, suppressor genes were subclassified as either apoptotic (gatekeepers) or repair (caretakers). Mutations affecting CGA codons in sporadic tumors proved to be highly asymmetric. Moreover, nonsense mutations were 3-fold more likely to affect gatekeepers than caretakers. In addition, intragenic CGA clustering nonrandomly affected functionally critical regions of gatekeepers. We conclude that human gatekeeper suppressor genes are enriched for nonsense-prone codons, and submit that this germline vulnerability to tumors could reflect in utero selection for a methylation-dependent capability to short-circuit environmental insults that otherwise trigger apoptosis and fetal loss.

Cannabis use by women during pregnancy does not influence infant DNA methylation of the dopamine receptor DRD4.

PubMed

Fransquet, Peter D; Hutchinson, Delyse; Olsson, Craig A; Allsop, Steve; Elliott, Elizabeth J; Burns, Lucinda; Mattick, Richard; Saffery, Richard; Ryan, Joanne

2017-11-01

Maternal cannabis use in pregnancy is linked with long-term adverse behavioral outcomes in offspring. Epigenetic processes established in utero that affect dopaminergic (reward) signaling may mediate risks. Associations between cannabis use and offspring DNA methylation have not been investigated; however, maternal tobacco smoking in pregnancy is associated with distinct patterns of DNA methylation at birth and beyond. To determine whether maternal cannabis use is associated with methylation of the dopamine receptor gene DRD4 promoter in infants. Mothers in the Triple B study provided detailed information on drug use in each trimester of pregnancy. Buccal swabs were collected from neonates at 8 weeks (n = 804, 51.7% male, and 48.3% female). DRD4 promoter DNA methylation was measured using SEQUENOM MassARRAY. Fifty-seven of the women in the study reported drug use during pregnancy, of whom 44 used cannabis. Of 19 cytosine-phosphate-guanine dinucleotides (CpG) units tested in DRD4, gestational cannabis use was associated with offspring methylation at 1 CpG unit in multivariate models (β + 1.48, CI: 0.02 to 2.93, and p = 0.047). At another site there was weak evidence that both cannabis and other drug use were independently associated with increased methylation, while the association with tobacco was in the reverse direction (cannabis use β + 0.67, CI: -0.12 to 1.46, and p = 0.09; other drug use β + 1.11, CI: 0.17 to 2.05, and p = 0.02; tobacco use β -0.41, CI: -0.85 to 0.03, and p = 0.07). None of the associations would remain significant after correction for multiple testing. There is no strong evidence that maternal cannabis use in pregnancy is associated with offspring DRD4 methylation.

Pattern generating and reflex-like processes controlling aiming movements in the presence of inertia, damping and gravity. A theoretical note.

PubMed

Kalveram, K T

1991-01-01

A model is proposed, in which goal-directed movements of the forearm are controlled by a central pattern generator (CPG) initiated for exactly one period, and by reflex-analogous processes. Movement width is proportional to the amplitude factor of the CPG's output, and to the square of the CPG's period length. The period duration can be freely selected, thus enabling the CPG to accommodate its time scale to the period of others CPG's. Parameters which influence movement accuracy can be adjusted by means of closed control loop, which are discrete with respect to time: The time unit corresponds to the period of the CPG. For instance, momentum adjustment balances the CPG in such a manner that the velocity of the arm becomes zero on termination of the period, while gain adjustment serves to attain a correct movement length in the presence of an inertial load. Friction, stiffness and gravitational force are neutralized by additional reflex-type processes, interpretable as positive feedback loops with adjustable gain factors, using position and velocity signals.

Modeling, Simulation, and Analysis of a Decoy State Enabled Quantum Key Distribution System

DTIC Science & Technology

2015-03-26

through the fiber , we assume Alice and Bob have correct basis alignment and timing control for reference frame correction and precise photon detection...optical components ( laser , polarization modulator, electronic variable optical attenuator, fixed optical attenuator, fiber channel, beamsplitter...generated by the laser in the CPG propagate through multiple optical components, each with a unique propagation delay before reaching the OPM. Timing

FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

PubMed Central

Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

2018-01-01

CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

Prediction of epigenetically regulated genes in breast cancer cell lines.

PubMed

Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria E H; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

2010-06-04

Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profiles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profiles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fixed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically significant negative correlation between methylation profiles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identified 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.

A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

PubMed Central

Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

2006-01-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

PubMed

Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

2006-03-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells

PubMed Central

Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L.; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M.

2017-01-01

Abstract Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. PMID:28126923

Functional characterization of dI6 interneurons in the neonatal mouse spinal cord.

PubMed

Dyck, Jason; Lanuza, Guillermo M; Gosgnach, Simon

2012-06-01

Our understanding of the neural control of locomotion has been greatly enhanced by the ability to identify and manipulate genetically defined populations of interneurons that comprise the locomotor central pattern generator (CPG). To date, the dI6 interneurons are one of the few populations that settle in the ventral region of the postnatal spinal cord that have not been investigated. In the present study, we utilized a novel transgenic mouse line to electrophysiologically characterize dI6 interneurons located close to the central canal and study their function during fictive locomotion. The majority of dI6 cells investigated were found to be rhythmically active during fictive locomotion and could be divided into two electrophysiologically distinct populations of interneurons. The first population fired rhythmic trains of action potentials that were loosely coupled to ventral root output and contained several intrinsic membrane properties of rhythm-generating neurons, raising the possibility that these cells may be involved in the generation of rhythmic activity in the locomotor CPG. The second population fired rhythmic trains of action potentials that were tightly coupled to ventral root output and lacked intrinsic oscillatory mechanisms, indicating that these neurons may be driven by a rhythm-generating network. Together these results indicate that dI6 neurons comprise an important component of the locomotor CPG that participate in multiple facets of motor behavior.

Functional characterization of dI6 interneurons in the neonatal mouse spinal cord

PubMed Central

Dyck, Jason; Lanuza, Guillermo M.

2012-01-01

Our understanding of the neural control of locomotion has been greatly enhanced by the ability to identify and manipulate genetically defined populations of interneurons that comprise the locomotor central pattern generator (CPG). To date, the dI6 interneurons are one of the few populations that settle in the ventral region of the postnatal spinal cord that have not been investigated. In the present study, we utilized a novel transgenic mouse line to electrophysiologically characterize dI6 interneurons located close to the central canal and study their function during fictive locomotion. The majority of dI6 cells investigated were found to be rhythmically active during fictive locomotion and could be divided into two electrophysiologically distinct populations of interneurons. The first population fired rhythmic trains of action potentials that were loosely coupled to ventral root output and contained several intrinsic membrane properties of rhythm-generating neurons, raising the possibility that these cells may be involved in the generation of rhythmic activity in the locomotor CPG. The second population fired rhythmic trains of action potentials that were tightly coupled to ventral root output and lacked intrinsic oscillatory mechanisms, indicating that these neurons may be driven by a rhythm-generating network. Together these results indicate that dI6 neurons comprise an important component of the locomotor CPG that participate in multiple facets of motor behavior. PMID:22442567

Lack of chart reminder effectiveness on family medicine resident JNC-VI and NCEP III guideline knowledge and attitudes.

PubMed

Echlin, Paul S; Upshur, Ross E G; Markova, Tsveti P

2004-07-05

The literature demonstrates that medical residents and practicing physicians have an attitudinal-behavioral discordance concerning their positive attitudes towards clinical practice guidelines (CPG), and the implementation of these guidelines into clinical practice patterns. A pilot study was performed to determine if change in a previously identified CPG compliance factor (accessibility) would produce a significant increase in family medicine resident knowledge and attitude toward the guidelines. The primary study intervention involved placing a summary of the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC VI) and the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (NCEP III) CPGs in all patient (>18 yr.) charts for a period of three months. The JNC VI and NCEP III CPGs were also distributed to each Wayne State family medicine resident, and a copy of each CPG was placed in the preceptor's area of the involved clinics. Identical pre- and post- intervention questionnaires were administered to all residents concerning CPG knowledge and attitude. Post-intervention analysis failed to demonstrate a significant difference in CPG knowledge. A statistically significant post-intervention difference was found in only on attitude question. The barriers to CPG compliance were identified as 1) lack of CPG instruction; 2) lack of critical appraisal ability; 3) insufficient time; 4) lack of CPG accessibility; and 5) lack of faculty modeling. This study demonstrated no significant post intervention changes in CPG knowledge, and only one question that reflected attitude change. Wider resident access to dedicated clinic time, increased faculty modeling, and the implementation of an electronic record/reminder system that uses a team-based approach are compliance factors that should be considered for further investigation. The interpretation of CPG non-compliance will benefit from a causal matrix focused on physician knowledge, attitudes, and behavior. Recent findings in resident knowledge-behavior discordance may direct the future investigation of physician CPG non-compliance away from generalized barrier research, and toward the development of information that maximizes the sense of individual practitioner urgency and certainty.

Social Behavior of Pet Dogs Is Associated with Peripheral OXTR Methylation

PubMed Central

Cimarelli, Giulia; Virányi, Zsófia; Turcsán, Borbála; Rónai, Zsolt; Sasvári-Székely, Mária; Bánlaki, Zsófia

2017-01-01

Oxytocin is a key modulator of emotional processing and social cognitive function. In line with this, polymorphisms of genes involved in oxytocin signaling, like the oxytocin receptor (OXTR) gene, are known to influence social behavior in various species. However, to date, no study has investigated environmental factors possibly influencing the epigenetic variation of the OXTR gene and its behavioral effects in dogs. Pet dogs form individualized and strong relationships with their owners who are central figures in the social environment of their dogs and therefore might influence the methylation levels of their OXTR gene. Here we set out to investigate whether DNA methylation within the OXTR promoter region of pet dogs is linked to their owner’s interaction style and to the social behavior of the dogs. To be able to do so, we collected buccal epithelial cells and, in Study 1, we used pyrosequencing techniques to look for differentially methylated CpG sites in the canine OXTR promoter region on a heterogeneous sample of dogs and wolves of different ages and keeping conditions. Four identified sites (at positions -727, -751, -1371, and -1383 from transcription start site) showing more than 10% methylation variation were then, in Study 2, measured in triplicate in 217 pet Border Collies previously tested for reactions to an adverse social situation (i.e., approach by a threatening human) and with available data on their owners’ interaction styles. We found that CpG methylation was significantly associated with the behavior of the dogs, in particular with the likelihood that dogs would hide behind their owner or remain passive when approached by a threatening human. On the other hand, CpG methylation was not related to the owners’ behavior but to dog sex (at position -1371). Our findings underpin the complex relationship between epigenetics and behavior and highlight the importance of including epigenetic methods in the analysis of dog behavioral development. Further research is needed to investigate which environmental factors influence the epigenetic variation of the OXTR gene. PMID:28443051

Impact of the Location of CpG Methylation within the GSTP1 Gene on Its Specificity as a DNA Marker for Hepatocellular Carcinoma

PubMed Central

Jain, Surbhi; Boldbaatar, Batbold; Hamilton, James P.; Lin, Selena Y.; Chang, Ting-Tsung; Chen, Shun-Hua; Song, Wei; Meltzer, Stephen J.; Block, Timothy M.; Su, Ying-Hsiu

2012-01-01

Hypermethylation of the glutathione S-transferase π 1 (GSTP1) gene promoter region has been reported to be a potential biomarker to distinguish hepatocellular carcinoma (HCC) from other liver diseases. However, reports regarding how specific a marker it is have ranged from 100% to 0%. We hypothesized that, to a large extent, the variation of specificity depends on the location of the CpG sites analyzed. To test this hypothesis, we compared the methylation status of the GSTP1 promoter region of the DNA isolated from HCC, cirrhosis, hepatitis, and normal liver tissues by bisulfite–PCR sequencing. We found that the 5′ region of the position −48 nt from the transcription start site of the GSTP1 gene is selectively methylated in HCC, whereas the 3′ region is methylated in all liver tissues examined, including normal liver and the HCC tissue. Interestingly, when DNA derived from fetal liver and 11 nonhepatic normal tissue was also examined by bisulfite-PCR sequencing, we found that methylation of the 3′ region of the promoter appeared to be liver-specific. A methylation-specific PCR assay targeting the 5′ region of the promoter was developed and used to quantify the methylated GSTP1 gene in various diseased liver tissues including HCC. When we used an assay targeting the 3′ region, we found that the methylation of the 5′-end of the GSTP1 promoter was significantly more specific than that of the 3′-end (97.1% vs. 60%, p<0.0001 by Fisher's exact test) for distinguishing HCC (n = 120) from hepatitis (n = 35) and cirrhosis (n = 35). Encouragingly, 33.8% of the AFP-negative HCC contained the methylated GSTP1 gene. This study clearly demonstrates the importance of the location of CpG site methylation for HCC specificity and how liver-specific DNA methylation should be considered when an epigenetic DNA marker is studied for detection of HCC. PMID:22536438

Gene-Specific Differential DNA Methylation and Chronic Arsenic Exposure in an Epigenome-Wide Association Study of Adults in Bangladesh

PubMed Central

Argos, Maria; Chen, Lin; Jasmine, Farzana; Tong, Lin; Pierce, Brandon L.; Roy, Shantanu; Paul-Brutus, Rachelle; Gamble, Mary V.; Harper, Kristin N.; Parvez, Faruque; Rahman, Mahfuzar; Rakibuz-Zaman, Muhammad; Slavkovich, Vesna; Baron, John A.; Graziano, Joseph H.; Kibriya, Muhammad G.

2014-01-01

Background: Inorganic arsenic is one of the most common naturally occurring contaminants found in the environment. Arsenic is associated with a number of health outcomes, with epigenetic modification suggested as a potential mechanism of toxicity. Objective: Among a sample of 400 adult participants, we evaluated the association between arsenic exposure, as measured by blood and urinary total arsenic concentrations, and epigenome-wide white blood cell DNA methylation. Methods: We used linear regression models to examine the associations between arsenic exposure and methylation at each CpG site, adjusted for sex, age, and batch. Differentially methylated loci were subsequently examined in relation to corresponding gene expression for functional evidence of gene regulation. Results: In adjusted analyses, we observed four differentially methylated CpG sites with urinary total arsenic concentration and three differentially methylated CpG sites with blood arsenic concentration, based on the Bonferroni-corrected significance threshold of p < 1 × 10–7. Methylation of PLA2G2C (probe cg04605617) was the most significantly associated locus in relation to both urinary (p = 3.40 × 10–11) and blood arsenic concentrations (p = 1.48 × 10–11). Three additional novel methylation loci—SQSTM1 (cg01225779), SLC4A4 (cg06121226), and IGH (cg13651690)—were also significantly associated with arsenic exposure. Further, there was evidence of methylation-related gene regulation based on gene expression for a subset of differentially methylated loci. Conclusions: We observed significant associations between arsenic exposure and gene-specific differential white blood cell DNA methylation, suggesting that epigenetic modifications may be an important pathway underlying arsenic toxicity. The specific differentially methylated loci identified may inform potential pathways for future interventions. Citation: Argos M, Chen L, Jasmine F, Tong L, Pierce BL, Roy S, Paul-Brutus R, Gamble MV, Harper KN, Parvez F, Rahman M, Rakibuz-Zaman M, Slavkovich V, Baron JA, Graziano JH, Kibriya MG, Ahsan H. 2015. Gene-specific differential DNA methylation and chronic arsenic exposure in an epigenome-wide association study of adults in Bangladesh. Environ Health Perspect 123:64–71; http://dx.doi.org/10.1289/ehp.1307884 PMID:25325195

Clinical practice guideline for Sjögren's syndrome 2017.

PubMed

Sumida, Takayuki; Azuma, Naoto; Moriyama, Masafumi; Takahashi, Hiroyuki; Asashima, Hiromitsu; Honda, Fumika; Abe, Saori; Ono, Yuko; Hirota, Tomoya; Hirata, Shintaro; Tanaka, Yoshiya; Shimizu, Toshimasa; Nakamura, Hideki; Kawakami, Atsushi; Sano, Hajime; Ogawa, Yoko; Tsubota, Kazuo; Ryo, Koufuchi; Saito, Ichiro; Tanaka, Akihiko; Nakamura, Seiji; Takamura, Etsuko; Tanaka, Masao; Suzuki, Katsuya; Takeuchi, Tsutomu; Yamakawa, Noriyuki; Mimori, Tsuneyo; Ohta, Akiko; Nishiyama, Susumu; Yoshihara, Toshio; Suzuki, Yasunori; Kawano, Mitsuhiro; Tomiita, Minako; Tsuboi, Hiroto

2018-05-01

The objective of this study is to develop clinical practice guideline (CPG) for Sjögren's syndrome (SS) based on recently available clinical and therapeutic evidences. The CPG committee for SS was organized by the Research Team for Autoimmune Diseases, Research Program for Intractable Disease of the Ministry of Health, Labor and Welfare (MHLW), Japan. The committee completed a systematic review of evidences for several clinical questions and developed CPG for SS 2017 according to the procedure proposed by the Medical Information Network Distribution Service (Minds). The recommendations and their strength were checked by the modified Delphi method. The CPG for SS 2017 has been officially approved by both Japan College of Rheumatology and the Japanese Society for SS. The CPG committee set 38 clinical questions for clinical symptoms, signs, treatment, and management of SS in pediatric, adult and pregnant patients, using the PICO (P: patients, problem, population, I: interventions, C: comparisons, controls, comparators, O: outcomes) format. A summary of evidence, development of recommendation, recommendation, and strength for these 38 clinical questions are presented in the CPG. The CPG for SS 2017 should contribute to improvement and standardization of diagnosis and treatment of SS.

Substantial reduction in hospital stay of children and adolescents with diabetic ketoacidosis after implementation of Clinical Practice Guidelines in a university hospital in Saudi Arabia.

PubMed

Al Nemri, Abdulrahman; Amer, Yasser Sami; Gasim, Hala; Osman, Mohamed Elfaki; Aleyadhy, Ayman; Al Otaibi, Hessah; Iqbal, Shaikh Mohammed; Aljurayyan, Nasir Abdullah; Assiri, Asaad M; Babiker, Amir; Mohamed, Sarar

2017-02-01

We aimed to determine the effect of Clinical Practice Guideline (CPG) implementation on length of hospital stay of children and adolescents with diabetic ketoacidosis (DKA). This was a 6-year (2008-2014) case-control retrospective study conducted at King Khalid University Hospital, Riyadh, that compared patients with DKA managed using CPG with those treated before CPG implementation. There were 63 episodes of DKA in 41 patients managed using CPG compared with 40 episodes in 33 patients treated before implementation of CPG. Baseline characteristics of the 2 groups were similar (age, sex, newly diagnosed patients, recurrent DKA, DKA severity, and mean glycosylated hemoglobin). The mean length of hospital stay (±SD) was 68.6 ± 53.1 hours after implementation of CPG compared with 107.4 ± 65.6 hours before implementation (P < .001). The reduction in length of hospital stay equals to 1700 bed days saved per year per 1000 patients. Implementation of CPG for DKA decreased the length of hospital stay. © 2016 John Wiley & Sons, Ltd.

Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

PubMed

Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

2010-08-01

Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

DNA Methylation as a Biomarker for Preeclampsia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Cindy M.; Ralph, Jody L.; Wright, Michelle L.

Background: Preeclampsia contributes significantly to pregnancy-associated morbidity and mortality as well as future risk of cardiovascular disease in mother and offspring, and preeclampsia in offspring. The lack of reliable methods for early detection limits the opportunities for prevention, diagnosis, and timely treatment. Purpose: The purpose of this study was to explore distinct DNA methylation patterns associated with preeclampsia in both maternal cells and fetal-derived tissue that represent potential biomarkers to predict future preeclampsia and inheritance in children. Method: A convenience sample of nulliparous women (N = 55) in the first trimester of pregnancy was recruited for this prospective study. Genome-widemore » DNA methylation was quantified in first-trimester maternal peripheral white blood cells and placental chorionic tissue from normotensive women and those with preeclampsia (n = 6/group). Results: Late-onset preeclampsia developed in 12.7% of women. Significant differences in DNA methylation were identified in 207 individual linked cytosine and guanine (CpG) sites in maternal white blood cells collected in the first trimester (132 sites with gain and 75 sites with loss of methylation), which were common to approximately 75% of the differentially methylated CpG sites identified in chorionic tissue of fetal origin. Conclusion: This study is the first to identify maternal epigenetic targets and common targets in fetal-derived tissue that represent putative biomarkers for early detection and heritable risk of preeclampsia. Findings may pave the way for diagnosis of preeclampsia prior to its clinical presentation and acute damaging effects, and the potential for prevention of the detrimental long-term sequelae.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pelch, Katherine E.; Tokar, Erik J.; Merrick, B. Alex

Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10 μM Cd for 11 weeks (CTPE) or 5 μM iAs for 29 weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1)more » were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (> 25-fold) and S100P (> 40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (> 15-fold) and NTM (> 1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. - Highlights: • Cd and iAs are known human carcinogens, yet neither appears directly mutagenic. • Prior data suggest epigenetic modification plays a role in Cd or iAs induced cancer. • Altered methylation of four misregulated genes was found in Cd or iAs transformants. • The resulting altered gene expression may be relevant to cellular transformation.« less

TET1 Depletion Induces Aberrant CpG Methylation in Colorectal Cancer Cells

PubMed Central

Yamamoto, Eiichiro; Harada, Taku; Aoki, Hironori; Maruyama, Reo; Toyota, Mutsumi; Sasaki, Yasushi; Sugai, Tamotsu; Tokino, Takashi; Nakase, Hiroshi

2016-01-01

Aberrant DNA methylation is commonly observed in colorectal cancer (CRC), but the underlying mechanism is not fully understood. 5-hydroxymethylcytosine levels and TET1 expression are both reduced in CRC, while epigenetic silencing of TET1 is reportedly associated with the CpG island methylator phenotype. In the present study, we aimed to clarify the relationship between loss of TET1 and aberrant DNA methylation in CRC. Stable TET1 knockdown clones were established using Colo320DM cells, which express high levels of TET1, and HCT116 cells, which express TET1 at a level similar to that in normal colonic tissue. Infinium HumanMethylation450 BeadChip assays revealed increased levels of 5-methylcytosine at more than 10,000 CpG sites in TET1-depleted Colo320DM cells. Changes in DNA methylation were observed at various positions within the genome, including promoters, gene bodies and intergenic regions, and the altered methylation affected expression of a subset of genes. By contrast, TET1 knockdown did not significantly affect DNA methylation in HCT116 cells. However, TET1 depletion was associated with attenuated effects of 5-aza-2’-deoxycytidine on gene expression profiles in both cell lines. These results suggest that loss of TET1 may induce aberrant DNA methylation and may attenuate the effect of 5-aza-2’-deoxycytidine in CRC cells. PMID:27977763

DNA methylation patterns of behavior-related gene promoter regions dissect the gray wolf from domestic dog breeds.

PubMed

Banlaki, Zsofia; Cimarelli, Giulia; Viranyi, Zsofia; Kubinyi, Eniko; Sasvari-Szekely, Maria; Ronai, Zsolt

2017-06-01

A growing body of evidence highlights the relationship between epigenetics, especially DNA methylation, and population divergence as well as speciation. However, little is known about how general the phenomenon of epigenetics-wise separation of different populations is, or whether population assignment is, possible based on solely epigenetic marks. In the present study, we compared DNA methylation profiles between four different canine populations: three domestic dog breeds and their ancestor the gray wolf. Altogether, 79 CpG sites constituting the 65 so-called CpG units located in the promoter regions of genes affecting behavioral and temperamental traits (COMT, HTR1A, MAOA, OXTR, SLC6A4, TPH1, WFS1)-regions putatively targeted during domestication and breed selection. Methylation status of buccal cells was assessed using EpiTYPER technology. Significant inter-population methylation differences were found in 52.3% of all CpG units investigated. DNA methylation profile-based hierarchical cluster analysis indicated an unambiguous segregation of wolf from domestic dog. In addition, one of the three dog breeds (Golden Retriever) investigated also formed a separate, autonomous group. The findings support that population segregation is interrelated with shifts in DNA methylation patterns, at least in putative selection target regions, and also imply that epigenetic profiles could provide a sufficient basis for population assignment of individuals.

Analysis of a Cholera Toxin B Subunit (CTB) and Human Mucin 1 (MUC1) Conjugate Protein in a MUC1 Tolerant Mouse Model

PubMed Central

Pinkhasov, Julia; Alvarez, M. Lucrecia; Pathangey, Latha B.; Tinder, Teresa L.; Mason, Hugh S.; Walmsley, Amanda M.; Gendler, Sandra J.; Mukherjee, Pinku

2011-01-01

Since epithelial mucin 1 (MUC1) is associated with several adenocarcinomas at mucosal sites, it is pertinent to test the efficacy of a mucosally targeted vaccine formulation. The B subunit of the Vibrio cholerae cholera toxin (CTB) has great potential to act as a mucosal carrier for subunit vaccines. In the present study we evaluated whether a MUC1 tandem repeat (TR) peptide chemically linked to CTB would break self-antigen tolerance in the transgenic MUC1 tolerant mouse model (MUC1.Tg) through oral or parenteral immunizations. We report that oral immunization with the CTB-MUC1 conjugate along with mucosal adjuvant, unmethylated CpG oligodeoxynucleotide (ODN) and interleukin-12 (IL-12), did not break self-antigen tolerance in MUC1.Tg mice, but induced a strong humoral response in wild-type C57BL/6 mice. However, self-antigen tolerance in the MUC1.Tg mouse model was broken after parenteral immunizations with different doses of the CTB-MUC1 conjugate protein and with the adjuvant CpG ODN co-delivered with CTB-MUC1. Importantly, mice immunized systemically with CpG ODN alone and with CTB-MUC1 exhibited decreased tumor burden when challenged with a mammary gland tumor cell line that expresses human MUC1. PMID:20824430

Analysis of a cholera toxin B subunit (CTB) and human mucin 1 (MUC1) conjugate protein in a MUC1-tolerant mouse model.

PubMed

Pinkhasov, Julia; Alvarez, M Lucrecia; Pathangey, Latha B; Tinder, Teresa L; Mason, Hugh S; Walmsley, Amanda M; Gendler, Sandra J; Mukherjee, Pinku

2010-12-01

Since epithelial mucin 1 (MUC1) is associated with several adenocarcinomas at the mucosal sites, it is pertinent to test the efficacy of a mucosally targeted vaccine formulation. The B subunit of the Vibrio cholerae cholera toxin (CTB) has great potential to act as a mucosal carrier for subunit vaccines. In the present study we evaluated whether a MUC1 tandem repeat (TR) peptide chemically linked to CTB would break self-antigen tolerance in the transgenic MUC1-tolerant mouse model (MUC1.Tg) through oral or parenteral immunizations. We report that oral immunization with the CTB-MUC1 conjugate along with mucosal adjuvant, unmethylated CpG oligodeoxynucleotide (ODN) and interleukin-12 (IL-12) did not break self-antigen tolerance in MUC1.Tg mice, but induced a strong humoral response in wild-type C57BL/6 mice. However, self-antigen tolerance in the MUC1.Tg mouse model was broken after parenteral immunizations with different doses of the CTB-MUC1 conjugate protein and with the adjuvant CpG ODN co-delivered with CTB-MUC1. Importantly, mice immunized systemically with CpG ODN alone and with CTB-MUC1 exhibited decreased tumor burden when challenged with a mammary gland tumor cell line that expresses human MUC1.

[Web Visit Patterns for the Clinical Practice Guidelines for Management of Depressive Disorder and Alcohol Abuse-Dependence].

PubMed

Suárez-Obando, Fernando; Restrepo, Carlos Gómez

Clinical practice guidelines (CPG) are a set of recommendations for professionals, patients, and families, in order to make decisions about health care. The CPG respond to the need for concise, accurate, practical, and up to date information. In the field of mental health, Colombia has developed three GPC; alcohol (GPC-OH), depression (GPC-TDA), and schizophrenia. To describe the Web Portal traffic related to psychiatry guidelines, with emphasis on the number of visits, distribution throughout Colombian cities, and estimating user behaviour patterns. An evaluation was made of the traffic at the Clinical Practice Guidelines Web Portal of the Ministry of Health and Social Protection between 2013 and 2015 (two years of observation since the inauguration of the Portal). Out of the 45 GPC published on the website, the CPG-OH represented 1.21% of all page views of the Portal. CPG-TDA reached 1.52% (accumulated percentage of 2.73%), being the eighth most consulted guideline, with CPG-OH being number 16. The highest mean monthly number of visits for this group of guideliness was for the CPG-OH for health professionals (353 visits/month), and the lowest was for the CPG-AD for patients and relatives (24 single visits/month). Bogotá D.C. was the city where health carers accessed the guidelines more often. The guidelines for patients and relatives were consulted more in Villavicencio, Cúcuta, Manizales, Pereira, and Pasto. The web portal partially fulfills the purpose of circulating the CPG in Colombia. The visits to the CPG of mental health is quite low, and requires better dissemination strategies that allow the use of information and communication technology. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.

PubMed

Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku

2012-11-01

Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.

Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity

PubMed Central

Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.

2013-01-01

Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528

Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

PubMed

Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

2011-10-01

Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

Assessing the efficacy of Duddingtonia flagrans chlamydospores per gram of faeces to control Haemonchus contortus larvae.

PubMed

Ojeda-Robertos, Nadia Florencia; Torres-Acosta, Juan Felipe de Jesus; Aguilar-Caballero, Armando Jacinto; Ayala-Burgos, Armín; Cob-Galera, Ligia Amira; Sandoval-Castro, Carlos Alfredo; Barrientos-Medina, Roberto Carlos; de Gives, Pedro Mendoza

2008-12-20

The aims were (a) to quantify the number of Duddingtonia flagrans chlamydospores per gram of faeces (CPG) recovered from sheep administered with different oral doses and, (b) to describe the relationship between CPG and eggs per gram of faeces (EPG) on the efficacy to reduce Haemonchus contortus infective larvae. Three doses of chlamydospores per kg BW were orally administered during seven days: (T1) non treated control group, (T2) 1 x 10(6), (T3) 2.5 x 10(6) and (T4) 5 x 10(6). Three lambs, infected with H. contortus, were used per group. Faeces were obtained from the rectum of each lamb during the fungal administration period (days 0-6) and for six days after that period. Four coproculture replicates were made from each animal in days 2, 4, 6, 8 and 10. A higher chlamydospore dose produced higher CPG in faeces (p < 0.05), but a clear dose dependent effect was not found either in the larvae reduction or in the CPG:EPG ratio. When ratios were re-analyzed, independently of the treatment groups of origin, a better efficacy was obtained with a ratio from 5 to 10 CPG:EPG and a higher ratio (> 10 per egg) showed a lower reduction efficacy (p < 0.05). The binomial analysis showed that for each unit of increment in CPG:EPG ratio there was a reduction of larvae number until a point (between 5 and 10 CPG:EPG) where no further reduction was detected. The surface response test indicated that the number of larvae was reduced by CPG until possible saturation. The highest CPG:EPG ratios did not necessarily improve efficacy of D. flagrans.

Association of Methylation Signals With Incident Coronary Heart Disease in an Epigenome-Wide Assessment of Circulating Tumor Necrosis Factor α.

PubMed

Aslibekyan, Stella; Agha, Golareh; Colicino, Elena; Do, Anh N; Lahti, Jari; Ligthart, Symen; Marioni, Riccardo E; Marzi, Carola; Mendelson, Michael M; Tanaka, Toshiko; Wielscher, Matthias; Absher, Devin M; Ferrucci, Luigi; Franco, Oscar H; Gieger, Christian; Grallert, Harald; Hernandez, Dena; Huan, Tianxiao; Iurato, Stella; Joehanes, Roby; Just, Allan C; Kunze, Sonja; Lin, Honghuang; Liu, Chunyu; Meigs, James B; van Meurs, Joyce B J; Moore, Ann Zenobia; Peters, Annette; Prokisch, Holger; Räikkönen, Katri; Rathmann, Wolfgang; Roden, Michael; Schramm, Katharina; Schwartz, Joel D; Starr, John M; Uitterlinden, André G; Vokonas, Pantel; Waldenberger, Melanie; Yao, Chen; Zhi, Degui; Baccarelli, Andrea A; Bandinelli, Stefania; Deary, Ian J; Dehghan, Abbas; Eriksson, Johan; Herder, Christian; Jarvelin, Marjo-Riitta; Levy, Daniel; Arnett, Donna K

2018-04-04

Tumor necrosis factor α (TNF-α) is a proinflammatory cytokine with manifold consequences for mammalian pathophysiology, including cardiovascular disease. A deeper understanding of TNF-α biology may enhance treatment precision. To conduct an epigenome-wide analysis of blood-derived DNA methylation and TNF-α levels and to assess the clinical relevance of findings. This meta-analysis assessed epigenome-wide associations in circulating TNF-α concentrations from 5 cohort studies and 1 interventional trial, with replication in 3 additional cohort studies. Follow-up analyses investigated associations of identified methylation loci with gene expression and incident coronary heart disease; this meta-analysis included 11 461 participants who experienced 1895 coronary events. Circulating TNF-α concentration. DNA methylation at approximately 450 000 loci, neighboring DNA sequence variation, gene expression, and incident coronary heart disease. The discovery cohort included 4794 participants, and the replication study included 816 participants (overall mean [SD] age, 60.7 [8.5] years). In the discovery stage, circulating TNF-α levels were associated with methylation of 7 cytosine-phosphate-guanine (CpG) sites, 3 of which were located in or near DTX3L-PARP9 at cg00959259 (β [SE] = -0.01 [0.003]; P = 7.36 × 10-8), cg08122652 (β [SE] = -0.008 [0.002]; P = 2.24 × 10-7), and cg22930808(β [SE] = -0.01 [0.002]; P = 6.92 × 10-8); NLRC5 at cg16411857 (β [SE] = -0.01 [0.002]; P = 2.14 × 10-13) and cg07839457 (β [SE] = -0.02 [0.003]; P = 6.31 × 10-10); or ABO, at cg13683939 (β [SE] = 0.04 [0.008]; P = 1.42 × 10-7) and cg24267699 (β [SE] = -0.009 [0.002]; P = 1.67 × 10-7), after accounting for multiple testing. Of these, negative associations between TNF-α concentration and methylation of 2 loci in NLRC5 and 1 in DTX3L-14 PARP9 were replicated. Replicated TNF-α-linked CpG sites were associated with 9% to 19% decreased risk of incident coronary heart disease per 10% higher methylation per CpG site (cg16411857: hazard ratio [HR], 0.86; 95% CI, 0.78-1.95; P = .003; cg07839457: HR, 0.89; 95% CI, 0.80-0.94; P = 3.1 × 10-5; cg00959259: HR, 0.91; 95% CI, 0.84-0.97; P = .002; cg08122652: HR, 0.81; 95% CI, 0.74-0.89; P = 2.0 × 10-5). We identified and replicated novel epigenetic correlates of circulating TNF-α concentration in blood samples and linked these loci to coronary heart disease risk, opening opportunities for validation and therapeutic applications.

DNA motifs associated with aberrant CpG island methylation.

PubMed

Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

2006-05-01

Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

PubMed

Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

2016-06-01

Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

PubMed Central

Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

2010-01-01

The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-22

...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

PubMed

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

2017-10-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

Quantitative, high-resolution epigenetic profiling of CpG loci identifies associations with cord blood plasma homocysteine and birth weight in humans

PubMed Central

Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D

2011-01-01

Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804

Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

PubMed Central

Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

2005-01-01

Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

PubMed

Najar, Hossain M; Dutz, Jan P

2008-09-01

Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

PubMed

Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

2009-04-06

The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

Nuclear Matrix Proteins in Disparity of Prostate Cancer

DTIC Science & Technology

2012-07-01

BCL6 promoter (PMID 20733034) in B cell lymphoma cells and suggested that methylation of these CpG sites have a positive role on BCL6 transcription. In...the nuclei of several human cancers, including, adenocarcinoma of the pancreas, hepatocellular carcinoma, gastric carcinoma, and head and neck...snap-frozen in liquid nitrogen, and stored at - 80ºC until processing. In addition, histopathological sections were made from the rest of the

Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

PubMed

Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

2017-03-22

Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.

T cells are influenced by a long non-coding RNA in the autoimmune associated PTPN2 locus.

PubMed

Houtman, Miranda; Shchetynsky, Klementy; Chemin, Karine; Hensvold, Aase Haj; Ramsköld, Daniel; Tandre, Karolina; Eloranta, Maija-Leena; Rönnblom, Lars; Uebe, Steffen; Catrina, Anca Irinel; Malmström, Vivianne; Padyukov, Leonid

2018-06-01

Non-coding SNPs in the protein tyrosine phosphatase non-receptor type 2 (PTPN2) locus have been linked with several autoimmune diseases, including rheumatoid arthritis, type I diabetes, and inflammatory bowel disease. However, the functional consequences of these SNPs are poorly characterized. Herein, we show in blood cells that SNPs in the PTPN2 locus are highly correlated with DNA methylation levels at four CpG sites downstream of PTPN2 and expression levels of the long non-coding RNA (lncRNA) LINC01882 downstream of these CpG sites. We observed that LINC01882 is mainly expressed in T cells and that anti-CD3/CD28 activated naïve CD4 + T cells downregulate the expression of LINC01882. RNA sequencing analysis of LINC01882 knockdown in Jurkat T cells, using a combination of antisense oligonucleotides and RNA interference, revealed the upregulation of the transcription factor ZEB1 and kinase MAP2K4, both involved in IL-2 regulation. Overall, our data suggests the involvement of LINC01882 in T cell activation and hints towards an auxiliary role of these non-coding SNPs in autoimmunity associated with the PTPN2 locus. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Differential DNA Methylation of MicroRNA Genes in Temporal Cortex from Alzheimer's Disease Individuals.

PubMed

Villela, Darine; Ramalho, Rodrigo F; Silva, Aderbal R T; Brentani, Helena; Suemoto, Claudia K; Pasqualucci, Carlos Augusto; Grinberg, Lea T; Krepischi, Ana C V; Rosenberg, Carla

2016-01-01

This study investigated for the first time the genomewide DNA methylation changes of noncoding RNA genes in the temporal cortex samples from individuals with Alzheimer's disease (AD). The methylome of 10 AD individuals and 10 age-matched controls were obtained using Illumina 450 K methylation array. A total of 2,095 among the 15,258 interrogated noncoding RNA CpG sites presented differential methylation, 161 of which were associated with miRNA genes. In particular, 10 miRNA CpG sites that were found to be hypermethylated in AD compared to control brains represent transcripts that have been previously associated with the disease. This miRNA set is predicted to target 33 coding genes from the neuregulin receptor complex (ErbB) signaling pathway, which is required for the neurons myelination process. For 6 of these miRNA genes (MIR9-1, MIR9-3, MIR181C, MIR124-1, MIR146B, and MIR451), the hypermethylation pattern is in agreement with previous results from literature that shows downregulation of miR-9, miR-181c, miR-124, miR-146b, and miR-451 in the AD brain. Our data implicate dysregulation of miRNA methylation as contributor to the pathogenesis of AD.

Genetic variation and epigenetic modification of the prodynorphin gene in peripheral blood cells in alcoholism.

PubMed

D'Addario, Claudio; Shchetynsky, Klementy; Pucci, Mariangela; Cifani, Carlo; Gunnar, Agneta; Vukojević, Vladana; Padyukov, Leonid; Terenius, Lars

2017-06-02

Dynorphins are critically involved in the development, maintenance and relapse of alcoholism. Alcohol-induced changes in the prodynorphin gene expression may be influenced by both gene polymorphisms and epigenetic modifications. The present study of human alcoholics aims to evaluate DNA methylation patterns in the prodynorphin gene (PDYN) promoter and to identify single nucleotide polymorphisms (SNPs) associated with alcohol dependence and with altered DNA methylation. Genomic DNA was isolated from peripheral blood cells of alcoholics and healthy controls, and DNA methylation was studied in the PDYN promoter by bisulfite pyrosequencing. In alcoholics, DNA methylation increased in three of the seven CpG sites investigated, as well as in the average of the seven CpG sites. Data stratification showed lower increase in DNA methylation levels in individuals reporting craving and with higher levels of alcohol consumption. Association with alcoholism was observed for rs2235751 and the presence of the minor allele G was associated with reduced DNA methylation at PDYN promoter in females and younger subjects. Genetic and epigenetic factors within PDYN are related to risk for alcoholism, providing further evidence of its involvement on ethanol effects. These results might be of relevance for developing new biomarkers to predict disease trajectories and therapeutic outcome. Copyright © 2017 Elsevier Inc. All rights reserved.

The dynamic DNA methylation cycle from egg to sperm in the honey bee Apis mellifera

PubMed Central

Drewell, Robert A.; Bush, Eliot C.; Remnant, Emily J.; Wong, Garrett T.; Beeler, Suzannah M.; Stringham, Jessica L.; Lim, Julianne; Oldroyd, Benjamin P.

2014-01-01

In honey bees (Apis mellifera), the epigenetic mark of DNA methylation is central to the developmental regulation of caste differentiation, but may also be involved in additional biological functions. In this study, we examine the whole genome methylation profiles of three stages of the haploid honey bee genome: unfertilised eggs, the adult drones that develop from these eggs and the sperm produced by these drones. These methylomes reveal distinct patterns of methylation. Eggs and sperm show 381 genes with significantly different CpG methylation patterns, with the vast majority being more methylated in eggs. Adult drones show greatly reduced levels of methylation across the genome when compared with both gamete samples. This suggests a dynamic cycle of methylation loss and gain through the development of the drone and during spermatogenesis. Although fluxes in methylation during embryogenesis may account for some of the differentially methylated sites, the distinct methylation patterns at some genes suggest parent-specific epigenetic marking in the gametes. Extensive germ line methylation of some genes possibly explains the lower-than-expected frequency of CpG sites in these genes. We discuss the potential developmental and evolutionary implications of methylation in eggs and sperm in this eusocial insect species. PMID:24924193

A Bayesian hierarchical model to detect differentially methylated loci from single nucleotide resolution sequencing data

PubMed Central

Feng, Hao; Conneely, Karen N.; Wu, Hao

2014-01-01

DNA methylation is an important epigenetic modification that has essential roles in cellular processes including gene regulation, development and disease and is widely dysregulated in most types of cancer. Recent advances in sequencing technology have enabled the measurement of DNA methylation at single nucleotide resolution through methods such as whole-genome bisulfite sequencing and reduced representation bisulfite sequencing. In DNA methylation studies, a key task is to identify differences under distinct biological contexts, for example, between tumor and normal tissue. A challenge in sequencing studies is that the number of biological replicates is often limited by the costs of sequencing. The small number of replicates leads to unstable variance estimation, which can reduce accuracy to detect differentially methylated loci (DML). Here we propose a novel statistical method to detect DML when comparing two treatment groups. The sequencing counts are described by a lognormal-beta-binomial hierarchical model, which provides a basis for information sharing across different CpG sites. A Wald test is developed for hypothesis testing at each CpG site. Simulation results show that the proposed method yields improved DML detection compared to existing methods, particularly when the number of replicates is low. The proposed method is implemented in the Bioconductor package DSS. PMID:24561809

Genome-Wide DNA Methylation Analysis and Epigenetic Variations Associated with Congenital Aortic Valve Stenosis (AVS).

PubMed

Radhakrishna, Uppala; Albayrak, Samet; Alpay-Savasan, Zeynep; Zeb, Amna; Turkoglu, Onur; Sobolewski, Paul; Bahado-Singh, Ray O

2016-01-01

Congenital heart defect (CHD) is the most common cause of death from congenital anomaly. Among several candidate epigenetic mechanisms, DNA methylation may play an important role in the etiology of CHDs. We conducted a genome-wide DNA methylation analysis using an Illumina Infinium 450k human methylation assay in a cohort of 24 newborns who had aortic valve stenosis (AVS), with gestational-age matched controls. The study identified significantly-altered CpG methylation at 59 sites in 52 genes in AVS subjects as compared to controls (either hypermethylated or demethylated). Gene Ontology analysis identified biological processes and functions for these genes including positive regulation of receptor-mediated endocytosis. Consistent with prior clinical data, the molecular function categories as determined using DAVID identified low-density lipoprotein receptor binding, lipoprotein receptor binding and identical protein binding to be over-represented in the AVS group. A significant epigenetic change in the APOA5 and PCSK9 genes known to be involved in AVS was also observed. A large number CpG methylation sites individually demonstrated good to excellent diagnostic accuracy for the prediction of AVS status, thus raising possibility of molecular screening markers for this disorder. Using epigenetic analysis we were able to identify genes significantly involved in the pathogenesis of AVS.

Genome-Wide DNA Methylation Analysis and Epigenetic Variations Associated with Congenital Aortic Valve Stenosis (AVS)

PubMed Central

Radhakrishna, Uppala; Albayrak, Samet; Alpay-Savasan, Zeynep; Zeb, Amna; Turkoglu, Onur; Sobolewski, Paul; Bahado-Singh, Ray O.

2016-01-01

Congenital heart defect (CHD) is the most common cause of death from congenital anomaly. Among several candidate epigenetic mechanisms, DNA methylation may play an important role in the etiology of CHDs. We conducted a genome-wide DNA methylation analysis using an Illumina Infinium 450k human methylation assay in a cohort of 24 newborns who had aortic valve stenosis (AVS), with gestational-age matched controls. The study identified significantly-altered CpG methylation at 59 sites in 52 genes in AVS subjects as compared to controls (either hypermethylated or demethylated). Gene Ontology analysis identified biological processes and functions for these genes including positive regulation of receptor-mediated endocytosis. Consistent with prior clinical data, the molecular function categories as determined using DAVID identified low-density lipoprotein receptor binding, lipoprotein receptor binding and identical protein binding to be over-represented in the AVS group. A significant epigenetic change in the APOA5 and PCSK9 genes known to be involved in AVS was also observed. A large number CpG methylation sites individually demonstrated good to excellent diagnostic accuracy for the prediction of AVS status, thus raising possibility of molecular screening markers for this disorder. Using epigenetic analysis we were able to identify genes significantly involved in the pathogenesis of AVS. PMID:27152866

Allele-specific DNA methylation and its interplay with repressive histone marks at promoter-mutant TERT genes

PubMed Central

Stern, Josh Lewis; Paucek, Richard D.; Huang, Franklin W.; Ghandi, Mahmoud; Nwumeh, Ronald; Costello, James C.; Cech, Thomas R.

2017-01-01

SUMMARY A mutation in the promoter of the Telomerase Reverse Transcriptase (TERT) gene is the most frequent noncoding mutation in cancer. The mutation drives unusual monoallelic expression of TERT, allowing immortalization. Here we find that DNA methylation of the TERT CpG Island (CGI) is also allele-specific in multiple cancers. The expressed allele is hypomethylated, which is opposite to cancers without TERT promoter mutations. The continued presence of Polycomb repressive complex 2 (PRC2) on the inactive allele suggests that histone marks of repressed chromatin may be causally linked to high DNA methylation. Consistent with this hypothesis, TERT promoter DNA containing 5-methyl-CpG has much increased affinity for PRC2 in vitro. Thus, CpG methylation and histone marks appear to collaborate to maintain the two TERT alleles in different epigenetic states in TERT promoter-mutant cancers. Finally, in several cancers DNA methylation levels at the TERT CGI correlate with altered patient survival. PMID:29281820

Induction of anti-glioma natural killer cell response following multiple low-dose intracerebral CpG therapy.

PubMed

Alizadeh, Darya; Zhang, Leying; Brown, Christine E; Farrukh, Omar; Jensen, Michael C; Badie, Behnam

2010-07-01

Stimulation of toll-like receptor-9 by CpG oligodeoxynucleotides (CpG-ODN) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. These studies, however, have used high doses of CpG-ODN, which can induce toxicity in a clinical setting. The goal of this study was to evaluate the antitumor efficacy of multiple low-dose intratumoral CpG-ODN in a glioma model. Mice bearing 4-day-old intracranial GL261 gliomas received a single or multiple (two or four) intratumoral injections of CpG-ODN (3 microg) every 4 days. Tumor growth was measured by bioluminescent imaging, brain histology, and animal survival. Flow cytometry and cytotoxicity assays were used to assess anti-glioma immune response. Two and four intracranial injections of low-dose CpG-ODN, but not a single injection, eradicated gliomas in 70% of mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months) and were protected from intracranial rechallenge with GL261 gliomas, showing the capacity for long-term antitumor immunity. Although most inflammatory cells seemed to increase, activated natural killer (NK) cells (i.e., NK(+)CD107a(+)) were more frequent than CD8(+)CD107a(+) in the brains of rechallenged CpG-ODN-treated animals and showed a stronger in vitro cytotoxicity against GL261 target cells. Leukocyte depletion studies confirmed that NK cells played an important role in the initial CpG-ODN antitumor response, but both CD8 and NK cells were equally important in long-term immunity against gliomas. These findings suggest that multiple low-dose intratumoral injections of CpG-ODN can eradicate intracranial gliomas possibly through mechanisms involving NK-mediated effector function.

CNVs affecting cancer predisposing genes (CPGs) detected as incidental findings in routine germline diagnostic chromosomal microarray (CMA) testing.

PubMed

Innes, Josie; Reali, Lisa; Clayton-Smith, Jill; Hall, Georgina; Lim, Derek Hk; Burghel, George J; French, Kim; Khan, Unzela; Walker, Daniel; Lalloo, Fiona; Evans, D Gareth R; McMullan, Dominic; Maher, Eamonn R; Woodward, Emma R

2018-02-01

Identification of CNVs through chromosomal microarray (CMA) testing is the first-line investigation in individuals with learning difficulties/congenital abnormalities. Although recognised that CMA testing may identify CNVs encompassing a cancer predisposition gene (CPG), limited information is available on the frequency and nature of such results. We investigated CNV gains and losses affecting 39 CPGs in 3366 pilot index case individuals undergoing CMA testing, and then studied an extended cohort (n=10 454) for CNV losses at 105 CPGs and CNV gains at 9 proto-oncogenes implicated in inherited cancer susceptibility. In the pilot cohort, 31/3366 (0.92%) individuals had a CNV involving one or more of 16/39 CPGs. 30/31 CNVs involved a tumour suppressor gene (TSG), and 1/30 a proto-oncogene (gain of MET ). BMPR1A , TSC2 and TMEM127 were affected in multiple cases. In the second stage analysis, 49/10 454 (0.47%) individuals in the extended cohort had 50 CNVs involving 24/105 CPGs. 43/50 CNVs involved a TSG and 7/50 a proto-oncogene (4 gains, 3 deletions). The most frequently involved genes, FLCN (n=10) and SDHA (n=7), map to the Smith-Magenis and cri-du-chat regions, respectively. Incidental identification of a CNV involving a CPG is not rare and poses challenges for future cancer risk estimation. Prospective data collection from CPG-CNV cohorts ascertained incidentally and through syndromic presentations is required to determine the risks posed by specific CNVs. In particular, ascertainment and investigation of adults with CPG-CNVs and adults with learning disability and cancer, could provide important information to guide clinical management and surveillance. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Leveraging workflow control patterns in the domain of clinical practice guidelines.

PubMed

Kaiser, Katharina; Marcos, Mar

2016-02-10

Clinical practice guidelines (CPGs) include recommendations describing appropriate care for the management of patients with a specific clinical condition. A number of representation languages have been developed to support executable CPGs, with associated authoring/editing tools. Even with tool assistance, authoring of CPG models is a labor-intensive task. We aim at facilitating the early stages of CPG modeling task. In this context, we propose to support the authoring of CPG models based on a set of suitable procedural patterns described in an implementation-independent notation that can be then semi-automatically transformed into one of the alternative executable CPG languages. We have started with the workflow control patterns which have been identified in the fields of workflow systems and business process management. We have analyzed the suitability of these patterns by means of a qualitative analysis of CPG texts. Following our analysis we have implemented a selection of workflow patterns in the Asbru and PROforma CPG languages. As implementation-independent notation for the description of patterns we have chosen BPMN 2.0. Finally, we have developed XSLT transformations to convert the BPMN 2.0 version of the patterns into the Asbru and PROforma languages. We showed that although a significant number of workflow control patterns are suitable to describe CPG procedural knowledge, not all of them are applicable in the context of CPGs due to their focus on single-patient care. Moreover, CPGs may require additional patterns not included in the set of workflow control patterns. We also showed that nearly all the CPG-suitable patterns can be conveniently implemented in the Asbru and PROforma languages. Finally, we demonstrated that individual patterns can be semi-automatically transformed from a process specification in BPMN 2.0 to executable implementations in these languages. We propose a pattern and transformation-based approach for the development of CPG models. Such an approach can form the basis of a valid framework for the authoring of CPG models. The identification of adequate patterns and the implementation of transformations to convert patterns from a process specification into different executable implementations are the first necessary steps for our approach.

In ovo CpG DNA delivery increases innate and adaptive immune cells in respiratory, gastrointestinal and immune systems post-hatch correlating with lower infectious laryngotracheitis virus infection.

PubMed

Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal

2018-01-01

Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.

Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

DOE Office of Scientific and Technical Information (OSTI.GOV)

Diver, R.B.; Moss, T.A.; Goldberg, V.

Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

Guideline-Driven Care Improves Outcomes in Patients with Traumatic Rib Fractures.

PubMed

Flarity, Kathleen; Rhodes, Whitney C; Berson, Andrew J; Leininger, Brian E; Reckard, Paul E; Riley, Keyan D; Shahan, Charles P; Schroeppel, Thomas J

2017-09-01

There is no established national standard for rib fracture management. A clinical practice guideline (CPG) for rib fractures, including monitoring of pulmonary function, early initiation of aggressive loco-regional analgesia, and early identification of deteriorating respiratory function, was implemented in 2013. The objective of the study was to evaluate the effect of the CPG on hospital length of stay. Hospital length of stay (LOS) was compared for adult patients admitted to the hospital with rib fracture(s) two years before and two years after CPG implementation. A separate analysis was done for the patients admitted to the intensive care unit (ICU). Over the 48-month study period, 571 patients met inclusion criteria for the study. Pre-CPG and CPG study groups were well matched with few differences. Multivariable regression did not demonstrate a difference in LOS (B = -0.838; P = 0.095) in the total study cohort. In the ICU cohort (n = 274), patients in the CPG group were older (57 vs 52 years; P = 0.023) and had more rib fractures (4 vs 3; P = 0.003). Multivariable regression identified a significant decrease in LOS for those patients admitted in the CPG period (B = -2.29; P = 0.019). Despite being significantly older with more rib fractures in the ICU cohort, patients admitted after implementation of the CPG had a significantly reduced LOS on multivariable analysis, reducing LOS by over two days. This structured intervention can limit narcotic usage, improve pulmonary function, and decrease LOS in the most injured patients with chest trauma.

Energetic study of cardioplegic hearts under ischaemia/reperfusion and [Ca(2+)] changes in cardiomyocytes of guinea-pig: mitochondrial role.

PubMed

Ragone, M I; Torres, N S; Consolini, A E

2013-02-01

To study the role of mitochondria in the recovery of guinea-pig hearts exposed to high-K(+)-cardioplegia (CPG) and ischaemia/reperfusion (I/R) METHODS: We measured contractility and heat release in perfused guinea-pig hearts and cytosolic and mitochondrial Ca(2+) by epifluorescence and confocal microscopy in isolated cardiomyocytes loaded with Fluo-4 or Rhod-2. In hearts, CPG increased the postischaemic contractile recovery, and this was potentiated by the mNCX blocker clonazepam and the mKATP opener diazoxide, which also prevented the fall in muscle economy. Moreover, CPG prevented the stunning induced by ouabain, which was reduced by clonazepam. In cardiomyocytes, CPG increased fluorescent signals of cytosolic and mitochondrial Ca(2+), while the addition of a mNCX blocker (CGP37157) increased cytosolic but reduced mitochondrial [Ca(2+)]. Ouabain in CPG increased cytosolic Ca(2+) and resting heat, but the addition of CGP37157 reduced them, as well as mitochondrial Ca(2+). CPG, diazoxide and clonazepam improve postischaemic recovery, respectively, by increasing the Ca(2+) cycling and by reducing the mitochondrial Ca(2+) uptake either by uniporter or by mNCX. The mitochondria compete with the leaky sarcoplasmic reticulum (SR) as sink of Ca(2+) in guinea-pig hearts, affecting the postischaemic contractility. CPG also prevented the ouabain-induced dysfunction by avoiding the Ca(2+) overload. Ouabain reduced the synergism between CPG and clonazepam suggesting that [Na(+)]i and SR load influence the mNCX role. © 2012 The Authors Acta Physiologica © 2012 Scandinavian Physiological Society.

75 FR 60761 - Government-Owned Inventions; Availability for Licensing

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-01

... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...

78 FR 46594 - Prospective Grant of Start-up Exclusive License: Topical Antibiotic With Immune Stimulating...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-01

... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...

Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

PubMed Central

Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

2009-01-01

Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

Reinforcement learning for a biped robot based on a CPG-actor-critic method.

PubMed

Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

2007-08-01

Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

Vitamin D dose response is underestimated by Endocrine Society's Clinical Practice Guideline.

PubMed

McKenna, Malachi J; Murray, Barbara F

2013-06-01

The recommended daily intakes of vitamin D according to the recent Clinical Practice Guideline (CPG) of the Endocrine Society are three- to fivefold higher than the Institute of Medicine (IOM) report. We speculated that these differences could be explained by different mathematical approaches to the vitamin D dose response. Studies were selected if the daily dose was ≤2000 IU/day, the duration exceeded 3 months, and 25-hydroxyvitamin D (25OHD) concentrations were measured at baseline and post-therapy. The rate constant was estimated according to the CPG approach. The achieved 25OHD result was estimated according to the following: i) the regression equation approach of the IOM; ii) the regression approach of the Vitamin D Supplementation in Older Subjects (ViDOS) study; and iii) the CPG approach using a rate constant of 2.5 (CPG2.5) and a rate constant of 5.0 (CPG5.0). The difference between the expected and the observed 25OHD result was expressed as a percentage of observed and analyzed for significance against a value of 0% for the four groups. Forty-one studies were analyzed. The mean (95% CI) rate constant was 5.3 (4.4-6.2) nmol/l per 100 IU per day, on average twofold higher than the CPG rate constant. The mean (95% CI) for the difference between the expected and observed expressed as a percentage of observed was as follows: i) IOM, -7 (-16,+2)% (t=1.64, P=0.110); ii) ViDOS, +2 (-8,+12)% (t=0.40, P=0.69); iii) CPG2.5, -21 (-27,-15)% (t=7.2, P<0.0001); and iv) CPG5.0+3 (-4,+10)% (t=0.91, P=0.366). The CPG 'rule of thumb' should be doubled to 5.0 nmol/l (2.0 ng/ml) per 100 IU per day, adopting a more risk-averse position.

MaFOS-GDM trial: Maternal fish oil supplementation in women with gestational diabetes and cord blood DNA methylation at insulin like growth factor-1 (IGF-1) gene.

PubMed

Dilli, Dilek; Doğan, Nazan Neslihan; İpek, Mehmet Şah; Çavuş, Yunus; Ceylaner, Serdar; Doğan, Haldun; Dursun, Arzu; Küçüközkan, Tuncay; Zenciroğlu, Ayşegül

2018-02-01

To evaluate the effects of maternal fish oil supplementation in women with gestational diabetes mellitus (GDM) on birthweight and DNA methylation at insulin like growth factor-1 (IGF-1) gene in their offspring. Randomized controlled trial. A total of 120 women with GDM were randomized to one of the two groups between 24 and 28 weeks of the pregnancy: Group 1 (n = 52) received fish oil liquid softgel (Ocean plus®) and Group 2 (Placebo) (n = 68) sunflower oil liquid softgel. The birthweight and DNA methylation at IGF-1 gene of the offsprings were assessed. We observed a significant inverse association between fish oil use during pregnancy and birthweight (β = -0.18, s.e.:125, P = .04), corresponding to a 250 g lower birthweight among infants born to fish oil users. This association didn't persist in multivariate analysis. Cord blood IGF-1 was lower in fish oil group (P = .001). Cord blood DNA methylation percentages at CpG-1044 and CpG-611 sites of IGF-1 gene promoter 1 (P1) region were higher in fish oil group compared to placebo group (P = .02 and P = .001, respectively). However, CpG-1044 and CpG-611 methylations were not associated to birthweight (β = 0.04, s.e: 25.1, P = .66 and β = 0.04, s.e: 22.7, P = 0.66, respectively). Maternal fish oil use has small effects on birthweight and DNA methylation when given to mothers with GDM at late pregnancy. Future studies are needed to show associations between maternal fish oil use and neonatal DNA methylations. "Fish Oil Supplementation in Women with Gestational Diabetes". NCT02371343. Copyright © 2017. Published by Elsevier Ltd.

Computational Approaches to Identify Promoters and cis-Regulatory Elements in Plant Genomes1

PubMed Central

Rombauts, Stephane; Florquin, Kobe; Lescot, Magali; Marchal, Kathleen; Rouzé, Pierre; Van de Peer, Yves

2003-01-01

The identification of promoters and their regulatory elements is one of the major challenges in bioinformatics and integrates comparative, structural, and functional genomics. Many different approaches have been developed to detect conserved motifs in a set of genes that are either coregulated or orthologous. However, although recent approaches seem promising, in general, unambiguous identification of regulatory elements is not straightforward. The delineation of promoters is even harder, due to its complex nature, and in silico promoter prediction is still in its infancy. Here, we review the different approaches that have been developed for identifying promoters and their regulatory elements. We discuss the detection of cis-acting regulatory elements using word-counting or probabilistic methods (so-called “search by signal” methods) and the delineation of promoters by considering both sequence content and structural features (“search by content” methods). As an example of search by content, we explored in greater detail the association of promoters with CpG islands. However, due to differences in sequence content, the parameters used to detect CpG islands in humans and other vertebrates cannot be used for plants. Therefore, a preliminary attempt was made to define parameters that could possibly define CpG and CpNpG islands in Arabidopsis, by exploring the compositional landscape around the transcriptional start site. To this end, a data set of more than 5,000 gene sequences was built, including the promoter region, the 5′-untranslated region, and the first introns and coding exons. Preliminary analysis shows that promoter location based on the detection of potential CpG/CpNpG islands in the Arabidopsis genome is not straightforward. Nevertheless, because the landscape of CpG/CpNpG islands differs considerably between promoters and introns on the one side and exons (whether coding or not) on the other, more sophisticated approaches can probably be developed for the successful detection of “putative” CpG and CpNpG islands in plants. PMID:12857799

Radiolabelling of glycosylated MFE-23::CPG2 fusion protein (MFECP1) with 99mTc for quantitation of tumour antibody-enzyme localisation in antibody-directed enzyme pro-drug therapy (ADEPT).

PubMed

Francis, R J; Mather, S J; Chester, K; Sharma, S K; Bhatia, J; Pedley, R B; Waibel, R; Green, A J; Begent, R H J

2004-08-01

MFECP1 is a glycosylated recombinant fusion protein composed of MFE-23, a high-affinity anti-carcinoembryonic antigen (CEA) single chain Fv (scFv), fused to the enzyme carboxypeptidase G2 (CPG2), and has been constructed for use in antibody-directed enzyme pro-drug therapy (ADEPT). Radiolabelling of glycosylated MFECP1 with technetium-99m was developed for the purpose of determining tumour localisation of MFECP1 in a phase I ADEPT clinical study. The method used was 99mTc-carbonyl [99mTc(H2O)3(CO)3]+ (abbreviated to TcCO) mediated labelling of 99mTc to the hexahistidine (His) tag of MFECP1. MFECP1 fusion protein was labelled with TcCO under a variety of conditions, and this was shown to be a relatively simple and robust method. Tissue biodistribution was assessed in a CEA-expressing LS174T (human colon carcinoma) nude mouse xenograft model. Tissues were taken at 1, 4 and 6 h for assessment of distribution of radioactivity and for measurement of CPG2 enzyme levels. The amount of radioactivity retained by the tumour proved to be an accurate estimation of actual measured enzyme activity, indicating that this radiolabelling method does not appear to damage the antibody-antigen binding or the enzyme activity of MFECP1. However, correlation between CPG2 enzyme activity and measured radioactivity in liver, spleen and kidney was poor, indicating retention of radioactivity in non-tumour sites but loss of enzyme activity. The high retention of technetium radioisotope in normal tissues may limit the clinical applicability of this radiolabelling method for MFECP1; however, these results suggest that this technique does have applicability for measuring the biodistribution of His-tagged recombinant proteins.

Migration phenology and breeding success are predicted by methylation of a photoperiodic gene in the barn swallow

PubMed Central

Saino, Nicola; Ambrosini, Roberto; Albetti, Benedetta; Caprioli, Manuela; De Giorgio, Barbara; Gatti, Emanuele; Liechti, Felix; Parolini, Marco; Romano, Andrea; Romano, Maria; Scandolara, Chiara; Gianfranceschi, Luca; Bollati, Valentina; Rubolini, Diego

2017-01-01

Individuals often considerably differ in the timing of their life-cycle events, with major consequences for individual fitness, and, ultimately, for population dynamics. Phenological variation can arise from genetic effects but also from epigenetic modifications in DNA expression and translation. Here, we tested if CpG methylation at the poly-Q and 5′-UTR loci of the photoperiodic Clock gene predicted migration and breeding phenology of long-distance migratory barn swallows (Hirundo rustica) that were tracked year-round using light-level geolocators. Increasing methylation at Clock poly-Q was associated with earlier spring departure from the African wintering area, arrival date at the European breeding site, and breeding date. Higher methylation levels also predicted increased breeding success. Thus, we showed for the first time in any species that CpG methylation at a candidate gene may affect phenology and breeding performance. Methylation at Clock may be a candidate mechanism mediating phenological responses of migratory birds to ongoing climate change. PMID:28361883

Integrative DNA methylation and gene expression analysis to assess the universality of the CpG island methylator phenotype.

PubMed

Moarii, Matahi; Reyal, Fabien; Vert, Jean-Philippe

2015-10-13

The CpG island methylator phenotype (CIMP) was first characterized in colorectal cancer but since has been extensively studied in several other tumor types such as breast, bladder, lung, and gastric. CIMP is of clinical importance as it has been reported to be associated with prognosis or response to treatment. However, the identification of a universal molecular basis to define CIMP across tumors has remained elusive. We perform a genome-wide methylation analysis of over 2000 tumor samples from 5 cancer sites to assess the existence of a CIMP with common molecular basis across cancers. We then show that the CIMP phenotype is associated with specific gene expression variations. However, we do not find a common genetic signature in all tissues associated with CIMP. Our results suggest the existence of a universal epigenetic and transcriptomic signature that defines the CIMP across several tumor types but does not indicate the existence of a common genetic signature of CIMP.

Migration phenology and breeding success are predicted by methylation of a photoperiodic gene in the barn swallow.

PubMed

Saino, Nicola; Ambrosini, Roberto; Albetti, Benedetta; Caprioli, Manuela; De Giorgio, Barbara; Gatti, Emanuele; Liechti, Felix; Parolini, Marco; Romano, Andrea; Romano, Maria; Scandolara, Chiara; Gianfranceschi, Luca; Bollati, Valentina; Rubolini, Diego

2017-03-31

Individuals often considerably differ in the timing of their life-cycle events, with major consequences for individual fitness, and, ultimately, for population dynamics. Phenological variation can arise from genetic effects but also from epigenetic modifications in DNA expression and translation. Here, we tested if CpG methylation at the poly-Q and 5'-UTR loci of the photoperiodic Clock gene predicted migration and breeding phenology of long-distance migratory barn swallows (Hirundo rustica) that were tracked year-round using light-level geolocators. Increasing methylation at Clock poly-Q was associated with earlier spring departure from the African wintering area, arrival date at the European breeding site, and breeding date. Higher methylation levels also predicted increased breeding success. Thus, we showed for the first time in any species that CpG methylation at a candidate gene may affect phenology and breeding performance. Methylation at Clock may be a candidate mechanism mediating phenological responses of migratory birds to ongoing climate change.

Early results of sarcomeric gene screening from the Egyptian National BA-HCM Program.

PubMed

Kassem, Heba Sh; Azer, Remon S; Saber-Ayad, Maha; Ayad, Maha S; Moharem-Elgamal, Sarah; Magdy, Gehan; Elguindy, Ahmed; Cecchi, Franco; Olivotto, Iacopo; Yacoub, Magdi H

2013-02-01

The present study comprised sarcomeric genotyping of the three most commonly involved sarcomeric genes: MYBPC3, MYH7, and TNNT2 in 192 unrelated Egyptian hypertrophic cardiomyopathy (HCM) index patients. Mutations were detected in 40 % of cases. Presence of positive family history was significantly (p=0.002) associated with a higher genetic positive yield (49/78, 62.8 %). The majority of the detected mutations in the three sarcomeric genes were novel (40/62, 65 %) and mostly private (47/62, 77 %). Single nucleotide substitution was the most frequently detected mutation type (51/62, 82 %). Over three quarters of these substitutions (21/27, 78 %) involved CpG dinucleotide sites and resulted from C>T or G>A transition in the three analyzed genes, highlighting the significance of CpG high mutability within the sarcomeric genes examined. This study could aid in global comparative studies in different ethnic populations and constitutes an important step in the evolution of the integrated clinical, translational, and basic science HCM program.

Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells.

PubMed

Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M; Michor, Franziska; Fan, Rong; Pan, Xinghua

2017-06-02

Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Effect of maternal gestational weight gain on offspring DNA methylation: a follow-up to the ALSPAC cohort study.

PubMed

Bohlin, Jon; Andreassen, Bettina K; Joubert, Bonnie R; Magnus, Maria C; Wu, Michael C; Parr, Christine L; Håberg, Siri E; Magnus, Per; Reese, Sarah E; Stoltenberg, Camilla; London, Stephanie J; Nystad, Wenche

2015-07-29

Several epidemiologic studies indicate that maternal gestational weight gain (GWG) influences health outcomes in offspring. Any underlying mechanisms have, however, not been established. A recent study of 88 children based on the Avon Longitudinal Study of Parents and Children (ALSPAC) cohort examined the methylation levels at 1,505 Cytosine-Guanine methylation (CpG) loci and found several to be significantly associated with maternal weight gain between weeks 0 and 18 of gestation. Since these results could not be replicated we wanted to examine associations between 0 and 18 week GWG and genome-wide methylation levels using the Infinium HumanMethylation450 BeadChip (450K) platform on a larger sample size, i.e. 729 newborns sampled from the Norwegian Mother and Child Cohort Study (MoBa). We found no CpG loci associated with 0-18 week GWG after adjusting for the set of covariates used in the ALSPAC study (i.e. child's sex and maternal age) and for multiple testing (q > 0.9, both 1,505 and 473,731 tests). Hence, none of the CpG loci linked with the genes found significantly associated with 0-18 week GWG in the ALSPAC study were significant in our study. The inconsistency in the results with the ALSPAC study with regards to the 0-18 week GWG model may arise for several reasons: sampling from different populations, dissimilar methylome coverage, sample size and/or false positive findings.

Development of a novel, multilayered presentation format for clinical practice guidelines.

PubMed

Kristiansen, Annette; Brandt, Linn; Alonso-Coello, Pablo; Agoritsas, Thomas; Akl, Elie A; Conboy, Tara; Elbarbary, Mahmoud; Ferwana, Mazen; Medani, Wedad; Murad, Mohammad Hassan; Rigau, David; Rosenbaum, Sarah; Spencer, Frederick A; Treweek, Shaun; Guyatt, Gordon; Vandvik, Per Olav

2015-03-01

Bridging the gap between clinical research and everyday health-care practice requires effective communication strategies. To address current shortcomings in conveying practice recommendations and supporting evidence, we are creating and testing presentation formats for clinical practice guidelines (CPGs). We carried out multiple cycles of brainstorming and sketching, developing a prototype. Physicians participating in the user testing viewed CPG formats linked to clinical scenarios and engaged in semistructured interviews applying a think-aloud method for exploring important aspects of user experience. We developed a multilayered presentation format that allows clinicians to successively view more in-depth information. Starting with the recommendations, clinicians can, on demand, access a rationale and a key information section containing statements on quality of the evidence, balance between desirable and undesirable consequences, values and preferences, and resource considerations. We collected feedback from 27 stakeholders and performed user testing with 47 practicing physicians from six countries. Advisory group feedback and user testing of the first version revealed problems with conceptual understanding of underlying CPG methodology, as well as difficulties with the complexity of the layout and content. Extensive revisions made before the second round of user testing resulted in most participants expressing overall satisfaction with the final presentation format. We have developed an electronic, multilayered, CPG format that enhances the usability of CPGs for frontline clinicians. We have implemented the format in electronic guideline tools that guideline organizations can now use when authoring and publishing their guidelines.

CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

PubMed Central

Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

2011-01-01

The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

PubMed Central

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

2017-01-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.

PubMed

Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei

2018-02-01

Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (P<0.05). Male METH addicts exhibited significantly higher DRD4 CpG1, CpG2 and CpG4 methylation levels compared with sex-matched controls (P<0.05). In heroin addicts, a positive correlation was observed between depression-dejection and DRD4 CpG5 methylation (r=0.537, P=0.039) whereas there was a negative correlation between drug usage frequency and CpG1 methylation (r=-0.632, P=0.011). In METH addicts, methylation levels were not significantly associated with depression-dejection and drug usage frequency. In addition, luciferase assays demonstrated that the target sequence of the DRD4 promoter upregulates gene expression. The results of the present study suggest that DNA methylation of DRD4 may be responsible for the pathophysiology of drug addiction.

No simple answers for the Finnish and Russian Karelia allergy contrast: Methylation of CD14 gene.

PubMed

Khoo, Siew-Kim; Mäkelä, Mika; Chandler, David; Schultz, En Nee; Jamieson, Sarra E; Goldblatt, Jack; Haahtela, Tari; LeSouëf, Peter; Zhang, Guicheng

2016-11-01

Finnish and Russian Karelian children have a highly contrasting occurrence of asthma and allergy. In these two environments, we studied associations between total serum immunoglobulin E (IgE) with methylation levels in cluster of differentiation 14 (CD14). Five hundred Finnish and Russian Karelian children were included in four groups: Finnish children with high IgE (n = 126) and low IgE (n = 124) as well as Russian children with high IgE (n = 125) and low IgE (n = 125). DNA was extracted from whole blood cells and pyrosequenced. Three CpG sites were selected in the promoter region of CD14. Methylation levels in two of the three CpG sites were higher in the Finnish compared to Russian Karelian children. In the promoter area of CD14, the Finnish compared to Russian children with low IgE had a significant (p < 0.0001) increase in methylation levels at the Amp5Site 2. Likewise, the Finnish compared to Russian children with high IgE had a significant (p = 0.003) increase in methylation levels at the Amp5Site 3. In Russian children with low vs. high IgE, there were significant differences in methylation levels, but this was not the case on the Finnish side. In the regression analysis, adding the methylation variation of CD14 to the model did not explain the higher asthma and allergy risk in the Finnish children. The methylation levels in the promoter region of CD14 gene were higher in the Finnish compared to Russian Karelian children. However, the methylation variation of this candidate gene did not explain the asthma and allergy contrast between these two areas. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Suicidal function of DNA methylation in age-related genome disintegration.

PubMed

Mazin, Alexander L

2009-10-01

This article is dedicated to the 60th anniversary of 5-methylcytosine discovery in DNA. Cytosine methylation can affect genetic and epigenetic processes, works as a part of the genome-defense system and has mutagenic activity; however, the biological functions of this enzymatic modification are not well understood. This review will put forward the hypothesis that the host-defense role of DNA methylation in silencing and mutational destroying of retroviruses and other intragenomic parasites was extended during evolution to most host genes that have to be inactivated in differentiated somatic cells, where it acquired a new function in age-related self-destruction of the genome. The proposed model considers DNA methylation as the generator of 5mC>T transitions that induce 40-70% of all spontaneous somatic mutations of the multiple classes at CpG and CpNpG sites and flanking nucleotides in the p53, FIX, hprt, gpt human genes and some transgenes. The accumulation of 5mC-dependent mutations explains: global changes in the structure of the vertebrate genome throughout evolution; the loss of most 5mC from the DNA of various species over their lifespan and the Hayflick limit of normal cells; the polymorphism of methylation sites, including asymmetric mCpNpN sites; cyclical changes of methylation and demethylation in genes. The suicidal function of methylation may be a special genetic mechanism for increasing DNA damage and the programmed genome disintegration responsible for cell apoptosis and organism aging and death.

A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer

PubMed Central

Good, Charly R.; Madzo, Jozef; Patel, Bela; Maegawa, Shinji; Engel, Nora; Jelinek, Jaroslav

2017-01-01

Abstract TET1 oxidizes methylated cytosine into 5-hydroxymethylcytosine (5hmC), resulting in regulation of DNA methylation and gene expression. Full length TET1 (TET1FL) has a CXXC domain that binds to unmethylated CpG islands (CGIs). This CXXC domain allows TET1 to protect CGIs from aberrant methylation, but it also limits its ability to regulate genes outside of CGIs. Here, we report a novel isoform of TET1 (TET1ALT) that has a unique transcription start site from an alternate promoter in intron 2, yielding a protein with a unique translation start site. Importantly, TET1ALT lacks the CXXC domain but retains the catalytic domain. TET1ALT is repressed in embryonic stem cells (ESCs) but becomes activated in embryonic and adult tissues while TET1FL is expressed in ESCs, but repressed in adult tissues. Overexpression of TET1ALT shows production of 5hmC with distinct (and weaker) effects on DNA methylation or gene expression when compared to TET1FL. TET1ALT is aberrantly activated in multiple cancer types including breast, uterine and glioblastoma, and TET1 activation is associated with a worse overall survival in breast, uterine and ovarian cancers. Our data suggest that the predominantly activated isoform of TET1 in cancer cells does not protect from CGI methylation and likely mediates dynamic site-specific demethylation outside of CGIs. PMID:28531272

Epigenetic control of alternative mRNA processing at the imprinted Herc3/Nap1l5 locus

PubMed Central

Cowley, Michael; Wood, Andrew J.; Böhm, Sabrina; Schulz, Reiner; Oakey, Rebecca J.

2012-01-01

Alternative polyadenylation increases transcriptome diversity by generating multiple transcript isoforms from a single gene. It is thought that this process can be subject to epigenetic regulation, but few specific examples of this have been reported. We previously showed that the Mcts2/H13 locus is subject to genomic imprinting and that alternative polyadenylation of H13 transcripts occurs in an allele-specific manner, regulated by epigenetic mechanisms. Here, we demonstrate that allele-specific polyadenylation occurs at another imprinted locus with similar features. Nap1l5 is a retrogene expressed from the paternally inherited allele, is situated within an intron of a ‘host’ gene Herc3, and overlaps a CpG island that is differentially methylated between the parental alleles. In mouse brain, internal Herc3 polyadenylation sites upstream of Nap1l5 are used on the paternally derived chromosome, from which Nap1l5 is expressed, whereas a downstream site is used more frequently on the maternally derived chromosome. Ablating DNA methylation on the maternal allele at the Nap1l5 promoter increases the use of an internal Herc3 polyadenylation site and alters exon splicing. These changes demonstrate the influence of epigenetic mechanisms in regulating Herc3 alternative mRNA processing. Internal Herc3 polyadenylation correlates with expression levels of Nap1l5, suggesting a possible role for transcriptional interference. Similar mechanisms may regulate alternative polyadenylation elsewhere in the genome. PMID:22790983

Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene.

PubMed

Ohtsuki, Shozo; Takahashi, Yuki; Inoue, Takao; Takakura, Yoshinobu; Nishikawa, Makiya

2017-10-20

We used human Toll-like receptor 9 (hTLR9)-expressing HEK-Blue hTLR9 cells, which release secreted embryonic alkaline phosphatase (SEAP) upon response to CpG DNA, to evaluate the immunological properties of nucleic acid drug candidates. Our preliminary studies showed that phosphodiester CpG DNA hardly induced any SEAP secretion in HEK-Blue hTLR9 cells. In the current study, therefore, we developed HEK-Blue hTLR9 cells transduced with human macrophage scavenger receptor-1 (hMSR1), a cell-surface DNA receptor, and determined whether HEK-Blue hTLR9/hMSR1 cells respond to phosphorothioate (PS) CpG DNA and phosphodiester (PO) CpG DNA. We selected PS CpG2006, a single-stranded PO CpG DNA (ssCpG), and a tetrapod-like structured DNA (tetrapodna) containing ssCpG (tetraCpG) as model TLR9 ligands. Alexa Fluor 488-labeled ligands were used for flow cytometry. Unlike the mock-transfected HEK-Blue hTLR9 cells, the HEK-Blue hTLR9/hMSR1 cells efficiently took up all three CpG DNAs. SEAP release was almost proportional to the uptake. Treatment of HEK-Blue hTLR9/hMSR1 cells with an anti-hMSR1 antibody significantly reduced the uptake of ssCpG and tetraCpG. Collectively, reconstruction of TLR9-mediated responses to CpG DNA in HEK-Blue hTLR9 cells can be used to evaluate the toxicity of nucleic acid drug candidates with diverse physicochemical properties.

Extended Plasticity of Visual Cortex in Dark-Reared Animals May Result from Prolonged Expression of cpg15-Like Genes

PubMed Central

Lee, Wei-Chung Allen; Nedivi, Elly

2011-01-01

cpg15 is an activity-regulated gene that encodes a membrane-bound ligand that coordinately regulates growth of apposing dendritic and axonal arbors and the maturation of their synapses. These properties make it an attractive candidate for participating in plasticity of the mammalian visual system. Here we compare cpg15 expression during normal development of the rat visual system with that seen in response to dark rearing, monocular blockade of retinal action potentials, or monocular deprivation. Our results show that the onset of cpg15 expression in the visual cortex is coincident with eye opening, and it increases until the peak of the critical period at postnatal day 28 (P28). This early expression is independent of both retinal activity and visual experience. After P28, a component of cpg15 expression in the visual cortex, lateral geniculate nucleus (LGN), and superior colliculus (SC) develops a progressively stronger dependence on retinally driven action potentials. Dark rearing does not affect cpg15 mRNA expression in the LGN and SC at any age, but it does significantly affect its expression in the visual cortex from the peak of the critical period and into adulthood. In dark-reared rats, the peak level of cpg15 expression in the visual cortex at P28 is lower than in controls. Rather than showing the normal decline with maturation, these levels are maintained in dark-reared animals. We suggest that the prolonged plasticity in the visual cortex that is seen in dark-reared animals may result from failure to downregulate genes such as cpg15 that could promote structural remodeling and synaptic maturation. PMID:11880509

Evidence-based clinical practice guideline for adult Still's disease.

PubMed

Mimura, Toshihide; Kondo, Yuya; Ohta, Akihide; Iwamoto, Masahiro; Ota, Akiko; Okamoto, Nami; Kawaguchi, Yasushi; Kono, Hajime; Takasaki, Yoshinari; Takei, Shuji; Nishimoto, Norihiro; Fujimoto, Manabu; Asanuma, Yu Funakubo; Mimori, Akio; Okiyama, Naoko; Kaneko, Shunta; Takahashi, Hiroyuki; Yokosawa, Masahiro; Sumida, Takayuki

2018-05-09

Using an expert- and data-driven methodology, we have constructed the first clinical practice guidelines (CPGs) for adult Still's disease (ASD) after complete systematic review (SR) of the literature based upon the Medical Information Network Distribution Service (Minds) procedure. The CPG committee for ASD organized by the Research Team for Autoimmune Diseases, the Research Program for Intractable Disease of the Japanese Ministry of Health, Labour, and Welfare has developed CPG for ASD 2017, according to the procedure proposed by Minds. The CPG development process includes (1) clarification of the purpose of CPG, (2) organization of the steering committee, (3) organization of the CPG committee and secretariat, (4) defining the scope (setting of clinical questions (CQs)), (5) SR, (6) development of recommendations, (7) drafting the CPG, (8) external evaluation and public comments, and (9) release. Because we wanted to construct CPG for ASD to encompass both adult-onset Still's disease (AOSD) and adult patients with systemic juvenile idiopathic arthritis (sJIA), we also included SR data from sJIA in this study. Twenty-six CQs were selected and roughly divided into the following items: (1) clinical findings (CQs 1-4), (2) laboratory findings (CQs 5-8), (3) complications (CQs 9-13), (4) treatment with oral medicine (CQs 14-19), (5) treatment with biological reagents (CQs 20-23), and (6) treatments for sJIA (CQs 25-26). Recommendations and the strength of the recommendations for these CQs were decided by a modified Delphi method. We have developed the first published CPG for ASD including AOSD and sJIA, which includes 26 CQs and recommendations. This guideline will help rheumatologists, non-specialized physicians, other healthcare providers, medical and health-related students, and patients and their family members to understand and treat ASD.

Provider Adherence to Implementation of Clinical Practice Guidelines for Neurogenic Bowel in Adults With Spinal Cord Injury

PubMed Central

Goetz, Lance L; Nelson, Audrey L; Guihan, Marylou; Bosshart, Helen T; Harrow, Jeffrey J; Gerhart, Kevin D; Krasnicka, Barbara; Burns, Stephen P

2005-01-01

Background/Objectives: Clinical Practice Guidelines (CPGs) have been published on a number of topics in spinal cord injury (SCI) medicine. Research in the general medical literature shows that the distribution of CPGs has a minimal effect on physician practice without targeted implementation strategies. The purpose of this study was to determine (a) whether dissemination of an SCI CPG improved the likelihood that patients would receive CPG recommended care and (b) whether adherence to CPG recommendations could be improved through a targeted implementation strategy. Specifically, this study addressed the “Neurogenic Bowel Management in Adults with Spinal Cord Injury” Clinical Practice Guideline published in March 1998 by the Consortium for Spinal Cord Medicine Methods: CPG adherence was determined from medical record review at 6 Veterans Affairs SCI centers for 3 time periods: before guideline publication (T1), after guideline publication but before CPG implementation (T2), and after targeted CPG implementation (T3). Specific implementation strategies to enhance guideline adherence were chosen to address the barriers identified by SCI providers in focus groups before the intervention. Results: Overall adherence to recommendations related to neurogenic bowel did not change between T1 and T2 (P = not significant) but increased significantly between T2 and T3 (P < 0.001) for 3 of 6 guideline recommendations. For the other 3 guideline recommendations, adherence rates were noted to be high at T1. Conclusions: While publication of the CPG alone did not alter rates of provider adherence, the use of a targeted implementation plan resulted in increases in adherence rates with some (3 of 6) CPG recommendations for neurogenic bowel management. PMID:16869086

The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

PubMed

Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

2017-02-14

The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

PubMed

Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

2013-11-07

We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

A terahertz EO detector with large dynamical range, high modulation depth and signal-noise ratio

NASA Astrophysics Data System (ADS)

Pan, Xinjian; Cai, Yi; Zeng, Xuanke; Zheng, Shuiqin; Li, Jingzhen; Xu, Shixiang

2017-05-01

The paper presents a novel design for terahertz (THz) free-space time domain electro-optic (EO) detection where the static birefringent phases of the two balanced arms are set close to zero but opposite to each other. Our theoretical and numerical analyses show this design has much stronger ability to cancel the optical background noise than both THz ellipsometer and traditional crossed polarizer geometry (CPG). Its optical modulation depth is about twice as high as that of traditional CPG, but about ten times as high as that of THz ellipsometer. As for the dynamical range, our improved design is comparable to the THz ellipsometer but obviously larger than the traditional CPG. Some experiments for comparing our improved CPG with traditional CPG agree well with the corresponding theoretical predictions. Our experiments also show that the splitting ratio of the used non-polarization beam splitter is critical for the performance of our design.

Exposure to Soy Protein Isolate From Conception Fails to Induce Epigenetic Changes in Viable Yellow Agouti (Avy/a) Mice, But Partially Blocks Hepatosteatosis and Altered Body Composition in Mice and Rats

USDA-ARS?s Scientific Manuscript database

Both beneficial and adverse health effects have been attributed to soy food consumption. Epigenetic programming through hypermethlylation of CpG sites on promoter regions may be a potential mechanism. Virgin a/a female and Avy/a male mice were fed AIN-93G diets made with either casein or soy protein...

Prediction of epigenetically regulated genes in breast cancer cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen

Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines,more » which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identifed 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.« less

Extensive sequence-influenced DNA methylation polymorphism in the human genome

PubMed Central

2010-01-01

Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546

DNA activates human immune cells through a CpG sequence-dependent manner

PubMed Central

Bauer, M; Heeg, K; Wagner, H; Lipford, G B

1999-01-01

While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

[Evaluation of the quality of clinical practice guidelines published in the Annales de Biologie Clinique with the help of the EFLM checklist].

PubMed

Wils, Julien; Fonfrède, Michèle; Augereau, Christine; Watine, Joseph

2014-01-01

Several tools are available to help evaluate the quality of clinical practice guidelines (CPG). The AGREE instrument (Appraisal of guidelines for research & evaluation) is the most consensual tool but it has been designed to assess CPG methodology only. The European federation of laboratory medicine (EFLM) recently designed a check-list dedicated to laboratory medicine which is supposed to be comprehensive and which therefore makes it possible to evaluate more thoroughly the quality of CPG in laboratory medicine. In the present work we test the comprehensiveness of this check-list on a sample of CPG written in French and published in Annales de biologie clinique (ABC). Thus we show that some work remains to be achieved before a truly comprehensive check-list is designed. We also show that there is some room for improvement for the CPG published in ABC, for example regarding the fact that some of these CPG do not provide any information about allowed durations of transport and of storage of biological samples before analysis, or about standards of minimal analytical performance, or about the sensitivities or the specificities of the recommended tests.

Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

PubMed

Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

2013-10-01

Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.

Towards autonomous locomotion: CPG-based control of smooth 3D slithering gait transition of a snake-like robot.

PubMed

Bing, Zhenshan; Cheng, Long; Chen, Guang; Röhrbein, Florian; Huang, Kai; Knoll, Alois

2017-04-04

Snake-like robots with 3D locomotion ability have significant advantages of adaptive travelling in diverse complex terrain over traditional legged or wheeled mobile robots. Despite numerous developed gaits, these snake-like robots suffer from unsmooth gait transitions by changing the locomotion speed, direction, and body shape, which would potentially cause undesired movement and abnormal torque. Hence, there exists a knowledge gap for snake-like robots to achieve autonomous locomotion. To address this problem, this paper presents the smooth slithering gait transition control based on a lightweight central pattern generator (CPG) model for snake-like robots. First, based on the convergence behavior of the gradient system, a lightweight CPG model with fast computing time was designed and compared with other widely adopted CPG models. Then, by reshaping the body into a more stable geometry, the slithering gait was modified, and studied based on the proposed CPG model, including the gait transition of locomotion speed, moving direction, and body shape. In contrast to sinusoid-based method, extensive simulations and prototype experiments finally demonstrated that smooth slithering gait transition can be effectively achieved using the proposed CPG-based control method without generating undesired locomotion and abnormal torque.

CpG island methylator phenotype in colorectal cancer

PubMed Central

Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

1999-01-01

Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

PubMed

Kava, Hieronimus W; Murray, Vincent

2016-10-01

This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

PubMed Central

Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

2004-01-01

Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use in clinical trials of recombinant malarial vaccine candidates. PMID:14742540

Predictive value of CpG island methylator phenotype for tumor recurrence in hepatitis B virus-associated hepatocellular carcinoma following liver transplantation

PubMed Central

2010-01-01

Background CpG island methylator phenotype (CIMP), in which multiple genes concordantly methylated, has been demonstrated to be associated with progression, recurrence, as well as overall survival in some types of cancer. Methods We examined the promoter methylation status of seven genes including P16, CDH1, GSTP1, DAPK, XAF1, SOCS1 and SYK in 65 cases of HCC treated with LT by methylation-specific PCR. CIMP+ was defined as having three or more genes that are concordantly methylated. The relationship between CIMP status and clinicopathological parameters, as well as tumor recurrence was further analyzed. Results CIMP+ was more frequent in HCC with AFP > 400 ng/ml than those with AFP ≤ 400 ng/ml (P = 0.017). In addition, patients with CIMP+ were prone to have multiple tumor numbers than those with CIMP- (P = 0.007). Patients with CIMP+ tumors had significantly worse recurrence-free survival (RFS) than patients with CIMP-tumors by Kaplan-Meier estimates (P = 0.004). Multivariate analysis also revealed that CIMP status might be a novel independent prognostic factor of RFS for HCC patients treated with LT (HR: 3.581; 95% CI: 1.473-8.710, P = 0.005). Conclusion Our results suggested that CIMP could serve as a new prognostic biomarker to predict the risk of tumor recurrence in HCC after transplantation. PMID:20678188

Dietary vitamin A impacts DNA methylation patterns of adipogenesis-related genes in suckling rats.

PubMed

Arreguín, A; Ribot, J; Mušinović, H; von Lintig, J; Palou, A; Bonet, M L

2018-05-11

We previously showed that vitamin A supplementation in early life impacts white adipose tissue (WAT) biology. We here studied the vitamin's effects on DNA methylation of genes crucial for WAT cell development, determination and metabolism. CpG promoter methylation and mRNA expression of Pparg, Zfp423, Pcna, and Rbp4 was compared in inguinal WAT of 21-day-old rats supplemented during the suckling period with vehicle (controls) or an emulsion of vitamin A as retinyl ester (RE) or β-carotene (BC). The methylation profile of promoters was affected by vitamin A supplementation with pronounced differences between the RE and BC groups. In the RE group, hypermethylation of the Rbp4 (at multiple CpGs) and the Pparg2 (at a specific CpG) promoters and hypomethylation of the Pcna promoter (at multiple CpGs) was observed, together with inverse changes in gene expression levels. In the BC group, hypomethylation of the Rbp4 and hypermethylation of the Pcna promoter at distinct CpGs was observed, with no effects on gene expression. In both supplemention groups, hypomethylation and increased expression was found for Zfp423. Thus, modest vitamin A supplementation in early postnatal life impacts methylation marks in developing WAT. Differential epigenetic effects of RE and BC in early life may affect adipose tissue programming activity. Copyright © 2018 Elsevier Inc. All rights reserved.

Multi-Targeted Antithrombotic Therapy for Total Artificial Heart Device Patients.

PubMed

Ramirez, Angeleah; Riley, Jeffrey B; Joyce, Lyle D

2016-03-01

To prevent thrombotic or bleeding events in patients receiving a total artificial heart (TAH), agents have been used to avoid adverse events. The purpose of this article is to outline the adoption and results of a multi-targeted antithrombotic clinical procedure guideline (CPG) for TAH patients. Based on literature review of TAH anticoagulation and multiple case series, a CPG was designed to prescribe the use of multiple pharmacological agents. Total blood loss, Thromboelastograph(®) (TEG), and platelet light-transmission aggregometry (LTA) measurements were conducted on 13 TAH patients during the first 2 weeks of support in our institution. Target values and actual medians for postimplant days 1, 3, 7, and 14 were calculated for kaolinheparinase TEG, kaolin TEG, LTA, and estimated blood loss. Protocol guidelines were followed and anticoagulation management reduced bleeding and prevented thrombus formation as well as thromboembolic events in TAH patients postimplantation. The patients in this study were susceptible to a variety of possible complications such as mechanical device issues, thrombotic events, infection, and bleeding. Among them all it was clear that patients were at most risk for bleeding, particularly on postoperative days 1 through 3. However, bleeding was reduced into postoperative days 3 and 7, indicating that acceptable hemostasis was achieved with the anticoagulation protocol. The multidisciplinary, multi-targeted anticoagulation clinical procedure guideline was successful to maintain adequate antithrombotic therapy for TAH patients.

Effect of alcohol consumption on CpG methylation in the differentially methylated regions of H19 and IG-DMR in male gametes: implications for fetal alcohol spectrum disorders.

PubMed

Ouko, Lillian A; Shantikumar, Katpaham; Knezovich, Jaysen; Haycock, Philip; Schnugh, Desmond J; Ramsay, Michèle

2009-09-01

Exposure to alcohol in utero is the main attributable cause of fetal alcohol spectrum disorders (FASD) which in its most severe form is characterized by irreversible behavioral and cognitive disability. Paternal preconception drinking is not considered to be a significant risk factor, even though animal studies have demonstrated that chronic paternal alcohol consumption has a detrimental effect on the physical and mental development of offspring even in the absence of in utero alcohol exposure. It has been documented that alcohol can reduce the levels and activity of DNA methyltransferases resulting in DNA hypomethylation and that reduced methyltransferase activity can cause activation of normally silenced genes. The aim of this study was to establish a link between alcohol use in men and hypomethylation of paternally imprinted loci in sperm DNA in genomic regions critical for embryonic development, thus providing a mechanism for paternal effects in the aetiology of FASD. Sperm DNA from male volunteers was bisulfite treated and the methylation patterns of 2 differentially methylated regions (DMRs), H19 and IG-DMR, analyzed following sequencing of individual clones. The methylation patterns were correlated with the alcohol consumption levels of the volunteer males. There was a pattern of increased demethylation with alcohol consumption at the 2 imprinted loci with a significant difference observed at the IG-DMR between the nondrinking and heavy alcohol consuming groups. Greater inter-individual variation in average methylation was observed at the H19 DMR and individual clones were more extensively demethylated than those of the IG-DMR. CpG site #4 in the IG-DMR was preferentially demethylated among all individuals and along with the H19 DMR CpG site #7 located within the CTCF binding site 6 showed significant demethylation in the alcohol consuming groups compared with the control group. This study demonstrates a correlation between chronic alcohol use and demethylation of normally hypermethylated imprinted regions in sperm DNA. We hypothesize that, should these epigenetic changes in imprinted genes be transmitted through fertilization, they would alter the critical gene expression dosages required for normal prenatal development resulting in offspring with features of FASD.

The genotypes and methylation of MAO genes as factors behind smoking behavior.

PubMed

Tiili, Emmi M; Mitiushkina, Natalia V; Sukhovskaya, Olga A; Imyanitov, Evgeny N; Hirvonen, Ari P

2017-11-01

Smoking dependence is the main cause for tobacco-related illnesses. The addiction-causing substance in tobacco, nicotine, acts through the dopamine pathway in the brain, causing several pleasurable experiences through cigarette smoking. Thus, both genetic and epigenetic factors related to dopamine metabolism may play an important role in influencing an individual's smoking behavior. We studied the 1460 C/T variation and the variable number tandem repeat polymorphism in the MAOA gene and A/G variation in intron 13 in the MAOB gene together with four DNA methylation sites in both of these genes in relation to several smoking-related phenotypes in a study population of 1230 Whites of Russian origin. The genotypes studied were found to be associated with smoking status in women; the MAOB G variant allele was more prevalent in female smokers than nonsmokers [odds ratio (OR): 2.16, 95% confidence interval (CI): 1.08-4.33], whereas a reverse relation was observed for the MAOA 1460 T-variant allele (OR: 0.44, 95% CI: 0.21-0.91) and variable number tandem repeat low-activity alleles (OR: 0.49, 95% CI: 0.24-0.98). Moreover, the mean methylation values of the CpG sites studied in the MAOA gene were related to smoking behavior in women. Similarly, several methylation patterns in the MAOB gene were associated with a smoking history, with each CpG site showing a remarkable sex dependence. Smoking behavior seems to be related to the genetic and epigenetic profile of MAO genes, with considerable individual and sex-related differences.

Isolation and identification of age-related DNA methylation markers for forensic age-prediction.

PubMed

Yi, Shao Hua; Xu, Long Chang; Mei, Kun; Yang, Rong Zhi; Huang, Dai Xin

2014-07-01

Age-prediction is an important part of forensic science. There is no available method of individual age-prediction for general forensic biological samples at crime scenes. Accumulating evidence indicates that aging resembles a developmentally regulated process tightly controlled by specific age-associated methylation exists in human genome. This study isolated and identified eight gene fragments in which the degree of cytosine methylation is significantly correlated with age in blood of 40 donors. Furthermore, we validated two CpG sites of each gene fragment and replicated our results in a general population sample of 40 males and 25 females with a wide age-range (11-72 years). The methylation of these fragments is linear with age over a range of six decades (Fragment P1 (r=-0.64), P2 (r=-0.58), P3 (r=-0.79), R1 (r=0.82), R2 (r=0.63), R3 (r=0.59), R4 (r=0.63) and R5 (r=0.62)). Using average methylation of two CpG sites from each fragment, we built a regression model that explained 95% of the variance in age and is able to predict the age of an individual with great accuracy (R(2)=0.918). The predicted values are highly correlated with the observed age in the sample (r=0.91). This study implicates that DNA methylation will be an available biological marker of age-prediction. Furthermore, measurement of relevant sites in the genome could be a tool in routine forensic screening to predict age of biological samples. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

DNA methylation and healthy human aging.

PubMed

Jones, Meaghan J; Goodman, Sarah J; Kobor, Michael S

2015-12-01

The process of aging results in a host of changes at the cellular and molecular levels, which include senescence, telomere shortening, and changes in gene expression. Epigenetic patterns also change over the lifespan, suggesting that epigenetic changes may constitute an important component of the aging process. The epigenetic mark that has been most highly studied is DNA methylation, the presence of methyl groups at CpG dinucleotides. These dinucleotides are often located near gene promoters and associate with gene expression levels. Early studies indicated that global levels of DNA methylation increase over the first few years of life and then decrease beginning in late adulthood. Recently, with the advent of microarray and next-generation sequencing technologies, increases in variability of DNA methylation with age have been observed, and a number of site-specific patterns have been identified. It has also been shown that certain CpG sites are highly associated with age, to the extent that prediction models using a small number of these sites can accurately predict the chronological age of the donor. Together, these observations point to the existence of two phenomena that both contribute to age-related DNA methylation changes: epigenetic drift and the epigenetic clock. In this review, we focus on healthy human aging throughout the lifetime and discuss the dynamics of DNA methylation as well as how interactions between the genome, environment, and the epigenome influence aging rates. We also discuss the impact of determining 'epigenetic age' for human health and outline some important caveats to existing and future studies. © 2015 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

Aldosterone alters the chromatin structure of the murine endothelin-1 gene.

PubMed

Welch, Amanda K; Jeanette Lynch, I; Gumz, Michelle L; Cain, Brian D; Wingo, Charles S

2016-08-15

Aldosterone increases sodium reabsorption in the renal collecting duct and systemic blood pressure. Paradoxically, aldosterone also induces transcription of the endothelin-1 (Edn1) gene to increase protein (ET-1) levels, which inhibits sodium reabsorption. Here we investigated changes in the chromatin structure of the Edn1 gene of collecting duct cell lines in response to aldosterone treatment. The Edn1 gene has a CpG island that encompasses the transcription start site and four sites in the 5' regulatory region previously linked to transcriptional regulation. The chromatin structure of the Edn1 gene was investigated using a quantitative PCR-based DNaseI hypersensitivity assay in murine hepatocyte (AML12), renal cortical collecting duct (mpkCCDC14), outer medullary collecting duct1 (OMCD1), and inner medullary collecting duct-3 (IMCD-3) cell lines. The CpG island was uniformly accessible. One calcium-responsive NFAT element remained at low chromatin accessibility in all cell lines under all conditions tested. However, the second calcium responsive NFAT element located at -1563bp upstream became markedly more accessible in IMCD-3 cells exposed to aldosterone. Importantly, one established aldosterone hormone response element HRE at -671bp relative to the transcription start site was highly accessible, and another HRE (-551bp) became more accessible in aldosterone-treated IMCD-3 and OMCD1 cells. The evidence supports a model in which aldosterone activation of the mineralocorticoid receptor (MR) results in the MR-hormone complex binding at HRE at -671bp to open chromatin structure around other regulatory elements in the Edn1 gene. Published by Elsevier Inc.

Comprehensive Analysis of DNA Methylation in Head and Neck Squamous Cell Carcinoma Indicates Differences by Survival and Clinicopathologic Characteristics

PubMed Central

Colacino, Justin A.; Dolinoy, Dana C.; Duffy, Sonia A.; Sartor, Maureen A.; Chepeha, Douglas B.; Bradford, Carol R.; McHugh, Jonathan B.; Patel, Divya A.; Virani, Shama; Walline, Heather M.; Bellile, Emily; Terrell, Jeffrey E.; Stoerker, Jay A.; Taylor, Jeremy M. G.; Carey, Thomas E.; Wolf, Gregory T.; Rozek, Laura S.

2013-01-01

Head and neck squamous cell carcinoma (HNSCC) is the eighth most commonly diagnosed cancer in the United States. The risk of developing HNSCC increases with exposure to tobacco, alcohol and infection with human papilloma virus (HPV). HPV-associated HNSCCs have a distinct risk profile and improved prognosis compared to cancers associated with tobacco and alcohol exposure. Epigenetic changes are an important mechanism in carcinogenic progression, but how these changes differ between viral- and chemical-induced cancers remains unknown. CpG methylation at 1505 CpG sites across 807 genes in 68 well-annotated HNSCC tumor samples from the University of Michigan Head and Neck SPORE patient population were quantified using the Illumina Goldengate Methylation Cancer Panel. Unsupervised hierarchical clustering based on methylation identified 6 distinct tumor clusters, which significantly differed by age, HPV status, and three year survival. Weighted linear modeling was used to identify differentially methylated genes based on epidemiological characteristics. Consistent with previous in vitro findings by our group, methylation of sites in the CCNA1 promoter was found to be higher in HPV(+) tumors, which was validated in an additional sample set of 128 tumors. After adjusting for cancer site, stage, age, gender, alcohol consumption, and smoking status, HPV status was found to be a significant predictor for DNA methylation at an additional 11 genes, including CASP8 and SYBL1. These findings provide insight into the epigenetic regulation of viral vs. chemical carcinogenesis and could provide novel targets for development of individualized therapeutic and prevention regimens based on environmental exposures. PMID:23358896

Comprehensive analysis of DNA methylation in head and neck squamous cell carcinoma indicates differences by survival and clinicopathologic characteristics.

PubMed

Colacino, Justin A; Dolinoy, Dana C; Duffy, Sonia A; Sartor, Maureen A; Chepeha, Douglas B; Bradford, Carol R; McHugh, Jonathan B; Patel, Divya A; Virani, Shama; Walline, Heather M; Bellile, Emily; Terrell, Jeffrey E; Stoerker, Jay A; Taylor, Jeremy M G; Carey, Thomas E; Wolf, Gregory T; Rozek, Laura S

2013-01-01

Head and neck squamous cell carcinoma (HNSCC) is the eighth most commonly diagnosed cancer in the United States. The risk of developing HNSCC increases with exposure to tobacco, alcohol and infection with human papilloma virus (HPV). HPV-associated HNSCCs have a distinct risk profile and improved prognosis compared to cancers associated with tobacco and alcohol exposure. Epigenetic changes are an important mechanism in carcinogenic progression, but how these changes differ between viral- and chemical-induced cancers remains unknown. CpG methylation at 1505 CpG sites across 807 genes in 68 well-annotated HNSCC tumor samples from the University of Michigan Head and Neck SPORE patient population were quantified using the Illumina Goldengate Methylation Cancer Panel. Unsupervised hierarchical clustering based on methylation identified 6 distinct tumor clusters, which significantly differed by age, HPV status, and three year survival. Weighted linear modeling was used to identify differentially methylated genes based on epidemiological characteristics. Consistent with previous in vitro findings by our group, methylation of sites in the CCNA1 promoter was found to be higher in HPV(+) tumors, which was validated in an additional sample set of 128 tumors. After adjusting for cancer site, stage, age, gender, alcohol consumption, and smoking status, HPV status was found to be a significant predictor for DNA methylation at an additional 11 genes, including CASP8 and SYBL1. These findings provide insight into the epigenetic regulation of viral vs. chemical carcinogenesis and could provide novel targets for development of individualized therapeutic and prevention regimens based on environmental exposures.

H. pylori modifies methylation of global genomic DNA and the gastrin gene promoter in gastric mucosal cells and gastric cancer cells.

PubMed

Xie, Yuan; Zhou, Jian Jiang; Zhao, Yan; Zhang, Ting; Mei, Liu Zheng

2017-07-01

The aim of this study was to evaluate the correlation between H. pylori infection and global DNA methylation, as well as the methylation levels of the gastrin promoters. We constructed a eukaryotic expression vector, pcDNA3.1::cagA, and transfected it into GES-1 gastric mucosal cells and SGC-7901 gastric cancer cells. Both cell lines were infected with the H. pylori/CagA + strain NCTC11637. Then, we detected global DNA methylation by capture and detection antibodies, followed by colorimetric quantification. The methylation levels of the gastrin promoter were evaluated by base-specific cleavage and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. In H. pylori/CagA + -infected GES-1 and SGC-7901 cells, the methylation levels of genomic DNA decreased by 49.4% and 18.8%, and in GES-1 and SGC-7901 cells transfected with pcDNA3.1::cagA, the methylation levels of genomic DNA decreased by 17.05% and 25.6%, respectively. Among 24 methylation sites detected in the gastrin promoter region, the methylation levels of 9 CpG sites were significantly decreased in H. pylori/CagA+-infected and pcDNA3.1:: cagA-transfected cells in comparison to corresponding control cells. These results indicate that H. pylori/CagA + decreases the methylation of the genome and the gastrin promoter at some CpG sites in gastric mucosal and gastric cancer cells. Copyright © 2017. Published by Elsevier Ltd.

REST–Mediated Recruitment of Polycomb Repressor Complexes in Mammalian Cells

PubMed Central

Landt, Eskild; Agrawal-Singh, Shuchi; Bak, Mads; Tommerup, Niels; Rappsilber, Juri; Södersten, Erik; Hansen, Klaus

2012-01-01

Polycomb Repressive Complex (PRC) 1 and PRC2 regulate genes involved in differentiation and development. However, the mechanism for how PRC1 and PRC2 are recruited to genes in mammalian cells is unclear. Here we present evidence for an interaction between the transcription factor REST, PRC1, and PRC2 and show that RNF2 and REST co-regulate a number of neuronal genes in human teratocarcinoma cells (NT2-D1). Using NT2-D1 cells as a model of neuronal differentiation, we furthermore showed that retinoic-acid stimulation led to displacement of PRC1 at REST binding sites, reduced H3K27Me3, and increased gene expression. Genome-wide analysis of Polycomb binding in Rest−/− and Eed−/− mouse embryonic stem (mES) cells showed that Rest was required for PRC1 recruitment to a subset of Polycomb regulated neuronal genes. Furthermore, we found that PRC1 can be recruited to Rest binding sites independently of CpG islands and the H3K27Me3 mark. Surprisingly, PRC2 was frequently increased around Rest binding sites located in CpG-rich regions in the Rest−/− mES cells, indicating a more complex interplay where Rest also can limit PRC2 recruitment. Therefore, we propose that Rest has context-dependent functions for PRC1- and PRC2- recruitment, which allows this transcription factor to act both as a recruiter of Polycomb as well as a limiting factor for PRC2 recruitment at CpG islands. PMID:22396653

Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

PubMed

Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

2017-06-27

Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.

Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

PubMed

Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

2014-11-28

NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Genistein promotes DNA demethylation of the steroidogenic factor 1 (SF-1) promoter in endometrial stromal cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsukura, Hiroshi, E-mail: hmatsukura.epi@mri.tmd.ac.jp; Aisaki, Ken-ichi; Igarashi, Katsuhide

2011-08-26

Highlights: {yields} Genistein (GEN) is a phytoestrogen found in soy products. {yields} GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. {yields} GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. {yields} A high-resolution melting assay was used to screen for epigenetic change. {yields} We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN onmore » mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.« less

Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

PubMed Central

Scheiermann, Julia; Klinman, Dennis M.

2014-01-01

Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

Transcultural Endocrinology: Adapting Type-2 Diabetes Guidelines on a Global Scale.

PubMed

Nieto-Martínez, Ramfis; González-Rivas, Juan P; Florez, Hermes; Mechanick, Jeffrey I

2016-12-01

Type-2 diabetes (T2D) needs to be prevented and treated effectively to reduce its burden and consequences. White papers, such as evidence-based clinical practice guidelines (CPG) and their more portable versions, clinical practice algorithms and clinical checklists, may improve clinical decision-making and diabetes outcomes. However, CPG are underused and poorly validated. Protocols that translate and implement these CPG are needed. This review presents the global dimension of T2D, details the importance of white papers in the transculturalization process, compares relevant international CPG, analyzes cultural variables, and summarizes translation strategies that can improve care. Specific protocols and algorithmic tools are provided. Copyright © 2016 Elsevier Inc. All rights reserved.

COBRA-Seq: Sensitive and Quantitative Methylome Profiling

PubMed Central

Varinli, Hilal; Statham, Aaron L.; Clark, Susan J.; Molloy, Peter L.; Ross, Jason P.

2015-01-01

Combined Bisulfite Restriction Analysis (COBRA) quantifies DNA methylation at a specific locus. It does so via digestion of PCR amplicons produced from bisulfite-treated DNA, using a restriction enzyme that contains a cytosine within its recognition sequence, such as TaqI. Here, we introduce COBRA-seq, a genome wide reduced methylome method that requires minimal DNA input (0.1–1.0 μg) and can either use PCR or linear amplification to amplify the sequencing library. Variants of COBRA-seq can be used to explore CpG-depleted as well as CpG-rich regions in vertebrate DNA. The choice of enzyme influences enrichment for specific genomic features, such as CpG-rich promoters and CpG islands, or enrichment for less CpG dense regions such as enhancers. COBRA-seq coupled with linear amplification has the additional advantage of reduced PCR bias by producing full length fragments at high abundance. Unlike other reduced representative methylome methods, COBRA-seq has great flexibility in the choice of enzyme and can be multiplexed and tuned, to reduce sequencing costs and to interrogate different numbers of sites. Moreover, COBRA-seq is applicable to non-model organisms without the reference genome and compatible with the investigation of non-CpG methylation by using restriction enzymes containing CpA, CpT, and CpC in their recognition site. PMID:26512698

H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells

PubMed Central

Fernández, Agustín F.; Bayón, Gustavo F.; Urdinguio, Rocío G.; Toraño, Estela G.; García, María G.; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M.; Riancho, José A.; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A.

2015-01-01

In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type–independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. PMID:25271306

Transcutaneous immunization with tetanus toxoid and mutants of Escherichia coli heat-labile enterotoxin as adjuvants elicits strong protective antibody responses.

PubMed

Tierney, Rob; Beignon, Anne-Sophie; Rappuoli, Rino; Muller, Sylviane; Sesardic, Dorothea; Partidos, Charalambos D

2003-09-01

In this study, the adjuvanticity of 2 nontoxic derivatives (LTK63 and LTR72) of heat-labile enterotoxin of Escherichia coli (LT) was evaluated and was compared with that of a cytosine phosphodiester-guanine (CpG) motif, after transcutaneous immunization with tetanus toxoid (TT). TT plus LTR72 elicited the strongest antibody responses, compared with those elicited by the other vaccines (TT, TT plus LTK63, TT plus CpG, and TT plus LTK63 plus CpG); it neutralized the toxin and conferred full protection after passive transfer in mice. Preexisting immunity to LT mutants did not adversely affect their adjuvant potency. Both LTK63 and LTR72 promoted the induction of IgG1 antibodies. In contrast, mice receiving either CpG motif alone or CpG motif plus LTK63 produced strong IgG2a anti-TT antibody responses. Overall, these findings demonstrate that mutants of enterotoxins with reduced toxicity are effective adjuvants for transcutaneous immunization.